Science.gov

Sample records for receptor tlr genes

  1. Genomic organization and transcript profiling of the bovine toll-like receptor gene cluster TLR6-TLR1-TLR10.

    PubMed

    Opsal, Monica Aa; Våge, Dag Inge; Hayes, Ben; Berget, Ingunn; Lien, Sigbjørn

    2006-12-15

    Toll-like receptors (TLRs) are a family of recognition receptors playing a crucial role in the innate immune system. Different combinations of TLRs are thought to be crucial for effective immune response, thus insight into the organization and expression of TLRs is important for understanding disease resistance. Mastitis is the most frequent and costly disease in dairy production, and the innate immune system is considered to be important in the first line defence against this disease. In the present paper we have characterized the genomic organization of TLR6-TLR1-TLR10 in a approximately 50 kb region of bovine chromosome 6, including 5'-untranslated exons not previously described. A method for gene expression analysis was developed and used for transcription profiling of the three paralogous genes in different bovine tissues. The expression analysis showed similar expression profiles for TLR1 and TLR6, which indicate a co-regulation of these two genes in cattle. TLR10 had a different expression profile, pointing toward a stronger functional diversification compared to TLR1 and TLR6. The differences in expression are in accordance with the evolutionary history of this gene cluster, where TLR10 diverged from the common ancestral gene before the duplication event that created TLR1 and TLR6.

  2. Genetic variation in the toll-like receptor gene cluster (TLR10-TLR1-TLR6) and prostate cancer risk.

    PubMed

    Stevens, Victoria L; Hsing, Ann W; Talbot, Jeffrey T; Zheng, Siqun Lilly; Sun, Jielin; Chen, Jinbo; Thun, Michael J; Xu, Jianfeng; Calle, Eugenia E; Rodriguez, Carmen

    2008-12-01

    Toll-like receptors (TLRs) are key players in the innate immune system and initiate the inflammatory response to foreign pathogens such as bacteria, fungi and viruses. The proposed role of chronic inflammation in prostate carcinogenesis has prompted investigation into the association of common genetic variation in TLRs with the risk of this cancer. We investigated the role of common SNPs in a gene cluster encoding the TLR10, TLR6 and TLR1 proteins in prostate cancer etiology among 1,414 cancer cases and 1,414 matched controls from the Cancer Prevention Study II Nutrition Cohort. Twenty-eight SNPs, which included the majority of the common nonsynonymous SNPs in the 54-kb gene region and haplotype-tagging SNPs that defined 5 specific haplotype blocks, were genotyped and their association with prostate cancer risk determined. Two SNPs in TLR10 [I369L (rs11096955) and N241H (rs11096957)] and 4 SNPs in TLR1 [N248S (rs4833095), S26L (rs5743596), rs5743595 and rs5743551] were associated with a statistically significant reduced risk of prostate cancer of 29-38% (for the homozygous variant genotype). The association of these SNPs was similar when the analysis was limited to cases with advanced prostate cancer. Haplotype analysis and linkage disequilibrium findings revealed that the 6 associated SNPs were not independent and represent a single association with reduced prostate cancer risk (OR = 0.55, 95% CI: 0.33, 0.90). Our study suggest that a common haplotype in the TLR10-TLR1-TLR6 gene cluster influences prostate cancer risk and clearly supports the need for further investigation of TLR genes in other populations.

  3. Repurposed transcriptomic data facilitate discovery of innate immunity toll-like receptor (TLR) Genes across Lophotrochozoa.

    PubMed

    Halanych, Kenneth M; Kocot, Kevin M

    2014-10-01

    The growing volume of genomic data from across life represents opportunities for deriving valuable biological information from data that were initially collected for another purpose. Here, we use transcriptomes collected for phylogenomic studies to search for toll-like receptor (TLR) genes in poorly sampled lophotrochozoan clades (Annelida, Mollusca, Brachiopoda, Phoronida, and Entoprocta) and one ecdysozoan clade (Priapulida). TLR genes are involved in innate immunity across animals by recognizing potential microbial infection. They have an extracellular leucine-rich repeat (LRR) domain connected to a transmembrane domain and an intracellular toll/interleukin-1 receptor (TIR) domain. Consequently, these genes are important in initiating a signaling pathway to trigger defense. We found at least one TLR ortholog in all but two taxa examined, suggesting that a broad array of lophotrochozoans may have innate immune systems similar to those observed in vertebrates and arthropods. Comparison to the SMART database confirmed the presence of both the LRR and the TIR protein motifs characteristic of TLR genes. Because we looked at only one transcriptome per species, discovery of TLR genes was limited for most taxa. However, several TRL-like genes that vary in the number and placement of LRR domains were found in phoronids. Additionally, several contigs contained LRR domains but lacked TIR domains, suggesting they were not TLRs. Many of these LRR-containing contigs had other domains (e.g., immunoglobin) and are likely involved in innate immunity.

  4. The heterogeneous allelic repertoire of human toll-like receptor (TLR) genes.

    PubMed

    Georgel, Philippe; Macquin, Cécile; Bahram, Seiamak

    2009-11-17

    Toll-Like Receptors (TLR) are critical elements of the innate arm of the vertebrate immune system. They constitute a multigenic family of receptors which collectively bind a diverse array of--exogeneous as well as endogeneous--ligands. An exponential burst of knowledge has defined their biological role in fight against infections and generation/modulation of auto-immune disorders. Hence, they could at least be conceptually recognized--despite being structurally unrelated - as innate counterparts to Major Histocompatibility Complex (MHC) molecules--equally recognizing antigenic ligands (albeit structurally more homogeneous i.e., peptides), again derived from self and/or non-self sources--preeminent this time in adaptive immunity. Our great disparities in face of infections and/or susceptibility to auto-immune diseases have provoked an intense search for genetic explanations, in part satisfied by the extraordinary MHC allelic repertoire. An equally in-depth and systematic analysis of TLR diversity is lacking despite numerous independent reports of a growing number of SNPs within these loci. The work described here aims at providing a preliminary picture of the allelic repertoire--and not purely SNPs--of all 10 human TLR coding sequences (with exception of TLR3) within a single cohort of up to 100 individuals. It appears from our work that TLR are unequally polymorphic: TLR2 (DNA alleles: 7/protein alleles: 3), 4 (4/3), 7 (6/3), 8 (9/2) and 9 (8/3) being comparatively least diverse whereas TLR1 (11/10), 5 (14/12), 6 (10/8) and 10 (15/10) show a substantial number of alleles. In addition to allelic assignment of a large number of SNPs, 10 new polymorphic positions were hereby identified. Hence this work depicts a first overview of the diversity of almost all human TLR genes, a prelude for large-scale population genetics as well as genetic association studies.

  5. Hymenolepis diminuta: analysis of the expression of Toll-like receptor genes (TLR2 and TLR4) in the small and large intestines of rats. Part II.

    PubMed

    Kosik-Bogacka, D I; Wojtkowiak-Giera, A; Kolasa, A; Czernomysy-Furowicz, D; Lanocha, N; Wandurska-Nowak, E; Salamatin, R; Jagodzinski, P P

    2013-10-01

    Toll-like receptors in the gastrointestinal tract can influence intestinal homeostasis and play a role in the repair and restitution of intestinal epithelium following tissue damage. In our previous study a statistically significant increase in the level of TLR4 and TLR2 gene expression was observed in rats in early stages of hymenolepidosis. Moreover, the immunopositive cell number and the intensity of immunohistochemical staining (indicating the presence of TLRs within intestinal epithelial cells) increased over the infection period. In this paper, we determined changes in the expression of TLR2 and TLR4 and the number of anaerobic intestinal commensal bacteria in Hymenolepis diminuta infected rats. In the isolated jejunum of infected rats at 16 days post infection (dpi), the expression of TLR4 and TLR2 was significantly higher than uninfected rats. In the colon, a statistically significantly increased expression of TLR2 was observed from 16 to 40 dpi, and TLR4 from 16 to 60 dpi. The jejunum and colon of infected rats contained Gram-negative bacteria (Escherichia coli), Gram-positive bacteria (Enterococcus, Streptococcus, Staphylococcus, Bacillus, Lactobacillus) and Candida. The total number of intestinal bacteria was higher in H. diminuta infected rats, but the observed microbiota had only minor effects on the expression of TLR2 and TLR4. Toll-like receptors play a role in maintaining epithelial barrier function in response to enteric pathogens and parasites. In our study, the alteration of TLR2 and TLR4 expression in the infected rats indicates the potential role of the innate immune system in the pathomechanism of this infection.

  6. Signatures of positive selection in Toll-like receptor (TLR) genes in mammals

    PubMed Central

    2011-01-01

    Background Toll-like receptors (TLRs) are a major class of pattern recognition receptors (PRRs) expressed in the cell surface or membrane compartments of immune and non-immune cells. TLRs are encoded by a multigene family and represent the first line of defense against pathogens by detecting foreigner microbial molecular motifs, the pathogen-associated molecular patterns (PAMPs). TLRs are also important by triggering the adaptive immunity in vertebrates. They are characterized by the presence of leucine-rich repeats (LRRs) in the ectodomain, which are associated with the PAMPs recognition. The direct recognition of different pathogens by TLRs might result in different evolutionary adaptations important to understand the dynamics of the host-pathogen interplay. Ten mammal TLR genes, viral (TLR3, 7, 8, 9) and non-viral (TLR1-6, 10), were selected to identify signatures of positive selection that might have been imposed by interacting pathogens and to clarify if viral and non-viral TLRs might display different patterns of molecular evolution. Results By using Maximum Likelihood approaches, evidence of positive selection was found in all the TLRs studied. The number of positively selected codons (PSC) ranged between 2-26 codons (0.25%-2.65%) with the non-viral TLR4 as the receptor with higher percentage of positively selected codons (2.65%), followed by the viral TLR8 (2.50%). The results indicated that viral and non-viral TLRs are similarly under positive selection. Almost all TLRs have at least one PSC located in the LRR ectodomain which underlies the importance of the pathogen recognition by this region. Conclusions Our results are not in line with previous studies on primates and birds that identified more codons under positive selection in non-viral TLRs. This might be explained by the fact that both primates and birds are homogeneous groups probably being affected by only a restricted number of related viruses with equivalent motifs to be recognized. The analyses

  7. Genetic polymorphism in CD14 gene, a co-receptor of TLR4 associated with non-alcoholic fatty liver disease

    PubMed Central

    Kapil, Shweta; Duseja, Ajay; Sharma, Bal Krishan; Singla, Bhupesh; Chakraborti, Anuradha; Das, Ashim; Ray, Pallab; Dhiman, Radha K; Chawla, Yogesh

    2016-01-01

    AIM To evaluate the pathogenic role of toll-like receptor (TLR) gene polymorphisms in patients with non-alcoholic fatty liver disease (NAFLD). METHODS Two hundred and fifty subjects (NAFLD = 200, healthy volunteers = 50) underwent polymerase chain reaction and restriction fragment length polymorphism to assess one polymorphism in the toll-like receptor 2 (TLR2) gene (A753G), two polymorphisms in the TLR4 gene (TLR4 Asp299Gly and Thr399Ile allele), and two polymorphisms in the cluster of differentiation 14 (CD14) (C-159T and C-550T) gene, a co-receptor of TLR4. Association of TLR gene polymorphisms with NAFLD and its severity was evaluated by genetic models of association. RESULTS On both multiplicative and recessive models of gene polymorphism association, there was significant association of CD14 C (-159) T polymorphism with NAFLD; patients with TT genotype had a 2.6 fold increased risk of developing NAFLD in comparison to CC genotype. There was no association of TLR2 Arg753Gln, TLR4 Asp299Gly, Thr399Ile, and CD14 C (-550) T polymorphisms with NAFLD. None of the TLR gene polymorphisms had an association with histological severity of NAFLD. CONCLUSION Patients with CD14 C (-159) T gene polymorphism, a co-receptor of TLR4, have an increased risk of NAFLD development. PMID:27895422

  8. Molecular cloning and expression analysis of toll-like receptor genes (TLR7, TLR8 and TLR9) of golden pompano (Trachinotus ovatus).

    PubMed

    Wei, Youchuan; Hu, Shu; Sun, Baobao; Zhang, Qihuan; Qiao, Guo; Wang, Zisheng; Shao, Rong; Huang, Guoqiang; Qi, Zhitao

    2017-02-20

    Toll like receptor (TLR) 7, 8 and 9 are intracellular TLRs which play important roles in host immune defense against bacterial or virus pathogens. In this study, TLR7, 8 and 9 were identified from golden pompano (Trachinotus ovatus), a marine teleost with great economic values. Sequence analysis revealed that the three TLRs contained several conserved characteristic features, including signal peptides, 25 leucine-rich repeat (LRR) motifs, a transmembrane domain and a TIR motif. These three TLRs shared high sequence identity and similarity with their counterparts from other teleosts. The phylogenetic tree analysis showed the three TLRs were clustered well with their piscine counterparts, confirming the correctness of their nomenclatures and closed relationships during evolution. Quantitative real-time PCR revealed that the three TLRs were ubiquitously expressed in all the tested tissues from normal pompano, with high expression in spleen and head kidney, indicating their role in immune reaction. Further, pompano TLR7 and TLR8 was up-regulated in spleen and head kidney from 12 h to 48 h following polyI:C challenge, but remained no changes to Vibrio alginilyticus infection. In contrast, pompano TLR9 could be induced by V. alginilyticus infection but remained apathetic to polyI:C challenge. These results indicated that pompano TLR7, 8 and 9 might have distinct roles in response to bacterial or virus pathogens. Our results provided the basis for further study on ligand specificity and signaling pathways of fish TLRs which are required for elucidating the immune functions of fish TLRs.

  9. Hymenolepis diminuta: analysis of the expression of Toll-like receptor genes and protein (TLR3 and TLR9) in the small and large intestines of rats.

    PubMed

    Kosik-Bogacka, Danuta I; Wojtkowiak-Giera, Agnieszka; Kolasa, Agnieszka; Baranowska-Bosiacka, Irena; Lanocha, Natalia; Wandurska-Nowak, Elzbieta; Izabela, Gutowska; Salamatin, Ruslan; Jagodzinski, Paweł P

    2014-10-01

    Toll-like receptors (TLRs) play a fundamental role in the rapid activation of innate immune responses to a variety of pathogen-associated molecular patterns (PAMPs). In a previous study we observed an increase in the level of expression of TLR2 and TLR4 mRNA in the jejunum and colon during experimental hymenolepidosis in rats. In this study, we performed a quantitative real-time polymerase chain reaction (qRT-PCR), Western blot analysis and immunohistochemical staining of TLR3 and TLR9 receptors during experimental hymenolepidosis in rats. The levels of mRNA and protein expression of TLR3 and TLR9 in the jejunum had increased at 16 days post Hymenolepis diminuta infection (dpi) in the case of TLR3 and at 16 and 25 dpi in the case of TLR9. In the colon the expression of TLR3 and TLR9 had increased at 16, 25 and 40 dpi. The results of the immunohistochemical reactions showed that H. diminuta infected rats (16, 25, 40 and 60 dpi) exhibited changes in TLR3 and TLR9 localization and intensity in the epithelial cells of the jejunum and colon. The changes in the level of TLR3 and TLR9 expression may confirm involvement of the innate immune system in the pathomechanism of hymenolepidosis.

  10. Expression of many immunologically important genes in Mycobacterium tuberculosis-infected macrophages is independent of both TLR2 and TLR4 but dependent on IFN-alphabeta receptor and STAT1.

    PubMed

    Shi, Shuangping; Blumenthal, Antje; Hickey, Christopher M; Gandotra, Sheetal; Levy, David; Ehrt, Sabine

    2005-09-01

    Macrophages respond to several subcellular products of Mycobacterium tuberculosis (Mtb) through TLR2 or TLR4. However, primary mouse macrophages respond to viable, virulent Mtb by pathways largely independent of MyD88, the common adaptor molecule for TLRs. Using microarrays, quantitative PCR, and ELISA with gene-disrupted macrophages and mice, we now show that viable Mtb elicits the expression of inducible NO synthase, RANTES, IFN-inducible protein 10, immune-responsive gene 1, and many other key genes in macrophages substantially independently of TLR2, TLR4, their combination, or the TLR adaptors Toll-IL-1R domain-containing adapter protein and Toll-IL-1R domain-containing adapter inducing IFN-beta. Mice deficient in both TLR2 and TLR4 handle aerosol infection with viable Mtb as well as congenic controls. Viable Mtb also up-regulates inducible NO synthase, RANTES, IFN-inducible protein 10, and IRG1 in macrophages that lack mannose receptor, complement receptors 3 and 4, type A scavenger receptor, or CD40. These MyD88, TLR2/4-independent transcriptional responses require IFN-alphabetaR and STAT1, but not IFN-gamma. Conversely, those genes whose expression is MyD88 dependent do not depend on IFN-alphabetaR or STAT1. Transcriptional induction of TNF is TLR2/4, MyD88, STAT1, and IFN-alphabetaR independent, but TNF protein release requires the TLR2/4-MyD88 pathway. Thus, macrophages respond transcriptionally to viable Mtb through at least three pathways. TLR2 mediates the responses of a numerically minor set of genes that collectively do not appear to affect the course of infection in mice; regulation of TNF requires TLR2/4 for post-transcriptional control, but not for transcriptional induction; and many responding genes are regulated through an unknown, TLR2/4-independent pathway that may involve IFN-alphabetaR and STAT1.

  11. SNP marker discovery in koala TLR genes.

    PubMed

    Cui, Jian; Frankham, Greta J; Johnson, Rebecca N; Polkinghorne, Adam; Timms, Peter; O'Meally, Denis; Cheng, Yuanyuan; Belov, Katherine

    2015-01-01

    Toll-like receptors (TLRs) play a crucial role in the early defence against invading pathogens, yet our understanding of TLRs in marsupial immunity is limited. Here, we describe the characterisation of nine TLRs from a koala immune tissue transcriptome and one TLR from a draft sequence of the koala genome and the subsequent development of an assay to study genetic diversity in these genes. We surveyed genetic diversity in 20 koalas from New South Wales, Australia and showed that one gene, TLR10 is monomorphic, while the other nine TLR genes have between two and 12 alleles. 40 SNPs (16 non-synonymous) were identified across the ten TLR genes. These markers provide a springboard to future studies on innate immunity in the koala, a species under threat from two major infectious diseases.

  12. Toll-like receptor 1(TLR1) Gene SNP rs5743618 is associated with increased risk for tuberculosis in Han Chinese children.

    PubMed

    Qi, Hui; Sun, Lin; Wu, Xirong; Jin, Yaqiong; Xiao, Jing; Wang, Shengfeng; Shen, Chen; Chu, Ping; Qi, Zhan; Xu, Fang; Guo, Yajie; Jiao, Weiwei; Tian, Jianling; Shen, Adong

    2015-03-01

    Toll-like receptor 1 (TLR1) recognizes lipopeptides with TLR2, and affects immune response to Mycobacterium tuberculosis infection. Here, we report results of the first case-control pediatric study of the TLR1 single-nucleotide polymorphisms and susceptibility to tuberculosis (TB). A pediatric case-control study enrolled 340 TB patients and 366 healthy controls, all Han Chinese from North China. Significant differences of the allelic and genotypic distributions of rs5743618 in TLR1 gene were observed between TB group and control group and, G allele of rs5743618 was associated with increased risk for TB (OR: 2.40, 95%CI: 1.41-4.07, P = 0.0009). TLR1 rs5743618 -GT genotype was related to reduction in surface expression of TLR1 in monocytes and granulocytes regardless of stimulation with inactivated H37Rv. In addition, after stimulated with inactivated lysate of M. tuberculosis strain H37Rv, samples of peripheral blood mononuclear cells (PBMCs) from children with the rs5743618 GT genotypes showed a decreased level of Tumor Necrosis Factor-a (TNF-a) and CXC chemokine ligand 10 (CXCL10) production, invariable production of interleukin-6 (IL-6) and IL-8 and increased production of IL-10 ex vivo. To conclude, TLR1 rs5743618 G allele was found associated to susceptibility to TB in Han Chinese pediatric population. TLR1 rs5743618-GT genotype carriers may have reduced immune response to MTB infection although further study is warranted to test this conclusion.

  13. The gene history of zebrafish tlr4a and tlr4b is predictive of their divergent functions.

    PubMed

    Sullivan, Con; Charette, Jeremy; Catchen, Julian; Lage, Christopher R; Giasson, Gregory; Postlethwait, John H; Millard, Paul J; Kim, Carol H

    2009-11-01

    Mammalian immune responses to LPS exposure are typified by the robust induction of NF-kappaB and IFN-beta responses largely mediated by TLR4 signal transduction pathways. In contrast to mammals, Tlr4 signal transduction pathways in nontetrapods are not well understood. Comprehensive syntenic and phylogenetic analyses support our hypothesis that zebrafish tlr4a and tlr4b genes are paralogous rather than orthologous to human TLR4. Furthermore, we provide evidence to support our assertion that the in vivo responsiveness of zebrafish to LPS exposure is not mediated by Tlr4a and Tlr4b paralogs because they fail to respond to LPS stimulation in vitro. Zebrafish Tlr4a and Tlr4b paralogs were also unresponsive to heat-killed Escherichia coli and Legionella pneumophila. Using chimeric molecules in which portions of the zebrafish Tlr4 proteins were fused to portions of the mouse TLR4 protein, we show that the lack of responsiveness to LPS was most likely due to the inability of the extracellular portions of zebrafish Tlr4a and Tlr4b to recognize the molecule, rather than to changes in their capacities to transduce signals through their Toll/IL-1 receptor (TIR) domains. Taken together, these findings strongly support the notion that zebrafish tlr4a and tlr4b paralogs have evolved to provide alternative ligand specificities to the Tlr immune defense system in this species. These data demonstrate that intensive examination of gene histories when describing the Tlr proteins of basally diverging vertebrates is required to obtain fuller appreciation of the evolution of their function. These studies provide the first evidence for the functional evolution of a novel Tlr.

  14. A Functional Toll-Like Receptor 3 Gene (TLR3) May Be a Risk Factor for Tick-borne Encephalitis Virus (TBEV) Infection

    PubMed Central

    Vene, Sirkka; Mickiene, Aukse; Lundkvist, Åke; Lindquist, Lars; Svensson, Lennart

    2011-01-01

    Background. Tick-borne encephalitis virus (TBEV) infections may be asymptomatic or cause severe symptoms in the central nervous system. A mutation in the chemokine receptor 5 gene has been associated with increased risk of TBE but explains only a limited number of cases. Investigations of further risk factors are needed. Method. To investigate the importance of the innate immune response, we analyzed 128 TBE patients, 77 patients with aseptic meningoencephalitis (AME) and 135 healthy controls, for 3mutations: 2 in the Toll-like receptor 3 (TLR3) gene and 1 in the 2′-5′-oligoadenylate synthetase (OAS1) gene. Results. Although no association was found between the mutation in the OAS1 gene and TBE, the genotype distribution ofrs3775291, a mutation in TLR3, differed significantly between TBE patients and controls; 61%, 32%, and 7% of the TBE patients were carriers of the wild-type, heterozygous, and mutant genotype of rs3775291, respectively. The corresponding percentages among healthy controls (n = 126) were 52%, 29%, and 19% (P = .02), and among AME patients (n = 75) were 47%, 32%, and 21% (P = .009). Additionally, the wild-type rs3775291 allele was more common among TBE patients than among healthy controls (allele frequency, .768 vs .663; P = .01). Conclusion. A functional TLR3 is a risk factor for TBEV infection. PMID:21216866

  15. Identification, characterization and genetic mapping of TLR7, TLR8a1 and TLR8a2 genes in rainbow trout (Oncorhynchus mykiss)

    USGS Publications Warehouse

    Palti, Yniv; Gahr, Scott A.; Purcell, Maureen K.; Hadidi, Sima; Rexroad, Caird E.; Wiens, Gregory A.

    2010-01-01

    Induction of the innate immune pathways is critical for early anti-viral defense but there is limited understanding of how teleost fish recognize viral molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 7 and 8 bind single-stranded RNA of viral origin and are activated by synthetic anti-viral imidazoquinoline compounds. Herein, we identify and describe the rainbow trout (Oncorhynchus mykiss) TLR7 and TLR8 gene orthologs and their mRNA expression. Two TLR7/8 loci were identified from a rainbow trout bacterial artificial chromosome (BAC) library using DNA fingerprinting and genetic linkage analyses. Direct sequencing of two representative BACs revealed intact omTLR7 and omTLR8a1 open reading frames (ORFs) located on chromosome 3 and a second locus on chromosome 22 that contains an omTLR8a2 ORF and a putative TLR7 pseudogene. We used the omTLR8a1/2 nomenclature for the two trout TLR8 genes as phylogenetic analysis revealed that they and all the other teleost TLR8 genes sequenced to date are similar to the zebrafish TLR8a, but are distinct from the zebrafish TLR8b. The duplicated trout loci exhibit conserved synteny with other fish genomes extending beyond the tandem of TLR7/8 genes. The trout TLR7 and 8a1/2 genes are composed of a single large exon similar to all other described TLR7/8 genes. The omTLR7 ORF is predicted to encode a 1049 amino acid (aa) protein with 84% similarity to the Fugu TLR7 and a conserved pattern of predicted leucine-rich repeats (LRR). The omTLR8a1 and omTLR8a2 are predicted to encode 1035- and 1034-aa proteins, respectively, and have 86% similarity to each other. omTLR8a1 is likely the ortholog of the only Atlantic salmon TLR8 gene described to date as they have 95% aa sequence similarity. The tissue expression profiles of omTLR7, omTLR8a1 and omTLR8a2 in healthy trout were highest in spleen tissue followed by anterior and then posterior kidney tissues. Rainbow trout anterior kidney leukocytes produced elevated

  16. HMGB1/TLR Receptor Danger Signaling Increases Brain Neuroimmune Activation in Alcohol Dependence

    PubMed Central

    Crews, Fulton T.; Qin, Liya; Sheedy, Donna; Vetreno, Ryan P.; Zou, Jian

    2012-01-01

    Background Innate immune gene expression is regulated in part through high mobility group box 1(HMGB1), an endogenous proinflammatory cytokine, that activates multiple members of the interleukin-1/Toll-like receptor (IL-1/TLR) family associated with danger signaling. We investigated expression of HMGB1, TLR2, TLR3 and TLR4 in chronic ethanol treated mouse brain, post-mortem human alcoholic brain, and rat brain slice culture to test the hypothesis that neuroimmune activation in alcoholic brain involves ethanol activation of HMGB1/TLR danger signaling. Methods Protein levels were assessed using Western blot, ELISA, immunohistochemical immunoreactivity (+IR), and mRNA levels were measured by real time PCR in ethanol-treated mice (5 g/kg/day, i.g., 10 days + 24 hr), rat brain slice culture, and post-mortem human alcoholic brain. Results Ethanol treatment of mice increased brain mRNA and +IR protein expression of HMGB1, TLR2, TLR3, and TLR4. Post-mortem human alcoholic brain also showed increased HMGB1, TLR2, TLR3, and TLR4+IR cells that correlated with lifetime alcohol consumption as well as each other. Ethanol treatment of brain slice culture released HMGB1 into the media and induced the proinflammatory cytokine, IL-1β. Neutralizing antibodies to HMGB1 and small inhibitory mRNA to HMGB1 or TLR4 blunted ethanol induction of IL-1β. Conclusions Ethanol-induced HMGB1/TLR signaling contributes to induction of the proinflammatory cytokine, IL-1β. Increased expression of HMGB1, TLR2, TLR3, and TLR4 in alcoholic brain and in mice treated with ethanol suggests that chronic alcohol-induced brain neuroimmune activation occurs through HMGB1/TLR signaling. PMID:23206318

  17. Naturally occurring Toll-like receptor 11 (TLR11) and Toll-like receptor 12 (TLR12) polymorphisms are not associated with Toxoplasma gondii infection in wild wood mice.

    PubMed

    Morger, Jennifer; Bajnok, Jaroslav; Boyce, Kellyanne; Craig, Philip S; Rogan, Michael T; Lun, Zhao-Rong; Hide, Geoff; Tschirren, Barbara

    2014-08-01

    Toxoplasma gondii is a highly successful parasite with a worldwide prevalence. Small rodents are the main intermediate hosts, and there is growing evidence that T. gondii modifies their behaviour. Chronically infected rodents show impaired learning capacity, enhanced activity, and, most importantly, a reduction of the innate fear towards cat odour. This modification of host behaviour ensures a successful transmission of T. gondii from rodents to felids, the definitive hosts of the parasite. Given the negative fitness consequences of this behavioural manipulation, as well as an increased mortality during the acute phase of infection, we expect rodents to evolve potent resistance mechanisms that prevent or control infection. Indeed, studies in laboratory mice have identified candidate genes for T. gondii resistance. Of particular importance appear to be the innate immune receptors Toll-like receptor 11 (TLR11) and Toll-like receptor 12 (TLR12), which recognise T. gondii profilin and initiate immune responses against the parasite. Here we analyse the genetic diversity of TLR11 and TLR12 in a natural population of wood mice (Apodemus sylvaticus), and test for associations between TLR11 and TLR12 polymorphisms and T. gondii infection, as well as for epistatic interactions between TLR11 and TLR12 on infection status. We found that both TLR11 and TLR12 were polymorphic in wood mice, with four and nine amino acid haplotypes, respectively. However, we found no evidence that TLR11 or TLR12 genotypes or haplotypes were significantly associated with Toxoplasma infection. Despite the importance of TLR11 and TLR12 in T. gondii recognition and immune defence initiation, naturally occurring polymorphisms at TLR11 and TLR12 thus appear to play a minor role in mediating qualitative resistance to T. gondii in natural host populations of A. sylvaticus. This highlights the importance of assessing the role of candidate genes for parasite resistance identified in a laboratory setting in

  18. Transcriptional Regulation of Tlr11 Gene Expression in Epithelial Cells*

    PubMed Central

    Cai, Zhenyu; Shi, Zhongcheng; Sanchez, Amir; Zhang, Tingting; Liu, Mingyao; Yang, Jianghua; Wang, Fen; Zhang, Dekai

    2009-01-01

    As sensors of invading microorganisms, Toll-like receptors (TLRs) are expressed not only on macrophages and dendritic cells (DCs) but also on epithelial cells. In the TLR family, Tlr11 appears to have the unique feature in that it is expressed primarily on epithelial cells, although it is also expressed on DCs and macrophages. Here, we demonstrate that transcription of the Tlr11 gene is regulated through two cis-acting elements, one Ets-binding site and one interferon regulatory factor (IRF)-binding site. The Ets element interacts with the epithelium-specific transcription factors, ESE-1 and ESE-3, and the IRF motif interacts with IRF-8. Thus, Tlr11 expression on epithelial cells is regulated by the transcription factors that are presumably distinct from transcription factors that regulate the expression of TLRs in innate immune cells such as macrophages and DCs. Our results imply that the distinctive transcription regulatory machinery for TLRs on epithelium may represent a promising new avenue for the development of epithelia-specific therapeutic interventions. PMID:19801549

  19. Effects of TLR4 gene silencing on the proliferation and apotosis of hepatocarcinoma HEPG2 cells.

    PubMed

    Liu, Yating; Li, Tao; Xu, Yuanhong; Xu, Enjun; Zhou, Min; Wang, Baolong; Shen, Jilong

    2016-05-01

    Toll-like receptors (TLRs) are key factors in the innate immune system and initiate an inflammatory response to foreign pathogens, such as bacteria, fungi and viruses. TLR4-mediated signaling has been implicated in tumor cell proliferation and apoptosis in numerous cancers. The present study aimed to investigate the biological effect of TLR4 on the proliferation and apoptosis of human liver cancer cells and the mechanisms responsible for the regulation of cellular responses following TLR4 gene knockdown. Three TLR4 small interfering (si)RNA constructs, consisting of TLR4-siRNA-1, TLR4-siRNA-2 and TLR4-siRNA-3, were transiently transfected into HepG2 cells using Lipofectamine 2000. TLR4 knockdown was confirmed using reverse transcription-polymerase chain reaction and western blotting. The effect of the TLR4 siRNA on tumor cell proliferation was monitored by methyl thiazolyl tetrazolium assay and cell apoptosis was observed by flow cytometry. The expression of TLR4-associated proteins, consisting of myeloid differentiation primary response 88 (MyD88), Toll-interleukin-1R-domain-containing adapter-inducing interferon-β (TRIF), interferon regulatory factor-3 (IRF3), nuclear factor (NF)-κB, NF-κB inhibitor α (IκBα), phosphorylated IκBα (p-IκBα), extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), was detected by western blot analysis. TLR4-siRNA-1 had the strongest knockdown effect and inhibited TLR4 messenger RNA and protein expression. TLR4 knockdown with TLR4-siRNA-1 reduced cell proliferation and promoted cell apoptosis. MyD88, TRIF, IRF3, IκBα, JNK and ERK were markedly suppressed in the cells transfected with TLR4 siRNA. However, nuclear expression of NF-κB and p-IκBα increased in HepG2 cells with TLR4 gene knockdown. The present study revealed that TLR4-mediated signaling plays a key role in the proliferation and apoptosis of cultured hepatocarcinoma cells. Therefore, RNA interference-directed targeting of TLR4 may raise

  20. Genetic polymorphisms in the bovine toll-like receptor 4 (TLR4) and monocyte chemo attractant protein-1(CCL2) genes: SNPs distribution analysis in Bos indicus Sahiwal cattle breed.

    PubMed

    Behl, Jyotsna Dhingra; Sharma, Anurodh; Kataria, R S; Verma, N K; Kimothi, Shiv Prasad; Bhatia, Avnish Kumar; Sodhi, Monika; Behl, Rahul; Joshi, B K

    2014-01-01

    Toll-like receptor 4 gene (TLR4) that recognizes the Gram negative bacterial ligand LPS was sequenced in the Bos indicus Sahiwal cattle breed. Ninety four single nucleotide polymorphisms (SNPs) were detected within 10.8 kb gene region. Seventeen of the SNPs were in the coding regions and the one at position 9589(A > G) in exon3 resulted in an amino acid change from Valine to Isoleucine. These SNPs led to generation of 27 TLR4 gene haplotypes. All the Sahiwal animals studied presently showed the occurrence of the genotype CC at gene position 9662, which codes for the amino acid threonine at position 674 of the TLR4 protein, and which had been reported to be associated with lower somatic cell score and, therefore, a lower susceptibility to mastitis, in Taurus cattle. This nucleotide configuration of the Toll-like receptor 4 gene of the Bos indicus Sahiwal cattle breed could possibly indicate toward a lower susceptibility to mastitis in the Sahiwal animals. Monocyte chemo-attractant protein-1 (CCL2) gene encoding for small inducible cytokine A2 that belongs to the CC chemokine family was also sequence characterized in these Sahiwal animals. The CCL2 gene was observed to have 12 polymorphic sites in 3.3 kb region of which one SNP at position 2500 (A > G) in exon 3 resulted in amino acid change from Valine to Isoleucine at position 46 of the mature CCL2 peptide. Seventeen haplotypes of the CCL2 gene were predicted corresponding to 12 genotypes detected.

  1. Estrogen Receptor Alpha Binding to ERE is Required for Full Tlr7- and Tlr9-Induced Inflammation

    PubMed Central

    Cunningham, Melissa A; Wirth, Jena R; Naga, Osama; Eudaly, Jackie; Gilkeson, Gary S

    2014-01-01

    We previously found that a maximum innate inflammatory response induced by stimulation of Toll-like receptors (TLRs) 3, 7 and 9 requires ERα, but does not require estrogen in multiple cell types from both control and lupus-prone mice. Given the estrogen-independence, we hypothesized that ERα mediates TLR signaling by tethering to, and enhancing, the activity of downstream transcription factors such as NFκB, rather than acting classically by binding EREs on target genes. To investigate the mechanism of ERα impact on TLR signaling, we utilized mice with a knock-in ERα mutant that is unable to bind ERE. After stimulation with TLR ligands, both ex vivo spleen cells and bone marrow-derived dendritic cells (BM-DCs) isolated from mutant ERα (“KIKO”) mice produced significantly less IL-6 compared with cells from wild-type (WT) littermates. These results suggest that ERα modulation of TLR signaling does indeed require ERE binding for its effect on the innate immune response. PMID:25061615

  2. Estrogen Receptor Alpha Binding to ERE is Required for Full Tlr7- and Tlr9-Induced Inflammation.

    PubMed

    Cunningham, Melissa A; Wirth, Jena R; Naga, Osama; Eudaly, Jackie; Gilkeson, Gary S

    2014-01-20

    We previously found that a maximum innate inflammatory response induced by stimulation of Toll-like receptors (TLRs) 3, 7 and 9 requires ERα, but does not require estrogen in multiple cell types from both control and lupus-prone mice. Given the estrogen-independence, we hypothesized that ERα mediates TLR signaling by tethering to, and enhancing, the activity of downstream transcription factors such as NFκB, rather than acting classically by binding EREs on target genes. To investigate the mechanism of ERα impact on TLR signaling, we utilized mice with a knock-in ERα mutant that is unable to bind ERE. After stimulation with TLR ligands, both ex vivo spleen cells and bone marrow-derived dendritic cells (BM-DCs) isolated from mutant ERα ("KIKO") mice produced significantly less IL-6 compared with cells from wild-type (WT) littermates. These results suggest that ERα modulation of TLR signaling does indeed require ERE binding for its effect on the innate immune response.

  3. Evolution of the Bovine TLR Gene Family and Member Associations with Mycobacterium avium Subspecies paratuberculosis Infection

    PubMed Central

    Fisher, Colleen A.; Bhattarai, Eric K.; Osterstock, Jason B.; Dowd, Scot E.; Seabury, Paul M.; Vikram, Meenu; Whitlock, Robert H.; Schukken, Ynte H.; Schnabel, Robert D.; Taylor, Jeremy F.; Womack, James E.; Seabury, Christopher M.

    2011-01-01

    Members of the Toll-like receptor (TLR) gene family occupy key roles in the mammalian innate immune system by functioning as sentries for the detection of invading pathogens, thereafter provoking host innate immune responses. We utilized a custom next-generation sequencing approach and allele-specific genotyping assays to detect and validate 280 biallelic variants across all 10 bovine TLR genes, including 71 nonsynonymous single nucleotide polymorphisms (SNPs) and one putative nonsense SNP. Bayesian haplotype reconstructions and median joining networks revealed haplotype sharing between Bos taurus taurus and Bos taurus indicus breeds at every locus, and specialized beef and dairy breeds could not be differentiated despite an average polymorphism density of 1 marker/158 bp. Collectively, 160 tagSNPs and two tag insertion-deletion mutations (indels) were sufficient to predict 100% of the variation at 280 variable sites for both Bos subspecies and their hybrids, whereas 118 tagSNPs and 1 tagIndel predictively captured 100% of the variation at 235 variable sites for B. t. taurus. Polyphen and SIFT analyses of amino acid (AA) replacements encoded by bovine TLR SNPs indicated that up to 32% of the AA substitutions were expected to impact protein function. Classical and newly developed tests of diversity provide strong support for balancing selection operating on TLR3 and TLR8, and purifying selection acting on TLR10. An investigation of the persistence and continuity of linkage disequilibrium (r2≥0.50) between adjacent variable sites also supported the presence of selection acting on TLR3 and TLR8. A case-control study employing validated variants from bovine TLR genes recognizing bacterial ligands revealed six SNPs potentially eliciting small effects on susceptibility to Mycobacterium avium spp paratuberculosis infection in dairy cattle. The results of this study will broadly impact domestic cattle research by providing the necessary foundation to explore several

  4. Breed-linked polymorphisms of porcine toll-like receptor 2 (TLR2) and TLR4 and the primary investigation on their relationship with prevention against Mycoplasma pneumoniae and bacterial LPS challenge.

    PubMed

    Fang, Xiaomin; Liu, Xiao; Meng, Cui; Fu, Yanfeng; Wang, Xuemin; Li, Bixia; Tu, Feng; Zhao, Fang; Ren, Shouwen

    2013-11-01

    Toll-like receptors (TLRs) play a crucial role in innate immunity, serving as pattern-recognition receptors and the first barrier in host defense against microbial infections. Genetic variations of TLR2 and TLR4 are closely associated with a variety of infectious diseases, particularly lung diseases. In this study, we detected six and four single nucleotide polymorphisms (SNPs) in the coding sequences of porcine TLR2 and TLR4 genes, respectively. Only SNP 1027C>A of TLR4 was shown to be markedly biased in Western and Oriental pig populations. Hence, the susceptibility of pigs with different genotype at position 1027C>A to Mycoplasma hyopneumoniae (Mhp) infection was investigated, and changes to the expression of TLR2, TLR4, TNF-α and IL-1β were monitored. The results showed that there was no significant difference in susceptibility to Mhp infection between AA and CC individuals despite expression levels for all detected genes of the challenge groups being significantly higher than the corresponding control groups. Furthermore, porcine alveolar macrophages of different genotype were collected and stimulated by lipopolysaccharide. We found that the expression of TLR2, TLR4, TNF-α and IL-1β genes were enhanced to different levels by lipopolysaccharide stimulation. TLR2 and TLR4 gene expressions and their rates of increase of 1027CC pigs were significantly higher than for 1027AC pigs (P < 0.01), while TNF-α and IL-1β expressions were significantly lower than for 1027AC pigs (P < 0.01). We predict that allele C at position 1027 of the TLR4 gene contributes to the pig's immune response to gram-negative bacterial infections.

  5. Acanthamoeba infection in lungs of mice expressed by toll-like receptors (TLR2 and TLR4).

    PubMed

    Derda, Monika; Wojtkowiak-Giera, Agnieszka; Kolasa-Wołosiuk, Agnieszka; Kosik-Bogacka, Danuta; Hadaś, Edward; Jagodziński, Paweł P; Wandurska-Nowak, Elżbieta

    2016-06-01

    Toll-like receptors (TLRs) play a key role in the innate immune responses to a variety of pathogens including parasites. TLRs are among the most highly conserved in the evolution of the receptor family, localized mainly on cells of the immune system and on other cells such as lung cells. The aim of this study was to determine for the first time the expression of TLR2 and TLR4 in the lung of Acanthamoeba spp. infected mice using quantitative real-time polymerase chain reaction (Q-PCR) and immunohistochemical (IHC) staining. The Acanthamoeba spp. were isolated from a patient with Acanthamoeba keratitis (AK) (strain Ac 55) and from environmental samples of water from Malta Lake (Poznań, Poland - strain Ac 43). We observed a significantly increased level of expression of TLR2 as well as TLR4 mRNA from 2 to 30 days post Acanthamoeba infection (dpi) in the lungs of mice infected with Ac55 (KP120880) and Ac43 (KP120879) strains. According to our observations, increased TLR2 and TLR4 expression in the pneumocytes, interstitial cells and epithelial cells of the bronchial tree may suggest an important role of these receptors in protective immunity against Acanthamoeba infection in the lung. Moreover, increased levels of TLR2 and TLR4 mRNA expression in infected Acanthamoeba mice may suggest the involvement of these TLRs in the recognition of this amoeba pathogen-associated molecular pattern (PAMP).

  6. Identification and characterisation of TLR18-21 genes in Atlantic salmon (Salmo salar).

    PubMed

    Lee, P T; Zou, J; Holland, J W; Martin, S A M; Collet, B; Kanellos, T; Secombes, C J

    2014-12-01

    Teleost fish possess many types of toll-like receptor (TLR) some of which exist in other vertebrate groups and some that do not (ie so-called "fish-specific" TLRs). In this study, we identified in Atlantic salmon (Salmo salar) whole-genome shotgun (WGS) contigs seven TLRs that are not found in mammals, including six types of fish-specific TLRs (one TLR18, one TLR19, and four TLR20 members (two of which are putative soluble forms (s)) and one TLR21. Phylogenetic analysis revealed that teleost TLR19-21 are closely related with murine TLR11-TLR13, whilst teleost TLR18 groups with mammalian TLR1, 2, 6 and 10. A typical TLR protein domain structure was found in all these TLRs with the exception of TLR20b(s) and TLR20c(s). TLR-GFP expression plasmids transfected into SHK-1 cells showed that salmon TLR19, TLR20a and TLR20d were preferentially localised to the intracellular compartment. Real time PCR analysis suggested that salmon TLR19-TLR21 are mainly expressed in immune related organs, such as spleen, head kidney and gills, while TLR18 transcripts are more abundant in muscle. In vitro stimulation of primary head kidney cells with type I IFN, IFNγ and IL-1β had no impact on TLR expression. Infectious salmon anaemia virus (ISAV) infection, in vivo, down-regulated TLR20a, TLR20b(s), TLR20d and TLR21 in infected salmon kidney tissue. In contrast, up-regulation of TLR19 and TLR20a expression was found in posterior kidney in rainbow trout with clinical proliferative kidney disease (PKD).

  7. Hypermethylation and low transcription of TLR2 gene in chronic periodontitis.

    PubMed

    de Faria Amormino, Simone Angélica; Arão, Telma Cristina; Saraiva, Adriana Machado; Gomez, Ricardo Santiago; Dutra, Walderez Ornelas; da Costa, José Eustáquio; de Fátima Correia Silva, Jeane; Moreira, Paula Rocha

    2013-09-01

    Periodontitis is an inflammatory disorder characterized by interactions between periodontal pathogens and host's immune response. Epigenetic may contribute to disease development and outcome by influencing the expression of genes involved in the immune response. It has been shown that Toll-like receptors (TLR) play an important role in the response to periodontopathic bacteria. The aim of study was to evaluate the methylation status and the expression of TLR2 gene in gingival samples from individuals with and without periodontitis. DNA was analyzed using the Methyl Profiler DNA Methylation qPCR assay. DNA methylation and transcript levels were evaluated by real-time polymerase chain reaction. The periodontitis group showed a hypermethylated profile and a low expression of gene. Positive correlation between the TLR2 methylation frequency and probing depth was observed. This study gives the first evidence of methylation frequency in inflamed periodontal tissues and of the possible participation of methylation in the development of periodontitis.

  8. Metalloproteinase-Dependent TLR2 Ectodomain Shedding is Involved in Soluble Toll-Like Receptor 2 (sTLR2) Production

    PubMed Central

    Langjahr, Patricia; Díaz-Jiménez, David; De la Fuente, Marjorie; Rubio, Estefhany; Golenbock, Douglas; Bronfman, Francisca C.; Quera, Rodrigo; González, María-Julieta; Hermoso, Marcela A.

    2014-01-01

    Toll-like receptor (TLR) 2, a type I membrane receptor that plays a key role in innate immunity, recognizes conserved molecules in pathogens, and triggering an inflammatory response. It has been associated with inflammatory and autoimmune diseases. Soluble TLR2 (sTLR2) variants have been identified in human body fluids, and the TLR2 ectodomain can negatively regulate TLR2 activation by behaving as a decoy receptor. sTLR2 generation does not involve alternative splicing mechanisms, indicating that this process might involve a post-translational modification of the full-length receptor; however, the specific mechanism has not been studied. Using CD14+ peripheral human monocytes and the THP-1 monocytic leukemia-derived cell line, we confirm that sTLR2 generation increases upon treatment with pro-inflammatory agents and requires a post-translational mechanism. We also find that the constitutive and ligand-induced release of sTLR2 is sensitive to pharmacological metalloproteinase activator and inhibitors leading us to conclude that metalloproteinase TLR2 shedding contributes to soluble receptor production. By expressing human TLR2 in ADAM10- or ADAM17-deficient MEF cells, we find both enzymes to be implicated in TLR2 ectodomain shedding. Moreover, using a deletion mutant of the TLR2 juxtamembrane region, we demonstrate that this domain is required for sTLR2 generation. Functional analysis suggests that sTLR2 generated by metalloproteinase activation inhibitsTLR2-induced cytokine production by this monocytic leukemia-derived cell line. The identification of the mechanisms involved in regulating the availability of soluble TLR2 ectodomain and cell surface receptors may contribute further research on TLR2-mediated processes in innate immunity and inflammatory disorders. PMID:25531754

  9. Nonbilayer Phospholipid Arrangements Are Toll-Like Receptor-2/6 and TLR-4 Agonists and Trigger Inflammation in a Mouse Model Resembling Human Lupus

    PubMed Central

    Wong-Baeza, Carlos; Tescucano, Alonso; Astudillo, Horacio; Reséndiz, Albany; Landa, Carla; España, Luis; Serafín-López, Jeanet; Estrada-García, Iris; Estrada-Parra, Sergio; Flores-Romo, Leopoldo; Wong, Carlos; Baeza, Isabel

    2015-01-01

    Systemic lupus erythematosus is characterized by dysregulated activation of T and B cells and autoantibodies to nuclear antigens and, in some cases, lipid antigens. Liposomes with nonbilayer phospholipid arrangements induce a disease resembling human lupus in mice, including IgM and IgG antibodies against nonbilayer phospholipid arrangements. As the effect of these liposomes on the innate immune response is unknown and innate immune system activation is necessary for efficient antibody formation, we evaluated the effect of these liposomes on Toll-like receptor (TLR) signaling, cytokine production, proinflammatory gene expression, and T, NKT, dendritic, and B cells. Liposomes induce TLR-4- and, to a lesser extent, TLR-2/TLR-6-dependent signaling in TLR-expressing human embryonic kidney (HEK) cells and bone marrow-derived macrophages. Mice with the lupus-like disease had increased serum concentrations of proinflammatory cytokines, C3a and C5a; they also had more TLR-4-expressing splenocytes, a higher expression of genes associated with TRIF-dependent TLR-4-signaling and complement activation, and a lower expression of apoptosis-related genes, compared to healthy mice. The percentage of NKT and the percentage and activation of dendritic and B2 cells were also increased. Thus, TLR-4 and TLR-2/TLR-6 activation by nonbilayer phospholipid arrangements triggers an inflammatory response that could contribute to autoantibody production and the generation of a lupus-like disease in mice. PMID:26568960

  10. Nonbilayer Phospholipid Arrangements Are Toll-Like Receptor-2/6 and TLR-4 Agonists and Trigger Inflammation in a Mouse Model Resembling Human Lupus.

    PubMed

    Wong-Baeza, Carlos; Tescucano, Alonso; Astudillo, Horacio; Reséndiz, Albany; Landa, Carla; España, Luis; Serafín-López, Jeanet; Estrada-García, Iris; Estrada-Parra, Sergio; Flores-Romo, Leopoldo; Wong, Carlos; Baeza, Isabel

    2015-01-01

    Systemic lupus erythematosus is characterized by dysregulated activation of T and B cells and autoantibodies to nuclear antigens and, in some cases, lipid antigens. Liposomes with nonbilayer phospholipid arrangements induce a disease resembling human lupus in mice, including IgM and IgG antibodies against nonbilayer phospholipid arrangements. As the effect of these liposomes on the innate immune response is unknown and innate immune system activation is necessary for efficient antibody formation, we evaluated the effect of these liposomes on Toll-like receptor (TLR) signaling, cytokine production, proinflammatory gene expression, and T, NKT, dendritic, and B cells. Liposomes induce TLR-4- and, to a lesser extent, TLR-2/TLR-6-dependent signaling in TLR-expressing human embryonic kidney (HEK) cells and bone marrow-derived macrophages. Mice with the lupus-like disease had increased serum concentrations of proinflammatory cytokines, C3a and C5a; they also had more TLR-4-expressing splenocytes, a higher expression of genes associated with TRIF-dependent TLR-4-signaling and complement activation, and a lower expression of apoptosis-related genes, compared to healthy mice. The percentage of NKT and the percentage and activation of dendritic and B2 cells were also increased. Thus, TLR-4 and TLR-2/TLR-6 activation by nonbilayer phospholipid arrangements triggers an inflammatory response that could contribute to autoantibody production and the generation of a lupus-like disease in mice.

  11. Variation in the TLR4 gene influences the risk of organ failure and shock post-trauma: a cohort study

    PubMed Central

    Shalhub, Sherene; Junker, Christopher E.; Imahara, Scott D.; Mindrinos, Michael N.; Dissanaike, Sharmila; O’Keefe, Grant E.

    2009-01-01

    Background Genetic variation contributes to risk and outcomes of sepsis. We sought to determine if variation in inflammation related genes is associated with severity of sepsis in trauma patients. Methods A cohort of severely injured Caucasian patients was studied and genotyped for candidate single nucleotide polymorphisms (SNPs). These were toll-like receptor 4 (TLR4) A896G, tumor necrosis factor-α G-308A, interleukin-6 G-174C, interleukin-1β C-31T, and cluster of differentiation marker-14 C-159T. SNP genotypes among patients with sepsis and complicated sepsis were analyzed by chi-square and logistic regression. Six haplotype-tagging SNPs in the TLR4 gene were subsequently examined to determine their influence on TLR4 A896G SNP’s relationship to sepsis severity. Results We enrolled 598 patients. Complicated sepsis developed in 147 (25%). Adjusting for independent risk factors, carriage of the variant TLR4 896 G allele was associated with decreased risk of complicated sepsis (OR = 0.3, 95%CI = 0.1–0.7, p = 0.008). Furthermore, two haplotypes seemed to better characterize this risk than the variant TLR4 896 G allele. The variant TLR4 896G allele is linked to one common haplotype, which seems to confer a considerably reduced risk of complicated sepsis. (aOR = 0.2 95% CI = 0.05–0.7, p = 0.01) Conclusions Variation within TLR4 gene is associated with severity of post-traumatic sepsis. This risk may not be solely related to TLR4 A896G SNP. It is likely that other, uncharacterized variations in the TLR4 gene contribute to sepsis severity. A thorough evaluation of variability within the TLR4 gene is needed to characterize sepsis risk. PMID:19131814

  12. Role of the Toll Like receptor (TLR) radical cycle in chronic inflammation: possible treatments targeting the TLR4 pathway.

    PubMed

    Lucas, Kurt; Maes, Michael

    2013-08-01

    Activation of the Toll-like receptor 4 (TLR4) complex, a receptor of the innate immune system, may underpin the pathophysiology of many human diseases, including asthma, cardiovascular disorder, diabetes, obesity, metabolic syndrome, autoimmune disorders, neuroinflammatory disorders, schizophrenia, bipolar disorder, autism, clinical depression, chronic fatigue syndrome, alcohol abuse, and toluene inhalation. TLRs are pattern recognition receptors that recognize damage-associated molecular patterns and pathogen-associated molecular patterns, including lipopolysaccharide (LPS) from gram-negative bacteria. Here we focus on the environmental factors, which are known to trigger TLR4, e.g., ozone, atmosphere particulate matter, long-lived reactive oxygen intermediate, pentachlorophenol, ionizing radiation, and toluene. Activation of the TLR4 pathways may cause chronic inflammation and increased production of reactive oxygen and nitrogen species (ROS/RNS) and oxidative and nitrosative stress and therefore TLR-related diseases. This implies that drugs or substances that modify these pathways may prevent or improve the abovementioned diseases. Here we review some of the most promising drugs and agents that have the potential to attenuate TLR-mediated inflammation, e.g., anti-LPS strategies that aim to neutralize LPS (synthetic anti-LPS peptides and recombinant factor C) and TLR4/MyD88 antagonists, including eritoran, CyP, EM-163, epigallocatechin-3-gallate, 6-shogaol, cinnamon extract, N-acetylcysteine, melatonin, and molecular hydrogen. The authors posit that activation of the TLR radical (ROS/RNS) cycle is a common pathway underpinning many "civilization" disorders and that targeting the TLR radical cycle may be an effective method to treat many inflammatory disorders.

  13. Establishing targeted carp TLR22 gene disruption via homologous recombination using CRISPR/Cas9.

    PubMed

    Chakrapani, Vemulawada; Patra, Swagat Kumar; Panda, Rudra Prasanna; Rasal, Kiran Dashrath; Jayasankar, Pallipuram; Barman, Hirak Kumar

    2016-08-01

    Recent advances in gene editing techniques have not been exploited in farmed fishes. We established a gene targeting technique, using the CRISPR/Cas9 system in Labeo rohita, a farmed carp (known as rohu). We demonstrated that donor DNA was integrated via homologous recombination (HR) at the site of targeted double-stranded nicks created by CRISPR/Cas9 nuclease. This resulted in the successful disruption of rohu Toll-like receptor 22 (TLR22) gene, involved in innate immunity and exclusively present in teleost fishes and amphibians. The null mutant, thus, generated lacked TLR22 mRNA expression. Altogether, this is the first evidence that the CRISPR/Cas9 system is a highly efficient tool for targeted gene disruption via HR in teleosts for generating model large-bodied farmed fishes.

  14. Low TLR7 gene expression in atherosclerotic plaques is associated with major adverse cardio- and cerebrovascular events

    PubMed Central

    Karadimou, Glykeria; Folkersen, Lasse; Berg, Martin; Perisic, Ljubica; Discacciati, Andrea; Roy, Joy; Hansson, Göran K.; Persson, Jonas; Paulsson-Berne, Gabrielle

    2017-01-01

    Aims Processes in the development of atherosclerotic lesions can lead to plaque rupture or erosion, which can in turn elicit myocardial infarction or ischaemic stroke. The aims of this study were to determine whether Toll-like receptor 7 (TLR7) gene expression levels influence patient outcome and to explore the mechanisms linked to TLR7 expression in atherosclerosis. Methods and results Atherosclerotic plaques were removed by carotid endarterectomy (CEA) and subjected to gene array expression analysis (n = 123). Increased levels of TLR7 transcript in the plaques were associated with better outcome in a follow-up study over a maximum of 8 years. Patients with higher TLR7 transcript levels had a lower risk of experiencing major cardiovascular and cerebrovascular events (MACCE) during the follow-up period after CEA (hazard ratio: 2.38, P = 0.012, 95% CI 1.21–4.67). TLR7 was expressed in all plaques by T cells, macrophages and endothelial cells in capillaries, as shown by immunohistochemistry. In short-term tissue cultures, ex vivo treatment of plaques with the TLR7 ligand imiquimod elicited dose-dependent secretion of IL-10, TNF-α, GM-CSF, and IL-12/IL-23p40. This secretion was blocked with a TLR7 inhibitor. Immunofluorescent tissue analysis after TLR7 stimulation showed IL-10 expression in T cells, macrophages and vascular smooth muscle cells. TLR7 mRNA levels in the plaques were correlated with IL-10 receptor (r = 0.4031, P < 0.0001) and GM-CSF receptor A (r = 0.4354, P < 0.0001) transcripts. Conclusion These findings demonstrate that TLR7 is abundantly expressed in human atherosclerotic plaques. TLR7 ligation elicits the secretion of pro-inflammatory and anti-inflammatory cytokines, and high TLR7 expression in plaques is associated with better patient outcome, suggesting that TLR7 is a potential therapeutic target for prevention of complications of atherosclerosis. PMID:27864310

  15. Genetic variation of toll-like receptor genes and infection by Mycobacterium avium ssp. paratuberculosis in Holstein-Friesian cattle.

    PubMed

    Ruiz-Larrañaga, O; Manzano, C; Iriondo, M; Garrido, J M; Molina, E; Vazquez, P; Juste, R A; Estonba, A

    2011-07-01

    Toll-like receptors (TLR) are membrane proteins that play a key role in innate immunity, by recognizing pathogens and subsequently activating appropriate responses. Mutations in TLR genes are associated with susceptibility to inflammatory and infectious diseases in humans. In cattle, 3 members of the TLR family, TLR1, TLR2, and TLR4, are associated with Mycobacterium avium ssp. paratuberculosis infection, although the extent of this association for the TLR1 and TLR4 receptors has not yet been determined. Moreover, the causal variant in the TLR2 gene has not yet been unequivocally established. In this study, 24 single nucleotide polymorphisms (SNP) in the bovine TLR1, TLR2, and TLR4 genes were selected from the literature, databases, and in silico searches, for a population-based genetic association study of a Spanish Holstein-Friesian sample. Whereas previous results regarding the TLR1 gene were not corroborated, a risk haplotype was detected in TLR2; however, its low frequency indicates that this detected association should be interpreted with caution. In the case of the TLR4 gene, 3 tightly linked SNP were found to be associated with susceptibility to M. avium ssp. paratuberculosis infection. Moreover, one of these SNP, the SNP c.-226G>C, which is localized in the 5'UTR region of the TLR4 gene, has been reported to be able to alter TLR4 expression, raising the possibility that this mutation may contribute to the response of the individual to infection.

  16. Polymorphisms in genes TLR1, 2 and 4 are associated with differential cytokine and chemokine serum production in patients with leprosy

    PubMed Central

    Santana, Nadja de Lima; Rêgo, Jamile Leão; Oliveira, Joyce Moura; de Almeida, Lucas Frederico; Braz, Marcos; Machado, Lídia Maria Medeiros; Machado, Paulo Roberto Lima; Castellucci, Léa Cristina

    2017-01-01

    BACKGROUND Leprosy or hansen’s disease is a spectral disease whose clinical forms mostly depends on host’s immune and genetic factors. Different Toll-like receptors (TLR) variants have been described associated with leprosy, but with some lack of replication across different populations. OBJECTIVES To evaluate the role of polymorphisms in genes TLR1, TLR2 and TLR4 and susceptibility to leprosy in a genetic case control study; to verify the association between genotypes of these markers and the immunological profile in the serum of patients with leprosy. METHODS Pre-designed TaqMan® assays were used to genotype markers at TLR1 (rs4833095, rs5743551), TLR2 (rs7656411, rs3804099) and TLR4 (rs1927914, rs1927911). A panel of cytokines and chemokines was accessed by enzime-linked immunosorbent assay (ELISA) test in the serum of a subgroup of patients with and without leprosy reactions. FINDINGS Our results show an association between the T allele of rs3804099 at the TLR2 gene and increased risk for leprosy per se [Odds ratio (OR) = 1.296, p = 0,022]. In addition, evaluating the association between different genotypes of the TLR1, 2 and 4 markers and cytokine/chemokine serological levels, IL-17 appears as an immunological marker regulated by the polymorphism of the three TLR genes evaluated, whereas different TLR1 genotypes were associated with differential production of IL-12p40 and MCP-1(CCL2). Furthermore, other relevant serum markers such as CXCL-10 and IL-6 seemed to be regulated by TLR2 variants and IL-1β was related to TLR4 genotypes. MAIN CONCLUSIONS All together our data points that the tested TLR markers may have a regulatory role in the immunity against Mycobacterium leprae, by driving the host’s production of key cytokines and chemokines involved in the pathogenesis of this disease. PMID:28327786

  17. The TLR4 D299G and T399I SNPs are constitutively active to up-regulate expression of Trif-dependent genes.

    PubMed

    Hold, Georgina L; Berry, Susan; Saunders, Karin A; Drew, Janice; Mayer, Claus; Brookes, Heather; Gay, Nick J; El-Omar, Emad M; Bryant, Clare E

    2014-01-01

    Dysregulated Toll-Like Receptor (TLR) signalling and genetic polymorphisms in these proteins are linked to many human diseases. We investigated TLR4 functional variants D299G and T399I to assess the impact on LPS-induced responsiveness in comparison to wild-type TLR4. The mechanism by which this occurs in unclear as these SNPs do not lie within the lipid A binding domain or dimerisation sites of the LPS-TLR4/MD2 receptor complexes. Transfection of TLR4D299G, TLR4T399I or TLR4D299G. T399I into HEK cells resulted in constitutive activation of an NF-κB reporter gene and a blunting of the LPS-induced reporter activation compared to WT-TLR4. Unstimulated human monocyte/macrophages, from patients with the D299G and T399I SNPs demonstrated a downregulation of many genes, particularly Tram/Trif signalling pathway constitutents compared to the TLR4 wild-type subjects supporting the concept of basal receptor activity. Monocyte/macrophages from carriers of the TLR4 D299G and T399I polymorphisms stimulated with LPS showed >6 fold lower levels of NF-κB and ∼12 fold higher IFN-β gene expression levels compared to wild-type subjects (P<0.05; MWU test) and dramatically altered resultant cytokine profiles. We conclude that these TLR4 SNPs affect constitutive receptor activity which impacts on the hosts ability to respond to LPS challenge leading to a dysregulated sub-optimal immune response to infection.

  18. Evolutionary analysis of TLR9 genes reveals the positive selection of extant teleosts in Perciformes.

    PubMed

    Zhu, Zhihuang; Sun, Yuena; Wang, Rixin; Xu, Tianjun

    2013-08-01

    The innate immune system can recognize non-self through pattern recognition receptors. Toll-like receptors were the best-known members of these receptors, and they could sense, recognize, and bind pathogen-associated molecular patterns. TLRs played an important role in innate immune system and were conserved in both invertebrate and vertebrate lineages. Thereinto, TLR9 could detect unmethylated CpG motifs in dsDNA and was expected to undergo coevolution with its microbial ligands. It was known that aquatic and terrestrial organisms dwelled in different environments which contained different pathogens, and they had to adapt to their local environmental conditions. Therefore, we collected TLR9 genes from invertebrate to vertebrate to further explore whether the huge differences between aquatic and terrestrial environments affected the TLR9s evolution between aquatic and terrestrial organisms. Molecular evolution analysis detected positively selected sites in the ancestral lineages of vertebrates, teleosts, and Perciformes but not in the ancestral lineage of mammals. In PAML, site model revealed that extant mammalian TLR9 genes underwent positive selection. However, the positive selection of extant teleosts appeared primarily in Perciformes in which there were 14 positively selected sites. Among these sites, two of them were located on the amino acid insertions of the leucine-rich repeats which could create DNA binding sites, three were found on the convex surface which might possibly affect the flexibility of the TLR solenoids, and six were located on the β-face of concave surface which contained the ligand-binding sites of the TLR solenoids. In other ML methods, we also found three sites under selection that coincided with the codons identified by M8 and these sites were all located in LRRs. The diverse aquatic and terrestrial environments might possess different pathogens to make the living organisms adapt to their local environmental conditions. The positive

  19. Apolipoprotein E inhibits toll-like receptor (TLR)-3- and TLR-4-mediated macrophage activation through distinct mechanisms.

    PubMed

    Zhu, Yanjuan; Kodvawala, Ahmer; Hui, David Y

    2010-04-28

    Previous studies have shown that apoE (apolipoprotein E) expression in macrophages suppresses inflammatory responses; however, whether endogenously synthesized apoE acts intracellularly or after its secretion in suppressing macrophage inflammation remains unclear. The present study used the murine monocyte macrophage cell line RAW 264.7 to examine the influence of exogenous apoE on macrophage inflammatory responses induced by TLR (Toll-like receptor)-4 and TLR-3 agonists LPS (lipopolysaccharide) and poly(I-C) respectively. Results showed that exogenously added apoE suppressed the LPS and poly(I-C) induction of IL (interleukin)-6, IL-1beta and TNF-alpha (tumour necrosis factor-alpha) secretion by RAW 264.7 cells. The mechanism was related to apoE suppression of TLR-agonist-induced phosphorylation of JNK (c-Jun N-terminal kinase) and c-Jun. A peptide containing the tandem repeat sequence of the receptor-binding domain of apoE, apoE-(141-155)2, was similarly effective in inhibiting LPS- and poly(I-C)-induced macrophage inflammatory responses. Reductive methylation of lysine residues in apoE, which abolished its receptor-binding capability without affecting its ability to interact with HSPGs (heparin sulfate proteoglycans), inhibited the ability of apoE to suppress macrophage responses to LPS, but had no effect on apoE suppression of poly(I-C)-induced macrophage activation. The ability of apoE to suppress poly(I-C)-induced pro-inflammatory cytokine production was abolished by heparinase treatment of RAW 264.7 cells to remove cell-surface HSPGs. Taken together, these results indicate that exogenous apoE inhibits macrophage inflammatory responses to TLR-4 and TLR-3 agonists through distinct mechanisms related to receptor and HSPG binding respectively, and that these inhibitory effects converged on suppression of JNK and c-Jun activation which are necessary for macrophage activation.

  20. Combating Drug Abuse by Targeting Toll-Like Receptor 4 (TLR4)

    DTIC Science & Technology

    2013-10-01

    to preserve the desired effects of   3   opioids ( pain -relief) while diminishing unwanted effects (analgesic tolerance and reward...significant progress anticipated in the coming project period. 15. SUBJECT TERMS toll like receptor 4 (TLR4); TLR4 agonists non- opioid (+)-naloxone and...naltrexone; drug abuse; glial activation; therapeutic approach to treating drug abuse; opioids ; cocaine 16. SECURITY CLASSIFICATION OF: 17

  1. Toll-like Receptor 4 (TLR4) modulation by synthetic and natural compounds: an update

    PubMed Central

    Peri, Francesco; Calabrese, Valentina

    2014-01-01

    Toll-like receptor 4 (TLR4), together with MD-2, binds bacterial endotoxins (E) with high affinity, triggering formation of the activated homodimer (E-MD-2-TLR4)2. Activated TLR4 induces intracellular signaling leading to activation of transcription factors that result in cytokine and chemokine production and initiation of inflammatory and immune responses. TLR4 also responds to endogenous ligands called danger associated molecular patterns (DAMPs). Increased sensitivity to infection and a variety of immune pathologies have been associated with either too little or too much TLR4 activation. We review here the molecular mechanisms of TLR4 activation (agonism) or inhibition (antagonism) by small organic molecules of both natural and synthetic origin. The role of co-receptors MD-2 and CD14 in the TLR4 modulation process is also discussed. Recent achievements in the field of chemical TLR4 modulation are reviewed, with special focus on non-classical TLR4 ligands with a chemical structure different from lipid A. PMID:24188011

  2. Studies on expression pattern of toll-like receptor 5 (TLR5) in Edwardsiella tarda infected Pangasianodon hypophthalmus.

    PubMed

    Jayaramu, Poojashree Kachigere; Tripathi, Gayatri; Pavan Kumar, A; Keezhedath, Jeena; Pathan, Mujahid Khan; Kurcheti, Pani Prasad

    2017-04-01

    TLR5 is one of the important PRR (pathogen recognition receptors) and plays a fundamental role in pathogen recognition and activation of innate immune responses. It recognizes bacterial flagellin and stimulates the production of proinflammatory cytokines, through signalling via the adaptor protein MyD88. In this study, we characterized partial TLR5 (soluble form) gene from Pangasianodon hypophthalmus and analysed its expression profile upon challenge by Edwardsiella tarda. Bioinformatic analysis of gene sequence revealed a putative protein of 266 amino acids with four Leucine rich repeats. Quantitative expression analysis of TLR 5S showed its wide distribution in various organs and tissues. However, significant expression of TLR5S was observed in liver and spleen at 12 h (∼207.8 fold, p < 0.05). Significant upregulation was observed in kidney at 72 h.p.i. (50 folds, p < 0.05) indicating that the kidney provides longer protection almost till the activation of the adaptive immune system. This study enriches the knowledge of TLR5S in boosting the innate immunity against bacterial invasion in fish.

  3. Identification, characterization, and genetic mapping of TLR7, TLR8a1 and TLR8a2 genes in rainbow trout (Oncorhynchus mykiss)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Induction of the innate immune pathways is critical for early antiviral defense but there is limited understanding of how teleost fish recognize viral molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 7 and 8 bind single-stranded RNA of viral origin and are activated by s...

  4. Combined effect of TLR2 gene polymorphism and early life stress on the age at onset of bipolar disorders.

    PubMed

    Oliveira, José; Etain, Bruno; Lajnef, Mohamed; Hamdani, Nora; Bennabi, Meriem; Bengoufa, Djaouida; Sundaresh, Aparna; Chaabane, Arij Ben; Bellivier, Frank; Henry, Chantal; Kahn, Jean-Pierre; Charron, Dominique; Krishnamoorthy, Rajagopal; Leboyer, Marion; Tamouza, Ryad

    2015-01-01

    Gene-environment interactions may play an important role in modulating the impact of early-life stressful events on the clinical course of bipolar disorder (BD), particularly associated to early age at onset. Immune dysfunction is thought to be an important mechanism linking childhood trauma with early-onset BD, thus the genetic diversity of immune-related loci may account for an important part of the interindividual susceptibility to this severe subform. Here we investigated the potential interaction between genetic variants of Toll-like receptors 2 (TLR2) and 4 (TLR4), major innate immune response molecules to pathogens, and the childhood trauma questionnaire (CTQ) in age at onset of BD. We recruited 531 BD patients (type I and II or not otherwise specified), genotyped for the TLR2 rs4696480 and rs3804099 and TLR4 rs1927914 and rs11536891 single-nucleotide polymorphisms and recorded for history of childhood trauma using the CTQ. TLR2 and TLR4 risk genotype carrier state and history of childhood emotional, physical and sexual abuses were evaluated in relation to age at onset as defined by the age at first manic or depressive episode. We observed a combined effect of TLR2 rs3804099 TT genotype and reported sexual abuse on determining an earlier age at onset of BD by means of a Kaplan-Meier survival curve (p = 0.002; corrected p = 0.02). Regression analysis, however, was non-significant for the TLR2-CTQ sexual abuse interaction term. The negative effects of childhood sexual abuse on age at onset of BD may be amplified in TLR2 rs3804099 risk genotype carriers through immune-mediated pathways. Clinical characteristics of illness severity, immune phenotypes and history of early life infectious insults should be included in future studies involving large patient cohorts.

  5. Toll-Like Receptor (TLR)-Associated Sequence Variants and Prostate Cancer Risk among Men of African Descent

    PubMed Central

    Rogers, Erica N.; Jones, Dominique; Kidd, Nayla C.; Yeyeodu, Susan; Brock, Guy; Ragin, Camille; Jackson, Maria; McFarlane-Anderson, Norma; Tulloch-Reid, Marshall; Kimbro, K. Sean; Kidd, LaCreis R.

    2013-01-01

    BACKGROUND Recent advances demonstrate a relationship between chronic/recurrent inflammation and prostate cancer (PCA). Among inflammatory regulators, toll-like receptors (TLRs) play a critical role in innate immune responses. However, it remains unclear whether variant TLR genes influence PCA risk among men of African descent. Therefore, we evaluated the impact of 32 TLR-associated single nucleotide polymorphisms (SNPs) on PCA risk among African-Americans and Jamaicans. METHODS SNP profiles of 814 subjects were evaluated using Illumina’s Veracode genotyping platform. Single and combined effects of SNPs in relation to PCA risk were assessed using age-adjusted logistic regression and entropy-based multifactor dimensionality reduction (MDR) models. RESULTS Seven sequence variants detected in TLR6, TOLLIP, IRAK4, IRF3 were marginally related to PCA. However, none of these effects remained significant after adjusting for multiple hypothesis testing. Nevertheless, MDR modeling revealed a complex interaction between IRAK4 rs4251545 and TLR2 rs1898830 as a significant predictor of PCA risk among U.S. men (permutation testing p-value = 0.001). CONCLUSIONS MDR identified an interaction between IRAK4 and TLR2 as the best two factor model for predicting PCA risk among men of African descent. However, these findings require further assessment and validation. PMID:23657238

  6. Epithelial and Stromal Cells of Bovine Endometrium Have Roles in Innate Immunity and Initiate Inflammatory Responses to Bacterial Lipopeptides In Vitro via Toll-Like Receptors TLR2, TLR1, and TLR6

    PubMed Central

    Turner, Matthew L.; Cronin, James G.; Healey, Gareth D.

    2014-01-01

    Bacteria often infect the endometrium of cattle to cause endometritis, uterine disease, and infertility. Lipopeptides are commonly found among bacteria and are detected by the Toll-like receptor (TLR) cell surface receptor TLR2 on immune cells. Heterodimers of TLR2 with TLR1 or TLR6 activate MAPK and nuclear factor-κB intracellular signaling pathways to stimulate inflammatory responses. In the endometrium, epithelial and stromal cells are the first to encounter invading bacteria, so the present study explored whether endometrial cells can also mount inflammatory responses to bacterial lipopeptides via TLRs. The supernatants of pure populations of primary bovine endometrial epithelial and stromal cells accumulated the cytokine IL-6 and the chemokine IL-8 in response to triacylated or diacylated bacterial lipopeptides. The accumulation of IL-6 and IL-8 in response to triacylated lipopeptides was reduced by small interfering RNA targeting TLR2 or TLR1 but not TLR6, whereas cellular responses to diacylated lipopeptide were reduced by small interfering RNA targeting TLR2, TLR1, or TLR6. Both lipopeptides induced rapid phosphorylation of ERK1/2, p38, and nuclear factor-κB in endometrial cells, and inhibitors of ERK1/2 or p38 limited the accumulation of IL-6. The ovarian steroids estradiol and progesterone had little impact on inflammatory responses to lipopeptides. The endometrial epithelial and stromal cell responses to lipopeptides via TLR2, TLR1, and TLR6 provide a mechanism linking a wide range of bacterial infections to inflammation of the endometrium. PMID:24437488

  7. Epithelial and stromal cells of bovine endometrium have roles in innate immunity and initiate inflammatory responses to bacterial lipopeptides in vitro via Toll-like receptors TLR2, TLR1, and TLR6.

    PubMed

    Turner, Matthew L; Cronin, James G; Healey, Gareth D; Sheldon, Iain Martin

    2014-04-01

    Bacteria often infect the endometrium of cattle to cause endometritis, uterine disease, and infertility. Lipopeptides are commonly found among bacteria and are detected by the Toll-like receptor (TLR) cell surface receptor TLR2 on immune cells. Heterodimers of TLR2 with TLR1 or TLR6 activate MAPK and nuclear factor-κB intracellular signaling pathways to stimulate inflammatory responses. In the endometrium, epithelial and stromal cells are the first to encounter invading bacteria, so the present study explored whether endometrial cells can also mount inflammatory responses to bacterial lipopeptides via TLRs. The supernatants of pure populations of primary bovine endometrial epithelial and stromal cells accumulated the cytokine IL-6 and the chemokine IL-8 in response to triacylated or diacylated bacterial lipopeptides. The accumulation of IL-6 and IL-8 in response to triacylated lipopeptides was reduced by small interfering RNA targeting TLR2 or TLR1 but not TLR6, whereas cellular responses to diacylated lipopeptide were reduced by small interfering RNA targeting TLR2, TLR1, or TLR6. Both lipopeptides induced rapid phosphorylation of ERK1/2, p38, and nuclear factor-κB in endometrial cells, and inhibitors of ERK1/2 or p38 limited the accumulation of IL-6. The ovarian steroids estradiol and progesterone had little impact on inflammatory responses to lipopeptides. The endometrial epithelial and stromal cell responses to lipopeptides via TLR2, TLR1, and TLR6 provide a mechanism linking a wide range of bacterial infections to inflammation of the endometrium.

  8. TLR9 gene region polymorphisms and susceptibility to tuberculosis in Vietnam.

    PubMed

    Graustein, A D; Horne, D J; Arentz, M; Bang, N D; Chau, T T H; Thwaites, G E; Caws, M; Thuong, N T T; Dunstan, S J; Hawn, T R

    2015-03-01

    Humans exposed to Mycobacterium tuberculosis (Mtb) show variation in susceptibility to infection and differences in tuberculosis (TB) disease outcome. Toll-like receptor 9 (TLR9) is a pattern recognition receptor that mediates recognition of Mtb and modulates Mtb-specific T-cell responses. Using a case-population design, we evaluated whether single nucleotide polymorphisms (SNPs) in the TLR9 gene region are associated with susceptibility to pulmonary or meningeal TB as well as neurologic presentation and mortality in the meningeal TB group. In a discovery cohort (n = 352 cases, 382 controls), three SNPs were associated with TB (all forms, p < 0.05) while three additional SNPs neared significance (0.05 < p < 0.1). When these six SNPs were evaluated in a validation cohort (n = 339 cases, 367 controls), one was significant (rs352142) while another neared significance (rs352143). When the cohorts were combined, rs352142 was most strongly associated with meningeal tuberculosis (dominant model; p = 0.0002, OR 2.36, CI 1.43-3.87) while rs352143 was associated with pulmonary tuberculosis (recessive model; p = 0.006, OR 5.3, CI 1.26-31.13). None of the SNPs were associated with mortality. This is the first demonstration of an association between a TLR9 gene region SNP and tuberculous meningitis. In addition, this extends previous findings that support associations of TLR9 SNPs with pulmonary tuberculosis.

  9. Age-related changes and distribution of T cell markers (CD3 and CD4) and toll-like receptors(TLR2, TLR3,TLR4 and TLR7) in the duck lymphoid organs.

    PubMed

    Zhang, Aiguo; Xu, Jiahua; Lai, Hanzhang; Huang, Wenke; Fang, Niran; Chen, Ruiai

    2017-03-10

    T lymphocytes and Toll-like receptors have been confirmed to have correlation with the ability to resistance to pathogenic challenges and play an important role in duck immune system. However, the information of ontogeny of T lymphocytes and Toll-like receptors is scarcely in duck. Therefore, to address these questions, we report the development and distribution of CD3 and CD4 by immunocytochemistry and the age-related mRNA level of duck T cell markers (CD3 and CD4) and Toll-like receptors (TLR2, TLR3, TLR4 and TLR7) by real time quantitative PCR in duck lymphoid organs (thymus, bursa of Fabricius and spleen). Results indicated that CD3 and CD4 positive cells can be observed in all test organs and partly change in an age-related way. CD4 positive T cell of duck spleen mainly distributed in periarterial lymphatic sheaths and red pulp, not in white pulp. Both of CD3 and CD4 were experienced significant increased wave twice in duck lymphoid organs and T cell dependent cellular immunity of duck may well established until 5 weeks old. The mRNA expression levels of duck TLRs were age and organ dependent, and duck TLR3 and TLR7 were significantly lower abundance in the spleen but higher in thymus and bursa of Fabricius, respectively. This study provide the essential knowledge of the ontogeny of T cells and Toll-like receptors in duck, which may shed lights on the T-cell mediate immunity and innate immunity in duck.

  10. Association of Toll-like receptor 4 (TLR4) with chronic plaque type psoriasis and psoriatic arthritis.

    PubMed

    Smith, Rh Ll; Hébert, H L; Massey, J; Bowes, J; Marzo-Ortega, H; Ho, P; McHugh, N J; Worthington, J; Barton, A; Griffiths, C E M; Warren, R B

    2016-04-01

    Family studies have provided overwhelming evidence for an underlying genetic component to psoriasis. Toll-like receptors (TLRs) are key transmembrane proteins in both the innate and adaptive immune responses which are known to be integral processes in psoriasis. Recent functional studies support this notion having suggested a role for TLR4 in the pathogenesis of psoriasis. Furthermore a missense polymorphism in the TLR4 gene has been associated with a number of autoimmune conditions, including Crohn diseases, making TLR4 a viable candidate gene for investigation. The aim of this study was to investigate polymorphisms across the TLR4 region with a high-density single nucleotide polymorphism (SNP) panel in a large cohort of patients with chronic plaque type psoriasis. Twenty SNPs were successfully genotyped using Sequenom iPLEX Gold platform in 2826 UK chronic plaque type psoriasis patients including subgroup data on presence of confirmed psoriatic arthritis (n = 1839) and early-onset psoriasis (n = 1466) was available. Allele frequencies for psoriasis patients were compared against imputed Wellcome Trust Case Control Consortium controls (n = 4861). Significant association was observed between a missense variant rs4986790 of TLR4 (Asp229Gly) and plaque type psoriasis (p = 2 × 10(-4)) which was also notable in those with psoriatic arthritis (p = 2 × 10(-4)) and early-onset psoriasis (p = 8 × 10(-4)). We present data suggestive of an association between a functional variant and an intronic variant of TLR4 and chronic plaque type psoriasis and psoriatic arthritis. However, validation of this association in independent cohorts will be necessary.

  11. A Novel Toll-Like Receptor (TLR) Influences Compatibility between the Gastropod Biomphalaria glabrata, and the Digenean Trematode Schistosoma mansoni.

    PubMed

    Pila, Emmanuel A; Tarrabain, Mahmoud; Kabore, Alethe L; Hanington, Patrick C

    2016-03-01

    Schistosomiasis, a devastating disease caused by parasitic flatworms of the genus Schistosoma, affects over 260 million people worldwide especially in tropical and sub-tropical regions. Schistosomes must undergo their larval development within specific species of snail intermediate hosts, a trait that is shared among almost all digenean trematodes. This unique and long-standing host-parasite relationship presents an opportunity to study both the importance of conserved immunological features in novel immunological roles, as well as new immunological adaptations that have arisen to combat a very specific type of immunological challenge. While it is well supported that the snail immune response is important for protecting against schistosome infection, very few specific snail immune factors have been identified and even fewer have been functionally characterized. Here, we provide the first functional report of a snail Toll-like receptor, which we demonstrate as playing an important role in the cellular immune response of the snail Biomphalaria glabrata following challenge with Schistosoma mansoni. This TLR (BgTLR) was identified as part of a peptide screen of snail immune cell surface proteins that differed in abundance between B. glabrata snails that differ in their compatibility phenotype to challenge by S. mansoni. The S. mansoni-resistant strain of B. glabrata (BS-90) displayed higher levels of BgTLR compared to the susceptible (M-line) strain. Transcript expression of BgTLR was found to be very responsive in BS-90 snails when challenged with S. mansoni, increasing 27 fold relative to β-actin (non-immune control gene); whereas expression in susceptible M-line snails was not significantly increased. Knockdown of BgTLR in BS-90 snails via targeted siRNA oligonucleotides was confirmed using a specific anti-BgTLR antibody and resulted in a significant alteration of the resistant phenotype, yielding patent infections in 43% of the normally resistant snails, which

  12. A Novel Toll-Like Receptor (TLR) Influences Compatibility between the Gastropod Biomphalaria glabrata, and the Digenean Trematode Schistosoma mansoni

    PubMed Central

    Pila, Emmanuel A.; Tarrabain, Mahmoud; Kabore, Alethe L.; Hanington, Patrick C.

    2016-01-01

    Schistosomiasis, a devastating disease caused by parasitic flatworms of the genus Schistosoma, affects over 260 million people worldwide especially in tropical and sub-tropical regions. Schistosomes must undergo their larval development within specific species of snail intermediate hosts, a trait that is shared among almost all digenean trematodes. This unique and long-standing host-parasite relationship presents an opportunity to study both the importance of conserved immunological features in novel immunological roles, as well as new immunological adaptations that have arisen to combat a very specific type of immunological challenge. While it is well supported that the snail immune response is important for protecting against schistosome infection, very few specific snail immune factors have been identified and even fewer have been functionally characterized. Here, we provide the first functional report of a snail Toll-like receptor, which we demonstrate as playing an important role in the cellular immune response of the snail Biomphalaria glabrata following challenge with Schistosoma mansoni. This TLR (BgTLR) was identified as part of a peptide screen of snail immune cell surface proteins that differed in abundance between B. glabrata snails that differ in their compatibility phenotype to challenge by S. mansoni. The S. mansoni-resistant strain of B. glabrata (BS-90) displayed higher levels of BgTLR compared to the susceptible (M-line) strain. Transcript expression of BgTLR was found to be very responsive in BS-90 snails when challenged with S. mansoni, increasing 27 fold relative to β-actin (non-immune control gene); whereas expression in susceptible M-line snails was not significantly increased. Knockdown of BgTLR in BS-90 snails via targeted siRNA oligonucleotides was confirmed using a specific anti-BgTLR antibody and resulted in a significant alteration of the resistant phenotype, yielding patent infections in 43% of the normally resistant snails, which

  13. Bacterial lipopolysaccharide induces increased expression of toll-like receptor (TLR) 4 and downstream TLR signaling molecules in bovine mammary epithelial cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bovine mammary epithelial cells contribute to the innate immune response to intramammary infections by recognizing pathogens through specialized pattern recognition receptors. Toll-like receptor 4 (TLR4) is one such receptor that binds and is activated by lipopolysaccharide (LPS), a component of the...

  14. Determination of the physiological 2:2 TLR5:flagellin activation stoichiometry revealed by the activity of a fusion receptor

    SciTech Connect

    Ivičak-Kocjan, Karolina; Panter, Gabriela; Benčina, Mojca; Jerala, Roman

    2013-05-24

    Highlights: •The chimeric protein fusing flagellin to the TLR5 ectodomain is constitutively active. •Mutation P736H within the BB-loop of TLR5 TIR domain renders the receptor inactive. •The R90D mutation in flagellin inactivated autoactivation of the chimeric protein. •The 2:2 stoichiometry of the TLR5:flagellin complex is physiologically relevant. -- Abstract: Toll-like receptor 5 (TLR5) recognizes flagellin of most flagellated bacteria, enabling activation of the MyD88-dependent signaling pathway. The recently published crystal structure of a truncated zebrafish TLR5 ectodomain in complex with an inactive flagellin fragment indicated binding of two flagellin molecules to a TLR5 homodimer, however this complex did not dimerize in solution. In the present study, we aimed to determine the physiological stoichiometry of TLR5:flagellin activation by the use of a chimeric protein composed of an active flagellin fragment linked to the N-terminus of human TLR5 (SF-TLR5). This construct was constitutively active. Inactivation by the R90D mutation within flagellin demonstrated that autoactivation of the chimeric protein depended solely on the specific interaction between TLR5 and flagellin. Addition of wild-type hTLR5 substantially lowered autoactivation of SF-TLR5 in a concentration dependent manner, an effect which was reversible by the addition of exogenous Salmonella typhimurium flagellin, indicating the biological activity of a TLR5:flagellin complex with a 2:2 stoichiometry. These results, in addition to the combinations of inactive P736H mutation within the BB-loop of the TIR domain of TLR5 and SF-TLR5, further confirm the mechanism of TLR5 activation.

  15. S-adenosylmethionine prevents the up regulation of Toll-like receptor (TLR) signaling caused by chronic ethanol feeding in rats.

    PubMed

    Oliva, Joan; Bardag-Gorce, Fawzia; Li, Jun; French, Barbara A; French, Samuel W

    2011-06-01

    Toll-like receptors (TLR) play a role in mediating the proinflammatory response, fibrogenesis and carcinogenesis in chronic liver diseases such as alcoholic liver disease, non-alcoholic liver disease, hepatitis C and hepatocellular carcinoma. This is true in experimental models of these diseases. For this reason, we investigated the TLR proinflammatory response in the chronic intragastric tube feeding rat model of alcohol liver disease. The methyl donor S-adenosylmethionine was also fed to prevent the gene expression changes induced by ethanol. Ethanol feeding tended to increase the up regulation of the gene expression of TLR2 and TLR4. SAMe feeding prevented this. TLR4 and MyD88 protein levels were significantly increased by ethanol and this was prevented by SAMe. This is the first report where ethanol feeding induced TLR2 and SAMe prevented the induction by ethanol. CD34, FOS, interferon responsive factor 1 (IRF-1), Jun, TLR 1,2,3,4,6 and 7 and Traf-6 were found to be up regulated as seen by microarray analysis where rats were sacrificed at high blood alcohol levels compared to pair fed controls. Il-6, IL-10 and IFNγ were also up regulated by high blood levels of ethanol. The gene expression of CD14, MyD88 and TNFR1SF1 were not up regulated by ethanol but were down regulated by SAMe. The gene expression of IL-1R1 and IRF1 tended to be up regulated by ethanol and this was prevented by feeding SAMe. The results suggest that SAMe, fed chronically prevents the activation of TLR pathways caused by ethanol. In this way the proinflammatory response, fibrogenesis, cirrhosis and hepatocellular carcinoma formation due to alcohol liver disease could be prevented by SAMe.

  16. Sialylation of Helicobacter bizzozeronii lipopolysaccharides modulates Toll-like receptor (TLR) 2 mediated response.

    PubMed

    Kondadi, Pradeep Kumar; Revez, Joana; Hänninen, Marja-Liisa; Rossi, Mirko

    2015-01-21

    Sialic acid in lipopolysaccharides (LPS) of mucosal pathogens is known to be an important virulence factor. Few strains of Helicobacter pylori express sialyl-Lewis-X and we have reported that human and canine Helicobacter bizzozeronii strains express sialyl-lactoseamine in their LPS. However, the role of sialyation of Helicobacter LPS in the interaction with the host cells is still unknown. In this study H. bizzozeronii LPS is shown to activate the TLR2 in a dose and strain dependent manner in the in vitro HEK-293 cells model expressing TLR2, but not the cells expressing TLR4. These results indicate that TLR2 is the specific receptor for H. bizzozzeronii LPS, as previously described for H. pylori. To further explore the role of sialylation of H. bizzozeronii LPS on TLR2 response, H. bizzozeronii Δhbs2 mutant strains deficient in sialyltransferase activity were constructed by homologous recombination. LPS from H. bizzozeronii Δhbs2 strains enhanced the NF-ĸB induction via TLR2 compared to the respective wild types, leading to the conclusion that the sialylation of H. bizzozeronii LPS in wild-type strains may modulate host immune response.

  17. A toll-like receptor 4 (TLR4) variant is associated with asthma severity

    PubMed Central

    Zhang, Long; Xu, Ai-Guo; Zhao, Wei; Xu, Qin-Fu; Zhao, Yu-Miao; Li, Dan-Dan; Shi, Xiao-Ya; Zhao, Jun-Jie

    2015-01-01

    Asthma is a complex airways disease resulting from the input of both biological and environmental factors. Previous studies of single-nucleotide polymorphisms in toll-like receptor 4 (TLR4), which produces a protein involved in regulating T cell populations, have presented conflicting results regarding its role in asthma severity. In the current study, individuals with asthma were genotyped for variants of TLR4, and the genotypes were compared with asthma severity and T cell subpopulations. TLR4 rs11536879 (A>G) and rs1927907 (G>A) genotypes were determined in 350 asthma patients using TaqMan. Asthma severity was graded by clinical symptoms, and blood markers and lung function measures were also collected. T cell subpopulations were identified from peripheral blood by flow cytometry. No significant correlations were observed between genotypes at TLR4 rs11536879 or rs1927907 and eosinophil counts, total serum IgE, serum hypersensitive C-reactive protein, forced expiratory volume in 1 second (FEV1%), or FEV1/forced vital capacity (FVC) in asthma patients (P > 0.05). However, the GG genotype of rs1927907 was correlated with higher asthma severity (P < 0.05). No associations were detected between genotypes at rs11536879 or rs1927907 and CD4+CD25high regulatory T cell counts in peripheral blood from asthmatic patients (P > 0.05), but the rs1927907 genotype was associated with TLR4 expression on the surface of CD4+CD25high regulatory T cells (P < 0.05). Therefore, the TLR4 variant rs1927907 appears to be related to asthma severity and TLR4 expression on the surface of CD4+CD25high regulatory T cells, suggesting the potential influence of TLR4 on T cell population balances. PMID:26221339

  18. Role of Toll-like receptor (TLR) 2 in experimental Bacillus cereus endophthalmitis.

    PubMed

    Novosad, Billy D; Astley, Roger A; Callegan, Michelle C

    2011-01-01

    Bacillus cereus causes a uniquely rapid and blinding intraocular infection, endophthalmitis. B. cereus replicates in the eye, synthesizes numerous toxins, and incites explosive intraocular inflammation. The mechanisms involved in the rapid and explosive intraocular immune response have not been addressed. Because Toll-like receptors (TLRs) are integral to the initial recognition of organisms during infection, we hypothesized that the uniquely explosive immune response observed during B. cereus endophthalmitis is directly influenced by the presence of TLR2, a known gram-positive pathogen recognition receptor. To address this hypothesis, we compared the courses of experimental B. cereus endophthalmitis in wild type C57BL/6J mice to that of age-matched homozygous TLR2(-/-) mice. Output parameters included analysis of bacterial growth, inflammatory cell (PMN) infiltration, cytokine/chemokine kinetics, retinal function testing, and histology, with N≥4 eyes/assay/time point/mouse strain. B. cereus grew at similar rates to10(8) CFU/eye by 12 h, regardless of the mouse strain. Retinal function was preserved to a greater degree in infected TLR2(-/-) eyes compared to that of infected wild type eyes, but infected eyes of both mouse strains lost significant function. Retinal architecture was preserved in infected TLR2(-/-) eyes, with limited retinal and vitreal cellular infiltration compared to that of infected wild type eyes. Ocular myeloperoxidase activities corroborated these results. In general, TNFα, IFNγ, IL6, and KC were detected in greater concentrations in infected wild type eyes than in infected TLR2(-/-) eyes. The absence of TLR2 resulted in decreased intraocular proinflammatory cytokine/chemokine levels and altered recruitment of inflammatory cells into the eye, resulting in less intraocular inflammation and preservation of retinal architecture, and a slightly greater degree of retinal function. These results demonstrate TLR2 is an important component of the

  19. Role of Toll-Like Receptor (TLR) 2 in Experimental Bacillus cereus Endophthalmitis

    PubMed Central

    Novosad, Billy D.; Astley, Roger A.; Callegan, Michelle C.

    2011-01-01

    Bacillus cereus causes a uniquely rapid and blinding intraocular infection, endophthalmitis. B. cereus replicates in the eye, synthesizes numerous toxins, and incites explosive intraocular inflammation. The mechanisms involved in the rapid and explosive intraocular immune response have not been addressed. Because Toll-like receptors (TLRs) are integral to the initial recognition of organisms during infection, we hypothesized that the uniquely explosive immune response observed during B. cereus endophthalmitis is directly influenced by the presence of TLR2, a known Gram-positive pathogen recognition receptor. To address this hypothesis, we compared the courses of experimental B. cereus endophthalmitis in wild type C57BL/6J mice to that of age-matched homozygous TLR2-/- mice. Output parameters included analysis of bacterial growth, inflammatory cell (PMN) infiltration, cytokine/chemokine kinetics, retinal function testing, and histology, with N≥4 eyes/assay/time point/mouse strain. B. cereus grew at similar rates to108 CFU/eye by 12 h, regardless of the mouse strain. Retinal function was preserved to a greater degree in infected TLR2-/- eyes compared to that of infected wild type eyes, but infected eyes of both mouse strains lost significant function. Retinal architecture was preserved in infected TLR2-/- eyes, with limited retinal and vitreal cellular infiltration compared to that of infected wild type eyes. Ocular myeloperoxidase activities corroborated these results. In general, TNFα, IFNγ, IL6, and KC were detected in greater concentrations in infected wild type eyes than in infected TLR2-/- eyes. The absence of TLR2 resulted in decreased intraocular proinflammatory cytokine/chemokine levels and altered recruitment of inflammatory cells into the eye, resulting in less intraocular inflammation and preservation of retinal architecture, and a slightly greater degree of retinal function. These results demonstrate TLR2 is an important component of the initial

  20. [The role of TLR4 receptor in the stress response of lymphocytes].

    PubMed

    Novoselova, E G; Khrenov, M O; Cherenkov, D A; Glushkova, O V; Novoselova, T V; Lunin, S M; Lysenko, E A; Fesenko, E E

    2008-01-01

    In vitro effects of low-level electromagnetic waves (8.18 GHz, frequency swings within 1 s, intensity 1 microW/cm, exposure for 1 h) and low-energy laser light (He-Ne laser with 632.8 nm, 0.2 mW/cm, dose 1.2 x 10(-2) J/cm2) on the expression of receptor protein TLR4, which is known as a part of the system for microbal toxin recognition, were studied in mouse lymphocytes. In addition, TLR4 expression was examined in situations when stress responses to low-level nonionizing radiation were modified by the antibiotic geldanamycin, which suppresses the activity of the heat shock protein Hsp90. It was found that low-level microwaves significantly raised the amount of TLR4; in contrast, laser light decreased the expression of the receptor in lymphocytes. In cells pretreated with geldanamycin, the TLR4 expression in irradiated cells was reduced to minimum levels, much lower than control values. The results showed that TLR4, which is involved in specific binding of toxin from gram-negative bacteria, can regulate cell responses to signals of other origin, in particular to nonionizig radiation, including low-level microwaves and laser light.

  1. Toll-like receptor 2 (TLR2) mediates intracellular signalling in human keratinocytes in response to Malassezia furfur.

    PubMed

    Baroni, Adone; Orlando, Manuela; Donnarumma, Giovanna; Farro, Pietro; Iovene, Maria Rosaria; Tufano, Maria Antonietta; Buommino, Elisabetta

    2006-01-01

    Toll-like receptors (TLRs) are crucial players in the innate immune response to microbial invaders. The lipophilic yeast Malassezia furfur has been implicated in the triggering of scalp lesions in psoriasis. The aim of the present study was to assess the role of TLRs in the defence against M. furfur infection. The expression of the myeloid differentiation factor 88 (MyD88) gene, which is involved in the signalling pathway of many TLRs, was also analysed. In addition, a possible correlation of antimicrobial peptides of the beta-defensin family to TLRs was tested. Human keratinocytes infected with M. furfur and a variety of M. furfur-positive psoriatic skin biopsies were analysed by RT-PCR, for TLRs, MyD88, human beta-defensin 2 (HBD-2), HBD-3 and interleukin-8 (IL-8) mRNA expression. When keratinocytes were infected with M. furfur, an up-regulation for TLR2, MyD88, HBD-2, HBD-3 and IL-8 mRNA was demonstrated, compared to the untreated cells. The same results were obtained when psoriatic skin biopsies were analysed. The M. furfur-induced increase in HBD-2 and IL-8 gene expression is inhibited by anti-TLR2 neutralising antibodies, suggesting that TLR2 is involved in the M. furfur-induced expression of these molecules. These findings suggest the importance of TLRs in skin protection against fungi and the importance of keratinocytes as a component of innate immunity.

  2. Localization of type I interferon receptor limits interferon-induced TLR-3 in epithelial cells

    EPA Science Inventory

    This study aimed to expand on the role of type I IFNs in the influenza-induced upregulation of TLR3 and determine whether and how the localization of the IFN-alpha/beta receptor (IFNAR) in respiratory epithelial cells could modify IFN-induced responses. Using differentiated prima...

  3. Influence of age, sex and rearing systems on Toll-like receptor 7 (TLR7) expression pattern in gut, lung and lymphoid tissues of indigenous ducks.

    PubMed

    Kolluri, Gautham; Ramamurthy, N; Churchil, R R; Dhinakar Raj, G; Kannaki, T R

    2014-02-01

    Abstract 1. The objective of the experiment was to determine the influence of age, sex and rearing system on Toll-like receptor 7 (TLR7) gene expression in gut, lung and lymphoid tissues and physiological responses to stress in male and female indigenous ducks of Tamil Nadu, India. 2. A total of 36 ducks (12 males and 24 females) were obtained from local farmers and tissue samples of gut tissues (duodenum, jejunum, ileum and caecum), lymphoid organs (spleen and bursa) and lungs were collected in RNAlater solution followed by RNA extraction. 3. After normalisation to β-actin (endogenous control) qPCR analysis identified a significant effect of age, sex and rearing system on TLR7 expression in the ducks. 4. A significant up-regulation of TLR7 expression was observed in lungs, duodenum, jejunum, ileum and caecum of sexually mature (45 wk) compared with that of immature ducks (16 wk). Among sexes, male ducks had significantly higher TLR7 expression than female ducks. 5. Age and sex interactions were significant in lungs, duodenum, jejunum and caecum. Ducks reared in an extensive housing system showed significantly higher TLR7 expression in bursa, lungs, duodenum, ileum and caecum compared to intensively reared ducks. There were no effects of age, sex and rearing systems on TLR7 expression in the spleen. 6. The heterophil-to-lymphocyte ratio and serum corticosterone were higher in ducks reared on an intensive system compared with ducks from an extensive rearing system.

  4. Discovery and Validation of a New Class of Small Molecule Toll-Like Receptor 4 (TLR4) Inhibitors

    PubMed Central

    Neal, Matthew D.; Jia, Hongpeng; Eyer, Benjamin; Good, Misty; Guerriero, Christopher J.; Sodhi, Chhinder P.; Afrazi, Amin; Prindle, Thomas; Ma, Congrong; Branca, Maria; Ozolek, John; Brodsky, Jeffrey L.; Wipf, Peter; Hackam, David J.

    2013-01-01

    Many inflammatory diseases may be linked to pathologically elevated signaling via the receptor for lipopolysaccharide (LPS), toll-like receptor 4 (TLR4). There has thus been great interest in the discovery of TLR4 inhibitors as potential anti-inflammatory agents. Recently, the structure of TLR4 bound to the inhibitor E5564 was solved, raising the possibility that novel TLR4 inhibitors that target the E5564-binding domain could be designed. We utilized a similarity search algorithm in conjunction with a limited screening approach of small molecule libraries to identify compounds that bind to the E5564 site and inhibit TLR4. Our lead compound, C34, is a 2-acetamidopyranoside (MW 389) with the formula C17H27NO9, which inhibited TLR4 in enterocytes and macrophages in vitro, and reduced systemic inflammation in mouse models of endotoxemia and necrotizing enterocolitis. Molecular docking of C34 to the hydrophobic internal pocket of the TLR4 co-receptor MD-2 demonstrated a tight fit, embedding the pyran ring deep inside the pocket. Strikingly, C34 inhibited LPS signaling ex-vivo in human ileum that was resected from infants with necrotizing enterocolitis. These findings identify C34 and the β-anomeric cyclohexyl analog C35 as novel leads for small molecule TLR4 inhibitors that have potential therapeutic benefit for TLR4-mediated inflammatory diseases. PMID:23776545

  5. Synergistic Induction of Interferon α through TLR-3 and TLR-9 Agonists Identifies CD21 as Interferon α Receptor for the B Cell Response

    PubMed Central

    Kim, Dhohyung; Niewiesk, Stefan

    2013-01-01

    Maternal antibodies inhibit seroconversion and the generation of measles virus (MeV)-specific antibodies (both neutralizing and non-neutralizing antibodies) after vaccination whereas T cell responses are usually unaffected. The lack of seroconversion leaves individuals susceptible to vaccine-preventable infections. Inhibition of antibody secretion is due to the inhibition of B cells through a cross-link of the B cell receptor with the inhibitory FcγIIB receptor (CD32) by maternal antibody/vaccine complexes. Here, we demonstrate that a combination of TLR-3 and TLR-9 agonists induces synergistically higher levels of type I interferon in vitro and in vivo than either agonist alone. The synergistic action of TLR-3 and TLR-9 agonists is based on a feedback loop through the interferon receptor. Finally, we have identified CD21 as a potential receptor for interferon α on B cells which contributes to interferon α-mediated activation of B cells in the presence of maternal antibodies. The combination leads to complete restoration of B cell and antibody responses after immunization in the presence of inhibitory MeV-specific IgG. The strong stimulatory action of type I interferon is due to the fact that type I interferon uses not only the interferon receptor but also CD21 as a functional receptor for B cell activation. PMID:23516365

  6. Genetic drift outweighs natural selection at toll-like receptor (TLR) immunity loci in a re-introduced population of a threatened species.

    PubMed

    Grueber, Catherine E; Wallis, Graham P; Jamieson, Ian G

    2013-09-01

    During population establishment, genetic drift can be the key driver of changes in genetic diversity, particularly while the population is small. However, natural selection can also play a role in shaping diversity at functionally important loci. We used a well-studied, re-introduced population of the threatened Stewart Island robin (N = 722 pedigreed individuals) to determine whether selection shaped genetic diversity at innate immunity toll-like receptor (TLR) genes, over a 9-year period of population growth following establishment with 12 genetic founders. We found no evidence for selection operating with respect to TLR diversity on first-year overwinter survival for the majority of loci, genotypes and alleles studied. However, survival of individuals with TLR4BE genotype was significantly improved: these birds were less than half as likely to die prior to maturity compared with all other TLR4 genotypes. Furthermore, the population frequency of this genotype, at a two-fold excess over Hardy-Weinberg expectation, was increased by nonrandom mating. Near-complete sampling and full pedigree and reproductive data enabled us to eliminate other potential causes of these patterns including inbreeding, year effects, density dependence, selection on animals at earlier life history stages or genome-level association of the TLR4E allele with 'good genes'. However, comparison of observed levels of gene diversity to predictions under simulated genetic drift revealed results consistent with neutral expectations for all loci, including TLR4. Although selection favoured TLR4BE heterozygotes in this population, these effects were insufficient to outweigh genetic drift. This is the first empirical study to show that genetic drift can overwhelm natural selection in a wild population immediately following establishment.

  7. Diversity in the Toll-like receptor genes of the Tasmanian devil (Sarcophilus harrisii).

    PubMed

    Cui, Jian; Cheng, Yuanyuan; Belov, Katherine

    2015-03-01

    The Tasmanian devil is an endangered marsupial species that has survived several historical bottlenecks and now has low genetic diversity. Here we characterize the Toll-like receptor (TLR) genes and their diversity in the Tasmanian devil. TLRs are a key innate immune gene family found in all animals. Ten TLR genes were identified in the Tasmanian devil genome. Unusually low levels of diversity were found in 25 devils from across Tasmania. We found two alleles at TLR2, TLR3 and TLR6. The other seven genes were monomorphic. The insurance population, which safeguards the species from extinction, has successfully managed to capture all of these TLR alleles, but concerns remain for the long-term survival of this species.

  8. Evolutionary redesign of the Atlantic cod (Gadus morhua L.) Toll-like receptor repertoire by gene losses and expansions.

    PubMed

    Solbakken, Monica H; Tørresen, Ole K; Nederbragt, Alexander J; Seppola, Marit; Gregers, Tone F; Jakobsen, Kjetill S; Jentoft, Sissel

    2016-04-29

    Genome sequencing of the teleost Atlantic cod demonstrated loss of the Major Histocompatibility Complex (MHC) class II, an extreme gene expansion of MHC class I and gene expansions and losses in the innate pattern recognition receptor (PRR) family of Toll-like receptors (TLR). In a comparative genomic setting, using an improved version of the genome, we characterize PRRs in Atlantic cod with emphasis on TLRs demonstrating the loss of TLR1/6, TLR2 and TLR5 and expansion of TLR7, TLR8, TLR9, TLR22 and TLR25. We find that Atlantic cod TLR expansions are strongly influenced by diversifying selection likely to increase the detectable ligand repertoire through neo- and subfunctionalization. Using RNAseq we find that Atlantic cod TLRs display likely tissue or developmental stage-specific expression patterns. In a broader perspective, a comprehensive vertebrate TLR phylogeny reveals that the Atlantic cod TLR repertoire is extreme with regards to losses and expansions compared to other teleosts. In addition we identify a substantial shift in TLR repertoires following the evolutionary transition from an aquatic vertebrate (fish) to a terrestrial (tetrapod) life style. Collectively, our findings provide new insight into the function and evolution of TLRs in Atlantic cod as well as the evolutionary history of vertebrate innate immunity.

  9. Evolutionary redesign of the Atlantic cod (Gadus morhua L.) Toll-like receptor repertoire by gene losses and expansions

    PubMed Central

    Solbakken, Monica H.; Tørresen, Ole K.; Nederbragt, Alexander J.; Seppola, Marit; Gregers, Tone F.; Jakobsen, Kjetill S.; Jentoft, Sissel

    2016-01-01

    Genome sequencing of the teleost Atlantic cod demonstrated loss of the Major Histocompatibility Complex (MHC) class II, an extreme gene expansion of MHC class I and gene expansions and losses in the innate pattern recognition receptor (PRR) family of Toll-like receptors (TLR). In a comparative genomic setting, using an improved version of the genome, we characterize PRRs in Atlantic cod with emphasis on TLRs demonstrating the loss of TLR1/6, TLR2 and TLR5 and expansion of TLR7, TLR8, TLR9, TLR22 and TLR25. We find that Atlantic cod TLR expansions are strongly influenced by diversifying selection likely to increase the detectable ligand repertoire through neo- and subfunctionalization. Using RNAseq we find that Atlantic cod TLRs display likely tissue or developmental stage-specific expression patterns. In a broader perspective, a comprehensive vertebrate TLR phylogeny reveals that the Atlantic cod TLR repertoire is extreme with regards to losses and expansions compared to other teleosts. In addition we identify a substantial shift in TLR repertoires following the evolutionary transition from an aquatic vertebrate (fish) to a terrestrial (tetrapod) life style. Collectively, our findings provide new insight into the function and evolution of TLRs in Atlantic cod as well as the evolutionary history of vertebrate innate immunity. PMID:27126702

  10. Genetic predisposition of variants in TLR2 and its co-receptors to severe malaria in Odisha, India.

    PubMed

    Panigrahi, Subhendu; Kar, Avishek; Tripathy, Sagnika; Mohapatra, Manoj K; Dhangadamajhi, Gunanidhi

    2016-02-01

    Although the role of TLRs signalling in malaria pathogenesis is well established, contribution of individual TLR to clinical outcome of malaria still remains inconclusive. Given the importance of TLR2 and its co-receptors in recognising distinct structural forms of key malaria toxins and mediating innate immune response, it is essential to delineate their genetic contribution. Variants in TLR1 (I602S) and TLR6 (P249S) were genotyped by PCR-RFLP methods, and TLR2 (I/D) was genotyped by PCR in 200 samples each from uncomplicated malaria (UM) and severe malaria (SM). Further, SM was categorised into its sub-clinical groups (CM and NCSM or SOD and MODS) and analysed. The results showed the PP genotype of TLR6 (P249S) to be significantly more common in UM (P < 0.0001), whereas the 'SS' genotype was the risk factor for SM including its sub-clinical categories. The TLR1 (602S) and TLR2 (D) variants were significantly high in patients with CM; however, negative LD was observed between TLR2 and TLR6 in NCSM and MODS. Haplotype analysis showed significantly high frequency of I-I-S haplotype in all forms of subclinical SM and was associated with low parasite load in SM (P = 0.013). The haplotypes I-D-S and S-I-P were significantly high in SOD and CM, respectively. The TLR6 '249S' variant appeared to be the dominant determinant for genetic predisposition to SM and that its association with either TLR2 'D' or TLR1 '602S' modulates for CM development. The present study opens up several new avenues for their exploration and validation in future studies in different global settings for malaria.

  11. Association of TLR5 Gene Polymorphisms in Ulcerative Colitis Patients of North India and Their Role in Cytokine Homeostasis

    PubMed Central

    Meena, Naresh Kumar; Ahuja, Vineet; Meena, Kusumlata; Paul, Jaishree

    2015-01-01

    Background and Aim In health, TLR signaling protects the intestinal epithelial barrier and in disease, aberrant TLR signaling stimulates diverse inflammatory responses. Association of TLR polymorphisms is ethnicity dependent but how they impact the complex pathogenesis of IBD is not clearly defined. So we propose to study the status of polymorphisms in TLR family of genes and their effect on cytokines level in UC patients. Methods The genotypes of the six loci TLR1-R80T, TLR2-R753Q, TLR3-S258G, TLR5-R392X, TLR5-N592S and TLR6-S249P were determined in 350 controls and 328 UC patients by PCR-RFLP and sequencing. Cytokine levels were measured by ELISA in blood plasma samples. Data were analyzed statistically by SPSS software. Results TLR5 variants R392X and N592S showed significant association (p = 0.007, 0.021) with UC patients but TLR 1, 2, 3, 6 variants did not show any association. Unlike other studies carried out in different ethnic groups, TLR 6 (S249P) SNP was universally present in our population irrespective of disease. Genotype-phenotype correlation analysis revealed that the patients having combination of multiple SNPs both in TLR5 and TLR4 gene suffered from severe disease condition and diagnosed at an early age. The level of TNFα (p = 0.004), IL-6 (p = 0.0001) and IFNγ (p = 0.006) significantly increased in patients as compared to controls having wild genotypes for the studied SNPs. However, there was decreased level of TNFα (p = 0.014), IL-6 (p = 0.028) and IFNγ (p = 0.001) in patients carrying TLR5-R392X variant as compared to wild type patients. Patients carrying two simultaneous SNPs D299G in TLR4 gene and N592S in TLR5 gene showed significant decrease in the levels of TNFα (p = 0.011) and IFNγ (p = 0.016). Conclusion Polymorphisms in TLR 5 genes were significantly associated with the UC in North Indian population. The cytokine level was significantly modulated in patients with different genotypes of TLR4 and TLR5 SNPs. PMID:25789623

  12. Suppression of TLR4-mediated inflammatory response by macrophage class A scavenger receptor (CD204)

    SciTech Connect

    Ohnishi, Koji; Komohara, Yoshihiro; Fujiwara, Yukio; Takemura, Kenichi; Lei, XiaoFeng; Nakagawa, Takenobu; Sakashita, Naomi; Takeya, Motohiro

    2011-08-05

    Highlights: {yields} We focused on the interaction between SR-A and TLR4 signaling in this study. {yields} SR-A deletion promoted NF{kappa}B activation in macrophages in septic model mouse. {yields} SR-A suppresses both MyD88-dependent and -independent TLR4 signaling in vitro. {yields} SR-A clears LPS binding to TLR4 which resulting in the suppression of TLR4 signals. -- Abstract: The class A scavenger receptor (SR-A, CD204), one of the principal receptors expressed on macrophages, has been found to regulate inflammatory response and attenuate septic endotoxemia. However, the detailed mechanism of this process has not yet been well characterized. To clarify the regulative mechanisms of lipopolysaccharide (LPS)-induced macrophage activation by SR-A, we evaluated the activation of Toll-like receptor 4 (TLR4)-mediated signaling molecules in SR-A-deficient (SR-A{sup -/-}) macrophages. In a septic shock model, the blood levels of tumor necrosis factor (TNF)-{alpha}, interleukin (IL)-6 and interferon (IFN)-{beta} were significantly increased in SR-A{sup -/-} mice compared to wild-type mice, and elevated nuclear factor kappa B (NF{kappa}B) activation was detected in SR-A{sup -/-} macrophages. SR-A deletion increased the production of pro-inflammatory cytokines, and the phosphorylation of mitogen-activated protein kinase (MAPK) and NF{kappa}B in vitro. SR-A deletion also promoted the nuclear translocation of NF{kappa}B and IFN regulatory factor (IRF)-3. In addition, a competitive binding assay with acetylated low-density lipoprotein, an SR-A-specific ligand, and anti-SR-A antibody induced significant activation of TLR4-mediated signaling molecules in wild-type macrophages but not in SR-A{sup -/-} macrophages. These results suggest that SR-A suppresses the macrophage activation by inhibiting the binding of LPS to TLR4 in a competitive manner and it plays a pivotal role in the regulation of the LPS-induced inflammatory response.

  13. Mapping toll-like receptor signaling pathway genes of Zhikong scallop ( Chlamys farreri) with FISH

    NASA Astrophysics Data System (ADS)

    Zhao, Bosong; Zhao, Liang; Liao, Huan; Cheng, Jie; Lian, Shanshan; Li, Xuan; Huang, Xiaoting; Bao, Zhenmin

    2015-12-01

    Toll-like receptor (TLR) signaling pathway plays a pivotal role in the innate immune system. Studies on TLR signaling pathway genes in Zhikong scallop ( Chlamys farreri) have mainly focused on sequence analysis and expression profiling, no research has been carried out on their localization. The chromosomal position of TLR signaling pathway genes can be valuable for assemblying scallop genome and analysizing gene regulatory networks. In the present study, five key TLR signaling pathway genes ( CfTLR, CfMyd88, CfTRAF6, CfNFκB, and CfIκB) containing bacterial artificial chromosomes (BACs) were isolated and physically mapped through fluorescence in situ hybridization on five non-homologous chromosome pairs, showing a similar distribution to another five model species. The isolation and mapping of these key immune genes of C. farreri will aid to the research on innate immunity, assignment of interested genes to chromosomes, and integration of physical, linkage and cytogenetic maps of this species.

  14. Toll-like receptor 3 (TLR3) plays a major role in the formation of rabies virus Negri Bodies.

    PubMed

    Ménager, Pauline; Roux, Pascal; Mégret, Françoise; Bourgeois, Jean-Pierre; Le Sourd, Anne-Marie; Danckaert, Anne; Lafage, Mireille; Préhaud, Christophe; Lafon, Monique

    2009-02-01

    Human neurons express the innate immune response receptor, Toll-like receptor 3 (TLR3). TLR3 levels are increased in pathological conditions such as brain virus infection. Here, we further investigated the production, cellular localisation, and function of neuronal TLR3 during neuronotropic rabies virus (RABV) infection in human neuronal cells. Following RABV infection, TLR3 is not only present in endosomes, as observed in the absence of infection, but also in detergent-resistant perinuclear inclusion bodies. As well as TLR3, these inclusion bodies contain the viral genome and viral proteins (N and P, but not G). The size and composition of inclusion bodies and the absence of a surrounding membrane, as shown by electron microscopy, suggest they correspond to the previously described Negri Bodies (NBs). NBs are not formed in the absence of TLR3, and TLR3(-/-) mice -- in which brain tissue was less severely infected -- had a better survival rate than WT mice. These observations demonstrate that TLR3 is a major molecule involved in the spatial arrangement of RABV-induced NBs and viral replication. This study shows how viruses can exploit cellular proteins and compartmentalisation for their own benefit.

  15. Polymorphisms at Locus 4p14 of Toll-Like Receptors TLR-1 and TLR-10 Confer Susceptibility to Gastric Carcinoma in Helicobacter pylori Infection

    PubMed Central

    Ravishankar Ram, M.; Goh, Khean Lee; Leow, Alex Hwong Ruey; Poh, Bee Hoon; Loke, Mun Fai; Harrison, Richard; Shankar, Esaki M.; Vadivelu, Jamuna

    2015-01-01

    Helicobacter pylori (H. pylori) -induced gastric inflammation impacts the functions of leptin- and ghrelin-producing cells in the gastroduodenum. Inflammation resulting from H. pylori sensing via Toll-like receptors (TLRs) and the associated downstream signaling largely remain ambiguous. Here, we investigated the role of gut hormones, pro-inflammatory cytokines and single nucleotide polymorphisms (SNPs) associated with TLR 4p14 in H. pylori disease in 30 subjects with non-ulcer dyspepsia (NUD), 40 with peptic ulcer disease (PUD) and 15 with gastric cancer (GC) subjects positive and negative for H. pylori infection. The level of pro-inflammatory cytokines was directly proportional to the severity of gastritis, and disease status influenced the levels of gut hormones and pro-inflammatory cytokines. TLR-1 SNPs rs4833095 and TLR-10 SNPs rs10004195 and were directly associated with H. pylori disease, and were up-regulated in the presence of H. pylori in a genotype-independent manner. We concluded that TLR-1 rs4833095 and TLR10 rs10004195 confer susceptibility to development of gastroduodenal disease, especially GC in H.pylori disease. PMID:26559190

  16. MAP1S Protein Regulates the Phagocytosis of Bacteria and Toll-like Receptor (TLR) Signaling.

    PubMed

    Shi, Ming; Zhang, Yifan; Liu, Leyuan; Zhang, Tingting; Han, Fang; Cleveland, Joseph; Wang, Fen; McKeehan, Wallace L; Li, Yu; Zhang, Dekai

    2016-01-15

    Phagocytosis is a critical cellular process for innate immune defense against microbial infection. The regulation of phagocytosis process is complex and has not been well defined. An intracellular molecule might regulate cell surface-initiated phagocytosis, but the underlying molecular mechanism is poorly understood (1). In this study, we found that microtubule-associated protein 1S (MAP1S), a protein identified recently that is involved in autophagy (2), is expressed primarily in macrophages. MAP1S-deficient macrophages are impaired in the phagocytosis of bacteria. Furthermore, we demonstrate that MAP1S interacts directly with MyD88, a key adaptor of Toll-like receptors (TLRs), upon TLR activation and affects the TLR signaling pathway. Intriguingly, we also observe that, upon TLR activation, MyD88 participates in autophagy processing in a MAP1S-dependent manner by co-localizing with MAP1 light chain 3 (MAP1-LC3 or LC3). Therefore, we reveal that an intracellular autophagy-related molecule of MAP1S controls bacterial phagocytosis through TLR signaling.

  17. X-Chromosome complement and estrogen receptor signaling independently contribute to the enhanced TLR7-mediated IFN-α production of plasmacytoid dendritic cells from women.

    PubMed

    Laffont, Sophie; Rouquié, Nelly; Azar, Pascal; Seillet, Cyril; Plumas, Joël; Aspord, Caroline; Guéry, Jean-Charles

    2014-12-01

    Human plasmacytoid dendritic cells (pDCs) play a major role in innate immunity through the production of type I IFNs after TLR engagement by pathogens. Sex-based differences in the innate function of human pDCs have been established, with pDCs from women exhibiting enhanced TLR7-mediated IFN-α production as compared with pDCs from males. In mice, we recently provided evidence for a role of estrogens as a positive regulator of pDC innate functions through cell-intrinsic estrogen receptor α signaling, but did not exclude a role for other X-linked factors, particularly in human pDCs. In this study, we investigated the respective contribution of X chromosome dosage and sex hormones using a humanized mouse model in which male or female NOD-SCID-β2m(-/-) were transplanted with human progenitor cells purified from either male or female cord blood cells. We showed that, in response to TLR7 ligands, the frequency of IFN-α- and TNF-α-producing pDCs from either sex was greater in female than in male host mice, suggesting a positive role for estrogens. Indeed, blockade of estrogen receptor signaling during pDC development in vitro inhibited TLR7-mediated IFN-α production by human pDCs, which expressed both ESR1 and ESR2 genes. Interestingly, we also found that X chromosome dosage contributed to this sex bias as female pDCs have an enhanced TLR7-mediated IFN-α response as compared with male ones, irrespective of the sex of the recipient mice. Together, these results indicate that female sex hormones, estrogens, and X chromosome complement independently contribute to the enhanced TLR7-mediated IFN-α response of pDCs in women.

  18. Expression and activation of intracellular receptors TLR7, TLR8 and TLR9 in peripheral blood monocytes from HIV-infected patients

    PubMed Central

    Pinzón Herrera, Francisc; Cruz López, Juan J; Vera Gamboa, Ligia del Carmen; Pavía Ruiz, Norma; Santos Rivero, Adrián; Sánchez Lugo, Saulo; Puerto, Fernando

    2013-01-01

    Introduction: TLR´s play a role in host defense in HIV infection recognizing the viral DNA or RNA. Their activation induces a signaling pathway that includes the proteins MyD88, IRAK4, TRAF6 and the transcription factor NF-kBp65. Objective: To determine the expression of TLR7, TLR8 and TLR9, and activation of its signaling pathway in monocytes from patients infected with HIV. Methods. Expression of TLR7, TLR8 and TLR9 was determined in monocytes from HIV-infected patients (n= 13) and control subjects (n= 13), which were activated with specific ligands. The expression of MyD88 and NF-kBp65 were determined by flow cytometry; IRAK4 and TRAF6 were studied by immunoblotting. Results: No statistical difference was found in the expression of TLR7, 8 and 9 in monocytes from patients compared to controls, but we observed the non-significant increased expression of TLR9 in patients. The activation showed no significant difference in the expression of MyD88 and NF-kBp65 in patients when compared to controls, but were decreased in stimulated cells over non-stimulated cells. IRAK4 and TRAF6 were not detected. Conclusions: No statistical difference was observed in the expression of intracellular TLRs, MyD88 and NFkBp65 in monocytes from patients compared to controls. This was probably due to effective antiretroviral therapy being received at the time of study entry. Additional studies are needed under controlled conditions that include infected patients with and without ARVT, responders and non-responders, and work with different cell populations. PMID:24892454

  19. Unique Roles of TLR9- and MyD88-Dependent and -Independent Pathways in Adaptive Immune Responses to AAV-Mediated Gene Transfer.

    PubMed

    Rogers, Geoffrey L; Suzuki, Masataka; Zolotukhin, Irene; Markusic, David M; Morel, Laurence M; Lee, Brendan; Ertl, Hildegund C J; Herzog, Roland W

    2015-01-01

    The immune system represents a significant barrier to successful gene therapy with adeno-associated viral (AAV) vectors. In particular, adaptive immune responses to the viral capsid or the transgene product are of concern. The sensing of AAV by toll-like receptors (TLRs) TLR2 and TLR9 has been suggested to play a role in innate immunity to the virus and may also shape subsequent adaptive immune responses. Here, we investigated the functions of TLR2, TLR9 and the downstream signaling adaptor MyD88 in antibody and CD8+ T-cell responses. Antibody formation against the transgene product occurred largely independently of TLR signaling following gene transfer with AAV1 or AAV2 vectors, whereas loss of signaling through the TLR9-MyD88 pathway substantially reduced CD8+ T-cell responses. In contrast, MyD88 (but neither of the TLRs) regulated antibody responses to capsid. B cell-intrinsic MyD88 was required for the formation of anti-capsid IgG2c independently of vector serotype or route of administration. However, MyD88(-/-) mice instead produced anti-capsid IgG1 that emerged with delayed kinetics but nonetheless completely prevented in vivo readministration. We conclude that there are distinct roles for TLR9 and MyD88 in promoting adaptive immune responses to AAV-mediated gene transfer and that there are redundant MyD88-dependent and MyD88-independent mechanisms that stimulate neutralizing antibody formation against AAV.

  20. Identification, characterization and genetic mapping of the TLR1 gene in rainbow trout (Oncorhynchus mykiss)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Induction of innate immune pathways is critical for early antimicrobial defense but there is limited understanding of how teleosts recognize microbial molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 1 and 2 form a heterodimer involved in recognizing peptidoglycans and l...

  1. Short- and long-term regulation of intestinal Na+/H+ exchange by Toll-like receptors TLR4 and TLR5.

    PubMed

    Cabral, José Miguel; Grácio, Daniela; Soares-da-Silva, Patrício; Magro, Fernando

    2015-10-15

    Inappropriate activation of pattern recognition receptors has been described as a potential trigger in the development of inflammatory bowel disease (IBD). In this study, we evaluated the activity and expression of Na(+)/H(+) exchanger (NHE) subtypes in T84 intestinal epithelial cells during Toll-like receptor 4 (TLR4) activation by monophosphoryl lipid A and TLR5 by flagellin. NHE activity and intracellular pH were evaluated by spectrofluorescence. Additionally, kinase activities were evaluated by ELISA, and siRNA was used to specifically inhibit adenylyl cyclase (AC). Monophosphoryl lipid A (MPLA) (0.01-50.00 μg/ml) and flagellin (10-500 ng/ml) inhibited NHE1 activity in a concentration-dependent manner (MPLA short term -25.2 ± 5.0%, long term -31.9 ± 4.0%; flagellin short term -14.9 ± 2.0%, long term -19.1 ± 2.0%). Both ligands triggered AC3, PKA, PLC, and PKC signal molecules. Long-term exposure to flagellin and MPLA induced opposite changes on NHE3 activity; flagellin increased NHE3 activity (∼10%) with overexpression of membrane protein, whereas MPLA decreased NHE3 activity (-17.3 ± 3.0%). MPLA and flagellin simultaneously had synergistic effects on NHE activity. MPLA and flagellin impaired pHi recovery after intracellular acidification. The simultaneous exposure to MPLA and flagellin induced a substantial pHi reduction (-0.55 ± 0.03 pH units). Activation of TLR4 and TLR5 exerts marked inhibition of NHE1 activity in intestinal epithelial cells. Transduction mechanisms set into motion during TLR4-mediated and long-term TLR5-mediated inhibition of NHE1 activity involve AC3, PKA, PLC, and PKC. However, short- and long-term TLR4 activation and TLR5 activation might use different signaling pathways. The physiological alterations on intestinal epithelial cells described here may be useful in the development of better IBD therapeutics.

  2. Activation of Toll-like Receptor 4 (TLR4) Attenuates Adaptive Thermogenesis via Endoplasmic Reticulum Stress*

    PubMed Central

    Okla, Meshail; Wang, Wei; Kang, Inhae; Pashaj, Anjeza; Carr, Timothy; Chung, Soonkyu

    2015-01-01

    Adaptive thermogenesis is the cellular process transforming chemical energy into heat in response to cold. A decrease in adaptive thermogenesis is a contributing factor to obesity. However, the molecular mechanisms responsible for the compromised adaptive thermogenesis in obese subjects have not yet been elucidated. In this study we hypothesized that Toll-like receptor 4 (TLR4) activation and subsequent inflammatory responses are key regulators to suppress adaptive thermogenesis. To test this hypothesis, C57BL/6 mice were either fed a palmitate-enriched high fat diet or administered with chronic low-dose LPS before cold acclimation. TLR4 stimulation by a high fat diet or LPS were both associated with reduced core body temperature and heat release. Impairment of thermogenic activation was correlated with diminished expression of brown-specific markers and mitochondrial dysfunction in subcutaneous white adipose tissue (sWAT). Defective sWAT browning was concomitant with elevated levels of endoplasmic reticulum (ER) stress and autophagy. Consistently, TLR4 activation by LPS abolished cAMP-induced up-regulation of uncoupling protein 1 (UCP1) in primary human adipocytes, which was reversed by silencing of C/EBP homologous protein (CHOP). Moreover, the inactivation of ER stress by genetic deletion of CHOP or chemical chaperone conferred a resistance to the LPS-induced suppression of adaptive thermogenesis. Collectively, our data indicate the existence of a novel signaling network that links TLR4 activation, ER stress, and mitochondrial dysfunction, thereby antagonizing thermogenic activation of sWAT. Our results also suggest that TLR4/ER stress axis activation may be a responsible mechanism for obesity-mediated defective brown adipose tissue activation. PMID:26370079

  3. The molecular mechanism of species-specific recognition of lipopolysaccharides by the MD-2/TLR4 receptor complex.

    PubMed

    Oblak, Alja; Jerala, Roman

    2015-02-01

    Lipid A, a component of bacterial lipopolysaccharide, is a conserved microbe-associated molecular pattern that activates the MD-2/TLR4 receptor complex. Nevertheless, bacteria produce lipid A molecules of considerable structural diversity. The human MD-2/TLR4 receptor most efficiently recognizes hexaacylated bisphosphorylated lipid A produced by enterobacteria, but in some animal species the immune response can be elicited also by alternative lipid A varieties, such as tetraacylated lipid IVa or pentaacylated lipid A of Rhodobacter spheroides. Several crystal structures revealed that hexaacylated lipid A and tetraacylated lipid IVa activate the murine MD-2/TLR4 in a similar manner, but failed to explain the antagonistic vs. agonistic activity of lipid IVa in the human vs. equine receptor, respectively. Targeted mutagenesis studies of the receptor complex revealed intricate combination of electrostatic and hydrophobic interactions primarily within the MD-2 co-receptor, but with a contribution of TLR4 as well, that contribute to species-specific recognition of lipid A. We will review current knowledge regarding lipid A diversity and species-specific activation of the MD-2/TLR4 receptor complex in different species (e.g. human, mouse or equine) by lipid A varieties.

  4. Histamine promotes the expression of receptors TLR2 and TLR4 and amplifies sensitivity to lipopolysaccharide and lipoteichoic acid treatment in human gingival fibroblasts.

    PubMed

    Gutiérrez-Venegas, Gloria; Cruz-Arrieta, Sandra; Villeda-Navarro, Mónica; Méndez-Mejía, José Antonio

    2011-10-01

    The vasoactive hydrophilic amine histamine is the most important molecule released by mast cells. However, histamine's role in activating intracellular responses in HGFs (human gingival fibroblasts) has not been evaluated to date. In the present study, we investigated the effect of histamine and of Gram-negative [LPS (lipopolysaccharide)] and Gram-positive [LTA (lipoteichoic acid)] bacterial components on the modulation of the inflammatory response of HGFs. We incubated HGFs with histamine to determine whether this hydrophilic amine regulates overexpression of TLR2 (Toll-like receptor 2) and TLR4, which recognize LTA and LPS respectively. Our experiments demonstrated that histamine increases transcription and translation of TLR2 and TLR4. Incubation with LTA or LPS in the presence of histamine markedly increased expression of COX2 (cyclo-oxygenase 2) and synthesis of prostaglandin E2. These results suggest that histamine plays an important role in modulating the innate immune response, and likewise, that LTA and LPS regulate the adaptive immune response. The present study provides information about the regulation and expression of molecules that promote chronic inflammatory processes leading to the emergence of periodontitis and the consequent loss of the dental organ.

  5. TLR4 single nucleotide polymorphisms (SNPs) associated with Salmonella shedding in pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Toll-like receptor 4 (TLR4) is a key factor in the innate immune recognition of lipopolysaccharide (LPS) from Gram-negative bacteria. Previous studies from our group identified differences in the expression profile of TLR4 and genes affected by the TLR4 signaling pathway among pigs that shed varying...

  6. Human decidual macrophages and NK cells differentially express Toll-like receptors and display distinct cytokine profiles upon TLR stimulation

    PubMed Central

    Duriez, Marion; Quillay, Héloïse; Madec, Yoann; El Costa, Hicham; Cannou, Claude; Marlin, Romain; de Truchis, Claire; Rahmati, Mona; Barré-Sinoussi, Françoise; Nugeyre, Marie-Thérèse; Menu, Elisabeth

    2014-01-01

    Maternofetal pathogen transmission is partially controlled at the level of the maternal uterine mucosa at the fetal implantation site (the decidua basalis), where maternal and fetal cells are in close contact. Toll-like receptors (TLRs) may play an important role in initiating rapid immune responses against pathogens in the decidua basalis, however the tolerant microenvironment should be preserved in order to allow fetal development. Here we investigated the expression and functionality of TLRs expressed by decidual macrophages (dMs) and NK cells (dNKs), the major decidual immune cell populations. We report for the first time that both human dMs and dNK cells express mRNAs encoding TLRs 1-9, albeit with a higher expression level in dMs. TLR2, TLR3, and TLR4 protein expression checked by flow cytometry was positive for both dMs and dNK cells. In vitro treatment of primary dMs and dNK cells with specific TLR2, TLR3, TLR4, TLR7/8, and TLR9 agonists enhanced their secretion of pro- and anti-inflammatory cytokines, as well as cytokines and chemokines involved in immune cell crosstalk. Only dNK cells released IFN-γ, whereas only dMs released IL-1β, IL-10, and IL-12. TLR9 activation of dMs resulted in a distinct pattern of cytokine expression compared to the other TLRs. The cytokine profiles expressed by dMs and dNK cells upon TLR activation are compatible with maintenance of the fetotolerant immune environment during initiation of immune responses to pathogens at the maternofetal interface. PMID:25071732

  7. Interaction of Bordetella pertussis filamentous hemagglutinin with human TLR2: identification of the TLR2-binding domain.

    PubMed

    Asgarian-Omran, Hossein; Amirzargar, Ali Akbar; Zeerleder, Sacha; Mahdavi, Marzieh; van Mierlo, Gerard; Solati, Shabnam; Jeddi-Tehrani, Mahmood; Rabbani, Hodjatallah; Aarden, Leucien; Shokri, Fazel

    2015-02-01

    Filamentous hemagglutinin (FHA) is a major adhesion and virulence factor of Bordetella pertussis and also a main component of acellular pertussis vaccines. Interaction of FHA with different receptors on human epithelial and immune cells facilitates entrance and colonization of bacteria as well as immunomodulation of the host immune response. Three overlapping segments of the FHA gene were cloned in a prokaryotic expression vector and the recombinant proteins were purified. These recombinant fragments along with the native FHA protein were employed to assess their potential Toll-like receptor (TLR) stimulatory effects and to localize the TLR binding region. TLR stimulation was monitored by applying HEK293-Blue cell lines cotransfected with TLR2, 4, or 5 and a NF-κB reporter gene. Culture supernatants were checked for secretion of the reporter gene product and IL-8 as indicators of TLR stimulation. Native FHA was found to strongly stimulate TLR2, but not TLR4 or TLR5 transfected cells. Among recombinant FHA fragments only the fragment spanning amino acid residues 1544-1917 was able to exhibit the TLR2 stimulating property of FHA. Interaction of FHA with TLR2 suggests its involvement in induction of the innate immune system against Bordetella pertussis. The TLR2-binding domain of FHA may contribute to immunoprotection against pertussis infection.

  8. Novel Toll/IL-1 Receptor Homologous Region Adaptors Act as Negative Regulators in Amphioxus TLR Signaling.

    PubMed

    Peng, Jian; Tao, Xin; Li, Rui; Hu, Jingru; Ruan, Jie; Wang, Ruihua; Yang, Manyi; Yang, Rirong; Dong, Xiangru; Chen, Shangwu; Xu, Anlong; Yuan, Shaochun

    2015-10-01

    Studies have shown that the basal chordate amphioxus possesses an extraordinarily complex TLR system, including 39 TLRs and at least 40 Toll/IL-1R homologous region (TIR) adaptors. Besides homologs to MyD88 and TIR domain-containing adaptor molecule (TICAM), most amphioxus TIR adaptors exhibit domain architectures that are not observed in other species. To reveal how these novel TIR adaptors function in amphioxus Branchiostoma belcheri tsingtauense (bbt), four representatives, bbtTIRA, bbtTIRB, bbtTIRC, and bbtTIRD, were selected for functional analyses. We found bbtTIRA to show a unique inhibitory role in amphioxus TICAM-mediated pathway by interacting with bbtTICAM and bbt receptor interacting protein 1b, whereas bbtTIRC specifically inhibits the amphioxus MyD88-dependent pathway by interacting with bbtMyD88 and depressing the polyubiquitination of bbt TNFR-associated factor 6. Although both bbtTIRB and bbtTIRD are located on endosomes, the TIR domain of bbtTIRB can interact with bbtMyD88 in the cytosol, whereas the TIR domain of bbtTIRD is enclosed in endosome, suggesting that bbtTIRD may be a redundant gene in amphioxus. This study indicated that most expanded TIR adaptors play nonredundant regulatory roles in amphioxus TLR signaling, adding a new layer to understanding the diversity and complexity of innate immunity at basal chordate.

  9. Post-bronchiolitis wheezing is associated with toll-like receptor 9 rs187084 gene polymorphism

    PubMed Central

    Nuolivirta, Kirsi; Törmänen, Sari; Teräsjärvi, Johanna; Vuononvirta, Juho; Koponen, Petri; Korppi, Matti; Helminen, Merja; Peltola, Ville; He, Qiushui

    2016-01-01

    Innate immunity receptors play a critical role in host defence, as well as in allergy and asthma. The aim of this exploratory study was to evaluate whether there are associations between TLR7 rs179008, TLR8 rs2407992, TLR9 rs187084 or TLR10 rs4129009 polymorphisms and viral findings, clinical characteristics or subsequent wheezing in infants with bronchiolitis. In all, 135 full-term infants were hospitalized for bronchiolitis at age less than 6 months: 129 of them were followed-up until the age of 1.5 years. The outcome measures were repeated wheezing, use of inhaled corticosteroids, atopic dermatitis during the first 1.5 years of life and total serum immunoglobulin E (IgE). There were no significant associations between the genotypes or allele frequencies of TLR7 rs179008, TLR8 rs2407992, TLR9 rs187084 or TLR10 rs4129009 polymorphisms and clinical characteristics or the severity of bronchiolitis during hospitalization. During follow-up, repeated wheezing was more common in children with TLR9 rs187084 variant genotype CC (30.5%) than in children with TLR9 wild-type genotype TT (12.2%) (p = 0.02, aOR 2.73, 95% CI 1.02–7.29). The TLR10 rs4129009 minor allele G was associated with elevated total serum IgE. TLR9 rs187084 gene polymorphism may be associated with post-bronchiolitis wheezing, and TLR10 rs4129009 gene polymorphism may be associated with atopy. PMID:27498757

  10. Retinal Photoreceptor Expresses Toll-Like Receptors (TLRs) and Elicits Innate Responses Following TLR Ligand and Bacterial Challenge

    PubMed Central

    Singh, Pawan Kumar; Kumar, Ashok

    2015-01-01

    Toll-like receptors (TLRs) play an important role in host defense against microbial pathogens. Our previous studies have shown that TLRs are expressed on various retinal cells (Microglia and Müller glia) and orchestrate retinal innate responses in bacterial endophthalmitis. In this study, we used a well-characterized mouse cone photoreceptor cell line (661W); and demonstrated that these cells express all known TLRs. Although the stimulation of 661W cells with TLR ligands (Pam3Cys, PolyI:C, LPS, Flagellin, Poly DT, and ODN) did not alter TLR expression, downstream TLR-signaling pathways (NF-κB, p38, and ERK) are activated. Moreover, TLR-activated 661W cells secreted significant amounts of inflammatory mediators (IL-6, IL-1β, MIP-2, and KC) in their culture supernatant, as assessed by ELISA. A similar trend was observed in 661W cells challenged with live bacteria (Staphylococcus aureus). Interestingly, the neutralization of TLR2, a major receptor for S. aureus recognition, did not significantly attenuate bacterial-induced inflammatory mediators, suggesting the existence of TLR2-independent mechanisms in photoreceptor cells. Together, these results indicate that photoreceptors constitutively express functional TLRs and possess the ability to initiate innate responses following pathogen challenge, implicating their role in retinal innate immunity. PMID:25767877

  11. The role of Toll-like receptor 4 (TLR4) in cardiac ischaemic-reperfusion injury, cardioprotection and preconditioning.

    PubMed

    Lee, Sam Man; Hutchinson, Mark; Saint, David A

    2016-09-01

    Cardiac ischaemic-reperfusion injury (IRI) remains the primary cause of mortality throughout the developed world. Molecular mechanisms underlying IRI are complex and are often interlinked with each other driving a synergistic response. Toll-like receptor 4 (TLR4), an immunosurveillance receptor, is known to enhance tissue injury during IRI by enhancing the inflammatory response. The release of endogenous components during IRI bind onto TLR4 leading to the activation of multiple signalling kinases. Once this event occurs these proteins are defined as danger associated molecular patterns molecules (DAMPs) or alarmins. Examples include heat shock proteins, high mobility group box one (HMGB1) and extracellular matrix proteins, all of which are involved in IRI. However, literature in the last two decades suggests that transient stimulation of TLR4 may suppress IRI and thus improve cardiac recovery. Furthermore, it remains to be seen what role TLR4 plays during ischaemic-preconditioning where acute bouts of ischaemia, preceding a harmful bout of ischaemic-reperfusion, is cardioprotective. The other question which also needs to be considered is that if transient TLR4 signalling drives a preconditioning response then what are the ligands which drive this? Hence the second part of this review explores the possible TLR4 ligands which may promote cardioprotection against IRI.

  12. TLR3 or TLR4 Activation Enhances Mesenchymal Stromal Cell-Mediated Treg Induction via Notch Signaling.

    PubMed

    Rashedi, Iran; Gómez-Aristizábal, Alejandro; Wang, Xing-Hua; Viswanathan, Sowmya; Keating, Armand

    2017-01-01

    Mesenchymal stromal cells (MSCs) are the subject of numerous clinical trials, largely due to their immunomodulatory and tissue regenerative properties. Toll-like receptors (TLRs), especially TLR3 and TLR4, are highly expressed on MSCs and their activation can significantly modulate the immunosuppressive and anti-inflammatory functions of MSCs. While MSCs can recruit and promote the generation of regulatory T cells (Tregs), the effect of TLR activation on MSC-mediated Treg induction is unknown. In this study, we investigated the effect of ligand-mediated activation of TLR3 and TLR4 on Treg induction by human MSCs. We found that generation of Tregs in human CD4(+) lymphocyte and MSC cocultures was enhanced by either TLR3 or TLR4 activation of MSCs and that the increase was abolished by TLR3 and TLR4 gene-silencing. Augmented Treg induction by TLR-activated MSCs was cell contact-dependent and associated with increased gene expression of the Notch ligand, Delta-like 1. Moreover, inhibition of Notch signaling abrogated the augmented Treg levels in the MSC cocultures. Our data show that TLR3 or TLR4 activation of MSCs increases Treg induction via the Notch pathway and suggest new means to enhance the potency of MSCs for treating disorders with an underlying immune dysfunction, including steroid resistant acute graft-versus-host disease. Stem Cells 2017;35:265-275.

  13. Preconditioning of Microglia by α-Synuclein Strongly Affects the Response Induced by Toll-like Receptor (TLR) Stimulation

    PubMed Central

    Gonzalez-Rey, Elena; Lachaud, Christian C.; Guilliams, Tim; Fernandez-Montesinos, Rafael; Benitez-Rondan, Alicia; Robledo, Gema; Hmadcha, Abdelkrim; Delgado, Mario; Dobson, Christopher M.; Pozo, David

    2013-01-01

    In recent years, it has become accepted that α-synuclein (αSyn) has a key role in the microglia-mediated neuroinflammation, which accompanies the development of Parkinson’s disease and other related disorders, such as Dementia with Lewy Bodies and Alzheimer’s disease. Nevertheless, the cellular and molecular mechanisms underlying its pathological actions, especially in the sporadic forms of the diseases, are not completely understood. Intriguingly, several epidemiological and animal model studies have revealed a link between certain microbial infections and the onset or progression of sporadic forms of these neurodegenerative disorders. In this work, we have characterized the effect of toll-like receptor (TLR) stimulation on primary murine microglial cultures and analysed the impact of priming cells with extracellular wild-type (Wt) αSyn on the subsequent TLR stimulation of cells with a set of TLR ligands. By assaying key interleukins and chemokines we report that specific stimuli, in particular Pam3Csk4 (Pam3) and single-stranded RNA40 (ssRNA), can differentially affect the TLR2/1- and TLR7-mediated responses of microglia when pre-conditioned with αSyn by augmenting IL-6, MCP-1/CCL2 or IP-10/CXCL10 secretion levels. Furthermore, we report a skewing of αSyn-primed microglia stimulated with ssRNA (TLR7) or Pam3 (TLR2/1) towards intermediate but at the same time differential, M1/M2 phenotypes. Finally, we show that the levels and intracellular location of activated caspase-3 protein change significantly in αSyn-primed microglia after stimulation with these particular TLR agonists. Overall, we report a remarkable impact of non-aggregated αSyn pre-sensitization of microglia on TLR-mediated immunity, a phenomenon that could contribute to triggering the onset of sporadic α-synuclein-related neuropathologies. PMID:24236103

  14. Structural characterisation of Toll-like receptor 1 (TLR1) and Toll-like receptor 6 (TLR6) in elephant and harbor seals.

    PubMed

    Woodman, Sally; Gibson, Amanda J; García, Ana Rubio; Contreras, Guillermo Sanchez; Rossen, John W; Werling, Dirk; Offord, Victoria

    2016-01-01

    Pinnipeds are a diverse clade of semi-aquatic mammals, which act as key indicators of ecosystem health. Their transition from land to marine environments provides a complex microbial milieu, making them vulnerable to both aquatic and terrestrial pathogens, thereby contributing to pinniped population decline. Indeed, viral pathogens such as influenza A virus and phocine distemper virus (PDV) have been identified as the cause of several of these mass mortality events. Furthermore, bacterial infection with mammalian Brucella sp. and methicillin-resistant Staphylococcus aureus strains have also been observed in marine mammals, posing further risk to both co-habiting endangered species and public health. During these disease outbreaks, mortality rates have varied amongst different pinniped species. Analyses of innate immune receptors at the host-pathogen interface have previously identified variants which may drive these species-specific responses. Through a combination of both sequence- and structure-based methods, this study characterises members of the Toll-like receptor (TLR) 1 superfamily from both harbour and elephant seals, identifying variations which will help us to understand these species-specific innate immune responses, potentially aiding the development of specific vaccine-adjuvants for these species.

  15. Relevance of single-nucleotide polymorphisms in human TLR genes to infectious and inflammatory diseases and cancer.

    PubMed

    Trejo-de la O, A; Hernández-Sancén, P; Maldonado-Bernal, C

    2014-04-01

    Innate and adaptive immune responses in humans have evolved as protective mechanisms against infectious microorganisms. Toll-like receptors (TLRs) have an important role in the recognition of invading microorganisms. TLRs are the first receptors to detect potential pathogens and to initiate the immune response, and they form the crucial link between the innate and adaptive immune responses. TLRs also have an important role in the pathophysiology of infectious and inflammatory diseases. Increasing data suggest that the ability of certain individuals to respond properly to TLR ligands may be impaired by single-nucleotide polymorphisms (SNPs) within TLR genes, resulting in an altered susceptibility to infectious or inflammatory disease that might contribute to the pathogenesis of complex diseases such as cancer. The associations between diseases and SNPs are in the early stage of discovery. Important clinical insights are emerging, and these polymorphisms provide new understanding of common diseases. This review summarizes and discusses the studies that shed light on the relevance of these polymorphisms in human infectious and inflammatory diseases and cancer.

  16. Toll like receptor (TLR)-4 as a regulator of peripheral endogenous opioid-mediated analgesia in inflammation

    PubMed Central

    2014-01-01

    Background Leukocytes containing opioid peptides locally control inflammatory pain. In the early phase of complete Freund’s adjuvant (CFA)-induced hind paw inflammation, formyl peptides (derived e.g. from Mycobacterium butyricum) trigger the release of opioid peptides from neutrophils contributing to tonic basal antinociception. In the later phase we hypothesized that toll-like-receptor-(TLR)-4 activation of monocytes/macrophages triggers opioid peptide release and thereby stimulates peripheral opioid-dependent antinociception. Results In Wistar rats with CFA hind paw inflammation in the later inflammatory phase (48–96 h) systemic leukocyte depletion by cyclophosphamide (CTX) or locally injected naloxone (NLX) further decreased mechanical and thermal nociceptive thresholds. In vitro β-endorphin (β-END) content increased during human monocyte differentiation as well as in anti-inflammatory CD14+CD16- or non-classical M2 macrophages. Monocytes expressing TLR4 dose-dependently released β-END after stimulation with lipopolysaccharide (LPS) dependent on intracellular calcium. Despite TLR4 expression proinflammatory M1 and anti-inflammatory M2 macrophages only secreted opioid peptides in response to ionomycin, a calcium ionophore. Intraplantar injection of LPS as a TLR4 agonist into the inflamed paw elicited an immediate opioid- and dose-dependent antinociception, which was blocked by TAK-242, a small-molecule inhibitor of TLR4, or by peripheral applied NLX. In the later phase LPS lowered mechanical and thermal nociceptive thresholds. Furthermore, local peripheral TLR4 blockade worsened thermal and mechanical nociceptive pain thresholds in CFA inflammation. Conclusion Endogenous opioids from monocytes/macrophages mediate endogenous antinociception in the late phase of inflammation. Peripheral TLR4 stimulation acts as a transient counter-regulatory mechanism for inflammatory pain in vivo, and increases the release of opioid peptides from monocytes in vitro. TLR4

  17. Triggering of TLR7 and TLR8 expressed by human lung cancer cells induces cell survival and chemoresistance

    PubMed Central

    Cherfils-Vicini, Julien; Platonova, Sophia; Gillard, Mélanie; Laurans, Ludivine; Validire, Pierre; Caliandro, Rafaele; Magdeleinat, Pierre; Mami-Chouaib, Fathia; Dieu-Nosjean, Marie-Caroline; Fridman, Wolf-Herman; Damotte, Diane; Sautès-Fridman, Catherine; Cremer, Isabelle

    2010-01-01

    Compelling evidence suggests that inflammation, cell survival, and cancer are linked, with a central role played by NF-κB. Recent studies implicate some TLRs in tumor development based on their ability to facilitate tumor growth; however, to our knowledge, involvement of neither TLR7 nor TLR78 has yet been demonstrated. Here we have demonstrated expression of TLR7 and TLR8, the natural receptors for single-stranded RNA, by tumor cells in human lung cancer in situ and in human lung tumor cell lines. Stimulation with TLR7 or TLR8 agonists led to activated NF-κB, upregulated expression of the antiapoptotic protein Bcl-2, increased tumor cell survival, and chemoresistance. Transcriptional analysis performed on human primary lung tumor cells and TLR7- or TLR8-stimulated human lung tumor cell lines revealed a gene expression signature suggestive of chronic stimulation of tumor cells by TLR ligands in situ. Together, these data emphasize that TLR signaling can directly favor tumor development and further suggest that researchers developing anticancer immunotherapy using TLR7 or TLR8 agonists as adjuvants should take into account the expression of these TLRs in lung tumor cells. PMID:20237413

  18. Functional Effects of Toll-Like Receptor (TLR)3, 7, 9, RIG-I and MDA-5 Stimulation in Nasal Epithelial Cells

    PubMed Central

    Tengroth, Lotta; Millrud, Camilla Rydberg; Kvarnhammar, Anne Månsson; Kumlien Georén, Susanna; Latif, Leith; Cardell, Lars-Olaf

    2014-01-01

    Background The human nasal epithelium is an important physical barrier, and a part of the innate immune defense that protect against pathogens. The epithelial cells recognize microbial components by pattern-recognition receptors (PRRs), and thereby trigger an immune response. Even though TLR3, TLR7, TLR9, RIG-I and MDA-5 are all known to respond to viral stimulation, their potential role in chronic airway inflammation triggered by local cytokine release remains to be established. Methods mRNA and corresponding protein expression of TLR3, TLR7, TLR9, RIG-I and MDA-5 were analyzed in nasal biopsies and various upper airway epithelial cell lines using real-time reverse transcription PCR, immunohistochemistry and flow cytometry. Ligand induced, cytokine release, was evaluated with ELISA. Results Nasal biopsies were found to express TLR3, TLR7, TLR9, RIG-I and MDA-5, with the most abundant expression in the surface epithelium. These receptors were verified in primary human nasal epithelial cell (HNEC) as well as in the airway epithelial cell lines Detroit-562 and FaDu. Poly(I:C) (TLR3) and R-837 (TLR7) stimulation increased secretion of IL-6 and GM-CSF from the nasal mucosa and the epithelial cell lines. CpG (TLR9) stimulation caused release of IL-8 in the nasal mucosa and in FaDu. Poly(I:C)/LyoVec (RIG-I/MDA-5) stimulation activated the secretion of IFN-β in the nasal mucosa. A corresponding release was also detected from HNEC and Detroit-562. Conclusion The nasal epithelium has the ability to recognize viral intrusion through TLR and RLR receptors, and the subsequent response might have a role in exacerbation of inflammatory diseases like allergic rhinitis and chronic rhinosinusitis. PMID:24886842

  19. Variants in toll-like receptor 9 gene influence susceptibility to tuberculosis in a Mexican population

    PubMed Central

    2013-01-01

    Background The control of Mycobacterium tuberculosis (Mtb) infection begins with the recognition of mycobacterial structural components by toll like receptors (TLRs) and other pattern recognition receptors. Our objective was to determine the influence of TLRs polymorphisms in the susceptibility to develop tuberculosis (TB) in Amerindian individuals from a rural area of Oaxaca, Mexico with high TB incidence. Methods We carried out a case–control association community based study, genotyping 12 polymorphisms of TLR2, TLR4, TLR6 and TLR9 genes in 90 patients with confirmed pulmonary TB and 90 unrelated exposed but asymptomatic household contacts. Results We found a significant increase in the frequency of the allele A of the TLR9 gene polymorphism rs352139 (A>G) in the group of TB patients (g.f. = 0.522) when compared with controls (g.f. = 0.383), (Pcorr = 0.01, OR = 1.75). Under the recessive model (A/G + A/A vs G/G) this polymorphism was also significantly associated with TB (Pcorr = 0.01, OR= 2.37). The association of the SNP rs352139 was statistically significant after adjustment by age, gender and comorbidities by regression logistic analysis (Dominant model: p value = 0.016, OR = 2.31; Additive model: p value = 0.023, OR = 1.68). The haplotype GAA of TLR9 SNPs was also associated with TB susceptibility (Pcorr = 0.02). Differences in the genotype or allele frequencies of TLR2, TLR4 and TLR6 polymorphisms between TB patients and healthy contacts were not detected. Conclusions Our study suggests that the allele A of the intronic polymorphism rs352139 on TLR9 gene might contribute to the risk of developing TB in Mexican Amerindians. PMID:24053111

  20. Association of Toll-Like Receptor 4 Gene Polymorphism and Expression with Urinary Tract Infection Types in Adults

    PubMed Central

    Yin, Xiaolin; Hou, Tianwen; Liu, Ying; Chen, Jing; Yao, Zhiyan; Ma, Cuiqing; Yang, Lijuan; Wei, Lin

    2010-01-01

    Background Innate immunity of which Toll-like receptor (TLR) 4 and CXCR1 are key elements plays a central role in the development of urinary tract infection (UTI). Although the relation between the genetics of TLR4 and CXCR1 and UTI is investigated partly, the polymorphisms and expression of TLR4 and CXCR1 in different types of UTI in adults are not extremely clear. Methodology/Principal Findings This study investigates the presence of TLR4 A (896) G and CXCR1 G (2608) C polymorphisms in 129 UTI patients using RFLP-PCR. Gene and allelic prevalence were compared with 248 healthy controls. Flow cytometry was used to detect TLR4 and CXCR1 expression in the monocytes of UTI patients and healthy controls. TLR4 (896) AG genotype and TLR4 (896) G allele had higher prevalence in UTI (especially in acute cystitis and urethritis) patients, whereas CXCR1 (2608) GC genotype and CXCR1 (2608) C allele had lower prevalence in UTI patients than controls. TLR4 expression was significantly lower in chronic UTI patients than in acute pyelonephritis or healthy controls. CXCR1 expression was similar in both controls and patients. TLR4 expression in chronic UTI patients after astragalus treatment was higher than pre-treatment. Conclusions The results indicate the relationship between the carrier status of TLR4 (896) G alleles and the development of UTI, especially acute cystitis and urethritis, in adults. TLR4 expression levels are correlated with chronic UTI. PMID:21151974

  1. Saturated fatty acids activate TLR-mediated proinflammatory signaling pathways.

    PubMed

    Huang, Shurong; Rutkowsky, Jennifer M; Snodgrass, Ryan G; Ono-Moore, Kikumi D; Schneider, Dina A; Newman, John W; Adams, Sean H; Hwang, Daniel H

    2012-09-01

    Toll-like receptor 4 (TLR4) and TLR2 were shown to be activated by saturated fatty acids (SFAs) but inhibited by docosahexaenoic acid (DHA). However, one report suggested that SFA-induced TLR activation in cell culture systems is due to contaminants in BSA used for solubilizing fatty acids. This report raised doubt about proinflammatory effects of SFAs. Our studies herein demonstrate that sodium palmitate (C16:0) or laurate (C12:0) without BSA solubilization induced phosphorylation of inhibitor of nuclear factor-κB α, c-Jun N-terminal kinase (JNK), p44/42 mitogen-activated-kinase (ERK), and nuclear factor-κB subunit p65, and TLR target gene expression in THP1 monocytes or RAW264.7 macrophages, respectively, when cultured in low FBS (0.25%) medium. C12:0 induced NFκB activation through TLR2 dimerized with TLR1 or TLR6, and through TLR4. Because BSA was not used in these experiments, contaminants in BSA have no relevance. Unlike in suspension cells (THP-1), BSA-solubilized C16:0 instead of sodium C16:0 is required to induce TLR target gene expression in adherent cells (RAW264.7). C16:0-BSA transactivated TLR2 dimerized with TLR1 or TLR6 and through TLR4 as seen with C12:0. These results and additional studies with the LPS sequester polymixin B and in MyD88(-/-) macrophages indicated that SFA-induced activation of TLR2 or TLR4 is a fatty acid-specific effect, but not due to contaminants in BSA or fatty acid preparations.

  2. Association of Toll-like receptors 2, 3, and 4 genes polymorphisms with periapical pathosis risk

    PubMed Central

    Özan, Ülkü; Ocak, Zeynep; Özan, Fatih; Oktay, Elif-Aybala; Şahman, Halil; Yikilgan, İhsan; Oruçoğlu, Hasan; Er, Kürşat

    2016-01-01

    Background The aim of this study was to investigate the role of gene variations of Toll-like receptors (TLR) 2, 3, and 4 on genetic susceptibility to periapical pathosis. Material and Methods One hundred patients were included in the study and divided into two groups as follows; Control Group (n=50) that have root canal treatment and no periapical lesion, Patient Group (n=50) that have root canal treatment and periapical lesion. TLR2 Arg753Gln, TLR3 (c.1377C/T) and TLR4 Asp299Gly and Thr399Ile polymorphisms were genotyped by using PCR-RFLP. Genotypical analysis of control and patient groups were investigated to disclose whether there is any association between periapical lesions and gene variations. Results There are no significant statistical differences between control and patient groups according to TLR 2 and 4 gene sequence. On the contrary, CC allele detected 74% for TLR 3 in patient group, and this difference was found to be statistically significant (p < 0.005). Conclusions According to these results, it can be suggested that patients with Toll-like receptor 3 gene polymorphisms could be susceptible to periapical pathosis. Key words:Toll-like receptors, periapical pathosis, endodontics. PMID:27031066

  3. NOD1 Cooperates with TLR2 to Enhance T Cell Receptor-Mediated Activation in CD8 T Cells

    PubMed Central

    Mercier, Blandine C.; Debaud, Anne-Laure; Tomkowiak, Martine; Marvel, Jacqueline; Bonnefoy, Nathalie

    2012-01-01

    Pattern recognition receptors (PRR), like Toll-like receptors (TLR) and NOD-like receptors (NLR), are involved in the detection of microbial infections and tissue damage by cells of the innate immune system. Recently, we and others have demonstrated that TLR2 can additionally function as a costimulatory receptor on CD8 T cells. Here, we establish that the intracytosolic receptor NOD1 is expressed and functional in CD8 T cells. We show that C12-iEDAP, a synthetic ligand for NOD1, has a direct impact on both murine and human CD8 T cells, increasing proliferation and effector functions of cells activated via their T cell receptor (TCR). This effect is dependent on the adaptor molecule RIP2 and is associated with an increased activation of the NF-κB, JNK and p38 signaling pathways. Furthermore, we demonstrate that NOD1 stimulation can cooperate with TLR2 engagement on CD8 T cells to enhance TCR-mediated activation. Altogether our results indicate that NOD1 might function as an alternative costimulatory receptor in CD8 T cells. Our study provides new insights into the function of NLR in T cells and extends to NOD1 the recent concept that PRR stimulation can directly control T cell functions. PMID:22848741

  4. Maximizing the potency of an anti-TLR4 monoclonal antibody by exploiting proximity to Fcγ receptors

    PubMed Central

    Loyau, Jérémy; Malinge, Pauline; Daubeuf, Bruno; Shang, Limin; Elson, Greg; Kosco-Vilbois, Marie; Fischer, Nicolas; Rousseau, François

    2014-01-01

    In order to treat Toll like receptor 4 (TLR4)-mediated diseases, we generated a potent antagonistic antibody directed against human TLR4, Hu 15C1. This antibody's potency can be modulated by engaging not only TLR4 but also Fcγ receptors (FcγR), a mechanism that is driven by avidity and not cell signaling. Here, using various formats of the antibody, we further dissect the relative contributions of the Fv and Fc portions of Hu 15C1, discovering that the relationship to potency of the different antibody arms is not linear. First, as could be anticipated, we observed that Hu 15C1 co-engages up to 3 receptors on the same plasma membrane, i.e., 2 TLR4 molecules (via its variable regions) and either FcγRI or FcγRIIA (via the Fc). The Kd of these interactions are in the nM range (3 nM of the Fv for TLR4 and 47 nM of the Fc for FcγRI). However, unexpectedly, neutralization experiments revealed that, due to the low level of cell surface TLR4 expression, the avidity afforded by engagement through 2 Fv arms was significantly limited. In contrast, the antibody's neutralization capacity increases by 3 logs when able to exploit Fc-FcγR interactions. Taken together, these results demonstrate an unforeseen level of contribution by FcγRs to an antibody's effectiveness when targeting a cell surface protein of relatively low abundance. These findings highlight an exploitable mechanism by which FcγR-bearing cells may be more powerfully targeted, envisioned to be broadly applicable to other reagents aimed at neutralizing cell surface targets on cells co-expressing FcγRs. PMID:25484053

  5. Flagellin acting via TLR5 is the major activator of key signaling pathways leading to NF-κB and proinflammatory gene program activation in intestinal epithelial cells

    PubMed Central

    Tallant, Thomas; Deb, Amitabha; Kar, Niladri; Lupica, Joseph; de Veer, Michael J; DiDonato, Joseph A

    2004-01-01

    Background Infection of intestinal epithelial cells by pathogenic Salmonella leads to activation of signaling cascades that ultimately initiate the proinflammatory gene program. The transcription factor NF-κB is a key regulator/activator of this gene program and is potently activated. We explored the mechanism by which Salmonella activates NF-κB during infection of cultured intestinal epithelial cells and found that flagellin produced by the bacteria and contained on them leads to NF-κB activation in all the cells; invasion of cells by the bacteria is not required to activate NF-κB. Results Purified flagellin activated the mitogen activated protein kinase (MAPK), stress-activated protein kinase (SAPK) and Ikappa B kinase (IKK) signaling pathways that lead to expression of the proinflammatory gene program in a temporal fashion nearly identical to that of infection of intestinal epithelial cells by Salmonella. Flagellin expression was required for Salmonella invasion of host cells and it activated NF-κB via toll-like receptor 5 (TLR5). Surprisingly, a number of cell lines found to be unresponsive to flagellin express TLR5 and expression of exogenous TLR5 in these cells induces NF-κB activity in response to flagellin challenge although not robustly. Conversely, overexpression of dominant-negative TLR5 alleles only partially blocks NF-κB activation by flagellin. These observations are consistent with the possibility of either a very stable TLR5 signaling complex, the existence of a low abundance flagellin co-receptor or required adapter, or both. Conclusion These collective results provide the evidence that flagellin acts as the main determinant of Salmonella mediated NF-κB and proinflammatory signaling and gene activation by this flagellated pathogen. In addition, expression of the fli C gene appears to play an important role in the proper functioning of the TTSS since mutants that fail to express fli C are defective in expressing a subset of Sip proteins and

  6. Dysregulation of toll-like receptor (TLR) 2 expression on monocytes and upregulation of the frequency of T cells expressing TLR2 in patients with chronic hepatitis C virus infection.

    PubMed

    Ronit, Andreas; Salem, Mohammad; Hartling, Hans J; Gaardbo, Julie C; Ullum, Henrik; Gerstoft, Jan; Nielsen, Susanne D

    2013-05-01

    Toll-like receptors (TLRs) initiate inflammatory responses that may play a role in disease progression in patients infected with hepatitis C virus (HCV). TLR2 and TLR4 surface expression were assessed on CD14(+) monocytes, CD4(+) and CD8(+) T cells in treatment naïve patients with chronic HCV infection with fibrosis, without fibrosis, co-infected with human immunodeficiency virus (HIV), and in healthy controls. Increased expression of TLR2 was found on monocytes in HCV-infected patients with fibrosis (p < 0.01), co-infected with HIV (p = 0.03), and possibly in patients without fibrosis (p = 0.07) when compared to controls. TLR2 positive CD4(+) and CD8(+) T cells were upregulated in patients with fibrosis only (p < 0.01). However, expression of TLR2 was not associated with T cell activation. TLR4 expression was similar in patients and healthy controls. In conclusion, TLR2 expression on monocytes and the frequency of T cells expressing TLR2 may contribute to disease progression in chronic HCV infection.

  7. [Nle4, D-Phe7]-α-MSH Inhibits Toll-Like Receptor (TLR)2- and TLR4-Induced Microglial Activation and Promotes a M2-Like Phenotype.

    PubMed

    Carniglia, Lila; Ramírez, Delia; Durand, Daniela; Saba, Julieta; Caruso, Carla; Lasaga, Mercedes

    2016-01-01

    α-melanocyte stimulating hormone (α-MSH) is an anti-inflammatory peptide, proved to be beneficial in many neuroinflammatory disorders acting through melanocortin receptor 4 (MC4R). We previously determined that rat microglial cells express MC4R and that NDP-MSH, an analog of α-MSH, induces PPAR-γ expression and IL-10 release in these cells. Given the great importance of modulation of glial activation in neuroinflammatory disorders, we tested the ability of NDP-MSH to shape microglial phenotype and to modulate Toll-like receptor (TLR)-mediated inflammatory responses. Primary rat cultured microglia were stimulated with NDP-MSH followed by the TLR2 agonist Pam3CSK4 or the TLR4 agonist LPS. NDP-MSH alone induced expression of the M2a/M2c marker Ag1 and reduced expression of the M2b marker Il-4rα and of the LPS receptor Tlr4. Nuclear translocation of NF-κB subunits p65 and c-Rel was induced by LPS and these effects were partially prevented by NDP-MSH. NDP-MSH reduced LPS- and Pam3CSK4-induced TNF-α release but did not affect TLR-induced IL-10 release. Also, NDP-MSH inhibited TLR2-induced HMGB1 translocation from nucleus to cytoplasm and TLR2-induced phagocytic activity. Our data show that NDP-MSH inhibits TLR2- and TLR4-mediated proinflammatory mechanisms and promotes microglial M2-like polarization, supporting melanocortins as useful tools for shaping microglial activation towards an alternative immunomodulatory phenotype.

  8. [Nle4, D-Phe7]-α-MSH Inhibits Toll-Like Receptor (TLR)2- and TLR4-Induced Microglial Activation and Promotes a M2-Like Phenotype

    PubMed Central

    Carniglia, Lila; Ramírez, Delia; Durand, Daniela; Saba, Julieta; Caruso, Carla; Lasaga, Mercedes

    2016-01-01

    α-melanocyte stimulating hormone (α-MSH) is an anti-inflammatory peptide, proved to be beneficial in many neuroinflammatory disorders acting through melanocortin receptor 4 (MC4R). We previously determined that rat microglial cells express MC4R and that NDP-MSH, an analog of α-MSH, induces PPAR-γ expression and IL-10 release in these cells. Given the great importance of modulation of glial activation in neuroinflammatory disorders, we tested the ability of NDP-MSH to shape microglial phenotype and to modulate Toll-like receptor (TLR)-mediated inflammatory responses. Primary rat cultured microglia were stimulated with NDP-MSH followed by the TLR2 agonist Pam3CSK4 or the TLR4 agonist LPS. NDP-MSH alone induced expression of the M2a/M2c marker Ag1 and reduced expression of the M2b marker Il-4rα and of the LPS receptor Tlr4. Nuclear translocation of NF-κB subunits p65 and c-Rel was induced by LPS and these effects were partially prevented by NDP-MSH. NDP-MSH reduced LPS- and Pam3CSK4-induced TNF-α release but did not affect TLR-induced IL-10 release. Also, NDP-MSH inhibited TLR2-induced HMGB1 translocation from nucleus to cytoplasm and TLR2-induced phagocytic activity. Our data show that NDP-MSH inhibits TLR2- and TLR4-mediated proinflammatory mechanisms and promotes microglial M2-like polarization, supporting melanocortins as useful tools for shaping microglial activation towards an alternative immunomodulatory phenotype. PMID:27359332

  9. Recent advances in the role of toll-like receptors and TLR agonists in immunotherapy for human glioma.

    PubMed

    Deng, Shuanglin; Zhu, Shan; Qiao, Yuan; Liu, Yong-Jun; Chen, Wei; Zhao, Gang; Chen, Jingtao

    2014-12-01

    Gliomas are extremely aggressive brain tumors with a very poor prognosis. One of the more promising strategies for the treatment of human gliomas is targeted immunotherapy where antigens that are unique to the tumors are exploited to generate vaccines. The approach, however, is complicated by the fact that human gliomas escape immune surveillance by creating an immune suppressed microenvironment. In order to oppose the glioma imposed immune suppression, molecules and pathways involved in immune cell maturation, expansion, and migration are under intensive clinical investigation as adjuvant therapy. Toll-like receptors (TLRs) mediate many of these functions in immune cell types, and TLR agonists, thus, are currently primary candidate molecules to be used as important adjuvants in a variety of cancers. In animal models for glioma, TLR agonists have exhibited antitumor properties by facilitating antigen presentation and stimulating innate and adaptive immunity. In clinical trials, several TLR agonists have achieved survival benefit, and many more trials are recruiting or ongoing. However, a second complicating factor is that TLRs are also expressed on cancer cells where they can participate instead in a variety of tumor promoting activities including cell growth, proliferation, invasion, migration, and even stem cell maintenance. TLR agonists can, therefore, possibly play dual roles in tumor biology. Here, how TLRs and TLR agonists function in glioma biology and in anti-glioma therapies is summarized in an effort to provide a current picture of the sophisticated relationship of glioma with the immune system and the implications for immunotherapy.

  10. Impact of TLR5 rs5744174 on stroke risk, gene expression and on inflammatory cytokines, and lipid levels in stroke patients.

    PubMed

    Gu, Lian; Huang, Jingyan; Tan, Jinjing; Wei, Qiugui; Jiang, Haiyun; Shen, Tingting; Liang, Baoyun; Tang, Nong

    2016-09-01

    Many studies reported that toll-like receptors (TLRs) played an important role in the process of ischemic stroke (IS). However, the impact of TLR5 rs5744174 on stroke risk, gene expression and on inflammatory cytokines, and lipid levels in ischemic stroke patients has not yet been reported and was therefore the subject of this study. In this case-control study, a total of 816 ischemic stroke patients and 816 healthy controls were genotyped using Sequenom MassArray technology. The mRNA expression of TLR5 was detected through quantitative real-time PCR among 52 ischemic stroke patients. The levels of IL-1b, IL-6, IL-8, and TNFα were measured by ELISA among 62 IS patients. Total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were determined among 816 IS patients using a Hitachi 7600 Automatic Biochemistry Analyzer. Our result showed TLR5 rs5744174 polymorphism was not associated with stroke risk, TLR5 mRNA expression and inflammatory cytokines of IS patients (P > 0.050), but was significantly associated with HDL-C (recessive model: β = - 0.14, 95 % CI: -0.24 to -0.03, P = 0.009). TLR5 rs5744174 polymorphism may have no impact on the stroke risk, gene expression and inflammatory cytokines, but may influence the HDL-C serum level of IS patients in Chinese Han population.

  11. TLR4 and CD14 receptors expressed in rat pineal gland trigger NFKB pathway.

    PubMed

    da Silveira Cruz-Machado, Sanseray; Carvalho-Sousa, Claudia Emanuele; Tamura, Eduardo Koji; Pinato, Luciana; Cecon, Erika; Fernandes, Pedro Augusto Carlos Magno; de Avellar, Maria Christina Werneck; Ferreira, Zulma Silva; Markus, Regina Pekelmann

    2010-09-01

    Nuclear factor-kappa B (NFKB), a pivotal player in inflammatory responses, is constitutively expressed in the pineal gland. Corticosterone inhibits pineal NFKB leading to an enhancement of melatonin production, while tumor necrosis factor (TNF) leads to inhibition of Aa-nat transcription and the production of N-acetylserotonin in cultured glands. The reduction in nocturnal melatonin surge favors the mounting of the inflammatory response. Despite these data, there is no clear evidence of the ability of the pineal gland to recognize molecules that signal infection. This study investigated whether the rat pineal gland expresses receptors for lipopolysaccharide (LPS), the endotoxin from the membranes of Gram-negative bacteria, and to establish the mechanism of action of LPS. Here, we show that pineal glands possess both CD14 and toll-like receptor 4 (TLR4), membrane proteins that bind LPS and trigger the NFKB pathway. LPS induced the nuclear translocation of p50/p50 and p50/RELA dimers and the synthesis of TNF. The maximal expression of TNF in cultured glands coincides with an increase in the expression of TNF receptor 1 (TNFR1) in isolated pinealocytes. In addition, LPS inhibited the synthesis of N-acetylserotonin and melatonin. Therefore, the pineal gland transduces Gram-negative endotoxin stimulation by producing TNF and inhibiting melatonin synthesis. Here, we provide evidence to reinforce the idea of an immune-pineal axis, showing that the pineal gland is a constitutive player in the innate immune response.

  12. A Polysaccharide from the Culinary-Medicinal Mushroom Pholiota nameko (Agaricomycetes) Inhibits the NF-κB Pathway in Dendritic Cells Through the TLR2 Receptor.

    PubMed

    Li, Haiping; Zhao, Pei; Wang, Fengling; Huai, Lihua; Zhu, Ruixuan; Li, Guoliang; Xu, Yufeng

    2016-01-01

    A polysaccharide purified from Pholiota nameko (PNPS-1) was found to have anticancer and anti-inflammatory activity. This study investigated the effect of PNPS-1 on the nuclear factor (NF)-κB signaling pathway of TLR2 small interfering RNA-silenced murine bone marrow-derived dendritic cells (BMDCs) and relevant mechanisms. The expression of messenger RNA of 4 NF-κB-related genes, including MyD88, IKBKB, RelA(p65), and CCL2, was determined by real-time polymerase chain reaction; the expression of the phenotype molecule intercellular adhesion molecule-1 (ICAM-1) by flow cytometry; the protein expression of IKKβ and p65 by Western blot; the production of p65 by enzyme-linked immunosorbent assay; and the expression of p65 by immunocytochemistry. The results showed that TLR2-specific small interfering RNA could effectively inhibit the decrease in the expression of MyD88, IKBKB, CCL2, p65, and ICAM-1 in BMDCs induced by PNPS-1, and thus the transcription inactivation of NF-κB, which obviously suggests that PNPS-1 could downregulate the NF-κB signaling pathway via the TLR2 receptor.

  13. Human Lipopolysaccharide-binding Protein (LBP) and CD14 Independently Deliver Triacylated Lipoproteins to Toll-like Receptor 1 (TLR1) and TLR2 and Enhance Formation of the Ternary Signaling Complex*

    PubMed Central

    Ranoa, Diana Rose E.; Kelley, Stacy L.; Tapping, Richard I.

    2013-01-01

    Bacterial lipoproteins are the most potent microbial agonists for the Toll-like receptor 2 (TLR2) subfamily, and this pattern recognition event induces cellular activation, leading to host immune responses. Triacylated bacterial lipoproteins coordinately bind TLR1 and TLR2, resulting in a stable ternary complex that drives intracellular signaling. The sensitivity of TLR-expressing cells to lipoproteins is greatly enhanced by two lipid-binding serum proteins known as lipopolysaccharide-binding protein (LBP) and soluble CD14 (sCD14); however, the physical mechanism that underlies this increased sensitivity is not known. To address this, we measured the ability of LBP and sCD14 to drive ternary complex formation between soluble extracellular domains of TLR1 and TLR2 and a synthetic triacylated lipopeptide agonist. Importantly, addition of substoichiometric amounts of either LBP or sCD14 significantly enhanced formation of a TLRTLR2 lipopeptide ternary complex as measured by size exclusion chromatography. However, neither LBP nor sCD14 was physically associated with the final ternary complex. Similar results were obtained using outer surface protein A (OspA), a naturally occurring triacylated lipoprotein agonist from Borrelia burgdorferi. Activation studies revealed that either LBP or sCD14 sensitized TLR-expressing cells to nanogram levels of either the synthetic lipopeptide or OspA lipoprotein agonist. Together, our results show that either LBP or sCD14 can drive ternary complex formation and TLR activation by acting as mobile carriers of triacylated lipopeptides or lipoproteins. PMID:23430250

  14. Expression, subcellular localization and cytokinic modulation of Toll-like receptors (TLRs) in normal human keratinocytes: TLR2 up-regulation in psoriatic skin.

    PubMed

    Begon, Edouard; Michel, Laurence; Flageul, Béatrice; Beaudoin, Isabelle; Jean-Louis, Francette; Bachelez, Hervé; Dubertret, Louis; Musette, Philippe

    2007-01-01

    The aim of the research described here was to investigate the expression of Toll-like receptors (TLRs) in normal human keratinocytes, to study its modulation by proinflammatory cytokines, and to characterize the function of the latter within the epidermis. Our results demonstrate that normal human keratinocytes may present an intra-cytoplasmic expression of TLR2, TLR3, and TLR4. Exposure of keratinocytes to IFN-gamma and TNF-alpha increased intra-cytoplasmic expression and led to partial translocation at the cell surface. Keratinocyte activation by TLR2, TLR3, and TLR4 ligands led to the nuclear translocation of NF-kappab and the release of proinflammatory cytokines TNF-alpha and IL-8. In immunochemistry analysis, psoriatic skin showed a strong over-expression of TLR2 in the epidermis compared with normal skin. Our results thus demonstrate large TLR expression in keratinocytes and the functionality of TLRs 2, 3, and 4. TLR2 over-expression in psoriatic skin provides new insights into TLR implication in the pathogenesis of psoriasis, through inappropriate stimulation by infectious or endogen ligands.

  15. Analysis of the Toll-Like Receptor 2-2 (TLR2-2) and TLR4 mRNA Expression in the Intestinal Mucosal Immunity of Broilers Fed on Diets Supplemented with Nickel Chloride

    PubMed Central

    Wu, Bangyuan; Cui, Hengmin; Peng, Xi; Fang, Jing; Zuo, Zhicai; Deng, Junliang; Huang, Jianying

    2014-01-01

    Toll-like receptor (TLRs) are important innate immune receptors, and TLR2 and TLR4 play an important role in intestinal mucosal innate immunity. It has been found that nickel (Ni) can affect the immune system in broilers. The purpose of this study was to analyze changes in TLR2-2 and TLR4 mRNA expression levels in the intestinal mucosal immunity system of broilers induced by dietary nickel chloride (NiCl2) using quantitative real-time polymerase chain reaction (qRT-PCR) assays. Two hundred and forty one-day-old avian broilers were divided into four groups and fed on a corn-soybean basal diet as control diet or the same basal diet supplemented with 300, 600 and 900 mg/kg of NiCl2 for 42 days. Results showed that the TLR2-2 and TLR4 mRNA expression levels in the intestinal mucosa and the cecal tonsil were lower (p < 0.05 or p < 0.01) in the 300, 600 and 900 mg/kg groups than those in the control group. It was concluded that dietary NiCl2 in excess of 300 mg/kg could reduce TLR2-2 and TLR4 mRNA expression levels in the intestinal mucosa and cecal tonsil in broilers, implying that the innate immunity in intestinal mucosal immune system could be impaired by pathways involving injured surface epithelium cells or/and the inhibition of the TLR signal transduction. PMID:24394214

  16. Single nucleotide polymorphisms in toll-like receptor genes and case-control association studies with bovine tuberculosis

    PubMed Central

    Bhaladhare, Ashish; Sharma, Deepak; Kumar, Amit; Sonwane, Arvind; Chauhan, Anuj; Singh, Ranvir; Kumar, Pushpendra; Yadav, Ramji; Baqir, Mohd; Bhushan, Bharat; Prakash, Om

    2016-01-01

    Aim: Toll-like receptor 2 (TLR2) and TLR4 genes play critical roles in host recognition of Mycobacterium bovis infection and initiation of innate and adaptive immune response. The present study was aimed at exploring the association of seven single nucleotide polymorphisms (SNPs) in TLR2 and TLR4 genes with susceptibility/resistance against bovine tuberculosis (bTB) infection in cattle. Materials and Methods: A case-control resource population of 35 positive and 45 negative animals was developed after screening with single intradermal tuberculin test for bTB. Resource population was screened for SNPs in TLR2 and TLR4 genes using polymerase chain reaction-restriction fragment length polymorphism. The PROC LOGISTIC procedure of SAS 9.3 was used to find an association of allelic and genotypic frequencies with bTB. Results: In TLR2 gene, two of SNPs under study (rs55617172 and rs68268253) revealed polymorphism while in the case of TLR4 gene all four SNPs under investigation (rs8193041, rs207836014, rs8193060, and rs8193069) were found to be polymorphic in case-control population. SNP locus rs55617172 in TLR2 gene was found significantly (p<0.01) associated with susceptibility/resistance to TB in cattle. Conclusion: These findings indicate the presence of SNPs in TLR2 and TLR4 genes in our resource population. Upon validation in independent, large resource population and following biological characterization, SNP rs55617172 can be incorporated in marker panel for selection of animals with greater resistance to bTB. PMID:27284220

  17. Combined Tlr2 and Tlr4 Deficiency Increases Radiation-Induced Pulmonary Fibrosis in Mice

    SciTech Connect

    Paun, Alexandra; Fox, Jessica; Balloy, Viviane; Chignard, Michel; Qureshi, Salman T.; Haston, Christina K.

    2010-07-15

    Purpose: To determine whether Toll-like receptor 2 or 4 genotype alters the lung response to irradiation in C57BL/6 mice using a model developing a phenotype that resembles radiotherapy-induced fibrosis in both histological characteristics and onset post-treatment. Methods and Materials: The pulmonary phenotype of C57BL/6 mice deficient in each or both of these genes was assessed after an 18-Gy single dose to the thoracic cavity by survival time postirradiation, bronchoalveolar lavage cell differential, histological evidence of alveolitis and fibrosis, and gene expression levels, and compared with that of wild-type mice. Results: The lung phenotype of Tlr4-deficient and Tlr2-deficient mice did not differ from that of wild-type mice in terms of survival time postirradiation, or by histological evidence of alveolitis or fibrosis. In contrast, mice deficient in both receptors developed respiratory distress at an earlier time than did wild-type mice and presented an enhanced fibrotic response (13.5% vs. 5.8% of the lung by image analysis of histological sections, p < 0.001). No differences in bronchoalveolar cell differential counts, nor in numbers of apoptotic cells in the lung as detected through active caspase-3 staining, were evident among the irradiated mice grouped by Tlr genotype. Gene expression analysis of lung tissue revealed that Tlr2,4-deficient mice have increased levels of hyaluronidase 2 compared with both wild-type mice and mice lacking either Tlr2 or Tlr4. Conclusion: We conclude that a combined deficiency in both Tlr2 and Tlr4, but not Tlr2 or Tlr4 alone, leads to enhanced radiation-induced fibrosis in the C57BL/6 mouse model.

  18. Blockade of Toll-Like Receptors (TLR2, TLR4) Attenuates Pain and Potentiates Buprenorphine Analgesia in a Rat Neuropathic Pain Model

    PubMed Central

    Jurga, Agnieszka M.; Rojewska, Ewelina; Makuch, Wioletta; Pilat, Dominika; Przewlocka, Barbara

    2016-01-01

    Accumulating evidence indicates that microglial TLR2 and TLR4 play a significant role in nociception. Experiments were conducted to evaluate the contribution of TLR2 and TLR4 and their adaptor molecules to neuropathy and their ability to amplify opioid effectiveness. Behavioral tests (von Frey's and cold plate) and biochemical (Western blot and qRT-PCR) analysis of spinal cord and DRG tissue were conducted after chronic constriction injury (CCI) to the sciatic nerve. Repeated intrathecal administration of LPS-RS (TLR2 and TLR4 antagonist) and LPS-RS Ultrapure (TLR4 antagonist) attenuated allodynia and hyperalgesia. Biochemical analysis revealed time-dependent upregulation of mRNA and/or protein levels of TLR2 and TLR4 and MyD88 and TRIF adaptor molecules, which was paralleled by an increase in IBA-1/CD40-positive cells under neuropathy. LPS-RS and LPS-RS Ultrapure similarly influenced opioid analgesia by enhancing the effectiveness of buprenorphine but not morphine. Summing up, in light of their upregulation over the course of pain, both TLR2 and TLR4 may indeed play a significant role in neuropathy, which could be linked to the observed activation of IBA-1/CD40-positive cells. Blockade of TLR2 and TLR4 produced analgesia and enhanced buprenorphine's effectiveness, which suggests that they may be a putative target for future pharmacological pain relief tools, especially for opioid rotation, when the effect of morphine is tolerated. PMID:26962463

  19. Blockade of Toll-Like Receptors (TLR2, TLR4) Attenuates Pain and Potentiates Buprenorphine Analgesia in a Rat Neuropathic Pain Model.

    PubMed

    Jurga, Agnieszka M; Rojewska, Ewelina; Piotrowska, Anna; Makuch, Wioletta; Pilat, Dominika; Przewlocka, Barbara; Mika, Joanna

    2016-01-01

    Accumulating evidence indicates that microglial TLR2 and TLR4 play a significant role in nociception. Experiments were conducted to evaluate the contribution of TLR2 and TLR4 and their adaptor molecules to neuropathy and their ability to amplify opioid effectiveness. Behavioral tests (von Frey's and cold plate) and biochemical (Western blot and qRT-PCR) analysis of spinal cord and DRG tissue were conducted after chronic constriction injury (CCI) to the sciatic nerve. Repeated intrathecal administration of LPS-RS (TLR2 and TLR4 antagonist) and LPS-RS Ultrapure (TLR4 antagonist) attenuated allodynia and hyperalgesia. Biochemical analysis revealed time-dependent upregulation of mRNA and/or protein levels of TLR2 and TLR4 and MyD88 and TRIF adaptor molecules, which was paralleled by an increase in IBA-1/CD40-positive cells under neuropathy. LPS-RS and LPS-RS Ultrapure similarly influenced opioid analgesia by enhancing the effectiveness of buprenorphine but not morphine. Summing up, in light of their upregulation over the course of pain, both TLR2 and TLR4 may indeed play a significant role in neuropathy, which could be linked to the observed activation of IBA-1/CD40-positive cells. Blockade of TLR2 and TLR4 produced analgesia and enhanced buprenorphine's effectiveness, which suggests that they may be a putative target for future pharmacological pain relief tools, especially for opioid rotation, when the effect of morphine is tolerated.

  20. Increased expression of TLR-2, COX-2, and SOD-2 genes in the peripheral blood leukocytes of opisthorchiasis patients induced by Opisthorchis viverrini antigen.

    PubMed

    Yongvanit, Puangrat; Thanan, Raynoo; Pinlaor, Somchai; Sithithaworn, Paiboon; Loilome, Watcharin; Namwat, Nisana; Techasen, Anchalee; Dechakhamphu, Somkid

    2012-05-01

    Re-infection with liver fluke, Opisthorchis viverrini, increases proinflammatory molecules involved in inflammation-mediated disease and carcinogenesis in an animal model. To clarify whether these genes respond to parasite antigen in peripheral blood leukocytes (PBL) of opisthorchiasis patients, we examined the transcriptional level of oxidant-generating (toll-like receptor 2 (TLR-2), nuclear factor-kappa B (NF-KB), and cyclooxygenase 2 (COX-2)), anti-oxidant-generating (manganese superoxide dismutase 2 (SOD-2) and catalase (CAT)), proinflammatory cytokine (interleukin (IL)-1β), and anti-inflammatory cytokine (IL-10), in PBL exposed to parasite antigen in O. viverrini-infected patients compared with healthy individuals in an in vitro experiment. After O. viverrini antigen-treated PBL, quantitative RT-PCR analysis revealed that increased expression of cytokines and oxidant-generating genes in PBL was similar between O. viverrini-infected and healthy groups. Interestingly, compared with healthy subjects, increase of TLR-2, COX-2, and SOD-2 and decreased CAT mRNA expression levels were observed in O. viverrini-infected group. The results indicate that O. viverrini antigen induces upregulation of TLR-2, COX-2, and SOD-2 and downregulation of CAT genes in opisthorchiasis patients, suggesting that imbalance of oxidant/anti-oxidant transcripts during re-infection may be involved in the inflammatory-driven carcinogenesis. These molecules may be used as the chemopreventive target for intervention of opisthorchiasis patients in an endemic area.

  1. NF-κB inhibition attenuates LPS-induced TLR4 activation in monocyte cells

    PubMed Central

    Wan, Jian; Shan, Yi; Fan, Yibo; Fan, Conghui; Chen, Song; Sun, Jie; Zhu, Lili; Qin, Long; Yu, Mengjin; Lin, Zhaofen

    2016-01-01

    Toll-like receptor (TLR) family are receptors for extracellular or intracellular signaling, such as lipopolysaccharide (LPS), or 12-O-tetradecanoylphorbol-13-acetate. TLR induces the differentiation of human myeloid monocytic-leukemia cells (THP-1) to macrophages. However, the relationship between extracellular or intracellular signaling and the TLR protein level remain to be determined. Using RT-PCR and western blot analysis, the aim of the present study was to determine whether TLR4, a major TLR family member, could be moderately upregulated by high concentration of LPS and whether it promoted the maturation of THP1 cells. The results showed that, upregulated TLR4 at the protein level and mRNA level enriched the TLR4 modulation style. In addition, TLR4 expression was blocked by nuclear factor (NF)-κB inhibitor, and LPS stimulated NF-κB binding in the TLR4 gene promoter. Therefore, the increased expression of TLR4 in the responsiveness of LPS-treated THP1 cells occurred in response to the upregulation of their respective receptors, as well as a tight binding of NF-κB in the TLR4 gene promoter. PMID:27748869

  2. Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

    PubMed

    El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

    2017-04-03

    Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

  3. The Structural Basis of Pathogen Recognition by TLR Receptors of the Innate Immune System

    DTIC Science & Technology

    2008-08-01

    BD biosciences) with a histidine purification tag. Sf9 insect cells were co- transfected with the TLR5-ECD pAcGP67 expression construct and...BaculoGold DNA (Sigma) to produce recombinant baculovirus. Sf9 or Hi5 insect cell infected with this virus overexpressed TLR5-ECD. Soluble TLR5-ECD was... Sf9 insect cells were co-transfected with the FL-TLR5 pAcGP67 expression construct and baculoviral genomic DNA to produce recombinant baculovirus. Sf9

  4. mRNA-Mediated Gene Supplementation of Toll-Like Receptors as Treatment Strategy for Asthma In Vivo

    PubMed Central

    Will, Clara; Carevic, Melanie; Rottenberger, Jennifer; Nürnberg, Bernd; Hartl, Dominik; Handgretinger, Rupert; Beer-Hammer, Sandra; Kormann, Michael S. D.

    2016-01-01

    Asthma is the most common chronic disease in childhood. Although several therapeutic options are currently available to control the symptoms, many drugs have significant side effects and asthma remains an incurable disease. Microbial exposure in early life reduces the risk of asthma and several studies have suggested protective effects of Toll-like receptor (TLR) activation. We showed previously that modified mRNA provides a safe and efficient therapeutic tool for in vivo gene supplementation. Since current asthma drugs do not take patient specific immune and TLR backgrounds into consideration, treatment with tailored mRNA could be an attractive approach to account for the patient’s individual asthma phenotype. Therefore, we investigated the effect of a preventative treatment with combinations of Tlr1, Tlr2 and Tlr6 mRNA in a House Dust Mite-induced mouse model of asthma. We used chemically modified mRNA which is–in contrast to conventional viral vectors–non-integrating and highly efficient in gene transfer. In our study, we found that treatment with either Tlr1/2 mRNA or Tlr2/6 mRNA, but not Tlr2 mRNA alone, resulted in better lung function as well as reduced airway inflammation in vivo. The present results point to a potentially protective effect of TLR heterodimers in asthma pathogenesis. PMID:27101288

  5. Identification, characterization and genetic mapping of TLR1 loci in rainbow trout (Oncorhynchus mykiss)

    USGS Publications Warehouse

    Palti, Y.; Rodriguez, M.F.; Gahr, S.A.; Purcell, M.K.; Rexroad, C. E.; Wiens, G.D.

    2010-01-01

    Induction of innate immune pathways is critical for early anti-microbial defense but there is limited understanding of how teleosts recognize microbial molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 1 and 2 form a heterodimer involved in recognizing peptidoglycans and lipoproteins of microbial origin. Herein, we identify and describe the rainbow trout (Oncorhynchus mykiss) TLR1 gene ortholog and its mRNA expression. Two TLR1 loci were identified from a rainbow trout bacterial artificial chromosome (BAC) library using DNA sequencing and genetic linkage analyses. Full length cDNA clone and direct sequencing of four BACs revealed an intact omTLR1 open reading frame (ORF) located on chromosome 14 and a second locus on chromosome 25 that contains a TLR1 pseudogene. The duplicated trout loci exhibit conserved synteny with other fish genomes that extends beyond the TLR1 gene sequences. The omTLR1 gene includes a single large coding exon similar to all other described TLR1 genes, but unlike other teleosts it also has a 5??? UTR exon and intron preceding the large coding exon. The omTLR1 ORF is predicted to encode an 808 amino-acid protein with 69% similarity to the Fugu TLR1 and a conserved pattern of predicted leucine-rich repeats (LRR). Phylogenetic analysis grouped omTLR1 with other fish TLR1 genes on a separate branch from the avian TLR1 and mammalian TLR1, 6 and 10. omTLR1 expression levels in rainbow trout anterior kidney leukocytes were not affected by the human TLR2/6 and TLR2/1 agonists diacylated lipoprotein (Pam2CSK4) and triacylated lipoprotein (Pam3CSK4). However, due to the lack of TLR6 and 10 genes in teleost genomes and up-regulation of TLR1 mRNA in response to LPS and bacterial infection in other fish species we hypothesize an important role for omTLR1 in anti-microbial immunity. Therefore, the identification of a TLR2 ortholog in rainbow trout and the development of assays to measure ligand binding and downstream signaling

  6. Identification, characterization and genetic mapping of TLR1 loci in rainbow trout (Oncorhynchus mykiss)

    USGS Publications Warehouse

    Palti, Yniv; Rodriguez, M. Fernanda; Gahr, Scott A.; Purcell, Maureen K.; Rexroad, Caird E.; Wiens, Gregory D.

    2010-01-01

    Induction of innate immune pathways is critical for early anti-microbial defense but there is limited understanding of how teleosts recognize microbial molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 1 and 2 form a heterodimer involved in recognizing peptidoglycans and lipoproteins of microbial origin. Herein, we identify and describe the rainbow trout (Oncorhynchus mykiss) TLR1 gene ortholog and its mRNA expression. Two TLR1 loci were identified from a rainbow trout bacterial artificial chromosome (BAC) library using DNA sequencing and genetic linkage analyses. Full length cDNA clone and direct sequencing of four BACs revealed an intact omTLR1 open reading frame (ORF) located on chromosome 14 and a second locus on chromosome 25 that contains a TLR1 pseudogene. The duplicated trout loci exhibit conserved synteny with other fish genomes that extends beyond the TLR1 gene sequences. The omTLR1 gene includes a single large coding exon similar to all other described TLR1 genes, but unlike other teleosts it also has a 5' UTR exon and intron preceding the large coding exon. The omTLR1 ORF is predicted to encode an 808 amino-acid protein with 69% similarity to the Fugu TLR1 and a conserved pattern of predicted leucine-rich repeats (LRR). Phylogenetic analysis grouped omTLR1 with other fish TLR1 genes on a separate branch from the avian TLR1 and mammalian TLR1, 6 and 10. omTLR1 expression levels in rainbow trout anterior kidney leukocytes were not affected by the human TLR2/6 and TLR2/1 agonists diacylated lipoprotein (Pam2CSK4) and triacylated lipoprotein (Pam3CSK4). However, due to the lack of TLR6 and 10 genes in teleost genomes and up-regulation of TLR1 mRNA in response to LPS and bacterial infection in other fish species we hypothesize an important role for omTLR1 in anti-microbial immunity. Therefore, the identification of a TLR2 ortholog in rainbow trout and the development of assays to measure ligand binding and downstream signaling are

  7. Soyasaponin Ab ameliorates colitis by inhibiting the binding of lipopolysaccharide (LPS) to Toll-like receptor (TLR)4 on macrophages.

    PubMed

    Lee, In-Ah; Park, Young-Jun; Joh, Eun-Ha; Kim, Dong-Hyun

    2011-12-28

    Many clinical studies have shown that daily intake of soybean [ Glycine max (L.) Merr., Fabacease] or its foods may reduce the risk of osteoporosis, heart attack, hyperlipidemia, coronary heart disease, cardiovascular and chronic renal diseases, and cancers, including prostate, colon, and breast cancers. Of the soy constituents, soyasaponins exhibit anti-aging, antioxidant, apoptotic, and anti-inflammatory effects. However, the anti-inflammatory effect of soyasaponin Ab has not been thoroughly studied. Therefore, we investigated its anti-inflammatory effects in 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitic mice and lipopolysaccharide (LPS)-stimulated peritoneal macrophages. Soyasaponin Ab inhibited colon shortening, myeloperoxidase activity, the expression of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS), and activation of the transcription factor nuclear factor-κB (NF-κB). Soyasaponin Ab (1, 2, 5, and 10 μM) inhibited the production of NO (IC(50) = 1.6 ± 0.1 μM) and prostaglandin E(2) (IC(50) = 2.0 ± 0.1 ng/mL), the expression of tumor necrosis factor (TNF)-α (IC(50) = 1.3 ± 0.1 ng/mL), interleukin (IL)-1β (IC(50) = 1.5 ± 0.1 pg/mL), and toll-like receptor (TLR)4, and the phosphorylation of interleukin-1 receptor-associated kinase (IRAK)-1 in LPS-stimulated peritoneal macrophages. Soyasaponin Ab weakly inhibited the phosphorylation of ERK, JNK, and p38. Soyasaponin Ab significantly reduced the binding of Alexa-Fluor-594-conjugated LPS to peritoneal macrophages. Soyasaponin Ab did not affect TLR4 expression or LPS-induced NF-κB activation in TLR4 siRNA-treated peritoneal macrophages (knockdown efficiency of TLR4 > 94%). On the basis of these findings, soyasaponin Ab may ameliorate colitis by inhibiting the binding of LPS to TLR4 on macrophages.

  8. TLR4 Antagonist Attenuates Atherogenesis in LDL Receptor-Deficient Mice with Diet-Induced Type 2 Diabetes

    PubMed Central

    Lu, Zhongyang; Zhang, Xiaoming; Li, Yanchun; Lopes-Virella, Maria F.; Huang, Yan

    2015-01-01

    Although a large number of studies have well documented a key role of toll-like receptor (TLR)4 in atherosclerosis, it remains undetermined if TLR4 antagonist attenuates atherogenesis in mouse model for type 2 diabetes. In this study, we induced type 2 diabetes in low-density lipoprotein receptor-deficient (LDLR−/−) mice by high-fat diet (HFD). At 8 weeks old, 20 mice were fed HFD and 20 mice fed regular chow (RC) for 24 weeks. In the last 10 weeks, half HFD-fed mice and half RC-fed mice were treated with Rhodobacter sphaeroides lipopolysaccharide (Rs-LPS), an established TLR4 antagonist. After the treatment, atherosclerotic lesions in aortas were analyzed. Results showed that the HFD significantly increased bodyweight, glucose, lipids including total cholesterol, triglycerides and free fatty acids, and insulin resistance, indicating that the HFD induced type 2 diabetes in LDLR−/− mice. Results also showed that Rs-LPS had no effect on HFD-increased metabolic parameters in both nondiabetic and diabetic mice. Lipid staining of aortas and histological analysis of cross-sections of aortic roots showed that diabetes increased atherosclerotic lesions, but Rs-LPS attenuated atherogenesis in diabetic mice. Furthermore, immunohistochemical studies showed that Rs-LPS reduced infiltration of monocytes/macrophages and expression of interleukin (IL)-6 and matrix metalloproteinase-9 in atherosclerotic lesions of diabetic mice. Finally, the antagonistic effect of Rs-LPS on TLR4 was demonstrated by our in vitro studies showing that Rs-LPS inhibited IL-6 secretion from macrophages and endothelial cells stimulated by LPS or LPS plus saturated fatty acid palmitate. Taken together, our study demonstrated that TLR4 antagonist was capable of attenuating vascular inflammation and atherogenesis in mice with HFD-induced type 2 diabetes. PMID:26162692

  9. Peptidoglycan induces interleukin-6 expression through the TLR2 receptor, JNK, c-Jun, and AP-1 pathways in microglia.

    PubMed

    Lin, Hsiao-Yun; Tang, Chih-Hsin; Chen, Jia-Hong; Chuang, Jing-Yuan; Huang, Ssu-Ming; Tan, Tzu-Wei; Lai, Chih-Ho; Lu, Dah-Yuu

    2011-06-01

    We recently reported that peptidoglycan (PGN), a cell wall component of the Gram-positive bacterium, induces NF-κB activation and microglia activation. However, PGN-regulated AP-1 activation and cytokine expression in microglia remains unclear. This study investigated how PGN influences the signaling pathway involved in IL-6 production in microglia. IL-6 mRNA and protein level up-regulation were increased by PGN in a concentration- and time-dependent manner. In addition, PGN increased toll-like receptor-2 (TLR2) expression, but not TLR4 receptor up-regulation. Administration of TLR2 siRNA or TLR2 neutralized antibody effectively inhibited PGN-induced IL-6 expression. In contrast, PGN-induced IL-6 mRNA and protein up-regulation were attenuated by the SAPK/JNK (c-Jun N-terminal kinases) inhibitor SP600125. Treatment of microglia with PGN increased levels of JNK phosphorylation and c-Jun phosphorylation, and up-regulated of JNK kinase activity. Treatment of microglia with AP-1 inhibitors (Tanshinone IIA and curcumin) effectively reduced PGN-induced IL-6 expression. PGN also significantly increased c-Fos and phospho-c-Jun translocation to nucleus. In line with this, PGN also increased AP-1-DNA complexes formation, as determined by the electrophoretic mobility shift assay. Furthermore, PGN also increased IL-6 transcription activity determined by transfection with IL-6 promoter construct plasmid. Co-transfection with dominant negative mutant of JNK (DN-JNK), or treatment with SP600125, curcumin, or Tanshinone IIA effectively antagonized PGN-increased IL-6 transcription activity. Our data demonstrate that PGN-induced IL-6 expression is mediated by AP-1 activation through the TLR2 and JNK/c-Jun pathways in microglia.

  10. Toll-like receptor 4 (TLR4) is correlated with delayed cerebral ischemia (DCI) and poor prognosis in aneurysmal subarachnoid hemorrhage.

    PubMed

    Ma, Chunxiao; Zhou, Wei; Yan, Zhaoyue; Qu, Mingqi; Bu, Xingyao

    2015-12-15

    Toll-like receptor 4 (TLR4) is one of key players in regulation of inflammation. Animal experiments have suggested an important role of TLR4 in the pathophysiology of subarachnoid hemorrhage (SAH). In present study, TLR4 is investigated in clinical SAH patients to explore its clinical significance. 30 patients with aneurysmal subarachnoid hemorrhage (aSAH) and 20 healthy control patients (HC) were enrolled in this prospective study. Blood samples were collected on days 1, 3 and 7 after admission. TLR4 expression level on cell surface of peripheral blood mononuclear cells (PBMCs) was determined by flow cytometry and presented as mean fluorescence intensity (MFI). Patients were clinically assessed every day after admission to monitor the occurrence of delayed cerebral ischemia (DCI). Participants were followed up until completion of 3 months after SAH. Functional outcome was defined by modified Rankin score (mRs). Results show that SAH patients presented a significantly higher TLR4 levels on days 1 and 3 post SAH compared to HC; TLR4 levels in SAH patients on day 1 was highest compared with that on days 3 and 7 and in HC. TLR4 of SAH patients on day 7 declined to the level showing no significant difference with that of HC. In patients with Hunt-Hess grades I-III lower TLR4 levels were observed. Patients with DCI showed significantly higher TLR4 levels than those without DCI. High TLR4 levels were statistically significantly associated with poor functional outcome after 3 months. Logistic regression analysis showed that TLR4 level on day 1 was independent predictor for DCI and 3-month poor neurological outcome of aneurysmal SAH patients. In summary, admission TLR4 level on PBMCs (day 1) is an independent risk factor to predict the occurrence of DCI and 3-month poor neurological outcome in aneurysmal SAH patients.

  11. CHK1 and RAD51 activation after DNA damage is regulated via urokinase receptor/TLR4 signaling

    PubMed Central

    Narayanaswamy, Pavan B; Tkachuk, Sergey; Haller, Hermann; Dumler, Inna; Kiyan, Yulia

    2016-01-01

    Mechanisms of DNA damage and repair signaling are not completely understood that hinder the efficiency of cancer therapy. Urokinase-type plasminogen activator receptor (PLAUR) is highly expressed in most solid cancers and serves as a marker of poor prognosis. We show that PLAUR actively promotes DNA repair in cancer cells. On the contrary, downregulation of PLAUR expression results in delayed DNA repair. We found PLAUR to be essential for activation of Checkpoint kinase 1 (CHK1); maintenance of cell cycle arrest after DNA damage in a TP53-dependent manner; expression, nuclear import and recruitment to DNA-damage foci of RAD51 recombinase, the principal protein involved in the homologous recombination repair pathway. Underlying mechanism implies auto-/paracrine signaling of PLAUR/TLR4 receptor complex leading to activation of CHK1 and DNA repair. The signaling is induced by a danger molecule released by DNA-damaged cells and mediates, at least partially, activation of DNA-damage response. This study describes a new mechanism of DNA repair activation initiated by auto-/paracrine signaling of membrane receptors PLAUR/TLR4. It adds to the understanding of role of PLAUR in cancer and provides a rationale for therapeutic targeting of PLAUR/TLR4 interaction in TP53-positive cancers. PMID:27685627

  12. Differential expression of toll-like receptor genes: sepsis compared with sterile inflammation 1 day before sepsis diagnosis.

    PubMed

    Lissauer, Matthew E; Johnson, Steven B; Bochicchio, Grant V; Feild, Carinda J; Cross, Alan S; Hasday, Jeffrey D; Whiteford, Craig C; Nussbaumer, William A; Towns, Michael; Scalea, Thomas M

    2009-03-01

    Toll-like receptors (TLRs) are critical components of innate immunity. This study was designed to evaluate differential expression of genes for TLR and associated signal transduction molecules in critically ill patients developing sepsis compared with those with sterile inflammation. Uninfected critically ill patients with systemic inflammatory response syndrome were prospectively followed daily for development of sepsis. They were divided into two groups and compared in a case-control manner: (a) preseptic patients (n = 45) who subsequently developed sepsis, and (b) uninfected systemic inflammatory response syndrome patients (n = 45) who remained uninfected. Whole blood RNA was collected (PAXGene tube) at study entry and 1, 2, and 3 days before clinical sepsis diagnosis (or time-matched uninfected control) and analyzed via Affymetrix Hg_U133 Plus 2.0 microarrays. Genes were considered differentially expressed if they met univariate significance controlled for multiple comparisons at P < 0.005. Differentially expressed probes were uploaded into the Database for Annotation, Visualization and Integrated Discovery. The TLR pathway (Kyoto Encyclopedia of Genes and Genomes-KEGG) significance was determined via Expression Analysis Systematic Explorer (EASE) scoring. A total of 2,974 Affymetrix probes representing 2,190 unique genes were differentially expressed 1 day before sepsis diagnosis. Thirty-six probes representing 25 genes were annotated to the TLR pathway (KEGG) via the Database for Annotation, Visualization and Integrated Discovery with an EASE score at P < 0.0004. Notable TLR genes demonstrating increased expression include TLR-4 (median, 1.43-fold change), TLR-5 (2.08-fold change), and MAPK14 (1.90-fold change). An additional 11 unique genes were manually annotated into the TLR pathway based on known relevance such as TLR-8 (1.54-fold change). The total 36 genes contained 28 showing increased expression and 8 showing decreased expression. Differential gene

  13. Synergistic Stimulation with Different TLR7 Ligands Modulates Gene Expression Patterns in the Human Plasmacytoid Dendritic Cell Line CAL-1

    PubMed Central

    Hilbert, Tobias; Steinhagen, Folkert; Weisheit, Christina; Baumgarten, Georg; Hoeft, Andreas; Klaschik, Sven

    2015-01-01

    Objective. TLR7 ligation in plasmacytoid dendritic cells is promising for the treatment of cancer, allergy, and infectious diseases; however, high doses of ligands are required. We hypothesized that the combination of structurally different TLR7 ligands exponentiates the resulting immune response. Methods. CAL-1 (human pDC line) cells were incubated with the TLR7-specific adenine analog CL264 and single-stranded 9.2s RNA. Protein secretion was measured by ELISA. Microarray technique was used to detect modified gene expression patterns upon synergistic stimulation, revealing underlying functional groups and networks. Cell surface binding properties were studied using FACS analysis. Results. CL264 in combination with 9.2s RNA significantly enhanced cytokine and interferon secretion to supra-additive levels. This effect was due to a stronger stimulation of already regulated genes (by monostimulation) as well as to recruitment of thus far unregulated genes. Top scoring canonical pathways referred to immune-related processes. Network analysis revealed IL-1β, IL-6, TNF, and IFN-β as major regulatory nodes, while several minor regulatory nodes were also identified. Binding of CL264 to the cell surface was enhanced by 9.2s RNA. Conclusion. Structurally different TLR7 ligands act synergistically on gene expression patterns and on the resulting inflammatory response. These data could impact future strategies optimizing TLR7-targeted drug design. PMID:26770023

  14. Activation of Human Toll-like Receptor 4 (TLR4)·Myeloid Differentiation Factor 2 (MD-2) by Hypoacylated Lipopolysaccharide from a Clinical Isolate of Burkholderia cenocepacia.

    PubMed

    Di Lorenzo, Flaviana; Kubik, Łukasz; Oblak, Alja; Lorè, Nicola Ivan; Cigana, Cristina; Lanzetta, Rosa; Parrilli, Michelangelo; Hamad, Mohamad A; De Soyza, Anthony; Silipo, Alba; Jerala, Roman; Bragonzi, Alessandra; Valvano, Miguel A; Martín-Santamaría, Sonsoles; Molinaro, Antonio

    2015-08-28

    Lung infection by Burkholderia species, in particular Burkholderia cenocepacia, accelerates tissue damage and increases post-lung transplant mortality in cystic fibrosis patients. Host-microbe interplay largely depends on interactions between pathogen-specific molecules and innate immune receptors such as Toll-like receptor 4 (TLR4), which recognizes the lipid A moiety of the bacterial lipopolysaccharide (LPS). The human TLR4·myeloid differentiation factor 2 (MD-2) LPS receptor complex is strongly activated by hexa-acylated lipid A and poorly activated by underacylated lipid A. Here, we report that B. cenocepacia LPS strongly activates human TLR4·MD-2 despite its lipid A having only five acyl chains. Furthermore, we show that aminoarabinose residues in lipid A contribute to TLR4-lipid A interactions, and experiments in a mouse model of LPS-induced endotoxic shock confirmed the proinflammatory potential of B. cenocepacia penta-acylated lipid A. Molecular modeling combined with mutagenesis of TLR4-MD-2 interactive surfaces suggests that longer acyl chains and the aminoarabinose residues in the B. cenocepacia lipid A allow exposure of the fifth acyl chain on the surface of MD-2 enabling interactions with TLR4 and its dimerization. Our results provide a molecular model for activation of the human TLR4·MD-2 complex by penta-acylated lipid A explaining the ability of hypoacylated B. cenocepacia LPS to promote proinflammatory responses associated with the severe pathogenicity of this opportunistic bacterium.

  15. [TOLL-LIKE RECEPTORS IN COSMONAUT'S PERIPHERAL BLOOD CELLS AFTER LONG-DURATION MISSIONS TO THE INTERNATIONAL SPACE STATION].

    PubMed

    Berendeeva, T A; Ponomarev, S A; Antropova, E N; Rykova, M P

    2015-01-01

    Studies of Toll-like receptors (TLR) in 20 cosmonauts-members of long-duration (124-199-day) missions to the International space station evidenced changes in relative and absolute counts of peripheral blood monocytes with TLR2, TLR4 and TLR6 on the surface, expression of TLR2 and TLR6 genes, and genes of molecules involved in the TLR signaling pathway and TLR-related NF-KB-, JNK/p38- and IRF pathways on the day of return to Earth. The observed changes displayed individual variability.

  16. Inhibition of LPS binding to MD-2 co-receptor for suppressing TLR4-mediated expression of inflammatory cytokine by 1-dehydro-10-gingerdione from dietary ginger

    SciTech Connect

    Park, Sun Hong; Kyeong, Min Sik; Hwang, Yuri; Ryu, Shi Yong; Han, Sang-Bae; Kim, Youngsoo

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer 1-Dehydro-10-gingerdione (1D10G) from ginger inhibits LPS binding to MD-2. Black-Right-Pointing-Pointer 1D10G suppresses MyD88- or TRIF-dependent signaling in LPS-activated macrophages. Black-Right-Pointing-Pointer 1D10G down-regulates the expression of NF-{kappa}B-, AP1- or IRF3-target genes. Black-Right-Pointing-Pointer MD-2 is a molecular target in the anti-inflammatory action of 1D10G. -- Abstract: Myeloid differentiation protein 2 (MD-2) is a co-receptor of toll-like receptor 4 (TLR4) for innate immunity. Here, we delineated a new mechanism of 1-dehydro-10-gingerdione (1D10G), one of pungent isolates from ginger (Zingiber officinale), in the suppression of lipopolysaccharide (LPS)-induced gene expression of inflammatory cytokines. 1D10G inhibited LPS binding to MD-2 with higher affinity than gingerol and shogaol from dietary ginger. Moreover, 1D10G down-regulated TLR4-mediated expression of nuclear factor-{kappa}B (NF-{kappa}B) or activating protein 1 (AP1)-target genes such as tumor necrosis factor {alpha} (TNF-{alpha}) and interleukin-1{beta}, as well as those of interferon (IFN) regulatory factor 3 (IRF3)-target IFN-{beta} gene and IFN-{gamma} inducible protein 10 (IP-10) in LPS-activated macrophages. Taken together, MD-2 is a molecular target in the anti-inflammatory action of 1D10G.

  17. Both intrinsic and extrinsic apoptotic pathways are involved in Toll-like receptor 4 (TLR4)-induced cell death in monocytic THP-1 cells.

    PubMed

    Liu, Bei; Sun, Ruili; Luo, Hongbo; Liu, Xueting; Jiang, Manli; Yuan, Chuang; Yang, Li; Hu, Jinyue

    2017-02-01

    Our previous study showed that TLR3 induces apoptosis via both death receptors and mitochondial in human endothelial cells. We report here that the activation of TLR4 induced dose- and time-dependent cell death in moncytic THP-1 cells. LPS treatment of THP-1 cells induced the activation of both caspase 8 and 9, suggesting the involvement of intrinsic and extrinsic apoptosis pathways. TNFα was induced by TLR4 activation at both mRNA and protein levels, but its neutralization did not down-regulated TLR4-induced cell death. TLR4 activation also induced the up-regulation of TRAIL and its receptors DR4 and DR5, and the neutralization of TRAIL ameliorated TLR4 induced apoptosis, suggesting the involvement of TRAIL and its receptors DR4 and DR5 in LPS-induced cell death. Meanwhile, LPS treatment down-regulated the expression of FLICE inhibitory protein (FLIP), a suppressor of death receptor-induced cell death. In addition, TLR4 activation down-regulated the anti-apoptotic protein bcl-2, and up-regulated the pro-apoptotic proteins Noxa and Puma, suggesting that mitochondrial apoptotic pathway was also involved in LPS-induced cell death. Furthermore, we found that TAP63α might confer to the activation of intrinsic and extrinsic apoptotic pathways. The treatment of THP-1 cells with LPS induced the translocation of TAP63α from cytoplasm to nucleus. Taken together, our study suggested that both death receptors and mitochondial were involved in TLR4-induced cell death, and TAP63α may be a target for the prevention of LPS-induced cell death.

  18. Effects of porcine MyD88 knockdown on the expression of TLR4 pathway-related genes and proinflammatory cytokines.

    PubMed

    Dai, Chaohui; Sun, Li; Yu, Lihuai; Zhu, Guoqiang; Wu, Shenglong; Bao, Wenbin

    2016-12-01

    As a critical adapter protein in Toll-like receptor (TLR)/Interleukin (IL)-1R signalling pathway, myeloid differentiation protein 88 (MyD88) plays an important role in immune responses and host defence against pathogens. The present study was designed to provide a foundation and an important reagent for the mechanistic study of MyD88 and its role TLR/IL-1R signalling pathways in porcine immunity. Lentivirus-mediated RNAi was used to generate a porcine PK15 cell line with a silenced MyD88 gene and quantitative real-time PCR (qPCR) and Western blotting were used to detect changes in the expression of critical genes in the Toll-like receptor 4 (TLR4) signalling pathway. ELISA was used to measure the levels of seven proinflammatory cytokines-interleukin-1β (IL-1β), tumour necrosis factor-α (TNF-α), IL-6, IL-8, IL-12, macrophage inflammatory protein (MIP)-1α and MIP-1β-in cell culture supernatants after MyD88 silencing. We successfully obtained a PK15 cell line with 61% MyD88 mRNA transcript down-regulated. In PK15 cells with MyD88 silencing, the transcript levels of TLR4 and IL-1β were significantly reduced, whereas there were no significant changes in the expression levels of cluster of differentiation antigen 14 (CD14), interferon-α (IFN-α) or TNF-α The ELISA results showed that the levels of most cytokines were not significantly changed apart from IL-8 without stimulation, which was significantly up-regulated. When cells were induced by lipopolysaccharide (LPS) (0.1 μg/ml) for 6 h, the global level of seven proinflammatory cytokines up-regulated and the level of IL-1β, TNF-α, IL-6, IL-8 and IL-12 of Blank and negative control (NC) group up-regulated more significantly than RNAi group (P<0.05), which revealed that the MyD88 silencing could reduce the TLR4 signal transduction which inhibited the release of proinflammatory cytokines and finally leaded to immunosuppression.

  19. Involvement of TLR2 and TLR4 in inflammatory immune responses induced by fine and coarse ambient air particulate matter

    PubMed Central

    Shoenfelt, Joanna; Mitkus, Robert J.; Zeisler, Rolf; Spatz, Rabia O.; Powell, Jan; Fenton, Matthew J.; Squibb, Katherine A.; Medvedev, Andrei E.

    2009-01-01

    Induction of proinflammatory mediators by alveolar macrophages exposed to ambient air particulate matter has been suggested to be a key factor in the pathogenesis of inflammatory and allergic diseases in the lungs. However, receptors and mechanisms underlying these responses have not been fully elucidated. In this study, we examined whether TLR2, TLR4, and the key adaptor protein, MyD88, mediate the expression of proinflammatory cytokines and chemokines by mouse peritoneal macrophages exposed to fine and coarse PM. TLR2 deficiency blunted macrophage TNF-α and IL-6 expression in response to fine (PM2.5), while not affecting cytokine-inducing ability of coarse NIST Standard Reference Material (SRM 1648) particles. In contrast, TLR4−/− macrophages showed inhibited cytokine expression upon stimulation with NIST SRM 1648 but exhibited normal responses to PM2.5. Preincubation with polymyxin B markedly suppressed the capacity of NIST SRM 1648 to elicit TNF-α and IL-6, indicating endotoxin as a principal inducer of cytokine responses. Overexpression of TLR2 in TLR2/4-deficient human embryonic kidney 293 cells imparted PM2.5 sensitivity, as judged by IL-8 gene expression, whereas NIST SRM 1648, but not PM2.5 elicited IL-8 expression in 293/TLR4/MD-2 transfectants. Engagement of TLR4 by NIST SRM 1648 induced MyD88-independent expression of the chemokine RANTES, while TLR2-reactive NIST IRM PM2.5 failed to up-regulate this response. Consistent with the shared use of MyD88 by TLR2 and TLR4, cytokine responses of MyD88−/− macrophages to both types of air PM were significantly reduced. These data indicate differential utilization of TLR2 and TLR4 but shared use of MyD88 by fine and coarse air pollution particles. PMID:19406832

  20. Gene expression induced by Toll-like receptors in macrophages requires the transcription factor NFAT5.

    PubMed

    Buxadé, Maria; Lunazzi, Giulia; Minguillón, Jordi; Iborra, Salvador; Berga-Bolaños, Rosa; Del Val, Margarita; Aramburu, José; López-Rodríguez, Cristina

    2012-02-13

    Toll-like receptors (TLRs) engage networks of transcriptional regulators to induce genes essential for antimicrobial immunity. We report that NFAT5, previously characterized as an osmostress responsive factor, regulates the expression of multiple TLR-induced genes in macrophages independently of osmotic stress. NFAT5 was essential for the induction of the key antimicrobial gene Nos2 (inducible nitric oxide synthase [iNOS]) in response to low and high doses of TLR agonists but is required for Tnf and Il6 mainly under mild stimulatory conditions, indicating that NFAT5 could regulate specific gene patterns depending on pathogen burden intensity. NFAT5 exhibited two modes of association with target genes, as it was constitutively bound to Tnf and other genes regardless of TLR stimulation, whereas its recruitment to Nos2 or Il6 required TLR activation. Further analysis revealed that TLR-induced recruitment of NFAT5 to Nos2 was dependent on inhibitor of κB kinase (IKK) β activity and de novo protein synthesis, and was sensitive to histone deacetylases. In vivo, NFAT5 was necessary for effective immunity against Leishmania major, a parasite whose clearance requires TLRs and iNOS expression in macrophages. These findings identify NFAT5 as a novel regulator of mammalian anti-pathogen responses.

  1. Gene expression induced by Toll-like receptors in macrophages requires the transcription factor NFAT5

    PubMed Central

    Buxadé, Maria; Lunazzi, Giulia; Minguillón, Jordi; Iborra, Salvador; Berga-Bolaños, Rosa; del Val, Margarita; Aramburu, José

    2012-01-01

    Toll-like receptors (TLRs) engage networks of transcriptional regulators to induce genes essential for antimicrobial immunity. We report that NFAT5, previously characterized as an osmostress responsive factor, regulates the expression of multiple TLR-induced genes in macrophages independently of osmotic stress. NFAT5 was essential for the induction of the key antimicrobial gene Nos2 (inducible nitric oxide synthase [iNOS]) in response to low and high doses of TLR agonists but is required for Tnf and Il6 mainly under mild stimulatory conditions, indicating that NFAT5 could regulate specific gene patterns depending on pathogen burden intensity. NFAT5 exhibited two modes of association with target genes, as it was constitutively bound to Tnf and other genes regardless of TLR stimulation, whereas its recruitment to Nos2 or Il6 required TLR activation. Further analysis revealed that TLR-induced recruitment of NFAT5 to Nos2 was dependent on inhibitor of κB kinase (IKK) β activity and de novo protein synthesis, and was sensitive to histone deacetylases. In vivo, NFAT5 was necessary for effective immunity against Leishmania major, a parasite whose clearance requires TLRs and iNOS expression in macrophages. These findings identify NFAT5 as a novel regulator of mammalian anti-pathogen responses. PMID:22312110

  2. Variants in Toll-like Receptor 1 and 4 Genes Are Associated With Chlamydia trachomatis Among Women With Pelvic Inflammatory Disease

    PubMed Central

    Darville, Toni; Ferrell, Robert E.; Kammerer, Candace M.; Ness, Roberta B.; Haggerty, Catherine L.

    2012-01-01

    Background. Toll-like receptors (TLRs) are involved in the innate immune response. We examined whether TLR variants are associated with Chlamydia trachomatis infection among women with pelvic inflammatory disease (PID). Methods. We tested whether 18 tagging single nucleotide polymorphisms (tagSNPs) assayed in 4 TLR genes (TLR1, TLR2, TLR4, TLR6) and 2 adaptor molecules (TIRAP, MyD88) were associated with C. trachomatis among 205 African American women with clinically suspected PID from the PID Evaluation and Clinical Health Study. Logistic regression was used to calculate odds ratios (ORs) and 95% confidence intervals (CIs). An empirical P value of <.004 was considered significant. Results. Women with PID who carried the TLR4 rs1927911 CC genotype had significantly increased odds of C. trachomatis (OR, 3.7; 95% CI, 1.6–8.8; P = .002). The TLR1 rs5743618TT genotype was also associated with C. trachomatis (OR, 2.8; 95% CI, 1.3–6.2; P = .008). Conclusions. Among African American women with PID, variants in the TLR1 and TLR4 genes, which may increase signaling, were associated with increased C. trachomatis infection. PMID:22238472

  3. Toll-like receptor stimulation in splenic marginal zone lymphoma can modulate cell signaling, activation and proliferation

    PubMed Central

    Fonte, Eleonora; Agathangelidis, Andreas; Reverberi, Daniele; Ntoufa, Stavroula; Scarfò, Lydia; Ranghetti, Pamela; Cutrona, Giovanna; Tedeschi, Alessandra; Xochelli, Aliki; Caligaris-Cappio, Federico; Ponzoni, Maurilio; Belessi, Chrysoula; Davis, Zadie; Piris, Miguel A.; Oscier, David; Ghia, Paolo; Stamatopoulos, Kostas; Muzio, Marta

    2015-01-01

    Recent studies on splenic marginal zone lymphoma identified distinct mutations in genes belonging to the B-cell receptor and Toll-like receptor signaling pathways, thus pointing to their potential implication in the biology of the disease. However, limited data is available regarding the exact role of TLRs. We aimed at characterizing the expression pattern of TLRs in splenic marginal zone lymphoma cells and their functional impact on the activation, proliferation and viability of malignant cells in vitro. Cells expressed significant levels of TLR1, TLR6, TLR7, TLR8, TLR9 and TLR10 mRNA; TLR2 and TLR4 showed a low, variable pattern of expression among patients whereas TLR3 and TLR5 mRNAs were undetectable; mRNA specific for TLR signaling molecules and adapters was also expressed. At the protein level, TLR1, TLR6, TLR7, TLR9 and TLR10 were detected. Stimulation of TLR1/2, TLR2/6 and TLR9 with their respective ligands triggered the activation of IRAK kinases, MAPK and NF-κB signaling pathways, and the induction of CD86 and CD25 activation molecules, although in a heterogeneous manner among different patient samples. TLR-induced activation and cell viability were also inhibited by a specific IRAK1/4 inhibitor, thus strongly supporting the specific role of TLR signaling in these processes. Furthermore, TLR2/6 and TLR9 stimulation also significantly increased cell proliferation. In conclusion, we demonstrate that splenic marginal zone lymphoma cells are equipped with functional TLR and signaling molecules and that the stimulation of TLR1/2, TLR2/6 and TLR9 may play a role in regulating disease pathobiology, likely promoting the expansion of the neoplastic clone. PMID:26294727

  4. Insights into the European rabbit (Oryctolagus cuniculus) innate immune system: genetic diversity of the toll-like receptor 3 (TLR3) in wild populations and domestic breeds

    PubMed Central

    2013-01-01

    Background Toll-like receptors (TLRs) belong to the innate immune system and are a major class of pattern recognition receptors representing the first line of the innate immune response. The TLR molecule is structurally composed by an ectodomain that contains leucine rich repeats (LRRs) that interact with pathogen associated molecular patterns (PAMPs), a transmembrane domain and a conserved cytoplasmic domain designated TIR (Toll-IL1 receptor) that is responsible for the intracellular signaling. TLR3 has been associated with the direct recognition of double-stranded viral RNA resulting from viral replication, while TLR7 and TLR8 target single-stranded viral RNA. In the European rabbit (Oryctolagus cuniculus), TLR7 and TLR8 were reported to be absent and pseudogenised, respectively, making TLR3 the only available TLR for the recognition of viral RNA. Thus, the levels of diversity of TLR3 were evaluated in the European rabbit by analysing different genetic backgrounds and exposure to pathogen pressures. Results We detected 41 single nucleotide polymorphisms (SNPs) in the coding sequence of TLR3. The highest diversity was observed in the wild populations of Iberian Peninsula, between 22–33 polymorphic positions. In the French population, 18 SNPs were observed and only 4 polymorphic positions were detected in the domestic breeds. 14 non-synonymous substitutions were observed, most of them in the LRR molecules. The remaining were scattered across the transmembrane and TIR domains. Conclusion The study of TLR3 in European rabbit populations might be relevant to understand the interplay between RNA viruses and innate immunity. Wild rabbit populations presented more diversity than domestic breeds and other mammals previously studied. This might be linked to the absence of population bottlenecks during their evolution and to the almost inexistence of man-mediated selection. The observed variability might have also been potentiated by the contact of the wild populations

  5. TLR2 and TLR4 polymorphisms influence mRNA and protein expression in colorectal cancer

    PubMed Central

    Proença, Marcela Alcântara; de Oliveira, Juliana Garcia; Cadamuro, Aline Cristina Targa; Succi, Maysa; Netinho, João Gomes; Goloni-Bertolo, Eny Maria; Pavarino, Érika Cristina; Silva, Ana Elizabete

    2015-01-01

    AIM: To evaluate the effect of promoter region polymorphisms of toll-like receptor (TLR)2-196 to -174del and TLR4-1607T/C (rs10759932) on mRNA and protein expression in tumor tissue and of TLR4+896A/G (rs4986790) on colorectal cancer (CRC) risk. METHODS: The TLR2-196 to -174del polymorphism was investigated using allele-specific polymerase chain reaction (PCR) and the TLR4-1607T/C and TLR4+896A/G by PCR-restriction fragment length polymorphism (RFLP). We genotyped 434 DNA samples from 194 CRC patients and 240 healthy individuals. The mRNA relative quantification (RQ) was performed in 40 tumor tissue samples by quantitative PCR TaqMan assay, using specific probes for TLR2 and TLR4 genes, and ACTB and GAPDH reference genes were used as endogenous controls. Protein expression was analyzed by immunohistochemistry with specific primary antibodies. RESULTS: No association was found for TLR4-1607T/C and TLR4+896A/G by three statistical models (log-additive, dominant and recessive). However, based on dominant and log-additive models, the polymorphic variant TLR2-196 to -174del was associated with increased CRC risk [dominant: odds ratio (OR) = 1.72, 95%CI: 1.03-2.89; P = 0.038 and log-additive: OR =1.59, 95%CI: 1.02-2.48; P = 0.039]. TLR2 mRNA expression was increased in tumor tissue (RQ = 2.36) when compared to adjacent normal tissue (RQ = 1; P < 0.0001), whereas the TLR4 mRNA showed a basal expression (RQ = 0.74 vs RQ = 1, P = 0.452). Immunohistochemistry analysis of TLR2 and TLR4 protein expression was concordant with the findings of mRNA expression. In addition, the TLR2-196 to -174del variant carriers showed mRNA relative expression 2.19 times higher than wild-genotype carriers. The TLR2 protein expression was also higher for the TLR2-196 to -174del variant carriers [117 ± 10 arbitrary unit (a.u.) vs 95 ± 4 a.u., P = 0.03]. However, for the TLR4 -1607T/C polymorphism no significant difference was found for both mRNA (P = 0.56) and protein expression (P = 0

  6. Up-regulation of TLR2 and TLR4 in high mobility group Box1-stimulated macrophages in pulpitis patients

    PubMed Central

    Mahmoudi, Javad; Sabermarouf, Babak; Baradaran, Behzad; Sadat-Hatamnezhad, Leila; Shotorbani, Siamak Sandoghchian

    2017-01-01

    Objective(s): High Mobility Group Box1 (HMGB1) is a nonhistone, DNA-binding protein that serves a crucial role in regulating gene transcription and is involved in a variety of proinflammatory, extracellular activities. The aim of this study was to explore whether HMGB1 stimulation can up-regulate the expression of Toll-like Receptor 2 (TLR2) and Toll-like Receptor 4 (TLR4) on macrophages from pulpitis and to clarify the subsequent events involving Th17 cells and Th17 cell-associated cytokine changes. Materials and Methods: Having prepared dental pulp tissues of pulpitis and healthy controls, macrophage were isolated and cultured. Macrophages were thereafter stimulated by HMGB1 time course. RT-QPCR, flowcytometer, immunofluorescence, Western blotting, and ELISA techniques were used in the present research. Results: Our results showed that the expression of TLR2 and TLR4 on macrophages stimulated with HMGB1 increased in pulpitis compared with controls (macrophages without HMGB1 stimulation) with a statistical significance (P<0.001). In addition, the levels of IL-17, IL-23, and IL-6 in supernatants from cultured macrophages stimulated with HMGB1 from pulpitis increased, and NF-kB, the downstream target of TLR2 and TLR4, also showed a marked elevation after macrophages’ stimulation by HMGB1. Conclusion: The evidence from the present study suggests that the enhanced TLR2 and TLR4 pathways and Th17 cell polarization may be due to HMGB1 stimulation in pulpitis. PMID:28293399

  7. Identification and optimization of pteridinone Toll-like receptor 7 (TLR7) agonists for the oral treatment of viral hepatitis.

    PubMed

    Roethle, Paul A; McFadden, Ryan M; Yang, Hong; Hrvatin, Paul; Hui, Hon; Graupe, Michael; Gallagher, Brian; Chao, Jessica; Hesselgesser, Joseph; Duatschek, Paul; Zheng, Jim; Lu, Bing; Tumas, Daniel B; Perry, Jason; Halcomb, Randall L

    2013-09-26

    Pteridinone-based Toll-like receptor 7 (TLR7) agonists were identified as potent and selective alternatives to the previously reported adenine-based agonists, leading to the discovery of GS-9620. Analogues were optimized for the immunomodulatory activity and selectivity versus other TLRs, based on differential induction of key cytokines including interferon α (IFN-α) and tumor necrosis factor α (TNF-α). In addition, physicochemical properties were adjusted to achieve desirable in vivo pharmacokinetic and pharmacodynamic properties. GS-9620 is currently in clinical evaluation for the treatment of chronic hepatitis B (HBV) infection.

  8. Increased Expression Profile and Functionality of TLR6 in Peripheral Blood Mononuclear Cells and Hepatocytes of Morbidly Obese Patients with Non-Alcoholic Fatty Liver Disease

    PubMed Central

    Arias-Loste, María Teresa; Iruzubieta, Paula; Puente, Ángela; Ramos, David; Santa Cruz, Carolina; Estébanez, Ángel; Llerena, Susana; Alonso-Martín, Carmen; San Segundo, David; Álvarez, Lorena; López Useros, Antonio; Fábrega, Emilio; López-Hoyos, Marcos; Crespo, Javier

    2016-01-01

    Current evidence suggests that gut dysbiosis drives obesity and non-alcoholic fatty liver disease (NAFLD) pathogenesis. Toll-like receptor 2 (TLR2) and TLR6 specifically recognize components of Gram-positive bacteria. Despite the potential implications of TLR2 in NAFLD pathogenesis, the role of TLR6 has not been addressed. Our aim is to study a potential role of TLR6 in obesity-related NAFLD. Forty morbidly obese patients undergoing bariatric surgery were prospectively studied. Cell surface expression of TLR2 and TLR6 was assessed on peripheral blood mononuclear cells (PBMCs) by flow cytometry. Freshly isolated monocytes were cultured with specific TLR2/TLR6 agonists and intracellular production of cytokines was determined by flow-cytometry. In liver biopsies, the expression of TLR2 and TLR6 was analyzed by immunohistochemistry and cytokine gene expression using RT-qPCR. TLR6 expression in PBMCs from non-alcoholic steatohepatitis (NASH) patients was significantly higher when compared to those from simple steatosis. The production of pro-inflammatory cytokines in response to TLR2/TLR6 stimulation was also significantly higher in patients with lobular inflammation. Hepatocyte expression of TLR6 but not that of TLR2 was increased in NAFLD patients compared to normal liver histology. Deregulated expression and activity of peripheral TLR6 in morbidly obese patients can mirror the liver inflammatory events that are well known drivers of obesity-related NASH pathogenesis. Moreover, TLR6 is also significantly overexpressed in the hepatocytes of NAFLD patients compared to their normal counterparts. Thus, deregulated TLR6 expression may potentiate TLR2-mediated liver inflammation in NAFLD pathogenesis, and also serve as a potential peripheral biomarker of obesity-related NASH. PMID:27834919

  9. Mutations in TLR/MYD88 pathway identify a subset of young chronic lymphocytic leukemia patients with favorable outcome.

    PubMed

    Martínez-Trillos, Alejandra; Pinyol, Magda; Navarro, Alba; Aymerich, Marta; Jares, Pedro; Juan, Manel; Rozman, María; Colomer, Dolors; Delgado, Julio; Giné, Eva; González-Díaz, Marcos; Hernández-Rivas, Jesús M; Colado, Enrique; Rayón, Consolación; Payer, Angel R; Terol, Maria José; Navarro, Blanca; Quesada, Victor; Puente, Xosé S; Rozman, Ciril; López-Otín, Carlos; Campo, Elías; López-Guillermo, Armando; Villamor, Neus

    2014-06-12

    Mutations in Toll-like receptor (TLR) and myeloid differentiation primary response 88 (MYD88) genes have been found in chronic lymphocytic leukemia (CLL) at low frequency. We analyzed the incidence, clinicobiological characteristics, and outcome of patients with TLR/MYD88 mutations in 587 CLL patients. Twenty-three patients (3.9%) had mutations, 19 in MYD88 (one with concurrent IRAK1 mutation), 2 TLR2 (one with concomitant TLR6 mutation), 1 IRAK1, and 1 TLR5. No mutations were found in IRAK2 and IRAK4. TLR/MYD88-mutated CLL overexpressed genes of the nuclear factor κB pathway. Patients with TLR/MYD88 mutations were significantly younger (83% age ≤50 years) than those with no mutations. TLR/MYD88 mutations were the most frequent in young patients. Patients with mutated TLR/MYD88 CLL had a higher frequency of mutated IGHV and low expression of CD38 and ZAP-70. Overall survival (OS) was better in TLR/MYD88-mutated than unmutated patients in the whole series (10-year OS, 100% vs 62%; P = .002), and in the subset of patients age ≤50 years (100% vs 70%; P = .02). In addition, relative OS of TLR/MYD88-mutated patients was similar to that in the age- and gender-matched population. In summary, TLR/MYD88 mutations identify a population of young CLL patients with favorable outcome.

  10. Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9

    PubMed Central

    Newman, Zachary R.; Young, Janet M.; Ingolia, Nicholas T.; Barton, Gregory M.

    2016-01-01

    The innate immune system detects diverse microbial species with a limited repertoire of immune receptors that recognize nucleic acids. The cost of this immune surveillance strategy is the potential for inappropriate recognition of self-derived nucleic acids and subsequent autoimmune disease. The relative expression of two closely related receptors, Toll-like receptor (TLR) 7 and TLR9, is balanced to allow recognition of microbial nucleic acids while limiting recognition of self-derived nucleic acids. Situations that tilt this balance toward TLR7 promote inappropriate responses, including autoimmunity; therefore, tight control of expression is critical for proper homeostasis. Here we report that differences in codon bias limit TLR7 expression relative to TLR9. Codon optimization of Tlr7 increases protein levels as well as responses to ligands, but, unexpectedly, these changes only modestly affect translation. Instead, we find that much of the benefit attributed to codon optimization is actually the result of enhanced transcription. Our findings, together with other recent examples, challenge the dogma that codon optimization primarily increases translation. We propose that suboptimal codon bias, which correlates with low guanine-cytosine (GC) content, limits transcription of certain genes. This mechanism may establish low levels of proteins whose overexpression leads to particularly deleterious effects, such as TLR7. PMID:26903634

  11. TLR3 deficiency impairs spinal cord synaptic transmission, central sensitization, and pruritus in mice.

    PubMed

    Liu, Tong; Berta, Temugin; Xu, Zhen-Zhong; Park, Chul-Kyu; Zhang, Ling; Lü, Ning; Liu, Qin; Liu, Yang; Gao, Yong-Jing; Liu, Yen-Chin; Ma, Qiufu; Dong, Xinzhong; Ji, Ru-Rong

    2012-06-01

    Itch, also known as pruritus, is a common, intractable symptom of several skin diseases, such as atopic dermatitis and xerosis. TLRs mediate innate immunity and regulate neuropathic pain, but their roles in pruritus are elusive. Here, we report that scratching behaviors induced by histamine-dependent and -independent pruritogens are markedly reduced in mice lacking the Tlr3 gene. TLR3 is expressed mainly by small-sized primary sensory neurons in dorsal root ganglions (DRGs) that coexpress the itch signaling pathway components transient receptor potential subtype V1 and gastrin-releasing peptide. Notably, we found that treatment with a TLR3 agonist induces inward currents and action potentials in DRG neurons and elicited scratching in WT mice but not Tlr3(-/-) mice. Furthermore, excitatory synaptic transmission in spinal cord slices and long-term potentiation in the intact spinal cord were impaired in Tlr3(-/-) mice but not Tlr7(-/-) mice. Consequently, central sensitization-driven pain hypersensitivity, but not acute pain, was impaired in Tlr3(-/-) mice. In addition, TLR3 knockdown in DRGs also attenuated pruritus in WT mice. Finally, chronic itch in a dry skin condition was substantially reduced in Tlr3(-/-) mice. Our findings demonstrate a critical role of TLR3 in regulating sensory neuronal excitability, spinal cord synaptic transmission, and central sensitization. TLR3 may serve as a new target for developing anti-itch treatment.

  12. An efficient method for gene silencing in human primary plasmacytoid dendritic cells: silencing of the TLR7/IRF-7 pathway as a proof of concept

    PubMed Central

    Smith, Nikaïa; Vidalain, Pierre-Olivier; Nisole, Sébastien; Herbeuval, Jean-Philippe

    2016-01-01

    Plasmacytoid dendritic cells (pDC) are specialized immune cells that produce massive levels of type I interferon in response to pathogens. Unfortunately, pDC are fragile and extremely rare, rendering their functional study a tough challenge. However, because of their central role in numerous pathologies, there is a considerable need for an efficient and reproducible protocol for gene silencing in these cells. In this report, we tested six different methods for siRNA delivery into primary human pDC including viral-based, lipid-based, electroporation, and poly-ethylenimine (PEI) technologies. We show that lipid-based reagent DOTAP was extremely efficient for siRNA delivery into pDC, and did not induce cell death or pDC activation. We successfully silenced Toll-Like Receptor 7 (TLR7), CXCR4 and IFN regulatory factor 7 (IRF-7) gene expression in pDC as assessed by RT-qPCR or cytometry. Finally, we showed that TLR7 or IRF-7 silencing in pDC specifically suppressed IFN-α production upon stimulation, providing a functional validation of our transfection protocol. PMID:27412723

  13. Molecular cloning, tissue distribution, and immune function of goose TLR7.

    PubMed

    Qi, Yulin; Chen, Shun; Zhao, Qiurong; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Cheng, Anchun

    2015-02-01

    TLR7 is a transmembrane endosomal protein that plays an essential role in innate antiviral responses via the recognition of conserved viral molecular patterns. Here, we cloned the full-length cDNA of goose TLR7 and carried out a molecular characterization of goose TLR7. The goose TLR7 gene is 3900 bp and encodes a 1045 amino acid protein with high homology to poultry (93% to duck and 83% to chicken). Similar conclusions were made by phylogenetic analysis. The predicted protein secondary structure of goose TLR7 contained a conserved Toll/interleukin-1 receptor domain and characteristic leucine-rich repeat regions, which has also been reported for duck TLR7. Additionally, the tissue distribution of goose TLR7 suggests that immune-associated tissues, especially the cecal tonsil and bursa of Fabricius, have high goose TLR7 expression levels. Goose TLR7 is abundantly expressed in lung tissues, which is distinct from its expression in chickens. Similar to duck TLR7, goose spleen mononuclear cells (MNCs) exposed to the mammalian TLR7 agonists R848 and Imiquimod showed significant induction of the production of proinflammatory cytokines and IFN-α. New type gosling viral enteritis virus (NGVEV) infection resulted in high mRNA expression levels of goose TLR7 in the spleen. By contrast, no direct interaction between NGVEV and goose TLR7 was detected after infecting goose spleen MNCs with NGVEV in vitro. However, triggering of goose TLR7 resulted in the rapid up-regulation of proinflammatory cytokines and anti-viral molecules, suggesting that goose TLR7 plays an important role in anti-viral defense.

  14. The localization of Toll-like receptor 2 (TLR2) in the endometrium and the cervix of dogs at different stages of the oestrous cycle and with pyometra.

    PubMed

    Chotimanukul, S; Sirivaidyapong, S

    2012-12-01

    The aim of this study was to localize and evaluate the role of Toll-like receptor 2 (TLR2) in the endometrium and cervix of bitches at different stages of the oestrous cycle and in bitches with pyometra. Sixty-seven nulliparous dogs, ranging in age from 1 to 13 years, were allocated amongst five groups (pro-oestrus; n = 7, oestrus; n = 10, dioestrus; n = 16, anoestrus; n = 11, pyometra; n = 23). Blood samples were collected for the measurement of progesterone concentration. The mean progesterone concentration was analysed as a parameter for validating the stage of the oestrous cycle in bitches. Tissues collected from uterine horn and cervix were fixed in 4% paraformaldehyde for immunohistochemical examination of TLR2. The expression of TLR2 was assessed semi-quantitatively. No pathological changes were found in the uterine samples of healthy dogs. In bitches with pyometra, the glandular epithelium expressed TLR2 more intensely than the surface epithelium. The expression of TLR2 in the glandular epithelium was also significantly higher in healthy dogs at oestrus, dioestrus and dogs with pyometra compared with anoestrous dogs (p < 0.01). The expression of TLR2 in the stroma was not observed in the group of healthy dogs at all stages. The surface epithelium of cervix in dogs with pyometra expressed TLR2 significantly more intensely than did the stoma, whereas the expression of TLR2 during oestrus and dioestrus was absent in the stroma of cervix. This study provides the first report of immunohistochemical localization of TLR2 in the canine reproductive tract. In the present study, TLR2 was expressed in endometrial epithelium but was absent in the endometrial stroma of healthy dogs at all oestrous cycle stages. These findings suggest differential expression of TLR in endometrial cells. On the other hand, the lack of TLR2 in the stroma of healthy uteri of dogs may predispose to infection from the invading pathogens once the epithelial cells have been destroyed by the

  15. Epigenetic modification of TLR4 promotes activation of NF-κB by regulating methyl-CpG-binding domain protein 2 and Sp1 in gastric cancer

    PubMed Central

    Oh, Byung Moo; Lee, Heesoo; Uhm, Tae Gi; Min, Jeong-Ki; Park, Young-Jun; Yoon, Suk Ran; Kim, Bo-Yeon; Kim, Jong Wan; Choe, Yong-Kyung; Lee, Hee Gu

    2016-01-01

    Toll-like receptor 4 (TLR4) is important in promoting the immune response in various cancers. Recently, TLR4 is highly expressed in a stage-dependent manner in gastric cancer, but the regulatory mechanism of TLR4 expression has been not elucidated it. Here, we investigated the mechanism underlying regulation of TLR4 expression through promoter methylation and histone modification between transcriptional regulation and silencing of the TLR4 gene in gastric cancer cells. Chromatin immunoprecipitation was carried out to screen for factors related to TLR4 methylation such as MeCP2, HDAC1, and Sp1 on the TLR4 promoter. Moreover, DNA methyltransferase inhibitor 5-aza-deoxycytidine (5-aza-dC) induced demethylation of the TLR4 promoter and increased H3K4 trimethylation and Sp1 binding to reactivate silenced TLR4. In contrast, although the silence of TLR4 activated H3K9 trimethylation and MeCP2 complex, combined treatment with TLR4 agonist and 5-aza-dC upregulated H3K4 trimethylation and activated with transcription factors as Sp1 and NF-κB. This study demonstrates that recruitment of the MeCP2/HDAC1 repressor complex increases the low levels of TLR4 expression through epigenetic modification of DNA and histones on the TLR4 promoter, but Sp1 activates TLR4 high expression by hypomethylation and NF-κB signaling in gastric cancer cells. PMID:26675260

  16. High toll-like receptor (TLR) 9 expression is associated with better prognosis in surgically treated pancreatic cancer patients.

    PubMed

    Leppänen, Joni; Helminen, Olli; Huhta, Heikki; Kauppila, Joonas H; Isohookana, Joel; Haapasaari, Kirsi-Maria; Lehenkari, Petri; Saarnio, Juha; Karttunen, Tuomo J

    2017-04-01

    Pancreatic cancer remains one of the deadliest malignancies in the world. Inflammatory response and tumor environment are thought to play a major role in its pathogenesis. Knowledge on TLR expression and impact on patient survival in pancreatic cancer is limited. The study's aim was to clarify the role of different TLRs in pancreatic cancer. TLR2, TLR4, and TLR9 expression was investigated in 65 surgically resected pancreatic ductal adenocarcinoma specimens by immunohistochemistry. The association between TLR expression, clinical parameters, and local inflammatory response to the tumor was assessed using chi-square test. Relation between patient survival and TLR expression was calculated with multivariable Cox regression, adjusted for age, sex, and tumor stage. We found TLR2, TLR4, and TLR9 to be expressed in pancreatic cancer. There was no association between TLR expression and tumor stage, tumor size, lymph node metastasis, or tumor necrosis. Contrary to our initial hypothesis, high cytoplasmic TLR9 expression was associated with longer patient survival, and multivariate analysis identified low TLR9 expression as an independent risk factor for cancer-specific death (HR 3.090, 95% CI 1.673-5.706). The results suggest that high TLR9 expression in pancreatic ductal adenocarcinoma indicates improved prognosis. The prognostic effect of TLR9 might be associated with bacterial exposure, but this needs further evidence.

  17. Toll-like receptors and microbial exposure: gene-gene and gene-environment interaction in the development of atopy.

    PubMed

    Reijmerink, N E; Kerkhof, M; Bottema, R W B; Gerritsen, J; Stelma, F F; Thijs, C; van Schayck, C P; Smit, H A; Brunekreef, B; Postma, D S; Koppelman, G H

    2011-10-01

    Environmental and genetic factors contribute to atopy development. High microbial exposure may confer a protective effect on atopy. Toll-like receptors (TLRs) bind microbial products and are important in activating the immune system. To assess whether interactions between microbial exposures and genes encoding TLRs (and related genes) result in atopy, genes, environmental factors and gene-environment interactions of 66 single-nucleotide polymorphisms (SNPs) of 12 genes (TLR 1-6, 9 and 10, CD14, MD2, lipopolysaccharide-binding protein (LBP) and Dectin-1), and six proxy parameters of microbial exposure (sibship size, pets (three different parameters), day-care and intrauterine and childhood tobacco smoke exposure) were analysed for association with atopic phenotypes in 3,062 Dutch children (the Allergenic study). The presence of two or more older siblings increased the risk of developing high total immunoglobulin (Ig)E levels at different ages. This risk increased further in children aged 1-2 yrs carrying the minor allele of TLR6 SNP rs1039559. Furthermore, novel two- and three-factor gene-gene and gene-environment interactions were found (e.g. between sibship size, day-care and LBP SNP rs2232596). Larger sibship size is associated with increased total IgE levels. Furthermore, complex two- and three-factor interactions exist between genes and the environment. The TLRs and related genes interact with proxy parameters of high microbial exposure in atopy development.

  18. Investigation of the role of endosomal Toll-like receptors in murine collagen-induced arthritis reveals a potential role for TLR7 in disease maintenance

    PubMed Central

    2012-01-01

    Introduction Endosomal toll-like receptors (TLRs) have recently emerged as potential contributors to the inflammation observed in human and rodent models of rheumatoid arthritis (RA). This study aims to evaluate the role of endosomal TLRs and in particular TLR7 in the murine collagen induced arthritis (CIA) model. Methods CIA was induced by injection of collagen in complete Freund's adjuvant. To investigate the effect of endosomal TLRs in the CIA model, mianserin was administered daily from the day of disease onset. The specific role of TLR7 was examined by inducing CIA in TLR7-deficient mice. Disease progression was assessed by measuring clinical score, paw swelling, serum anti-collagen antibodies histological parameters, cytokine production and the percentage of T regulatory (Treg) cells. Results Therapeutic administration of mianserin to arthritic animals demonstrated a highly protective effect on paw swelling and joint destruction. TLR7-/- mice developed a mild arthritis, where the clinical score and paw swelling were significantly compromised in comparison to the control group. The amelioration of arthritis by mianserin and TLR7 deficiency both corresponded with a reduction in IL-17 responses, histological and clinical scores, and paw swelling. Conclusions These data highlight the potential role for endosomal TLRs in the maintenance of inflammation in RA and support the concept of a role for TLR7 in experimental arthritis models. This study also illustrates the potential benefit that may be afforded by therapeutically inhibiting the endosomal TLRs in RA. PMID:22691272

  19. Whole blood stimulation with Toll-like receptor (TLR)-7/8 and TLR-9 agonists induces interleukin-12p40 expression in plasmacytoid dendritic cells in rhesus macaques but not in humans.

    PubMed

    Koopman, G; Beenhakker, N; Burm, S; Bouwhuis, O; Bajramovic, J; Sommandas, V; Mudde, G; Mooij, P; 't Hart, B A; Bogers, W M J M

    2013-10-01

    Macaques provide important animal models in biomedical research into infectious and chronic inflammatory disease. Therefore, a proper understanding of the similarities and differences in immune function between macaques and humans is needed for adequate interpretation of the data and translation to the human situation. Dendritic cells are important as key regulators of innate and adaptive immune responses. Using a new whole blood assay we investigated functional characteristics of blood plasmacytoid dendritic cells (pDC), myeloid dendritic cells (mDC) and monocytes in rhesus macaques by studying induction of activation markers and cytokine expression upon Toll-like receptor (TLR) stimulation. In a head-to-head comparison we observed that rhesus macaque venous blood contained relatively lower numbers of pDC than human venous blood, while mDC and monocytes were present at similar percentages. In contrast to humans, pDC in rhesus macaques expressed the interleukin (IL)-12p40 subunit in response to TLR-7/8 as well as TLR-9 stimulation. Expression of IL-12p40 was confirmed by using different monoclonal antibodies and by reverse transcription-polymerase chain reaction (RT-PCR). Both in humans and rhesus macaques, TLR-4 stimulation induced IL-12p40 expression in mDC and monocytes, but not in pDC. The data show that, in contrast to humans, pDC in macaques are able to express IL-12p40, which could have consequences for evaluation of human vaccine candidates and viral infection.

  20. Copy Number Variation of TLR-7 Gene and its Association with the Development of Systemic Lupus Erythematosus in Female Patients from Yucatan Mexico

    PubMed Central

    Pacheco, Guillermo Valencia; Cruz, Darig Cámara; González Herrera, Lizbeth J; Pérez Mendoza, Gerardo J; Adrián Amaro, Guadalupe I; Nakazawa Ueji, Yumi E; Angulo Ramírez, Angélica V

    2014-01-01

    Systemic lupus erythematosus (SLE) is a systemic autoimmune disease characterized by the production of autoantibodies against self-antigens, which occurs most often in women between 15 and 40 years of age. The innate immunity is involved in the pathogenesis of SLE through TLR- 7. Genetic factors such as copy number variation (CNV) of target genes may contribute to disease development, but this possible risk has not yet been studied in SLE patients from Yucatan, Mexico. The CNV of TLR-7 gene was determined by quantitative polymerase chain reaction assay using TaqMan probes in 80 SLE women and 150 control subjects. The results showed that 10% of SLE patients exhibited more than two copies of TLR-7 gene, whereas no mRNA overexpression was detected. These data suggested that increased CNV of the TLR-7 gene in Yucatan SLE women can be a risk factor for this disease. PMID:25512712

  1. CD14 Is a Co-Receptor for TLR4 in the S100A9-Induced Pro-Inflammatory Response in Monocytes

    PubMed Central

    He, Zhifei; Riva, Matteo; Björk, Per; Swärd, Karl; Mörgelin, Matthias; Leanderson, Tomas; Ivars, Fredrik

    2016-01-01

    The cytosolic Ca2+-binding S100A9 and S100A8 proteins form heterodimers that are primarily expressed in human neutrophils and monocytes. We have recently shown that S100A9 binds to TLR4 in vitro and induces TLR4-dependent NF-κB activation and a pro-inflammatory cytokine response in monocytes. In the present report we have further investigated the S100A9-mediated stimulation of TLR4 in monocytes. Using transmission immunoelectron microscopy, we detected focal binding of S100A9 to monocyte membrane subdomains containing the caveolin-1 protein and TLR4. Furthermore, the S100A9 protein was detected in early endosomes of the stimulated cells, indicating that the protein could be internalized by endocytosis. Although stimulation of monocytes with S100A9 was strictly TLR4-dependent, binding of S100A9 to the plasma membrane and endocytosis of S100A9 was still detectable and coincided with CD14 expression in TLR4-deficient cells. We therefore investigated whether CD14 would be involved in the TLR4-dependent stimulation and could show that the S100A9-induced cytokine response was inhibited both in CD14-deficient cells and in cells exposed to CD14 blocking antibodies. Further, S100A9 was not internalized into CD14-deficient cells suggesting a direct role of CD14 in endocytosis of S100A9. Finally, we could detect satiable binding of S100A9 to CD14 in surface plasmon resonance experiments. Taken together, these results indicate that CD14 is a co-receptor of TLR4 in the S100A9-induced cytokine response. PMID:27228163

  2. PPARγ ameliorated LPS induced inflammation of HEK cell line expressing both human Toll-like receptor 4 (TLR4) and MD2.

    PubMed

    Darehgazani, Reyhaneh; Peymani, Maryam; Hashemi, Motahare-Sadat; Omrani, Mir Davood; Movafagh, Abolfazl; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

    2016-08-01

    TLR4 is transmembrane pattern-recognition receptor that initiates signals in response to diverse pathogen-associated molecular patterns especially LPS. Recently, there have been an increasing number of studies about the role of TLRs in the pathogenesis of several disorders as well as the therapeutic potential of TLR intervention in such diseases. Peroxisome proliferator-activated receptor-gamma (PPARγ) is a ligand-activated transcription factor with numerous biological effects. PPARγ has been shown to exert a potential anti-inflammatory effect through suppression of TLR4-mediated inflammation. Therefore, PPARγ agonists may have a potential to combat inflammatory conditions in pathologic states. The current study aims to show the decrease of inflammation by overexpression of PPARγ in a cell reporter model. To reach this goal, recombinant pBudCE4.1 (+) containing encoding sequences of human TLR4 and MD2 was constructed and used to transfect HEK cells. Subsequently, inflammation was induced by LPS treatment as control group. In the treatment group, overexpression of PPARγ prior to inflammation was performed and the expression of inflammatory markers was assessed in this condition. The expression of inflammatory markers (TNFα and iNOS) was defined by quantitative real time PCR and the amount of phosphorylated NF-κB was measured by western blot. Data indicated expression of TNFα and iNOS increased in LPS induced inflammation of stably transformed HEK cells with MD2 and TLR4. In this cell reporter model overexpression of PPARγ dramatically prevented LPS-induced inflammation through the blocking of TLR4/NF-κB signaling. PPARγ was shown to negatively regulate TLR4 activity and therefore exerts its anti-inflammatory action against LPS induced inflammation.

  3. Evidence for TLR4 and FcRγ-CARD9 activation by cholera toxin B subunit and its direct bindings to TREM2 and LMIR5 receptors.

    PubMed

    Phongsisay, Vongsavanh; Iizasa, Ei'ichi; Hara, Hiromitsu; Yoshida, Hiroki

    2015-08-01

    Cholera toxin (CTX) is a virulent factor of Vibrio cholerae that causes life-threatening diarrheal disease. Its non-toxic subunit CTB has been extensively studied for vaccine delivery. In immune cells, CTB induces a number of signaling molecules related to cellular activation and cytokine production. The mechanisms by which CTB exerts its immunological effects are not understood. We report here the immunological targets of CTB. The unexpected finding that GM1 ganglioside inhibited NF-κB activation in human monocytes stimulated with CTX and agonists of Toll-like receptors (TLR) suggests the possibility of CTX-TLR interaction. Indeed, CTX-induced IL-6 production was substantially reduced in MyD88(-/-) or TLR4(-/-) macrophages. Ectopic expression of TLR4 was required for CTX-induced NF-κB activation in HEK 293 cells. Furthermore, the inflammatory capacity of CTB was lost in the absence of TLR4, adaptor protein FcRγ, or its downstream signaling molecule CARD9. Attempts have been made to identify CTB-binding targets from various C-type lectin and immunoglobulin-like receptors. CTB targeted not only GM1 and TLR4 but also TREM2 and LMIR5/CD300b. CTB-TREM2 interaction initiated signal transduction through adaptor protein DAP12. The binding of CTB inhibited LMIR5 activation induced by its endogenous ligand 3-O-sulfo-β-d-galactosylceramide C24:1. In summary, CTB targets TLR4, FcRγ-CARD9, TREM2, and LMIR5. These findings provide new insights into the immunobiology of cholera toxin.

  4. Emerging Bordetella pertussis Strains Induce Enhanced Signaling of Human Pattern Recognition Receptors TLR2, NOD2 and Secretion of IL-10 by Dendritic Cells

    PubMed Central

    Hovingh, Elise S.; van Gent, Marjolein; Hamstra, Hendrik-Jan; Demkes, Marc; Mooi, Frits R.; Pinelli, Elena

    2017-01-01

    Vaccines against pertussis have been available for more than 60 years. Nonetheless, this highly contagious disease is reemerging even in countries with high vaccination coverage. Genetic changes of Bordetella pertussis over time have been suggested to contribute to the resurgence of pertussis, as these changes may favor escape from vaccine-induced immunity. Nonetheless, studies on the effects of these bacterial changes on the immune response are limited. Here, we characterize innate immune recognition and activation by a collection of genetically diverse B. pertussis strains isolated from Dutch pertussis patients before and after the introduction of the pertussis vaccines. For this purpose, we used HEK-Blue cells transfected with human pattern recognition receptors TLR2, TLR4, NOD2 and NOD1 as a high throughput system for screening innate immune recognition of more than 90 bacterial strains. Physiologically relevant human monocyte derived dendritic cells (moDC), purified from peripheral blood of healthy donors were also used. Findings indicate that, in addition to inducing TLR2 and TLR4 signaling, all B. pertussis strains activate the NOD-like receptor NOD2 but not NOD1. Furthermore, we observed a significant increase in TLR2 and NOD2, but not TLR4, activation by strains circulating after the introduction of pertussis vaccines. When using moDC, we observed that the recently circulating strains induced increased activation of these cells with a dominant IL-10 production. In addition, we observed an increased expression of surface markers including the regulatory molecule PD-L1. Expression of PD-L1 was decreased upon blocking TLR2. These in vitro findings suggest that emerging B. pertussis strains have evolved to dampen the vaccine-induced inflammatory response, which would benefit survival and transmission of this pathogen. Understanding how this disease has resurged in a highly vaccinated population is crucial for the design of improved vaccines against pertussis

  5. Lectin-like ox-LDL receptor-1 (LOX-1)-Toll-like receptor 4 (TLR4) interaction and autophagy in CATH.a differentiated cells exposed to angiotensin II.

    PubMed

    Ding, Zufeng; Liu, Shijie; Wang, Xianwei; Khaidakov, Magomed; Dai, Yao; Deng, Xiaoyan; Fan, Yubo; Xiang, David; Mehta, Jawahar L

    2015-04-01

    Toll-like receptors (TLRs) play an essential role in innate immune response. Expression of TLRs has also been linked to autophagy. As the main receptor for oxidized low-density lipoprotein (ox-LDL) on the cell surface, lectin-like ox-LDL receptor-1 (LOX-1) is upregulated by proinflammatory cytokines and has been linked to the development of autophagy. However, the relationship between LOX-1, autophagy, and TLR4 in neurons has not been defined. Here, we show that Angiotensin II (Ang II) treatment of CATH.a differentiated neuronal cells resulted in the expression of TLR4 (and associated signals MyD88 and Toll/interleukin-1 receptor domain-containing adapter-inducing interferon (TRIF)), LOX-1 autophagy. LOX-1 knockdown (transfection with specific small interfering RNA (siRNA)) resulted in reduced expression of TLR4 (and associated signals MyD88 and TRIF) and P-P38 mitogen-activated protein kinase (MAPK) and autophagy. TLR4 knockdown with siRNA resulted in reduced LOX-1 expression and autophagy, indicating a positive feedback between LOX-1 and TLR4. Knockdown of TRIF as well as MyD88 or inhibition of P38 MAPK also inhibited the expression of LOX-1 and TLR4 and autophagy. Importantly, pretreatment with 3-methyladenine (autophagy inhibitor) enhanced while rapamycin (autophagy inducer) decreased the expression of LOX-1, TLR4, and P-P38 MAPK. These studies suggest the presence of a bidirectional link between LOX-1and TLR4 in cultured CATH.a differentiated cells exposed to Ang II with an important role for autophagy in this link.

  6. Study of TLR3, TLR4 and TLR9 in breast carcinomas and their association with metastasis

    PubMed Central

    2010-01-01

    Background Toll-like receptors (TLRs) have garnered an extraordinary amount of interest in cancer research due to their role in tumor progression. By activating the production of several biological factors, TLRs induce type I interferons and other cytokines, which drive an inflammatory response and activate the adaptive immune system. The aim of this study was to investigate the expression and clinical relevance of TLR3, 4 and 9 in breast cancer. Methods The expression levels of TLR3, TLR4 and TLR9 were analyzed on tumors from 74 patients with breast cancer. The analysis was performed by immunohistochemistry. Results Samples of carcinomas with recurrence exhibited a significant increase in the mRNA levels of TLR3, TLR4 and TLR9. Tumors showed high expression of TLRs expression levels by cancer cells, especially TLR4 and 9. Nevertheless, a significant percentage of tumors also showed TLR4 expression by mononuclear inflammatory cells (21.6%) and TLR9 expression by fibroblast-like cells (57.5%). Tumors with high TLR3 expression by tumor cell or with high TLR4 expression by mononuclear inflammatory cells were significantly associated with higher probability of metastasis. However, tumours with high TLR9 expression by fibroblast-like cells were associated with low probability of metastasis. Conclusions The expression levels of TLR3, TLR4 and TLR9 have clinical interest as indicators of tumor aggressiveness in breast cancer. TLRs may represent therapeutic targets in breast cancer. PMID:21129170

  7. TLR2 — EDRN Public Portal

    Cancer.gov

    TLR2, or toll-like receptor 2, is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLR2 is involved in the innate immune response to bacterial lipoproteins and other microbial cell wall components. TLR2 also plays a role in NF-kappa-B activation, cytokine secretion and the inflammatory response.

  8. Role of Toll-like receptors and retinoic acid inducible gene I in endogenous production of type I interferon in dermatomyositis.

    PubMed

    Li, Ling; Dai, Tingjun; Lv, Jingwei; Ji, Kunqian; Liu, Junling; Zhang, Bin; Yan, Chuanzhu

    2015-08-15

    To explore the possible mechanisms implicated in the endogenous production of type I interferons within the muscle tissue of dermatomyositis (DM) patients. We detected the co-localization of plasmacytoid dendritic cells (pDCs) with Toll-like receptors (TLRs) and retinoic acid inducible gene (RIG)-I by immunohistochemistry and immunofluorescence. Western blotting confirmed the expression of TLRs and RIG-I. TLR-3 and RIG-I was preferentially expressed in the perifascicular atrophy fibers of DM. TLR-7 was only in inflammatory infiltrates of a few DM patients. TLR-4 and TLR-9 was expressed mainly in inflammatory infiltrates. Immunofluorescence showed extensive co-localization of BDCA-2 with TLR-9 and little co-localization with TLR-7. Western blotting showed upregulation of expression of TLRs and RIG-I in DM compared with the controls. Our findings indicate that endogenous production of type I IFN in DM is generated by pDCs, mainly through the TLR-9 pathway and in part by TLR-7. TLR-3 and RIG-I are implicated in the formation of perifascicular atrophy in DM.

  9. Orostachys japonicus Inhibits Expression of the TLR4, NOD2, iNOS, and COX-2 Genes in LPS-Stimulated Human PMA-Differentiated THP-1 Cells by Inhibiting NF-κB and MAPK Activation

    PubMed Central

    Woo, Hong-Jung; Kim, Youngchul

    2015-01-01

    Orostachys japonicus is traditionally used as an inflammatory agent. In this report, we investigated the effects of O. japonicus extract on the expression of genes encoding pathogen-recognition receptors (TLR2, TLR4, NOD1, and NOD2) and proinflammatory factors (iNOS, COX-2, and cytokines) in LPS-stimulated PMA-differentiated THP-1 cells and the NF-κB and MAPK pathways. O. japonicus induced toxicity at high concentrations but had no effect at concentrations lower than 25 μg/mL. O. japonicus inhibited LPS-induced TLR4 and NOD2 mRNA levels, suppressed LPS-induced iNOS and COX-2 transcription and translocation, and downregulated LPS-induced proinflammatory cytokine (IL-1β, IL-6, IL-8, and TNF-α) mRNA levels. In addition, O. japonicus inhibited LPS-induced NF-κB activation and IκBα degradation and suppressed LPS-induced JNK, p38 MAPK, and ERK phosphorylation. Overall, our results demonstrate that the anti-inflammatory effects of O. japonicus are mediated by suppression of NF-κB and MAPK signaling, resulting in reduced TLR4, NOD2, iNOS, and COX-2 expression and inhibition of inflammatory cytokine expression. PMID:25810745

  10. Expression of TLR2 and TLR4 in murine small intestine during postnatal development.

    PubMed

    Inoue, Ryo; Yajima, Takaji; Tsukahara, Takamitsu

    2017-02-01

    The important role played by the gut microbiota in host immunity is mediated, in part, through toll-like receptors (TLRs). We evaluated the postnatal changes in expression of TLR2 and TLR4 in the murine small intestine and assessed how expression is influenced by gut microbiota. The expression of TLR2 and TLR4 in the murine small intestine was highly dynamic during development. The changes were especially profound during the suckling period, with the maximal mRNA levels detected in the mid-suckling period. Immunohistochemical and flow-cytometric analyses indicated that the changes in TLR2 and TLR4 expression involve primarily epithelial cells. The germ-free mice showed minor changes in TLR2/TLR4 mRNA and TLR2 protein during the suckling period. This study demonstrated that the postnatal expression of TLR2 and TLR4 in small intestinal epithelial cells is dynamic and depends on the presence of commensal intestinal microbiota.

  11. The autoimmunity-associated gene PTPN22 potentiates toll-like receptor-driven, type 1 interferon-dependent immunity.

    PubMed

    Wang, Yaya; Shaked, Iftach; Stanford, Stephanie M; Zhou, Wenbo; Curtsinger, Julie M; Mikulski, Zbigniew; Shaheen, Zachary R; Cheng, Genhong; Sawatzke, Kristy; Campbell, Amanda M; Auger, Jennifer L; Bilgic, Hatice; Shoyama, Fernanda M; Schmeling, David O; Balfour, Henry H; Hasegawa, Kiminori; Chan, Andrew C; Corbett, John A; Binstadt, Bryce A; Mescher, Matthew F; Ley, Klaus; Bottini, Nunzio; Peterson, Erik J

    2013-07-25

    Immune cells sense microbial products through Toll-like receptors (TLR), which trigger host defense responses including type 1 interferons (IFNs) secretion. A coding polymorphism in the protein tyrosine phosphatase nonreceptor type 22 (PTPN22) gene is a susceptibility allele for human autoimmune and infectious disease. We report that Ptpn22 selectively regulated type 1 IFN production after TLR engagement in myeloid cells. Ptpn22 promoted host antiviral responses and was critical for TLR agonist-induced, type 1 IFN-dependent suppression of inflammation in colitis and arthritis. PTPN22 directly associated with TNF receptor-associated factor 3 (TRAF3) and promotes TRAF3 lysine 63-linked ubiquitination. The disease-associated PTPN22W variant failed to promote TRAF3 ubiquitination, type 1 IFN upregulation, and type 1 IFN-dependent suppression of arthritis. The findings establish a candidate innate immune mechanism of action for a human autoimmunity "risk" gene in the regulation of host defense and inflammation.

  12. B cell-intrinsic TLR7 signaling is essential for the development of spontaneous germinal centers

    PubMed Central

    Soni, Chetna; Wong, Eric B.; Domeier, Phillip P.; Khan, Tahsin N.; Satoh, Takashi; Akira, Shizuo; Rahman, Ziaur S.M.

    2014-01-01

    Spontaneous germinal center (Spt-GC) B cells and follicular helper T cells (Tfh) generate high affinity autoantibodies involved in the development of systemic lupus erythematosus (SLE). Toll like receptors (TLRs) play a pivotal role in SLE pathogenesis. While previous studies have focused on the B cell intrinsic role of TLR-MyD88 signaling on immune activation, autoantibody repertoire and systemic inflammation, a thorough investigation of the mechanisms by which TLRs control the formation of Spt-GCs remains unclear. Using non-autoimmune C57BL/6 (B6) mice deficient in MyD88, TLR2, 3, 4, 7 or 9, we identified B cell-intrinsic TLR7 signaling as a prerequisite to Spt-GC formation without the confounding effects of autoimmune susceptibility genes and the overexpression of TLRs. TLR7 deficiency also rendered autoimmune B6.Sle1b mice unable to form Spt-GCs, leading to markedly decreased autoantibodies. Conversely, B6.yaa and B6.Sle1b.yaa mice expressing an extra copy of TLR7 and B6.Sle1b mice treated with a TLR7 agonist had increased Spt-GCs and Tfh. Further, TLR7/ MyD88 deficiency led to compromised B cell proliferation and survival after B cell stimulation both in vitro and in vivo. In contrast, TLR9 inhibited Spt-GC development. Our findings demonstrate an absolute requirement of TLR7 and a negative regulatory function for TLR9 in Spt-GC formation under non-autoimmune and autoimmune conditions. Our data suggest that, under non-autoimmune conditions, Spt-GCs initiated by TLR7 produce protective antibodies. However, in the presence of autoimmune susceptibility genes, TLR7 dependent Spt-GCs produce pathogenic autoantibodies. Thus, a single copy of TLR7 in B cells is the minimal requirement for breaking the GC-tolerance checkpoint. PMID:25252960

  13. Tissue factor and Toll-like receptor (TLR)4 in hyperglycaemia-hyperinsulinaemia. Effects in healthy subjects, and type 1 and type 2 diabetes mellitus.

    PubMed

    Singh, Anamika; Boden, Guenther; Rao, A Koneti

    2015-04-01

    Diabetes mellitus (DM) patients have an increased incidence of cardiovascular events. Blood tissue factor-procoagulant activity (TF-PCA), the initiating mechanism for blood coagulation, is elevated in DM. We have shown that hyperglycaemia (HG), hyperinsulinaemia (HI) and combined HG+HI (induced using 24-hour infusion clamps) increases TF-PCA in healthy and type 2 DM (T2DM) subjects, but not in type 1 DM (T1DM) subjects. The mechanisms for this are unknown. DM patients have elevated plasma lipopolysaccharide (LPS), a toll-like receptor (TLR) 4 ligand. We postulated that TLR4 plays a role in modulating TF levels. We studied the effect of HG+HI on TLR4 and TF-PCA in vivo during 24-hour HG+HI infusion clamps in healthy subjects, and T1DM and T2DM subjects, and in vitro in blood. In vivo, in healthy subjects, 24-hour HG + HI infusion increased TLR4 six-fold, which correlated with TF-PCA (r= 0.91, p<0.0001). T2DM patients showed smaller increases in both. In T1DM subjects, TLR4 declined (50%, p<0.05) and correlated with TF-PCA (r=0.55; p<0.05). In vitro, HG (200 mg/dl added glucose) and HI (1-100 nM added insulin) increased TF-PCA in healthy subjects (~2-fold, 2-4 hours). Insulin inhibited by ~30% LPS-induced increase in TF-PCA and high glucose reversed it. TLR4 levels paralleled TF-PCA (r=0.71, p<0.0001); HG and HI increased TLR4 and insulin inhibited LPS-induced TLR4 increase. This is first evidence that even in healthy subjects, HG of short duration increases TLR4 and TF-PCA, key players in inflammation and thrombosis. TLR4-TF interplay is strikingly different in non-diabetic, T1DM and T2DM subjects.

  14. Characterization and comprehensive analysis of the miiuy croaker TLR2 reveals a direct evidence for intron insert and loss.

    PubMed

    Xu, Tianjun; Meng, Fanxing; Zhu, Zhihuang; Wang, Rixin

    2013-01-01

    Toll-like receptor 2 (TLR2) is a member of an ancient pattern recognition receptor family, conserved from insects to mammals and it is best known as a receptor for recognizing conserved components of Gram-positive bacteria. In present study, the genomic structure of TLR2 gene from miiuy croaker was identified and characterized. It comprises twelve exons and eleven introns. The lengths of exons 3 to 10 of miiuy croaker TLR2 and exons 2 to 9 of fugu and pufferfish TLR2 are exactly the same, but most importantly, both of fugu and pufferfish have only eleven exons and ten introns. An intron insert event probably happened on exon 1 of miiuy croaker TLR2 after its divergence from ancestor of zebrafish, and an intron loss event probably happened on those of Tetraodontiformes TLR2 after the divergence with ancestor of miiuy croaker. Our study showed the direct evidence and strongly supported the intron insert and loss on fish TLR2. The pathogen injection experiments indicated that TLR2 might not be an important responder to Gram-negative bacteria in miiuy croaker. Molecular evolutionary analyses indicated TLR2 genes were under strong purifying selection pressure, showing a quite strong functional constraint in both of fish and mammals, despite of their distinct living environment conditions.

  15. Mechanism of bacterial interference with TLR4 signaling by Brucella Toll/interleukin-1 receptor domain-containing protein TcpB.

    PubMed

    Alaidarous, Mohammed; Ve, Thomas; Casey, Lachlan W; Valkov, Eugene; Ericsson, Daniel J; Ullah, M Obayed; Schembri, Mark A; Mansell, Ashley; Sweet, Matthew J; Kobe, Bostjan

    2014-01-10

    Upon activation of Toll-like receptors (TLRs), cytoplasmic Toll/interleukin-1 receptor (TIR) domains of the receptors undergo homo- or heterodimerization. This in turn leads to the recruitment of adaptor proteins, activation of transcription factors, and the secretion of pro-inflammatory cytokines. Recent studies have described the TIR domain-containing protein from Brucella melitensis, TcpB (BtpA/Btp1), to be involved in virulence and suppression of host innate immune responses. TcpB interferes with TLR4 and TLR2 signaling pathways by a mechanism that remains controversial. In this study, we show using co-immunoprecipitation analyses that TcpB interacts with MAL, MyD88, and TLR4 but interferes only with the MAL-TLR4 interaction. We present the crystal structure of the TcpB TIR domain, which reveals significant structural differences in the loop regions compared with other TIR domain structures. We demonstrate that TcpB forms a dimer in solution, and the crystal structure reveals the dimerization interface, which we validate by mutagenesis and biophysical studies. Our study advances the understanding of the molecular mechanisms of host immunosuppression by bacterial pathogens.

  16. Activation of TLR3 in keratinocytes increases expression of genes involved in formation of the epidermis, lipid accumulation and epidermal organelles

    PubMed Central

    Borkowski, Andrew W.; Park, Kyungho; Uchida, Yoshikazu; Gallo, Richard L.

    2013-01-01

    Injury to the skin, and the subsequent release of non-coding double-stranded RNA from necrotic keratinocytes, has been identified as an endogenous activator of Toll-like receptor 3 (TLR3). Since changes in keratinocyte growth and differentiation follow injury, we hypothesized that TLR3 might trigger some elements of the barrier repair program in keratinocytes. Double-stranded RNA was observed to induce TLR3-dependent increases in human keratinocyte mRNA abundance for ABCA12 (ATP-binding cassette, sub-family A, member 12), glucocerebrosidase, acid sphingomyelinase, and transglutaminase 1. Additionally, treatment with double-stranded RNA resulted in increases in sphingomyelin and morphologic changes including increased epidermal lipid staining by oil-red O and TLR3-dependent increases in lamellar bodies and keratohyalin granules. These observations show that double-stranded RNA can stimulate some events in keratinocytes that are important for skin barrier repair and maintenance. PMID:23353987

  17. Identification and immune functional characterization of pigeon TLR7.

    PubMed

    Xiong, Dan; Song, Li; Pan, Zhiming; Chen, Xiang; Geng, Shizhong; Jiao, Xinan

    2015-04-14

    Toll-like receptor 7 (TLR7) is activated by single-stranded RNA and synthetic imidazoquinoline components, and induces interferon production. In this study, we cloned the TLR7 gene from King pigeon (Columba livia). The TLR7 open reading frame is 3144 bp and encodes a 1047-amino acid protein, consisting of a canonical TLR composition with 15 leucine-rich repeats (LRRs). Amino acid-inserting modifications were found at position 15 of LRR2, LRR11, LRR13, and LRR14 and position 10 of LRR10. The tissue distribution of pigeon TLR7 suggests that immune-associated tissues, especially the spleen and liver, have high TLR7 expression. HEK293T cells transfected with pigeon TLR7 plasmid responded to the agonist R848, indicating a functional TLR7 homolog. Following R848 stimulation of pigeon peripheral blood mononuclear cells, the levels of IFN-γ, IL-6, IL-8, CCL5, and IL-10 mRNA, assessed using quantitative real-time PCR, were significantly up-regulated. After Newcastle disease virus vaccine strain LaSota inoculation and agonist R848 injection, the level of TLR7 mRNA in the spleen of pigeons increased significantly in the R848-injected group, but decreased in the LaSota-inoculated group at three day post-infection (d.p.i.). The mRNA levels of inflammatory cytokines and chemokines were significantly upregulated in both LaSota-inoculated and R848-injected groups. Triggering pigeon TLR7 leads to robust up-regulation of inflammatory cytokines and chemokines, suggesting an important role in the innate immune response.

  18. Prevention and mitigation of acute radiation syndrome in mice by synthetic lipopeptide agonists of Toll-like receptor 2 (TLR2).

    PubMed

    Shakhov, Alexander N; Singh, Vijay K; Bone, Frederick; Cheney, Alec; Kononov, Yevgeniy; Krasnov, Peter; Bratanova-Toshkova, Troitza K; Shakhova, Vera V; Young, Jason; Weil, Michael M; Panoskaltsis-Mortari, Angela; Orschell, Christie M; Baker, Patricia S; Gudkov, Andrei; Feinstein, Elena

    2012-01-01

    Bacterial lipoproteins (BLP) induce innate immune responses in mammals by activating heterodimeric receptor complexes containing Toll-like receptor 2 (TLR2). TLR2 signaling results in nuclear factor-kappaB (NF-κB)-dependent upregulation of anti-apoptotic factors, anti-oxidants and cytokines, all of which have been implicated in radiation protection. Here we demonstrate that synthetic lipopeptides (sLP) that mimic the structure of naturally occurring mycoplasmal BLP significantly increase mouse survival following lethal total body irradiation (TBI) when administered between 48 hours before and 24 hours after irradiation. The TBI dose ranges against which sLP are effective indicate that sLP primarily impact the hematopoietic (HP) component of acute radiation syndrome. Indeed, sLP treatment accelerated recovery of bone marrow (BM) and spleen cellularity and ameliorated thrombocytopenia of irradiated mice. sLP did not improve survival of irradiated TLR2-knockout mice, confirming that sLP-mediated radioprotection requires TLR2. However, sLP was radioprotective in chimeric mice containing TLR2-null BM on a wild type background, indicating that radioprotection of the HP system by sLP is, at least in part, indirect and initiated in non-BM cells. sLP injection resulted in strong transient induction of multiple cytokines with known roles in hematopoiesis, including granulocyte colony-stimulating factor (G-CSF), keratinocyte chemoattractant (KC) and interleukin-6 (IL-6). sLP-induced cytokines, particularly G-CSF, are likely mediators of the radioprotective/mitigative activity of sLP. This study illustrates the strong potential of LP-based TLR2 agonists for anti-radiation prophylaxis and therapy in defense and medical scenarios.

  19. Prevention and Mitigation of Acute Radiation Syndrome in Mice by Synthetic Lipopeptide Agonists of Toll-Like Receptor 2 (TLR2)

    PubMed Central

    Shakhov, Alexander N.; Singh, Vijay K.; Bone, Frederick; Cheney, Alec; Kononov, Yevgeniy; Krasnov, Peter; Bratanova-Toshkova, Troitza K.; Shakhova, Vera V.; Young, Jason; Weil, Michael M.; Panoskaltsis-Mortari, Angela; Orschell, Christie M.; Baker, Patricia S.; Gudkov, Andrei; Feinstein, Elena

    2012-01-01

    Bacterial lipoproteins (BLP) induce innate immune responses in mammals by activating heterodimeric receptor complexes containing Toll-like receptor 2 (TLR2). TLR2 signaling results in nuclear factor-kappaB (NF-κB)-dependent upregulation of anti-apoptotic factors, anti-oxidants and cytokines, all of which have been implicated in radiation protection. Here we demonstrate that synthetic lipopeptides (sLP) that mimic the structure of naturally occurring mycoplasmal BLP significantly increase mouse survival following lethal total body irradiation (TBI) when administered between 48 hours before and 24 hours after irradiation. The TBI dose ranges against which sLP are effective indicate that sLP primarily impact the hematopoietic (HP) component of acute radiation syndrome. Indeed, sLP treatment accelerated recovery of bone marrow (BM) and spleen cellularity and ameliorated thrombocytopenia of irradiated mice. sLP did not improve survival of irradiated TLR2-knockout mice, confirming that sLP-mediated radioprotection requires TLR2. However, sLP was radioprotective in chimeric mice containing TLR2-null BM on a wild type background, indicating that radioprotection of the HP system by sLP is, at least in part, indirect and initiated in non-BM cells. sLP injection resulted in strong transient induction of multiple cytokines with known roles in hematopoiesis, including granulocyte colony-stimulating factor (G-CSF), keratinocyte chemoattractant (KC) and interleukin-6 (IL-6). sLP-induced cytokines, particularly G-CSF, are likely mediators of the radioprotective/mitigative activity of sLP. This study illustrates the strong potential of LP-based TLR2 agonists for anti-radiation prophylaxis and therapy in defense and medical scenarios. PMID:22479357

  20. Oligonucleotides designed to inhibit TLR9 block Herpes simplex virus type 1 infection at multiple steps.

    PubMed

    Sauter, Monica M; Gauger, Joshua J L; Brandt, Curtis R

    2014-09-01

    Herpes simplex virus type 1 (HSV-1) is an important human pathogen which requires activation of nuclear factor-kappa B (NFκB) during its replication cycle. The persistent nature of HSV-1 infection, and the emergence of drug-resistant strains, highlights the importance of research to develop new antiviral agents. Toll-like receptors (TLRs) play a prominent role during the early antiviral response by recognizing viral nucleic acid and gene products, activating NFκB, and stimulating the production of inflammatory cytokines. We demonstrate a significant effect on HSV-1 replication in ARPE-19 and Vero cells when oligonucleotides designed to inhibit TLR9 are added 2h prior to infection. A greater than 90% reduction in the yield of infectious virus was achieved at oligonucleotide concentrations of 10-20 μM. TLR9 inhibitory oligonucleotides prevented expression of essential immediate early herpes gene products as determined by immunofluorescence microscopy and Western blotting. TLR9 oligonucleotides also interfered with viral attachment and entry. A TLR9 inhibitory oligonucleotide containing five adjacent guanosine residues (G-ODN) exhibited virucidal activity and inhibited HSV-1 replication when added post-infection. The antiviral effect of the TLR9 inhibitory oligonucleotides did not depend on the presence of TLR9 protein, suggesting a mechanism of inhibition that is not TLR9 specific. TLR9 inhibitory oligonucleotides also reduced NFκB activity in nuclear extracts. Studies using these TLR inhibitors in the context of viral infection should be interpreted with caution.

  1. TLR signaling in the gut in health and disease.

    PubMed

    Abreu, Maria T; Fukata, Masayuki; Arditi, Moshe

    2005-04-15

    The human intestine has evolved in the presence of diverse enteric microflora. TLRs convert the recognition of pathogen-associated molecules in the gut into signals for anti-microbial peptide expression, barrier fortification, and proliferation of epithelial cells. Healing of injured intestinal epithelium and clearance of intramucosal bacteria require the presence of intact TLR signaling. Nucleotide oligomerization domain (Nod)1 and Nod2 are additional pattern recognition receptors that are required for defense against invasive enteric pathogens. Through spatial and functional localization of TLR and Nod molecules, the normal gut maintains a state of controlled inflammation. By contrast, patients with inflammatory bowel disease demonstrate inflammation in response to the normal flora. A subset of these patients carry polymorphisms in TLR and CARD15/NOD2 genes. A better understanding of the delicate regulation of TLR and Nod molecules in the gut may lead to improved treatment for enteric infections and idiopathic inflammatory bowel diseases.

  2. The interaction between farming/rural environment and TLR2, TLR4, TLR6 and CD14 genetic polymorphisms in relation to early- and late-onset asthma

    PubMed Central

    Lau, Melisa Y. Z.; Dharmage, Shyamali C.; Burgess, John A.; Win, Aung K.; Lowe, Adrian J.; Lodge, Caroline; Perret, Jennifer; Hui, Jennie; Thomas, Paul S.; Morrison, Stephen; Giles, Graham G.; Hopper, John; Abramson, Michael J.; Walters, E. Haydn; Matheson, Melanie C.

    2017-01-01

    Asthma phenotypes based on age-of-onset may be differently influenced by the interaction between variation in toll-like receptor (TLR)/CD14 genes and environmental microbes. We examined the associations between single-nucleotide polymorphisms (SNP) in the TLR/CD14 genes and asthma, and their interaction with proxies of microbial exposure (childhood farm exposure and childhood rural environment). Ten SNPs in four genes (TLR2, TLR4, TLR6, CD14) were genotyped for 1,116 participants from the Tasmanian Longitudinal Health Study (TAHS). Using prospectively collected information, asthma was classified as never, early- (before 13 years) or late-onset (after 13 years). Information on childhood farm exposure/childhood rural environment was collected at baseline. Those with early-onset asthma were more likely to be males, had a family history of allergy and a personal history of childhood atopy. We found significant interaction between TLR6 SNPs and childhood farm exposure. For those with childhood farm exposure, carriers of the TLR6-rs1039559 T-allele (p-interaction = 0.009) and TLR6-rs5743810 C-allele (p-interaction = 0.02) were associated with lower risk of early-onset asthma. We suggest the findings to be interpreted as hypothesis-generating as the interaction effect did not withstand correction for multiple testing. In this large, population-based longitudinal study, we found that the risk of early- and late-onset asthma is differently influenced by the interaction between childhood farming exposure and genetic variations. PMID:28262750

  3. The dual role of TLR3 in metastatic cell line.

    PubMed

    Matijevic, Tanja; Pavelic, Jasminka

    2011-10-01

    Toll-like receptors (TLRs) are members of transmembrane proteins that recognize conserved molecular motifs of viral and bacterial origin and initiate innate immune response. As the role of TLRs in tumors cells is still not clear, our aim was to investigate the role of TLR3 in primary tumor and metastatic cells (SW480, SW620, FaDu and Detroit 562). We have reported here on the dual role of TLR3 in pharynx metastatic cell line (Detroit 562); on one hand TLR3 activation drove cells to apoptosis while on the other its stimulation contributed to tumor progression by altering the expression of tumor promoting genes (PLAUR, RORB) and enhancing the cell migration potential. In addition, we have shown TLR3 signaling pathway is functional in another metastatic cancer cell line (SW620) suggesting TLR3 might be important in the process of tumor metastasis. Since TLR3 agonists have been used in tumor therapy with the aim to activate immune system, scientific contribution of this work is drawing attention to the importance of further work on this topic, especially pro-tumor effect of TLR3, in order to avoid possible side-effects.

  4. Moraxella catarrhalis activates murine macrophages through multiple toll like receptors and has reduced clearance in lungs from TLR4 mutant mice.

    PubMed

    Hassan, Ferdaus; Ren, Dabin; Zhang, Wenhong; Merkel, Tod J; Gu, Xin-Xing

    2012-01-01

    Moraxella catarrhalis is a gram negative bacterium and a leading causative agent of otitis media (OM) in children. Several recent reports have provided strong evidence for an association between toll like receptors and OM. It has been found that both Streptococcus pneumoniae and nontypeable Haemophilus influenzae activate host protective immune responses through toll like receptors (TLRs), however, the precise mechanism by which Moraxella catarrhalis initiates the host immune response is currently unknown. In this report, using murine macrophages generated from a series of knock-out mice, we have demonstrated that M. catarrhalis lipooligosaccharide (LOS) and either heat killed or live bacteria are recognized by one or more TLRs. LOS activates the host immune response through a membrane bound CD14-TLR4 complex, while both heat killed and live M.cat require recognition by multiple toll like receptors such as TLR2, TLR4 and TLR9 without the requirement of CD14. We have also shown that M.cat stimuli are capable of triggering the host innate immune response by both MyD88- and TRIF- dependent signaling pathways. We further showed that M.cat induced activation of mitogen activated protein kinase (MAPK) is essential in order to achieve optimal secretion of pro-inflammatory cytokine TNF-α. We finally showed that TLR4 mutant C3H/HeJ mice produce significantly lower levels of pro-inflammatory cytokines TNF-α and IL-6 in vivo, An increased bacterial loads at 12 and 24 hours (P<0.001) in their lungs upon challenge with live M.cat in an aerosol chamber compared to wild-type (WT) control mice. These data suggest that TLRs are crucial for an effective innate immune response induced by M.cat. The results of these studies contribute to an increased understanding of molecular mechanism and possible novel treatment strategies for diseases caused by M.cat by specifically targeting TLRs and their signaling pathways.

  5. Toll-like receptor 2 (TLR2), transforming growth factor-β, hyaluronan (HA), and receptor for HA-mediated motility (RHAMM) are required for surfactant protein A-stimulated macrophage chemotaxis.

    PubMed

    Foley, Joseph P; Lam, David; Jiang, Hongmei; Liao, Jie; Cheong, Naeun; McDevitt, Theresa M; Zaman, Aisha; Wright, Jo Rae; Savani, Rashmin C

    2012-10-26

    The innate immune system protects the host from bacterial and viral invasion. Surfactant protein A (SPA), a lung-specific collectin, stimulates macrophage chemotaxis. However, the mechanisms regulating this function are unknown. Hyaluronan (HA) and its receptors RHAMM (receptor for HA-mediated motility, CD168) and CD44 also regulate cell migration and inflammation. We therefore examined the role of HA, RHAMM, and CD44 in SPA-stimulated macrophage chemotaxis. Using antibody blockade and murine macrophages, SPA-stimulated macrophage chemotaxis was dependent on TLR2 but not the other SPA receptors examined. Anti-TLR2 blocked SPA-induced production of TGFβ. In turn, TGFβ1-stimulated chemotaxis was inhibited by HA-binding peptide and anti-RHAMM antibody but not anti-TLR2 antibody. Macrophages from TLR2(-/-) mice failed to migrate in response to SPA but responded normally to TGFβ1 and HA, effects that were blocked by anti-RHAMM antibody. Macrophages from WT and CD44(-/-) mice had similar responses to SPA, whereas those from RHAMM(-/-) mice had decreased chemotaxis to SPA, TGFβ1, and HA. In primary macrophages, SPA-stimulated TGFβ production was dependent on TLR2, JNK, and ERK but not p38. Pam3Cys, a specific TLR2 agonist, stimulated phosphorylation of JNK, ERK, and p38, but only JNK and ERK inhibition blocked Pam3Cys-stimulated chemotaxis. We have uncovered a novel pathway for SPA-stimulated macrophage chemotaxis where SPA stimulation via TLR2 drives JNK- and ERK-dependent TGFβ production. TGFβ1, in turn, stimulates macrophage chemotaxis in a RHAMM and HA-dependent manner. These findings are highly relevant to the regulation of innate immune responses by SPA with key roles for specific components of the extracellular matrix.

  6. Toll-like Receptor 2 (TLR2), Transforming Growth Factor-β, Hyaluronan (HA), and Receptor for HA-mediated Motility (RHAMM) Are Required for Surfactant Protein A-stimulated Macrophage Chemotaxis*

    PubMed Central

    Foley, Joseph P.; Lam, David; Jiang, Hongmei; Liao, Jie; Cheong, Naeun; McDevitt, Theresa M.; Zaman, Aisha; Wright, Jo Rae; Savani, Rashmin C.

    2012-01-01

    The innate immune system protects the host from bacterial and viral invasion. Surfactant protein A (SPA), a lung-specific collectin, stimulates macrophage chemotaxis. However, the mechanisms regulating this function are unknown. Hyaluronan (HA) and its receptors RHAMM (receptor for HA- mediated motility, CD168) and CD44 also regulate cell migration and inflammation. We therefore examined the role of HA, RHAMM, and CD44 in SPA-stimulated macrophage chemotaxis. Using antibody blockade and murine macrophages, SPA-stimulated macrophage chemotaxis was dependent on TLR2 but not the other SPA receptors examined. Anti-TLR2 blocked SPA-induced production of TGFβ. In turn, TGFβ1-stimulated chemotaxis was inhibited by HA-binding peptide and anti-RHAMM antibody but not anti-TLR2 antibody. Macrophages from TLR2−/− mice failed to migrate in response to SPA but responded normally to TGFβ1 and HA, effects that were blocked by anti-RHAMM antibody. Macrophages from WT and CD44−/− mice had similar responses to SPA, whereas those from RHAMM−/− mice had decreased chemotaxis to SPA, TGFβ1, and HA. In primary macrophages, SPA-stimulated TGFβ production was dependent on TLR2, JNK, and ERK but not p38. Pam3Cys, a specific TLR2 agonist, stimulated phosphorylation of JNK, ERK, and p38, but only JNK and ERK inhibition blocked Pam3Cys-stimulated chemotaxis. We have uncovered a novel pathway for SPA-stimulated macrophage chemotaxis where SPA stimulation via TLR2 drives JNK- and ERK-dependent TGFβ production. TGFβ1, in turn, stimulates macrophage chemotaxis in a RHAMM and HA-dependent manner. These findings are highly relevant to the regulation of innate immune responses by SPA with key roles for specific components of the extracellular matrix. PMID:22948158

  7. Lipid-induced insulin resistance mediated by the proinflammatory receptor TLR4 requires saturated fatty acid-induced ceramide biosynthesis in mice.

    PubMed

    Holland, William L; Bikman, Benjamin T; Wang, Li-Ping; Yuguang, Guan; Sargent, Katherine M; Bulchand, Sarada; Knotts, Trina A; Shui, Guanghou; Clegg, Deborah J; Wenk, Markus R; Pagliassotti, Michael J; Scherer, Philipp E; Summers, Scott A

    2011-05-01

    Obesity is associated with an enhanced inflammatory response that exacerbates insulin resistance and contributes to diabetes, atherosclerosis, and cardiovascular disease. One mechanism accounting for the increased inflammation associated with obesity is activation of the innate immune signaling pathway triggered by TLR4 recognition of saturated fatty acids, an event that is essential for lipid-induced insulin resistance. Using in vitro and in vivo systems to model lipid induction of TLR4-dependent inflammatory events in rodents, we show here that TLR4 is an upstream signaling component required for saturated fatty acid-induced ceramide biosynthesis. This increase in ceramide production was associated with the upregulation of genes driving ceramide biosynthesis, an event dependent of the activity of the proinflammatory kinase IKKβ. Importantly, increased ceramide production was not required for TLR4-dependent induction of inflammatory cytokines, but it was essential for TLR4-dependent insulin resistance. These findings suggest that sphingolipids such as ceramide might be key components of the signaling networks that link lipid-induced inflammatory pathways to the antagonism of insulin action that contributes to diabetes.

  8. Lipid-induced insulin resistance mediated by the proinflammatory receptor TLR4 requires saturated fatty acid–induced ceramide biosynthesis in mice

    PubMed Central

    Holland, William L.; Bikman, Benjamin T.; Wang, Li-Ping; Yuguang, Guan; Sargent, Katherine M.; Bulchand, Sarada; Knotts, Trina A.; Shui, Guanghou; Clegg, Deborah J.; Wenk, Markus R.; Pagliassotti, Michael J.; Scherer, Philipp E.; Summers, Scott A.

    2011-01-01

    Obesity is associated with an enhanced inflammatory response that exacerbates insulin resistance and contributes to diabetes, atherosclerosis, and cardiovascular disease. One mechanism accounting for the increased inflammation associated with obesity is activation of the innate immune signaling pathway triggered by TLR4 recognition of saturated fatty acids, an event that is essential for lipid-induced insulin resistance. Using in vitro and in vivo systems to model lipid induction of TLR4-dependent inflammatory events in rodents, we show here that TLR4 is an upstream signaling component required for saturated fatty acid–induced ceramide biosynthesis. This increase in ceramide production was associated with the upregulation of genes driving ceramide biosynthesis, an event dependent of the activity of the proinflammatory kinase IKKβ. Importantly, increased ceramide production was not required for TLR4-dependent induction of inflammatory cytokines, but it was essential for TLR4-dependent insulin resistance. These findings suggest that sphingolipids such as ceramide might be key components of the signaling networks that link lipid-induced inflammatory pathways to the antagonism of insulin action that contributes to diabetes. PMID:21490391

  9. The Role of TLR2, TLR4, and TLR9 in the Pathogenesis of Atherosclerosis

    PubMed Central

    2016-01-01

    Toll-like receptors (TLRs) are key players in the pathogenesis of inflammatory conditions including coronary arterial disease (CAD). They are expressed by a variety of immune cells where they recognize pathogen-associated molecular patterns (PAMPs). TLRs recruit adaptor molecules, including myeloid differentiation primary response protein (MYD88) and TIRF-related adaptor protein (TRAM), to mediate activation of MAPKs and NF-kappa B pathways. They are associated with the development of CAD through various mechanisms. TLR4 is expressed in lipid-rich and atherosclerotic plaques. In TLR2−/− and TLR4−/− mice, atherosclerosis-associated inflammation was diminished. Moreover, TLR2 and TLR4 may induce expression of Wnt5a in advanced staged atheromatous plaque leading to activation of the inflammatory processes. TLR9 is activated by CpG motifs in nucleic acids and have been implicated in macrophage activation and the uptake of oxLDL from the circulation. Furthermore, TLR9 also stimulates interferon-α (INF-α) secretion and increases cytotoxic activity of CD4+ T-cells towards coronary artery tunica media smooth muscle cells. This review outlines the pathophysiological role of TLR2, TLR4, and TLR9 in atherosclerosis, focusing on evidence from animal models of the disease. PMID:27795867

  10. A pilot study examining the impact of exercise training on skeletal muscle genes related to the TLR signaling pathway in older adults following hip fracture recovery.

    PubMed

    McKenzie, Alec I; Briggs, Robert A; Barrows, Katherine M; Nelson, Daniel S; Kwon, Oh Sung; Hopkins, Paul N; Higgins, Thomas F; Marcus, Robin L; Drummond, Micah J

    2017-01-01

    Older adults after hip fracture surgery experience progressive muscle atrophy and weakness, limiting full recovery. Further understanding of the molecular mechanisms in muscle with adaptation to exercise training in this vulnerable population is necessary. Therefore, we conducted a pilot study to investigate the skeletal muscle inflammatory and ceramide biosynthesis gene expression levels associated with the toll-like receptor (TLR) pathway before (Pre) and following a 3-mo multicomponent exercise training program in older adults (3M, 4F; 78.4 ± 13.3 yr; 25.5 ± 2.3 kg/m(2)) ~4 mo after repair from hip fracture (HipFx). Vastus lateralis biopsies from the surgical limb were obtained before (Pre) and after training. Molecular end points and muscle function data were also compared with matched nonexercise healthy controls (CON). As a follow-up analysis, we evaluated specific sphingolipid pools in HipFx and CON muscle. Following training, quadriceps cross-sectional area, strength, and 6-min walk (6MW) increased in the surgical limb (P < 0.05). Additionally, MYD88, TAK1, NFKB1, IL6, SPT2, and CERS1 gene expression decreased after training (P ≤ 0.05), but some remained elevated above CON levels. Interestingly, MYD88 mRNA was inversely correlated to quadriceps CSA, strength, and 6MW. Finally, muscle dihydroceramides and phosphoceramides in HipFx were lower than CON at Pre (P ≤ 0.05), but after training differences from CON were removed. Together, our pilot data support that exercise training alters skeletal muscle inflammation and ceramide metabolism associated with TLR signaling in older adults recovering from hip fracture surgery and may be related to improvements in muscle function recovery.

  11. TLR/MyD88 and liver X receptor alpha signaling pathways reciprocally control Chlamydia pneumoniae-induced acceleration of atherosclerosis.

    PubMed

    Naiki, Yoshikazu; Sorrentino, Rosalinda; Wong, Michelle H; Michelsen, Kathrin S; Shimada, Kenichi; Chen, Shuang; Yilmaz, Atilla; Slepenkin, Anatoly; Schröder, Nicolas W J; Crother, Timothy R; Bulut, Yonca; Doherty, Terence M; Bradley, Michelle; Shaposhnik, Zory; Peterson, Ellena M; Tontonoz, Peter; Shah, Prediman K; Arditi, Moshe

    2008-11-15

    Experimental and clinical studies link Chlamydia pneumoniae infection to atherogenesis and atherothrombotic events, but the underlying mechanisms are unclear. We tested the hypothesis that C. pneumoniae-induced acceleration of atherosclerosis in apolipoprotein E (ApoE)(-/-) mice is reciprocally modulated by activation of TLR-mediated innate immune and liver X receptor alpha (LXRalpha) signaling pathways. We infected ApoE(-/-) mice and ApoE(-/-) mice that also lacked TLR2, TLR4, MyD88, or LXRalpha intranasally with C. pneumoniae followed by feeding of a high fat diet for 4 mo. Mock-infected littermates served as controls. Atherosclerosis was assessed in aortic sinuses and in en face preparation of whole aorta. The numbers of activated dendritic cells (DCs) within plaques and the serum levels of cholesterol and proinflammatory cytokines were also measured. C. pneumoniae infection markedly accelerated atherosclerosis in ApoE-deficient mice that was associated with increased numbers of activated DCs in aortic sinus plaques and higher circulating levels of MCP-1, IL-12p40, IL-6, and TNF-alpha. In contrast, C. pneumoniae infection had only a minimal effect on atherosclerosis, accumulation of activated DCs in the sinus plaques, or circulating cytokine increases in ApoE(-/-) mice that were also deficient in TLR2, TLR4, or MyD88. However, C. pneumoniae-induced acceleration of atherosclerosis in ApoE(-/-) mice was further enhanced in ApoE(-/-)LXRalpha(-/-) double knockout mice and was accompanied by higher serum levels of IL-6 and TNF-alpha. We conclude that C. pneumoniae infection accelerates atherosclerosis in hypercholesterolemic mice predominantly through a TLR/MyD88-dependent mechanism and that LXRalpha appears to reciprocally modulate and reduce the proatherogenic effects of C. pneumoniae infection.

  12. Macrophages exposed continuously to lipopolysaccharide and other agonists that act via toll-like receptors exhibit a sustained and additive activation state

    PubMed Central

    Hume, David A; Underhill, David M; Sweet, Matthew J; Ozinsky, Adrian O; Liew, Foo Y; Aderem, Alan

    2001-01-01

    Background Macrophages sense microorganisms through activation of members of the Toll-like receptor family, which initiate signals linked to transcription of many inflammation associated genes. In this paper we examine whether the signal from Toll-like receptors [TLRs] is sustained for as long as the ligand is present, and whether responses to different TLR agonists are additive. Results RAW264 macrophage cells were doubly-transfected with reporter genes in which the IL-12p40, ELAM or IL-6 promoter controls firefly luciferase, and the human IL-1β promoter drives renilla luciferase. The resultant stable lines provide robust assays of macrophage activation by TLR stimuli including LPS [TLR4], lipopeptide [TLR2], and bacterial DNA [TLR9], with each promoter demonstrating its own intrinsic characteristics. With each of the promoters, luciferase activity was induced over an 8 hr period, and thereafter reached a new steady state. Elevated expression required the continued presence of agonist. Sustained responses to different classes of agonist were perfectly additive. This pattern was confirmed by measuring inducible cytokine production in the same cells. While homodimerization of TLR4 mediates responses to LPS, TLR2 appears to require heterodimerization with another receptor such as TLR6. Transient expression of constitutively active forms of TLR4 or TLR2 plus TLR6 stimulated IL-12 promoter activity. The effect of LPS, a TLR4 agonist, was additive with that of TLR2/6 but not TLR4, whilst that of lipopeptide, a TLR2 agonist, was additive with TLR4 but not TLR2/6. Actions of bacterial DNA were additive with either TLR4 or TLR2/6. Conclusions These findings indicate that maximal activation by any one TLR pathway does not preclude further activation by another, suggesting that common downstream regulatory components are not limiting. Upon exposure to a TLR agonist, macrophages enter a state of sustained activation in which they continuously sense the presence of a

  13. TLR4/MD-2 activation by a synthetic agonist with no similarity to LPS

    PubMed Central

    Wang, Ying; Su, Lijing; Morin, Matthew D.; Jones, Brian T.; Whitby, Landon R.; Surakattula, Murali M. R. P.; Huang, Hua; Shi, Hexin; Choi, Jin Huk; Wang, Kuan-wen; Moresco, Eva Marie Y.; Berger, Michael; Zhan, Xiaoming; Zhang, Hong; Boger, Dale L.; Beutler, Bruce

    2016-01-01

    Structurally disparate molecules reportedly engage and activate Toll-like receptor (TLR) 4 and other TLRs, yet the interactions that mediate binding and activation by dissimilar ligands remain unknown. We describe Neoseptins, chemically synthesized peptidomimetics that bear no structural similarity to the established TLR4 ligand, lipopolysaccharide (LPS), but productively engage the mouse TLR4 (mTLR4)/myeloid differentiation factor 2 (MD-2) complex. Neoseptin-3 activates mTLR4/MD-2 independently of CD14 and triggers canonical myeloid differentiation primary response gene 88 (MyD88)- and Toll-interleukin 1 receptor (TIR) domain-containing adaptor inducing IFN-beta (TRIF)-dependent signaling. The crystal structure mTLR4/MD-2/Neoseptin-3 at 2.57-Å resolution reveals that Neoseptin-3 binds as an asymmetrical dimer within the hydrophobic pocket of MD-2, inducing an active receptor complex similar to that induced by lipid A. However, Neoseptin-3 and lipid A form dissimilar molecular contacts to achieve receptor activation; hence strong TLR4/MD-2 agonists need not mimic LPS. PMID:26831104

  14. TLR4/MD-2 activation by a synthetic agonist with no similarity to LPS.

    PubMed

    Wang, Ying; Su, Lijing; Morin, Matthew D; Jones, Brian T; Whitby, Landon R; Surakattula, Murali M R P; Huang, Hua; Shi, Hexin; Choi, Jin Huk; Wang, Kuan-wen; Moresco, Eva Marie Y; Berger, Michael; Zhan, Xiaoming; Zhang, Hong; Boger, Dale L; Beutler, Bruce

    2016-02-16

    Structurally disparate molecules reportedly engage and activate Toll-like receptor (TLR) 4 and other TLRs, yet the interactions that mediate binding and activation by dissimilar ligands remain unknown. We describe Neoseptins, chemically synthesized peptidomimetics that bear no structural similarity to the established TLR4 ligand, lipopolysaccharide (LPS), but productively engage the mouse TLR4 (mTLR4)/myeloid differentiation factor 2 (MD-2) complex. Neoseptin-3 activates mTLR4/MD-2 independently of CD14 and triggers canonical myeloid differentiation primary response gene 88 (MyD88)- and Toll-interleukin 1 receptor (TIR) domain-containing adaptor inducing IFN-beta (TRIF)-dependent signaling. The crystal structure mTLR4/MD-2/Neoseptin-3 at 2.57-Å resolution reveals that Neoseptin-3 binds as an asymmetrical dimer within the hydrophobic pocket of MD-2, inducing an active receptor complex similar to that induced by lipid A. However, Neoseptin-3 and lipid A form dissimilar molecular contacts to achieve receptor activation; hence strong TLR4/MD-2 agonists need not mimic LPS.

  15. Expression profiling of TRIM protein family in THP1-derived macrophages following TLR stimulation

    PubMed Central

    Jiang, Mei-Xiu; Hong, Xuan; Liao, Bin-Bin; Shi, Shui-Zhen; Lai, Xiao-Fang; Zheng, Huai-Yu; Xie, Lin; Wang, Yuan; Wang, Xiao-Lei; Xin, Hong-Bo; Fu, Mingui; Deng, Ke-Yu

    2017-01-01

    Activated macrophages play an important role in many inflammatory diseases including septic shock and atherosclerosis. However, the molecular mechanisms limiting macrophage activation are not completely understood. Members of the tripartite motif (TRIM) family have recently emerged as important players in innate immunity and antivirus. Here, we systematically analyzed mRNA expressions of representative TRIM molecules in human THP1-derived macrophages activated by different toll-like receptor (TLR) ligands. Twenty-nine TRIM members were highly induced (>3 fold) by one or more TLR ligands, among which 19 of them belong to TRIM C-IV subgroup. Besides TRIM21, TRIM22 and TRIM38 were shown to be upregulated by TLR3 and TLR4 ligands as previous reported, we identified a novel group of TRIM genes (TRIM14, 15, 31, 34, 43, 48, 49, 51 and 61) that were significantly up-regulated by TLR3 and TLR4 ligands. In contrast, the expression of TRIM59 was down-regulated by TLR3 and TLR4 ligands in both human and mouse macrophages. The alternations of the TRIM proteins were confirmed by Western blot. Finally, overexpression of TRIM59 significantly suppressed LPS-induced macrophage activation, whereas siRNA-mediated knockdown of TRIM59 enhanced LPS-induced macrophage activation. Taken together, the study provided an insight into the TLR ligands-induced expressions of TRIM family in macrophages. PMID:28211536

  16. Expression profiling of TRIM protein family in THP1-derived macrophages following TLR stimulation.

    PubMed

    Jiang, Mei-Xiu; Hong, Xuan; Liao, Bin-Bin; Shi, Shui-Zhen; Lai, Xiao-Fang; Zheng, Huai-Yu; Xie, Lin; Wang, Yuan; Wang, Xiao-Lei; Xin, Hong-Bo; Fu, Mingui; Deng, Ke-Yu

    2017-02-17

    Activated macrophages play an important role in many inflammatory diseases including septic shock and atherosclerosis. However, the molecular mechanisms limiting macrophage activation are not completely understood. Members of the tripartite motif (TRIM) family have recently emerged as important players in innate immunity and antivirus. Here, we systematically analyzed mRNA expressions of representative TRIM molecules in human THP1-derived macrophages activated by different toll-like receptor (TLR) ligands. Twenty-nine TRIM members were highly induced (>3 fold) by one or more TLR ligands, among which 19 of them belong to TRIM C-IV subgroup. Besides TRIM21, TRIM22 and TRIM38 were shown to be upregulated by TLR3 and TLR4 ligands as previous reported, we identified a novel group of TRIM genes (TRIM14, 15, 31, 34, 43, 48, 49, 51 and 61) that were significantly up-regulated by TLR3 and TLR4 ligands. In contrast, the expression of TRIM59 was down-regulated by TLR3 and TLR4 ligands in both human and mouse macrophages. The alternations of the TRIM proteins were confirmed by Western blot. Finally, overexpression of TRIM59 significantly suppressed LPS-induced macrophage activation, whereas siRNA-mediated knockdown of TRIM59 enhanced LPS-induced macrophage activation. Taken together, the study provided an insight into the TLR ligands-induced expressions of TRIM family in macrophages.

  17. A Novel Approach for Effectively Treating SCI Pain, Improving Opioid Efficacy, and Preventing Opioid-Induced Constipation: Key Role of Toll-Like Receptor 4 (TLR4)

    DTIC Science & Technology

    2015-10-01

    pain ; however, morphine for 7 d post-SCI has little effect on chronic thermal nociceptive thresholds in this model. Establishing effects of post-SCI...AWARD NUMBER: W81XWH-13-1-0277 TITLE: A Novel Approach for Effectively Treating SCI Pain , Improving Opioid Efficacy, and Preventing Opioid...SCI Pain , Improving Opioid Efficacy, and Preventing Opioid-Induced Constipation: Key Role of Toll-Like Receptor 4 (TLR4) 5a. CONTRACT NUMBER 5b

  18. The critical role of ABCG1 and PPARγ/LXRα signaling in TLR4 mediates inflammatory responses and lipid accumulation in vascular smooth muscle cells.

    PubMed

    Cao, Xiaojie; Zhang, Lili; Chen, Chunhai; Wang, Qingsong; Guo, Lu; Ma, Qinlong; Deng, Ping; Zhu, Gang; Li, Binghu; Pi, Yan; Long, Chunyan; Zhang, Lei; Yu, Zhengping; Zhou, Zhou; Li, Jingcheng

    2017-04-01

    Toll-like receptor 4 (TLR4) plays critical roles in vascular inflammation, lipid accumulation and atherosclerosis development. However, the mechanisms underlying these processes are still not well established, especially in vascular smooth muscle cells (VSMCs). ATP-binding cassette transporter G1 (ABCG1) is one of the key genes mediating inflammation and cellular lipid accumulation. The function of TLR4 in regulating the expression of ABCG1 and the underlying molecular mechanisms remain to be elucidated. In this study, we cultured VSMCs from the thoracic aortas of mice and treated the cells with 50 μg/ml oxidized low-density lipoprotein (oxLDL) to activate TLR4 signaling. We observed that activating TLR4 with oxLDL induced inflammatory responses and lipid accumulation in VSMCs. The expression of peroxisome proliferator-activated receptor gamma (PPARγ), liver X receptor alpha (LXRα) and ABCG1 was inhibited by TLR4 activation. However, these effects could be reversed by knocking out TLR4. PPARγ activation by rosiglitazone rescued LXRα and ABCG1 expression and reduced TLR4-induced inflammation and lipid accumulation. Silencing PPARγ expression with a specific small interfering RNA (siRNA) inhibited LXRα and ABCG1 expression and, importantly, enhanced TLR4-induced inflammation and lipid accumulation. In conclusion, ABCG1 expression was down-regulated by TLR4, which induces inflammation and lipid accumulation in VSMCs via PPARγ/LXRα signaling. These findings indicate a novel molecular mechanism underlying TLR4-induced inflammation and lipid accumulation.

  19. Dectin-1 Controls TLR9 Trafficking to Phagosomes containing β-1,3 glucan123

    PubMed Central

    Khan, Nida S.; Kasperkovitz, Pia V.; Timmons, Allison K.; Mansour, Michael K.; Tam, Jenny M.; Seward, Michael W.; Reedy, Jennifer L.; Puranam, Sravanthi; Feliu, Marianela; Vyas, Jatin M.

    2016-01-01

    Dectin-1 and TLR9 play distinct roles in the recognition and induction of innate immune responses to Aspergillus fumigatus and Candida albicans. Dectin-1 is a receptor for the major fungal cell wall carbohydrate β-1,3 glucan that induces inflammatory cytokines and controls phagosomal maturation through Syk activation. TLR9 is an endosomal Toll-like receptor that also modulates the inflammatory cytokine response to fungal pathogens. In this study, we demonstrate that β-1,3 glucan beads are sufficient to induce dynamic redistribution and accumulation of cleaved TLR9 to phagosomes. Trafficking of TLR9 to A. fumigatus and C. albicans phagosomes requires Dectin-1 recognition. Inhibition of phagosomal acidification blocks TLR9 accumulation on phagosomes containing β-1,3 glucan beads. Dectin-1 mediated Syk activation is required for TLR9 trafficking to β-1,3 glucan, A. fumigatus, and C. albicans containing phagosomes. In addition, Dectin-1 regulates TLR9 dependent gene expression. Collectively, our study demonstrates that recognition of β-1,3 glucan by Dectin-1 triggers TLR9 trafficking to β-1,3 glucan-containing phagosomes, which may be critical in coordinating innate anti-fungal defense. PMID:26829985

  20. NF-κB activation primes cells to a pro-inflammatory polarized response to a TLR7 agonist

    PubMed Central

    Lee, Jongdae; Hayashi, Masaaki; Lo, Jeng-Fan; Fearns, Colleen; Chu, Wen-Ming; Luo, Yunping; Xiang, Rong; Chuang, Tsung-Hsien

    2009-01-01

    Toll-like receptor 7 (TLR7) mediates anti-viral immunity by recognizing ssRNA viruses. Small molecular weight TLR7 agonists have been approved, or are being evaluated, for treatment of cancers or infectious diseases. Although TLR7 is predominantly expressed in a restricted set of immune cell types including plasmacytoid dendritic cells (pDCs), it is also expressed in non-native expressing cells (e.g., hepatocytes) under certain circumstances. To elucidate the molecular basis of TLR7 induction by pro-inflammatory stimulation and the subsequent cellular responses in these non-native TLR7-expressing cell types, we firstly cloned and characterized the 5′-promoter region of TLR7. The proximal region of this promoter drives the transcription of the TLR7 gene. Pro-inflammatory stimuli activated TLR7 transcription via a NF-κB binding motif in this region, and this activation could be blocked by mutation of the NF-κB binding site or addition of NF-κB inhibitors. Further studies showed that pretreatment of the Hep3B hepatocytes with TNF-α or IL-1 rendered them responsive to TLR7 activation by a TLR7 agonist. However, distinct from TLR7 activation in pDCs, which respond to stimulation with Th1 polarized cytokine production, TLR7 induction by pro-inflammatory signals in hepatocytes reconstitutes the NF-κB-dependent cascade but not the IRF7-dependent cascade, resulting in a pro-inflammatory polarized response rather than a Th1 polarized response. These results indicate that inflammatory stimulation is capable of priming cells to respond to TLR7 agonist with an immune response that differs from that in native TLR7-expressing cells. PMID:19426145

  1. The emerging role of Toll-like receptor 4 in myocardial inflammation

    PubMed Central

    Yang, Y; Lv, J; Jiang, S; Ma, Z; Wang, D; Hu, W; Deng, C; Fan, C; Di, S; Sun, Y; Yi, W

    2016-01-01

    Toll-like receptors (TLRs) are a family of pattern recognition receptors involved in cardiovascular diseases. Notably, numerous studies have demonstrated that TLR4 activates the expression of several of pro-inflammatory cytokine genes that play pivotal roles in myocardial inflammation, particularly myocarditis, myocardial infarction, ischemia-reperfusion injury, and heart failure. In addition, TLR4 is an emerging target for anti-inflammatory therapies. Given the significance of TLR4, it would be useful to summarize the current literature on the molecular mechanisms and roles of TLR4 in myocardial inflammation. Thus, in this review, we first introduce the basic knowledge of the TLR4 gene and describe the activation and signaling pathways of TLR4 in myocardial inflammation. Moreover, we highlight the recent progress of research on the involvement of TLR4 in myocardial inflammation. The information reviewed here may be useful to further experimental research and to increase the potential of TLR4 as a therapeutic target. PMID:27228349

  2. Enhancement of the antigen-specific cytotoxic T lymphocyte-inducing ability in the PMDC11 leukemic plasmacytoid dendritic cell line via lentiviral vector-mediated transduction of the caTLR4 gene.

    PubMed

    Iwabuchi, Minami; Narita, Miwako; Uchiyama, Takayoshi; Iwaya, Shunpei; Oiwa, Eri; Nishizawa, Yoshinori; Hashimoto, Shigeo; Bonehill, Aude; Kasahara, Noriyuki; Takizawa, Jun; Takahashi, Masuhiro

    2015-08-01

    The aim of the present study was to enhance the efficiency of leukemia immunotherapy by increasing the antigen-specific cytotoxic T lymphocyte-inducing ability of leukemia cells. The leukemic plasmacytoid dendritic cell line PMDC05 containing the HLA-A02/24 antigen, which was previously established in our laboratory (Laboratory of Hematology and Oncology, Graduate School of Health Sciences, Niigata University, Niigata, Japan), was used in the present study. It exhibited higher expression levels of CD80 following transduction with lentiviruses encoding the CD80 gene. This CD80-expressing PMDC05 was named PMDC11. In order to establish a more potent antigen-presenting cell for cellular immunotherapy of tumors or severe infections, PMDC11 cells were transduced with a constitutively active (ca) toll-like receptor 4 (TLR4) gene using the Tet-On system (caTLR4-PMDC11). CD8(+) T cells from healthy donors with HLA-A02 were co-cultured with mutant WT1 peptide-pulsed PMDC11, lipopolysaccharide (LPS)-stimulated PMDC11 or caTLR4-PMDC11 cells. Interleukin (IL)-2 (50 IU/ml) and IL-7 (10 ng/ml) were added on day three of culture. Priming with mutant WT1 peptide-pulsed PMDC11, LPS-stimulated PMDC11 or caTLR4-PMDC11 cells was conducted once per week and two thirds of the IL-2/IL-7 containing medium was replenished every 3-4 days. Immediately prior to the priming with these various PMDC11 cells, the cultured cells were analyzed for the secretion of interferon (IFN)-γ in addition to the percentage and number of CD8(+)/WT1 tetramer(+) T cells using flow cytometry. caTLR4-PMDC11 cells were observed to possess greater antigen-presenting abilities compared with those of PMDC11 or LPS-stimulated PMDC11 cells in a mixed leukocyte culture. CD8 T cells positive for the WT1 tetramer were generated following 3-4 weeks of culture and CD8(+)/WT1 tetramer+ T cells were markedly increased in caTLR4-PMDC11-primed CD8(+) T cell culture compared with PMDC11 or LPS-stimulated PMDC11-primed CD8(+) T

  3. Gene polymorphisms in pattern recognition receptors and susceptibility to idiopathic recurrent vulvovaginal candidiasis

    PubMed Central

    Rosentul, Diana C.; Delsing, Corine E.; Jaeger, Martin; Plantinga, Theo S.; Oosting, Marije; Costantini, Irene; Venselaar, Hanka; Joosten, Leo A. B.; van der Meer, Jos W. M.; Dupont, Bertrand; Kullberg, Bart-Jan; Sobel, Jack D.; Netea, Mihai G.

    2014-01-01

    Objective: Approximately 5% of women suffer from recurrent vulvovaginal candidiasis (RVVC). It has been hypothesized that genetic factors play an important role in the susceptibility to RVVC. The aim of this study was to assess the effect of genetic variants of genes encoding for pattern recognition receptors (PRRs) on susceptibility to RVVC. Study design: For the study, 119 RVVC patients and 263 healthy controls were recruited. Prevalence of polymorphisms in five PRRs involved in recognition of Candida were investigated in patients and controls. In silico and functional studies were performed to assess their functional effects. Results: Single nucleotide polymorphisms (SNPs) in TLR1, TLR4, CLEC7A, and CARD9 did not affect the susceptibility to RVVC. In contrast, a non-synonymous polymorphism in TLR2 (rs5743704, Pro631His) increased the susceptibility to RVVC almost 3-fold. Furthermore, the TLR2 rs5743704 SNP had deleterious effects on protein function as assessed by in silico analysis, and in vitro functional assays suggested that it reduces production of IL-17 and IFNγ upon stimulation of peripheral blood mononuclear cells with Candida albicans. No effects were observed on serum mannose-binding lectin concentrations. Condensation: This study demonstrates the association of susceptibility to RVVC with genetic variation in TLR2, most likely caused by decreased induction of mucosal antifungal host defense. Conclusion: Genetic variation in TLR2 may significantly enhance susceptibility to RVVC by modulating host defense mechanisms against Candida. Additional studies are warranted to assess systematically the role of host genetic variation for susceptibility to RVVC. PMID:25295030

  4. TLR4 and DC-SIGN receptors recognized Mycobacterium scrofulaceum promoting semi-activated phenotype on bone marrow dendritic cells.

    PubMed

    Cruz-Aguilar, Marisa; Castillo-Rodal, Antonia I; Schcolnik-Cabrera, Alejandro; Bonifaz, Laura C; Molina, Gabriela; López-Vidal, Yolanda

    2016-07-01

    Nontuberculous mycobacteria (NTM) are recognized as emerging pathogens and their immune regulatory mechanisms are not well described yet. From them, Mycobacterium avium is known to be a weak activator of dendritic cells (DCs) that impairs the response induced by BCG vaccine. However, whether other NTM such as Mycobacterium scrofulaceum may modulate the activation of DCs, has not been extensively studied. Here, we exposed bone marrow-derived DCs (BMDCs) to M. scrofulaceum and we analyzed the effect on the activation of DCs. We found that M. scrofulaceum has a comparable ability to induce a semi-mature DC phenotype, which was produced by its interaction with DC-SIGN and TLR4 receptors in a synergic effect. BMDCs exposed to M. scrofulaceum showed high expression of PD-L2 and production of IL-10, as well as low levels of co-stimulatory molecules and pro-inflammatory cytokines. In addition to immunophenotype induced on DCs, changes in morphology, re-organization of cytoskeleton and decreased migratory capacity are consistent with a semi-mature phenotype. However, unlike other pathogenic mycobacteria, the DC-semi-mature phenotype induced by M. scrofulaceum was reversed after re-exposure to BCG, suggesting that modulation mechanisms of DC-activation used by M. scrofulaceum are different to other known pathogenic mycobacteria. This is the first report about the immunophenotypic characterization of DC stimulated by M. scrofulaceum.

  5. TLR4 single nucleotide polymorphisms (SNPs) associated with Salmonella shedding in pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Toll-like receptor 4 (TLR4) is a key receptor in the innate immune recognition of lipopolysaccharide (LPS) from Gram-negative bacteria; genetic variation in this specific gene has been linked with the host’s response to bacterial infections and disease resistance. Since colonization and ...

  6. The effect of Tlr4 and/or C3 deficiency and of neonatal gene therapy on skeletal disease in mucopolysaccharidosis VII mice.

    PubMed

    Xing, Elizabeth M; Wu, Susan; Ponder, Katherine P

    2015-02-01

    Mucopolysaccharidosis (MPS) VII is a lysosomal storage disorder caused by the deficiency of the enzyme β-glucuronidase (Gusb(-/-)) and results in glycosaminoglycan (GAG) accumulation. Skeletal abnormalities include stunted long bones and bone degeneration. GAGs have been hypothesized to activate toll-like receptor 4 (Tlr4) signaling and the complement pathway, resulting in upregulation of inflammatory cytokines that suppress growth and cause degeneration of the bone. Gusb(-/-) mice were bred with Tlr4- and complement component 3 (C3)-deficient mice, and the skeletal manifestations of the doubly- and triply-deficient mice were compared to those of purebred Gusb(-/-) mice. Radiographs showed that purebred Gusb(-/-) mice had shorter tibias and femurs, and wider femurs, compared to normal mice. No improvement was seen in Tlr4, C3, or Tlr4/C3-deficient Gusb(-/-) mice. The glenoid cavity and humerus were scored on a scale from 0 (normal) to +3 (severely abnormal) for dysplasia and bone irregularities, and the joint space was measured. No improvement was seen in Tlr4, C3, or Tlr4/C3-deficient Gusb(-/-) mice, and their joint space remained abnormally wide. Gusb(-/-) mice treated neonatally with an intravenous retroviral vector (RV) had thinner femurs, longer legs, and a narrowed joint space compared with untreated purebred Gusb(-/-) mice, but no improvement in glenohumeral degeneration. We conclude that Tlr4- and/or C3-deficiency fail to ameliorate skeletal abnormalities, and other pathways may be involved. RV treatment improves some but not all aspects of bone disease. Radiographs may be an efficient method for future evaluation, as they readily show glenohumeral joint abnormalities.

  7. Ultraviolet B radiation illuminates the role of TLR3 in the epidermis

    PubMed Central

    Borkowski, Andrew W.; Gallo, Richard L.

    2014-01-01

    UV radiation poses a significant risk to human health. The mechanisms that help repair UV-damaged cells have recently been more clearly defined with the observation that Toll-like receptor 3 can sense self RNA released from necrotic keratinocytes following UV damage. TLR3 activation in the skin induces inflammation and increases expression of genes involved in skin barrier repair. Activation of TLR2 in the skin by commensal microbial products prevents excessive inflammation by blocking downstream TLR3 signaling. This review highlights how UV damage induced inflammation in the skin is propagated by host products and regulated by host inhabitants. PMID:24786223

  8. UVB radiation illuminates the role of TLR3 in the epidermis.

    PubMed

    Borkowski, Andrew W; Gallo, Richard L

    2014-09-01

    UV radiation poses a significant risk to human health. The mechanisms that help repair UV-damaged cells have recently been more clearly defined with the observation that Toll-like receptor 3 can sense self RNA released from necrotic keratinocytes following UV damage. TLR3 activation in the skin induces inflammation and increases the expression of genes involved in skin barrier repair. Activation of TLR2 in the skin by commensal microbial products prevents excessive inflammation by blocking downstream TLR3 signaling. This review highlights how UV damage-induced inflammation in the skin is propagated by host products and regulated by host inhabitants.

  9. Changes in toll-like receptor (TLR)4-NFκB-IL1β signaling in male gout patients might be involved in the pathogenesis of primary gouty arthritis.

    PubMed

    Qing, Yu-Feng; Zhang, Quan-Bo; Zhou, Jing-Guo; Jiang, Li

    2014-02-01

    We undertook this study to determine whether the altered toll-like receptor (TLR)4-nuclear factor κB (NFκB)-interleukin1β (IL1β) signaling in peripheral blood of gout patients could provide insights into the pathogenesis of primary gouty arthritis (GA). TLR4 mRNA, TLR4 and NFκBp65 proteins expression and IL1β production were measured in 52 acute GA (AGA) and 34 non-acute GA (NAGA) male patients and 78 male healthy subjects (HC). NFκBp65 transcriptional activity and IL1β production were measured after TLR4 inhibition with anti-TLR4 antibody in peripheral whole blood from 13 AGA patients. The TLR4, NFκBp65 and IL1β expression was significantly increased in the AGA group than those in the NAGA or HC group (P < 0.05, respectively), also the levels were higher in the NAGA group comparing with those in the HC group (P < 0.05, respectively). Furthermore, moderate positive correlations were observed between concentration of uric acid and the TLR4 mRNA level, serum IL1β production (r = 0.649, 0.616), and strong positive correlation was observed between TLR4 mRNA level and serum IL1β (r = 0.848) in 52 AGA patients. On the other hand, NFκBp65 level and IL1β production were dramatically reduced after TLR4 blockade with anti-TLR4 antibody in peripheral blood from the AGA patients (P < 0.05, respectively). TLR4-NFκB-IL1β signaling might play a crucial role in the development of acute inflammation in primary gout patients.

  10. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2014-01-01

    Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. PMID:21424379

  11. Lactobacillus acidophilus induces virus immune defence genes in murine dendritic cells by a Toll-like receptor-2-dependent mechanism.

    PubMed

    Weiss, Gudrun; Rasmussen, Simon; Zeuthen, Louise Hjerrild; Nielsen, Birgit Nøhr; Jarmer, Hanne; Jespersen, Lene; Frøkiaer, Hanne

    2010-10-01

    Lactobacilli are probiotics that, among other health-promoting effects, have been ascribed immunostimulating and virus-preventive properties. Certain Lactobacillus spp. have been shown to possess strong interleukin-12 (IL-12) -inducing properties. As IL-12 production depends on the up-regulation of type I interferons (IFNs), we hypothesized that the strong IL-12-inducing capacity of Lactobacillus acidophilus NCFM in murine bone-marrow-derived dendritic cells (DCs) is caused by an up-regulation of IFN-β, which subsequently induces IL-12 and the double-stranded RNA binding Toll-like receptor-3 (TLR-3). The expression of the genes encoding IFN-β, TLR-3, IL-12 and IL-10 in DCs upon stimulation with L. acidophilus NCFM was determined. Lactobacillus acidophilus NCFM induced a much stronger expression of Ifn-β, Il-12 and Il-10 compared with the synthetic double-stranded RNA ligand Poly I:C, whereas the levels of expressed Tlr-3 were similar. Whole genome microarray gene expression analysis revealed that other genes related to viral defence were significantly up-regulated and among the strongest induced genes in DCs stimulated with L. acidophilus NCFM. The ability to induce IFN-β was also detected in another L. acidophilus strain (X37), but was not a property of other probiotic strains tested, i.e. Bifidobacterium bifidum Z9 and Escherichia coli Nissle 1917. The IFN-β expression was markedly reduced in TLR-2(-/-) DCs, dependent on endocytosis, and the major cause of the induction of Il-12 and Tlr-3 in DCs stimulated with L. acidophilus NCFM. Collectively, our results reveal that certain lactobacilli trigger the expression of viral defence genes in DCs in a TLR-2 manner dependent on IFN-β.

  12. Polymorphism in the promoter region of the Toll-like receptor 9 gene and cervical human papillomavirus infection.

    PubMed

    Oliveira, Lucas Boeno; Louvanto, Karolina; Ramanakumar, Agnihotram V; Franco, Eduardo L; Villa, Luisa L

    2013-08-01

    Polymorphism in the Toll-like receptor (TLR) 9 gene has been shown to have a significant role in some diseases; however, little is known about its possible role in the natural history of human papillomavirus (HPV) infections. We investigated the association between a single-nucleotide polymorphism (SNP) (rs5743836) in the promoter region of TLR9 (T1237C) and type-specific HPV infections. Specimens were derived from a cohort of 2462 women enrolled in the Ludwig-McGill Cohort Study. We randomly selected 500 women who had a cervical HPV infection detected at least once during the study as cases. We defined two control groups: (i) a random sample of 300 women who always tested HPV negative, and (ii) a sample of 234 women who were always HPV negative but had a minimum of ten visits during the study. TLR9 genotyping was performed using bidirectional PCR amplification of specific alleles. Irrespective of group, the WT homozygous TLR9 genotype (TT) was the most common form, followed by the heterozygous (TC) and the mutant homozygous (CC) forms. There were no consistent associations between polymorphism and infection risk, either overall or by type or species. Likewise, there were no consistently significant associations between polymorphism and HPV clearance or persistence. We concluded that this polymorphism in the promoter region of TLR9 gene does not seem to have a mediating role in the natural history of the HPV infection.

  13. TLR7 and TLR8 expression increases tumor cell proliferation and promotes chemoresistance in human pancreatic cancer

    PubMed Central

    GRIMMIG, TANJA; MATTHES, NIELS; HOELAND, KATHARINA; TRIPATHI, SUDIPTA; CHANDRAKER, ANIL; GRIMM, MARTIN; MOENCH, ROMANA; MOLL, EVA-MARIA; FRIESS, HELMUT; TSAUR, IGOR; BLAHETA, ROMAN A.; GERMER, CRISTOPH T.; WAAGA-GASSER, ANA MARIA; GASSER, MARTIN

    2015-01-01

    Chronic inflammation as an important epigenetic and environmental factor for putative tumorigenesis and tumor progression may be associated with specific activation of Toll-like receptors (TLR). Recently, carcinogenesis has been suggested to be dependent on TLR7 signaling. In the present study, we determined the role of both TLR7 and TLR8 expression and signaling in tumor cell proliferation and chemoresistance in pancreatic cancer. Expression of TLR7/TLR8 in UICC stage I–IV pancreatic cancer, chronic pancreatitis, normal pancreatic tissue and human pancreatic (PANC1) cancer cell line was examined. For in vitro/in vivo studies TLR7/TLR8 overexpressing PANC1 cell lines were generated and analyzed for effects of (un-)stimulated TLR expression on tumor cell proliferation and chemoresistance. TLR expression was increased in pancreatic cancer, with stage-dependent upregulation in advanced tumors, compared to earlier stages and chronic pancreatitis. Stimulation of TLR7/TLR8 overexpressing PANC1 cells resulted in elevated NF-κB and COX-2 expression, increased cancer cell proliferation and reduced chemosensitivity. More importantly, TLR7/TLR8 expression increased tumor growth in vivo. Our data demonstrate a stage-dependent upregulation of both TLR7 and TLR8 expression in pancreatic cancer. Functional analysis in human pancreatic cancer cells point to a significant role of both TLRs in chronic inflammation-mediated TLR7/TLR8 signaling leading to tumor cell proliferation and chemoresistance. PMID:26134824

  14. Lactobacillus rhamnosus GG increases Toll-like receptor 3 gene expression in murine small intestine ex vivo and in vivo.

    PubMed

    Aoki-Yoshida, A; Saito, S; Fukiya, S; Aoki, R; Takayama, Y; Suzuki, C; Sonoyama, K

    2016-06-01

    Administration of Lactobacillus rhamnosus GG (LGG) has been reported to be therapeutically effective against acute secretory diarrhoea resulting from the structural and functional intestinal mucosal lesions induced by rotavirus infection; however, the underlying mechanisms remain to be completely elucidated. Because Toll-like receptor 3 (TLR3) plays a key role in the innate immune responses following the recognition of rotavirus, the present study examined whether LGG influences TLR3 gene expression in murine small intestine ex vivo and in vivo. We employed cultured intestinal organoids derived from small intestinal crypts as an ex vivo tissue model. LGG supplementation increased TLR3 mRNA levels in the intestinal organoids, as estimated by quantitative real-time polymerase chain reaction. Likewise, single and 7-day consecutive daily administrations of LGG increased TLR3 mRNA levels in the small intestine of C57BL/6N mice. The mRNA levels of other TLRs were not substantially altered both ex vivo and in vivo. In addition, LGG supplementation increased the mRNA levels of an antiviral type 1 interferon, interferon-α (IFN-α), and a neutrophil chemokine, CXCL1, upon stimulation with a synthetic TLR3 ligand, poly(I:C) in the intestinal organoids. LGG administration did not alter IFN-α and CXCL1 mRNA levels in the small intestine in vivo. Supplementation of other bacterial strains, Bifidobacterium bifidum and Lactobacillus paracasei, failed to increase TLR3 and poly(I:C)-stimulated CXCL1 mRNA levels ex vivo. We propose that upregulation of TLR3 gene expression may play a pivotal role in the therapeutic efficacy of LGG against rotavirus-associated diarrhoea. In addition, we demonstrated that intestinal organoids may be a promising ex vivo tissue model for investigating host-pathogen interactions and the antiviral action of probiotics in the intestinal epithelium.

  15. TLR4 antagonist FP7 inhibits LPS-induced cytokine production and glycolytic reprogramming in dendritic cells, and protects mice from lethal influenza infection

    PubMed Central

    Perrin-Cocon, Laure; Aublin-Gex, Anne; Sestito, Stefania E.; Shirey, Kari Ann; Patel, Mira C.; André, Patrice; Blanco, Jorge C.; Vogel, Stefanie N.; Peri, Francesco; Lotteau, Vincent

    2017-01-01

    Dysregulated Toll-like receptor (TLR)-4 activation is involved in acute systemic sepsis, chronic inflammatory diseases, such as atherosclerosis and diabetes, and in viral infections, such as influenza infection. Thus, therapeutic control of the TLR4 signalling pathway is of major interest. Here we tested the activity of the small-molecule synthetic TLR4 antagonist, FP7, in vitro on human monocytes and monocyte-derived dendritic cells (DCs) and in vivo during influenza virus infection of mice. Our results indicate that FP7 antagonized the secretion of proinflammatory cytokines (IL-6, IL-8, and MIP-1β) by monocytes and DCs (IC50 < 1 μM) and prevented DC maturation upon TLR4 activation by ultrapure lipopolysaccharide (LPS). FP7 selectively blocked TLR4 stimulation, but not TLR1/2, TLR2/6, or TLR3 activation. TLR4 stimulation of human DCs resulted in increased glycolytic activity that was also antagonized by FP7. FP7 protected mice from influenza virus-induced lethality and reduced both proinflammatory cytokine gene expression in the lungs and acute lung injury (ALI). Therefore, FP7 can antagonize TLR4 activation in vitro and protect mice from severe influenza infection, most likely by reducing TLR4-dependent cytokine storm mediated by damage-associated molecular patterns (DAMPs) like HMGB1. PMID:28106157

  16. Expression of Toll-like receptors and their association with cytokine responses in peripheral blood mononuclear cells of children with acute rotavirus diarrhoea.

    PubMed

    Xu, J; Yang, Y; Sun, J; Ding, Y; Su, L; Shao, C; Jiang, B

    2006-06-01

    To understand virus and host interactions and host responses to rotavirus infection in children, we analysed by real-time polymerase chain reaction (PCR) the expression of mRNA for five Toll-like receptors (TLRs) (TLR2, TLR3, TLR4, TLR7 and TLR8) and four T helper (Th)1 and Th2 cytokines [interleukin (IL)-2, IL-12, interferon (IFN)-gamma and IL-4) in peripheral blood mononuclear cells (PBMC) of children with acute rotavirus diarrhoea. We observed significantly higher expression of genes encoding TLR2, TLR3, TLR4, TLR7 and TLR8 in PBMC of 41% (31/75) patients within 3 days of illness onset than those in healthy children. After 3 days of illness onset, only TLR3 and TLR8 mRNA expressions were still significantly (P<0.05) increased in 59% (44/75) children with diarrhoea. We also observed significantly (P<0.05) elevated expression of IL-12p40 and IFN-gamma in PBMC of patients during the entire period of illness and the first 3 days of illness, respectively. We further demonstrated a weak but significant association between elevated levels of gene expression of four TLRs (TLR2, TLR3, TLR4 and TLR8) and IFN-gamma. Our results suggest that multiple TLRs may modulate the immune response in the acute phase of rotavirus infection and play a role in the activation of IFN-gamma.

  17. TLR4 signaling induces TLR3 up-regulation in alveolar macrophages during acute lung injury

    PubMed Central

    Ding, Xibing; Jin, Shuqing; Tong, Yao; Jiang, Xi; Chen, Zhixia; Mei, Shuya; Zhang, Liming; Billiar, Timothy R.; Li, Quan

    2017-01-01

    Acute lung injury is a life-threatening inflammatory response caused by severe infection. Toll-like receptors in alveolar macrophages (AMΦ) recognize the molecular constituents of pathogens and activate the host’s innate immune responses. Numerous studies have documented the importance of TLR-TLR cross talk, but few studies have specifically addressed the relationship between TLR4 and TLR3. We explored a novel mechanism of TLR3 up-regulation that is induced by LPS-TLR4 signaling in a dose- and time-dependent manner in AMΦ from C57BL/6 mice, while the LPS-induced TLR3 expression was significantly reduced in TLR4−/− and Myd88−/− mice and following pretreatment with a NF-κB inhibitor. The enhanced TLR3 up-regulation in AMΦ augmented the expression of cytokines and chemokines in response to sequential challenges with LPS and Poly I:C, a TLR3 ligand, which was physiologically associated with amplified AMΦ-induced PMN migration into lung alveoli. Our study demonstrates that the synergistic effect between TLR4 and TLR3 in macrophages is an important determinant in acute lung injury and, more importantly, that TLR3 up-regulation is dependent on TLR4-MyD88-NF-κB signaling. These results raise the possibility that bacterial infections can induce sensitivity to viral infections, which may have important implications for the therapeutic manipulation of the innate immune system. PMID:28198368

  18. Differential expression of Toll-like receptor pathway genes in chicken embryo fibroblasts from chickens resistant and susceptible to Marek's disease.

    PubMed

    Haunshi, Santosh; Cheng, Hans H

    2014-03-01

    The Toll-like receptor (TLR) signaling pathway is one of the innate immune defense mechanisms against pathogens in vertebrates and invertebrates. However, the role of TLR in non-MHC genetic resistance or susceptibility to Marek's disease (MD) in the chicken is yet to be elucidated. Chicken embryo fibroblast (CEF) cells from MD susceptible and resistant lines were infected either with Marek's disease virus (MDV) or treated with polyionosinic-polycytidylic acid, a synthetic analog of dsRNA, and the expression of TLR and pro-inflammatory cytokines was studied at 8 and 36 h posttreatment by quantitative reverse transcriptase PCR. Findings of the present study reveal that MDV infection and polyionosinic-polycytidylic acid treatment significantly elevated the mRNA expression of TLR3, IL6, and IL8 in both susceptible and resistant lines. Furthermore, basal expression levels in uninfected CEF for TLR3, TLR7, and IL8 genes were significantly higher in resistant chickens compared with those of susceptible chickens. Our results suggest that TLR3 together with pro-inflammatory cytokines may play a significant role in genetic resistance to MD.

  19. A functional variant at miR-34a binding site in toll-like receptor 4 gene alters susceptibility to hepatocellular carcinoma in a Chinese Han population.

    PubMed

    Jiang, Zi-Cheng; Tang, Xian-Mei; Zhao, Ying-Ren; Zheng, Lei

    2014-12-01

    Toll-like receptor 4 (TLR4) plays a key role in prompting the innate or immediate response. A growing body of evidence suggests that genetic variants of TLR4 gene were associated with the development of cancers. This study aimed to investigate the relationship of a functional variant (rs1057317) at microRNA-34a (miR-34a) binding site in toll-like receptor 4 gene and the risk of hepatocellular carcinoma. A single center-based case-control study was conducted. In this study, the polymerase chain reaction (PCR) and direct sequencing were used to genotype sequence variants of TLR4 in 426 hepatocellular carcinoma cases and 438 controls. The modification of rs1057317 on the binding of hsa-miR-34a to TLR4 messenger RNA (mRNA) was measured by luciferase activity assay. Individuals carrying the AA genotypes for the rs1057317 were associated significantly with increased risk of hepatocellular carcinoma comparing with those carrying wild-type homozygous CC genotypes (adjusted odds ratio [OR] by sex and age, from 1.116 to 2.452, P = 0.013). The activity of the reporter vector was lower in the reporter vector carrying C allele than the reporter vector carrying A allele. Furthermore, the expression of TLR4 was detected in the peripheral blood mononucleated cell of hepatocellular carcinoma (HCC) patients, suggesting that mRNA and protein levels of TLR4 might be associated with SNP rs1057317. Collectively, these results suggested that the risk of hepatocellular carcinoma was associated with a functional variant at miR-34a binding site in toll-like receptor 4 gene. miR-34a/TLR4 axis may play an important role in the development of hepatocellular carcinoma.

  20. Cell-specific expression of TLR9 isoforms in inflammation.

    PubMed

    McKelvey, Kelly J; Highton, John; Hessian, Paul A

    2011-02-01

    Toll-like receptors (TLRs) are key pattern recognition receptors during an immune response. With five isoforms of human TLR9 described, we hypothesised that differential expression of TLR9 isoforms in different cell types would result in variable contributions to the overall input from TLR9 during inflammation. We assessed the molecular expression of the TLR9 isoforms, TLR9-A, -C and -D. In normal peripheral blood mononuclear cells, B-lymphocytes express ∼100-fold more TLR9-A transcript than monocytes or T-lymphocytes, which predominantly express the TLR9-C transcript. Switches in isoform predominance accompany B-lymphocyte development. TLR9 protein expression in rheumatoid inflammatory lesions reflected the TLR9 isoform expression by immune cells. Herein we suggest that B-lymphocytes and plasmacytoid dendritic cells contribute the ∼3-fold higher TLR9-A transcript levels observed in inflamed synovium when compared to subcutaneous rheumatoid nodules. In contrast, macrophages and T-lymphocytes contribute the ∼4-fold higher TLR9-C transcript levels seen in nodules, compared to synovia. From protein sequence, predictions of subcellular localisation suggest TLR9-B may locate to the mitochondria, whereas TLR9-D adopts an opposing orientation in the endoplasmic reticulum. Consistent with this, structure models raise the possibility of alternative ligands for the TLR9-B and TLR9-D variants. Our results highlight differences in the expression of human TLR9 isoforms in normal and inflamed tissues, with differing contributions to inflammation.

  1. Expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and mitochondrial oxidative phosphorylation in septic patients

    PubMed Central

    Nucci, Laura A.; Santos, Sidnéia S.; Brunialti, Milena K. C.; Sharma, Narendra Kumar; Machado, Flavia R.; Assunção, Murillo; de Azevedo, Luciano C. P.

    2017-01-01

    Background and objectives Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients. Materials and methods Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0), and after 7 days (D7, N = 10) of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant. Results Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients. Conclusion Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by

  2. Toll-like receptor 3 gene polymorphisms in South African Blacks with type 1 diabetes.

    PubMed

    Pirie, F J; Pegoraro, R; Motala, A A; Rauff, S; Rom, L; Govender, T; Esterhuizen, T M

    2005-08-01

    Type 1 diabetes is the consequence of exposure of genetically susceptible individuals to specific environmental precipitants. The innate immune system provides the initial response to exogenous antigen and links with the adaptive immune system. The aim of this study was to assess the role of polymorphisms occurring in the cytoplasmic region of toll-like receptor (TLR) 3 gene and immediate 5' sequence, in subjects of Zulu descent with type 1 diabetes in KwaZulu-Natal, South Africa. Seventy-nine subjects with type 1 diabetes and 74 healthy normal glucose tolerant gender-matched control subjects were studied. Parts of exon 4 and exon 3/intron 3 of the TLR3 gene were studied by polymerase chain reaction, direct sequencing and restriction enzyme digestion with Bts 1. Of the nine polymorphisms studied, a significant association with type 1 diabetes was found for the major allele in the 2593 C/T polymorphism and for the minor alleles in the 2642 C/A and 2690 A/G polymorphisms, which were found to be in complete linkage disequilibrium. Correction of the P-values for the number of alleles studied, however, rendered the results no longer significant. These results suggest that polymorphisms in the TLR3 gene, which is part of the innate immune system, may be associated with type 1 diabetes in this population.

  3. TLR7 Deficiency Leads to TLR8 Compensative Regulation of Immune Response against JEV in Mice

    PubMed Central

    Awais, Muhammad; Wang, Ke; Lin, Xianwu; Qian, Wenjie; Zhang, Nan; Wang, Chong; Wang, Kunlun; Zhao, Ling; Fu, Zhen F.; Cui, Min

    2017-01-01

    Japanese encephalitis virus (JEV) is a highly fatal pathogen to human beings. Toll-like receptor 7 (TLR7) plays a role as the first host defense against most single-stranded RNA flaviviruses. This study aims to investigate the role of TLR7 in inducing adaptive immune response in mice against JEV. In vitro and in vivo studies were conducted to examine the expression of toll-like receptors (TLRs) in mice. After JEV infection, physical parameters of mice (survival rate and body weight) were evaluated, and organs or cells were collected for further analysis. The expression of TLR7 was increased significantly as compare to other TLR molecules post-JEV infection. The expression of CD80, CD86, and CD273 on bone marrow-derived dendritic cells was increased significantly in TLR7−/− mice. Furthermore, viral load was also increased significantly in TLR7−/− mice as compare to C57BL/6 mice. But there was no significant difference among survival rate and body weight in TLR7−/− mice as compare to C57BL/6. Interestingly, we also found that TLR8 was upregulated in TLR7−/− mice. The study concluded that TLR8 was upregulated in TLR7-deficient mice, and it might play a compensatory role in the immune response in TLR7−/− mice. PMID:28265274

  4. Inhibition of TLR4 Signalling-Induced Inflammation Attenuates Secondary Injury after Diffuse Axonal Injury in Rats

    PubMed Central

    Zhao, Yonglin; Zhang, Ming; Zhao, Junjie; Ma, Xudong; Huang, Tingqin; Pang, Honggang

    2016-01-01

    Increasing evidence suggests that secondary injury after diffuse axonal injury (DAI) damages more axons than the initial insult, but the underlying mechanisms of this phenomenon are not fully understood. Recent studies show that toll-like receptor 4 (TLR4) plays a critical role in promoting adaptive immune responses and have been shown to be associated with brain damage. The purpose of this study was to investigate the role of the TLR4 signalling pathway in secondary axonal injury in the cortices of DAI rats. TLR4 was mainly localized in microglial cells and neurons, and the levels of TLR4 downstream signalling molecules, including TLR4, myeloid differentiation primary response gene 88, toll/IR-1-(TIR-) domain-containing adaptor protein inducing interferon-beta, interferon regulatory factor 3, interferon β, nuclear factor κB (NF-κB) p65, and phospho-NF-κB p65, significantly increased and peaked at 1 d after DAI. Inhibition of TLR4 by TAK-242 attenuated apoptosis, neuronal and axonal injury, and glial responses. The neuroprotective effects of TLR4 inhibition were associated with decreases in the levels of TLR4 downstream signalling molecules and inflammatory factors, including interleukin-1β, interleukin-6, and tumour necrosis factor-α. These results suggest that the TLR4 signalling pathway plays an important role in secondary injury and may be an important therapeutic target following DAI. PMID:27478307

  5. Effect of herbal melanin on IL-8: a possible role of Toll-like receptor 4 (TLR4).

    PubMed

    El-Obeid, Adila; Hassib, Adil; Pontén, Fredrik; Westermark, Bengt

    2006-06-16

    The production of IL-8 can be induced by LPS via TLR4 signaling pathway. In this study, we tested the effect of a herbal melanin (HM) extract, from black cumin seeds (Nigella sativa L.), on IL-8 production. We used HM and LPS in parallel to induce IL-8 production by THP-I, PBMCs, and TLR4-transfected HEK293 cells. Both HM and LPS induced IL-8 mRNA expression and protein production in THP-1 and PBMCs. On applying similar treatment to HEK293 cells that express TLR4, MD2, and CD14, both HM and LPS significantly induced IL-8 protein production. We have also demonstrated that HM and LPS had identical effects in terms of IL-8 stimulation by HEK293 transfected with either TLR4 or MD2-CD14. Melanin extracted from N. sativa L. mimics the action of LPS in the induction of IL-8 by PBMC and the other used cell lines. Our results suggest that HM may share a signaling pathway with LPS that involves TLR4.

  6. Green tea polyphenol epigallocatechin-3-gallate inhibits TLR4 signaling through the 67-kDa laminin receptor on lipopolysaccharide-stimulated dendritic cells

    SciTech Connect

    Byun, Eui-Baek; Choi, Han-Gyu; Sung, Nak-Yun; Byun, Eui-Hong

    2012-10-05

    Highlights: Black-Right-Pointing-Pointer Expressions of CD80, CD86, and MHC class I/II were inhibited by EGCG via 67LR. Black-Right-Pointing-Pointer EGCG-treated DCs inhibited LPS-induced pro-inflammatory cytokines via 67LR. Black-Right-Pointing-Pointer EGCG-treated DCs inhibited MAPKs activation and NF-{kappa}B p65 translocation via 67LR. Black-Right-Pointing-Pointer EGCG elevated the expression of the Tollip protein through 67LR in DCs. -- Abstract: Epigallocatechin-3-gallate (EGCG), a major active polyphenol of green tea, has been shown to down-regulate inflammatory responses in dendritic cells (DCs); however, the underlying mechanism has not been understood. Recently, we identified the 67-kDa laminin receptor (67LR) as a cell-surface EGCG receptor. In this study, we showed the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by EGCG in DCs. The expressions of CD80, CD86, and MHC class I and II, which are molecules essential for antigen presentation by DCs, were inhibited by EGCG via 67LR. In addition, EGCG-treated DCs inhibited lipopolysaccharide (LPS)-induced production of pro-inflammatory cytokines (tumor necrosis factor [TNF]-{alpha}, interleukin [IL]-1{beta}, and IL-6) and activation of mitogen-activated protein kinases (MAPKs), e.g., extracellular signal-regulated kinase 1/2 (ERK1/2), p38, c-Jun N-terminal kinase (JNK), and nuclear factor {kappa}B (NF-{kappa}B) p65 translocation through 67LR. Interestingly, we also found that EGCG markedly elevated the expression of the Tollip protein, a negative regulator of TLR signaling, through 67LR. These novel findings provide new insight into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and consequent inflammatory responses that are implicated in the development and progression of many chronic diseases.

  7. Evaluating Effect of Mesenchymal Stem Cells on Expression of TLR2 and TLR4 in Mouse DCs

    PubMed Central

    Karimi, Mohammad Hossein; Barzkar, Zahra; Babaee, Maryam; Naghdi, Majid

    2016-01-01

    Purpose: Mesenchymal stem cells (MSCs) are multipotent cells and recent findings suggest immunomodulatory effect of them on immune cells including T cells and dendritic cells (DCs). DCs are the most potent antigen presenting cells. It seems because of immunoregulatory properties of MSCs, they can affect the maturation and differentiation of DCs. DCs express a kind of surface receptors called toll-like receptors (TLRs) and play a key role in maturation process and activation of DCs. The aim of this study was to evaluate expression of TLR2 and TLR4 on DCs after exposure to mesenchymal stem cell’s supernatant in culture media containing LPS and devoid of it. Methods: In this experimental study, MSCs and DCs were extracted from adult Balb/c mouse bone marrow and spleen, respectively. MSCs supernatant were collected 24 and 48 h after 5th passage, and in adjusted with DCs culture. Isolated DCs were co-cultured with MSCs supernatant, incubation time were 24 and 48 hours. mRNA levels of TLR2 and TLR4 were evaluated using real time PCR technique. Results: The results demonstrated that although, expressions of these two receptors were up-regulated in culture media lacking LPS in comparison with the control group but the increase was not significant. There were no significant associations between LPS stimulated DCs with and without MSCs supernatants. Conclusion: According to the results presented here, it appears that TLR2 and TLR4 gene expressions on the DCs are not affected by MSCs supernatant. PMID:27478779

  8. Deletion of the Vaccinia Virus Gene A46R, Encoding for an Inhibitor of TLR Signalling, Is an Effective Approach to Enhance the Immunogenicity in Mice of the HIV/AIDS Vaccine Candidate NYVAC-C

    PubMed Central

    Perdiguero, Beatriz; Gómez, Carmen Elena; Di Pilato, Mauro; Sorzano, Carlos Oscar S.; Delaloye, Julie; Roger, Thierry; Calandra, Thierry; Pantaleo, Giuseppe; Esteban, Mariano

    2013-01-01

    Viruses have developed strategies to counteract signalling through Toll-like receptors (TLRs) that are involved in the detection of viruses and induction of proinflammatory cytokines and IFNs. Vaccinia virus (VACV) encodes A46 protein which disrupts TLR signalling by interfering with TLR: adaptor interactions. Since the innate immune response to viruses is critical to induce protective immunity, we studied whether deletion of A46R gene in a NYVAC vector expressing HIV-1 Env, Gag, Pol and Nef antigens (NYVAC-C) improves immune responses against HIV-1 antigens. This question was examined in human macrophages and in mice infected with a single A46R deletion mutant of the vaccine candidate NYVAC-C (NYVAC-C-ΔA46R). The viral gene A46R is not required for virus replication in primary chicken embryo fibroblast (CEF) cells and its deletion in NYVAC-C markedly increases TNF, IL-6 and IL-8 secretion by human macrophages. Analysis of the immune responses elicited in BALB/c mice after DNA prime/NYVAC boost immunization shows that deletion of A46R improves the magnitude of the HIV-1-specific CD4 and CD8 T cell immune responses during adaptive and memory phases, maintains the functional profile observed with the parental NYVAC-C and enhances anti-gp120 humoral response during the memory phase. These findings establish the immunological role of VACV A46R on innate immune responses of macrophages in vitro and antigen-specific T and B cell immune responses in vivo and suggest that deletion of viral inhibitors of TLR signalling is a useful approach for the improvement of poxvirus-based vaccine candidates. PMID:24069354

  9. Structure of the Toll/Interleukin-1 Receptor (TIR) Domain of the B-cell Adaptor That Links Phosphoinositide Metabolism with the Negative Regulation of the Toll-like Receptor (TLR) Signalosome*

    PubMed Central

    Halabi, Samer; Sekine, Eiki; Verstak, Brett; Gay, Nicholas J.; Moncrieffe, Martin C.

    2017-01-01

    Ligand binding to Toll-like receptors (TLRs) results in dimerization of their cytosolic Toll/interleukin-1 receptor (TIR) domains and recruitment of post-receptor signal transducers into a complex signalosome. TLR activation leads to the production of transcription factors and pro-inflammatory molecules and the activation of phosphoinositide 3-kinases (PI3K) in a process that requires the multimodular B-cell adaptor for phosphoinositide 3-kinase (BCAP). BCAP has a sequence previously proposed as a “cryptic” TIR domain. Here, we present the structure of the N-terminal region of human BCAP and show that it possesses a canonical TIR fold. Dimeric BCAP associates with the TIR domains of TLR2/4 and MAL/TIRAP, suggesting that it is recruited to the TLR signalosome by multitypic TIR-TIR interactions. BCAP also interacts with the p85 subunit of PI3K and phospholipase Cγ, enzymes that deplete plasma membrane phosphatidylinositol 4,5-bisphosphate (PIP2), and these interactions provide a molecular explanation for BCAP-mediated down-regulation of inflammatory signaling. PMID:27909057

  10. Flavonoids Affect Host-Microbiota Crosstalk through TLR Modulation

    PubMed Central

    Pérez-Cano, Francisco J.; Massot-Cladera, Malen; Rodríguez-Lagunas, Maria J.; Castell, Margarida

    2014-01-01

    Interaction between host cells and microbes is known as crosstalk. Among other mechanisms, this takes place when certain molecules of the micro-organisms are recognized by the toll-like receptors (TLRs) in the body cells, mainly in the intestinal epithelial cells and in the immune cells. TLRs belong to the pattern-recognition receptors and represent the first line of defense against pathogens, playing a pivotal role in both innate and adaptive immunity. Dysregulation in the activity of such receptors can lead to the development of chronic and severe inflammation as well as immunological disorders. Among components present in the diet, flavonoids have been suggested as antioxidant dietary factors able to modulate TLR-mediated signaling pathways. This review focuses on the molecular targets involved in the modulatory action of flavonoids on TLR-mediated signaling pathways, providing an overview of the mechanisms involved in such action. Particular flavonoids have been able to modify the composition of the microbiota, to modulate TLR gene and protein expression, and to regulate the downstream signaling molecules involved in the TLR pathway. These synergistic mechanisms suggest the role of some flavonoids in the preventive effect on certain chronic diseases. PMID:26785232

  11. RING finger E3 ligase PPP1R11 regulates TLR2 signaling and innate immunity

    PubMed Central

    McKelvey, Alison C; Lear, Travis B; Dunn, Sarah R; Evankovich, John; Londino, James D; Bednash, Joseph S; Zhang, Yingze; McVerry, Bryan J; Liu, Yuan; Chen, Bill B

    2016-01-01

    Toll-like receptor 2 (TLR2) is a pattern recognition receptor that recognizes many types of PAMPs that originate from gram-positive bacteria. Here we describe a novel mechanism regulating TLR2 protein expression and subsequent cytokine release through the ubiquitination and degradation of the receptor in response to ligand stimulation. We show a new mechanism in which an uncharacterized RING finger E3 ligase, PPP1R11, directly ubiquitinates TLR2 both in vitro and in vivo, which leads to TLR2 degradation and disruption of the signaling cascade. Lentiviral gene transfer or knockdown of PPP1R11 in mouse lungs significantly affects lung inflammation and the clearance of Staphylococcus aureus. There is a negative correlation between PPP1R11 and TLR2 levels in white blood cell samples isolated from patients with Staphylococcus aureus infections. These results suggest that PPP1R11 plays an important role in regulating innate immunity and gram-positive bacterial clearance by functioning, in part, through the ubiquitination and degradation of TLR2. DOI: http://dx.doi.org/10.7554/eLife.18496.001 PMID:27805901

  12. Augmentation of autologous T cell reactivity with acute myeloid leukemia (AML) blasts by Toll-like receptor (TLR) agonists.

    PubMed

    Zhong, RuiKun; Li, Hongying; Messer, Karen; Lane, Thomas A; Zhou, Jiehua; Ball, Edward D

    2015-06-01

    This study investigated whether TNF-α, Toll-like receptors (TLRs) 7/8 agonist resiquimod (R848), the TLR4 agonist lipopolysaccharide (LPS) and their combinations can enhance autologous AML-reactive T cell generation in an in vitro culture. AML peripheral blood or bone marrow mononuclear cells were cultured in medium supplemented with GM-CSF/IL-4 to induce dendritic cell (DC) differentiation of AML blasts (AML-DC). The impact of TNF-α, LPS, R848 and their combinations on AML-DC cultures was analyzed. Significantly enhanced CD80, CD40, CD83, CD54, HLA-DR and CD86 expression of AML cells was observed by addition of TNF-α, LPS, R848 alone or combinations. Induced CD80 expression of AML cells was significantly higher through the combination of TNF-α, LPS and R848 (T + L + R) than that by T alone. CTL induced from T + L + R, T + R, T + L, L + R and R, but not T, L alone stimulated cultures showed significantly higher IFN-γ release than the medium control in response to autologous AML cells. IFN-γ release by T + L + R was significantly higher than T or L alone, and T + R was significantly higher than T alone. CTL generated from T + L + R, T + L, T + R, L + R and L alone exerted significantly higher AML cell killing than medium control. AML cell killing by T + L + R and T + R was significantly higher than T or R alone. These results indicate that the combination of T + L + R induces a significantly enhanced antigen presentation effect of AML-DC. We speculate that the complementary effects of reagent combinations may better address the heterogeneity of responses to any single agent in AML cells from different patients.

  13. Allelic variation in TLR4 is linked to resistance to Salmonella Enteritidis infection in chickens.

    PubMed

    Li, Peng; Wang, Huihua; Zhao, Xingwang; Gou, Zhongyong; Liu, Ranran; Song, Yongmei; Li, Qinghe; Zheng, Maiqing; Cui, Huanxian; Everaert, Nadia; Zhao, Guiping; Wen, Jie

    2017-03-01

    Salmonella Enteritidis (SE) is a foodborne pathogen that negatively affects both animal and human health. Polymorphisms of the TLR4 gene may affect recognition by Toll-like receptor 4 (TLR4) of bacterial lipopolysaccharide (LPS), leading to differences in host resistance to pathogenic infections. The present study has investigated polymorphic loci of chicken TLR4 (ChTLR4) in ten chicken breeds, electrostatic potentials of mutant structures of TLR4, and a linkage analysis between allelic variation and survival ratio to infection with SE in specific-pathogen-free (SPF) White Leghorns. A total of 19 Single Nucleotide Polymorphisms (SNPs), of which 10 were novel, were found in chicken breeds. Seven newly identified amino acid variants (C68G, G674A, G782A, A896T, T959G, T986A, and A1104C) and previously reported important mutations (G247A, G1028A, C1147T, and A1832G) were demonstrated in the extracellular domain of the ChTLR4 gene. Significant changes in surface electrostatic potential of the ectodomain of TLR4, built by homology modeling, were observed at the Glu83Lys (G247A), Arg298Ser (A896T), Ser368Arg (A1104C), and Gln611Arg (A1832G) substitutions. Linkage analysis showed that one polymorphic locus G247A of TLR4 gene, common in all breeds examined, was significantly associated with increased resistance to SE in SPF White Leghorns chicks (log-rank P-value = 0.04). The genotypes from A1832G SNPs did not show statistically significant survival differences. This study has provided the first direct evidence that G247A substitution in ChTLR4 is associated with increased resistance to Salmonella Enteritidis.

  14. Local Innate Responses to TLR Ligands in the Chicken Trachea

    PubMed Central

    Barjesteh, Neda; Alkie, Tamiru Negash; Hodgins, Douglas C.; Nagy, Éva; Sharif, Shayan

    2016-01-01

    The chicken upper respiratory tract is the portal of entry for respiratory pathogens, such as avian influenza virus (AIV). The presence of microorganisms is sensed by pathogen recognition receptors (such as Toll-like receptors (TLRs)) of the innate immune defenses. Innate responses are essential for subsequent induction of potent adaptive immune responses, but little information is available about innate antiviral responses of the chicken trachea. We hypothesized that TLR ligands induce innate antiviral responses in the chicken trachea. Tracheal organ cultures (TOC) were used to investigate localized innate responses to TLR ligands. Expression of candidate genes, which play a role in antiviral responses, was quantified. To confirm the antiviral responses of stimulated TOC, chicken macrophages were treated with supernatants from stimulated TOC, prior to infection with AIV. The results demonstrated that TLR ligands induced the expression of pro-inflammatory cytokines, type I interferons and interferon stimulated genes in the chicken trachea. In conclusion, TLR ligands induce functional antiviral responses in the chicken trachea, which may act against some pathogens, such as AIV. PMID:27455308

  15. Ligand dependent restoration of human TLR3 signaling and death in p53 mutant cells

    PubMed Central

    Menendez, Daniel; Lowe, Julie M.; Snipe, Joyce; Resnick, Michael A.

    2016-01-01

    Diversity within the p53 transcriptional network can arise from a matrix of changes that include target response element sequences and p53 expression level variations. We previously found that wild type p53 (WT p53) can regulate expression of most innate immune-related Toll-like-receptor genes (TLRs) in human cells, thereby affecting immune responses. Since many tumor-associated p53 mutants exhibit change-of-spectrum transactivation from various p53 targets, we examined the ability of twenty-five p53 mutants to activate endogenous expression of the TLR gene family in p53 null human cancer cell lines following transfection with p53 mutant expression vectors. While many mutants retained the ability to drive TLR expression at WT levels, others exhibited null, limited, or change-of-spectrum transactivation of TLR genes. Using TLR3 signaling as a model, we show that some cancer-associated p53 mutants amplify cytokine, chemokine and apoptotic responses after stimulation by the cognate ligand poly(I:C). Furthermore, restoration of WT p53 activity for loss-of-function p53 mutants by the p53 reactivating drug RITA restored p53 regulation of TLR3 gene expression and enhanced DNA damage-induced apoptosis via TLR3 signaling. Overall, our findings have many implications for understanding the impact of WT and mutant p53 in immunological responses and cancer therapy. PMID:27533082

  16. Valsartan independent of AT₁ receptor inhibits tissue factor, TLR-2 and -4 expression by regulation of Egr-1 through activation of AMPK in diabetic conditions.

    PubMed

    Ha, Yu Mi; Park, Eun Jung; Kang, Young Jin; Park, Sang Won; Kim, Hye Jung; Chang, Ki Churl

    2014-10-01

    Patients suffering from diabetes mellitus (DM) are at a severe risk of atherothrombosis. Early growth response (Egr)-1 is well characterized as a central mediator in vascular pathophysiology. We tested whether valsartan independent of Ang II type 1 receptor (AT1R) can reduce tissue factor (TF) and toll-like receptor (TLR)-2 and -4 by regulating Egr-1 in THP-1 cells and aorta in streptozotocin-induced diabetic mice. High glucose (HG, 15 mM) increased expressions of Egr-1, TF, TLR-2 and -4 which were significantly reduced by valsartan. HG increased Egr-1 expression by activation of PKC and ERK1/2 in THP-1 cells. Valsartan increased AMPK phosphorylation in a concentration and time-dependent manner via activation of LKB1. Valsartan inhibited Egr-1 without activation of PKC or ERK1/2. The reduced expression of Egr-1 by valsartan was reversed by either silencing Egr-1, or compound C, or DN-AMPK-transfected cells. Valsartan inhibited binding of NF-κB and Egr-1 to TF promoter in HG condition. Furthermore, valsartan reduced inflammatory cytokine (TNF-α, IL-6 and IL-1β) production and NF-κB activity in HG-activated THP-1 cells. Interestingly, these effects of valsartan were not affected by either silencing AT1R in THP-1 cells or CHO cells, which were devoid of AT1R. Importantly, administration of valsartan (20 mg/kg, i.p) for 8 weeks significantly reduced plasma TF activity, expression of Egr-1, TLR-2, -4 and TF in thoracic aorta and improved glucose tolerance of streptozotocin-induced diabetic mice. Taken together, we concluded that valsartan may reduce atherothrombosis in diabetic conditions through AMPK/Egr-1 regulation.

  17. Lipoteichoic acid enhances IL-6 production in human synovial fibroblasts via TLR2 receptor, PKCdelta and c-Src dependent pathways.

    PubMed

    Tang, Chih-Hsin; Hsu, Chin-Jung; Yang, Wei-Hung; Fong, Yi-Chin

    2010-06-01

    Patients with rheumatoid arthritis (RA) are at increased risk of developing infections and appear to be particularly susceptible to septic arthritis. Lipoteichoic acid (LTA), a cell wall component of Gram-positive bacteria is an amphiphilic, negatively charged glycolipid. However, the effects of LTA on human synovial fibroblasts are largely unknown. We investigated the signaling pathway involved in IL-6 production stimulated by LTA in rheumatoid arthritis synovial fibroblasts (RASF). LTA caused concentration- and time-dependent increases in IL-6 production. LTA-mediated IL-6 production was attenuated by Toll-like receptor 2 (TLR2) monoclonal antibody or siRNA. Pretreatment with PKCdelta inhibitor (rottlerin), c-Src inhibitor (PP2), AP-1 inhibitor (tanshinone IIA) and NF-kappaB inhibitor (PDTC and TPCK) also inhibited the potentiating action of LTA. However, focal adhesion kinase (FAK) mutant and siRNA did not affect LTA-mediated IL-6 production. Stimulation of cells with LTA increased the PKCdelta and c-Src phosphorylation and kinase activity. LTA increased the accumulation of p-c-Jun and p-p65 in the nucleus, as well as AP-1 and NF-kappaB luciferase activity. LTA-mediated increase of AP-1 and NF-kappaB luciferase activity was inhibited by rottlerin and PP2 or TLR2 and PKCdelta siRNA or c-Src mutant. Our results suggest that LTA-increased IL-6 production in human synovial fibroblasts via the TLR2 receptor, PKCdelta, c-Src, AP-1 and NF-kappaB signaling pathways.

  18. Polymorphisms in Chemokine Receptor 5 and Toll-Like Receptor 3 Genes Are Risk Factors for Clinical Tick-Borne Encephalitis in the Lithuanian Population

    PubMed Central

    Nordgren, Johan; Carlsson, Beatrice; Hagbom, Marie; Svensson, Lennart; Lindquist, Lars

    2014-01-01

    Background Tick-borne encephalitis virus (TBEV) infections can be asymptomatic or cause moderate to severe injuries of the nervous system. We previously reported that a nonfunctional chemokine receptor 5 (CCR5) and a functional Toll-like receptor 3 (TLR3) predispose adults to clinical tick-borne encephalitis (TBE). This study expands our previous findings and further examines polymorphisms in CCR5 and TLR3 genes in different age and disease severity groups. Methods 117 children and 129 adults, stratified into mild, moderate and severe forms of TBE, and 103 adults with severe TBE were analyzed. 135 healthy individuals and 79 patients with aseptic meningoencephalitis served as controls. CCR5 delta 32 and rs3775291 TLR3 genotypes were established by pyrosequencing, and their frequencies were analyzed using recessive genetic, genotype and allelic models. Findings The prevalence of CCR5Δ32 homozygotes was higher in children (2.5%), in adults with severe TBE (1.9%), and in the combined cohort of TBE patients (2.3%) than in controls (0%) (p<0.05). The nonfunctional homozygous TLR3 genotype was less prevalent among the combined TBE cohort (11.5%) than among controls (19.9%) (p = 0.025), but did not differ between children TBE and controls. The genotype and allele prevalence of CCR5 and TLR3 did not differ in children nor adult TBE cohorts stratified by disease severity. However, in the severe adult TBE cohort, homozygous functional TLR3 genotype and wt allele were less prevalent compared to the adult cohort with the whole disease severity spectrum (44.4% vs 59.8% p = 0.022 and 65.2% vs 76.4% p = 0.009; respectively). Conclusions Independently of age, nonfunctional CCR5Δ32 mutation is a significant risk factor for development of clinical TBE, but not for disease severity. The polymorphism of TLR3 gene predisposes to clinical TBE in adults only and may be associated with disease severity. Further studies are needed to clarify the role of these polymorphisms in

  19. TLR9 is required for MAPK/NF-κB activation but does not cooperate with TLR2 or TLR6 to induce host resistance to Brucella abortus.

    PubMed

    Gomes, Marco Túlio; Campos, Priscila Carneiro; Pereira, Guilherme de Sousa; Bartholomeu, Daniella Castanheira; Splitter, Gary; Oliveira, Sergio Costa

    2016-05-01

    Brucella abortus is a Gram-negative intracellular bacterial pathogen that causes a zoonosis of worldwide occurrence, leading to undulant fever in humans and abortion in domestic animals. B. abortus is recognized by several pattern-recognition receptors triggering pathways during the host innate immune response. Therefore, here, we determined the cooperative role of TLR9 with TLR2 or TLR6 receptors in sensing Brucella Furthermore, we deciphered the host innate immune response against B. abortus or its DNA, emphasizing the role of TLR9-MAPK/NF-κB signaling pathways in the production of proinflammatory cytokines. TLR9 is required for the initial host control of B. abortus, but this TLR was dispensable after 6 wk of infection. The susceptibility of TLR9(-/-)-infected animals to Brucella paralleled with lower levels of IFN-γ produced by mouse splenocytes stimulated with this pathogen compared with wild-type cells. However, no apparent cooperative interplay was observed between TLR2-TLR9 or TLR6-TLR9 receptors to control infection. Moreover, B. abortus or its DNA induced activation of MAPK/NF-κB pathways and production of IL-12 and TNF-α by macrophages partially dependent on TLR9 but completely dependent on MyD88. In addition, B. abortus-derived CpG oligonucleotides required TLR9 to promote IL-12 and TNF-α production by macrophages. By confocal microscopy, we demonstrated that TLR9 redistributed and colocalized with lysosomal-associated membrane protein-1 upon Brucella infection. Thus, B. abortus induced TLR9 traffic, leading to cell signaling activation and IL-12 and TNF-α production. Although TLR9 recognized Brucella CpG motifs, our results suggest a new pathway of B. abortus DNA-activating macrophages independent of TLR9.

  20. A recombinant lipoprotein containing an unsaturated fatty acid activates NF-kappaB through the TLR2 signaling pathway and induces a differential gene profile from a synthetic lipopeptide.

    PubMed

    Leng, Chih-Hsiang; Chen, Hsin-Wei; Chang, Li-Sheng; Liu, Hsueh-Hung; Liu, Hsin-Yu; Sher, Yuh-Pyng; Chang, Yu-Wen; Lien, Shu-Pei; Huang, Tzu-Yi; Chen, Mei-Yu; Chou, Ai-Hsiang; Chong, Pele; Liu, Shih-Jen

    2010-07-01

    The lipid moiety of a novel recombinant lipoprotein, which contains a dengue virus envelope protein domain 3, rlipo-D1E3, has been shown to activate antigen-presenting cells (APCs) as an intrinsic adjuvant. Because the lipid moiety of rlipo-D1E3 contains an unsaturated fatty acid, it is unclear if the receptor usage by bacterially derived lipoproteins is the same as that of the synthetic lipopeptide palmitoyl-3-Cys-Ser-(Lys)(4) (Pam3). In the present study, we show that the rlipo-D1E3 lipoprotein can induce the activation of spleen cells and bone marrow-derived dendritic cells (BM-DCs) in wild-type and TLR4-deficient mice, but not in TLR2(-/-) mice. After analyzing the co-receptor usage of TLR2 using TLR1(-/-) or TLR6(-/-) mice, the TLR2 signaling triggered by rlipo-D1E3 and Pam3 could use either TLR1 or TLR6 as a co-receptor. Analysis of the MAPK signaling pathway revealed that rlipo-D1E3 could initiate the phosphorylation of p38, ERK1/2 and JNK1/2 earlier than the synthetic lipopeptide. In addition, the expression levels of IL-23, IL-27 and MIP-1 alpha in BM-DCs stimulated by rlipo-D1E3 were higher than the expression levels in BM-DCs stimulated by Pam3. Taken together, these results demonstrate that different TLR2 ligands can promote various immune responses by inducing different levels of biological cytokines and chemokines.

  1. Toll-Like Receptors of Deuterostome Invertebrates

    PubMed Central

    Satake, Honoo; Sekiguchi, Toshio

    2012-01-01

    Defensive systems against pathogens are responsible not only for survival or lifetime of an individual but also for the evolution of a species. Innate immunity is expected to be more important for invertebrates than mammals, given that adaptive immunity has not been acquired in the former. Toll-like receptors (TLRs) have been shown to play a crucial role in host defense of pathogenic microbes in innate immunity of mammals. Recent genome-wide analyses have suggested that TLR or their related genes are conserved in invertebrates. In particular, numerous TLR-related gene candidates were detected in deuterostome invertebrates, including a sea urchin (222 TLR-related gene candidates) and amphioxus (72 TLR-related gene candidates). Molecular phylogenetic analysis verified that most of sea urchin or amphioxus TLR candidates are paralogous, suggesting that these organisms expanded TLR-related genes in a species-specific manner. In contrast, another deuterostome invertebrate, the ascidian Ciona intestinalis, was found to possess only two TLR genes. Moreover, Ciona TLRs, Ci-TLR1 and Ci-TLR2, were shown to possess “hybrid” functionality of mammalian TLRs. Such functionality of Ci-TLRs could not be predicted by sequence comparison with vertebrate TLRs, indicating confounding evolutionary lineages of deuterostome invertebrate TLRs or their candidates. In this review article, we present recent advances in studies of TLRs or their candidates among deuterostome invertebrates, and provide insight into an evolutionary process of TLRs. PMID:22566918

  2. Involvement of TLR2 in Recognition of Acute Gammaherpesvirus-68 Infection

    PubMed Central

    Michaud, François; Coulombe, François; Gaudreault, Éric; Kriz, Jasna; Gosselin, Jean

    2010-01-01

    Background Toll-like receptors (TLRs) play a crucial role in the activation of innate immunity in response to many viruses. We previously reported the implication of TLR2 in the recognition of Epstein-Barr virus (EBV) by human monocytes. Because murine gammaherpesvirus-68 (MHV-68) is a useful model to study human gammaherpesvirus pathogenesis in vivo, we evaluated the importance of mouse TLR2 in the recognition of MHV-68. Methodology/Principal Findings In studies using transfected HEK293 cells, MHV-68 lead to the activation of NF-κB reporter through TLR2. In addition, production of interleukin-6 (IL-6) and interferon-α (IFN-α) upon MHV-68 stimulation was reduced in murine embryonic fibroblasts (MEFs) derived from TLR2−/− and MyD88−/− mice as compared to their wild type (WT) counterpart. In transgenic mice expressing a luciferase reporter gene under the control of the mTLR2 promoter, MHV-68 challenge activated TLR2 transcription. Increased expression levels of TLR2 on blood granulocytes (CD115−Gr1+) and inflammatory monocytes (CD115+Gr1+), which mobilized to the lungs upon infection with MHV-68, was also confirmed by flow cytometry. Finally, TLR2 or MyD88 deficiency was associated with decreased IL-6 and type 1 IFN production as well as increased viral burden during short-term challenges with MHV-68. Conclusions/Significance TLR2 contributes to the production of inflammatory cytokines and type 1 IFN as well as to the control of viral burden during infection with MHV-68. Taken together, our results suggest that the TLR2 pathway has a relevant role in the recognition of this virus and in the subsequent activation of the innate immune response. PMID:21060793

  3. Genetic variability in swine leukocyte antigen class II and Toll-like receptors affects immune responses to vaccination for bacterial infections in pigs.

    PubMed

    Shinkai, H; Arakawa, A; Tanaka-Matsuda, M; Ide-Okumura, H; Terada, K; Chikyu, M; Kawarasaki, T; Ando, A; Uenishi, H

    2012-12-01

    The genes encoding swine leukocyte antigen (SLA) and Toll-like receptor (TLR) are highly polymorphic in pig populations, and likely have influences on infection and the effects of vaccination. We explored the associations of different genotypes of SLA class II and of the genes TLR1, TLR4, TLR5, and TLR6 with antibody responses after vaccination against Erysipelothrix rhusiopathiae (ER) and Actinobacillus pleuropneumoniae (APP) serotypes 1, 2, and 5 in 191 Duroc pigs maintained under specific pathogen-free conditions. We demonstrated close relationships between SLA class II and ER antibody response and between TLR genes other than TLR4 and APP antibody responses. Pigs with specific haplotypes in SLA class II or TLR5 showed decreased antibody response to ER vaccination or increased responses to APP2 and APP5 vaccination, respectively. It might be possible to breed for responsiveness to vaccination and to implement new vaccine development strategies unaffected by genetic backgrounds of pigs.

  4. Mucolipin 1 positively regulates TLR7 responses in dendritic cells by facilitating RNA transportation to lysosomes.

    PubMed

    Li, Xiaobing; Saitoh, Shin-Ichiroh; Shibata, Takuma; Tanimura, Natsuko; Fukui, Ryutaro; Miyake, Kensuke

    2015-02-01

    Toll-like receptor 7 (TLR7) and TLR9 sense microbial single-stranded RNA (ssRNA) and ssDNA in endolysosomes. Nucleic acid (NA)-sensing in endolysosomes is thought to be important for avoiding TLR7/9 responses to self-derived NAs. Aberrant self-derived NA transportation to endolysosomes predisposes to autoimmune diseases. To restrict NA-sensing in endolysosomes, TLR7/9 trafficking is tightly controlled by a multiple transmembrane protein Unc93B1. In contrast to TLR7/9 trafficking, little is known about a mechanism underlying NA transportation. We here show that Mucolipin 1 (Mcoln1), a member of the transient receptor potential (TRP) cation channel gene family, has an important role in ssRNA trafficking into lysosomes. Mcoln1(-/-) dendritic cells (DCs) showed impaired TLR7 responses to ssRNA. A mucolipin agonist specifically enhanced TLR7 responses to ssRNAs. The channel activity of Mcoln1 is activated by a phospholipid phosphatidylinositol (3,5) bisphosphate (PtdIns(3,5)P2), which is generated by a class III lipid kinase PIKfyve. A PIKfyve inhibitor completely inhibited TLR7 responses to ssRNA in DCs. Confocal analyses showed that ssRNA transportation to lysosomes in DCs was impaired by PIKfyve inhibitor as well as by the lack of Mcoln1. Transportation of TLR9 ligands was also impaired by the PIKfyve inhibitor. These results demonstrate that the PtdIns(3,5)P2-Mcoln1 axis has an important role in ssRNA transportation into lysosomes in DCs.

  5. A member of the Tlr family is involved in dsRNA innate immune response in Paracentrotus lividus sea urchin.

    PubMed

    Russo, Roberta; Chiaramonte, Marco; Matranga, Valeria; Arizza, Vincenzo

    2015-08-01

    The innate immune response involves proteins such as the membrane receptors of the Toll-like family (TLRs), which trigger different intracellular signalling pathways that are dependent on specific stimulating molecules. In sea urchins, TLR proteins are encoded by members of a large multigenic family composed of 60-250 genes in different species. Here, we report a newly identified mRNA sequence encoding a TLR protein (referred to as Pl-Tlr) isolated from Paracentrotus lividus immune cells. The partial protein sequence contained the conserved Toll/IL-1 receptor (TIR) domain, the transmembrane domain and part of the leucine repeats. Phylogenetic analysis of the Pl-Tlr protein was accomplished by comparing its sequence with those of TLRs from different classes of vertebrates and invertebrates. This analysis was suggestive of an evolutionary path that most likely represented the course of millions of years, starting from simple organisms and extending to humans. Challenge of the sea urchin immune system with poly-I:C, a chemical compound that mimics dsRNA, caused time-dependent Pl-Tlr mRNA up-regulation that was detected by QPCR. In contrast, bacterial LPS injury did not affect Pl-Tlr transcription. The study of the Tlr genes in the sea urchin model system may provide new perspectives on the role of Tlrs in the invertebrate immune response and clues concerning their evolution in a changing world.

  6. Goose Toll-like receptor 7 (TLR7), myeloid differentiation factor 88 (MyD88) and antiviral molecules involved in anti-H5N1 highly pathogenic avian influenza virus response.

    PubMed

    Wei, Liangmeng; Jiao, Peirong; Yuan, Runyu; Song, Yafen; Cui, Pengfei; Guo, Xuchen; Zheng, Bofang; Jia, Weixin; Qi, Wenbao; Ren, Tao; Liao, Ming

    2013-05-15

    In mammals, Toll-like receptor 7 (TLR7) is an important membrane-bound receptor triggered by antiviral compounds and single-stranded RNA. It is implicated in the immune response to viruses such as influenza virus. It was not known whether geese, a natural host for avian influenza viruses, possess a homologue of mammalian TLR7 for recognizing avian influenza virus. In this study, we cloned the full-length of goose TLR7 and partial sequences of its adaptor protein, myeloid differentiation factor 88 (MyD88), some antiviral molecules such as RNA-dependent protein kinase (PKR) and 2',5'-oligoadenylate synthetase (OAS). Goose TLR7 has a protein secondary structure identical to that of mammals, consisting of several leucine-rich domains, a transmembrane domain, and Toll/interleukin-1 receptor domain. To further understand whether the MyD88-dependent pathway of TLR7 is involved in the antiviral innate immune response against highly pathogenic avian influenza virus (HPAIV) infection in geese, we inoculated geese with an H5N1 HPAIV isolated from ducks in 2004. The virus, A/Duck/Guangdong/212/2004, replicated in various tissues resulting in 40% mortality. Quantitative real-time PCR analysis showed upregulation of mRNA transcripts for TLR7, MyD88, PKR and OAS in the lungs of geese at 1, 2 and 3 days post-inoculation. Therefore, the MyD88-dependent pathway of TLR7 was involved in the early stage of antiviral innate immune response in geese during H5N1 HPAIV infection.

  7. Extracellular microRNAs activate nociceptor neurons to elicit pain via TLR7 and TRPA1.

    PubMed

    Park, Chul-Kyu; Xu, Zhen-Zhong; Berta, Temugin; Han, Qingjian; Chen, Gang; Liu, Xing-Jun; Ji, Ru-Rong

    2014-04-02

    Intracellular microRNAs (miRNAs) are key regulators of gene expression. The role of extracellular miRNAs in neuronal activation and sensory behaviors are unknown. Here we report an unconventional role of extracellular miRNAs for rapid excitation of nociceptor neurons via toll-like receptor-7 (TLR7) and its coupling to TRPA1 ion channel. miRNA-let-7b induces rapid inward currents and action potentials in dorsal root ganglion (DRG) neurons. These responses require the GUUGUGU motif, only occur in neurons coexpressing TLR7 and TRPA1, and are abolished in mice lacking Tlr7 or Trpa1. Furthermore, let-7b induces TLR7/TRPA1-dependent single-channel activities in DRG neurons and HEK293 cells overexpressing TLR7/TRPA1. Intraplantar injection of let-7b elicits rapid spontaneous pain via TLR7 and TRPA1. Finally, let-7b can be released from DRG neurons by neuronal activation, and let-7b inhibitor reduces formalin-induced TRPA1 currents and spontaneous pain. Thus, secreted extracellular miRNAs may serve as novel pain mediators via activating TLR7/TRPA1 in nociceptor neurons.

  8. Characterization of TLR-induced inflammatory responses in COPD and control lung tissue explants

    PubMed Central

    Pomerenke, Anna; Lea, Simon R; Herrick, Sarah; Lindsay, Mark A; Singh, Dave

    2016-01-01

    Purpose Viruses are a common cause of exacerbations in chronic obstructive pulmonary disease (COPD). They activate toll-like receptors (TLRs) 3, 7, and 8, leading to a pro-inflammatory response. We have characterized the responses of TLR3 and TLR7/8 in lung tissue explants from COPD patients and control smokers. Methods We prepared lung whole tissue explants (WTEs) from patients undergoing surgery for confirmed or suspected lung cancer. In order to mimic the conditions of viral infection, we used poly(I:C) for TLR3 stimulation and R848 for TLR7/8 stimulation. These TLR ligands were used alone and in combination. The effects of tumor necrosis factor α (TNFα) neutralization and dexamethasone on TLR responses were examined. Inflammatory cytokine release was measured by enzyme-linked immunosorbent assay and gene expression by quantitative real-time polymerase chain reaction. Results WTEs from COPD patients released higher levels of pro-inflammatory cytokines compared with WTEs from smokers. Activation of multiple TLRs led to a greater than additive release of TNFα and CCL5. TNFα neutralization and dexamethasone treatment decreased cytokine release. Conclusion This WTE model shows an enhanced response of COPD compared with controls, suggesting an increased response to viral infection. There was amplification of innate immune responses with multiple TLR stimulation. PMID:27729782

  9. Role of constitutive androstane receptor in Toll-like receptor-mediated regulation of gene expression of hepatic drug-metabolizing enzymes and transporters.

    PubMed

    Shah, Pranav; Guo, Tao; Moore, David D; Ghose, Romi

    2014-01-01

    Impairment of drug disposition in the liver during inflammation has been attributed to downregulation of gene expression of drug-metabolizing enzymes (DMEs) and drug transporters. Inflammatory responses in the liver are primarily mediated by Toll-like receptors (TLRs). We have recently shown that activation of TLR2 or TLR4 by lipoteichoic acid (LTA) and lipopolysaccharide (LPS), respectively, leads to the downregulation of gene expression of DMEs/transporters. However, the molecular mechanism underlying this downregulation is not fully understood. The xenobiotic nuclear receptors, pregnane X receptor (PXR) and constitutive androstane receptor (CAR), regulate the expression of DMEs/transporter genes. Downregulation of DMEs/transporters by LTA or LPS was associated with reduced expression of PXR and CAR genes. To determine the role of CAR, we injected CAR(+/+) and CAR(-/-) mice with LTA or LPS, which significantly downregulated (~40%-60%) RNA levels of the DMEs, cytochrome P450 (Cyp)3a11, Cyp2a4, Cyp2b10, uridine diphosphate glucuronosyltransferase 1a1, amine N-sulfotransferase, and the transporter, multidrug resistance-associated protein 2, in CAR(+/+) mice. Suppression of most of these genes was attenuated in LTA-treated CAR(-/-) mice. In contrast, LPS-mediated downregulation of these genes was not attenuated in CAR(-/-) mice. Induction of these genes by mouse CAR activator 1,4-bis-[2-(3,5-dichloropyridyloxy)]benzene was sustained in LTA- but not in LPS-treated mice. Similar observations were obtained in humanized CAR mice. We have replicated these results in primary hepatocytes as well. Thus, LPS can downregulate DME/transporter genes in the absence of CAR, whereas the effect of LTA on these genes is attenuated in the absence of CAR, indicating the potential involvement of CAR in LTA-mediated downregulation of DME/transporter genes.

  10. Rothia dentocariosa induces TNF-alpha production in a TLR2-dependent manner.

    PubMed

    Kataoka, Hideo; Taniguchi, Makoto; Fukamachi, Haruka; Arimoto, Takafumi; Morisaki, Hirobumi; Kuwata, Hirotaka

    2014-06-01

    Previous work suggested that Rothia dentocariosa is associated with periodontal inflammatory disease. However, little is known about the pathogenicity of this bacterium. To characterize host response to this bacterium, we measured (via ELISA) the amount of TNF-α in the culture supernatant following the stimulation of THP-1 cells (a human acute monocytic leukemia cell line) with R. dentocariosa cells (ATCC14189 and ATCC14190). Exposure to bacterial cells induced the production of TNF-α in a dose-dependent manner. The bacterial induction of TNF-α in THP-1 cells was mediated by the Toll-like receptor 2 (TLR2), as demonstrated by gene-specific knockdown via siRNA, which successfully suppressed TLR2 expression and significantly inhibited the production of TNF-α in the culture supernatant. To confirm the role of TLR2, we examined TLR2-dependent NF-κB activation by R. dentocariosa cells in a distinct cell line. Specifically, HEK293 cells were transiently cotransfected with the human TLR2 gene and an NF-κB-dependent luciferase-encoding reporter gene. The bacterial cells induced NF-κB activation in the transfected HEK293 cells in a dose-dependent manner. In contrast, bacterial cells failed to induce NF-κB activation in cells transfected with pEF6 control vector. Taken together, these results suggest that R. dentocariosa induces host TNF-α production by a TLR2-dependent mechanism.

  11. TLR9 re-expression in cancer cells extends the S-phase and stabilizes p16INK4a protein expression

    PubMed Central

    Parroche, P; Roblot, G; Le Calvez-Kelm, F; Tout, I; Marotel, M; Malfroy, M; Durand, G; McKay, J; Ainouze, M; Carreira, C; Allatif, O; Traverse-Glehen, A; Mendiola, M; Pozo-Kreilinger, J J; Caux, C; Tommasino, M; Goutagny, N; Hasan, U A

    2016-01-01

    Toll-like receptor 9 (TLR9) recognizes bacterial, viral or cell damage-associated DNA, which initiates innate immune responses. We have previously shown that TLR9 expression is downregulated in several viral induced cancers including HPV16-induced cervical neoplasia. Findings supported that downregulation of TLR9 expression is involved in loss of anti-viral innate immunity allowing an efficient viral replication. Here we investigated the role of TLR9 in altering the growth of transformed epithelial cells. Re-introducing TLR9 under the control of an exogenous promoter in cervical or head and neck cancer patient-derived cells reduced cell proliferation, colony formation and prevented independent growth of cells under soft agar. Neither TLR3, 7, nor the TLR adapter protein MyD88 expression had any effect on cell proliferation, indicating that TLR9 has a unique role in controlling cell growth. The reduction of cell growth was not due to apoptosis or necrosis, yet we observed that cells expressing TLR9 were slower in entering the S-phase of the cell cycle. Microarray-based gene expression profiling analysis highlighted a strong interferon (IFN) signature in TLR9-expressing head and neck cancer cells, with an increase in IFN-type I and IL-29 expression (IFN-type III), yet neither IFN-type I nor IL-29 production was responsible for the block in cell growth. We observed that the protein half-life of p16INK4a was increased in TLR9-expressing cells. Taken together, these data show for the first time that TLR9 affects the cell cycle by regulating p16INK4a post-translational modifications and highlights the role of TLR9 in the events that lead to carcinogenesis. PMID:27454079

  12. Actinobacillus actinomycetemcomitans lipopolysaccharide stimulates the phosphorylation of p44 and p42 MAP kinases through CD14 and TLR-4 receptor activation in human gingival fibroblasts.

    PubMed

    Gutiérrez-Venegas, Gloria; Kawasaki-Cárdenas, Perla; Cruz-Arroyo, Santa Rita; Pérez-Garzón, Miguel; Maldonado-Frías, Silvia

    2006-04-25

    Tyrosine phosphorylation is an early step in lipopolysaccharide (LPS) stimulated monocytes and macrophages that appears to play a key role in signal transduction. We have demonstrated that LPS purified from Actinobacillus actinomycetemcomitans also increases protein tyrosine phosphorylation in human gingival fibroblasts (HGF). This effect was elicited rapidly after LPS stimulation at concentrations that stimulate anti-bacterial responses in human gingival fibroblasts. Two main proteins, with an apparent molecular weight of 44 and 42 kDa, were phosphorylated after LPS stimulation of the human gingival fibroblasts. The phosphorylation was detected after 5 to 15 min and reached the maximum at 30 min of treatment. The increase in tyrosine phosphorylation was apparent following stimulation with LPS at 10 ng/ml and the response was dose dependent up to 10 microg/ml. Pretreatment with the tyrosine kinase inhibitors, herbimycin A and genistein inhibited the LPS-stimulated phosphorylation of p44 and p42 MAP kinases in a dose dependent manner. Pretreatment of human gingival fibroblasts with antibodies anti-CD14 or anti-TLR-4 but not anti-TLR-2 inhibited the LPS-induced tyrosine phosphorylation of p44 and p42. Additionally, LPS-induced p44 and p42 phosphorylation was inhibited by polymyxin treatment. These findings demonstrate that LPS from A. actinomycetemcomintans increases rapidly p44 and p42 phosphorylation (ERK 1 and ERK 2, respectively) in human gingival fibroblasts. Our data also suggest that CD14 and TLR-4 receptors are involved in the LPS effects in human gingival fibroblasts.

  13. The Toll-Like Receptor 4 (TLR4) Variant rs2149356 and Risk of Gout in European and Polynesian Sample Sets

    PubMed Central

    Rasheed, Humaira; McKinney, Cushla; Stamp, Lisa K.; Dalbeth, Nicola; Topless, Ruth K.; Day, Richard; Kannangara, Diluk; Williams, Kenneth; Smith, Malcolm; Janssen, Matthijs; Jansen, Tim L.; Joosten, Leo A.; Radstake, Timothy R.; Riches, Philip L.; Tausche, Anne-Kathrin; Lioté, Frederic; Lu, Leo; Stahl, Eli A.; Choi, Hyon K.; So, Alexander; Merriman, Tony R.

    2016-01-01

    Deposition of crystallized monosodium urate (MSU) in joints as a result of hyperuricemia is a central risk factor for gout. However other factors must exist that control the progression from hyperuricaemia to gout. A previous genetic association study has implicated the toll-like receptor 4 (TLR4) which activates the NLRP3 inflammasome via the nuclear factor-κB signaling pathway upon stimulation by MSU crystals. The T-allele of single nucleotide polymorphism rs2149356 in TLR4 is a risk factor associated with gout in a Chinese study. Our aim was to replicate this observation in participants of European and New Zealand Polynesian (Māori and Pacific) ancestry. A total of 2250 clinically-ascertained prevalent gout cases and 13925 controls were used. Non-clinically-ascertained incident gout cases and controls from the Health Professional Follow-up (HPFS) and Nurses Health Studies (NHS) were also used. Genotypes were derived from genome-wide genotype data or directly obtained using Taqman. Logistic regression analysis was done including age, sex, diuretic exposure and ancestry as covariates as appropriate. The T-allele increased the risk of gout in the clinically-ascertained European samples (OR = 1.12, P = 0.012) and decreased the risk of gout in Polynesians (OR = 0.80, P = 0.011). There was no evidence for association in the HPFS or NHS sample sets. In conclusion TLR4 SNP rs2143956 associates with gout risk in prevalent clinically-ascertained gout in Europeans, in a direction consistent with previously published results in Han Chinese. However, with an opposite direction of association in Polynesians and no evidence for association in a non-clinically-ascertained incident gout cohort this variant should be analysed in other international gout genetic data sets to determine if there is genuine evidence for association. PMID:26808548

  14. The Toll-Like Receptor 4 (TLR4) Variant rs2149356 and Risk of Gout in European and Polynesian Sample Sets.

    PubMed

    Rasheed, Humaira; McKinney, Cushla; Stamp, Lisa K; Dalbeth, Nicola; Topless, Ruth K; Day, Richard; Kannangara, Diluk; Williams, Kenneth; Smith, Malcolm; Janssen, Matthijs; Jansen, Tim L; Joosten, Leo A; Radstake, Timothy R; Riches, Philip L; Tausche, Anne-Kathrin; Lioté, Frederic; Lu, Leo; Stahl, Eli A; Choi, Hyon K; So, Alexander; Merriman, Tony R

    2016-01-01

    Deposition of crystallized monosodium urate (MSU) in joints as a result of hyperuricemia is a central risk factor for gout. However other factors must exist that control the progression from hyperuricaemia to gout. A previous genetic association study has implicated the toll-like receptor 4 (TLR4) which activates the NLRP3 inflammasome via the nuclear factor-κB signaling pathway upon stimulation by MSU crystals. The T-allele of single nucleotide polymorphism rs2149356 in TLR4 is a risk factor associated with gout in a Chinese study. Our aim was to replicate this observation in participants of European and New Zealand Polynesian (Māori and Pacific) ancestry. A total of 2250 clinically-ascertained prevalent gout cases and 13925 controls were used. Non-clinically-ascertained incident gout cases and controls from the Health Professional Follow-up (HPFS) and Nurses Health Studies (NHS) were also used. Genotypes were derived from genome-wide genotype data or directly obtained using Taqman. Logistic regression analysis was done including age, sex, diuretic exposure and ancestry as covariates as appropriate. The T-allele increased the risk of gout in the clinically-ascertained European samples (OR = 1.12, P = 0.012) and decreased the risk of gout in Polynesians (OR = 0.80, P = 0.011). There was no evidence for association in the HPFS or NHS sample sets. In conclusion TLR4 SNP rs2143956 associates with gout risk in prevalent clinically-ascertained gout in Europeans, in a direction consistent with previously published results in Han Chinese. However, with an opposite direction of association in Polynesians and no evidence for association in a non-clinically-ascertained incident gout cohort this variant should be analysed in other international gout genetic data sets to determine if there is genuine evidence for association.

  15. Polo-like kinase 1 (PLK1) is involved in toll-like receptor (TLR)-mediated TNF-α production in monocytic THP-1 cells.

    PubMed

    Hu, Jinyue; Wang, Guihua; Liu, Xueting; Zhou, Lina; Jiang, Manli; Yang, Li

    2013-01-01

    Polo-like kinases (PLKs) have been reported to be essential components of anti-viral pathways. However, the role of PLKs in the production of pro-inflammatory cytokines induced by TLR activation is uncertain. We report here that monocytic THP-1 cells expressed PLK1, PLK2, PLK3 and PLK4. When THP-1 cells were treated with GW843682X, an inhibitor of PLK1 and PLK3, the results showed that GW843682X down-regulated Pam3CSK4- and LPS-induced TNF-α at both the gene and protein levels. GW843682X did not impact Pam3CSK4-induced IL-1β and IL-8 or LPS-induced IL-1β, but it down-regulated LPS-induced IL-8 significantly. Moreover, western blot results showed that TLRs activated PLK1, and PLK1 inhibition by RNA interference down-regulated Pam3CSK4-induced TNF-α production, suggesting the involvement of PLK1 in TNF-α up-regulation. In addition, GW843682X treatment for 12 to 24 h induced cell death and down-regulated MyD88, but neither of these roles contributed to the down-regulation of TNF-α, as TNF-α gene expression was up-regulated at 1 h. Furthermore, GW843682X inhibited Pam3CSK4-induced activation of ERK and NF-κB, which contributed to Pam3CSK4-induced up-regulation of TNF-α. GW843682X also inhibited LPS-induced activation of ERK, p38 and NF-κB, which contributed to LPS-induced up-regulation of TNF-α. Taken together, these results suggested that PLK1 is involved in TLR2- and TLR4-induced inflammation, and GW843682X may be valuable for the regulation of the inflammatory response.

  16. Isoflurane preconditioning provides neuroprotection against stroke by regulating the expression of the TLR4 signalling pathway to alleviate microglial activation

    PubMed Central

    Sun, Meiyan; Deng, Bin; Zhao, Xiaoyong; Gao, Changjun; Yang, Lu; Zhao, Hui; Yu, Daihua; Zhang, Feng; Xu, Lixian; Chen, Lei; Sun, Xude

    2015-01-01

    Excessive microglial activation often contributes to inflammation-mediated neurotoxicity in the ischemic penumbra during the acute stage of ischemic stroke. Toll-like receptor 4 (TLR4) has been reported to induce microglial activation via the NF-κB pathway. Isoflurane preconditioning (IP) can provide neuroprotection and inhibit microglial activation. In this study, we investigated the roles of the TLR4 signalling pathway in IP to exert neuroprotection following ischemic stroke in vivo and in vitro. The results showed that 2% IP alleviated neurological deficits, reduced the infarct volume, attenuated apoptosis and weakened microglial activation in the ischemic penumbra. Furthermore, IP down-regulated the expression of HSP 60, TLR4 and MyD88 and up-regulated inhibitor of IκB-α expression compared with I/R group in vivo. In vitro, 2% IP and a specific inhibitor of TLR4, CLI-095, down-regulated the expression of TLR4, MyD88, IL-1β, TNF-α and Bax, and up-regulated IκB-α and Bcl-2 expression compared with OGD group. Moreover, IP and CLI-095 attenuated microglial activation-induced neuronal apoptosis, and overexpression of the TLR4 gene reversed the neuroprotective effects of IP. In conclusion, IP provided neuroprotection by regulating TLR4 expression directly, alleviating microglial activation and neuroinflammation. Thus, inhibiting the activation of microglial activation via TLR4 may be a new avenue for stroke treatment. PMID:26086415

  17. Age-Dependent TLR3 Expression of the Intestinal Epithelium Contributes to Rotavirus Susceptibility

    PubMed Central

    Pott, Johanna; Stockinger, Silvia; Torow, Natalia; Smoczek, Anna; Lindner, Cornelia; McInerney, Gerald; Bäckhed, Fredrik; Baumann, Ulrich; Pabst, Oliver; Bleich, André; Hornef, Mathias W.

    2012-01-01

    Rotavirus is a major cause of diarrhea worldwide and exhibits a pronounced small intestinal epithelial cell (IEC) tropism. Both human infants and neonatal mice are highly susceptible, whereas adult individuals remain asymptomatic and shed only low numbers of viral particles. Here we investigated age-dependent mechanisms of the intestinal epithelial innate immune response to rotavirus infection in an oral mouse infection model. Expression of the innate immune receptor for viral dsRNA, Toll-like receptor (Tlr) 3 was low in the epithelium of suckling mice but strongly increased during the postnatal period inversely correlating with rotavirus susceptibility, viral shedding and histological damage. Adult mice deficient in Tlr3 (Tlr3−/−) or the adaptor molecule Trif (TrifLps2/Lps2) exerted significantly higher viral shedding and decreased epithelial expression of proinflammatory and antiviral genes as compared to wild-type animals. In contrast, neonatal mice deficient in Tlr3 or Trif did not display impaired cell stimulation or enhanced rotavirus susceptibility. Using chimeric mice, a major contribution of the non-hematopoietic cell compartment in the Trif-mediated antiviral host response was detected in adult animals. Finally, a significant age-dependent increase of TLR3 expression was also detected in human small intestinal biopsies. Thus, upregulation of epithelial TLR3 expression during infancy might contribute to the age-dependent susceptibility to rotavirus infection. PMID:22570612

  18. Toll Like Receptor 3 modulates immunopathology during a Schistosoma mansoni egg-driven Th2 response in the lung

    PubMed Central

    Joshi, Amrita D.; Schaller, Matthew; Lukacs, Nicholas W.; Kunkel, Steven L.; Hogaboam, Cory M.

    2010-01-01

    We examined the role of Toll Like Receptor 3 (TLR3) in Th2-driven pulmonary granulomatous disease, using wildtype (TLR3+/+) and TLR3 gene deficient (TLR3−/−) mice in a well-established model of S. mansoni egg induced pulmonary granuloma. The intravenous bolus injection of S. mansoni eggs into S. mansoni-sensitized TLR3+/+ mice was associated with an increase in TLR3 transcript expression in alveolar macrophages and ex vivo spleen and lung cultures at day 8 after egg injection. Lungs from TLR3−/− mice showed an increase in granuloma size, greater collagen deposition around the granuloma, and increased Th2 cytokine and chemokine levels compared with similarly sensitized and challenged TLR3+/+ mice. Macrophages from TLR3−/− mice exhibited a M2 phenotype characterized by increased arginase and CCL2 expression. Significantly greater numbers of CD4+CD25+ T cells were present in the lungs of TLR3−/− mice compared with TLR3+/+ mice at day 8 after egg embolization. Cells derived from granulomatous lung and lung draining lymph nodes of TLR3−/− mice released significantly higher levels of IL-17 levels relative to TLR3+/+ cells. Thus, our data suggest that TLR3 has a major regulatory role during a Th2-driven granulomatous response as its absence enhanced immunopathology. PMID:19009529

  19. Association of TLR3 L412F Polymorphism with Cytomegalovirus Infection in Children

    PubMed Central

    Studzińska, Mirosława; Jabłońska, Agnieszka; Wiśniewska-Ligier, Małgorzata; Nowakowska, Dorota; Gaj, Zuzanna; Leśnikowski, Zbigniew J.; Woźniakowska-Gęsicka, Teresa; Wilczyński, Jan; Paradowska, Edyta

    2017-01-01

    Intracellular Toll-like receptor 3 (TLR3) recognizes viral double-stranded RNA (dsRNA) and activates antiviral immune responses through the production of type I interferons (IFNs) and inflammatory cytokines. This receptor binds to dsRNA molecules produced during human cytomegalovirus (HCMV) replication. TLR7 senses viral single-stranded RNA (ssRNA) in endosomes, and it can interact with endogenous RNAs. We determined the genotype distribution of single-nucleotide polymorphisms (SNPs) within the TLR3 and TLR7 genes in children with HCMV infection and the relationship between TLR polymorphisms and viral infection. We genotyped 59 children with symptomatic HCMV infection and 78 healthy individuals for SNPs in the TLR3 (rs3775290, c.1377C>T, F459F; rs3775291, c.1234C>T, L412F; rs3775296, c.-7C>A) and TLR7 (rs179008, c.32A>T, Q11L; rs5741880, c.3+1716G>T) genes. SNP genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and capillary electrophoresis. The HCMV DNA load was quantified by real-time PCR. We found an increased frequency of the heterozygous genotype TLR3 L412F in children with HCMV infection compared with uninfected cases. In individuals with a mutation present in at least one allele of the L412F SNP, an increased risk of HCMV disease was found, and this result remained highly significant after Bonferroni’s correction for multiple testing (Pc < 0.001). The heterozygous genotype of this SNP was associated with the increased risk of HCMV disease in an adjusted model that included the HCMV DNA copy number in whole blood and urine (P < 0.001 and P = 0.008, respectively). Moreover, those with a heterozygous genotype of rs3775296 showed an increased relative risk of HCMV infection (P = 0.042), but this association did not reach statistical significance after correction for multiple testing. In contrast, the rs3775290 SNP of TLR3 and TLR7 SNPs were not related to viral infection. A moderate linkage

  20. The role of indoleamine 2,3-dioxygenase-aryl hydrocarbon receptor pathway in the TLR4-induced tolerogenic phenotype in human DCs

    PubMed Central

    Salazar, Fabián; Awuah, Dennis; Negm, Ola H.; Shakib, Farouk; Ghaemmaghami, Amir M.

    2017-01-01

    A controlled inflammatory response is required for protection against infection, but persistent inflammation causes tissue damage. Dendritic cells (DCs) have a unique capacity to promote both inflammatory and anti-inflammatory processes. One key mechanism involved in DC-mediated immunosuppression is the expression of tryptophan-metabolizing enzyme indoleamine 2,3-dioxygenase (IDO). IDO has been implicated in diverse processes in health and disease but its role in endotoxin tolerance in human DCs is still controversial. Here we investigated the role of IDO in shaping DCs phenotype and function under endotoxin tolerance conditions. Our data show that TLR4 ligation in LPS-primed DCs, induced higher levels of both IDO isoforms together with the transcription factor aryl-hydrocarbon receptor (AhR), compared to unprimed controls. Additionally, LPS conditioning induced an anti-inflammatory phenotype in DCs - with an increase in IL-10 and higher expression of programmed death ligand (PD-L)1 and PD-L2 - which were partially dependent on IDO. Furthermore, we demonstrated that the AhR-IDO pathway was responsible for the preferential activation of non-canonical NF-κB pathway in LPS-conditioned DCs. These data provide new insight into the mechanisms of the TLR4-induced tolerogenic phenotype in human DCs, which can help the better understanding of processes involved in induction and resolution of chronic inflammation and tolerance. PMID:28256612

  1. Structural and evolutionary characteristics of fish-specific TLR19.

    PubMed

    Wang, Jinlan; Zhang, Zheng; Fu, Hui; Zhang, Shangli; Liu, Jing; Chang, Fen; Li, Fang; Zhao, Jing; Yin, Deling

    2015-11-01

    Toll-like receptors (TLRs) are important pattern recognition receptors in the innate immune system of fish. Although ten years have passed since the first identification, the systematic knowledge about fish-specific TLR19 is still far insufficient. In present study, a phylogenetic analysis showed that TLR19 belonged to family 11, and clustered with TLR20 and TLR11/12 on the evolutionary tree. TLR20 is the closest paralogue of TLR19. The ectodomain of TLR19 contains 24 leucine-rich repeat (LRR) modules. The electrostatic surface potential analysis indicated that the modeled structure of TLR19 ectodomain showed much stronger polarity on the ascending lateral surface than on the descending lateral surface. The ascending lateral surface with strong electrostatic surface potential possibly mainly participates in the ligand binding of TLR19 ectodomain. The quite small dN/dS value at the TLR19 locus showed that TLR19 was very conserved. Approximately one third codons in the coding sequence of TLR19 were subjected to significantly negative selection, whereas only 5 codons underwent significantly positive selection. Overall, these findings possibly help in deepening the understanding to fish-specific TLR19.

  2. Association of Single Nucleotide Polymorphisms in Toll-like Receptors with Acinetobacter baumanii Infectionin a Chinese Population

    PubMed Central

    HE, Lei; LIN, Maohu; FAN, Wensheng; LIU, Yunxi; SUO, Jijiang; XING, Yubin; JIA, Ning

    2016-01-01

    Background: During recent years, infection of Acinetobacter baumanii showed a rapid growth in hospitals and community. Toll-like receptors (TLRs) are the most important pattern recognition receptors, which play a critical role during recognizing invading pathogens by the natural immune system. Our objective was to determine the associations of TLRs polymorphisms with the susceptibility to A. baumanii infection in a Chinese population. Methods: We carried out a case-control study, genotyping 13 polymorphisms of TLR-2, TLR-4, TLR-5 and TLR-9 genes on 423 A. baumanii-infected patients and 385 exposed controls. Thirteen SNPs at the TLR-2 (rs3804099, rs7656411 and rs76112010), TLR-4 (rs1927914, rs10759932 and rs11536889), TLR-5 (rs1341987, rs1640827, rs1861172, rs2241097, rs5744174 and rs17163737) and TLR9 (rs187084) genes were analyzed. SNP genotyping was performed using an improved multiplex ligation detection reaction (iMLDR) technique. Results: The SNP of TLR-9, rs187084, was related to A. baumanii-infection significantly under recessive model (G/G, to A/A + G/A, P = 0.0064, OR = 0.59, 95% CI = 0.40–0.86) after adjustment with age. Besides, the haplotype GCG of TLR-4 was significantly associated with A. baumanii infection (P = 0.027). Conclusion: TLR-4 and TLR-9 may be related to the susceptibility to A. baumanii infection in a Chinese population. PMID:27057517

  3. Biocomputational analysis of evolutionary relationship between toll-like receptor and nucleotide-binding oligomerization domain-like receptors genes

    PubMed Central

    Bhardwaj, Rabia; Mukhopadhyay, Chandra Shekhar; Deka, Dipak; Verma, Ramneek; Dubey, P. P.; Arora, J. S.

    2016-01-01

    Aim: The active domains (TIR and NACHT) of the pattern recognition receptors (PRRs: Toll-like receptors [TLRs] and nucleotide-binding oligomerization domain [NOD]-like receptors [NLR], respectively) are the major hotspots of evolution as natural selection has crafted their final structure by substitution of residues over time. This paper addresses the evolutionary perspectives of the TLR and NLR genes with respect to the active domains in terms of their chronological fruition, functional diversification, and species-specific stipulation. Materials and Methods: A total of 48 full-length cds (and corresponding peptide) of the domains were selected as representatives of each type of PRRs, belonging to divergent animal species, for the biocomputational analyses. The secondary and tertiary structure of the taurine TIR and NACHT domains was predicted to compare the relatedness among the domains under study. Results: Multiple sequence alignment and phylogenetic tree results indicated that these host-specific PRRs formed entirely different clusters, with active domains of NLRs (NACHT) evolved earlier as compared to the active domains of TLRs (TIR). Each type of TLR or NLR shows comparatively less variation among the animal species due to the specificity of action against the type of microbes. Conclusion: It can be concluded from the study that there has been no positive selection acting on the domains associated with disease resistance which is a fitness trait indicating the extent of purifying pressure on the domains. Gene duplication could be a possible reason of genesis of similar kinds of TLRs (virus or bacteria specific). PMID:27956772

  4. Toll-like receptor 7 mediates early innate immune responses to malaria.

    PubMed

    Baccarella, Alyssa; Fontana, Mary F; Chen, Eunice C; Kim, Charles C

    2013-12-01

    Innate immune recognition of malaria parasites is the critical first step in the development of the host response. At present, Toll-like receptor 9 (TLR9) is thought to play a central role in sensing malaria infection. However, we and others have observed that Tlr9(-/-) mice, in contrast to mice deficient in the downstream adaptor, Myeloid differentiation primary response gene 88 (MYD88), exhibit few deficiencies in immune function during early infection with the malaria parasite Plasmodium chabaudi, implying that another MYD88-dependent receptor also contributes to the antimalarial response. Here we use candidate-based screening to identify TLR7 as a key sensor of early P. chabaudi infection. We show that TLR7 mediates a rapid systemic response to infection through induction of cytokines such as type I interferons (IFN-I), interleukin 12, and gamma interferon. TLR7 is also required for induction of IFN-I by other species and strains of Plasmodium, including an etiological agent of human disease, P. falciparum, suggesting that malaria parasites harbor a common pathogen-associated molecular pattern (PAMP) recognized by TLR7. In contrast to the nonredundant requirement for TLR7 in early immune activation, sensing through both TLR7 and TLR9 was required for proinflammatory cytokine production and immune cell activation during the peak of parasitemia. Our findings indicate that TLR7 plays a central role in early immune activation during malaria infection, whereas TLR7 and TLR9 contribute combinatorially to immune responses as infection progresses.

  5. CRF-Amplified Neuronal TLR4/MCP-1 Signaling Regulates Alcohol Self-Administration

    PubMed Central

    June, Harry L; Liu, Juan; Warnock, Kaitlin T; Bell, Kimberly A; Balan, Irina; Bollino, Dominique; Puche, Adam; Aurelian, Laure

    2015-01-01

    Alcohol dependence is a complex disorder that initiates with episodes of excessive alcohol drinking known as binge drinking. It has a 50–60% risk contribution from inherited susceptibility genes; however, their exact identity and function are still poorly understood. We report that alcohol-preferring P rats have innately elevated levels of Toll-like receptor 4 (TLR4) and monocyte chemotactic protein-1 (MCP-1) that colocalize in neurons from the central nucleus of the amygdala (CeA) and ventral tegmental area (VTA). To examine the potential role of a TLR4/MCP-1 signal, we used Herpes Simplex Virus (HSV) vectors (amplicons) that retain in vivo neurotropism. Infusion of amplicons for TLR4 or MCP-1 siRNA into the CeA or VTA from the P rats inhibited target gene expression and blunted binge drinking. A similarly delivered amplicon for scrambled siRNA did not inhibit TLR4 or MCP-1 expression nor reduce binge drinking, identifying a neuronal TLR4/MCP-1 signal that regulates the initiation of voluntary alcohol self-administration. The signal was sustained during alcohol drinking by increased expression of corticotropin-releasing factor and its feedback regulation of TLR4 expression, likely contributing to the transition to alcohol dependence. PMID:25567426

  6. Molecular cloning and expression of TLR in the Eisenia andrei earthworm.

    PubMed

    Škanta, František; Roubalová, Radka; Dvořák, Jiří; Procházková, Petra; Bilej, Martin

    2013-12-01

    Toll-like receptors (TLRs) play an important role in defense responses to pathogens in invertebrates. Here we characterize the first TLR isolated from an oligochaete annelid, namely, Eisenia andrei (EaTLR) and show its expression pattern. The full-length EaTLR cDNA consists of 2615 bp encoding a putative protein of 675 amino acids. The predicted amino acid sequence comprises of an extracellular domain containing 31 amino acid signal peptide and seven leucine-rich repeats (LRR), capped with cysteine-rich N- and C-terminal LRRs followed by a transmembrane domain and cytoplasmic Toll/IL-1R domain (TIR). TIR domains of twenty individual earthworms were sequenced and the variability suggesting the presence of a high number of TLR genes in the genome of E. andrei was observed. Phylogenetic analysis revealed the highest similarity of EaTLR with polychaete annelid, Capitella teleta and TLRs of mollusks and echinoderms. Finally, the highest constitutive expression of EaTLR was observed in the digestive tract. Gene expression was significantly increased in coelomocytes of E. andrei after the challenge with Gram-positive bacteria.

  7. Histone Deacetylase 7 Promotes Toll-like Receptor 4-dependent Proinflammatory Gene Expression in Macrophages*

    PubMed Central

    Shakespear, Melanie R.; Hohenhaus, Daniel M.; Kelly, Greg M.; Kamal, Nabilah A.; Gupta, Praveer; Labzin, Larisa I.; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A.; Reid, Robert C.; Irvine, Katharine M.; Fairlie, David P.; Sweet, Matthew J.

    2013-01-01

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target. PMID:23853092

  8. Association between TLR7 copy number variations and hepatitis B virus infection outcome in Chinese

    PubMed Central

    Li, Fang; Li, Xu; Zou, Gui-Zhou; Gao, Yu-Feng; Ye, Jun

    2017-01-01

    AIM To explore whether copy number variations (CNVs) of toll-like receptor 7 (TLR7) are associated with susceptibility to chronic hepatitis B virus (HBV) infection. METHODS This study included 623 patients (495 males and 128 females) with chronic hepatitis B virus infection (CHB) and 300 patients (135 females and 165 males) with acute hepatitis B virus infection (AHB) as controls. All CHB patients were further categorized according to disease progression after HBV infection (CHB, liver cirrhosis, or hepatocellular carcinoma). Copy numbers of the TLR7 gene were measured using the AccuCopy method. χ2 tests were used to evaluate the association between TLR7 CNVs and infection type. P values, odds ratios, and 95% confidence intervals (CIs) were used to estimate the effects of risk. RESULTS Among male patients, there were significant differences between the AHB group and CHB group in the distribution of TLR7 CNVs. Low copy number of TLR7 was significantly associated with chronic HBV infection (OR = 0.329, 95%CI: 0.229-0.473, P < 0.001). Difference in TLR7 copy number was also found between AHB and CHB female patients, with low copy number again associated with an increased risk of chronic HBV infection (OR = 0.292, 95%CI: 0.173-0.492, P < 0.001). However, there were no significant differences in TLR7 copy number among the three types of chronic HBV infection (CHB, liver cirrhosis, or hepatocellular carcinoma). In addition, there was no association between TLR7 copy number and titer of the HBV e antigen. CONCLUSION Low TLR7 copy number is a risk factor for chronic HBV infection but is not associated with later stages of disease progression. PMID:28321161

  9. Molecular cloning and characterization of LrTLR4, analysis of its inductive expression and associated down-stream signaling molecules following lipopolysaccharide stimulation and Gram-negative bacterial infection.

    PubMed

    Samanta, Mrinal; Basu, Madhubanti; Swain, Banikalyan; Paichha, Mahismita; Lenka, Saswati S; Das, Surajit; Jayasankar, Pallipuram; Maiti, Nikhil Kumar

    2017-01-01

    Toll-like receptors (TLRs) play key roles in innate immunity from lower to higher vertebrates. Among various TLR types, TLR4 was reported to recognize LPS in higher vertebrates resulting in the activation of down-stream signaling pathway. Except in some teleosts, function of TLR4 in most fish species including rohu (Labeo rohita) a commercially important fish species in the South-East Asian countries remained unknown. To investigate it, full-length cDNA of Labeo rohita TLR4 (LrTLR4) was cloned, and it consisted of 2729 bp, with a single ORF of 2469 bp encoding a polypeptide of 822 aa with a predicted molecular mass of 94.753 kDa. Structurally, LrTLR4 consisted of 25 LRRs (leucine rich repeat regions), one TM (trans-membrane) domain and one TIR (Toll/interleukin-1 receptor) domain, and was similar to higher vertebrate's TLR4. Phylogenetically, LrTLR4 exhibited highest (85%) identity with the common carp TLR4b amino acids sequence, and formed a separate subgroup in the phylogenetic tree. LrTLR4 was widely expressed in all tested organs/tissues, and amidst the tissues highest expression was detected in blood and the lowest in eye. In response to LPS-stimulation, LrTLR4 was induced with the activation of MyD88-dependent and TRIF-dependent signaling pathway resulting in pro-inflammatory cytokines (interleukin 6 and 8) and type I IFN gene expression. Infection of rohu with a Gram-negative fish pathogen (Aeromonas hydrophila), also activated LrTLR4. Together, these findings suggest the important role of TLR4 in LPS sensing and augmentation of innate immunity against Gram-negative bacterial infection in fish.

  10. The rationale for combined chemo/immunotherapy using a Toll-like receptor 3 (TLR3) agonist and tumour-derived exosomes in advanced ovarian cancer.

    PubMed

    Adams, M; Navabi, H; Croston, D; Coleman, S; Tabi, Z; Clayton, A; Jasani, B; Mason, M D

    2005-03-18

    A clinical trial employing an immunotherapeutic approach based on the use of a Toll-like receptor 3 (TLR3) agonist and tumour-derived exosomes carrying tumour-associated antigens is planned in advanced ovarian cancer in conjunction with conventional first line chemotherapy. Most patients with ovarian cancer present with advanced disease and despite high initial response rate to chemotherapy the majority will relapse within 2 years with poor overall survival. Tumour antigen-specific T cells are naturally occurring in ovarian cancer patients and T cell infiltration of the tumour is highly prognostic. Novel immunotherapy to expand and activate tumour antigen-specific T cells combined with adjuvant treatment to overcome tumour-induced immunosuppression is considered to be therapeutically beneficial. The rationale for adopting such a combined approach is discussed here.

  11. Pterostilbene, a novel natural plant conduct, inhibits high fat-induced atherosclerosis inflammation via NF-κB signaling pathway in Toll-like receptor 5 (TLR5) deficient mice.

    PubMed

    Zhang, Yuan; Zhang, Yi

    2016-07-01

    Atherosclerosis is a specific form of an artery wall thickens, a syndrome affecting arterial blood vessels due to a chronic inflammatory response in the walls of arteries, which is promoted by fat accumulation. Toll-like receptors (TLRs) play prominent roles in inflammatory responses. And TLR5 is overexpressed in several diseases. Here in our study, we investigated the effect of TLR5 in high fat-induced atherosclerosis via NF-κB signaling pathway modulating pro-inflammatory cytokines releasing. Our results found that high fat induced atherosclerosis in wild type mice with fat accumulation and inflammatory response through NF-κB activation. Contrastly, TLR5 knockout mice displayed lower fat accumulation and ameliorated inflammation after high fat feeding with NF-κB inactivation. In addition, pterostilbene, as a natural dimethyl ether derivative of resveratrol mainly from blueberries, has diverse pharmacological activities, especially anti-inflammation. Our study also found that pterostilbene displayed inhibited role in suppressing inflammatory response through inactivating NF-κB signaling pathway regulated by TLR5 down-regulation in high fat-induced mice. Moreover, in vitro experiments of vascular smooth muscle cells (VSMCs) challenged with LPS or TNF-α, further indicated that NF-κB was involved in atherosclerosis progression, leading to high secretion of pro-inflammatory cytokines. However, VSMCs from TLR5 deficient mice inhibited phosphorylated levels of NF-κB signalilng pathway, finally resulting in down-regulation of inflammatory cytokines. Notably, pterostilbene also displayed suppressed role in inflammatory response via NF-κB inactivity in LPS or TNF-α-induced VSMCs by decreasing TLR5 expression. The results above indicated a novel therapeutic strategy of pterostilbene to protect against atherosclerosis via TLR5 regulation for clinic treatment in the future.

  12. Concomitant activation of P2Y(2) and P2Y(6) receptors on monocytes is required for TLR1/2-induced neutrophil migration by regulating IL-8 secretion.

    PubMed

    Ben Yebdri, Fethia; Kukulski, Filip; Tremblay, Alain; Sévigny, Jean

    2009-10-01

    Extracellular nucleotides regulate a variety of cellular responses involved in inflammation via the activation of P2 receptors. Here, we show that nucleotides regulate TLR2-induced neutrophil migration both in vivo and in vitro. The nucleotide scavenger apyrase inhibited neutrophil recruitment in murine air pouches injected with the TLR2 agonist Pam(3)CSK(4). In agreement, the supernatants of either human primary monocytes or monocytic cells (THP-1 and U937) treated with Pam(3)CSK(4) recruited significantly fewer neutrophils when the former cells were treated in the presence of apyrase. As demonstrated with inhibitory Ab, these supernatants induced neutrophil migration due to IL-8 secretion. In addition, IL-8 secretion was markedly diminished by the non-selective P2 receptor antagonists reactive blue 2 and suramin, and by a selective P2Y(6) antagonist, MRS2578. Selective antagonists of P2Y(1) (MRS2500) and P2Y(11) (NF157) did not affect IL-8 release. The knockdown of either P2Y(2) or P2Y(6) with specific shRNA diminished IL-8 secretion from Pam(3)CSK(4)-treated THP-1 cells. Altogether, these results show that extracellular nucleotides, via P2Y(2) and P2Y(6) receptors, regulate neutrophil migration by controlling TLR2-induced IL-8 release from human monocytes. In line with our previous work on TLR4, this study further supports the importance of nucleotides in bacterial-induced neutrophil migration.

  13. Surface proteins of Setaria cervi induce inflammation in macrophage through Toll-like receptor 4 (TLR4)-mediated signalling pathway.

    PubMed

    Mukherjee, Su; Mukherjee, Sa; Bhattacharya, S; Sinha Babu, S P

    2017-01-01

    Lymphatic filariasis is a vectorborne parasitic disease that results in morbidities, disabilities and socio-economic loss each year globally. Inflammatory consequences associated with any form of filariasis have drawn special attention. However, the molecular insight behind the inflammation of host macrophage (MФ) is considered as one of the shaded areas in filarial research. Herein, major emphasis was given to study the signalling pathway of MФ inflammation induced by surface proteins (SPs) of filarial parasite through in vitro and in vivo approaches. Twenty-four hours of in vitro stimulation of Raw MФs with endotoxin-free SPs of Setaria cervi resulted in the secretion of pro-inflammatory cytokines (TNF-α and IL-1β) that revealed induction of inflammation, which was found to be elicited from classical NF-кB activation. Moreover, this NF-кB activation was found to be signalled from TLR4 and mediated by the downstream signalling intermediates, viz. MyD88, pTAK1 and NEMO. In vivo studies in adult Wistar rats, experimentally injected with SPs, clearly supported the outcomes of in vitro experiments by showing higher degree of inflammation rather classical activation of the peritoneal MФs. Therefore, SPs from S. cervi cuticle could be responsible for the induction of pro-inflammatory response in MФ, which appears to be propagated through TLR4-NF-кB route.

  14. Targeting the TLR9-MyD88 pathway in the regulation of adaptive immune responses

    PubMed Central

    Huang, Xiaopei; Yang, Yiping

    2010-01-01

    IMPORTANCE OF THE FIELD Toll-like receptors (TLRs) are innate immune receptors critical in the innate immune defense against invading pathogens. Recent advances also reveal a crucial role for TLRs in shaping adaptive immune responses, conferring a potential therapeutic value to their modulation in the treatment of diseases. AREAS COVERED IN THIS REVIEW The aim of this review is to discuss TLR9, the TLR9-MyD88 signaling pathway and its role in regulation of adaptive immune responses, as well as potential therapeutic implications by targeting this pathway. WHAT THE READER WILL GAIN This review shows that the TLR9-MyD88 signaling pathway plays a critical role in promoting adaptive immune responses and that modulation of this pathway may have enormous therapeutic potential in enhancing vaccine potency, controlling autoimmunity, as well as improving the outcome of viral vector-mediated gene therapy. TAKE HOME MESSAGE Although TLR9 agonists have been used as adjuvants for enhancing vaccine potency, further exploitation of the TLR9-MyD88 pathway and its dynamic interaction with the immune system in vivo is needed to provide more effective therapeutic inventions in the design of vaccines for infectious diseases, allergies and cancer, in the control of autoimmunity, as well as in the improvement of viral vector-mediated gene therapy. PMID:20560798

  15. Reishi polysaccharides induce immunoglobulin production through the TLR4/TLR2-mediated induction of transcription factor Blimp-1.

    PubMed

    Lin, Kuo-I; Kao, Yeong-Yi; Kuo, Hui-Kai; Yang, Wen-Bin; Chou, Alice; Lin, Hsin-Hung; Yu, Alice L; Wong, Chi-Huey

    2006-08-25

    The polysaccharides of Ganoderma lucidum (Reishi) possess immunomodulation activities; however, their mode of molecular action in regulating each cellular subset in the immune system is still not clear. Here, we investigate the function of the main polysaccharide fraction of Reishi (Reishi-F3) in B lymphocyte activation/differentiation. We find that Reishi-F3 causes mouse splenic B cell activation and differentiation to IgM-secreting plasma cells, and the process depends on Reishi-F3-mediated induction of Blimp-1, a master regulator capable of triggering the changes of a cascade of gene expression during plasmacytic differentiation. In human peripheral B lymphocytes, although Reishi-F3 fails to induce their activation, it is able to enhance antibody secretion, which is associated with Blimp-1 mRNA induction. The function of Reishi-F3 depends on the Toll-like receptors TLR4/TLR2 as neutralizing antibodies against TLR4/TLR2 block Reishi-F3-mediated induction of Blimp-1 mRNA and Ig secretion. We have shown that interaction of Reishi-F3 with TLR4/TLR2 followed by signaling through p38 MAPK is involved in the induction of Blimp-1 mRNA, whereas signaling through ERK, p38 MAPK, JNK, and IKK complex is involved in Reishi-F3-mediated Ig secretion. Furthermore, the differential mechanism of Reishi-F3 in mouse and human B cell activation is probably due to the presence of Blimp-1 regulatory site in human CD86 promoter. These results establish the signaling and molecular mechanisms of Reishi-F3 on promoting antibody secretion.

  16. Transcriptional profiling of TLR-4/7/8-stimulated guinea pig splenocytes and whole blood by bDNA assay

    PubMed Central

    Ching, Lance K.; Mompoint, Farah; Guderian, Jeffrey A.; Picone, Alex; Orme, Ian M.; Coler, Rhea N.; Reed, Steven G.; Baldwin, Susan L.

    2011-01-01

    Toll-like receptor (TLR) agonists are currently being examined as adjuvants for vaccines, with several lead candidates now in licensed products or in late-stage clinical development. Guinea pigs are widely used for preclinical testing of drugs and vaccines; however, evaluation of TLR agonists in this model is hindered by the limited availability of immunological tools and reagents. In this study, we validated the use of a branched-chain DNA (bDNA) assay known as the QuantiGene Plex 2.0 Reagent System for measuring innate cytokine and chemokine mRNA levels following TLR stimulation of guinea pig cells. Gene expression for T-helper-1 (Th1) polarizing cytokines (TNF-α, IL-1β, IL-12) and chemokines (CXCL1, CCL2) was upregulated following ex vivo stimulation of guinea pig splenocytes and whole blood with TLR-4 or TLR-7/8 agonists. These data confirm the utility of the QuantiGene system both as an alternative to RT-PCR for measuring transcript levels and as a high-throughput screening tool for dissecting the immunological response to TLR stimulation in guinea pigs. Overall, the QuantiGene platform is reliable, reproducible, and sensitive. These agonists have the potential to be used as adjuvant components in vaccines against various pathogens. PMID:21839740

  17. TLR2, TLR4 and TLR9 genotypes and haplotypes in the susceptibility to and clinical course of Chlamydia trachomatis infections in Dutch women

    PubMed Central

    Verweij, Stephan P.; Karimi, Ouafae; Pleijster, Jolein; Lyons, Joseph M.; de Vries, Henry J.C.; Land, Jolande A.; Morré, Servaas A.; Ouburg, Sander

    2015-01-01

    Chlamydia trachomatis infections demonstrate remarkable differences in clinical course that are approximately 40% based on host genetic variation. Here, we study the single nucleotide polymorphisms (SNPs) and their haplotypes in TLR2, TLR4 and TLR9 (TLR2 +2477G>A; TLR2 –16934T>A; TLR4+896A>G; TLR9 –1237T>C and TLR9 +2848G>A) in relation to the susceptibility to, and severity of C. trachomatis infections. We analysed the five SNPs in a cohort of 770 Dutch Caucasian women either attending a sexually transmitted diseases outpatient clinic (n = 731) or having complaints of subfertility (n = 39). Haplotype analyses showed a trend for TLR2 haplotype I (–16934T/+2477G) to protect against the development of symptoms and tubal pathology (Ptrend = 0.03) after Chlamydia infection. In the susceptibility cohort, TLR9 haplotype III (–1237C/+2848A) showed a significant decreasing trend in the development of symptoms after C. trachomatis infection (P = 0.02, OR: 0.55, 95%CI: 0.33–0.91). Logistic regression of the TLR2 haplotypes, TLR4+896A>G, and TLR9 haplotypes showed that the TLR2 haplotype combinations AG-TA and AG-TG confer risk (OR 3.4 (P = 0.01) and 1.6 (P = 0.03)), while the TLR9 haplotype combination TG-TA protects against C. trachomatis infections (OR: 0.4, P = 0.004). Our study shows that both TLR2 and TLR9 genes and SNP combinations do influence the clinical course of Chlamydia infections. PMID:26568059

  18. Phagosomal degradation increases TLR access to bacterial ligands and enhances macrophage sensitivity to bacteria

    PubMed Central

    Wolf, Andrea J.; Arruda, Andrea; Reyes, Christopher N.; Kaplan, Amber T.; Shimada, Takahiro; Shimada, Kenichi; Arditi, Moshe; Liu, George; Underhill, David M.

    2011-01-01

    Signaling by innate immune receptors initiates and orchestrates the overall immune responses to infection. Macrophage receptors recognizing pathogens can be broadly grouped into surface receptors and receptors restricted to intracellular compartments, such as phagosomes and the cytoplasm. There is an expectation that ingestion and degradation of microorganisms by phagocytes contributes to activation of intracellular innate receptors, although direct demonstrations of this are rare and many model ligands are studied in soluble form, outside of their microbial context. By comparing a wild-type strain of Staphylococcus aureus and a lysozyme-sensitive mutant, we have been able to directly address the role of degradation of live bacteria by mouse macrophages in determining the overall innate cellular inflammatory response. Our investigations revealed a biphasic response to S. aureus that consisted of an initial signal resulting from the engagement of surface TLR2, followed by a later, second wave on inflammatory gene induction. This second wave of inflammatory signaling was dependent on and correlated with the timing of bacterial degradation in phagosomes. We found that TLR2 signaling followed by TLR2/TLR9 signaling enhanced sensitivity to small numbers of bacteria. We further found that treating wild-type bacteria with the peptidoglycan synthesis-inhibiting antibiotic vancomycin made S. aureus more susceptible to degradation and resulted in increased inflammatory responses, similar to those observed for mutant degradation-sensitive bacteria. PMID:22031762

  19. Relationship between TLR4 and MCP2 expression levels and habitual abortion.

    PubMed

    Li, X P; Song, L N; Tian, L P; Zhang, Y S

    2016-04-25

    Habitual abortion is associated with the altered expression of multiple genes. This study was carried out to investigate the relationship between expression of Toll-like receptor 4 (TLR4) and monocyte chemotactic protein 2 (MCP2 or CCL8) and habitual abortion. This was done by detecting and comparing their relative expression in peripheral blood and placental villi of patients and healthy fertile women. Based on our previous research, 85 subjects with habitual abortion (study group) and 40 healthy fertile women (control group), who were admitted to our hospital between June 2013 and December 2014, were enrolled in this study. After these subjects signed written informed consent, peripheral blood samples and villous tissues were collected, from which the total RNA was extracted. The expression of TLR4 and MCP2 was detected with quantitative reverse transcription-polymerase chain reaction, using GAPDH as a reference control. The expression of TLR4 and MCP2 in the peripheral blood and villous tissues of the study group was significantly higher than that of the control group (P < 0.05). A positive correlation was also observed between the changes in expression levels of TLR4 and MCP2. In conclusion, TLR4 and MCP2 expression correlated with the occurrence of habitual abortion. Detecting expression changes in TLR4 and MCP2 in the peripheral blood is a feasible method for predicting the occurrence of abortion in women of child-bearing age.

  20. Helminth-excreted/secreted products are recognized by multiple receptors on DCs to block the TLR response and bias Th2 polarization in a cRAF dependent pathway

    PubMed Central

    Terrazas, César A.; Alcántara-Hernández, Marcela; Bonifaz, Laura; Terrazas, Luis I.; Satoskar, Abhay R.

    2013-01-01

    Dendritic cells (DCs) recognize pathogens and initiate the T-cell response. The DC-helminth interaction induces an immature phenotype in DCs; as a result, these DCs display impaired responses to TLR stimulation and prime Th2-type responses. However, the DC receptors and intracellular pathways targeted by helminth molecules and their importance in the initiation of the Th2 response are poorly understood. In this report, we found that products excreted/secreted by Taenia crassiceps (TcES) triggered cRAF phosphorylation through MGL, MR, and TLR2. TcES interfered with the LPS-induced NFκB p65 and p38 MAPK signaling pathways. In addition, TcES-induced cRAF signaling pathway was critical for down-regulation of the TLR-mediated DC maturation and secretion of IL-12 and TNF-α. Finally, we show for the first time that blocking cRAF in DCs abolishes their ability to induce Th2 polarization in vitro after TcES exposure. Our data demonstrate a new mechanism by which helminths target intracellular pathways to block DC maturation and efficiently program Th2 polarization.—Terrazas, C. A., Alcántara-Hernández, M., Bonifaz, L., Terrazas, L. I., Satoskar, A. R. Helminth-excreted/secreted products are recognized by multiple receptors on DCs to block the TLR response and bias Th2 polarization in a cRAF dependent pathway. PMID:23907435

  1. Molecular cloning and tissue-specific expression of Toll-like receptor 5 gene from turkeys.

    PubMed

    Gopinath, V P; Biswas, Moanaro; Raj, Gopal Dhinakar; Raja, A; Kumanan, A K; Elankumaran, Subbiah

    2011-09-01

    Toll-like receptors (TLRs), a family of transmembrane and cytosolic proteins, detect microbial patterns, initiating innate immune responses in various organisms. Although they are abundant, genetic characterization and functional differences of TLRs in economically important avian species such as chickens and turkeys have not been investigated in detail. In this study, the putative TLR5 coding region from turkey genome was sequenced, and its homology to other vertebrate species was analyzed. Secondary structure analysis revealed protein motifs typical of the chicken TLR5 protein structure, with 97% amino acid identity between them. mRNA expression profiling in adult turkeys revealed abundant TLR5 expression in a broad range of tissues. Stimulation with the TLR5 ligand flagellin resulted in the production of the inflammatory mediators interleukin (IL)-1beta, IL-6, and nitric oxide in peripheral blood mononuclear cells. To our knowledge, this is the first complete turkey TLR5 coding DNA sequence reported in sequence databases.

  2. Mycoplasma gallisepticum Lipid Associated Membrane Proteins Up-regulate Inflammatory Genes in Chicken Tracheal Epithelial Cells via TLR-2 Ligation through an NF-κB Dependent Pathway

    PubMed Central

    Majumder, Sanjukta; Zappulla, Frank; Silbart, Lawrence K.

    2014-01-01

    Mycoplasma gallisepticum-mediated respiratory inflammation in chickens is associated with accumulation of leukocytes in the tracheal submucosa. However the molecular mechanisms underpinning these changes have not been well described. We hypothesized that the initial inflammatory events are initiated upon ligation of mycoplasma lipid associated membrane proteins (LAMP) to TLRs expressed on chicken tracheal epithelial cells (TEC). To test this hypothesis, live bacteria or LAMPs isolated from a virulent (Rlow) or a non-virulent (Rhigh) strain were incubated with primary TECs or chicken tracheae ex vivo. Microarray analysis identified up-regulation of several inflammatory and chemokine genes in TECs as early as 1.5 hours post-exposure. Kinetic analysis using RT-qPCR identified the peak of expression for most genes to be at either 1.5 or 6 hours. Ex-vivo exposure also showed up-regulation of inflammatory genes in epithelial cells by 1.5 hours. Among the commonly up-regulated genes were IL-1β, IL-6, IL-8, IL-12p40, CCL-20, and NOS-2, all of which are important immune-modulators and/or chemo-attractants of leukocytes. While these inflammatory genes were up-regulated in all four treatment groups, Rlow exposed epithelial cells both in vitro and ex vivo showed the most dramatic up-regulation, inducing over 100 unique genes by 5-fold or more in TECs. Upon addition of a TLR-2 inhibitor, LAMP-mediated gene expression of IL-1β and CCL-20 was reduced by almost 5-fold while expression of IL-12p40, IL-6, IL-8 and NOS-2 mRNA was reduced by about 2–3 fold. Conversely, an NF-κB inhibitor abrogated the response entirely for all six genes. miRNA-146a, a negative regulator of TLR-2 signaling, was up-regulated in TECs in response to either Rlow or Rhigh exposure. Taken together we conclude that LAMPs isolated from both Rhigh and Rlow induced rapid, TLR-2 dependent but transient up-regulation of inflammatory genes in primary TECs through an NF-κB dependent pathway. PMID:25401327

  3. Deletion of TLR3 alters the pulmonary immune environment and mucus production during respiratory syncytial virus infection.

    PubMed

    Rudd, Brian D; Smit, Jetse J; Flavell, Richard A; Alexopoulou, Lena; Schaller, Matthew A; Gruber, Achim; Berlin, Aaron A; Lukacs, Nicholas W

    2006-02-01

    The detection of a viral infection by pattern recognition receptors (PAMPs) is an integral part of antiviral immunity. In these studies we have investigated the role of TLR3, which recognizes dsRNA, in Respiratory Syncytial virus (RSV) infection using B6 background mice with a TLR3 deletion. Although we observed no changes in viral growth, we did find that TLR3-/- mice demonstrated significant increases in mucus production in the airways of RSV-infected mice. The qualitative assessment was observed by examining differentially stained lungs, followed by immunohistochemical staining for gob5, a mucus-associated protein. The histopathologic observations were verified using quantitative gene expression analyses examining gob5 gene expression. Changes in pulmonary mucus production were accompanied by an increase in pulmonary IL-13 as well as IL-5 expression and eosinophils in the airways of TLR3-/- mice. Examining leukocytes in the airway indicated an accumulation of eosinophils in TLR3-/- mice, but not wild-type mice, after RSV infection. Isolated lung draining lymph node cells from TLR3-/- mice produced significant increases in Th2-type cytokines, IL-5, and IL-13, compared with wild-type TLR3+/+ mice only after RSV infection. To demonstrate a causative link, we depleted TLR3-/- mice of IL-13 during RSV infection and found that mucus and gob5 expression in the lungs was attenuated. Together, these studies highlight that although TLR3 may not be required for viral clearance, it is necessary to maintain the proper immune environment in the lung to avoid developing pathologic symptoms of disease.

  4. Identification and functional characterization of novel genetic variations in porcine TLR5 promoter.

    PubMed

    Domínguez, Miguel A; Landi, Vincenzo; Martínez, Amparo; Garrido, Juan J

    2014-07-01

    Toll-like receptors (TLRs) play a critical role in the immune process acting as innate sensors of pathogens. Toll-like receptor 5 (TLR5) is especially relevant in those tissues maintaining close contact with microorganisms, not only because it prevents infections but also due to its involvement in the regulation of host-commensal interactions. Recent studies suggest that the occurrence of genetic polymorphisms may impair TLR function, consequently increasing or decreasing the individual susceptibility to infectious diseases. In this study, the promoter sequence of the porcine TLR5 gene was scanned with the aim of identifying mutations with potential effects on gene expression. Two Indel variations in the predicted promoter sequence and seven single-nucleotide polymorphisms were identified. The luciferase reporter gene assay indicated that one Indel, consisting in a 23-bp insertion at the -581 to -559 nucleotide position, creates an additional STAT binding site, and it is associated with an increase of the promoter activity. This finding suggests that genetic variation in the TLR5 promoter could alter the expression of the gene, and may be used as a molecular marker to define pathogen susceptibility or resistance patterns in pigs.

  5. The TLR4-Active Morphine Metabolite Morphine-3-Glucuronide Does Not Elicit Macrophage Classical Activation In Vitro

    PubMed Central

    Khabbazi, Samira; Xie, Nan; Pu, Wenjun; Goumon, Yannick; Parat, Marie-Odile

    2016-01-01

    Macrophages are abundant in the tumor microenvironment where they adopt a pro-tumor phenotype following alternative polarization induced by paracrine factors from cancer and stromal cells. In contrast, classically activated macrophages have tumoricidal activities, such that the polarization of tumor-associated macrophages has become a novel therapeutic target. Toll-like receptor 4 engagement promotes classical activation of macrophages, and recent literature suggests TLR4 agonism to prevent metastasis and promote survival in experimental metastasis models. A growing number of studies indicate that TLR4 can respond to opioids, including the opioid receptor-inactive morphine metabolite morphine-3-glucuronide (M3G). We measured the activation of TLR4 in a reporter cell line exogenously expressing TLR4 and TLR4 co-receptors, and confirmed that M3G weakly but significantly activates TLR4. We hypothesized that M3G would promote the expression of classical activation signature genes in macrophages in vitro. We exposed mouse and human macrophage cell lines to M3G or the TLR4 activator lipopolysaccharide (LPS), alone or in combination with interferon gamma (IFN-γ). The classical macrophage activation markers tested were iNOS, CD86, IL-6, or TNF-α in RAW 264.7 cells and IL-6, IL-12, IL-23, TNF-α, CXCL10, and CXCL11 in THP1 cells. Our results show that despite exhibiting TLR4-activation ability, M3G does not elicit the expression of classical activation markers in LPS-responsive macrophages. PMID:27909407

  6. The TLR4-Active Morphine Metabolite Morphine-3-Glucuronide Does Not Elicit Macrophage Classical Activation In Vitro.

    PubMed

    Khabbazi, Samira; Xie, Nan; Pu, Wenjun; Goumon, Yannick; Parat, Marie-Odile

    2016-01-01

    Macrophages are abundant in the tumor microenvironment where they adopt a pro-tumor phenotype following alternative polarization induced by paracrine factors from cancer and stromal cells. In contrast, classically activated macrophages have tumoricidal activities, such that the polarization of tumor-associated macrophages has become a novel therapeutic target. Toll-like receptor 4 engagement promotes classical activation of macrophages, and recent literature suggests TLR4 agonism to prevent metastasis and promote survival in experimental metastasis models. A growing number of studies indicate that TLR4 can respond to opioids, including the opioid receptor-inactive morphine metabolite morphine-3-glucuronide (M3G). We measured the activation of TLR4 in a reporter cell line exogenously expressing TLR4 and TLR4 co-receptors, and confirmed that M3G weakly but significantly activates TLR4. We hypothesized that M3G would promote the expression of classical activation signature genes in macrophages in vitro. We exposed mouse and human macrophage cell lines to M3G or the TLR4 activator lipopolysaccharide (LPS), alone or in combination with interferon gamma (IFN-γ). The classical macrophage activation markers tested were iNOS, CD86, IL-6, or TNF-α in RAW 264.7 cells and IL-6, IL-12, IL-23, TNF-α, CXCL10, and CXCL11 in THP1 cells. Our results show that despite exhibiting TLR4-activation ability, M3G does not elicit the expression of classical activation markers in LPS-responsive macrophages.

  7. The effects of oral and enteric Campylobacter concisus strains on expression of TLR4, MD-2, TLR2, TLR5 and COX-2 in HT-29 cells.

    PubMed

    Ismail, Yazan; Lee, Hoyul; Riordan, Stephen M; Grimm, Michael C; Zhang, Li

    2013-01-01

    Campylobacter concisus, a Gram-negative bacterium that colonizes the human oral cavity, has been shown to be associated with inflammatory bowel diseases (IBD). The effects of different C. concisus strains on intestinal epithelial expression of Toll like receptors (TLR) have not been investigated. This study examined the effects of C. concisus strains isolated from patients with IBD and controls on expression of TLR4, its co-receptor myeloid differentiation factor (MD)-2; TLR2, TLR5, cyclooxygenase-2 (COX-2) and interleukin (IL)-8 in HT-29 cells.Fourteen oral and enteric C. concisus strains isolated from patients with IBD and healthy controls were co-incubated with HT-29 cells. Expression of TLR4, MD-2, TLR2, TLR5 and COX-2 in HT-29 cells in response to C. concisus infection was examined by Western blot, flow cytometry analysis and immunofluorescent staining visualized by confocal microscope. Production of IL-8 was evaluated by enzyme-linked immunosorbent assay.Both oral and enteric C. concisus strains upregulated expression of TLR4 in HT-29 cells. The levels of glycosylated TLR4 (Gly-TLR4) and surface TLR4 induced by C. concisus strains isolated from patients with IBD were significantly higher than those induced by C. concisus strains isolated from the healthy controls. Four C. concisus strains isolated from patients with IBD induced more than two-fold increase of surface expression of MD-2. C. concisus did not affect expression of TLR2 and TLR5. All C. concisus strains induced production of IL-8 and COX-2 in HT-29 cells.This study shows that some C. concisus strains, most from patients with IBD, upregulate surface expression of TLR4 and MD-2 in HT-29 cells. These data suggest that a potential role of specific C. concisus strains in modulating the intestinal epithelial responses to bacterial LPS needs to be investigated.

  8. Silencing cardiomyocyte TLR4 reduces injury following hypoxia.

    PubMed

    Avlas, Orna; Srara, Smadar; Shainberg, Asher; Aravot, Dan; Hochhauser, Edith

    2016-11-01

    Toll-like receptor 4 (TLR4), the receptor for lipopolysaccharide (LPS) of gram-negative pathogens expressed in the heart, is activated by several endogenous ligands associated with tissue injury in response to myocardial infarction (MI). The aim of this study was to investigate the involvement of TLR4 signaling in cardiomyocytes dysfunction following hypoxia (90min) using multiple methodologies such as knocking down TLR4 and small interfering RNA (siTLR4). Cardiomyocytes of C57Bl/6 mice (WT) subjected to hypoxic stress showed increased cardiac release of LDH, HMGB1, IκB, TNF-α and myocardial apoptotic and necrotic markers (BAX, PI) compared to TLR4 knock out mice (TLR4KO). Treating these cardiomyocytes with siRNA against TLR4 decreased the damage markers (LDH, IκB, TNF-α). TLR4 silencing during hypoxic stress resulted in the activation of the p-AKT and p-GSK3β (by ∼25%). The latter is an indicator that there is a reduction of mitochondrial permeability transition pore (mPTP) opening following hypoxic myocardial induced injury leading to preserved mitochondrial membrane potential. Silencing TLR4 in cardiomyocytes improved cell survival following hypoxic injury through activation of the AKT/GSK3β pathway, reduced inflammatory and apoptotic signals. These findings suggest that TLR4 may serve as a potential target in the treatment of ischemic myocardial injury. Moreover, RNA interfering targeting TLR4 expression represents a therapeutic strategy.

  9. Retinoic Acid Inducible Gene 1 Protein (RIG1)-Like Receptor Pathway Is Required for Efficient Nuclear Reprogramming.

    PubMed

    Sayed, Nazish; Ospino, Frank; Himmati, Farhan; Lee, Jieun; Chanda, Palas; Mocarski, Edward S; Cooke, John P

    2017-03-09

    We have revealed a critical role for innate immune signaling in nuclear reprogramming to pluripotency, and in the nuclear reprogramming required for somatic cell transdifferentiation. Activation of innate immune signaling causes global changes in the expression and activity of epigenetic modifiers to promote epigenetic plasticity. In our previous articles, we focused on the role of toll-like receptor 3 (TLR3) in this signaling pathway. Here, we define the role of another innate immunity pathway known to participate in response to viral RNA, the retinoic acid-inducible gene 1 receptor (RIG-1)-like receptor (RLR) pathway. This pathway is represented by the sensors of viral RNA, RIG-1, LGP2, and melanoma differentiation-associated protein 5 (MDA5). We first found that TLR3 deficiency only causes a partial inhibition of nuclear reprogramming to pluripotency in mouse tail-tip fibroblasts, which motivated us to determine the contribution of RLR. We found that knockdown of interferon beta promoter stimulator 1, the common adaptor protein for the RLR family, substantially reduced nuclear reprogramming induced by retroviral or by modified messenger RNA expression of Oct 4, Sox2, KLF4, and c-MYC (OSKM). Importantly, a double knockdown of both RLR and TLR3 pathway led to a further decrease in induced pluripotent stem cell (iPSC) colonies suggesting an additive effect of both these pathways on nuclear reprogramming. Furthermore, in murine embryonic fibroblasts expressing a doxycycline (dox)-inducible cassette of the genes encoding OSKM, an RLR agonist increased the yield of iPSCs. Similarly, the RLR agonist enhanced nuclear reprogramming by cell permeant peptides of the Yamanaka factors. Finally, in the dox-inducible system, RLR activation promotes activating histone marks in the promoter region of pluripotency genes. To conclude, innate immune signaling mediated by RLR plays a critical role in nuclear reprogramming. Manipulation of innate immune signaling may facilitate

  10. Targeting TLR2 for Vaccine Development

    PubMed Central

    2014-01-01

    Novel and more effective immunization strategies against many animal diseases may profit from the current knowledge on the modulation of specific immunity through stimulation of innate immune receptors. Toll-like receptor (TLR)2-targeting formulations, such as synthetic lipopeptides and antigens expressed in fusion with lipoproteins, have been shown to have built-in adjuvant properties and to be effective at inducing cellular and humoral immune mechanisms in different animal species. However, contradictory data has arisen concerning the profile of the immune response elicited. The benefits of targeting TLR2 for vaccine development are thus still debatable and more studies are needed to rationally explore its characteristics. Here, we resume the main features of TLR2 and TLR2-induced immune responses, focusing on what has been reported for veterinary animals. PMID:25057505

  11. Concomitant Interferon Alpha Stimulation and TLR3 Activation Induces Neuronal Expression of Depression-Related Genes That Are Elevated in the Brain of Suicidal Persons

    PubMed Central

    Trippler, Martin; Lutterbeck, Melanie; Liu, Zijian J.; Truebner, Kurt; Bajanowski, Thomas; Gerken, Guido; Hermann, Dirk M.; Schlaak, Joerg F.

    2013-01-01

    We have previously identified 15 genes that are associated with the development of severe depressive side effects during the standard therapy with interferon alpha and ribavirin in the peripheral blood of hepatitis C virus infected patients. An enhanced expression of these genes was also found in the blood of psychiatric patients suffering severe depressive episode. Herein, we demonstrate that the same depression-related interferon-inducible genes (DRIIs) are also upregulated in post-mortem brains of suicidal individuals. Using cultured mouse hippocampal and prefrontal neurons we show that costimulation with murine IFN (mIFN) and the TLR3 agonist poly(I:C) promotes the expression of the described DRIIs, at the same time inducing pro-inflammatory cytokine expression through Stat1 and Stat3 activation, promoting neuronal apoptosis. Consequently, the upregulation of selective DRIIs, production of inflammatory cytokines and inhibition of neuronal plasticity may be involved in the pathogenesis of IFN-associated depression. PMID:24391741

  12. The androgen receptor gene mutations database.

    PubMed

    Patterson, M N; Hughes, I A; Gottlieb, B; Pinsky, L

    1994-09-01

    The androgen receptor gene mutations database is a comprehensive listing of mutations published in journals and meetings proceedings. The majority of mutations are point mutations identified in patients with androgen insensitivity syndrome. Information is included regarding the phenotype, the nature and location of the mutations, as well as the effects of the mutations on the androgen binding activity of the receptor. The current version of the database contains 149 entries, of which 114 are unique mutations. The database is available from EMBL (NetServ@EMBL-Heidelberg.DE) or as a Macintosh Filemaker file (mc33001@musica.mcgill.ca).

  13. Prothymosin-alpha preconditioning activates TLR4-TRIF signaling to induce protection of ischemic retina.

    PubMed

    Halder, Sebok Kumar; Matsunaga, Hayato; Ishii, Ken J; Ueda, Hiroshi

    2015-12-01

    Prothymosin-alpha protects the brain and retina from ischemic damage. Although prothymosin-alpha contributes to toll-like receptor (TLR4)-mediated immnunopotentiation against viral infection, the beneficial effects of prothymosin-alpha-TLR4 signaling in protecting against ischemia remain to be elucidated. In this study, intravitreal administration of prothymosin-alpha 48 h before induction of retinal ischemia prevented retinal cellular damage as evaluated by histology, and retinal functional deficits as evaluated by electroretinography. Prothymosin-alpha preconditioning completely prevented the ischemia-induced loss of ganglion cells with partial survival of bipolar and photoreceptor cells, but not amacrine cells, in immunohistochemistry experiments. Prothymosin-alpha treatment in the absence of ischemia caused mild activation, proliferation, and migration of retinal microglia, whereas the ischemia-induced microglial activation was inhibited by prothymosin-alpha preconditioning. All these preventive effects of prothymosin-alpha preconditioning were abolished in TLR4 knock-out mice and by pre-treatments with anti-TLR4 antibodies or minocycline, a microglial inhibitor. Prothymosin-alpha preconditioning inhibited the retinal ischemia-induced up-regulation of TLR4-related injury genes, and increased expression of TLR4-related protective genes. Furthermore, the prothymosin-alpha preconditioning-induced prevention of retinal ischemic damage was abolished in TIR-domain-containing adapter-inducing interferon-β knock-out mice, but not in myeloid differentiation primary response gene 88 knock-out mice. Taken together, the results of this study suggest that prothymosin-alpha preconditioning selectively drives TLR4-TIR-domain-containing adapter-inducing interferon-β signaling and microglia in the prevention of retinal ischemic damage. We propose the following mechanism for prothymosin-alpha (ProTα) preconditioning-induced retinal prevention against ischemia: Pro

  14. Down-Regulation of TLR and JAK/STAT Pathway Genes Is Associated with Diffuse Cutaneous Leishmaniasis: A Gene Expression Analysis in NK Cells from Patients Infected with Leishmania mexicana

    PubMed Central

    Castillo-Fernández, Juan E.; Miranda-Ortíz, Haydee; Fernández-López, Juan C.; Becker, Ingeborg; Rangel-Escareño, Claudia

    2016-01-01

    An important NK-cell inhibition with reduced TNF-α, IFN-γ and TLR2 expression had previously been identified in patients with diffuse cutaneous leishmaniasis (DCL) infected with Leishmania mexicana. In an attempt to pinpoint alterations in the signaling pathways responsible for the NK-cell dysfunction in patients with DCL, this study aimed at identifying differences in the NK-cell response towards Leishmania mexicana lipophosphoglycan (LPG) between patients with localized and diffuse cutaneous leishmaniasis through gene expression profiling. Our results indicate that important genes involved in the innate immune response to Leishmania are down-regulated in NK cells from DCL patients, particularly TLR and JAK/STAT signaling pathways. This down-regulation showed to be independent of LPG stimulation. The study sheds new light for understanding the mechanisms that undermine the correct effector functions of NK cells in patients with diffuse cutaneous leishmaniasis contributing to a better understanding of the pathobiology of leishmaniasis. PMID:27031998

  15. Differential involvement of IFN-beta in Toll-like receptor-stimulated dendritic cell activation.

    PubMed

    Hoshino, Katsuaki; Kaisho, Tsuneyasu; Iwabe, Tomio; Takeuchi, Osamu; Akira, Shizuo

    2002-10-01

    Toll-like receptor (TLR) can activate dendritic cells (DC) through common signaling pathways requiring a cytoplasmic adapter, MyD88. However, the signaling is differentially regulated among TLR family members. TLR4 can activate MyD88-deficient bone marrow-derived DC (BMDC), and lead to induction of IFN-inducible genes and up-regulation of co-stimulatory molecules such as CD40, implying that the MyD88-independent signaling pathway functions downstream of TLR4. Because these effects can also be induced by type I IFN, we have analyzed whether type I IFN is involved in TLR4-induced responses. In response to lipopolysaccharide (LPS), IFN-beta gene expression was augmented in both wild-type and MyD88-deficient BMDC. Expression of all IFN-inducible genes except immune-responsive gene 1 (IRG1) was abolished and CD40 up-regulation was decreased in LPS-stimulated BMDC lacking either IFN-alpha/beta receptor (IFN-alpha/betaR) or signal transducer and activator of transcription 1 (STAT-1). Similar to the LPS response, TLR9 signaling can also induce expression of IFN-beta and IFN-inducible genes, and up-regulation of CD40. However, all these effects were MyD88 dependent. Thus, in TLR4 signaling, IFN-beta expression can be induced either by the MyD88-dependent or -independent pathway, whereas, in TLR9 signaling, it is dependent on MyD88. In CpG DNA-stimulated DC, expression of IFN-inducible genes except IRG1 was dependent on type I IFN signaling as in LPS-stimulated DC. However, in contrast to TLR4 signaling, TLR9 signaling requires type I IFN signaling for CD40 up-regulation. Taken together, this study demonstrates differential involvement of type I IFN in TLR4- and TLR9-induced effects on DC.

  16. Specific activation of the TLR1-TLR2 heterodimer by small-molecule agonists

    PubMed Central

    Cheng, Kui; Gao, Meng; Godfroy, James I.; Brown, Peter N.; Kastelowitz, Noah; Yin, Hang

    2015-01-01

    Toll-like receptor (TLR) agonists activate both the innate and the adaptive immune systems. These TLR agonists have been exploited as potent vaccine adjuvants and antitumor agents. We describe the identification and characterization of a small molecule, N-methyl-4-nitro-2-(4-(4-(trifluoromethyl)phenyl)-1H-imidazol-1-yl)aniline (CU-T12-9), that directly targets TLR1/2 to initiate downstream signaling. CU-T12-9 specifically induces TLR1/2 activation, which can be blocked by either the anti-hTLR1 or the anti-hTLR2 antibody, but not the anti-hTLR6 antibody. Using a variety of different biophysical assays, we have demonstrated the binding mode of CU-T12-9. By binding to both TLR1 and TLR2, CU-T12-9 facilitates the TLR1/2 heterodimeric complex formation, which in turn activates the downstream signaling. Fluorescence anisotropy assays revealed competitive binding to the TLR1/2 complex between CU-T12-9 and Pam3CSK4 with a half-maximal inhibitory concentration (IC50) of 54.4 nM. Finally, we showed that CU-T12-9 signals through nuclear factor κB (NF-κB) and invokes an elevation of the downstream effectors tumor necrosis factor–α (TNF-α), interleukin-10 (IL-10), and inducible nitric oxide synthase (iNOS). Thus, our studies not only provide compelling new insights into the regulation of TLR1/2 signaling transduction but also may facilitate future therapeutic developments. PMID:26101787

  17. Quercetin modulates toll-like receptor-mediated protein kinase signaling pathways in oxLDL-challenged human PBMCs and regulates TLR-activated atherosclerotic inflammation in hypercholesterolemic rats.

    PubMed

    Bhaskar, Shobha; Helen, A

    2016-12-01

    Toll-like receptors (TLRs) are pattern recognition receptors that have a unique and essential function in innate immunity. The effect of quercetin on TLR-mediated downstream signaling mechanism and its effect on TLR-mediated MAP kinase and Akt pathways were studied in oxLDL-stimulated hPBMCs using specific inhibitors. The pretreatment of hPBMCs with specific TLR inhibitor, CLI-095, decreased the NF-κB nuclear translocation and TNF-α release by oxLDL. When the cells treated with inhibitor and quercetin together, the inhibition was more effective. The specific inhibitor for p38 MAPK, SB203580, reduced the phosphorylated p38 level and decreased the NF-κB activation and TNF-α release by oxLDL-challenged hPBMCs. This inhibitor showed enhanced inhibition when treated with quercetin together. The inhibitors for ERK1/2, PD98059, and for JNK, SP606125, also showed inhibitory effect on NF-κB activation and TNF-α release by oxLDL-simulated hPBMCs. Quercetin supplementation enhanced the inhibition of nuclear translocation of NF-κB and the release of cytokines. TLR4 inhibition study confirmed the downstream signaling mechanism mediated by NF-κB which is involved in the oxLDL-induced inflammatory response, and quercetin suppresses the cytokine, TNF-α release by modulating TLR-NF-κB signaling pathway. In addition to NF-κB signaling pathway, inflammation induced by oxLDL was also related to the activation of p38MAPK, ERK1/2 and JNK, and Akt pathways, and the protective effect of quercetin may be also related to the inhibition of activation of these pathways. Quercetin significantly downregulated the elevated mRNA expression of TLRs and cytokine TNF-α in HCD-fed atherosclerotic rats in vivo. As quercetin possesses inhibition on both TLR-NF-κB signaling pathway and TLR-mediated MAPK pathway, it is evident that it can be used as a therapeutic agent to ameliorate atherosclerotic inflammation. Since quercetin is the major flavonoid and forms the backbone of many other

  18. Sequence Based Structural Characterization and Genetic Diversity Analysis of Full Length TLR4 CDS in Crossbred and Indigenous Cattle.

    PubMed

    Mishra, Chinmoy; Kumar, Subodh; Sonwane, Arvind Asaram; Yathish, H M; Chaudhary, Rajni

    2017-01-02

    The exploration of candidate genes for immune response in cattle may be vital for improving our understanding regarding the species specific response to pathogens. Toll-like receptor 4 (TLR4) is mostly involved in protection against the deleterious effects of Gram negative pathogens. Approximately 2.6 kb long cDNA sequence of TLR4 gene covering the entire coding region was characterized in two Indian milk cattle (Vrindavani and Tharparkar). The phylogenetic analysis confirmed that the bovine TLR4 was apparently evolved from an ancestral form that predated the appearance of vertebrates, and it is grouped with buffalo, yak, and mithun TLR4s. Sequence analysis revealed a 2526-nucleotide long open reading frame (ORF) encoding 841 amino acids, similar to other cattle breeds. The calculated molecular weight of the translated ORF was 96144 and 96040.9 Da; the isoelectric point was 6.35 and 6.42 in Vrindavani and Tharparkar cattle, respectively. The Simple Modular Architecture Research Tool (SMART) analysis identified 14 leucine rich repeats (LRR) motifs in bovine TLR4 protein. The deduced TLR4 amino acid sequence of Tharparkar had 4 different substitutions as compared to Bos taurus, Sahiwal, and Vrindavani. The signal peptide cleavage site predicted to lie between 16th and 17th amino acid of mature peptide. The transmebrane helix was identified between 635-657 amino acids in the mature peptide.

  19. Social regulation of cortisol receptor gene expression

    PubMed Central

    Korzan, Wayne J.; Grone, Brian P.; Fernald, Russell D.

    2014-01-01

    In many social species, individuals influence the reproductive capacity of conspecifics. In a well-studied African cichlid fish species, Astatotilapia burtoni, males are either dominant (D) and reproductively competent or non-dominant (ND) and reproductively suppressed as evidenced by reduced gonadotropin releasing hormone (GnRH1) release, regressed gonads, lower levels of androgens and elevated levels of cortisol. Here, we asked whether androgen and cortisol levels might regulate this reproductive suppression. Astatotilapia burtoni has four glucocorticoid receptors (GR1a, GR1b, GR2 and MR), encoded by three genes, and two androgen receptors (ARα and ARβ), encoded by two genes. We previously showed that ARα and ARβ are expressed in GnRH1 neurons in the preoptic area (POA), which regulates reproduction, and that the mRNA levels of these receptors are regulated by social status. Here, we show that GR1, GR2 and MR mRNAs are also expressed in GnRH1 neurons in the POA, revealing potential mechanisms for both androgens and cortisol to influence reproductive capacity. We measured AR, MR and GR mRNA expression levels in a microdissected region of the POA containing GnRH1 neurons, comparing D and ND males. Using quantitative PCR (qPCR), we found D males had higher mRNA levels of ARα, MR, total GR1a and GR2 in the POA compared with ND males. In contrast, ND males had significantly higher levels of GR1b mRNA, a receptor subtype with a reduced transcriptional response to cortisol. Through this novel regulation of receptor type, neurons in the POA of an ND male will be less affected by the higher levels of cortisol typical of low status, suggesting GR receptor type change as a potential adaptive mechanism to mediate high cortisol levels during social suppression. PMID:25013108

  20. Association of NOD1, CXCL16, STAT6 and TLR4 gene polymorphisms with Malaysian patients with Crohn’s disease

    PubMed Central

    Chua, Kek Heng; Ng, Jin Guan; Ng, Ching Ching; Hilmi, Ida; Goh, Khean Lee

    2016-01-01

    Crohn’s disease (CD) is a prominent type of inflammatory bowel disease (IBD) that can affect any part of the gastrointestinal tract. CD is known to have higher prevalence in the Western countries, but the number of cases has been increasing in the past decades in Asia, including Malaysia. Therefore, there is a need to investigate the underlining causes of CD that may shed light on its prevention and treatment. In this study, genetic polymorphisms in NOD1 (rs2075820), CXCL16 (rs2277680), STAT6 (rs324015) and TLR4 (rs4986791) genes were examined in a total of 335 individuals (85 CD patients and 250 healthy controls) with PCR-RFLP approach. There was no significant association observed between NOD1 rs2075820 and STAT6 rs324015 with the onset of CD in the studied cohort. However, the G allele of CXCL16 rs2277680 was found to have a weak association with CD patients (P = 0.0482; OR = 1.4310). The TLR4 rs4986791 was also significantly associated to CD. Both the homozygous C genotype (P = 0.0029; OR = 0.3611) and C allele (P = 0.0069; OR = 0.4369) were observed to confer protection against CD. On the other hand, the heterozygous C/T genotype was a risk genotype (P = 0.0015; OR = 3.1392). Further ethnic-stratified analysis showed that the significant associations in CXCL16 rs2277680 and TLR4 rs4986791 were accounted by the Malay cohort. In conclusion, the present study reported two CD-predisposing loci in the Malay CD patients. However, these loci were not associated to the onset of CD in Chinese and Indian patients. PMID:27069792

  1. The influence of genetic polymorphisms in TLR4 and TIRAP, and their expression levels in peripheral blood, on susceptibility to sepsis

    PubMed Central

    ZHANG, JIANPING; YANG, JINGPING; XU, XIYUAN; LIANG, LIANGSHEN; SUN, HAIXIA; LIU, GUOHUA; ZHANG, LIHONG; SU, YUN

    2016-01-01

    The present study aimed to investigate whether genetic polymorphisms in the Toll-like receptor (TLR)-4 and Toll/interleukin-1 receptor (TIR)-associated protein (TIRAP) genes, and/or their expression levels, influence the susceptibility of a patient to sepsis. A total of 106 patients with sepsis were divided into two groups on the basis of their acute physiology and chronic health evaluation (APACHE) II scores: i) Sepsis group A (APACHE II <20) and ii) Sepsis group B (APACHE II >20). In addition, 100 healthy volunteers were enrolled into the control group. Polymerase chain reaction-restriction fragment length polymorphism assay was used to detect the following genetic polymorphisms: The Ser180Leu allele of the TIRAP gene and the Asp299Gly and Thr399I1e alleles of the TLR4 gene. Furthermore, the protein expression levels of TLR4 and TIRAP were analyzed using an enzyme-linked immunosorbent assay. Genetic polymorphisms were not detected for the TLR4 and TIRAP genes; however, the protein expression levels of TLR4 and TIRAP differed significantly between the control, sepsis A and sepsis B groups (P<0.01). An APACHE II score of 20 was used as a baseline in order to differentiate sepsis severity. Pearson analysis demonstrated that TLR4 and TIRAP protein expression levels were positively correlated with sepsis severity (r=0.931 and 0.972; P<0.05), and TLR4 protein expression levels were positively correlated with those of TIRAP (r=0.936; P<0.05). The results of the present study suggested that the protein expression levels of, but not genetic polymorphisms in, TLR4 and TIRAP were associated with the severity of sepsis. PMID:26889229

  2. Pattern-Recognition Receptors and Gastric Cancer

    PubMed Central

    Castaño-Rodríguez, Natalia; Kaakoush, Nadeem O.; Mitchell, Hazel M.

    2014-01-01

    Chronic inflammation has been associated with an increased risk of several human malignancies, a classic example being gastric adenocarcinoma (GC). Development of GC is known to result from infection of the gastric mucosa by Helicobacter pylori, which initially induces acute inflammation and, in a subset of patients, progresses over time to chronic inflammation, gastric atrophy, intestinal metaplasia, dysplasia, and finally intestinal-type GC. Germ-line encoded receptors known as pattern-recognition receptors (PRRs) are critical for generating mature pro-inflammatory cytokines that are crucial for both Th1 and Th2 responses. Given that H. pylori is initially targeted by PRRs, it is conceivable that dysfunction within genes of this arm of the immune system could modulate the host response against H. pylori infection, and subsequently influence the emergence of GC. Current evidence suggests that Toll-like receptors (TLRs) (TLR2, TLR3, TLR4, TLR5, and TLR9), nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs) (NOD1, NOD2, and NLRP3), a C-type lectin receptor (DC-SIGN), and retinoic acid-inducible gene (RIG)-I-like receptors (RIG-I and MDA-5), are involved in both the recognition of H. pylori and gastric carcinogenesis. In addition, polymorphisms in genes involved in the TLR (TLR1, TLR2, TLR4, TLR5, TLR9, and CD14) and NLR (NOD1, NOD2, NLRP3, NLRP12, NLRX1, CASP1, ASC, and CARD8) signaling pathways have been shown to modulate the risk of H. pylori infection, gastric precancerous lesions, and/or GC. Further, the modulation of PRRs has been suggested to suppress H. pylori-induced inflammation and enhance GC cell apoptosis, highlighting their potential relevance in GC therapeutics. In this review, we present current advances in our understanding of the role of the TLR and NLR signaling pathways in the pathogenesis of GC, address the involvement of other recently identified PRRs in GC, and discuss the potential implications of PRRs in GC immunotherapy

  3. Allergic rhinitis and genetic components: focus on Toll-like receptors (TLRs) gene polymorphism

    PubMed Central

    Gao, Zhiwei; Rennie, Donna C; Senthilselvan, Ambikaipakan

    2010-01-01

    Allergic rhinitis represents a global health issue affecting 10% to 25% of the population worldwide. Over the years, studies have found that allergic diseases, including allergic rhinitis, are associated with immunological responses to antigens driven by a Th2-mediated immune response. Because Toll-like receptors (TLRs) are involved in both innate and adaptive immune responses to a broad variety of antigens, the association between polymorphisms of TLRs and allergic diseases has been the focus in many animal and human studies. Although the etiology of allergic rhinitis is still unknown, extensive research over the years has confirmed that the underlying causes of allergic diseases are due to many genetic and environmental factors, along with the interactions among them, which include gene–environment, gene–gene, and environment–environment interactions. Currently, there is great inconsistency among studies mainly due to differences in genetic background and unique gene–environment interactions. This paper reviews studies focusing on the association between TLR polymorphisms and allergic diseases, including allergic rhinitis, which would help researchers better understand the role of TLR polymorphisms in the development of allergic rhinitis, and ultimately lead to more efficient therapeutic interventions being developed. PMID:23776356

  4. Functional characterisation of a TLR accessory protein, UNC93B1, in Atlantic salmon (Salmo salar).

    PubMed

    Lee, P T; Zou, J; Holland, J W; Martin, S A M; Scott, C J W; Kanellos, T; Secombes, C J

    2015-05-01

    Toll-like receptors (TLRs) are indispensable components of the innate immune system, which recognise conserved pathogen associated molecular patterns (PAMPs) and induce a series of defensive immune responses to protect the host. Biosynthesis, localisation and activation of TLRs are dependent on TLR accessory proteins. In this study, we identified the accessory protein, UNC93B1, from Atlantic salmon (Salmo salar) whole-genome shotgun (WGS) contigs aided by the conserved gene synteny of genes flanking UNC93B1 in fish, birds and mammals. Phylogenetic analysis showed that salmon UNC93B1 grouped with other vertebrate UNC93B1 molecules, and had highest amino acid identity and similarity to zebrafish UNC93B1. The salmon UNC93B1 gene organisation was also similar in structure to mammalian UNC93B1. Our gene expression studies revealed that salmon UNC93B1 was more highly expressed in spleen, liver and gill tissues but was expressed at a lower level in head kidney tissue in post-smolts relative to parr. Moreover, salmon UNC93B1 mRNA transcripts were up-regulated in vivo in spleen tissue from polyI:C treated salmon and in vitro in polyI:C or IFNγ stimulated Salmon Head Kidney-1 (SHK-1) cells. Initial studies into the functional role of salmon UNC93B1 in fish TLR signalling found that both wild type salmon UNC93B1 and a molecule with a site-directed mutation (H424R) co-immunoprecipitated with salmon TLR19, TLR20a and TLR20d. Overall, these data illustrate the potential importance of UNC93B1 as an accessory protein in fish TLR signalling.

  5. Genetic variants in TLR2 and TLR4 are associated with markers of monocyte activation: the Atherosclerosis Risk in Communities MRI Study

    PubMed Central

    Hall, Jennifer L.; Pankow, James S.; Boerwinkle, Eric; Matijevic-Aleksic, Nena; He, Max; Chambless, Lloyd; Folsom, Aaron R.

    2012-01-01

    Markers of monocyte activation play a critical role in atherosclerosis, but little is known about the genetic influences on cellular levels. Therefore, we investigated the influence of genetic variants in monocyte differentiation antigen (CD14), toll-like receptor-4 (TLR4), toll-like receptor-2 (TLR2), and myeloperoxidase (MPO) on monocyte surface receptor levels. The study sample consisted of 1,817 members of a biracial cohort of adults from the Atherosclerosis Risk in Communities Carotid MRI Study. Monocyte receptors were measured using flow cytometry on fasting whole blood samples. TLR2 rs1816702 genotype was significantly associated with CD14+/TLR2+ percent of positive cells (%) and median fluorescence intensity (MFI) in whites but not in blacks (p < 0.001). Specifically, the presence of the minor T-allele was associated with increased receptor levels. In blacks, TLR4 rs5030719 was significantly associated with CD14+/TLR4+ monocytes (MFI) with mean ± SE intensities of 16.7 ± 0.05 and 16.0 ± 0.14 for GG and GT/TT genotypes, respectively (p < 0.001). Variants in TLR2 and TLR4 were associated with monocyte receptor levels of TLR2 and TLR4, respectively, in a biracial cohort of adults. To our knowledge, this is the first study to look at associations between variants in the toll-like receptor family and toll-like receptor levels on monocytes. PMID:21298446

  6. Toll-Like Receptor 4 Mutant and Null Mice Retain Morphine-Induced Tolerance, Hyperalgesia, and Physical Dependence

    PubMed Central

    Mattioli, Theresa Alexandra; Leduc-Pessah, Heather; Skelhorne-Gross, Graham; Nicol, Christopher J. B.; Milne, Brian; Trang, Tuan; Cahill, Catherine M.

    2014-01-01

    The innate immune system modulates opioid-induced effects within the central nervous system and one target that has received considerable attention is the toll-like receptor 4 (TLR4). Here, we examined the contribution of TLR4 in the development of morphine tolerance, hyperalgesia, and physical dependence in two inbred mouse strains: C3H/HeJ mice which have a dominant negative point mutation in the Tlr4 gene rendering the receptor non-functional, and B10ScNJ mice which are TLR4 null mutants. We found that neither acute antinociceptive response to a single dose of morphine, nor the development of analgesic tolerance to repeated morphine treatment, was affected by TLR4 genotype. Likewise, opioid induced hyperalgesia and opioid physical dependence (assessed by naloxone precipitated withdrawal) were not altered in TLR4 mutant or null mice. We also examined the behavioural consequence of two stereoisomers of naloxone: (−) naloxone, an opioid receptor antagonist, and (+) naloxone, a purported antagonist of TLR4. Both stereoisomers of naloxone suppressed opioid induced hyperalgesia in wild-type control, TLR4 mutant, and TLR4 null mice. Collectively, our data suggest that TLR4 is not required for opioid-induced analgesic tolerance, hyperalgesia, or physical dependence. PMID:24824631

  7. TLR9 ligation in pancreatic stellate cells promotes tumorigenesis

    PubMed Central

    Zambirinis, Constantinos P.; Levie, Elliot; Nguy, Susanna; Avanzi, Antonina; Barilla, Rocky; Xu, Yijie; Seifert, Lena; Daley, Donnele; Greco, Stephanie H.; Deutsch, Michael; Jonnadula, Saikiran; Torres-Hernandez, Alejandro; Tippens, Daniel; Pushalkar, Smruti; Eisenthal, Andrew; Saxena, Deepak; Ahn, Jiyoung; Hajdu, Cristina; Engle, Dannielle D.; Tuveson, David

    2015-01-01

    Modulation of Toll-like receptor (TLR) signaling can have protective or protumorigenic effects on oncogenesis depending on the cancer subtype and on specific inflammatory elements within the tumor milieu. We found that TLR9 is widely expressed early during the course of pancreatic transformation and that TLR9 ligands are ubiquitous within the tumor microenvironment. TLR9 ligation markedly accelerates oncogenesis, whereas TLR9 deletion is protective. We show that TLR9 activation has distinct effects on the epithelial, inflammatory, and fibrogenic cellular subsets in pancreatic carcinoma and plays a central role in cross talk between these compartments. Specifically, TLR9 activation can induce proinflammatory signaling in transformed epithelial cells, but does not elicit oncogene expression or cancer cell proliferation. Conversely, TLR9 ligation induces pancreatic stellate cells (PSCs) to become fibrogenic and secrete chemokines that promote epithelial cell proliferation. TLR9-activated PSCs mediate their protumorigenic effects on the epithelial compartment via CCL11. Additionally, TLR9 has immune-suppressive effects in the tumor microenvironment (TME) via induction of regulatory T cell recruitment and myeloid-derived suppressor cell proliferation. Collectively, our work shows that TLR9 has protumorigenic effects in pancreatic carcinoma which are distinct from its influence in extrapancreatic malignancies and from the mechanistic effects of other TLRs on pancreatic oncogenesis. PMID:26481685

  8. TLR9 ligation in pancreatic stellate cells promotes tumorigenesis.

    PubMed

    Zambirinis, Constantinos P; Levie, Elliot; Nguy, Susanna; Avanzi, Antonina; Barilla, Rocky; Xu, Yijie; Seifert, Lena; Daley, Donnele; Greco, Stephanie H; Deutsch, Michael; Jonnadula, Saikiran; Torres-Hernandez, Alejandro; Tippens, Daniel; Pushalkar, Smruti; Eisenthal, Andrew; Saxena, Deepak; Ahn, Jiyoung; Hajdu, Cristina; Engle, Dannielle D; Tuveson, David; Miller, George

    2015-11-16

    Modulation of Toll-like receptor (TLR) signaling can have protective or protumorigenic effects on oncogenesis depending on the cancer subtype and on specific inflammatory elements within the tumor milieu. We found that TLR9 is widely expressed early during the course of pancreatic transformation and that TLR9 ligands are ubiquitous within the tumor microenvironment. TLR9 ligation markedly accelerates oncogenesis, whereas TLR9 deletion is protective. We show that TLR9 activation has distinct effects on the epithelial, inflammatory, and fibrogenic cellular subsets in pancreatic carcinoma and plays a central role in cross talk between these compartments. Specifically, TLR9 activation can induce proinflammatory signaling in transformed epithelial cells, but does not elicit oncogene expression or cancer cell proliferation. Conversely, TLR9 ligation induces pancreatic stellate cells (PSCs) to become fibrogenic and secrete chemokines that promote epithelial cell proliferation. TLR9-activated PSCs mediate their protumorigenic effects on the epithelial compartment via CCL11. Additionally, TLR9 has immune-suppressive effects in the tumor microenvironment (TME) via induction of regulatory T cell recruitment and myeloid-derived suppressor cell proliferation. Collectively, our work shows that TLR9 has protumorigenic effects in pancreatic carcinoma which are distinct from its influence in extrapancreatic malignancies and from the mechanistic effects of other TLRs on pancreatic oncogenesis.

  9. Investigation of Toll-Like Receptor-2 (2258G/A) and Interferon Gamma (+874T/A) Gene Polymorphisms among Infertile Women with Female Genital Tuberculosis

    PubMed Central

    Bhanothu, Venkanna; Lakshmi, Vemu; Theophilus, Jane P.; Rozati, Roya; Badhini, Prabhakar; Vijayalaxmi, Boda

    2015-01-01

    Background Toll-like receptor 2 (TLR2) and interferon-gamma (IFN-γ) coordinate with a diverse array of cellular programs through the transcriptional regulation of immunologically relevant genes and play an important role in immune system, reproductive physiology and basic pathology. Alterations in the functions of TLR2 2258G (guanine)/ A, IFN-γ (+874T/A) and signalling molecules that result from polymorphisms are often associated with susceptibility or resistance, which may, in turn, establish the innate host response to various infectious diseases. Presently, we proposed to investigate the risk of common single nucleotide polymorphism (SNP) of TLR2 and IFN-γ genes, for their effect on infertility in women with female genital tuberculosis (FGTB) and healthy women as controls. Methodology/Principal Findings Genotyping of TLR2 and IFN-γ gene polymorphisms was performed by amplification refractory mutation system multi-gene/multi-primer polymerase chain reaction followed by restriction fragment length polymorphism in 175 FGTB patients and 100 healthy control women (HCW). The TLR2 polymorphism [adenine (A) allele] was observed in 57.7 and 58.0% of FGTB patients and HCW, respectively. The IFN-γ (+874T/A) polymorphism (A allele) was significant in 74.3 and 71.0% of FGTB patients and HCW, respectively, while the odds ratios for the AA and TA genotypes for predisposition of FGTB were found to be 0.304 and 1.650 in HCW, respectively. The SNP of TLR2 was not associated with FGTB but the SNP of IFN-γ was found to be associated with mycobacteria infections and to induce infertility. Conclusions/Significance At present, we hypothesize that infertile women with FGTB and HCW without tuberculosis (TB) have identical frequency of TLR variants, which may be adequate in the production of IFN-γ in response to Mycobacterium tuberculosis infections. Thus, the study appears to be the first of its kind reporting a mutation in the IFN-γ gene [+874 T (thymine) to A] responsible for

  10. Toll-like receptor 2 mediates microglia/brain macrophage MT1-MMP expression and glioma expansion

    PubMed Central

    Vinnakota, Katyayni; Hu, Feng; Ku, Min-Chi; Georgieva, Petya B.; Szulzewsky, Frank; Pohlmann, Andreas; Waiczies, Sonia; Waiczies, Helmar; Niendorf, Thoralf; Lehnardt, Seija; Hanisch, Uwe-Karsten; Synowitz, Michael; Markovic, Darko; Wolf, Susanne A.; Glass, Rainer; Kettenmann, Helmut

    2013-01-01

    Background Glioblastomas are the most aggressive primary brain tumors in humans. Microglia/brain macrophage accumulation in and around the tumor correlates with malignancy and poor clinical prognosis of these tumors. We have previously shown that microglia promote glioma expansion through upregulation of membrane type 1 matrix metalloprotease (MT1-MMP). This upregulation depends on signaling via the Toll-like receptor (TLR) adaptor molecule myeloid differentiation primary response gene 88 (MyD88). Methods Using in vitro, ex vivo, and in vivo techniques, we identified TLR2 as the main TLR controlling microglial MT1-MMP expression and promoting microglia-assisted glioma expansion. Results The implantation of mouse GL261 glioma cells into TLR2 knockout mice resulted in significantly smaller tumors, reduced MT1-MMP expression, and enhanced survival rates compared with wild-type control mice. Tumor expansion studied in organotypic brain slices depended on both parenchymal TLR2 expression and the presence of microglia. Glioma-derived soluble factors and synthetic TLR2 specific ligands induced MT1-MMP expression in microglia from wild-type mice, but no such change in MT1-MMP gene expression was observed in microglia from TLR2 knockout mice. We also found evidence that TLR1 and TLR6 cofunction with TLR2 as heterodimers in regulating MT1-MMP expression in vitro. Conclusions Our results thus show that activation of TLR2 along with TLRs 1 and/or 6 converts microglia into a glioma supportive phenotype. PMID:24014382

  11. A Coding IRAK2 Protein Variant Compromises Toll-like receptor (TLR) Signaling and Is Associated with Colorectal Cancer Survival*

    PubMed Central

    Wang, Hui; Flannery, Sinead M.; Dickhöfer, Sabine; Huhn, Stefanie; George, Julie; Kubarenko, Andriy V.; Lascorz, Jesus; Bevier, Melanie; Willemsen, Joschka; Pichulik, Tica; Schafmayer, Clemens; Binder, Marco; Manoury, Bénédicte; Paludan, Søren R.; Alarcon-Riquelme, Marta; Bowie, Andrew G.; Försti, Asta; Weber, Alexander N. R.

    2014-01-01

    Within innate immune signaling pathways, interleukin-1 receptor-associated kinases (IRAKs) fulfill key roles downstream of multiple Toll-like receptors and the interleukin-1 receptor. Although human IRAK4 deficiency was shown to lead to severe immunodeficiency in response to pyogenic bacterial infection during childhood, little is known about the role of human IRAK2. We here identified a non-synonymous IRAK2 variant, rs35060588 (coding R214G), as hypofunctional in terms of NF-κB signaling and Toll-like receptor-mediated cytokine induction. This was due to reduced ubiquitination of TRAF6, a key step in signal transduction. IRAK2 rs35060588 occurs in 3–9% of individuals in different ethnic groups, and our studies suggested a genetic association of rs35060588 with colorectal cancer survival. This for the first time implicates human IRAK2 in a human disease and highlights the R214G IRAK2 variant as a potential novel and broadly applicable biomarker for disease or as a therapeutic intervention point. PMID:24973222

  12. A coding IRAK2 protein variant compromises Toll-like receptor (TLR) signaling and is associated with colorectal cancer survival.

    PubMed

    Wang, Hui; Flannery, Sinead M; Dickhöfer, Sabine; Huhn, Stefanie; George, Julie; Kubarenko, Andriy V; Lascorz, Jesus; Bevier, Melanie; Willemsen, Joschka; Pichulik, Tica; Schafmayer, Clemens; Binder, Marco; Manoury, Bénédicte; Paludan, Søren R; Alarcon-Riquelme, Marta; Bowie, Andrew G; Försti, Asta; Weber, Alexander N R

    2014-08-15

    Within innate immune signaling pathways, interleukin-1 receptor-associated kinases (IRAKs) fulfill key roles downstream of multiple Toll-like receptors and the interleukin-1 receptor. Although human IRAK4 deficiency was shown to lead to severe immunodeficiency in response to pyogenic bacterial infection during childhood, little is known about the role of human IRAK2. We here identified a non-synonymous IRAK2 variant, rs35060588 (coding R214G), as hypofunctional in terms of NF-κB signaling and Toll-like receptor-mediated cytokine induction. This was due to reduced ubiquitination of TRAF6, a key step in signal transduction. IRAK2 rs35060588 occurs in 3-9% of individuals in different ethnic groups, and our studies suggested a genetic association of rs35060588 with colorectal cancer survival. This for the first time implicates human IRAK2 in a human disease and highlights the R214G IRAK2 variant as a potential novel and broadly applicable biomarker for disease or as a therapeutic intervention point.

  13. The Evolution of Mammalian Olfactory Receptor Genes

    PubMed Central

    Issel-Tarver, L.; Rine, J.

    1997-01-01

    We performed a comparative study of four subfamilies of olfactory receptor genes first identified in the dog to assess changes in the gene family during mammalian evolution, and to begin linking the dog genetic map to that of humans. The human subfamilies were localized to chromosomes 7, 11, and 19. The two subfamilies that were tightly linked in the dog genome were also tightly linked in the human genome. The four subfamilies were compared in human (primate), horse (perissodactyl), and a variety of artiodactyls and carnivores. Some changes in gene number were detected, but overall subfamily size appeared to have been established before the divergence of these mammals 60-100 million years ago. PMID:9017400

  14. TLR7 and TLR9 responsive human B cells share phenotypic and genetic characteristics

    PubMed Central

    Simchoni, Noa; Cunningham-Rundles, Charlotte

    2015-01-01

    B cells activated by nucleic-acid sensing Toll-like receptor 7 and TLR9 proliferate and secrete immune globulins. Memory B cells are presumably more responsive due to higher TLR expression levels, but selectivity and differential outcomes remain largely unknown. In this study, peripheral blood human B cells were stimulated by TLR7 or TLR9 ligands, with or without IFNα, and compared to activators CD40L plus IL-21, to identify differentially responsive cell populations, defined phenotypically and by BCR characteristics. While all activators induced differentiation and antibody secretion, TLR stimulation expanded IgM+ memory and plasma cell lineage committed populations and favored secretion of IgM, unlike CD40L/IL-21 which drove IgM and IgG more evenly. Patterns of proliferation similarly differed, with CD40L/IL-21 inducing proliferation of most memory and naïve B cells, in contrast to TLRs which induced robust proliferation in a subset of these cells. On deep sequencing of the IgH locus, TLR responsive B cells shared patterns of IgHV and IgHJ usage, clustering apart from CD40L/IL-21 and control conditions. TLR activators, but not CD40L/IL-21, similarly promoted increased sharing of CDR3 sequences. TLR responsive B cells were characterized by more somatic hypermutation, shorter CDR3 segments, and less negative charges. TLR activation also induced long positively charged CDR3 segments, suggestive of autoreactive antibodies. Testing this, culture supernatants from TLR stimulated B cells were found to bind HEp-2 cells, while those from CD40L/IL-21 stimulated cells did not. Human B cells possess selective sensitivity to TLR stimulation, with distinctive phenotypic and genetic signatures. PMID:25740945

  15. Activation of TLR2 and TLR6 by Dengue NS1 Protein and Its Implications in the Immunopathogenesis of Dengue Virus Infection

    PubMed Central

    Chen, Jincheng; Ng, Mary Mah-Lee; Chu, Justin Jang Hann

    2015-01-01

    Dengue virus (DV) infection is the most prevalent mosquito-borne viral disease and its manifestation has been shown to be contributed in part by the host immune responses. In this study, pathogen recognition receptors, Toll-like receptor (TLR) 2 and TLR6 were found to be up-regulated in DV-infected human PBMC using immunofluorescence staining, flow cytometry and Western blot analyses. Using ELISA, IL-6 and TNF-α, cytokines downstream of TLR2 and TLR6 signaling pathways were also found to be up-regulated in DV-infected PBMC. IL-6 and TNF-α production by PBMC were reduced when TLR2 and TLR6 were blocked using TLR2 and TLR6 neutralizing antibodies during DV infection. These results suggested that signaling pathways of TLR2 and TLR6 were activated during DV infection and its activation contributed to IL-6 and TNF-α production. DV NS1 protein was found to significantly increase the production of IL-6 and TNF-α when added to PBMC. The amount of IL-6 and TNF-α stimulated by DV NS1 protein was reduced when TLR2 and TLR6 were blocked, suggesting that DV NS1 protein is the viral protein responsible for the activation of TLR2 and TLR6 during DV infection. Secreted alkaline phosphatase (SEAP) reporter assay was used to further confirm activation of TLR2 and TLR6 by DV NS1 protein. In addition, DV-infected and DV NS1 protein-treated TLR6-/- mice have higher survivability compared to DV-infected and DV NS1 protein-treated wild-type mice. Hence, activation of TLR6 via DV NS1 protein could potentially play an important role in the immunopathogenesis of DV infection. PMID:26226614

  16. Role of TLR2- and TLR4-mediated signaling in Mycobacterium tuberculosis-induced macrophage death.

    PubMed

    Sánchez, Dulfary; Rojas, Mauricio; Hernández, Israel; Radzioch, Danuta; García, Luis F; Barrera, Luis F

    2010-01-01

    Infection of macrophages with Mycobacterium tuberculosis (Mtb) induces cell death by apoptosis or necrosis. TLRs 2 and 4 recognition of mycobacterial ligands has been independently associated to apoptosis induction. To try to understand the particular contribution of these receptors to apoptotic or necrotic signaling upon infection with live Mtb H37Rv, we used macrophage lines derived from wild-type or TLR2-, TLR4-, and MyD88-deficient mouse strains. Mtb-infection triggered apoptosis depending on a TLR2/TLR4/MyD88/p38/ERK/PI-3K/NF-kB pathway; however, necrosis was favored in absence of TLR4 signaling independently of p38, ERK1/2, PI-3K or NF-kappaB activity. In conclusion, our results indicate that cooperation between TLR2- and TLR4-dependent mediated signals play a critical role in macrophage apoptosis induced by Mtb and the TLR4-mediated signaling has important role in the maintenance of the balance between apoptotic vs. necrotic cell death induced by macrophage infection with Mtb.

  17. Engineering AAV receptor footprints for gene therapy.

    PubMed

    Madigan, Victoria J; Asokan, Aravind

    2016-06-01

    Adeno-associated viruses (AAV) are currently at the forefront of human gene therapy clinical trials as recombinant vectors. Significant progress has been made in elucidating the structure, biology and tropisms of different naturally occurring AAV isolates in the past decade. In particular, a spectrum of AAV capsid interactions with host receptors have been identified and characterized. These studies have enabled a better understanding of key determinants of AAV cell recognition and entry in different hosts. This knowledge is now being applied toward engineering new, lab-derived AAV capsids with favorable transduction profiles. The current review conveys a structural perspective of capsid-glycan interactions and provides a roadmap for generating synthetic strains by engineering AAV receptor footprints.

  18. TLR9 -1486T/C and 2848C/T SNPs Are Associated with Human Cytomegalovirus Infection in Infants

    PubMed Central

    Paradowska, Edyta; Jabłońska, Agnieszka; Studzińska, Mirosława; Skowrońska, Katarzyna; Suski, Patrycja; Wiśniewska-Ligier, Małgorzata; Woźniakowska-Gęsicka, Teresa; Nowakowska, Dorota; Gaj, Zuzanna; Wilczyński, Jan; Leśnikowski, Zbigniew J.

    2016-01-01

    Toll-like receptor 9 (TLR9) recognizes non-methylated viral CpG-containing DNA and serves as a pattern recognition receptor that signals the presence of human cytomegalovirus (HCMV). Here, we present the genotype distribution of single-nucleotide polymorphisms (SNPs) of the TLR9 gene in infants and the relationship between TLR9 polymorphisms and HCMV infection. Four polymorphisms (-1237T/C, rs5743836; -1486T/C, rs187084; 1174G/A, rs352139; and 2848C/T, rs352140) in the TLR9 gene were genotyped in 72 infants with symptomatic HCMV infection and 70 healthy individuals. SNP genotyping was performed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Digested fragments were separated and identified by capillary electrophoresis. The HCMV DNA copy number was measured by a quantitative real-time PCR assay. We found an increased frequency of heterozygous genotypes TLR9 -1486T/C and 2848C/T in infants with HCMV infection compared with uninfected cases. Heterozygous variants of these two SNPs increased the risk of HCMV disease in children (P = 0.044 and P = 0.029, respectively). In infants with a mutation present in at least one allele of -1486T/C and 2848C/T SNPs, a trend towards increased risk of cytomegaly was confirmed after Bonferroni’s correction for multiple testing (Pc = 0.063). The rs352139 GG genotype showed a significantly reduced relative risk for HCMV infection (Pc = 0.006). In contrast, the -1237T/C SNP was not related to viral infection. We found no evidence for linkage disequilibrium with the four examined TLR9 SNPs. The findings suggest that the TLR9 -1486T/C and 2848C/T polymorphisms could be a genetic risk factor for the development of HCMV disease. PMID:27105145

  19. Resolution of TLR2-induced inflammation through manipulation of metabolic pathways in Rheumatoid Arthritis

    PubMed Central

    McGarry, Trudy; Biniecka, Monika; Gao, Wei; Cluxton, Deborah; Canavan, Mary; Wade, Siobhan; Wade, Sarah; Gallagher, Lorna; Orr, Carl; Veale, Douglas J.; Fearon, Ursula

    2017-01-01

    During inflammation, immune cells activated by toll-like receptors (TLRs) have the ability to undergo a bioenergetic switch towards glycolysis in a manner similar to that observed in tumour cells. While TLRs have been implicated in the pathogenesis of rheumatoid arthritis (RA), their role in regulating cellular metabolism in synovial cells, however, is still unknown. In this study, we investigated the effect of TLR2-activation on mitochondrial function and bioenergetics in primary RA-synovial fibroblast cells (RASFC), and further determined the role of glycolytic blockade on TLR2-induced inflammation in RASFC using glycolytic inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one (3PO). We observed an increase in mitochondrial mutations, ROS and lipid peroxidation, paralleled by a decrease in the mitochondrial membrane potential in TLR2-stimulated RASFC. This was mirrored by differential regulation of key mitochondrial genes, coupled with alteration in mitochondrial morphology. TLR2-activation also regulated changes in the bioenergetic profile of RASFC, inducing PKM2 nuclear translocation, decreased mitochondrial respiration and ATP synthesis and increased glycolysis:respiration ratio, suggesting a metabolic switch. Finally, using 3PO, we demonstrated that glycolytic blockade reversed TLR2-induced pro-inflammatory mechanisms including invasion, migration, cytokine/chemokine secretion and signalling pathways. These findings support the concept of complex interplay between innate immunity, oxidative damage and oxygen metabolism in RA pathogenesis. PMID:28225071

  20. IFNα enhances the production of IL-6 by human neutrophils activated via TLR8

    PubMed Central

    Zimmermann, Maili; Arruda-Silva, Fabio; Bianchetto-Aguilera, Francisco; Finotti, Giulia; Calzetti, Federica; Scapini, Patrizia; Lunardi, Claudio; Cassatella, Marco A.; Tamassia, Nicola

    2016-01-01

    Recently, we reported that human neutrophils produce biologically active amounts of IL-6 when incubated with agonists activating TLR8, a receptor recognizing viral single strand RNA. In this study, we demonstrate that IFNα, a cytokine that modulates the early innate immune responses toward viral and bacterial infections, potently enhances the production of IL-6 in neutrophils stimulated with R848, a TLR8 agonist. We also show that such an effect is not caused by an IFNα-dependent induction of TLR7 and its consequent co-activation with TLR8 in response to R848, but, rather, it is substantially mediated by an increased production and release of endogenous TNFα. The latter cytokine, in an autocrine manner, leads to an augmented synthesis of the IkBζ co-activator and an enhanced recruitment of the C/EBPβ transcription factor to the IL-6 promoter. Moreover, we show that neutrophils from SLE patients with active disease state, hence displaying an IFN-induced gene expression signature, produce increased amounts of both IL-6 and TNFα in response to R848 as compared to healthy donors. Altogether, data uncover novel effects that type I IFN exerts in TLR8-activated neutrophils, which therefore enlarge our knowledge on the various biological actions which type I IFN orchestrates during infectious and autoimmune diseases. PMID:26790609

  1. Identification of TLR2/TLR6 signalling lactic acid bacteria for supporting immune regulation

    PubMed Central

    Ren, Chengcheng; Zhang, Qiuxiang; de Haan, Bart J.; Zhang, Hao; Faas, Marijke M.; de Vos, Paul

    2016-01-01

    Although many lactic acid bacteria (LAB) influence the consumer’s immune status it is not completely understood how this is established. Bacteria-host interactions between bacterial cell-wall components and toll-like receptors (TLRs) have been suggested to play an essential role. Here we investigated the interaction between LABs with reported health effects and TLRs. By using cell-lines expressing single or combination of TLRs, we show that LABs can signal via TLR-dependent and independent pathways. The strains only stimulated and did not inhibit TLRs. We found that several strains such as L. plantarum CCFM634, L. plantarum CCFM734, L. fermentum CCFM381, L. acidophilus CCFM137, and S. thermophilus CCFM218 stimulated TLR2/TLR6. TLR2/TLR6 is essential in immune regulatory processes and of interest for prevention of diseases. Specificity of the TLR2/TLR6 stimulation was confirmed with blocking antibodies. Immunomodulatory properties of LABs were also studied by assessing IL-10 and IL-6 secretion patterns in bacteria-stimulated THP1-derived macrophages, which confirmed species and strain specific effects of the LABs. With this study we provide novel insight in LAB specific host-microbe interactions. Our data demonstrates that interactions between pattern recognition receptors such as TLRs is species and strain specific and underpins the importance of selecting specific strains for promoting specific health effects. PMID:27708357

  2. Identification of a novel human MD-2 splice variant that negatively regulates Lipopolysaccharide-induced TLR4 signaling.

    PubMed

    Gray, Pearl; Michelsen, Kathrin S; Sirois, Cherilyn M; Lowe, Emily; Shimada, Kenichi; Crother, Timothy R; Chen, Shuang; Brikos, Constantinos; Bulut, Yonca; Latz, Eicke; Underhill, David; Arditi, Moshe

    2010-06-01

    Myeloid differentiation factor 2 (MD-2) is a secreted gp that assembles with TLR4 to form a functional signaling receptor for bacterial LPS. In this study, we have identified a novel alternatively spliced isoform of human MD-2, termed MD-2 short (MD-2s), which lacks the region encoded by exon 2 of the MD-2 gene. Similar to MD-2, MD-2s is glycosylated and secreted. MD-2s also interacted with LPS and TLR4, but failed to mediate LPS-induced NF-kappaB activation and IL-8 production. We show that MD-2s is upregulated upon IFN-gamma, IL-6, and TLR4 stimulation and negatively regulates LPS-mediated TLR4 signaling. Furthermore, MD-2s competitively inhibited binding of MD-2 to TLR4. Our study pinpoints a mechanism that may be used to regulate TLR4 activation at the onset of signaling and identifies MD-2s as a potential therapeutic candidate to treat human diseases characterized by an overly exuberant or chronic immune response to LPS.

  3. TLR4 acts as a death receptor for ultraviolet radiation (UVR) through IRAK-independent and FADD-dependent pathway in macrophages.

    PubMed

    Zhou, Hua; Harberts, Erin; Fishelevich, Rita; Gaspari, Anthony A

    2016-12-01

    UVR-induced apoptosis in cutaneous antigen presenting cells (APC) causes systemic immune suppression and is dependent on TLR4/MyD88 signalling, but the apoptotic signalling pathways have not been defined. Macrophages pretreated with lipopolysaccharide (LPS) were unresponsive to subsequent LPS treatment, however, but were susceptible to UVR-induced apoptosis. Macrophage survival and apoptotic events after UVR were also unaffected by treatment with TLR4 antagonists, a blocking IgG or a TLR4 analog antagonist, suggesting that UVR cell death is independent of a soluble ligand. After UVR, IRAK4(KDKI) (catalytically inactive IRAK4) and wild-type (WT) macrophages show equivalent levels of survival, as measured by MTT assay, and apoptosis, as measured by cleaved caspase-3. Furthermore, in macrophages from both mice, UVR activated caspase-8 and PARP, while inactivating Rip3. This finding is supported by a lack of IRAK1 degradation after UVR, compared to treatment with TLR2 or TLR4 agonists. UVR induced association of MyD88 with FADD, an extrinsic apoptotic pathway protein, but not IRAK4. UVR-induced migration of FADD to the cell membrane of WT macrophages, but not MyD88(-/-) macrophages, was observed (confocal microscopy). Co-immunoprecipitation using an epitope-tagged MyD88 revealed that FADD, but not TRADD, was recruited to MyD88 within 30 minutes of UVR exposure. UVR engages TLR4/MyD88 as a death signalling complex, rather than the classical inflammatory signalling pathway triggered by PAMP recognition of TLR4. These studies provide the rationale for the future development of topical TLR4 modulating therapies to interfere with this UVB-mediated apoptosis and the associated negative consequences of immune suppression.

  4. Identification and characterization of three TLR1 subfamily members from the orange-spotted grouper, Epinephelus coioides.

    PubMed

    Li, Yan-Wei; Xu, Dong-Dong; Li, Xia; Mo, Ze-Quan; Luo, Xiao-Chun; Li, An-Xing; Dan, Xue-Ming

    2016-08-01

    Toll-like receptors (TLRs), which play important roles in host defense against pathogen infection, are the most intensively studied pattern recognition receptors (PRRs). In this study, we identified three novel TLR1 subfamily members, including TLR1 (EcTLR1b), TLR2 (EcTLR2b) and TLR14 (EcTLR14), from the orange-spotted grouper (Epinephelus coioides). EcTLR1b and EcTLR2b displayed low sequence identity with the previously reported grouper TLR1 (EcTLR1a) and TLR2 (EcTLR2a), respectively. The open reading frames (ORFs) of EcTLR1b, EcTLR2b and EcTLR14 contain 2484 bp, 2394 bp and 2640 bp, which encode the corresponding 827 amino acids (aa), 797 aa and 879 aa, respectively. All three TLRs have leucine-rich repeat (LRR) domains (including an LRR-NT (except for EcTLR1b), several LRR motifs and an LRR-CT), a trans-membrane region and a Toll/interleukin-1 receptor (TIR) domain. The TIR domains of the three TLRs exhibited conserved boxes, namely box1, box2 and box3, and their 3D models were similar to those of human TLR1 or TLR2. Sequence alignment demonstrated that the TIR domains of the three TLRs shared higher sequence identity with those of other species than the full-length receptors. Phylogenetic analysis indicated that EcTLR1s and EcTLR2s are characterized by their differing evolutionary status, whereas EcTLR14 was found to be in the same group as other piscine TLR14/18s. The three TLRs were ubiquitously expressed in seven tested tissues of healthy groupers, although their expression profiles were different. Post Cryptocaryon irritans infection, TLR1s expression was up-regulated in the gills. The expression of TLR2b was mainly increased in the spleen, but decreased in the gills, which was similar to the expression pattern of TLR2a post C. irritans infection. Unlike EcTLR1b and EcTLR2b, however, the grouper TLR14 transcript was substantially induced in both tissues post challenge. These findings may be helpful in understanding the innate immune mechanism of host

  5. The Androgen Receptor Gene Mutations Database.

    PubMed

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  6. TLR4-mediated galectin-1 production triggers epithelial-mesenchymal transition in colon cancer cells through ADAM10- and ADAM17-associated lactate production.

    PubMed

    Park, Ga Bin; Kim, Daejin

    2017-01-01

    Toll-like receptor 4 (TLR4) activation is a key contributor to the carcinogenesis of colon cancer. Overexpression of galectin-1 (Gal-1) also correlates with increased invasive activity of colorectal cancer. Lactate production is a critical predictive factor of risk of metastasis, but the functional relationship between intracellular lactate and Gal-1 expression in TLR4-activated colon cancer remains unknown. In this study, we investigated the underlying mechanism and role of Gal-1 in metastasis and invasion of colorectal cancer (CRC) cells after TLR4 stimulation. Exposure to the TLR4 ligand lipopolysaccharide (LPS) increased expression of Gal-1, induced EMT-related cytokines, triggered the activation of glycolysis-related enzymes, and promoted lactate production. Gene silencing of TLR4 and Gal-1 in CRC cells inhibited lactate-mediated epithelial-mesenchymal transition (EMT) after TLR4 stimulation. Gal-1-mediated activation of a disintegrin and metalloproteinase 10 (ADAM10) and ADAM 17 increased the invasion activity and expression of mesenchymal characteristics in LPS-activated CRC cells. Conversely, inhibition of ADAM10 or ADAM17 effectively blocked the generation of lactate and the migration capacity of LPS-treated CRC cells. Thus, the TLR4/Gal-1 signaling pathway regulates lactate-mediated EMT processes through the activation of ADAM10 and ADAM17 in CRC cells.

  7. Increased frequency of immunoglobulin (Ig)A-secreting cells following Toll-like receptor (TLR)-9 engagement in patients with Kawasaki disease

    PubMed Central

    Giordani, L; Quaranta, M G; Marchesi, A; Straface, E; Pietraforte, D; Villani, A; Malorni, W; Del Principe, D; Viora, M

    2011-01-01

    Kawasaki disease (KD) is an acute vasculitis affecting mainly infants and children. Human B cells express Toll-like receptor (TLR)-9, whose natural ligands are unmethylated cytosine–guanine dinucleotide (CpG) motifs characteristic of bacterial DNA. The aim of this study was to clarify the pathogenesis of KD analysing the activation status of peripheral blood mononuclear cells (PBMC), focusing on B lymphocyte activation and functions. Ten patients and 10 age-matched healthy donors were recruited from the Bambino Gesù Hospital of Rome, Italy and enrolled into this study. We determined phenotype profile and immunoglobulin (Ig) production of PBMC from KD patients and age-matched controls. We found that the frequency of CD19+ B lymphocytes and CD19+/CD86+ activated B lymphocytes from KD patients during the acute phase before therapy was increased significantly. Moreover, B lymphocytes of acute-phase KD patients were more prone to CpG oligodeoxynucleotide (ODN) activation compared with the age-matched controls, as assessed by a significant increase of the number of IgA-secreting cells (SC). In the same patients we found a marked increase of IgM, IgG, interleukin (IL)-6 and tumour necrosis factor (TNF)-α production compared with the control group. In addition, in two convalescent KD patients, conventional treatment with intravenous immunoglobulin (IVIG) restored the normal frequency of CD19+ B cells, the number of IgA-, IgM- and IgG-SC and the production of IL-6 and TNF-α. Our findings indicate that the percentages of peripheral B lymphocytes of acute-phase KD patients are increased and are prone to bacterial activation in terms of increased numbers of IgA-SC and increased production of IL-6 and TNF-α inflammatory cytokines. Thus, our data support the hypothesis of an infectious triggering in KD. PMID:21175593

  8. Increased frequency of immunoglobulin (Ig)A-secreting cells following Toll-like receptor (TLR)-9 engagement in patients with Kawasaki disease.

    PubMed

    Giordani, L; Quaranta, M G; Marchesi, A; Straface, E; Pietraforte, D; Villani, A; Malorni, W; Del Principe, D; Viora, M

    2011-03-01

    Kawasaki disease (KD) is an acute vasculitis affecting mainly infants and children. Human B cells express Toll-like receptor (TLR)-9, whose natural ligands are unmethylated cytosine-guanine dinucleotide (CpG) motifs characteristic of bacterial DNA. The aim of this study was to clarify the pathogenesis of KD analysing the activation status of peripheral blood mononuclear cells (PBMC), focusing on B lymphocyte activation and functions. Ten patients and 10 age-matched healthy donors were recruited from the Bambino Gesù Hospital of Rome, Italy and enrolled into this study. We determined phenotype profile and immunoglobulin (Ig) production of PBMC from KD patients and age-matched controls. We found that the frequency of CD19(+) B lymphocytes and CD19(+) /CD86(+) activated B lymphocytes from KD patients during the acute phase before therapy was increased significantly. Moreover, B lymphocytes of acute-phase KD patients were more prone to CpG oligodeoxynucleotide (ODN) activation compared with the age-matched controls, as assessed by a significant increase of the number of IgA-secreting cells (SC). In the same patients we found a marked increase of IgM, IgG, interleukin (IL)-6 and tumour necrosis factor (TNF)-α production compared with the control group. In addition, in two convalescent KD patients, conventional treatment with intravenous immunoglobulin (IVIG) restored the normal frequency of CD19(+) B cells, the number of IgA-, IgM- and IgG-SC and the production of IL-6 and TNF-α. Our findings indicate that the percentages of peripheral B lymphocytes of acute-phase KD patients are increased and are prone to bacterial activation in terms of increased numbers of IgA-SC and increased production of IL-6 and TNF-α inflammatory cytokines. Thus, our data support the hypothesis of an infectious triggering in KD.

  9. Identification of a family of muscarinic acetylcholine receptor genes

    SciTech Connect

    Bonner, T.I.; Buckley, N.J.; Young, A.C.; Brann, M.R.

    1987-07-31

    Complementary DNAs for three different muscarinic acetylcholine receptors were isolated from a rat cerebral cortex library, and the cloned receptors were expressed in mammalian cells. Analysis of human and rat genomic clones indicates that there are at least four functional muscarinic receptor genes and that these genes lack introns in the coding sequence. This gene family provides a new basis for evaluating the diversity of muscarinic mechanisms in the nervous system.

  10. Saturated fatty acids activate TLR-mediated pro-inflammatory signaling pathways

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Toll-like receptor 4 (TLR4) and TLR2 were shown to be activated by saturated fatty acids (SFAs) but inhibited by docosahexaenoic acid (DHA). However, one report (ATVB 11:1944, 2009) suggested that SFA-induced TLR activation in cell culture systems is due to contaminants in BSA used for conjugating f...

  11. Differential outcome of TRIF-mediated signaling in TLR4 and TLR3 induced DC maturation.

    PubMed

    Hu, Wei; Jain, Aakanksha; Gao, Yajing; Dozmorov, Igor M; Mandraju, Rajakumar; Wakeland, Edward K; Pasare, Chandrashekhar

    2015-11-10

    Recognition of pathogen-associated molecular patterns by Toll-like receptors (TLRs) on dendritic cells (DCs) leads to DC maturation, a process involving up-regulation of MHC and costimulatory molecules and secretion of proinflammatory cytokines. All TLRs except TLR3 achieve these outcomes by using the signaling adaptor myeloid differentiation factor 88. TLR4 and TLR3 can both use the Toll-IL-1 receptor domain-containing adaptor inducing IFN-β (TRIF)-dependent signaling pathway leading to IFN regulatory factor 3 (IRF3) activation and induction of IFN-β and -α4. The TRIF signaling pathway, downstream of both of these TLRs, also leads to DC maturation, and it has been proposed that the type I IFNs act in cis to induce DC maturation and subsequent effects on adaptive immunity. The present study was designed to understand the molecular mechanisms of TRIF-mediated DC maturation. We have discovered that TLR4-TRIF-induced DC maturation was independent of both IRF3 and type I IFNs. In contrast, TLR3-mediated DC maturation was completely dependent on type I IFN feedback. We found that differential activation of mitogen-activated protein kinases by the TLR4- and TLR3-TRIF axes determined the type I IFN dependency for DC maturation. In addition, we found that the adjuvanticity of LPS to induce T-cell activation is completely independent of type I IFNs. The important distinction between the TRIF-mediated signaling pathways of TLR4 and TLR3 discovered here could have a major impact in the design of future adjuvants that target this pathway.

  12. Salmonid Tollip and MyD88 factors can functionally replace their mammalian orthologues in TLR-mediated trout SAA promoter activation.

    PubMed

    Rebl, Alexander; Rebl, Henrike; Liu, Shuzhen; Goldammer, Tom; Seyfert, Hans-Martin

    2011-01-01

    Many functional details of the piscine Toll-like receptor (TLR) signal-mediated activation of immune defense are still elusive. We used an established reconstitution system of mammalian TLR signaling to examine if this system would allow for pathogen-dependent promoter activation of the serum amyloid A (SAA)-encoding gene from rainbow trout (Oncorhynchus mykiss) and if the key mediators MyD88 and Tollip from trout can functionally substitute for their mammalian orthologues. Cells of the established human embryonic kidney line HEK-293 were transiently co-transfected with vectors expressing bovine TLR2 or TLR4 factors and a reporter gene driven by the promoter of the trout SAA gene. Escherichia coli stimulation increased reporter gene expression more than 3-fold. Deletion series and point mutations identified in the proximal SAA promoter a composite overlapping binding site for NF-κB and CEBP factors as crucial for promoter activation. Overexpression of NF-κB p65, but not of p50 or different members of the CEBP factor family proved this factor as an essential driver for SAA expression. Overexpression of a transdominant-negative mutant of the trout MyD88 factor reduced TLR-mediated SAA promoter activation confirming functional conservation of its TIR domain. Overexpression of the Tollip factor from trout also quenched TLR-mediated NF-κB and TLR4-mediated SAA promoter activation. The MyD88 mutant and Tollip expression studies confirm the functional homology of both piscine factors and their mammalian counterparts. We provide for the first time evidence that also the Tollip-mediated negative loop of TLR signaling may be conserved in non-mammalian organisms.

  13. Characterization of Innate Responses Induced by PLGA Encapsulated- and Soluble TLR Ligands In Vitro and In Vivo in Chickens

    PubMed Central

    Alkie, Tamiru N.; Taha-Abdelaziz, Khaled; Barjesteh, Neda; Bavananthasivam, Jegarubee; Hodgins, Douglas C.; Sharif, Shayan

    2017-01-01

    Natural or synthetic Toll-like receptor (TLR) ligands trigger innate responses by interacting with distinct TLRs. TLR ligands can thus serve as vaccine adjuvants or stand-alone antimicrobial agents. One of the limitations of TLR ligands for clinical application is their short half-life and rapid clearance from the body. In the current study, encapsulation of selected TLR ligands in biodegradable poly(D,L-lactide-co-glycolide) polymer nanoparticles (PLGA NPs) was examined in vitro and in vivo as a means to prolong innate responses. MQ-NCSU cells (a chicken macrophage cell line) were treated with encapsulated or soluble forms of TLR ligands and the resulting innate responses were evaluated. In most cases, encapsulated forms of TLR ligands (CpG ODN 2007, lipopolysaccharide and Pam3CSK4) induced comparable or higher levels of nitric oxide and cytokine gene expression in macrophages, compared to the soluble forms. Encapsulated CpG ODN, in particular the higher dose, induced significantly higher expression of interferon (IFN)-γ and IFN-β until at least 18 hr post-treatment. Cytokine expression by splenocytes was also examined in chickens receiving encapsulated or soluble forms of lipopolysaccharide (a potent inflammatory cytokine inducer in chickens) by intramuscular injection. Encapsulated LPS induced more sustained innate responses characterized by higher expression of IFN-γ and IL-1β until up to 96 hr. The ability of TLR ligands encapsulated in polymeric nanoparticles to maintain prolonged innate responses indicates that this controlled-release system can extend the use of TLR ligands as vaccine adjuvants or as stand-alone prophylactic agents against pathogens. PMID:28045984

  14. Co-stimulation with TLR3 and TLR21 ligands synergistically up-regulates Th1-cytokine IFN-gamma and regulatory cytokine IL-10 expression in chicken monocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Toll-like receptors (TLRs) are the pattern recognition receptors of the innate immune system for various conserved pathogen-associated molecular motifs. The chicken TLR3 and TLR21 (avian equivalent to mammalian TLR9) recognize poly I:C (viral double-stranded RNA) and CpG-ODN (a CpG-motif containing...

  15. Identification and characterization of toll-like receptors (TLRs) in the Chinese tree shrew (Tupaia belangeri chinensis).

    PubMed

    Yu, Dandan; Wu, Yong; Xu, Ling; Fan, Yu; Peng, Li; Xu, Min; Yao, Yong-Gang

    2016-07-01

    In mammals, the toll-like receptors (TLRs) play a major role in initiating innate immune responses against pathogens. Comparison of the TLRs in different mammals may help in understanding the TLR-mediated responses and developing of animal models and efficient therapeutic measures for infectious diseases. The Chinese tree shrew (Tupaia belangeri chinensis), a small mammal with a close relationship to primates, is a viable experimental animal for studying viral and bacterial infections. In this study, we characterized the TLRs genes (tTLRs) in the Chinese tree shrew and identified 13 putative TLRs, which are orthologs of mammalian TLR1-TLR9 and TLR11-TLR13, and TLR10 was a pseudogene in tree shrew. Positive selection analyses using the Maximum likelihood (ML) method showed that tTLR8 and tTLR9 were under positive selection, which might be associated with the adaptation to the pathogen challenge. The mRNA expression levels of tTLRs presented an overall low and tissue-specific pattern, and were significantly upregulated upon Hepatitis C virus (HCV) infection. tTLR4 and tTLR9 underwent alternative splicing, which leads to different transcripts. Phylogenetic analysis and TLR structure prediction indicated that tTLRs were evolutionarily conserved, which might reflect an ancient mechanism and structure in the innate immune response system. Taken together, TLRs had both conserved and unique features in the Chinese tree shrew.

  16. Coxiella burnetii lipopolysaccharide blocks p38α-MAPK activation through the disruption of TLR-2 and TLR-4 association

    PubMed Central

    Conti, Filippo; Boucherit, Nicolas; Baldassarre, Veronica; Trouplin, Virginie; Toman, Rudolf; Mottola, Giovanna; Mege, Jean-Louis; Ghigo, Eric

    2015-01-01

    To survive in macrophages, Coxiella burnetii hijacks the activation pathway of macrophages. Recently, we have demonstrated that C. burnetii, via its lipopolysaccharide (LPS), avoids the activation of p38α-MAPK through an antagonistic engagement of Toll-like receptor (TLR)-4. We investigated the fine-tuned mechanism leading to the absence of activation of the p38α-MAPK despite TLR-4 engagement. In macrophages challenged with LPS from the avirulent variants of C. burnetii, TLR-4 and TLR-2 co-immunoprecipitated. This association was absent in cells challenged by the LPS of pathogenic C. burnetii. The disruption makes TLRs unable to signal during the recognition of the LPS of pathogenic C. burnetii. The disruption of TLR-2 and TLR-4 was induced by the re-organization of the macrophage cytoskeleton by C. burnetii LPS. Interestingly, blocking the actin cytoskeleton re-organization relieved the disruption of the association TLR-2/TLR-4 by pathogenic C. burnetii and rescued the p38α-MAPK activation by C. burnetii. We elucidated an unexpected mechanism allowing pathogenic C. burnetii to avoid macrophage activation by the disruption of the TLR-2 and TLR-4 association. PMID:25610812

  17. Helminth-excreted/secreted products are recognized by multiple receptors on DCs to block the TLR response and bias Th2 polarization in a cRAF dependent pathway.

    PubMed

    Terrazas, César A; Alcántara-Hernández, Marcela; Bonifaz, Laura; Terrazas, Luis I; Satoskar, Abhay R

    2013-11-01

    Dendritic cells (DCs) recognize pathogens and initiate the T-cell response. The DC-helminth interaction induces an immature phenotype in DCs; as a result, these DCs display impaired responses to TLR stimulation and prime Th2-type responses. However, the DC receptors and intracellular pathways targeted by helminth molecules and their importance in the initiation of the Th2 response are poorly understood. In this report, we found that products excreted/secreted by Taenia crassiceps (TcES) triggered cRAF phosphorylation through MGL, MR, and TLR2. TcES interfered with the LPS-induced NFκB p65 and p38 MAPK signaling pathways. In addition, TcES-induced cRAF signaling pathway was critical for down-regulation of the TLR-mediated DC maturation and secretion of IL-12 and TNF-α. Finally, we show for the first time that blocking cRAF in DCs abolishes their ability to induce Th2 polarization in vitro after TcES exposure. Our data demonstrate a new mechanism by which helminths target intracellular pathways to block DC maturation and efficiently program Th2 polarization.

  18. Complex Negative Regulation of TLR9 by Multiple Proteolytic Cleavage Events.

    PubMed

    Sinha, Siddhartha S; Cameron, Jody; Brooks, James C; Leifer, Cynthia A

    2016-08-15

    TLR9 is an innate immune receptor important for recognizing DNA of host and foreign origin. A mechanism proposed to prevent excessive response to host DNA is the requirement for proteolytic cleavage of TLR9 in endosomes to generate a mature form of the receptor (TLR9(471-1032)). We previously described another cleavage event in the juxtamembrane region of the ectodomain that generated a dominant-negative form of TLR9. Thus, there are at least two independent cleavage events that regulate TLR9. In this study, we investigated whether an N-terminal fragment of TLR9 could be responsible for regulation of the mature or negative-regulatory form. We show that TLR9(471-1032), corresponding to the proteolytically cleaved form, does not function on its own. Furthermore, activity is not rescued by coexpression of the N-terminal fragment (TLR9(1-440)), inclusion of the hinge region (TLR9(441-1032)), or overexpression of UNC93B1, the last of which is critical for trafficking and cleavage of TLR9. TLR9(1-440) coimmunoprecipitates with full-length TLR9 and TLR9(471-1032) but does not rescue the native glycosylation pattern; thus, inappropriate trafficking likely explains why TLR9(471-1032) is nonfunctional. Lastly, we show that TLR9(471-1032) is also a dominant-negative regulator of TLR9 signaling. Together, these data provide a new perspective on the complexity of TLR9 regulation by proteolytic cleavage and offer potential ways to inhibit activity through this receptor, which may dampen autoimmune inflammation.

  19. RhoA GTPase activation by TLR2 and TLR3 ligands: connecting via Src to NF-kappa B.

    PubMed

    Manukyan, Maria; Nalbant, Perihan; Luxen, Sylvia; Hahn, Klaus M; Knaus, Ulla G

    2009-03-15

    Rho GTPases are essential regulators of signaling networks emanating from many receptors involved in innate or adaptive immunity. The Rho family member RhoA controls cytoskeletal processes as well as the activity of transcription factors such as NF-kappaB, C/EBP, and serum response factor. The multifaceted host cell activation triggered by TLRs in response to soluble and particulate microbial structures includes rapid stimulation of RhoA activity. RhoA acts downstream of TLR2 in HEK-TLR2 and monocytic THP-1 cells, but the signaling pathway connecting TLR2 and RhoA is still unknown. It is also not clear if RhoA activation is dependent on a certain TLR adapter. Using lung epithelial cells, we demonstrate TLR2- and TLR3-triggered recruitment and activation of RhoA at receptor-proximal cellular compartments. RhoA activity was dependent on TLR-mediated stimulation of Src family kinases. Both Src family kinases and RhoA were required for NF-kappaB activation, whereas RhoA was dispensable for type I IFN generation. These results suggest that RhoA plays a role downstream of MyD88-dependent and -independent TLR signaling and acts as a molecular switch downstream of TLR-Src-initiated pathways.

  20. Regulatory Features for Odorant Receptor Genes in the Mouse Genome

    PubMed Central

    Degl’Innocenti, Andrea; D’Errico, Anna

    2017-01-01

    The odorant receptor genes, seven transmembrane receptor genes constituting the vastest mammalian gene multifamily, are expressed monogenically and monoallelicaly in each sensory neuron in the olfactory epithelium. This characteristic, often referred to as the one neuron–one receptor rule, is driven by mostly uncharacterized molecular dynamics, generally named odorant receptor gene choice. Much attention has been paid by the scientific community to the identification of sequences regulating the expression of odorant receptor genes within their loci, where related genes are usually arranged in genomic clusters. A number of studies identified transcription factor binding sites on odorant receptor promoter sequences. Similar binding sites were also found on a number of enhancers that regulate in cis their transcription, but have been proposed to form interchromosomal networks. Odorant receptor gene choice seems to occur via the local removal of strongly repressive epigenetic markings, put in place during the maturation of the sensory neuron on each odorant receptor locus. Here we review the fast-changing state of art for the study of regulatory features for odorant receptor genes. PMID:28270833

  1. Regulatory Features for Odorant Receptor Genes in the Mouse Genome.

    PubMed

    Degl'Innocenti, Andrea; D'Errico, Anna

    2017-01-01

    The odorant receptor genes, seven transmembrane receptor genes constituting the vastest mammalian gene multifamily, are expressed monogenically and monoallelicaly in each sensory neuron in the olfactory epithelium. This characteristic, often referred to as the one neuron-one receptor rule, is driven by mostly uncharacterized molecular dynamics, generally named odorant receptor gene choice. Much attention has been paid by the scientific community to the identification of sequences regulating the expression of odorant receptor genes within their loci, where related genes are usually arranged in genomic clusters. A number of studies identified transcription factor binding sites on odorant receptor promoter sequences. Similar binding sites were also found on a number of enhancers that regulate in cis their transcription, but have been proposed to form interchromosomal networks. Odorant receptor gene choice seems to occur via the local removal of strongly repressive epigenetic markings, put in place during the maturation of the sensory neuron on each odorant receptor locus. Here we review the fast-changing state of art for the study of regulatory features for odorant receptor genes.

  2. Analysis of antigen receptor genes in Hodgkin's disease.

    PubMed Central

    Angel, C A; Pringle, J H; Naylor, J; West, K P; Lauder, I

    1993-01-01

    AIM--To analyse the configuration of the antigen receptor genes in Hodgkin's disease. METHODS--DNA extracted from 45 samples of Hodgkin's disease was analysed using Southern blotting and DNA hybridisation, using probes to the joining region of the immunoglobulin heavy chain gene, the constant region of kappa immunoglobulin light chain gene, and the constant region of the beta chain of the T cell receptor gene. RESULTS--A single case of nodular sclerosing disease showed clonal rearrangement of the immunoglobulin heavy and light chain genes, all other samples having germline immunoglobulin genes. The nature of the clonal population in the diseased tissue is uncertain, because the intensity of the rearranged bands did not correlate with the percentage of Reed-Sternberg cells present. The T cell receptor genes were in germline configuration in all the samples. CONCLUSIONS--Antigen receptor gene rearrangement is a rare finding in unselected cases of Hodgkin's disease. Images PMID:8388407

  3. Toll-Like Receptor 4 Is an Essential Upstream Regulator of On-Time Parturition and Perinatal Viability in Mice.

    PubMed

    Wahid, Hanan H; Dorian, Camilla L; Chin, Peck Yin; Hutchinson, Mark R; Rice, Kenner C; Olson, David M; Moldenhauer, Lachlan M; Robertson, Sarah A

    2015-10-01

    An inflammatory response is instrumental in the physiological process of parturition but the upstream signals initiating inflammation are undefined. Because endogenous ligands for Toll-like receptor 4 (TLR4) are released in late gestation, we hypothesized that on-time labor requires TLR4 signaling, to trigger a cytokine and leukocyte response and accelerate the parturition cascade. In pregnant TLR4-deficient (Tlr4-/-) mice, average gestation length was extended by 13 hours and increased perinatal mortality was seen compared with wild-type controls. Quantification of cytokine and uterine activation gene expression showed that late gestation induction of Il1b, Il6, Il12b, and Tnf expression seen in control placenta and fetal membranes was disrupted in Tlr4-/- mice, and accompanied by a transient delay in expression of uterine activation genes, including prostaglandin F receptor, oxytocin receptor, and connexin-43. Leukocyte populations were altered before birth in TLR4-deficient females, with fewer neutrophils and macrophages in the placenta, and fewer dendritic cells and more regulatory T cells in the myometrium. Administration of TLR4 ligand lipopolysaccharide to pregnant wild-type mice induced cytokine expression and fetal loss, whereas Tlr4-/- pregnancies were protected. The small molecule TLR4 antagonist (+)-naloxone increased mean duration of gestation by 16 hours in wild-type mice. Collectively, these data demonstrate that TLR4 is a key upstream regulator of the inflammatory response acting to drive uterine activation and control the timing of labor. Because causal pathways for term and preterm labor converge with TLR4, interventions to manipulate TLR4 signaling may have therapeutic utility for women at risk of preterm labor, or in postterm pregnancy.

  4. Histones from dying renal cells aggravate kidney injury via TLR2 and TLR4.

    PubMed

    Allam, Ramanjaneyulu; Scherbaum, Christina Rebecca; Darisipudi, Murthy Narayana; Mulay, Shrikant R; Hägele, Holger; Lichtnekert, Julia; Hagemann, Jan Henrik; Rupanagudi, Khader Valli; Ryu, Mi; Schwarzenberger, Claudia; Hohenstein, Bernd; Hugo, Christian; Uhl, Bernd; Reichel, Christoph A; Krombach, Fritz; Monestier, Marc; Liapis, Helen; Moreth, Kristin; Schaefer, Liliana; Anders, Hans-Joachim

    2012-08-01

    In AKI, dying renal cells release intracellular molecules that stimulate immune cells to secrete proinflammatory cytokines, which trigger leukocyte recruitment and renal inflammation. Whether the release of histones, specifically, from dying cells contributes to the inflammation of AKI is unknown. In this study, we found that dying tubular epithelial cells released histones into the extracellular space, which directly interacted with Toll-like receptor (TLR)-2 (TLR2) and TLR4 to induce MyD88, NF-κB, and mitogen activated protein kinase signaling. Extracellular histones also had directly toxic effects on renal endothelial cells and tubular epithelial cells in vitro. In addition, direct injection of histones into the renal arteries of mice demonstrated that histones induce leukocyte recruitment, microvascular vascular leakage, renal inflammation, and structural features of AKI in a TLR2/TLR4-dependent manner. Antihistone IgG, which neutralizes the immunostimulatory effects of histones, suppressed intrarenal inflammation, neutrophil infiltration, and tubular cell necrosis and improved excretory renal function. In summary, the release of histones from dying cells aggravates AKI via both its direct toxicity to renal cells and its proinflammatory effects. Because the induction of proinflammatory cytokines in dendritic cells requires TLR2 and TLR4, these results support the concept that renal damage triggers an innate immune response, which contributes to the pathogenesis of AKI.

  5. Comprehensive siRNA-based screening of human and mouse TLR pathways identifies species-specific preferences in signaling protein use

    PubMed Central

    Sun, Jing; Li, Ning; Oh, Kyu-Seon; Dutta, Bhaskar; Vayttaden, Sharat J.; Lin, Bin; Ebert, Thomas S.; De Nardo, Dominic; Davis, Joie; Bagirzadeh, Rustam; Lounsbury, Nicolas W.; Pasare, Chandrashekhar; Latz, Eicke; Hornung, Veit; Fraser, Iain D. C.

    2017-01-01

    Toll-like receptors (TLRs) are a major class of pattern recognition receptors, which mediate the response of innate immune cells to microbial stimuli. To systematically determine the roles of gene products in canonical TLR signaling pathways, we conducted an RNA interference (RNAi)-based screen in human and mouse macrophages. We observed a pattern of conserved signaling module dependencies across species, but found notable species-specific requirements at the level of individual gene products. Among these, we identified unexpected differences in interleukin 1 receptor-associated kinase (IRAK) protein use between the human and mouse TLR pathways. Whereas TLR signaling in mouse macrophages depended primarily on IRAK4 and IRAK2, with little or no role for IRAK1, TLR signaling and proinflammatory cytokine production in human macrophages were highly dependent on IRAK1 and were less affected by perturbations of IRAK4 or IRAK2. The differential sensitivity of human and mouse cells to the loss of IRAK4 was reflected in the inability of the IRAK4 orthologs to rescue signaling in IRAK4-deficient macrophages from the other species, and in a mouse-specific requirement for the kinase activity of IRAK4 in TLR responses in macrophages. Our study also identified a critical role for IRAK1 in TLR signaling in humans, which could potentially explain the association of IRAK1 with several autoimmune diseases. Furthermore, we demonstrated how systematic screening can be used to identify important characteristics of innate immune responses across species and more optimal therapeutic targets for regulating human TLR-dependent outputs. PMID:26732763

  6. The androgen receptor gene mutations database.

    PubMed

    Gottlieb, B; Trifiro, M; Lumbroso, R; Vasiliou, D M; Pinsky, L

    1996-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. We have added (if available) data on the androgen binding phenotype of the mutant AR, the clinical phenotype of the affected persons, the family history and whether the pathogenicity of a mutation has been proven. Exonic mutations are now listed in 5'-->3' sequence regardless of type and single base pair changes are presented in codon context. Splice site and intronic mutations are listed separately. The database has allowed us to substantiate and amplify the observation of mutational hot spots within exons encoding the AR androgen binding domain. The database is available from EML (ftp://www.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker file (MC33@musica.mcgill.ca).

  7. The androgen receptor gene mutations database.

    PubMed

    Gottlieb, B; Trifiro, M; Lumbroso, R; Pinsky, L

    1997-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 212 to 272. We have expanded the database: (i) by adding a large amount of new data on somatic mutations in prostatic cancer tissue; (ii) by defining a new constitutional phenotype, mild androgen insensitivity (MAI); (iii) by placing additional relevant information on an internet site (http://www.mcgill.ca/androgendb/ ). The database has allowed us to examine the contribution of CpG sites to the multiplicity of reports of the same mutation in different families. The database is also available from EMBL (ftp.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker Pro or Word file (MC33@musica,mcgill.ca)

  8. Bioinformatics analysis of the structural and evolutionary characteristics for toll-like receptor 15

    PubMed Central

    Wang, Jinlan; Chang, Fen

    2016-01-01

    Toll-like receptors (TLRs) play important role in the innate immune system. TLR15 is reported to have a unique role in defense against pathogens, but its structural and evolution characterizations are still poorly understood. In this study, we identified 57 completed TLR15 genes from avian and reptilian genomes. TLR15 clustered into an individual clade and was closely related to family 1 on the phylogenetic tree. Unlike the TLRs in family 1 with the broken asparagine ladders in the middle, TLR15 ectodomain had an intact asparagine ladder that is critical to maintain the overall shape of ectodomain. The conservation analysis found that TLR15 ectodomain had a highly evolutionarily conserved region on the convex surface of LRR11 module, which is probably involved in TLR15 activation process. Furthermore, the protein–protein docking analysis indicated that TLR15 TIR domains have the potential to form homodimers, the predicted interaction interface of TIR dimer was formed mainly by residues from the BB-loops and αC-helixes. Although TLR15 mainly underwent purifying selection, we detected 27 sites under positive selection for TLR15, 24 of which are located on its ectodomain. Our observations suggest the structural features of TLR15 which may be relevant to its function, but which requires further experimental validation. PMID:27257554

  9. TLR2 and TLR4 mediated host immune responses in major infectious diseases: a review.

    PubMed

    Mukherjee, Suprabhat; Karmakar, Subhajit; Babu, Santi Prasad Sinha

    2016-01-01

    During the course of evolution, multicellular organisms have been orchestrated with an efficient and versatile immune system to counteract diverse group of pathogenic organisms. Pathogen recognition is considered as the most critical step behind eliciting adequate immune response during an infection. Hitherto Toll-like receptors (TLRs), especially the surface ones viz. TLR2 and TLR4 have gained immense importance due to their extreme ability of identifying distinct molecular patterns from invading pathogens. These pattern recognition receptors (PRRs) not only act as innate sensor but also shape and bridge innate and adaptive immune responses. In addition, they also play a pivotal role in regulating the balance between Th1 and Th2 type of response essential for the survivability of the host. In this work, major achievements rather findings made on the typical signalling and immunopathological attributes of TLR2 and TLR4 mediated host response against the major infectious diseases have been reviewed. Infectious diseases like tuberculosis, trypanosomiasis, malaria, and filariasis are still posing myriad threat to mankind. Furthermore, increasing resistance of the causative organisms against available therapeutics is also an emerging problem. Thus, stimulation of host immune response with TLR2 and TLR4 agonist can be the option of choice to treat such diseases in future.

  10. DNA-Encoded Flagellin Activates Toll-Like Receptor 5 (TLR5), Nod-like Receptor Family CARD Domain-Containing Protein 4 (NRLC4), and Acts as an Epidermal, Systemic, and Mucosal-Adjuvant

    PubMed Central

    Nyström, Sanna; Bråve, Andreas; Falkeborn, Tina; Devito, Claudia; Rissiek, Björn; Johansson, Daniel X.; Schröder, Ulf; Uematsu, Satoshi; Akira, Shizuo; Hinkula, Jorma; Applequist, Steven E.

    2013-01-01

    Eliciting effective immune responses using non-living/replicating DNA vaccines is a significant challenge. We have previously shown that ballistic dermal plasmid DNA-encoded flagellin (FliC) promotes humoral as well as cellular immunity to co-delivered antigens. Here, we observe that a plasmid encoding secreted FliC (pFliC(-gly)) produces flagellin capable of activating two innate immune receptors known to detect flagellin; Toll-like Receptor 5 (TLR5) and Nod-like Receptor family CARD domain-containing protein 4 (NRLC4). To test the ability of pFliC(-gly) to act as an adjuvant we immunized mice with plasmid encoding secreted FliC (pFliC(-gly)) and plasmid encoding a model antigen (ovalbumin) by three different immunization routes representative of dermal, systemic, and mucosal tissues. By all three routes we observed increases in antigen-specific antibodies in serum as well as MHC Class I-dependent cellular immune responses when pFliC(-gly) adjuvant was added. Additionally, we were able to induce mucosal antibody responses and Class II-dependent cellular immune responses after mucosal vaccination with pFliC(-gly). Humoral immune responses elicited by heterologus prime-boost immunization with a plasmid encoding HIV-1 from gp160 followed by protein boosting could be enhanced by use of pFliC(-gly). We also observed enhancement of cross-clade reactive IgA as well as a broadening of B cell epitope reactivity. These observations indicate that plasmid-encoded secreted flagellin can activate multiple innate immune responses and function as an adjuvant to non-living/replicating DNA immunizations. Moreover, the capacity to elicit mucosal immune responses, in addition to dermal and systemic properties, demonstrates the potential of flagellin to be used with vaccines designed to be delivered by various routes. PMID:26344341

  11. TLR2 and TLR4 in autoimmune diseases: a comprehensive review.

    PubMed

    Liu, Yu; Yin, Heng; Zhao, Ming; Lu, Qianjin

    2014-10-01

    Autoimmune diseases are immune disorders characterized by T cell hyperactivity and B cell overstimulation leading to overproduction of autoantibodies. Although the pathogenesis of various autoimmune diseases remains to be elucidated, environmental factors have been thought to contribute to the initiation and maintenance of auto-respond inflammation. Toll-like receptors (TLRs) are pattern recognition receptors belonging to innate immunity that recognize and defend invading microorganisms. Besides these exogenous pathogen-associated molecular patterns, TLRs can also bind with damage-associated molecular patterns produced under strike or by tissue damage or cells apoptosis. It is believed that TLRs build a bridge between innate immunity and autoimmunity. There are five adaptors to TLRs including MyD88, TRIF, TIRAP/MAL, TRAM, and SARM. Upon activation, TLRs recruit specific adaptors to initiate the downstream signaling pathways leading to the production of inflammatory cytokines and chemokines. Under certain circumstances, ligation of TLRs drives to aberrant activation and unrestricted inflammatory responses, thereby contributing to the perpetuation of inflammation in autoimmune diseases. In the past, most studies focused on the intracellular TLRs, such as TLR3, TLR7, and TLR9, but recent studies reveal that cell surface TLRs, especially TLR2 and TLR4, also play an essential role in the development of autoimmune diseases and afford multiple therapeutic targets. In this review, we summarized the biological characteristics, signaling mechanisms of TLR2/4, the negative regulators of TLR2/4 pathway, and the pivotal function of TLR2/4 in the pathogenesis of autoimmune diseases including rheumatoid arthritis, systemic lupus erythematosus, systemic sclerosis, Sjogren's syndrome, psoriasis, multiple sclerosis, and autoimmune diabetes.

  12. Origin of Toll-like receptor-mediated innate immunity.

    PubMed

    Kanzok, Stefan M; Hoa, Ngo T; Bonizzoni, Mariangela; Luna, Coralia; Huang, Yaming; Malacrida, Anna R; Zheng, Liangbiao

    2004-04-01

    Toll-related receptors (TLR) have been found in four animal phyla: Nematoda, Arthropoda, Echinodermata, and Chordata. No TLR has been identified thus far in acoelomates. TLR genes play a pivotal role in the innate immunity in both fruit fly and mammals. The prevailing view is that TLR-mediated immunity is ancient. The two pseudocoelomate TLRs, one each from Caenorhabditis elegans and Strongyloides stercoralis, were distinct from the coelomate ones. Further, the only TLR gene (Tol-1) in Ca. elegans did not appear to play a role in innate immunity. We argue that TLR-mediated innate immunity developed only in the coelomates, after they split from pseudocoelomates and acoelomates. We hypothesize that the function of TLR-mediated immunity is to prevent microbial infection in the body cavity present only in the coelomates. Phylogenetic analysis showed that almost all arthropod TLRs form a separate cluster from the mammalian counterparts. We further hypothesize that TLR-mediated immunity developed independently in the protostomia and deuterostomia coelomates.

  13. Pathogenic strains of Acanthamoeba are recognized by TLR4 and initiated inflammatory responses in the cornea.

    PubMed

    Alizadeh, Hassan; Tripathi, Trivendra; Abdi, Mahshid; Smith, Ashley Dawn

    2014-01-01

    Free-living amoebae of the Acanthamoeba species are the causative agent of Acanthamoeba keratitis (AK), a sight-threatening corneal infection that causes severe pain and a characteristic ring-shaped corneal infiltrate. Innate immune responses play an important role in resistance against AK. The aim of this study is to determine if Toll-like receptors (TLRs) on corneal epithelial cells are activated by Acanthamoeba, leading to initiation of inflammatory responses in the cornea. Human corneal epithelial (HCE) cells constitutively expressed TLR1, TLR2, TLR3, TLR4, and TLR9 mRNA, and A. castellanii upregulated TLR4 transcription. Expression of TLR1, TLR2, TLR3, and TLR9 was unchanged when HCE cells were exposed to A. castellanii. IL-8 mRNA expression was upregulated in HCE cells exposed to A. castellanii. A. castellanii and lipopolysaccharide (LPS) induced significant IL-8 production by HCE cells as measured by ELISA. The percentage of total cells positive for TLR4 was higher in A. castellanii stimulated HCE cells compared to unstimulated HCE cells. A. castellanii induced upregulation of IL-8 in TLR4 expressing human embryonic kidney (HEK)-293 cells, but not TLR3 expressing HEK-293 cells. TLR4 neutralizing antibody inhibited A. castellanii-induced IL-8 by HCE and HEK-293 cells. Clinical strains but not soil strains of Acanthamoeba activated TLR4 expression in Chinese hamster corneas in vivo and in vitro. Clinical isolates but not soil isolates of Acanthamoeba induced significant (P< 0.05) CXCL2 production in Chinese hamster corneas 3 and 7 days after infection, which coincided with increased inflammatory cells in the corneas. Results suggest that pathogenic species of Acanthamoeba activate TLR4 and induce production of CXCL2 in the Chinese hamster model of AK. TLR4 may be a potential target in the development of novel treatment strategies in Acanthamoeba and other microbial infections that activate TLR4 in corneal cells.

  14. Altered molecular expression of the TLR4/NF-κB signaling pathway in mammary tissue of Chinese Holstein cattle with mastitis.

    PubMed

    Wu, Jie; Li, Lian; Sun, Yu; Huang, Shuai; Tang, Juan; Yu, Pan; Wang, Genlin

    2015-01-01

    Toll-like receptor 4 (TLR4) mediated activation of the nuclear transcription factor κB (NF-κB) signaling pathway by mastitis initiates expression of genes associated with inflammation and the innate immune response. In this study, the profile of mastitis-induced differential gene expression in the mammary tissue of Chinese Holstein cattle was investigated by Gene-Chip microarray and bioinformatics. The microarray results revealed that 79 genes associated with the TLR4/NF-κB signaling pathway were differentially expressed. Of these genes, 19 were up-regulated and 29 were down-regulated in mastitis tissue compared to normal, healthy tissue. Statistical analysis of transcript and protein level expression changes indicated that 10 genes, namely TLR4, MyD88, IL-6, and IL-10, were up-regulated, while, CD14, TNF-α, MD-2, IL-β, NF-κB, and IL-12 were significantly down-regulated in mastitis tissue in comparison with normal tissue. Analyses using bioinformatics database resources, such as the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis and the Gene Ontology Consortium (GO) for term enrichment analysis, suggested that these differently expressed genes implicate different regulatory pathways for immune function in the mammary gland. In conclusion, our study provides new evidence for better understanding the differential expression and mechanisms of the TLR4 /NF-κB signaling pathway in Chinese Holstein cattle with mastitis.

  15. Histone deacetylase inhibitors decrease Toll-like receptor-mediated activation of proinflammatory gene expression by impairing transcription factor recruitment

    PubMed Central

    Bode, Konrad A; Schroder, Kate; Hume, David A; Ravasi, Timothy; Heeg, Klaus; Sweet, Matthew J; Dalpke, Alexander H

    2007-01-01

    Post-translational modifications of histone proteins are major mechanisms that modify chromatin structure and regulate gene expression in eukaryotes. Activation of histone acetyltransferases or inhibition of histone deacetylases (HDACs) is generally believed to allow chromatin to assume a more open state, permitting transcriptional activity. We report here the surprising observation that treatment of murine dendritic cells with the HDAC inhibitors trichostatin A (TSA) or suberoylanilide hydroxamic acid (SAHA) in non-apoptotic concentrations strongly inhibited induction of both interleukin-12 protein p40 (IL-12p40) mRNA and protein upon stimulation of Toll-like receptors (TLRs). Moreover, TLR-mediated up-regulation of costimulatory molecules was also inhibited. Up-regulation of tumour necrosis factor-α mRNA and protein in response to TLR agonists was only affected upon prolonged exposure to HDAC inhibitors and regulation of IL-1β was not affected. Similar effects were apparent in murine and human macrophages. Regarding the mode of action, HDAC inhibition increased the acetylation status at the IL-12p40 locus. Nevertheless, IL-12p40 chromatin remodelling, binding of Rel-A and IRF1 to the IL-12p40 promoter and transcriptional activation were abrogated. In contrast, HDAC inhibitors had no effects on upstream nuclear factor-κB and mitogen-activated protein kinase activation. Thus HDACs positively regulate the expression of a subset of cytokine genes by enabling transcription factor recruitment. PMID:17635610

  16. Saturated fatty acids trigger TLR4-mediated inflammatory response.

    PubMed

    Rocha, D M; Caldas, A P; Oliveira, L L; Bressan, J; Hermsdorff, H H

    2016-01-01

    Toll-like receptors (TLR) mediate infection-induced inflammation and sterile inflammation by endogenous molecules. Among the TLR family, TLR4 is the best understood. However, while its downstream signaling pathways have been well defined, not all ligands of TLR4 are currently known. Current evidence suggests that saturated fatty acids (SFA) act as non-microbial TLR4 agonists, and trigger its inflammatory response. Thus, our present review provides a new perspective on the potential mechanism by which SFAs could modulate TLR4-induced inflammatory responses: (1) SFAs can be recognized by CD14-TLR4-MD2 complex and trigger inflammatory pathways, similar to lipopolysaccharide (LPS). (2) SFAs lead to modification of gut microbiota with an overproduction of LPS after a high-fat intake, enhancing this natural TLR4 ligand. (3) In addition, this metabolic endotoxemia leads to an oxidative stress thereby producing atherogenic lipids - oxLDL and oxidized phospholipids - which trigger CD36-TLR4-TLR6 inflammatory response. (4) Also, the high SFA consumption increases the lipemia and the mmLDL and oxLDL formation through oxidative modifications of LDL. The mmLDL, unlike oxLDL, is involved in activation of the CD14-TLR4-MD2 inflammatory pathway. Those molecules can induce TLR4 inflammatory response by MyD88-dependent and/or MyD88-independent pathways that, in turn, promotes the expression of proinflammatory transcript factors such as factor nuclear kappa B (NF-κB), which plays a crucial role in the induction of inflammatory mediators (cytokines, chemokines, or costimulatory molecules) implicated in the development and progression of many chronic diseases.

  17. Evaluation of TLR2 and 4 in Chronic Periodontitis

    PubMed Central

    Mahalingam, Arulpari; Parthasarathy, Harinath; Katamreddy, Vineela; Subbareddy, Venkat

    2016-01-01

    Introduction Periodontal disease is the major cause of adult tooth loss and is commonly characterized by a chronic inflammation caused by infection due to oral bacteria. Members of Toll-Like Receptor (TLR) family recognize conserved microbial structures, such as bacterial lipopolysaccharides and activate signalling pathways that result in immune responses against microbial infections. Aim The aim of the present study was to assess the mRNA expression of Toll-Like Receptor 2 and 4 in tissues with or without chronic periodontitis. Materials and Methods Gingival tissue samples were collected from controls (30 subjects with healthy periodontal tissues) and experimental group (30 subjects with chronic periodontitis). Total RNA was extracted and RT-PCR was done for evaluation of TLR-2 and TLR-4. Mann Whitney U-test, Pearson Chi-square Test was used for statistics. Results The results showed that there is a significant (p-value= 0.004) association between TLR-4 and the experimental group comprising of chronic periodontitis patients in comparison to the insignificant (p-value= 0.085) TLR-2 expression. Conclusion This study concludes that TLR-2 and TLR-4 expressed in the gingival tissues recognize different bacterial cell wall components thus helping us to associate its potential in diagnosing periodontal disease. Hence, in the future, these scientific findings can pave the way in using TLR as a diagnostic biomarker for periodontal disease. PMID:27504418

  18. SARM1, not MyD88, mediates TLR7/TLR9-induced apoptosis in neurons1

    PubMed Central

    Mukherjee, Piyali; Winkler, Clayton W.; Taylor, Katherine G.; Woods, Tyson A.; Nair, Vinod; Khan, Burhan A.; Peterson, Karin E.

    2015-01-01

    Neuronal apoptosis is a key aspect of many different neurological diseases, but the mechanisms remain unresolved. Recent studies have suggested a mechanism of innate immune-induced neuronal apoptosis that may act through the stimulation of toll-like receptors (TLR) in neurons. TLRs are stimulated both by pathogen associated molecular patterns (PAMPs) as well as by damage-associated molecular patterns (DAMPs), including micro-RNAs released by damaged neurons. In the current study, we identified the mechanism responsible for TLR7/TLR9-mediated neuronal apoptosis. TLR-induced apoptosis required endosomal localization of TLRs but was independent of MyD88 signaling. Instead, apoptosis required the TLR adaptor molecule, sterile alpha armadillo motif (SARM1), which localized to the mitochondria following TLR activation and was associated with mitochondrial accumulation in neurites. Deficiency in SARM1 inhibited both mitochondrial accumulation in neurites and TLR-induced apoptosis. These studies identify a non-MyD88 pathway of TLR7/TLR9 signaling in neurons and provide a mechanism for how innate immune responses in the CNS directly induce neuronal damage. PMID:26423149

  19. Decreased expression of TLR7 in gastric cancer tissues and the effects of TLR7 activation on gastric cancer cells

    PubMed Central

    JIANG, JIONG; DONG, LEI; QIN, BIN; SHI, HAITAO; GUO, XIAOYAN; WANG, YAN

    2016-01-01

    The present study aimed to determine the expression of Toll-like receptor 7 (TLR7) in gastric cancer tissues and investigate the effects of its activation on gastric cancer cells. Patients with gastric cancer (n=30) and patients without gastric cancer (control; n=14) who underwent gastroscopy were enrolled in the study. Gastric cancer and cancer-adjacent tissues were obtained from the patients with gastric cancer, and normal gastric epithelial tissues were obtained from the control patients. The TLR7 mRNA and protein expressions in different tissues were investigated by reverse transcription-quantitative polymerase chain reaction, western blotting and immunohistochemistry. The present study also determined the effects of TLR7 activation by the agonist imiquimod on TLR7 protein expression, proinflammatory cytokine secretion and viability in SGC-7901 gastric cancer cells. The mRNA and protein expression levels of TLR7 were significantly downregulated in gastric cancer tissues compared with cancer-adjacent and normal gastric epithelial tissues (P<0.01). Imiquimod significantly increased TLR7 protein expression levels, and promoted the secretion of proinflammatory cytokines tumor necrosis factor-α and interleukin-6 in SGC-7901 cells. Furthermore, imiquimod inhibited the proliferation of SGC-7901 cells in a dose- and time-dependent manner. Thus, the present study identified that the expression of TLR7 was decreased in gastric cancer tissues, and TLR7 activation enhanced TLR7 expression, promoted the production of proinflammatory cytokines and inhibited the growth of gastric cancer cells. PMID:27347192

  20. Hypertensive rats are susceptible to TLR4-mediated signaling following exposure to combustion source particulate matter.

    PubMed

    Gilmour, Peter S; Schladweiler, Mette C; Richards, Judy H; Ledbetter, Allen D; Kodavanti, Urmila P

    2004-01-01

    Toll-like receptor 4 (TLR4) has been shown to play a role in cell signaling that results in neutrophilic inflammation in response to lipopolysaccharide and respiratory syncytial virus infection. TLR4 also interacts with CD14, which upon complex formation triggers TLR4-associated signaling pathways to produce a proinflammatory response. This mechanism results in the activation of NF-kappa B and subsequent inflammatory gene induction. In order to determine the effect of combustion source particle matter (PM), rich in zinc and nickel but with negligible endotoxin, on a possible activation of TLR4-mediated cell signaling and inflammation, we intratracheally (IT) instilled 3.3 mg/kg of PM into 12-w-old healthy male Wistar Kyoto (WKY) and susceptible spontaneously hypertensive (SH) rats. Inflammation, inflammatory-mediator gene expression, bronchoalveolar lavage fluid (BALF) protein and LDH, TLR4 and CD14 protein, and NF-kappa B activation in the lung were determined after 24 h. Dose-response data (0.0, 0.83, 3.33, and 8.3 mg/kg PM) for BALF LDH were obtained as a marker of lung cell injury in SH rats. BALF neutrophils, but not macrophages, were significantly increased in the PM-exposed WKY and SH rats. SH rats showed a greater PMN increase than WKY rats. Similarly, BALF protein and LDH levels were also increased following PM exposure but to a significantly greater extent in SH rats. Plasma fibrinogen was increased only in SH rats exposed to PM. The increased inflammation seen in PM-exposed SH rats was accompanied by a significant increase in TLR4 protein in the lung tissue, which was primarily localized in alveolar macrophages and epithelial cells. CD14 was also increased by PM exposure in both SH and WKY rats but was significantly greater in the SH rats. These increases were associated with greater translocation of NF-kappa B in the lungs of SH rather than WKY rats. This was accompanied by increased macrophage inhibitory protein (MIP)-2 mRNA expression at 24 h of

  1. Downregulation of IL7R, CCR7, and TLR4 in the cord blood of children with respiratory syncytial virus disease.

    PubMed

    Inchley, Christopher S; Osterholt, Helene C D; Sonerud, Tonje; Fjærli, Hans O; Nakstad, Britt

    2013-11-01

    The association between gene expression at birth of 11 candidate genes with important innate and adaptive immune functions and later respiratory syncytial virus (RSV) disease was investigated. Cord blood was collected from 2108 newborns. Forty-seven were subsequently RSV positive. Gene expression analysis by quantitative reverse transcription-polymerase chain reaction was compared to 17 controls. There was downregulation of interleukin 7 receptor (IL7R) (P = .0001) and chemokine receptor 7 (CCR7) (P = .002), and in the severe disease subcategory, downregulation of Toll-like receptor 4 (TLR4) (P = .003). IL7R and CCR7 facilitate communication between adaptive and innate immune systems. TLR4 activates the innate immune system on RSV exposure. Delayed innate and adaptive immune activation may predispose children to more severe RSV disease.

  2. Cardioprotective effect of metformin in lipopolysaccharide-induced sepsis via suppression of toll-like receptor 4 (TLR4) in heart.

    PubMed

    Vaez, Haleh; Rameshrad, Maryam; Najafi, Moslem; Barar, Jaleh; Barzegari, Abolfazl; Garjani, Alireza

    2016-02-05

    Sepsis-induced myocardial dysfunction is a serious organ complication. In the present study, we investigated the effect of metformin on myocardial dysfunction and TLR4 activity in LPS-induced sepsis. Male Wistar rats were randomly divided into 3 groups (n=6): control received normal saline (0.5ml), LPS group received lipopolysaccharide (0.5mg/kg; i.p), and metformin treated group received LPS (0.5mg/kg)+metformin (100mg/kg; i.p). 9h later the hemodynamic parameters were recorded, blood samples were collected, and the hearts were removed and weighted. The concentration of TNF-α, content of MYD88, the phosphorylation of AMPK, and the rate of TLR4 expression in the heart were assessed. In the animals treated with metformin, the preservation of left ventricular function was associated with the reduction of myeloperoxidase activity (31%, P<0.01) in the heart and decrease of TNF-α level both in the serum and heart tissue (20%, P<0.01 and 42%, P<0.05, respectively). It was found that the level of phosphorylated AMPK in heart was significantly upregulated by 43% (P<0.001) in the metformin group while the content of TLRs adapter protein of MyD88 was reduced by 45% (P<0.05). This was associated with a remarkable decrease in the expression of myocardial TLR4. Furthermore, in a mice model of sepsis, coadministration of compound C (20mg/kg) as an AMPK inhibitor reversed the suppressive effects of metformin on TLR4 expression and MYD88 protein level. These results suggest that metformin exhibits cardioprotective effects in sepsis by suppression of TLR4 activity, at least in part through pathways involving AMPK activation.

  3. Lignin-rich Enzyme Lignin (LREL), a Cellulase-treated Lignin-Carbohydrate Derived from Plants, Activates Myeloid Dendritic Cells via Toll-like Receptor 4 (TLR4)

    PubMed Central

    Tsuji, Ryohei; Koizumi, Hideki; Aoki, Dan; Watanabe, Yuta; Sugihara, Yoshihiko; Matsushita, Yasuyuki; Fukushima, Kazuhiko; Fujiwara, Daisuke

    2015-01-01

    Lignin-carbohydrates, one of the major cell wall components, are believed to be the structures that form chemical linkage between lignin and cell wall polysaccharides. Due to the molecular complexity of lignin-containing substances, their isolation and the assignment of their biological activities have so far remained a difficult task. Here, we extracted two lignin-containing carbohydrates, lignin-rich enzyme lignin (LREL) and pure enzyme lignin (PEL), from barley husk and demonstrated that they act as immune stimulators of dendritic cells (DCs), which are particularly important in linking innate and adaptive immunity. Thioacidolysis, acid hydrolysis, and mild alkali hydrolysis of both LREL and PEL revealed that their immunostimulatory activities depended on the lignin structure and/or content, neutral sugar content (especially the characteristic distribution of galactose and mannose), and presence of an ester bond. Furthermore, we showed that the immunostimulatory potency of the lignin-carbohydrate depended on its molecular weight and degree of polymerization. We also demonstrated that the LREL-induced activation of DCs was mediated via TLR4. Thus, LREL-induced increases in the expression levels of several cell surface marker proteins, production of inflammatory cytokines IL-12p40 and TNF-α, and activation and nuclear translocation of transcription factors, as was observed in the WT DCs, were completely abrogated in DCs derived from the TLR4−/− mice but not in DCs derived from the TLR2−/−, TLR7−/−, and TLR9−/− mice. We further demonstrated that LRELs isolated from other plant tissues also activated DCs. These immunostimulatory activities of lignin-carbohydrates, extracted from edible plant tissues, could have potential relevance in anti-infectious immunity and vaccine adjuvants. PMID:25548274

  4. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    NASA Astrophysics Data System (ADS)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

    1986-04-01

    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  5. Toll-like receptor genes (TLRs) from Capitella capitata and Helobdella robusta (Annelida).

    PubMed

    Davidson, Charis R; Best, Natalie M; Francis, Joseph W; Cooper, Edwin L; Wood, Todd Charles

    2008-01-01

    Toll-like receptors (TLRs) are an important part of the innate immunity system and are found throughout the animal kingdom, but have not yet been reported in annelids. We searched shotgun reads of the genomes of the leech Helobdella and polychaete Capitella for TLR homologs. We found 105 TLR homologs in Capitella and 16 in Helobdella. The deduced phylogeny of these sequences, together with TLRs from other animal phyla, reveals three major clades. One clade consists of a mixture of both vertebrates and invertebrates, including sequences from Capitella and Helobdella, while the other two clades contain only invertebrate TLRs.

  6. Molecular cloning and functional analysis of duck Toll-like receptor 5.

    PubMed

    Xiong, Dan; Pan, Zhiming; Kang, Xilong; Wang, Jing; Song, Li; Jiao, Xinan

    2014-08-01

    Toll-like receptor 5 (TLR5) is responsible for the recognition of bacterial flagellin in vertebrates. In this study, we cloned the single-exon TLR5 gene of the Maya breed of Common Shelduck (Tadorna tadorna). The TLR5 open reading frame is 2580 bp in length and encodes an 859-amino acid protein. The putative amino acid sequence of duck TLR5 consisted of a signal peptide sequence, 11 leucine-rich repeat domains, a leucine-rich repeat C-terminal domain, a transmembrane domain, and an intracellular Toll-interleukin-1 receptor domain. The duck TLR5 gene was highly expressed in the lung, bone marrow, spleen, and liver; moderately expressed in kidney, small intestine, large intestine, and brain. A plasmid expressing duck TLR5 was constructed and transfected into HEK293T cells, and expression was confirmed by indirect immunofluorescence assay. HEK293T cells transfected with duck TLR5- and NF-κB-luciferase-containing plasmids significantly responded to flagellin from Salmonella typhimurium, indicating that it is a functional TLR5 homolog.

  7. Malaria primes the innate immune response due to interferon-gamma induced enhancement of toll-like receptor expression and function.

    PubMed

    Franklin, Bernardo S; Parroche, Peggy; Ataíde, Marco Antonio; Lauw, Fanny; Ropert, Catherine; de Oliveira, Rosane B; Pereira, Dhelio; Tada, Mauro Shugiro; Nogueira, Paulo; da Silva, Luiz Hildebrando Pereira; Bjorkbacka, Harry; Golenbock, Douglas T; Gazzinelli, Ricardo T

    2009-04-07

    Malaria-induced sepsis is associated with an intense proinflammatory cytokinemia for which the underlying mechanisms are poorly understood. It has been demonstrated that experimental infection of humans with Plasmodium falciparum primes Toll-like receptor (TLR)-mediated proinflammatory responses. Nevertheless, the relevance of this phenomenon during natural infection and, more importantly, the mechanisms by which malaria mediates TLR hyperresponsiveness are unclear. Here we show that TLR responses are boosted in febrile patients during natural infection with P. falciparum. Microarray analyses demonstrated that an extraordinary percentage of the up-regulated genes, including genes involving TLR signaling, had sites for IFN-inducible transcription factors. To further define the mechanism involved in malaria-mediated "priming," we infected mice with Plasmodium chabaudi. The human data were remarkably predictive of what we observed in the rodent malaria model. Malaria-induced priming of TLR responses correlated with increased expression of TLR mRNA in a TLR9-, MyD88-, and IFNgamma-dependent manner. Acutely infected WT mice were highly susceptible to LPS-induced lethality while TLR9(-/-), IL12(-/-) and to a greater extent, IFNgamma(-/-) mice were protected. Our data provide unprecedented evidence that TLR9 and MyD88 are essential to initiate IL12 and IFNgamma responses and favor host hyperresponsiveness to TLR agonists resulting in overproduction of proinflammatory cytokines and the sepsis-like symptoms of acute malaria.

  8. Regulation of cytochrome P450 (CYP) genes by nuclear receptors.

    PubMed Central

    Honkakoski, P; Negishi, M

    2000-01-01

    Members of the nuclear-receptor superfamily mediate crucial physiological functions by regulating the synthesis of their target genes. Nuclear receptors are usually activated by ligand binding. Cytochrome P450 (CYP) isoforms often catalyse both formation and degradation of these ligands. CYPs also metabolize many exogenous compounds, some of which may act as activators of nuclear receptors and disruptors of endocrine and cellular homoeostasis. This review summarizes recent findings that indicate that major classes of CYP genes are selectively regulated by certain ligand-activated nuclear receptors, thus creating tightly controlled networks. PMID:10749660

  9. Multigenic control of measles vaccine immunity mediated by polymorphisms in measles receptor, innate pathway, and cytokine genes.

    PubMed

    Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; O'Byrne, Megan M; Jacobson, Robert M; Pankratz, V Shane; Poland, Gregory A

    2012-03-09

    Measles infection and vaccine response are complex biological processes that involve both viral and host genetic factors. We have previously investigated the influence of genetic polymorphisms on vaccine immune response, including measles vaccines, and have shown that polymorphisms in HLA, cytokine, cytokine receptor, and innate immune response genes are associated with variation in vaccine response but do not account for all of the inter-individual variance seen in vaccinated populations. In the current study we report the findings of a multigenic analysis of measles vaccine immunity, indicating a role for the measles virus receptor CD46, innate pattern-recognition receptors (DDX58, TLR2, 4, 5, 7 and 8) and intracellular signaling intermediates (MAP3K7, NFKBIA), and key antiviral molecules (VISA, OAS2, MX1, PKR) as well as cytokines (IFNA1, IL4, IL6, IL8, IL12B) and cytokine receptor genes (IL2RB, IL6R, IL8RA) in the genetic control of both humoral and cellular immune responses. This multivariate approach provided additional insights into the genetic control of measles vaccine responses over and above the information gained by our previous univariate SNP association analyses.

  10. TLR4 Promotes Breast Cancer Metastasis via Akt/GSK3β/β-Catenin Pathway upon LPS Stimulation.

    PubMed

    Li, Jun; Yin, Jing; Shen, Wenzhi; Gao, Ruifang; Liu, Yanhua; Chen, Yanan; Li, Xiru; Liu, Chenghu; Xiang, Rong; Luo, Na

    2017-03-14

    Bacteria/virus-induced chronic inflammation is involved in both tumor initiation and tumor progression. Toll-like receptor 4 (TLR4) has been implicated in the development of several types of cancer. In this study, we explored the impact of TLR4 activation by lipopolysaccharide (LPS) on breast cancer metastasis and associated signaling molecules. We first examined TLR4 expression levels in breast tissue using a human breast tissue microarray and breast cell lines. We then studied the role of TLR4 activation by LPS stimulation in breast cancer metastasis using both in vitro and in vivo models. Finally, we investigated signaling molecules involved in the process using Western blotting and fluorescent immunohistochemistry staining. The results showed that TLR4 expression levels increased in breast cancer tissue compared to normal breast tissue. In addition, our results also showed that TLR4 pathway activation by LPS stimulation in MCF7 and MDA-MB-231 breast cancer cells caused the following actions: (1) promotes migration of breast cancer cells, (2) triggers the β-catenin signaling pathway via PI3K/Akt/GSK3β, and (3) promotes transcription of downstream β-catenin target genes leading to breast cancer metastasis. This study substantiates and further extends the relationship between TLR4 activation by LPS and breast cancer using both in vitro and in vivo models. The results suggest that the Akt/GSK3β/β-catenin signal transduction pathway may serve as a viable clinical treatment target in breast cancer. Anat Rec, 2017. © 2017 Wiley Periodicals, Inc.

  11. Dopamine receptor genes: new tools for molecular psychiatry.

    PubMed Central

    Niznik, H B; Van Tol, H H

    1992-01-01

    For over a decade it has been generally assumed that all the pharmacological and biochemical actions of dopamine within the central nervous system and periphery were mediated by two distinct dopamine receptors. These receptors, termed D1 and D2, were defined as those coupled to the stimulation or inhibition of adenylate cyclase, respectively, and by their selectivity and avidity for various drugs and compounds. The concept that two dopamine receptors were sufficient to account for all the effects mediated by dopamine was an oversimplification. Recent molecular biological studies have identified five distinct genes which encode at least eight functional dopamine receptors. The members of the expanded dopamine receptor family, however, can still be codifed by way of the original D1 and D2 receptor dichotomy. These include two genes encoding dopamine D1-like receptors (D1 [D1A]/D5 [D1B]) and three genes encoding D2-like receptors (D2/D3/D4). We review here our recent work on the cloning and characterization of some of the members of the dopamine receptor gene family (D1, D2, D4, D5), their relationship to neuropsychiatric disorders and their potential role in antipsychotic drug action. Images Fig. 1 PMID:1450188

  12. The Troll in Toll: Mal and Tram as bridges for TLR2 and TLR4 signaling.

    PubMed

    Sheedy, Frederick J; O'Neill, Luke A J

    2007-08-01

    Signaling by two of the most important bacteria-sensing TLRs, TLR2 and TLR4, involves two adaptor proteins, MyD88 adaptor-like (Mal) and Toll/IL-1 receptor (TIR) domain-containing adaptor-inducing IFN-beta (Trif)-related adaptor molecule (TRAM). Recently, new insights into the functioning of these two adapters have emerged. Mal is required by both TLRs to act as a bridge to recruit the adaptor MyD88, leading ultimately to NF-kappaB activation. Similarly, TRAM acts as a bridge to recruit TRIF to the TLR4 complex, leading to activation of the transcription factor IFN regulatory factor 3. Consistent with Mal and TRAM being key points of control, recent evidence suggests that they are subject to regulation by phosphorylation. Further, a variant in Mal in humans has been found to protect against multiple infectious diseases. Finally, another TIR domain-containing adaptor, sterile alpha and HEAT/armadillo motif protein (SARM), has been shown to act as an inhibitor of TRIF-dependent signaling. These recent discoveries add to the complexity of TLR signaling and highlight specific control mechanisms for TLR2 and TLR4 signaling.

  13. B cell-intrinsic TLR7 signaling is essential for the development of spontaneous germinal centers.

    PubMed

    Soni, Chetna; Wong, Eric B; Domeier, Phillip P; Khan, Tahsin N; Satoh, Takashi; Akira, Shizuo; Rahman, Ziaur S M

    2014-11-01

    Spontaneous germinal center (Spt-GC) B cells and follicular helper T cells generate high-affinity autoantibodies that are involved in the development of systemic lupus erythematosus. TLRs play a pivotal role in systemic lupus erythematosus pathogenesis. Although previous studies focused on the B cell-intrinsic role of TLR-MyD88 signaling on immune activation, autoantibody repertoire, and systemic inflammation, the mechanisms by which TLRs control the formation of Spt-GCs remain unclear. Using nonautoimmune C57BL/6 (B6) mice deficient in MyD88, TLR2, TLR3, TLR4, TLR7, or TLR9, we identified B cell-intrinsic TLR7 signaling as a prerequisite to Spt-GC formation without the confounding effects of autoimmune susceptibility genes and the overexpression of TLRs. TLR7 deficiency also rendered autoimmune B6.Sle1b mice unable to form Spt-GCs, leading to markedly decreased autoantibodies. Conversely, B6.yaa and B6.Sle1b.yaa mice expressing an extra copy of TLR7 and B6.Sle1b mice treated with a TLR7 agonist had increased Spt-GCs and follicular helper T cells. Further, TLR7/MyD88 deficiency led to compromised B cell proliferation and survival after B cell stimulation both in vitro and in vivo. In contrast, TLR9 inhibited Spt-GC development. Our findings demonstrate an absolute requirement for TLR7 and a negative regulatory function for TLR9 in Spt-GC formation under nonautoimmune and autoimmune conditions. Our data suggest that, under nonautoimmune conditions, Spt-GCs initiated by TLR7 produce protective Abs. However, in the presence of autoimmune susceptibility genes, TLR7-dependent Spt-GCs produce pathogenic autoantibodies. Thus, a single copy of TLR7 in B cells is the minimal requirement for breaking the GC-tolerance checkpoint.

  14. Racial Variation in Toll-like Receptor Variants Among Women With Pelvic Inflammatory Disease

    PubMed Central

    Taylor, Brandie D.; Darville, Toni; Ferrell, Robert E.; Ness, Roberta B.; Haggerty, Catherine L.

    2013-01-01

    Background. Racial disparities exist in gynecological diseases. Variations in Toll-like receptor (TLR) genes may alter signaling following microbial recognition. Methods. We explored genotypic differences in 6 functional variants in 4 TLR genes (TLR1, TLR2, TLR4, TLR6) and the adaptor molecule TIRAP between 205 African American women and 51 white women with clinically suspected pelvic inflammatory disease (PID). A permutated P < .007 was used to assess significance. Associations between race and endometritis and/or upper genital tract infection (UGTI) were explored. Logistic regression was used to calculate odds ratios (ORs) and 95% confidence intervals (CIs). Results. The TT genotype for TLR1 rs5743618, the GG genotype for TLR1 rs4833095, the CC genotype for TLR2 rs3804099, the TLR6 rs5743810 T allele, and the CC genotype for TIRAP rs8177374 significantly differed between races (P < .007). African American race was associated with endometritis and/or UGTI (OR, 4.2 [95% CI, 2.0–8.7]; P = .01). Among African Americans, the TLR6 rs5743810 T allele significantly decreased endometritis and/or UGTI (OR, 0.4 [95% CI, .2–.9]; P = .04). Additionally, rs5743618, rs4833095, and rs8177374 increased endometritis and/or UGTI, albeit not significantly. Conclusions. Among women with PID, TLR variants that increase inflammation are associated with African American race and may mediate the relationship between race and endometritis and/or UGTI. PMID:23255565

  15. Modulation of endotoxicity of Shigella generalized modules for membrane antigens (GMMA) by genetic lipid A modifications: relative activation of TLR4 and TLR2 pathways in different mutants.

    PubMed

    Rossi, Omar; Pesce, Isabella; Giannelli, Carlo; Aprea, Susanna; Caboni, Mariaelena; Citiulo, Francesco; Valentini, Sara; Ferlenghi, Ilaria; MacLennan, Calman Alexander; D'Oro, Ugo; Saul, Allan; Gerke, Christiane

    2014-09-05

    Outer membrane particles from Gram-negative bacteria are attractive vaccine candidates as they present surface antigens in their natural context. We previously developed a high yield production process for genetically derived particles, called generalized modules for membrane antigens (GMMA), from Shigella. As GMMA are derived from the outer membrane, they contain immunostimulatory components, especially lipopolysaccharide (LPS). We examined ways of reducing their reactogenicity by modifying lipid A, the endotoxic part of LPS, through deletion of late acyltransferase genes, msbB or htrB, in GMMA-producing Shigella sonnei and Shigella flexneri strains. GMMA with resulting penta-acylated lipid A from the msbB mutants showed a 600-fold reduced ability, and GMMA from the S. sonnei ΔhtrB mutant showed a 60,000-fold reduced ability compared with GMMA with wild-type lipid A to stimulate human Toll-like receptor 4 (TLR4) in a reporter cell line. In human peripheral blood mononuclear cells, GMMA with penta-acylated lipid A showed a marked reduction in induction of inflammatory cytokines (S. sonnei ΔhtrB, 800-fold; ΔmsbB mutants, 300-fold). We found that the residual activity of these GMMA is largely due to non-lipid A-related TLR2 activation. In contrast, in the S. flexneri ΔhtrB mutant, a compensatory lipid A palmitoleoylation resulted in GMMA with hexa-acylated lipid A with ∼10-fold higher activity to stimulate peripheral blood mononuclear cells than GMMA with penta-acylated lipid A, mostly due to retained TLR4 activity. Thus, for use as vaccines, GMMA will likely require lipid A penta-acylation. The results identify the relative contributions of TLR4 and TLR2 activation by GMMA, which need to be taken into consideration for GMMA vaccine development.

  16. TLR4 in Toxoplasmosis; friends or foe?

    PubMed

    Zare-Bidaki, Mohammad; Hakimi, Hamid; Abdollahi, Seyyed Hossein; Zainodini, Nahid; Arababadi, Mohammad Kazemi; Kennedy, Derek

    2014-01-01

    Toxoplasma species are obligate intracellular protozoan which are responsible for induction of several forms of Toxoplasmosis in humans. The mechanisms responsible for the progression of the prolonged forms of Toxoplasmosis and associated pathologies are yet to be identified. However, previous studies proposed that immunological and genetic parameters may play important roles in the etiology and complexity of Toxoplasmosis. Pathogen recognition receptors (PRRs) recognize microbial antigens and induce immune responses against parasites, including toxoplasma species. Toll like receptors (TLRs) are PRRs which recognize toxoplasma as a pathogenic parasite and activate immune cells. It has been reported that the TLR4 is a critical innate immune cell receptor in toxoplasma detection and subsequently activates immune responses using either MYD88 or TRIF pathways. This review collates recent information regarding the role of TLR4 and its related signaling molecules with Toxoplasmosis.

  17. Adenovirus receptors and their implications in gene delivery

    PubMed Central

    Sharma, Anurag; Li, Xiaoxin; Bangari, Dinesh S.; Mittal, Suresh K.

    2010-01-01

    Adenoviruses (Ads) have gained popularity as gene delivery vectors for therapeutic and prophylactic applications. Ad entry into host cells involves specific interactions between cell surface receptors and viral capsid proteins. Several cell surface molecules have been identified as receptors for Ad attachment and entry. Tissue tropism of Ad vectors is greatly influenced by their receptor usage. A variety of strategies have been investigated to modify Ad vector tropism by manipulating the receptor-interacting moieties. Many such strategies are aimed at targeting and/or detargeting of Ad vectors. In this review, we discuss the various cell surface molecules that are implicated as receptors for virus attachment and internalization. Special emphasis is given to Ad types that are utilized as gene delivery vectors. Various strategies to modify Ad tropism using the knowledge of Ad receptors are also discussed. PMID:19647886

  18. Differential expression of Toll-like receptor pathway genes in chicken embryo fibroblasts from chickens resistant and susceptible to Marek’s disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Toll-like receptor (TLR) signaling pathway is one of the innate immune defense mechanisms against pathogens in vertebrates and invertebrates. However, the role of TLR in non-MHC genetic resistance or susceptibility to Marek’s disease (MD) in the chicken is yet to be elucidated. Chicken embryo fi...

  19. Hantaan virus triggers TLR4-dependent innate immune responses.

    PubMed

    Yu, Hai-Tao; Jiang, Hong; Zhang, Ye; Nan, Xue-Ping; Li, Yu; Wang, Wei; Jiang, Wei; Yang, Dong-Qiang; Su, Wen-Jing; Wang, Jiu-Ping; Wang, Ping-Zhong; Bai, Xue-Fan

    2012-10-01

    The innate immune response induced by Hantavirus is responsible for endothelial cell dysfunction and viral pathogenicity. Recent studies demonstrate that TLR4 expression is upregulated and mediates the secretion of several cytokines in Hantaan virus (HTNV)-infected endothelial cells. To examine viral interactions with host endothelial cells and characterize the innate antiviral responses associated with Toll-like receptors, we selected TLR4 as the target molecule to investigate anti-hantavirus immunity. TLR4 mRNA-silenced EVC-304 (EVC-304 TLR4-) cells and EVC-304 cells were used to investigate signaling molecules downstream of TLR4. The expression of the adaptor protein TRIF was higher in HTNV-infected EVC-304 cells than in EVC-304 TLR4- cells. However, there was no apparent difference in the expression of MyD88 in either cell line. The transcription factors for NF-κB and IRF-3 were translocated from the cytoplasm into the nucleus in HTNV-infected EVC-304 cells, but not in HTNV-infected EVC-304 TLR4- cells. Our results demonstrate that TLR4 may play an important role in the antiviral immunity of the host against HTNV infection through an MyD88-independent signaling pathway.

  20. Eimeria tenella: expression profiling of toll-like receptors and associated cytokines in the cecum of infected day-old and three-week old SPF chickens.

    PubMed

    Zhang, Lei; Liu, Renqiang; Ma, Liping; Wang, Yingwei; Pan, Baoliang; Cai, Jianping; Wang, Ming

    2012-04-01

    Coccidiosis is an economically important protozoan disease worldwide caused by Eimeria parasites. Toll-like receptors (TLRs), a family of highly conserved proteins, are involved in pathogen detection by initiating host responses, and play important roles in the reduction and clearance of pathogens. Little is known about the roles of chicken TLRs during Eimeria tenella infection. We detected the dynamic changes in the expression of TLRs and associated cytokines in the cecum of E. tenella-infected chickens during the early stage of infection. Day-old (Experiment 1) and three-week-old (Experiment 2) chickens were orally gavaged with 10,000 oocysts (30 chickens each experiment), and their cecum intraepithelial lymphocytes were collected at 3, 6, 12, 24, 48, and 72h post-infection (hpi). Expression profiling of TLR1LA, TLR4, TLR5, TLR7, TLR21, and IFN-α, IFN-β, IFN-γ, IL-1β, IL-12 genes were analyzed using quantitative real-time polymerase chain reaction. Almost all TLR transcripts were transiently increased at 3hpi in Experiment 1. In three-week-old chickens, TLR1LA, TLR4, TLR5, TLR7, and TLR21 expression was upregulated at 12hpi, and TLR1LA, TLR5, and TLR21 were highly expressed at 72hpi. In day-old chickens, IFN-α, IFN-β, IFN-γ, IL-1β, and IL-12 expression was significantly upregulated at 3hpi (156.1-1117.1-fold change), in comparison to the different peak level times and relatively small changes for these cytokines in the three-week-old chickens. Our results provide a valuable overview for the expression pattern of TLRs and associated cytokines during the early stage of E. tenella infection in chickens.

  1. Impaired Innate Immunity in Tlr4−/− Mice but Preserved CD8+ T Cell Responses against Trypanosoma cruzi in Tlr4-, Tlr2-, Tlr9- or Myd88-Deficient Mice

    PubMed Central

    Tzelepis, Fanny; Klezewsky, Weberton; da Silva, Raquel N.; Neves, Fabieni S.; Cavalcanti, Gisele S.; Boscardin, Silvia; Nunes, Marise P.; Santiago, Marcelo F.; Nóbrega, Alberto; Rodrigues, Maurício M.; Bellio, Maria

    2010-01-01

    The murine model of T. cruzi infection has provided compelling evidence that development of host resistance against intracellular protozoans critically depends on the activation of members of the Toll-like receptor (TLR) family via the MyD88 adaptor molecule. However, the possibility that TLR/MyD88 signaling pathways also control the induction of immunoprotective CD8+ T cell-mediated effector functions has not been investigated to date. We addressed this question by measuring the frequencies of IFN-γ secreting CD8+ T cells specific for H-2Kb-restricted immunodominant peptides as well as the in vivo Ag-specific cytotoxic response in infected animals that are deficient either in TLR2, TLR4, TLR9 or MyD88 signaling pathways. Strikingly, we found that T. cruzi-infected Tlr2−/−, Tlr4−/−, Tlr9−/− or Myd88−/− mice generated both specific cytotoxic responses and IFN-γ secreting CD8+ T cells at levels comparable to WT mice, although the frequency of IFN-γ+CD4+ cells was diminished in infected Myd88−/− mice. We also analyzed the efficiency of TLR4-driven immune responses against T. cruzi using TLR4-deficient mice on the C57BL genetic background (B6 and B10). Our studies demonstrated that TLR4 signaling is required for optimal production of IFN-γ, TNF-α and nitric oxide (NO) in the spleen of infected animals and, as a consequence, Tlr4−/− mice display higher parasitemia levels. Collectively, our results indicate that TLR4, as well as previously shown for TLR2, TLR9 and MyD88, contributes to the innate immune response and, consequently, resistance in the acute phase of infection, although each of these pathways is not individually essential for the generation of class I-restricted responses against T. cruzi. PMID:20442858

  2. Disordered Toll-like receptor 2 responses in the pathogenesis of pulmonary sarcoidosis.

    PubMed

    Gabrilovich, M I; Walrath, J; van Lunteren, J; Nethery, D; Seifu, M; Kern, J A; Harding, C V; Tuscano, L; Lee, H; Williams, S D; Mackay, W; Tomashefski, J F; Silver, R F

    2013-09-01

    In this study, we hypothesized that the granulomatous disorder sarcoidosis is not caused by a single pathogen, but rather results from abnormal responses of Toll-like receptors (TLRs) to conserved bacterial elements. Unsorted bronchoalveolar lavage (BAL) cells from patients with suspected pulmonary sarcoidosis and healthy non-smoking control subjects were stimulated with representative ligands of TLR-2 (in both TLR-2/1 and TLR-2/6 heterodimers) and TLR-4. Responses were determined by assessing resulting production of tumour necrosis factor (TNF)-α and interleukin (IL)-6. BAL cells from patients in whom sarcoidosis was confirmed displayed increased cytokine responses to the TLR-2/1 ligand 19-kDa lipoprotein of Mycobacterium tuberculosis (LpqH) and decreased responses to the TLR-2/6 agonist fibroblast stimulating ligand-1 (FSL)-1. Subsequently, we evaluated the impact of TLR-2 gene deletion in a recently described murine model of T helper type 1 (Th1)-associated lung disease induced by heat-killed Propionibacterium acnes. As quantified by blinded scoring of lung pathology, P. acnes-induced granulomatous pulmonary inflammation was markedly attenuated in TLR-2(-/-) mice compared to wild-type C57BL/6 animals. The findings support a potential role for disordered TLR-2 responses in the pathogenesis of pulmonary sarcoidosis.

  3. Accessory Cell Mediated Activation of Porcine NK Cells by TLR7 and TLR8 Agonists

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The induction of innate immune responses by toll-like receptor (TLR) agonists is the subject of intense investigation in many different species. In large part, this reflects the potential of such compounds to be effective vaccine adjuvants. For that reason, we analyzed the activation of innate cells...

  4. Constitutive gene expression in monocytes from chronic HIV-1 infection overlaps with acute Toll-like receptor induced monocyte activation profiles.

    PubMed

    Gekonge, Bethsebah; Giri, Malavika S; Kossenkov, Andrew V; Nebozyhn, Michael; Yousef, Malik; Mounzer, Karam; Showe, Louise; Montaner, Luis J

    2012-01-01

    Elevated TLR expression/signalling in monocyte/macrophages has been shown to mediate systemic immune activation, a hallmark of progressive HIV-1 infection. Here we show, via differential gene expression comparisons, the presence of a constitutive in vivo TLR-like gene activation signature in steady-state circulating monocytes from chronically HIV-1 infected subjects. The TLR2-like gene signature was defined as an 82 gene subset of the 376 genes constitutively modulated in in vivo HIV-1 monocytes, based on their overlap with de novo TLR2-induced genes in uninfected subjects' monocytes following acute ex vivo stimulation with Staphylococcus Aureus Cowan (SAC). Additional comparison of in vivo gene networks with available datasets from acute TLR activations in M/M expanded the overlap to 151-gene concordance among the 376 differential genes with emphasis on ERK/MAPK, TNF/IL6 (NFκB) and p53 gene networks. TLR2 stimulation of monocytes from HIV-1 infected subjects resulted in further upregulation of inflammatory genes indicative of a sustained transcriptional potential upon stimulation. In summary, our data support the presence of a sustained TLR-like gene activation profile in circulating monocyte from steady-state viremia in HIV-1 infected subjects.

  5. Antiphospholipid antibodies induce translocation of TLR7 and TLR8 to the endosome in human monocytes and plasmacytoid dendritic cells.

    PubMed

    Prinz, Nadine; Clemens, Natascha; Strand, Dennis; Pütz, Inge; Lorenz, Mareike; Daiber, Andreas; Stein, Pamela; Degreif, Adriana; Radsak, Markus; Schild, Hansjörg; Bauer, Stefan; von Landenberg, Philipp; Lackner, Karl J

    2011-08-25

    The antiphospholipid syndrome (APS) is an autoimmune disease characterized by thromboembolic events and/or fetal loss in the presence of antiphospholipid antibodies (aPLs). The mechanisms underlying the pathogenicity of aPLs are still poorly understood. Here we show that 3 human monoclonal aPLs as well as IgG fractions from patients with the APS increase mRNA expression of the intracellular toll-like receptor (TLR) 7 in plasmacytoid dendritic cells and TLR8 in monocytes. Simultaneously they induce the translocation of TLR7 or TLR8 from the endoplasmic reticulum to the endosome. These effects depend on the uptake of aPLs into the endosome, subsequent activation of endosomal NADPH oxidase, and generation of superoxide. As a consequence cells are dramatically sensitized to ligands for TLR7 and TLR8. This observation delineates a novel signal transduction pathway in innate immunity originating from the endosome. Because the overexpression of TLR7 can also be detected in plasmacytoid dendritic cells from patients with the APS ex vivo, our results provide an explanation for proinflammatory and procoagulant effects of aPLs. Because inappropriate expression of TLR7 has been implicated in the development of systemic autoimmunity, these findings may also be relevant for the understanding of autoimmunity.

  6. Association of TLR3-hyporesponsiveness and functional TLR3 L412F polymorphism with recurrent herpes labialis.

    PubMed

    Yang, Chin-An; Raftery, Martin J; Hamann, Lutz; Guerreiro, Manuel; Grütz, Gerald; Haase, Doreen; Unterwalder, Nadine; Schönrich, Günther; Schumann, Ralf R; Volk, Hans-Dieter; Scheibenbogen, Carmen

    2012-08-01

    HSV-1 persistently infects almost 90% of our population; however, only 30% of the infected subjects suffer from recurrent herpes lesions, most frequently herpes labialis (HL). We hypothesized that variations in toll-like receptor (TLR) functions might contribute to HL susceptibility. In our study, the TLR-2/1,-3, and -7/8 responses of immune cell subsets derived from asymptomatic HSV-1 carriers were compared with responses of subjects with HL history. Remarkably, natural killer (NK) cells isolated from HL subjects showed significantly lower IFN-γ responses selectively to the TLR3 agonist poly(I:C). Furthermore, the TLR3 L412F genetic polymorphism was found to reduce NK cell TLR3-responsiveness and is associated with susceptibility to recurrent HL. The TLR3 response detected in HL total peripheral blood mononuclear cells (PBMCs), however, was not impaired, indicating restoration of NK cell TLR3-deficiency through co-stimulatory functions. In conclusion, our results suggest that decreased TLR3 response of NK cells is associated with HL susceptibility; and potentially explain why symptomatic outbreak of HL usually occurs after stress or prolonged UV light exposure, when host co-stimulatory functions are disturbed.

  7. Toll-like receptor-2 and -4 are associated with hyperlipidemia.

    PubMed

    Zhu, Ya-Jun; Wang, Chao; Song, Guangyao; Zang, Sha-Sha; Liu, Yi-Xuan; Li, Ling

    2015-12-01

    Recent studies have suggested that toll-like receptors (TLRs) contribute to insulin resistance, and that fatty acids have a role in TLR activation. Other studies have found that TLR2 and TLR4 upregulation is consistent with an increase in serum lipid. Therefore, it was hypothesized that TLRs are associated with hyperlipidemia. The aim of the present study was to investigate whether TLR2 or TLR4 was associated with hyperlipidemia and to provide novel targets for hyperlipidemia therapy. Volunteers were selected at the Medical Examination Center of Hebei General Hospital (Shijiazhuang, China), including 43 patients with high triglyceride (TG) levels, 84 with high total cholesterol (TC) levels and 55 with high TG and high TC levels. In addition, 68 healthy volunteers were selected as a control group. For the animal study, the TLR gene and protein levels were assessed in the skeletal muscle of rats fed a high‑fat diet. As expected, TLR2 and TLR4 gene expression were upregulated when TC increased, TG increased, or TC and TG increased. In rats fed a high‑fat diet, the levels of gene and protein expression in the skeletal muscle of the two TLRs were all increased compared with the control group, this was consistent with an increase in TC and TG. In addition, in drug treatment groups the mRNA and protein expression levels of TLR in the skeletal muscle of rats fed a high fat diet were decreased, as were the TC and TG levels. In conclusion, these findings suggest that TLR2 and TLR4 are associated with hyperlipidemia.

  8. Inhibition of TLR4 protects rat islets against lipopolysaccharide-induced dysfunction.

    PubMed

    Wang, Xiao; Ge, Qin Min; Bian, Fan; Dong, Yan; Huang, Chun Mei

    2017-02-01

    Oxidative stress leads to dysfunction in pancreatic cells, causing a reduction in insulin secretion following exposure to glucose. Toll-like receptor 4 (TLR4) may be activated by exposure to lipopolysaccharide (LPS) stress. TLR4 may mediate the initiation of inflammatory and immune defense responses; however, the importance of the LPS/TLR4 interaction in apoptosis induced by oxidative stress in pancreatic β cells remains to be elucidated. The present study aimed to investigate the importance of TLR4 during LPS‑induced oxidative stress, apoptosis and dysfunction of insulin secretion in isolated islets of rats. LPS‑induced stimulation of TLR4 increased the production of reactive oxygen species and promoted apoptosis by upregulating the expression levels of caspase‑3, poly ADP ribose polymerase and altering the expression ratio of B‑cell lymphoma‑2 (Bcl‑2)/Bcl‑2 associated X protein. Additionally, the insulin secretion of islets cells was reduced. Anti‑TLR4 antibody and a knockdown of TLR4 by TLR4‑short hairpin RNA were used to inhibit TLR4 activity, which may reverse LPS‑induced events. The present study determined that in islets exposed to LPS oxidative stress, dysfunction may be partly mediated via the TLR4 pathway. Inhibition of TLR4 may prevent dysfunction of rat islets due to oxidative stress. The present study revealed that targeting the LPS/TLR4 signaling pathway and antioxidant therapy may be a novel treatment for the severely septic patients with hyperglycemia stress.

  9. An unusual dimeric structure and assembly for TLR4 regulator RP105-MD-1

    SciTech Connect

    Yoon, Sung-il; Hong, Minsun; Wilson, Ian A

    2011-11-16

    RP105-MD-1 modulates the TLR4-MD-2-mediated, innate immune response against bacterial lipopolysaccharide (LPS). The crystal structure of the bovine 1:1 RP105-MD-1 complex bound to a putative endogenous lipid at 2.9 Å resolution shares a similar overall architecture to its homolog TLR4-MD-2 but assembles into an unusual 2:2 homodimer that differs from any other known TLR-ligand assembly. The homodimer is assembled in a head-to-head orientation that juxtaposes the N-terminal leucine-rich repeats (LRRs) of the two RP105 chains, rather than the usual tail-to-tail configuration of C-terminal LRRs in ligand-activated TLR dimers, such as TLR1-TRL2, TLR2-TLR6, TLR3-TLR3 and TLR4-TLR4. Another unusual interaction is mediated by an RP105-specific asparagine-linked glycan, which wedges MD-1 into the co-receptor binding concavity on RP105. This unique mode of assembly represents a new paradigm for TLR complexes and suggests a molecular mechanism for regulating LPS responses.

  10. Recognition of lipopeptide patterns by Toll-like receptor 2-Toll-like receptor 6 heterodimer.

    PubMed

    Kang, Jin Young; Nan, Xuehua; Jin, Mi Sun; Youn, Suk-Jun; Ryu, Young Hee; Mah, Shinjee; Han, Seung Hyun; Lee, Hayyoung; Paik, Sang-Gi; Lee, Jie-Oh

    2009-12-18

    Toll-like receptor 2 (TLR2) initiates potent immune responses by recognizing diacylated and triacylated lipopeptides. Its ligand specificity is controlled by whether it heterodimerizes with TLR1 or TLR6. We have determined the crystal structures of TLR2-TLR6-diacylated lipopeptide, TLR2-lipoteichoic acid, and TLR2-PE-DTPA complexes. PE-DTPA, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid, is a synthetic phospholipid derivative. Two major factors contribute to the ligand specificity of TLR2-TLR1 or TLR2-TLR6 heterodimers. First, the lipid channel of TLR6 is blocked by two phenylalanines. Simultaneous mutation of these phenylalanines made TLR2-TLR6 fully responsive not only to diacylated but also to triacylated lipopeptides. Second, the hydrophobic dimerization interface of TLR2-TLR6 is increased by 80%, which compensates for the lack of amide lipid interaction between the lipopeptide and TLR2-TLR6. The structures of the TLR2-lipoteichoic acid and the TLR2-PE-DTPA complexes demonstrate that a precise interaction pattern of the head group is essential for a robust immune response by TLR2 heterodimers.

  11. Evidence for a role of heat shock protein-90 (HSP90) in TLR4 mediated pain enhancement in rats

    PubMed Central

    Hutchinson, Mark R.; Ramos, Khara M.; Loram, Lisa C.; Wieseler, Julie; Sholar, Paige W.; Kearney, Jeffrey J.; Lewis, Makenzie T.; Crysdale, Nicole Y.; Zhang, Yingning; Harrison, Jacqueline A.; Maier, Steven F.; Rice, Kenner C.; Watkins, Linda R.

    2009-01-01

    Spinal cord microglial toll-like receptor-4 (TLR4) has been implicated in enhancing neuropathic pain and opposing morphine analgesia. The present study was initiated to explore TLR4-mediated pain modulation by intrathecal lipopolysaccharide, a classic TLR4 agonist. However, our initial study revealed that intrathecal lipopolysaccharide failed to induce low-threshold mechanical allodynia in naive rats, suggestive that TLR4 agonism may be insufficient to enhance pain. These studies explore the possibility that a second signal is required; namely, heat shock protein-90 (HSP90). This candidate was chosen for study given its known importance as a regulator of TLR4 signaling. A combination of in vitro TLR4 cell signaling and in vivo behavioral studies of pain modulation suggest that TLR4-enhancement of neuropathic pain and TLR4-suppression of morphine analgesia each likely require HSP90 as a cofactor for the effects observed. In vitro studies revealed that DMSO enhances HSP90 release, suggestive that this may be a means by which DMSO enhances TLR4 signaling. While 2 µg and 100 µg lipopolysaccharide intrathecally did not induce mechanical allodynia across the time course tested, co-administration of 1 µg lipopolysaccharide with a drug that enhances HSP90-mediated TLR4 signaling now induced robust allodynia. In support of this allodynia being mediated via a TLR4/HSP90 pathway, it was prevented or reversed by intrathecal co-administration of a HSP90 inhibitor, a TLR4 inhibitor, a microglia/monocyte activation inhibitor (as monocytes-derived cells are the predominant cell type expressing TLR4), and interleukin-1 receptor antagonist (as this proinflammatory cytokine is a downstream consequence of TLR4 activation). Together, these results suggest for the first time that TLR4 activation is necessary but not sufficient to induce spinally mediated pain enhancement. Rather, the data suggest that TLR4-dependent pain phenomena may require contributions by multiple components of

  12. Impact of estrogen receptor α gene and oxytocin receptor gene polymorphisms on female sexuality.

    PubMed

    Armeni, Anastasia K; Assimakopoulos, Konstantinos; Marioli, Dimitra; Koika, Vassiliki; Michaelidou, Euthychia; Mourtzi, Niki; Iconomou, Gregoris; Georgopoulos, Neoklis A

    2017-01-01

    Over the past decades, research attention has increasingly been paid to the neurobiological component of sexual behavior. The aim of the present study was to investigate the correlation of estrogen receptor α (ERA) gene polymorphism (rs2234693-PvuII) (T→C substitution) and oxytocin receptor gene polymorphism (rs53576) (G→A substitution) with sexuality parameters of young, healthy women. One hundred thirty-three Greek heterosexual women, students in higher education institutions, 20-25 years of age, sexually active, with normal menstrual cycles (28-35 days), were recruited in the study. Exclusion criteria were chronic and/or major psychiatric diseases, use of oral contraceptive pills (OCs), polycystic ovary syndrome (PCOS), thyroid diseases as well as drugs that are implicated in hypothalamus-pituitary-gonadal axis. T allele (wildtype) of rs2234693 (PvuII) polymorphism of ERA gene was correlated with increased levels of arousal and lubrication, whereas A allele (polymorphic) of rs53576 (OXTR) polymorphism was correlated with increased arousal levels. The simultaneous presence of both T allele of rs2234693 (PvuII) and A allele of rs53576 (OXTR) polymorphisms (T + A group) was correlated with increased arousal, orgasm levels as well as female sexual function index full score. To our knowledge, this is the first study to investigate the interaction between ERA and OXTR with regard to sexual function in women. Female sexuality is a complex behavioral trait that encompasses both biological and psychological components. It seems that variability in female sexual response stems from genetic variability that characterizes endocrine, neurotransmitter and central nervous system influences.

  13. Impact of estrogen receptor α gene and oxytocin receptor gene polymorphisms on female sexuality

    PubMed Central

    Armeni, Anastasia K; Assimakopoulos, Konstantinos; Marioli, Dimitra; Koika, Vassiliki; Michaelidou, Euthychia; Mourtzi, Niki; Iconomou, Gregoris

    2017-01-01

    Over the past decades, research attention has increasingly been paid to the neurobiological component of sexual behavior. The aim of the present study was to investigate the correlation of estrogen receptor α (ERA) gene polymorphism (rs2234693-PvuII) (T→C substitution) and oxytocin receptor gene polymorphism (rs53576) (G→A substitution) with sexuality parameters of young, healthy women. One hundred thirty-three Greek heterosexual women, students in higher education institutions, 20–25 years of age, sexually active, with normal menstrual cycles (28–35 days), were recruited in the study. Exclusion criteria were chronic and/or major psychiatric diseases, use of oral contraceptive pills (OCs), polycystic ovary syndrome (PCOS), thyroid diseases as well as drugs that are implicated in hypothalamus–pituitary–gonadal axis. T allele (wildtype) of rs2234693 (PvuII) polymorphism of ERA gene was correlated with increased levels of arousal and lubrication, whereas A allele (polymorphic) of rs53576 (OXTR) polymorphism was correlated with increased arousal levels. The simultaneous presence of both T allele of rs2234693 (PvuII) and A allele of rs53576 (OXTR) polymorphisms (T + A group) was correlated with increased arousal, orgasm levels as well as female sexual function index full score. To our knowledge, this is the first study to investigate the interaction between ERA and OXTR with regard to sexual function in women. Female sexuality is a complex behavioral trait that encompasses both biological and psychological components. It seems that variability in female sexual response stems from genetic variability that characterizes endocrine, neurotransmitter and central nervous system influences. PMID:28069897

  14. TLR4 deficiency promotes autophagy during cigarette smoke-induced pulmonary emphysema.

    PubMed

    An, Chang Hyeok; Wang, Xiao Mei; Lam, Hilaire C; Ifedigbo, Emeka; Washko, George R; Ryter, Stefan W; Choi, Augustine M K

    2012-11-01

    Toll-like receptors (TLRs) exert important nonimmune functions in lung homeostasis. TLR4 deficiency promotes pulmonary emphysema. We examined the role of TLR4 in regulating cigarette smoke (CS)-induced autophagy, apoptosis, and emphysema. Lung tissue was obtained from chronic obstructive lung disease (COPD) patients. C3H/HeJ (Tlr4-mutated) mice and C57BL/10ScNJ (Tlr4-deficient) mice and their respective control strains were exposed to chronic CS or air. Human or mouse epithelial cells (wild-type, Tlr4-knockdown, and Tlr4-deficient) were exposed to CS-extract (CSE). Samples were analyzed for TLR4 expression, and for autophagic or apoptotic proteins by Western blot analysis or confocal imaging. Chronic obstructive lung disease lung tissues and human pulmonary epithelial cells exposed to CSE displayed increased TLR4 expression, and increased autophagic [microtubule-associated protein-1 light-chain-3B (LC3B)] and apoptotic (cleaved caspase-3) markers. Beas-2B cells transfected with TLR4 siRNA displayed increased expression of LC3B relative to control cells, basally and after exposure to CSE. The basal and CSE-inducible expression of LC3B and cleaved caspase-3 were elevated in pulmonary alveolar type II cells from Tlr4-deficient mice. Wild-type mice subjected to chronic CS-exposure displayed airspace enlargement;, however, the Tlr4-mutated or Tlr4-deficient mice exhibited a marked increase in airspace relative to wild-type mice after CS-exposure. The Tlr4-mutated or Tlr4-deficient mice showed higher levels of LC3B under basal conditions and after CS exposure. The expression of cleaved caspase-3 was markedly increased in Tlr4-deficient mice exposed to CS. We describe a protective regulatory function of TLR4 against emphysematous changes of the lung in response to CS.

  15. Estrogen increases renal oxytocin receptor gene expression.

    PubMed

    Ostrowski, N L; Young, W S; Lolait, S J

    1995-04-01

    Estrogens have been implicated in the sodium and fluid imbalances associated with the menstrual cycle and late pregnancy. An estrogen-dependent role for renal oxytocin receptors in fluid homeostasis is suggested by the present findings which demonstrate that estradiol benzoate treatment increases the expression of the oxytocin receptor messenger ribonucleic acid and 125I-OTA binding to oxytocin receptors in the renal cortex and medullary collecting ducts of ovariectomized female rats. Moreover, estradiol induced high levels of oxytocin receptor expression in outer stripe proximal tubules of ovariectomized female and adrenalectomized male rats. Proximal tubule induction was inhibited in a dose-dependent manner by the antiestrogen tamoxifen, but cortical expression of oxytocin receptors in macula densa cells was unaffected by tamoxifen. These data demonstrate cell-specific regulation of oxytocin receptor expression in macula densa and proximal tubule cells, and suggest a important role for these receptors in mediating estrogen-induced alterations in renal fluid dynamics by possibly affecting glomerular filtration and water and solute reabsorption during high estrogen states.

  16. Characteristics of the mouse genomic histamine H1 receptor gene

    SciTech Connect

    Inoue, Isao; Taniuchi, Ichiro; Kitamura, Daisuke

    1996-08-15

    We report here the molecular cloning of a mouse histamine H1 receptor gene. The protein deduced from the nucleotide sequence is composed of 488 amino acid residues with characteristic properties of GTP binding protein-coupled receptors. Our results suggest that the mouse histamine H1 receptor gene is a single locus, and no related sequences were detected. Interspecific backcross analysis indicated that the mouse histamine H1 receptor gene (Hrh1) is located in the central region of mouse Chromosome 6 linked to microphthalmia (Mitfmi), ras-related fibrosarcoma oncogene 1 (Raf1), and ret proto-oncogene (Ret) in a region of homology with human chromosome 3p. 12 refs., 3 figs.

  17. Toll-like receptor 4 as a predictor of clinical outcomes of estrogen receptor-negative breast cancer in Saudi women.

    PubMed

    Semlali, Abdelhabib; Jalouli, Maroua; Parine, Narasimha Reddy; Al Amri, Abdullah; Arafah, Maha; Al Naeem, Abdulrahman; Abdullah Ajaj, Sanaa; Rouabhia, Mahmoud; Alanazi, Mohammad Saud

    2017-01-01

    The aim of this study was to investigate the association of the common polymorphisms of Toll-like receptor 4 (TLR-4) with breast cancer development in the Saudi Arabian population. Four TLR-4 polymorphisms (rs2770150, rs10759931, rs10759932, and rs4986790) were studied using 127 breast cancer patients and 117 controls. Relative expression of TLR-4 protein in the breast tumor and the matched normal breast tissues was determined in a large cohort of 70 clinical breast samples in a tissue micro-array format by immunohistochemistry using a specific anti-TLR-4 antibody. Our results demonstrated an increase in TLR-4 expression in estrogen receptor (ER)-, postmenopausal breast cancer patients compared to normal. We also demonstrated that the G allele of single-nucleotide polymorphism rs10759931 was found to be significantly higher in frequency among patients (36.3%) compared to the control group (26.7%), suggesting that this polymorphism is strongly associated with the development of breast cancer in this ethnic population. In addition, the TLR-4 polymorphism rs2770150 was shown to be highly correlated with breast cancer in patients over 48 years of age. The TLR-4 polymorphism rs4986790 was also found to be associated with this malignancy in the ER- patient groups. Our results suggested firstly that the variation in TLR-4 gene expression may influence breast cancer development and secondly a closely linked association between TLR-4 gene polymorphism and ER status. Our study provides support for a better understanding of the implication of TLR-4 polymorphism in breast tumorigenesis and for its eventual use as a cancer biomarker.

  18. Toll-like receptor 4 as a predictor of clinical outcomes of estrogen receptor-negative breast cancer in Saudi women

    PubMed Central

    Semlali, Abdelhabib; Jalouli, Maroua; Parine, Narasimha Reddy; Al Amri, Abdullah; Arafah, Maha; Al Naeem, Abdulrahman; Abdullah Ajaj, Sanaa; Rouabhia, Mahmoud; Alanazi, Mohammad Saud

    2017-01-01

    The aim of this study was to investigate the association of the common polymorphisms of Toll-like receptor 4 (TLR-4) with breast cancer development in the Saudi Arabian population. Four TLR-4 polymorphisms (rs2770150, rs10759931, rs10759932, and rs4986790) were studied using 127 breast cancer patients and 117 controls. Relative expression of TLR-4 protein in the breast tumor and the matched normal breast tissues was determined in a large cohort of 70 clinical breast samples in a tissue micro-array format by immunohistochemistry using a specific anti-TLR-4 antibody. Our results demonstrated an increase in TLR-4 expression in estrogen receptor (ER)−, postmenopausal breast cancer patients compared to normal. We also demonstrated that the G allele of single-nucleotide polymorphism rs10759931 was found to be significantly higher in frequency among patients (36.3%) compared to the control group (26.7%), suggesting that this polymorphism is strongly associated with the development of breast cancer in this ethnic population. In addition, the TLR-4 polymorphism rs2770150 was shown to be highly correlated with breast cancer in patients over 48 years of age. The TLR-4 polymorphism rs4986790 was also found to be associated with this malignancy in the ER− patient groups. Our results suggested firstly that the variation in TLR-4 gene expression may influence breast cancer development and secondly a closely linked association between TLR-4 gene polymorphism and ER status. Our study provides support for a better understanding of the implication of TLR-4 polymorphism in breast tumorigenesis and for its eventual use as a cancer biomarker. PMID:28280355

  19. Innate Immune Sensing of Modified Vaccinia Virus Ankara (MVA) Is Mediated by TLR2-TLR6, MDA-5 and the NALP3 Inflammasome

    PubMed Central

    Delaloye, Julie; Roger, Thierry; Steiner-Tardivel, Quynh-Giao; Le Roy, Didier; Knaup Reymond, Marlies; Akira, Shizuo; Petrilli, Virginie; Gomez, Carmen E.; Perdiguero, Beatriz; Tschopp, Jürg; Pantaleo, Giuseppe; Esteban, Mariano; Calandra, Thierry

    2009-01-01

    Modified vaccinia virus Ankara (MVA) is an attenuated double-stranded DNA poxvirus currently developed as a vaccine vector against HIV/AIDS. Profiling of the innate immune responses induced by MVA is essential for the design of vaccine vectors and for anticipating potential adverse interactions between naturally acquired and vaccine-induced immune responses. Here we report on innate immune sensing of MVA and cytokine responses in human THP-1 cells, primary human macrophages and mouse bone marrow-derived macrophages (BMDMs). The innate immune responses elicited by MVA in human macrophages were characterized by a robust chemokine production and a fairly weak pro-inflammatory cytokine response. Analyses of the cytokine production profile of macrophages isolated from knockout mice deficient in Toll-like receptors (TLRs) or in the adapter molecules MyD88 and TRIF revealed a critical role for TLR2, TLR6 and MyD88 in the production of IFNβ-independent chemokines. MVA induced a marked up-regulation of the expression of RIG-I like receptors (RLR) and the IPS-1 adapter (also known as Cardif, MAVS or VISA). Reduced expression of RIG-I, MDA-5 and IPS-1 by shRNAs indicated that sensing of MVA by RLR and production of IFNβ and IFNβ-dependent chemokines was controlled by the MDA-5 and IPS-1 pathway in the macrophage. Crosstalk between TLR2-MyD88 and the NALP3 inflammasome was essential for expression and processing of IL-1β. Transcription of the Il1b gene was markedly impaired in TLR2−/− and MyD88−/− BMDM, whereas mature and secreted IL-1β was massively reduced in NALP3−/− BMDMs or in human THP-1 macrophages with reduced expression of NALP3, ASC or caspase-1 by shRNAs. Innate immune sensing of MVA and production of chemokines, IFNβ and IL-1β by macrophages is mediated by the TLR2-TLR6-MyD88, MDA-5-IPS-1 and NALP3 inflammasome pathways. Delineation of the host response induced by MVA is critical for improving our understanding of poxvirus antiviral escape

  20. Characterization and functional analysis of toll-like receptor 4 in Chinese soft-shelled turtle Pelodiscus sinensis.

    PubMed

    Zhou, Yingshan; Liang, Quan; Li, Weifen; Gu, Yuanxing; Liao, Xun; Fang, Weihuan; Li, Xiaoliang

    2016-10-01

    Mammalian Toll-like receptor 4 (TLR4) recognizes lipopolysaccharide (LPS) in initiating the innate immune responses. Early studies indicate that turtles are more resistant to LPS challenge than mammals. It remains unknown if turtles express TLR4 and why they are more resistant to LPS. In this study, TLR4 gene from Chinese soft-shelled turtle, Pelodiscus sinensis, was cloned and characterized. The full length cDNA of turtle TLR4 (tTLR4) consists of 3396 base pairs with an 2499-bp open reading frame, encoding 833 amino acids. Phylogenetic and syntenic analyses suggest that tTLR4 is to be orthologous to human TLR4. Its mRNA expression was up-regulated in spleen and blood of turtles upon Aeromonas hydrophila infection. Stimulation of turtle peripheral blood monocytes with LPS significantly upregulated tTLR4 mRNA and inflammation-related gene expression, such as Interleukin-1β (IL-1β) and cyclooxygenase-2 (COX-2). In tTLR4-expressing HEK293 cells, higher concentration of LPS exposure could enhance the activity of the NF-κB promoter, but not the INF-β promoter. Such activity required co-expression of turtle myeloid differentiation factor 2 (tMD2) and cluster of differentiation 14 (tCD14). These results provide evidence for a functional TLR4 in reptiles and, together with the syntenic analysis, support the idea that the TLR4 receptor for LPS recognition may have arisen after reptiles.

  1. Local Interleukin-1-Driven Joint Pathology Is Dependent on Toll-Like Receptor 4 Activation

    PubMed Central

    Abdollahi-Roodsaz, Shahla; Joosten, Leo A.B.; Koenders, Marije I.; van den Brand, Ben T.; van de Loo, Fons A.J.; van den Berg, Wim B.

    2009-01-01

    Toll-like receptors (TLRs) may contribute to the pathogenesis of chronic inflammatory destructive diseases through the recognition of endogenous ligands produced on either inflammation or degeneration of the extracellular matrix. The presence of endogenous TLR agonists has been reported in rheumatoid joints. In the present study, we investigated the significance of TLR2 and TLR4 activation by locally- produced endogenous ligands in the severity of joint inflammation and destruction. Local joint pathology independent of systemic immune activation was induced by overexpression of interleukin (IL)-1 and TNF in naive joints using adenoviral gene transfer. Here, we report that at certain doses, IL-1-induced local joint inflammation, cartilage proteoglycan depletion, and bone erosion are dependent on TLR4 activation, whereas TLR2 activation is not significantly involved. In comparison, tumor necrosis factor α-driven joint pathology seemed to be less dependent on TLR2 and TLR4. The severity of IL-1-induced bone erosion and irreversible cartilage destruction was markedly reduced in TLR4−/− mice, even though the degree of inflammation was similar, suggesting uncoupled processes. Furthermore, the expression of cathepsin K, a marker for osteoclast activity, induced by IL-1β was dependent on TLR4. Overexpression of IL-1β in the joint as well as ex vivo IL-1 stimulation of patellae provoked the release of endogenous TLR4 agonists capable of inducing TLR4-mediated cytokine production. These data emphasize the potential relevance of TLR4 activation in rheumatoid arthritis, particularly with respect to IL-1-mediated joint pathology. PMID:19834062

  2. Botulinum neurotoxin type A induces TLR2-mediated inflammatory responses in macrophages.

    PubMed

    Kim, Yun Jeong; Kim, Jeong-Hee; Lee, Kwang-Jun; Choi, Myung-Min; Kim, Yeon Hee; Rhie, Gi-Eun; Yoo, Cheon-Kwon; Cha, Kiweon; Shin, Na-Ri

    2015-01-01

    Botulinum neurotoxin type A (BoNT/A) is the most potent protein toxin and causes fatal flaccid muscle paralysis by blocking neurotransmission. Application of BoNT/A has been extended to the fields of therapeutics and biodefense. Nevertheless, the global response of host immune cells to authentic BoNT/A has not been reported. Employing microarray analysis, we performed global transcriptional profiling of RAW264.7 cells, a murine alveolar macrophage cell line. We identified 70 genes that were modulated following 1 nM BoNT/A treatment. The altered genes were mainly involved in signal transduction, immunity and defense, protein metabolism and modification, neuronal activities, intracellular protein trafficking, and muscle contraction. Microarray data were validated with real-time RT-PCR for seven selected genes including tlr2, tnf, inos, ccl4, slpi, stx11, and irg1. Proinflammatory mediators such as nitric oxide (NO) and tumor necrosis factor alpha (TNFα) were induced in a dose-dependent manner in BoNT/A-stimulated RAW264.7 cells. Increased expression of these factors was inhibited by monoclonal anti-Toll-like receptor 2 (TLR2) and inhibitors specific to intracellular proteins such as c-Jun N-terminal kinase (JNK), extracellular signal-regulated kinase (ERK), and p38 mitogen-activated protein kinase (MAPK). BoNT/A also suppressed lipopolysaccharide-induced NO and TNFα production from RAW264.7 macrophages at the transcription level by blocking activation of JNK, ERK, and p38 MAPK. As confirmed by TLR2-/- knock out experiments, these results suggest that BoNT/A induces global gene expression changes in host immune cells and that host responses to BoNT/A proceed through a TLR2-dependent pathway, which is modulated by JNK, ERK, and p38 MAPK.

  3. Botulinum Neurotoxin Type A Induces TLR2-Mediated Inflammatory Responses in Macrophages

    PubMed Central

    Kim, Yun Jeong; Kim, Jeong-Hee; Lee, Kwang-Jun; Choi, Myung-Min; Kim, Yeon Hee; Rhie, Gi-eun; Yoo, Cheon-Kwon; Cha, Kiweon; Shin, Na-Ri

    2015-01-01

    Botulinum neurotoxin type A (BoNT/A) is the most potent protein toxin and causes fatal flaccid muscle paralysis by blocking neurotransmission. Application of BoNT/A has been extended to the fields of therapeutics and biodefense. Nevertheless, the global response of host immune cells to authentic BoNT/A has not been reported. Employing microarray analysis, we performed global transcriptional profiling of RAW264.7 cells, a murine alveolar macrophage ce