Science.gov

Sample records for receptor tlr genes

  1. Genomic organization and transcript profiling of the bovine toll-like receptor gene cluster TLR6-TLR1-TLR10.

    PubMed

    Opsal, Monica Aa; Våge, Dag Inge; Hayes, Ben; Berget, Ingunn; Lien, Sigbjørn

    2006-12-15

    Toll-like receptors (TLRs) are a family of recognition receptors playing a crucial role in the innate immune system. Different combinations of TLRs are thought to be crucial for effective immune response, thus insight into the organization and expression of TLRs is important for understanding disease resistance. Mastitis is the most frequent and costly disease in dairy production, and the innate immune system is considered to be important in the first line defence against this disease. In the present paper we have characterized the genomic organization of TLR6-TLR1-TLR10 in a approximately 50 kb region of bovine chromosome 6, including 5'-untranslated exons not previously described. A method for gene expression analysis was developed and used for transcription profiling of the three paralogous genes in different bovine tissues. The expression analysis showed similar expression profiles for TLR1 and TLR6, which indicate a co-regulation of these two genes in cattle. TLR10 had a different expression profile, pointing toward a stronger functional diversification compared to TLR1 and TLR6. The differences in expression are in accordance with the evolutionary history of this gene cluster, where TLR10 diverged from the common ancestral gene before the duplication event that created TLR1 and TLR6.

  2. Genetic variation in the toll-like receptor gene cluster (TLR10-TLR1-TLR6) and prostate cancer risk.

    PubMed

    Stevens, Victoria L; Hsing, Ann W; Talbot, Jeffrey T; Zheng, Siqun Lilly; Sun, Jielin; Chen, Jinbo; Thun, Michael J; Xu, Jianfeng; Calle, Eugenia E; Rodriguez, Carmen

    2008-12-01

    Toll-like receptors (TLRs) are key players in the innate immune system and initiate the inflammatory response to foreign pathogens such as bacteria, fungi and viruses. The proposed role of chronic inflammation in prostate carcinogenesis has prompted investigation into the association of common genetic variation in TLRs with the risk of this cancer. We investigated the role of common SNPs in a gene cluster encoding the TLR10, TLR6 and TLR1 proteins in prostate cancer etiology among 1,414 cancer cases and 1,414 matched controls from the Cancer Prevention Study II Nutrition Cohort. Twenty-eight SNPs, which included the majority of the common nonsynonymous SNPs in the 54-kb gene region and haplotype-tagging SNPs that defined 5 specific haplotype blocks, were genotyped and their association with prostate cancer risk determined. Two SNPs in TLR10 [I369L (rs11096955) and N241H (rs11096957)] and 4 SNPs in TLR1 [N248S (rs4833095), S26L (rs5743596), rs5743595 and rs5743551] were associated with a statistically significant reduced risk of prostate cancer of 29-38% (for the homozygous variant genotype). The association of these SNPs was similar when the analysis was limited to cases with advanced prostate cancer. Haplotype analysis and linkage disequilibrium findings revealed that the 6 associated SNPs were not independent and represent a single association with reduced prostate cancer risk (OR = 0.55, 95% CI: 0.33, 0.90). Our study suggest that a common haplotype in the TLR10-TLR1-TLR6 gene cluster influences prostate cancer risk and clearly supports the need for further investigation of TLR genes in other populations.

  3. Repurposed transcriptomic data facilitate discovery of innate immunity toll-like receptor (TLR) Genes across Lophotrochozoa.

    PubMed

    Halanych, Kenneth M; Kocot, Kevin M

    2014-10-01

    The growing volume of genomic data from across life represents opportunities for deriving valuable biological information from data that were initially collected for another purpose. Here, we use transcriptomes collected for phylogenomic studies to search for toll-like receptor (TLR) genes in poorly sampled lophotrochozoan clades (Annelida, Mollusca, Brachiopoda, Phoronida, and Entoprocta) and one ecdysozoan clade (Priapulida). TLR genes are involved in innate immunity across animals by recognizing potential microbial infection. They have an extracellular leucine-rich repeat (LRR) domain connected to a transmembrane domain and an intracellular toll/interleukin-1 receptor (TIR) domain. Consequently, these genes are important in initiating a signaling pathway to trigger defense. We found at least one TLR ortholog in all but two taxa examined, suggesting that a broad array of lophotrochozoans may have innate immune systems similar to those observed in vertebrates and arthropods. Comparison to the SMART database confirmed the presence of both the LRR and the TIR protein motifs characteristic of TLR genes. Because we looked at only one transcriptome per species, discovery of TLR genes was limited for most taxa. However, several TRL-like genes that vary in the number and placement of LRR domains were found in phoronids. Additionally, several contigs contained LRR domains but lacked TIR domains, suggesting they were not TLRs. Many of these LRR-containing contigs had other domains (e.g., immunoglobin) and are likely involved in innate immunity. © 2014 Marine Biological Laboratory.

  4. Cloning, expression and functional analysis of the duck Toll-like receptor 5 (TLR5) gene

    PubMed Central

    Cheng, Yuqiang; Sun, Yingjie; Wang, Hengan; Shi, Shuduan; Yan, Yaxian; Li, Jing

    2015-01-01

    Toll-like receptor 5 (TLR5) is responsible for the recognition of bacterial flagellin in vertebrates. In the present study, the first TLR5 gene in duck was cloned. The open reading frame (ORF) of duck TLR5 (dTLR5) cDNA is 2580 bp and encodes a polypeptide of 859 amino acids. We also cloned partial sequences of myeloid differentiation factor 88, 2'-5'-oligoadenylate synthetase (OAS), and myxovirus resistance (Mx) genes from duck. dTLR5 mRNA was highly expressed in the bursa of Fabricius, spleen, trachea, lung, jejunum, rectum, and skin; moderately expressed in the muscular and glandular tissues, duodenum, ileum, caecum, and pancreas; and minimally expressed in the heart, liver, kidney, and muscle. DF-1 or HeLa cells transfected with DNA constructs encoding dTLR5 can activate NF-κB leading to the activation of interleukin-6 (IL-6) promoter. When we challenged ducks with a Herts33 Newcastle disease virus (NDV), mRNA transcription of the antiviral molecules Mx, Double stranded RNA activated protein kinase (PKR), and OAS was up-regulated in the liver, lung, and spleen 1 and 2 days post-inoculation. PMID:25269719

  5. The heterogeneous allelic repertoire of human toll-like receptor (TLR) genes.

    PubMed

    Georgel, Philippe; Macquin, Cécile; Bahram, Seiamak

    2009-11-17

    Toll-Like Receptors (TLR) are critical elements of the innate arm of the vertebrate immune system. They constitute a multigenic family of receptors which collectively bind a diverse array of--exogeneous as well as endogeneous--ligands. An exponential burst of knowledge has defined their biological role in fight against infections and generation/modulation of auto-immune disorders. Hence, they could at least be conceptually recognized--despite being structurally unrelated - as innate counterparts to Major Histocompatibility Complex (MHC) molecules--equally recognizing antigenic ligands (albeit structurally more homogeneous i.e., peptides), again derived from self and/or non-self sources--preeminent this time in adaptive immunity. Our great disparities in face of infections and/or susceptibility to auto-immune diseases have provoked an intense search for genetic explanations, in part satisfied by the extraordinary MHC allelic repertoire. An equally in-depth and systematic analysis of TLR diversity is lacking despite numerous independent reports of a growing number of SNPs within these loci. The work described here aims at providing a preliminary picture of the allelic repertoire--and not purely SNPs--of all 10 human TLR coding sequences (with exception of TLR3) within a single cohort of up to 100 individuals. It appears from our work that TLR are unequally polymorphic: TLR2 (DNA alleles: 7/protein alleles: 3), 4 (4/3), 7 (6/3), 8 (9/2) and 9 (8/3) being comparatively least diverse whereas TLR1 (11/10), 5 (14/12), 6 (10/8) and 10 (15/10) show a substantial number of alleles. In addition to allelic assignment of a large number of SNPs, 10 new polymorphic positions were hereby identified. Hence this work depicts a first overview of the diversity of almost all human TLR genes, a prelude for large-scale population genetics as well as genetic association studies.

  6. Toll-like receptors-2 and -9 (TLR2 and TLR9) gene polymorphism in patients with type 2 diabetes and diabetic foot

    PubMed Central

    Wifi, Mohamed-Naguib Abdalla; Assem, Maha; Elsherif, Rasha Hamed; El-Azab, Hameda Abdel-Fattah; Saif, Aasem

    2017-01-01

    Abstract Toll-like receptors (TLRs) are innate immune receptors that mediate the inflammatory response in diabetes mellitus (DM). The aim of this study is to evaluate the association of TLR2 and TLR9 gene polymorphism in patients with type 2 DM (T2DM) and diabetic foot (DF). The study included 90 subjects divided into group I (30 patients with T2DM and DF), group II (30 patients with T2DM and no evidence of DF), and group III (normal control subjects). TLR2 (1350 T/C, rs3804100) and TLR9 (1237 T/C, rs5743836) genotyping was performed by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) technique for all subjects. There was a statistically significant difference in the distribution of TLR9-1237 T/C genotypes between groups I and II (P < .029) as well as between groups I and III (P < .001). Calculated risk estimation revealed that TLR9-1237 polymorphism conferred almost 20 times increased risk of DF disorders in T2DM (OR = 20, 95% CI = 5.38–74.30). There was no statistical difference in the distribution of TLR2-1350T/C genotypes between the 3 groups. TLR9-1237 T/C gene polymorphism may be considered as a molecular risk for DF among patients with T2DM. PMID:28445304

  7. Toll-like receptors-2 and -9 (TLR2 and TLR9) gene polymorphism in patients with type 2 diabetes and diabetic foot.

    PubMed

    Wifi, Mohamed-Naguib Abdalla; Assem, Maha; Elsherif, Rasha Hamed; El-Azab, Hameda Abdel-Fattah; Saif, Aasem

    2017-04-01

    Toll-like receptors (TLRs) are innate immune receptors that mediate the inflammatory response in diabetes mellitus (DM). The aim of this study is to evaluate the association of TLR2 and TLR9 gene polymorphism in patients with type 2 DM (T2DM) and diabetic foot (DF).The study included 90 subjects divided into group I (30 patients with T2DM and DF), group II (30 patients with T2DM and no evidence of DF), and group III (normal control subjects). TLR2 (1350 T/C, rs3804100) and TLR9 (1237 T/C, rs5743836) genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique for all subjects.There was a statistically significant difference in the distribution of TLR9-1237 T/C genotypes between groups I and II (P < .029) as well as between groups I and III (P < .001). Calculated risk estimation revealed that TLR9-1237 polymorphism conferred almost 20 times increased risk of DF disorders in T2DM (OR = 20, 95% CI = 5.38-74.30). There was no statistical difference in the distribution of TLR2-1350T/C genotypes between the 3 groups.TLR9-1237 T/C gene polymorphism may be considered as a molecular risk for DF among patients with T2DM.

  8. Hymenolepis diminuta: analysis of the expression of Toll-like receptor genes (TLR2 and TLR4) in the small and large intestines of rats. Part II.

    PubMed

    Kosik-Bogacka, D I; Wojtkowiak-Giera, A; Kolasa, A; Czernomysy-Furowicz, D; Lanocha, N; Wandurska-Nowak, E; Salamatin, R; Jagodzinski, P P

    2013-10-01

    Toll-like receptors in the gastrointestinal tract can influence intestinal homeostasis and play a role in the repair and restitution of intestinal epithelium following tissue damage. In our previous study a statistically significant increase in the level of TLR4 and TLR2 gene expression was observed in rats in early stages of hymenolepidosis. Moreover, the immunopositive cell number and the intensity of immunohistochemical staining (indicating the presence of TLRs within intestinal epithelial cells) increased over the infection period. In this paper, we determined changes in the expression of TLR2 and TLR4 and the number of anaerobic intestinal commensal bacteria in Hymenolepis diminuta infected rats. In the isolated jejunum of infected rats at 16 days post infection (dpi), the expression of TLR4 and TLR2 was significantly higher than uninfected rats. In the colon, a statistically significantly increased expression of TLR2 was observed from 16 to 40 dpi, and TLR4 from 16 to 60 dpi. The jejunum and colon of infected rats contained Gram-negative bacteria (Escherichia coli), Gram-positive bacteria (Enterococcus, Streptococcus, Staphylococcus, Bacillus, Lactobacillus) and Candida. The total number of intestinal bacteria was higher in H. diminuta infected rats, but the observed microbiota had only minor effects on the expression of TLR2 and TLR4. Toll-like receptors play a role in maintaining epithelial barrier function in response to enteric pathogens and parasites. In our study, the alteration of TLR2 and TLR4 expression in the infected rats indicates the potential role of the innate immune system in the pathomechanism of this infection.

  9. Modulation of TLR2, TLR4, TLR5, NOD1 and NOD2 receptor gene expressions and their downstream signaling molecules following thermal stress in the Indian major carp catla (Catla catla).

    PubMed

    Basu, Madhubanti; Paichha, Mahismita; Swain, Banikalyan; Lenka, Saswati S; Singh, Samarpal; Chakrabarti, Rina; Samanta, Mrinal

    2015-12-01

    Toll-like receptors (TLRs) and nucleotide binding and oligomerization domain (NOD) receptors are pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs) and play crucial role in innate immunity. In addition to PAMPs, PRRs recognize endogenous molecules released from damaged tissue or dead cells [damage-associated molecular patterns (DAMPs)] and activate signaling cascades to induce inflammatory processes. In the aquatic environment, large variation in seasonal and diurnal water temperature causes heat and cold stresses in fish, resulting in tissue injury and mortality of fish. In the Indian subcontinent, catla (Catla catla) is an economically important freshwater fish species and is prone to thermal stresses. To investigate the response of pattern recognition receptors in thermal stress, we analyzed TLRs (TLR2, TLR4 and TLR5) and NOD (NOD1 and NOD2) receptors gene expression in catla following heat and cold stress. Analysis of tissue samples (gill, liver, kidney and blood) of the thermal stressed and control fish by quantitative real-time PCR (qRT-PCR) assay revealed significant (p < 0.05) induction of TLR2, TLR4 and NOD2 gene expression in majority of the tested tissues of the treated fish as compared to the control. The expression of TLR5 and NOD1 gene was also induced in the heat and cold stressed fish, but mostly restricted in the blood. The downstream signaling molecule of TLR and NOD signaling pathway viz., MyD88 (myeloid differentiation primary response gene 88) and RICK (receptor interacting serine-threonine protein kinase-2) was also induced in the thermal stressed fish suggesting the engagement of TLR and NOD signaling pathway during thermal stress.

  10. Signatures of positive selection in Toll-like receptor (TLR) genes in mammals

    PubMed Central

    2011-01-01

    Background Toll-like receptors (TLRs) are a major class of pattern recognition receptors (PRRs) expressed in the cell surface or membrane compartments of immune and non-immune cells. TLRs are encoded by a multigene family and represent the first line of defense against pathogens by detecting foreigner microbial molecular motifs, the pathogen-associated molecular patterns (PAMPs). TLRs are also important by triggering the adaptive immunity in vertebrates. They are characterized by the presence of leucine-rich repeats (LRRs) in the ectodomain, which are associated with the PAMPs recognition. The direct recognition of different pathogens by TLRs might result in different evolutionary adaptations important to understand the dynamics of the host-pathogen interplay. Ten mammal TLR genes, viral (TLR3, 7, 8, 9) and non-viral (TLR1-6, 10), were selected to identify signatures of positive selection that might have been imposed by interacting pathogens and to clarify if viral and non-viral TLRs might display different patterns of molecular evolution. Results By using Maximum Likelihood approaches, evidence of positive selection was found in all the TLRs studied. The number of positively selected codons (PSC) ranged between 2-26 codons (0.25%-2.65%) with the non-viral TLR4 as the receptor with higher percentage of positively selected codons (2.65%), followed by the viral TLR8 (2.50%). The results indicated that viral and non-viral TLRs are similarly under positive selection. Almost all TLRs have at least one PSC located in the LRR ectodomain which underlies the importance of the pathogen recognition by this region. Conclusions Our results are not in line with previous studies on primates and birds that identified more codons under positive selection in non-viral TLRs. This might be explained by the fact that both primates and birds are homogeneous groups probably being affected by only a restricted number of related viruses with equivalent motifs to be recognized. The analyses

  11. Genetic polymorphism in CD14 gene, a co-receptor of TLR4 associated with non-alcoholic fatty liver disease

    PubMed Central

    Kapil, Shweta; Duseja, Ajay; Sharma, Bal Krishan; Singla, Bhupesh; Chakraborti, Anuradha; Das, Ashim; Ray, Pallab; Dhiman, Radha K; Chawla, Yogesh

    2016-01-01

    AIM To evaluate the pathogenic role of toll-like receptor (TLR) gene polymorphisms in patients with non-alcoholic fatty liver disease (NAFLD). METHODS Two hundred and fifty subjects (NAFLD = 200, healthy volunteers = 50) underwent polymerase chain reaction and restriction fragment length polymorphism to assess one polymorphism in the toll-like receptor 2 (TLR2) gene (A753G), two polymorphisms in the TLR4 gene (TLR4 Asp299Gly and Thr399Ile allele), and two polymorphisms in the cluster of differentiation 14 (CD14) (C-159T and C-550T) gene, a co-receptor of TLR4. Association of TLR gene polymorphisms with NAFLD and its severity was evaluated by genetic models of association. RESULTS On both multiplicative and recessive models of gene polymorphism association, there was significant association of CD14 C (-159) T polymorphism with NAFLD; patients with TT genotype had a 2.6 fold increased risk of developing NAFLD in comparison to CC genotype. There was no association of TLR2 Arg753Gln, TLR4 Asp299Gly, Thr399Ile, and CD14 C (-550) T polymorphisms with NAFLD. None of the TLR gene polymorphisms had an association with histological severity of NAFLD. CONCLUSION Patients with CD14 C (-159) T gene polymorphism, a co-receptor of TLR4, have an increased risk of NAFLD development. PMID:27895422

  12. Molecular cloning and expression analysis of toll-like receptor genes (TLR7, TLR8 and TLR9) of golden pompano (Trachinotus ovatus).

    PubMed

    Wei, Youchuan; Hu, Shu; Sun, Baobao; Zhang, Qihuan; Qiao, Guo; Wang, Zisheng; Shao, Rong; Huang, Guoqiang; Qi, Zhitao

    2017-02-20

    Toll like receptor (TLR) 7, 8 and 9 are intracellular TLRs which play important roles in host immune defense against bacterial or virus pathogens. In this study, TLR7, 8 and 9 were identified from golden pompano (Trachinotus ovatus), a marine teleost with great economic values. Sequence analysis revealed that the three TLRs contained several conserved characteristic features, including signal peptides, 25 leucine-rich repeat (LRR) motifs, a transmembrane domain and a TIR motif. These three TLRs shared high sequence identity and similarity with their counterparts from other teleosts. The phylogenetic tree analysis showed the three TLRs were clustered well with their piscine counterparts, confirming the correctness of their nomenclatures and closed relationships during evolution. Quantitative real-time PCR revealed that the three TLRs were ubiquitously expressed in all the tested tissues from normal pompano, with high expression in spleen and head kidney, indicating their role in immune reaction. Further, pompano TLR7 and TLR8 was up-regulated in spleen and head kidney from 12 h to 48 h following polyI:C challenge, but remained no changes to Vibrio alginilyticus infection. In contrast, pompano TLR9 could be induced by V. alginilyticus infection but remained apathetic to polyI:C challenge. These results indicated that pompano TLR7, 8 and 9 might have distinct roles in response to bacterial or virus pathogens. Our results provided the basis for further study on ligand specificity and signaling pathways of fish TLRs which are required for elucidating the immune functions of fish TLRs.

  13. Hymenolepis diminuta: analysis of the expression of Toll-like receptor genes and protein (TLR3 and TLR9) in the small and large intestines of rats.

    PubMed

    Kosik-Bogacka, Danuta I; Wojtkowiak-Giera, Agnieszka; Kolasa, Agnieszka; Baranowska-Bosiacka, Irena; Lanocha, Natalia; Wandurska-Nowak, Elzbieta; Izabela, Gutowska; Salamatin, Ruslan; Jagodzinski, Paweł P

    2014-10-01

    Toll-like receptors (TLRs) play a fundamental role in the rapid activation of innate immune responses to a variety of pathogen-associated molecular patterns (PAMPs). In a previous study we observed an increase in the level of expression of TLR2 and TLR4 mRNA in the jejunum and colon during experimental hymenolepidosis in rats. In this study, we performed a quantitative real-time polymerase chain reaction (qRT-PCR), Western blot analysis and immunohistochemical staining of TLR3 and TLR9 receptors during experimental hymenolepidosis in rats. The levels of mRNA and protein expression of TLR3 and TLR9 in the jejunum had increased at 16 days post Hymenolepis diminuta infection (dpi) in the case of TLR3 and at 16 and 25 dpi in the case of TLR9. In the colon the expression of TLR3 and TLR9 had increased at 16, 25 and 40 dpi. The results of the immunohistochemical reactions showed that H. diminuta infected rats (16, 25, 40 and 60 dpi) exhibited changes in TLR3 and TLR9 localization and intensity in the epithelial cells of the jejunum and colon. The changes in the level of TLR3 and TLR9 expression may confirm involvement of the innate immune system in the pathomechanism of hymenolepidosis.

  14. Expression of many immunologically important genes in Mycobacterium tuberculosis-infected macrophages is independent of both TLR2 and TLR4 but dependent on IFN-alphabeta receptor and STAT1.

    PubMed

    Shi, Shuangping; Blumenthal, Antje; Hickey, Christopher M; Gandotra, Sheetal; Levy, David; Ehrt, Sabine

    2005-09-01

    Macrophages respond to several subcellular products of Mycobacterium tuberculosis (Mtb) through TLR2 or TLR4. However, primary mouse macrophages respond to viable, virulent Mtb by pathways largely independent of MyD88, the common adaptor molecule for TLRs. Using microarrays, quantitative PCR, and ELISA with gene-disrupted macrophages and mice, we now show that viable Mtb elicits the expression of inducible NO synthase, RANTES, IFN-inducible protein 10, immune-responsive gene 1, and many other key genes in macrophages substantially independently of TLR2, TLR4, their combination, or the TLR adaptors Toll-IL-1R domain-containing adapter protein and Toll-IL-1R domain-containing adapter inducing IFN-beta. Mice deficient in both TLR2 and TLR4 handle aerosol infection with viable Mtb as well as congenic controls. Viable Mtb also up-regulates inducible NO synthase, RANTES, IFN-inducible protein 10, and IRG1 in macrophages that lack mannose receptor, complement receptors 3 and 4, type A scavenger receptor, or CD40. These MyD88, TLR2/4-independent transcriptional responses require IFN-alphabetaR and STAT1, but not IFN-gamma. Conversely, those genes whose expression is MyD88 dependent do not depend on IFN-alphabetaR or STAT1. Transcriptional induction of TNF is TLR2/4, MyD88, STAT1, and IFN-alphabetaR independent, but TNF protein release requires the TLR2/4-MyD88 pathway. Thus, macrophages respond transcriptionally to viable Mtb through at least three pathways. TLR2 mediates the responses of a numerically minor set of genes that collectively do not appear to affect the course of infection in mice; regulation of TNF requires TLR2/4 for post-transcriptional control, but not for transcriptional induction; and many responding genes are regulated through an unknown, TLR2/4-independent pathway that may involve IFN-alphabetaR and STAT1.

  15. SNP marker discovery in koala TLR genes.

    PubMed

    Cui, Jian; Frankham, Greta J; Johnson, Rebecca N; Polkinghorne, Adam; Timms, Peter; O'Meally, Denis; Cheng, Yuanyuan; Belov, Katherine

    2015-01-01

    Toll-like receptors (TLRs) play a crucial role in the early defence against invading pathogens, yet our understanding of TLRs in marsupial immunity is limited. Here, we describe the characterisation of nine TLRs from a koala immune tissue transcriptome and one TLR from a draft sequence of the koala genome and the subsequent development of an assay to study genetic diversity in these genes. We surveyed genetic diversity in 20 koalas from New South Wales, Australia and showed that one gene, TLR10 is monomorphic, while the other nine TLR genes have between two and 12 alleles. 40 SNPs (16 non-synonymous) were identified across the ten TLR genes. These markers provide a springboard to future studies on innate immunity in the koala, a species under threat from two major infectious diseases.

  16. SNP Marker Discovery in Koala TLR Genes

    PubMed Central

    Cui, Jian; Frankham, Greta J.; Johnson, Rebecca N.; Polkinghorne, Adam; Timms, Peter; O’Meally, Denis; Cheng, Yuanyuan; Belov, Katherine

    2015-01-01

    Toll-like receptors (TLRs) play a crucial role in the early defence against invading pathogens, yet our understanding of TLRs in marsupial immunity is limited. Here, we describe the characterisation of nine TLRs from a koala immune tissue transcriptome and one TLR from a draft sequence of the koala genome and the subsequent development of an assay to study genetic diversity in these genes. We surveyed genetic diversity in 20 koalas from New South Wales, Australia and showed that one gene, TLR10 is monomorphic, while the other nine TLR genes have between two and 12 alleles. 40 SNPs (16 non-synonymous) were identified across the ten TLR genes. These markers provide a springboard to future studies on innate immunity in the koala, a species under threat from two major infectious diseases. PMID:25799012

  17. Molecular and functional characterization of Toll-like receptor (Tlr)1 and Tlr2 in common carp (Cyprinus carpio).

    PubMed

    Fink, Inge R; Pietretti, Danilo; Voogdt, Carlos G P; Westphal, Adrie H; Savelkoul, Huub F J; Forlenza, Maria; Wiegertjes, Geert F

    2016-09-01

    Toll-like receptors (TLRs) are fundamental components of innate immunity that play significant roles in the defence against pathogen invasion. In this study, we present the molecular characterization of the full-length coding sequence of tlr1, tlr2a and tlr2b from common carp (Cyprinus carpio). Each is encoded within a single exon and contains a conserved number of leucine-rich repeats, a transmembrane region and an intracellular TIR domain for signalling. Indeed, sequence, phylogenetic and synteny analysis of carp tlr1, tlr2a and tlr2b support that these genes are orthologues of mammalian TLR1 and TLR2. The tlr genes are expressed in various immune organs and cell types. Furthermore, the carp sequences exhibited a good three-dimensional fit with the heterodimer structure of human TLR1-TLR2, including the potential to bind to the ligand Pam3CSK4. This supports the possible formation of carp Tlr1-Tlr2 heterodimers. However, we were unable to demonstrate Tlr1/Tlr2-mediated ligand binding in transfected cell lines through NF-κB activation, despite showing the expression and co-localization of Tlr1 and Tlr2. We discuss possible limitations when studying ligand-specific activation of NF-κB after expression of Tlr1 and/or Tlr2 in human but also fish cell lines and we propose alternative future strategies for studying ligand-binding properties of fish Tlrs. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Toll-like receptor 1(TLR1) Gene SNP rs5743618 is associated with increased risk for tuberculosis in Han Chinese children.

    PubMed

    Qi, Hui; Sun, Lin; Wu, Xirong; Jin, Yaqiong; Xiao, Jing; Wang, Shengfeng; Shen, Chen; Chu, Ping; Qi, Zhan; Xu, Fang; Guo, Yajie; Jiao, Weiwei; Tian, Jianling; Shen, Adong

    2015-03-01

    Toll-like receptor 1 (TLR1) recognizes lipopeptides with TLR2, and affects immune response to Mycobacterium tuberculosis infection. Here, we report results of the first case-control pediatric study of the TLR1 single-nucleotide polymorphisms and susceptibility to tuberculosis (TB). A pediatric case-control study enrolled 340 TB patients and 366 healthy controls, all Han Chinese from North China. Significant differences of the allelic and genotypic distributions of rs5743618 in TLR1 gene were observed between TB group and control group and, G allele of rs5743618 was associated with increased risk for TB (OR: 2.40, 95%CI: 1.41-4.07, P = 0.0009). TLR1 rs5743618 -GT genotype was related to reduction in surface expression of TLR1 in monocytes and granulocytes regardless of stimulation with inactivated H37Rv. In addition, after stimulated with inactivated lysate of M. tuberculosis strain H37Rv, samples of peripheral blood mononuclear cells (PBMCs) from children with the rs5743618 GT genotypes showed a decreased level of Tumor Necrosis Factor-a (TNF-a) and CXC chemokine ligand 10 (CXCL10) production, invariable production of interleukin-6 (IL-6) and IL-8 and increased production of IL-10 ex vivo. To conclude, TLR1 rs5743618 G allele was found associated to susceptibility to TB in Han Chinese pediatric population. TLR1 rs5743618-GT genotype carriers may have reduced immune response to MTB infection although further study is warranted to test this conclusion.

  19. The gene history of zebrafish tlr4a and tlr4b is predictive of their divergent functions.

    PubMed

    Sullivan, Con; Charette, Jeremy; Catchen, Julian; Lage, Christopher R; Giasson, Gregory; Postlethwait, John H; Millard, Paul J; Kim, Carol H

    2009-11-01

    Mammalian immune responses to LPS exposure are typified by the robust induction of NF-kappaB and IFN-beta responses largely mediated by TLR4 signal transduction pathways. In contrast to mammals, Tlr4 signal transduction pathways in nontetrapods are not well understood. Comprehensive syntenic and phylogenetic analyses support our hypothesis that zebrafish tlr4a and tlr4b genes are paralogous rather than orthologous to human TLR4. Furthermore, we provide evidence to support our assertion that the in vivo responsiveness of zebrafish to LPS exposure is not mediated by Tlr4a and Tlr4b paralogs because they fail to respond to LPS stimulation in vitro. Zebrafish Tlr4a and Tlr4b paralogs were also unresponsive to heat-killed Escherichia coli and Legionella pneumophila. Using chimeric molecules in which portions of the zebrafish Tlr4 proteins were fused to portions of the mouse TLR4 protein, we show that the lack of responsiveness to LPS was most likely due to the inability of the extracellular portions of zebrafish Tlr4a and Tlr4b to recognize the molecule, rather than to changes in their capacities to transduce signals through their Toll/IL-1 receptor (TIR) domains. Taken together, these findings strongly support the notion that zebrafish tlr4a and tlr4b paralogs have evolved to provide alternative ligand specificities to the Tlr immune defense system in this species. These data demonstrate that intensive examination of gene histories when describing the Tlr proteins of basally diverging vertebrates is required to obtain fuller appreciation of the evolution of their function. These studies provide the first evidence for the functional evolution of a novel Tlr.

  20. A Functional Toll-Like Receptor 3 Gene (TLR3) May Be a Risk Factor for Tick-borne Encephalitis Virus (TBEV) Infection

    PubMed Central

    Vene, Sirkka; Mickiene, Aukse; Lundkvist, Åke; Lindquist, Lars; Svensson, Lennart

    2011-01-01

    Background. Tick-borne encephalitis virus (TBEV) infections may be asymptomatic or cause severe symptoms in the central nervous system. A mutation in the chemokine receptor 5 gene has been associated with increased risk of TBE but explains only a limited number of cases. Investigations of further risk factors are needed. Method. To investigate the importance of the innate immune response, we analyzed 128 TBE patients, 77 patients with aseptic meningoencephalitis (AME) and 135 healthy controls, for 3mutations: 2 in the Toll-like receptor 3 (TLR3) gene and 1 in the 2′-5′-oligoadenylate synthetase (OAS1) gene. Results. Although no association was found between the mutation in the OAS1 gene and TBE, the genotype distribution ofrs3775291, a mutation in TLR3, differed significantly between TBE patients and controls; 61%, 32%, and 7% of the TBE patients were carriers of the wild-type, heterozygous, and mutant genotype of rs3775291, respectively. The corresponding percentages among healthy controls (n = 126) were 52%, 29%, and 19% (P = .02), and among AME patients (n = 75) were 47%, 32%, and 21% (P = .009). Additionally, the wild-type rs3775291 allele was more common among TBE patients than among healthy controls (allele frequency, .768 vs .663; P = .01). Conclusion. A functional TLR3 is a risk factor for TBEV infection. PMID:21216866

  1. Identification, characterization and genetic mapping of TLR7, TLR8a1 and TLR8a2 genes in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Palti, Yniv; Gahr, Scott A; Purcell, Maureen K; Hadidi, Sima; Rexroad, Caird E; Wiens, Gregory D

    2010-02-01

    Induction of the innate immune pathways is critical for early anti-viral defense but there is limited understanding of how teleost fish recognize viral molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 7 and 8 bind single-stranded RNA of viral origin and are activated by synthetic anti-viral imidazoquinoline compounds. Herein, we identify and describe the rainbow trout (Oncorhynchus mykiss) TLR7 and TLR8 gene orthologs and their mRNA expression. Two TLR7/8 loci were identified from a rainbow trout bacterial artificial chromosome (BAC) library using DNA fingerprinting and genetic linkage analyses. Direct sequencing of two representative BACs revealed intact omTLR7 and omTLR8a1 open reading frames (ORFs) located on chromosome 3 and a second locus on chromosome 22 that contains an omTLR8a2 ORF and a putative TLR7 pseudogene. We used the omTLR8a1/2 nomenclature for the two trout TLR8 genes as phylogenetic analysis revealed that they and all the other teleost TLR8 genes sequenced to date are similar to the zebrafish TLR8a, but are distinct from the zebrafish TLR8b. The duplicated trout loci exhibit conserved synteny with other fish genomes extending beyond the tandem of TLR7/8 genes. The trout TLR7 and 8a1/2 genes are composed of a single large exon similar to all other described TLR7/8 genes. The omTLR7 ORF is predicted to encode a 1049 amino acid (aa) protein with 84% similarity to the Fugu TLR7 and a conserved pattern of predicted leucine-rich repeats (LRR). The omTLR8a1 and omTLR8a2 are predicted to encode 1035- and 1034-aa proteins, respectively, and have 86% similarity to each other. omTLR8a1 is likely the ortholog of the only Atlantic salmon TLR8 gene described to date as they have 95% aa sequence similarity. The tissue expression profiles of omTLR7, omTLR8a1 and omTLR8a2 in healthy trout were highest in spleen tissue followed by anterior and then posterior kidney tissues. Rainbow trout anterior kidney leukocytes produced elevated

  2. Identification, characterization and genetic mapping of TLR7, TLR8a1 and TLR8a2 genes in rainbow trout (Oncorhynchus mykiss)

    USGS Publications Warehouse

    Palti, Yniv; Gahr, Scott A.; Purcell, Maureen K.; Hadidi, Sima; Rexroad, Caird E.; Wiens, Gregory A.

    2010-01-01

    Induction of the innate immune pathways is critical for early anti-viral defense but there is limited understanding of how teleost fish recognize viral molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 7 and 8 bind single-stranded RNA of viral origin and are activated by synthetic anti-viral imidazoquinoline compounds. Herein, we identify and describe the rainbow trout (Oncorhynchus mykiss) TLR7 and TLR8 gene orthologs and their mRNA expression. Two TLR7/8 loci were identified from a rainbow trout bacterial artificial chromosome (BAC) library using DNA fingerprinting and genetic linkage analyses. Direct sequencing of two representative BACs revealed intact omTLR7 and omTLR8a1 open reading frames (ORFs) located on chromosome 3 and a second locus on chromosome 22 that contains an omTLR8a2 ORF and a putative TLR7 pseudogene. We used the omTLR8a1/2 nomenclature for the two trout TLR8 genes as phylogenetic analysis revealed that they and all the other teleost TLR8 genes sequenced to date are similar to the zebrafish TLR8a, but are distinct from the zebrafish TLR8b. The duplicated trout loci exhibit conserved synteny with other fish genomes extending beyond the tandem of TLR7/8 genes. The trout TLR7 and 8a1/2 genes are composed of a single large exon similar to all other described TLR7/8 genes. The omTLR7 ORF is predicted to encode a 1049 amino acid (aa) protein with 84% similarity to the Fugu TLR7 and a conserved pattern of predicted leucine-rich repeats (LRR). The omTLR8a1 and omTLR8a2 are predicted to encode 1035- and 1034-aa proteins, respectively, and have 86% similarity to each other. omTLR8a1 is likely the ortholog of the only Atlantic salmon TLR8 gene described to date as they have 95% aa sequence similarity. The tissue expression profiles of omTLR7, omTLR8a1 and omTLR8a2 in healthy trout were highest in spleen tissue followed by anterior and then posterior kidney tissues. Rainbow trout anterior kidney leukocytes produced elevated

  3. Sequence characterization and phylogenetic analysis of Toll-like receptor (TLR) 4 gene in the Tibetan macaque (Macaca thibetana).

    PubMed

    Dai, Q X; Yao, Y F; Qi, Z C; Huang, Y; Ni, Q Y; Zhang, M W; Xu, H L

    2015-03-13

    In this study, the complete coding region sequence of an innate immune-related TLR4 gene was obtained from the Tibetan macaque (Macaca thibetana) genome via PCR and direct sequencing. The sequence had a total length of 2481 bp, contained 3 complete exons, and encoded 826 amino acids (AAs); its isoelectric point was 5.703, and the molecular weight was 94.72 kDa. The high structure prediction showed that the protein was comprised of one extracellular region, one transmembrane region, and one intracellular region. There were 48 potential functional sites in the protein, including glycosylation, phosphorylation, and acetylation sites. A homology analysis among 9 primate species, including the Tibetan macaque, human, chimpanzee, gibbon, rhesus macaque, cynomolgus monkey, pig-tailed monkey, squirrel monkey, and small-eared galago, showed that the homology of the nucleotide and AA sequences ranged from 60.9-99.5% and 51.4- 99.0%, respectively. Higher variability was identified in the extracellular region of the TLR4 protein, and its variable sites accounted for 88.79% (AA) of the total variable sites. Additionally, the number of AAs at the 3' end of the intracellular region was notably different among the primate lineages. The phylogenetic tree based on TLR4 gene exons of 9 primate species showed that the Tibetan macaque clustered with the rhesus macaque, cynomolgus monkey, and pig-tailed monkey; it was most distant from the small-eared galago. This study will provide an important basis for further study on the expression, regulation, and polymorphism of the TLR4 gene and the relationship between polymorphisms and host disease susceptibility.

  4. Identification and characterization of a functional, alternatively spliced Toll-like receptor 7 (TLR7) and genomic disruption of TLR8 in chickens

    PubMed Central

    Philbin, Victoria J; Iqbal, Muhammad; Boyd, Yvonne; Goodchild, Marianne J; Beal, Richard K; Bumstead, Nat; Young, John; Smith, Adrian L

    2005-01-01

    Based upon the recognition of antiviral compounds and single stranded viral RNA the Toll-like receptors TLR7 and TLR8 are suggested to play a significant role in initiating antiviral immune responses. Here we report the molecular characterization of the chicken TLR7/8 loci which revealed an intact TLR7 gene and fragments of a TLR8-like gene with a 6-kilobase insertion containing chicken repeat 1 (CR1) retroviral-like insertion elements. The chicken TLR7 gene encodes a 1047-amino-acid protein with 62% identity to human TLR7 and a conserved pattern of predicted leucine-rich repeats. Highest levels of chicken TLR7 mRNA were detected in immune-related tissues and cells, especially the spleen, caecal, tonsil and splenic B cells. Alternative spliced forms of TLR7 mRNA were identified in chicken, mouse and human and expressed in similar tissues and cell types to the major form of chicken TLR7. The chicken TLR7+ HD11 cell line and fresh splenocytes produced elevated levels of interleukin-1β (IL-1β) mRNA after exposure to the agonists R848 and loxoribine. Interestingly, none of the TLR7 agonists stimulated increased type I interferon (IFN) mRNA whereas poly(I:C) (a TLR3 agonist) up-regulated both chicken IFN-α and chicken IFN-β mRNA. In contrast, TLR7 agonists, particularly R848 and poly(U) stimulated up-regulation of chicken IL-1β, and chicken IL-8 mRNAs more effectively than poly(I:C). Stimulation of chicken TLR7 with R848 was chloroquine sensitive, suggesting signalling within an endosomal compartment, as for mammalian TLR7. The deletion of TLR8 in galliforms, accompanied with the differential response after exposure to TLR7 agonists, offers insight into the evolution of vertebrate TLR function. PMID:15804288

  5. Association between toll-like receptors 9 (TLR9) gene polymorphism and risk of pulmonary tuberculosis: meta-analysis.

    PubMed

    Chen, Zhi; Wang, Wei; Liang, Jianqin; Wang, Jinhe; Feng, Shisheng; Zhang, Guangyu

    2015-05-08

    Previous studies indicated that the single nucleotide polymorphisms (SNPs) in TLR9 gene might be associated with Tuberculosis (TB) risk. However, the results are inconsistent and inconclusive. 1745 articles from four databases were involved in our study. A meta-analysis on the associations between the seven polymorphisms and TB risk was carried out by comparison using different genetic models. In this systematic review 8 studies from seven English articles were analyzed. Our results showed that rs352139 is significantly associated with TB risk (AA vs. AG, OR 0.77, 95% CI 0.65-0.92, P = 0.004). In the ethnic subgroup analysis, Indonesians with AA genotype had a decreased susceptibility while Mexicans with GG allele had an increased risk. The meta-analysis indicated that rs352139 polymorphism might be associated with decreased TB risk in Indonesians whereas increased risk in Mexicans. Whether the observed association was due to causal effect needs to be further studied.

  6. HMGB1/TLR Receptor Danger Signaling Increases Brain Neuroimmune Activation in Alcohol Dependence

    PubMed Central

    Crews, Fulton T.; Qin, Liya; Sheedy, Donna; Vetreno, Ryan P.; Zou, Jian

    2012-01-01

    Background Innate immune gene expression is regulated in part through high mobility group box 1(HMGB1), an endogenous proinflammatory cytokine, that activates multiple members of the interleukin-1/Toll-like receptor (IL-1/TLR) family associated with danger signaling. We investigated expression of HMGB1, TLR2, TLR3 and TLR4 in chronic ethanol treated mouse brain, post-mortem human alcoholic brain, and rat brain slice culture to test the hypothesis that neuroimmune activation in alcoholic brain involves ethanol activation of HMGB1/TLR danger signaling. Methods Protein levels were assessed using Western blot, ELISA, immunohistochemical immunoreactivity (+IR), and mRNA levels were measured by real time PCR in ethanol-treated mice (5 g/kg/day, i.g., 10 days + 24 hr), rat brain slice culture, and post-mortem human alcoholic brain. Results Ethanol treatment of mice increased brain mRNA and +IR protein expression of HMGB1, TLR2, TLR3, and TLR4. Post-mortem human alcoholic brain also showed increased HMGB1, TLR2, TLR3, and TLR4+IR cells that correlated with lifetime alcohol consumption as well as each other. Ethanol treatment of brain slice culture released HMGB1 into the media and induced the proinflammatory cytokine, IL-1β. Neutralizing antibodies to HMGB1 and small inhibitory mRNA to HMGB1 or TLR4 blunted ethanol induction of IL-1β. Conclusions Ethanol-induced HMGB1/TLR signaling contributes to induction of the proinflammatory cytokine, IL-1β. Increased expression of HMGB1, TLR2, TLR3, and TLR4 in alcoholic brain and in mice treated with ethanol suggests that chronic alcohol-induced brain neuroimmune activation occurs through HMGB1/TLR signaling. PMID:23206318

  7. Grancalcin (GCA) modulates Toll-like receptor 9 (TLR9) mediated signaling through its direct interaction with TLR9.

    PubMed

    Kim, Tae Whan; Hong, Seunghee; Talukder, Amjad H; Pascual, Virginia; Liu, Yong-Jun

    2016-03-01

    Toll-like receptors (TLRs) are playing important roles in stimulating the innate immune response and intensifying adaptive immune response against invading pathogens. Appropriate regulation of TLR activation is important to maintain a balance between preventing tumor activation and inhibiting autoimmunity. Toll-like receptor 9 (TLR9) senses microbial DNA in the endosomes of plasmacytoid dendritic cells and triggers myeloid differentiation primary response gene 88 (MyD88) dependent nuclear factor kappa B (NF-κB) pathways and type I interferon (IFN) responses. However, mechanisms of how TLR9 signals are mediated and which molecules are involved in controlling TLR9 functions remain poorly understood. Here, we report that penta EF-hand protein grancalcin (GCA) interacts and binds with TLR9 in a yeast two-hybrid system and an overexpression system. Using siRNA-mediated knockdown experiments, we also revealed that GCA positively regulates type I IFN production, cytokine/chemokine production through nuclear localization of interferon regulatory factor 7 (IRF7), NF-κB activation, and mitogen-activated protein kinase (MAPK) activation in plasmacytoid dendritic cells. Our results indicate that heterodimerization of GCA and TLR9 is important for TLR9-mediated downstream signaling and might serve to fine tune processes against viral infection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. A non-synonymous single-nucleotide polymorphism in the gene encoding Toll-like Receptor 3 (TLR3) is associated with sero-negative rheumatoid arthritis (RA) in a Danish population.

    PubMed

    Laska, Magdalena J; Hansen, Bettina; Troldborg, Anne; Lorenzen, Tove; Stengaard-Pedersen, Kristian; Junker, Peter; Nexø, Bjørn A; Lindegaard, Hanne M

    2014-10-10

    It has been suggested that polymorphisms in Toll-like Receptors (TLRs) are associated with Rheumatoid Arthritis (RA), but the implicated alleles have differed between studies. The aim of this investigation was to explore whether polymorphisms of TLR genes are associated with RA in a predominantly Caucasian population from Denmark using a case-control approach. DNA samples (3 university hospital outpatient clinics) were obtained from patients with RA (n = 704) and healthy controls (n = 639) in a Danish population. TLR single nucleotide polymorphisms (SNPs) were selected based on the previously reported associations with chronic autoimmune diseases. Genotyping for the TLR SNPs was performed using Sequenom Multiplex technology.We identified one SNP in TLR3, [(rs3775291, P = 0.02, OR (95% CI) 1.31 (1.1087-1.5493)] significantly associated with the whole RA cohort. Subgroup analysis according to IgM rheumatoid factor (RF) and anti-cyclic citrinullated peptide (CCP) status suggested a significant association of sero-negative RA with the rs3775291 A allele and disease activity in this subset. These observations on a RA population of Danish ancestry suggest that variations in the TLR3 locus may be implicated in the pathogenesis of sero-negative RA. Since this TLR3 SNP has previously been associated with systemic lupus erythematous (SLE), the present findings support the notion that TLR3 genetic variants may represent a common risk factor in different chronic inflammatory conditions, including RA and SLE.

  9. Polymorphisms in the Tlr4 and Tlr5 Gene Are Significantly Associated with Inflammatory Bowel Disease in German Shepherd Dogs

    PubMed Central

    Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

    2010-01-01

    Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease. PMID:21203467

  10. Intramembrane attenuation of the TLR4-TLR6 dimer impairs receptor assembly and reduces microglia-mediated neurodegeneration.

    PubMed

    Shmuel-Galia, Liraz; Klug, Yoel; Porat, Ziv; Charni, Meital; Zarmi, Batya; Shai, Yechiel

    2017-08-11

    Recently, a single study revealed a new complex composed of Toll-like receptor 4 (TLR4), TLR6, and CD36 induced by fibrillary Aβ peptides, the hallmark of Alzheimer's disease. Unlike TLRs located on the plasma membrane that dimerize on the membrane after ligand binding to their extracellular domain, the TLR4-TLR6-CD36 complex assembly has been suggested to be induced by intracellular signals from CD36, similar to integrin inside-out signaling. However, the assembly site of TLR4-TLR6-CD36 and the domains participating in Aβ-induced signaling is still unknown. By interfering with TLR4-TLR6 dimerization using a TLR4-derived peptide, we show that receptor assembly is abrogated within the plasma membrane. Furthermore, we reveal that the transmembrane domains of TLR4 and TLR6 have an essential role in receptor dimerization and activation. Inhibition of TLR4-TLR6 assembly was associated with reduced secretion of proinflammatory mediators from microglia cells, ultimately rescuing neurons from death. Our findings support TLR4-TLR6 dimerization induced by Aβ. Moreover, we shed new light on TLR4-TLR6 assembly and localization and show the potential of inhibiting TLR4-TLR6 dimerization as a treatment of Alzheimer's disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Targeted resequencing implicates the familial Mediterranean fever gene MEFV and the toll-like receptor 4 gene TLR4 in Behçet disease

    PubMed Central

    Kirino, Yohei; Zhou, Qing; Ishigatsubo, Yoshiaki; Mizuki, Nobuhisa; Tugal-Tutkun, Ilknur; Seyahi, Emire; Özyazgan, Yilmaz; Ugurlu, Serdal; Erer, Burak; Abaci, Neslihan; Ustek, Duran; Meguro, Akira; Ueda, Atsuhisa; Takeno, Mitsuhiro; Inoko, Hidetoshi; Ombrello, Michael J.; Satorius, Colleen L.; Maskeri, Baishali; Mullikin, James C.; Sun, Hong-Wei; Gutierrez-Cruz, Gustavo; Kim, Yoonhee; Wilson, Alexander F.; Kastner, Daniel L.; Gül, Ahmet; Remmers, Elaine F.

    2013-01-01

    Genome-wide association studies (GWAS) are a powerful means of identifying genes with disease-associated common variants, but they are not well-suited to detecting genes with disease-associated rare and low-frequency variants. In the current study of Behçet disease (BD), nonsynonymous variants (NSVs) identified by deep exonic resequencing of 10 genes found by GWAS (IL10, IL23R, CCR1, STAT4, KLRK1, KLRC1, KLRC2, KLRC3, KLRC4, and ERAP1) and 11 genes selected for their role in innate immunity (IL1B, IL1R1, IL1RN, NLRP3, MEFV, TNFRSF1A, PSTPIP1, CASP1, PYCARD, NOD2, and TLR4) were evaluated for BD association. A differential distribution of the rare and low-frequency NSVs of a gene in 2,461 BD cases compared with 2,458 controls indicated their collective association with disease. By stringent criteria requiring at least a single burden test with study-wide significance and a corroborating test with at least nominal significance, rare and low-frequency NSVs in one GWAS-identified gene, IL23R (P = 6.9 × 10−5), and one gene involved in innate immunity, TLR4 (P = 8.0 × 10−4), were associated with BD. In addition, damaging or rare damaging NOD2 variants were nominally significant across all three burden tests applied (P = 0.0063–0.045). Furthermore, carriage of the familial Mediterranean fever gene (MEFV) mutation Met694Val, which is known to cause recessively inherited familial Mediterranean fever, conferred BD risk in the Turkish population (OR, 2.65; P = 1.8 × 10−12). The disease-associated NSVs in MEFV and TLR4 implicate innate immune and bacterial sensing mechanisms in BD pathogenesis. PMID:23633568

  12. Toll-Like Receptor 9 Alternatively Spliced Isoform Negatively Regulates TLR9 Signaling in Teleost Fish

    PubMed Central

    Chen, Nai-Yu; Nagarajan, Govindarajulu; Chiou, Pinwen Peter

    2015-01-01

    Toll-like receptor 9 (TLR9) recognizes and binds unmethylated CpG motifs in DNA, which are found in the genomes of bacteria and DNA viruses. In fish, Tlr9 is highly diverse, with the number of introns ranging from 0 to 4. A fish Tlr9 gene containing two introns has been reported to express two alternatively spliced isoforms, namely gTLR9A (full-length) and gTLR9B (with a truncated Cʹ-terminal signal transducing domain), whose regulation and function remain unclear. Here, we report a unique regulatory mechanism of gTLR9 signaling in orange-spotted grouper (Epinephelus coioides), whose gTlr9 sequence also contains two introns. We demonstrated that the grouper gTlr9 gene indeed has the capacity to produce two gTLR9 isoforms via alternative RNA splicing. We found that gTLR9B could function as a negative regulator to suppress gTLR9 signaling as demonstrated by the suppression of downstream gene expression. Following stimulation with CpG oligodeoxynucleotide (ODN), gTLR9A and gTLR9B were observed to translocate into endosomes and co-localize with ODN and the adaptor protein gMyD88. Both gTLR9A and gTLR9B could interact with gMyD88; however, gTLR9B could not interact with downstream IRAK4 and TRAF6. Further analysis of the expression profile of gTlr9A and gTlr9B upon immune-stimulation revealed that the two isoforms were differentially regulated in a time-dependent manner. Overall, these data suggest that fish TLR9B functions as a negative regulator, and that its temporal expression is mediated by alternative RNA splicing. This has not been observed in mammalian TLR9s and might have been acquired relatively recently in the evolution of fish. PMID:25955250

  13. Naturally occurring Toll-like receptor 11 (TLR11) and Toll-like receptor 12 (TLR12) polymorphisms are not associated with Toxoplasma gondii infection in wild wood mice.

    PubMed

    Morger, Jennifer; Bajnok, Jaroslav; Boyce, Kellyanne; Craig, Philip S; Rogan, Michael T; Lun, Zhao-Rong; Hide, Geoff; Tschirren, Barbara

    2014-08-01

    Toxoplasma gondii is a highly successful parasite with a worldwide prevalence. Small rodents are the main intermediate hosts, and there is growing evidence that T. gondii modifies their behaviour. Chronically infected rodents show impaired learning capacity, enhanced activity, and, most importantly, a reduction of the innate fear towards cat odour. This modification of host behaviour ensures a successful transmission of T. gondii from rodents to felids, the definitive hosts of the parasite. Given the negative fitness consequences of this behavioural manipulation, as well as an increased mortality during the acute phase of infection, we expect rodents to evolve potent resistance mechanisms that prevent or control infection. Indeed, studies in laboratory mice have identified candidate genes for T. gondii resistance. Of particular importance appear to be the innate immune receptors Toll-like receptor 11 (TLR11) and Toll-like receptor 12 (TLR12), which recognise T. gondii profilin and initiate immune responses against the parasite. Here we analyse the genetic diversity of TLR11 and TLR12 in a natural population of wood mice (Apodemus sylvaticus), and test for associations between TLR11 and TLR12 polymorphisms and T. gondii infection, as well as for epistatic interactions between TLR11 and TLR12 on infection status. We found that both TLR11 and TLR12 were polymorphic in wood mice, with four and nine amino acid haplotypes, respectively. However, we found no evidence that TLR11 or TLR12 genotypes or haplotypes were significantly associated with Toxoplasma infection. Despite the importance of TLR11 and TLR12 in T. gondii recognition and immune defence initiation, naturally occurring polymorphisms at TLR11 and TLR12 thus appear to play a minor role in mediating qualitative resistance to T. gondii in natural host populations of A. sylvaticus. This highlights the importance of assessing the role of candidate genes for parasite resistance identified in a laboratory setting in

  14. Transcriptional Regulation of Tlr11 Gene Expression in Epithelial Cells*

    PubMed Central

    Cai, Zhenyu; Shi, Zhongcheng; Sanchez, Amir; Zhang, Tingting; Liu, Mingyao; Yang, Jianghua; Wang, Fen; Zhang, Dekai

    2009-01-01

    As sensors of invading microorganisms, Toll-like receptors (TLRs) are expressed not only on macrophages and dendritic cells (DCs) but also on epithelial cells. In the TLR family, Tlr11 appears to have the unique feature in that it is expressed primarily on epithelial cells, although it is also expressed on DCs and macrophages. Here, we demonstrate that transcription of the Tlr11 gene is regulated through two cis-acting elements, one Ets-binding site and one interferon regulatory factor (IRF)-binding site. The Ets element interacts with the epithelium-specific transcription factors, ESE-1 and ESE-3, and the IRF motif interacts with IRF-8. Thus, Tlr11 expression on epithelial cells is regulated by the transcription factors that are presumably distinct from transcription factors that regulate the expression of TLRs in innate immune cells such as macrophages and DCs. Our results imply that the distinctive transcription regulatory machinery for TLRs on epithelium may represent a promising new avenue for the development of epithelia-specific therapeutic interventions. PMID:19801549

  15. Effects of TLR4 gene silencing on the proliferation and apotosis of hepatocarcinoma HEPG2 cells.

    PubMed

    Liu, Yating; Li, Tao; Xu, Yuanhong; Xu, Enjun; Zhou, Min; Wang, Baolong; Shen, Jilong

    2016-05-01

    Toll-like receptors (TLRs) are key factors in the innate immune system and initiate an inflammatory response to foreign pathogens, such as bacteria, fungi and viruses. TLR4-mediated signaling has been implicated in tumor cell proliferation and apoptosis in numerous cancers. The present study aimed to investigate the biological effect of TLR4 on the proliferation and apoptosis of human liver cancer cells and the mechanisms responsible for the regulation of cellular responses following TLR4 gene knockdown. Three TLR4 small interfering (si)RNA constructs, consisting of TLR4-siRNA-1, TLR4-siRNA-2 and TLR4-siRNA-3, were transiently transfected into HepG2 cells using Lipofectamine 2000. TLR4 knockdown was confirmed using reverse transcription-polymerase chain reaction and western blotting. The effect of the TLR4 siRNA on tumor cell proliferation was monitored by methyl thiazolyl tetrazolium assay and cell apoptosis was observed by flow cytometry. The expression of TLR4-associated proteins, consisting of myeloid differentiation primary response 88 (MyD88), Toll-interleukin-1R-domain-containing adapter-inducing interferon-β (TRIF), interferon regulatory factor-3 (IRF3), nuclear factor (NF)-κB, NF-κB inhibitor α (IκBα), phosphorylated IκBα (p-IκBα), extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), was detected by western blot analysis. TLR4-siRNA-1 had the strongest knockdown effect and inhibited TLR4 messenger RNA and protein expression. TLR4 knockdown with TLR4-siRNA-1 reduced cell proliferation and promoted cell apoptosis. MyD88, TRIF, IRF3, IκBα, JNK and ERK were markedly suppressed in the cells transfected with TLR4 siRNA. However, nuclear expression of NF-κB and p-IκBα increased in HepG2 cells with TLR4 gene knockdown. The present study revealed that TLR4-mediated signaling plays a key role in the proliferation and apoptosis of cultured hepatocarcinoma cells. Therefore, RNA interference-directed targeting of TLR4 may raise

  16. Genetic polymorphisms in the bovine toll-like receptor 4 (TLR4) and monocyte chemo attractant protein-1(CCL2) genes: SNPs distribution analysis in Bos indicus Sahiwal cattle breed.

    PubMed

    Behl, Jyotsna Dhingra; Sharma, Anurodh; Kataria, R S; Verma, N K; Kimothi, Shiv Prasad; Bhatia, Avnish Kumar; Sodhi, Monika; Behl, Rahul; Joshi, B K

    2014-01-01

    Toll-like receptor 4 gene (TLR4) that recognizes the Gram negative bacterial ligand LPS was sequenced in the Bos indicus Sahiwal cattle breed. Ninety four single nucleotide polymorphisms (SNPs) were detected within 10.8 kb gene region. Seventeen of the SNPs were in the coding regions and the one at position 9589(A > G) in exon3 resulted in an amino acid change from Valine to Isoleucine. These SNPs led to generation of 27 TLR4 gene haplotypes. All the Sahiwal animals studied presently showed the occurrence of the genotype CC at gene position 9662, which codes for the amino acid threonine at position 674 of the TLR4 protein, and which had been reported to be associated with lower somatic cell score and, therefore, a lower susceptibility to mastitis, in Taurus cattle. This nucleotide configuration of the Toll-like receptor 4 gene of the Bos indicus Sahiwal cattle breed could possibly indicate toward a lower susceptibility to mastitis in the Sahiwal animals. Monocyte chemo-attractant protein-1 (CCL2) gene encoding for small inducible cytokine A2 that belongs to the CC chemokine family was also sequence characterized in these Sahiwal animals. The CCL2 gene was observed to have 12 polymorphic sites in 3.3 kb region of which one SNP at position 2500 (A > G) in exon 3 resulted in amino acid change from Valine to Isoleucine at position 46 of the mature CCL2 peptide. Seventeen haplotypes of the CCL2 gene were predicted corresponding to 12 genotypes detected.

  17. TLR7/TLR9- and B Cell Receptor-Signaling Crosstalk: Promotion of Potentially Dangerous B Cells.

    PubMed

    Suthers, Amy N; Sarantopoulos, Stefanie

    2017-01-01

    B cells are capable of receptor-mediated responses to foreign antigens. Recognition of microbial-derived nucleic acid (NA) by toll-like receptors (TLRs) 7 and 9 in B cells has been substantiated. Endogenous NA released from damaged or dying cells can also be immunogenic in certain contexts and can incite aberrant activation of B cells. When TLR-driven B cell receptor (BCR)-activated B cells are not properly constrained, pathologic autoantibodies are produced. It is also clear that endosomal TLR7/TLR9 can operate in conjunction with BCR. In addition to BCR signaling, a balance between TLR7 and TLR9 is pivotal in the development of B cell autoreactivity. While TLR9 is important in normal memory B cell responses through BCR, TLR9 activation has been implicated in autoantibody production. Paradoxically, TLR9 also plays known protective roles against autoimmunity by directly and indirectly inhibiting TLR7-mediated autoantibody production. Herein, we summarize literature supporting mechanisms underpinning the promotion of pathological BCR-activated B cells by TLR7 and TLR9. We focus on the literature regarding known points of TLR7/TLR9 and BCR crosstalk. Data also suggest that the degree of TLR responsiveness relies on alterations of certain intrinsic B-cell signaling molecules and is also context specific. Because allogeneic hematopoietic stem cell transplantation is a high NA and B cell-activating factor environment, we conclude that B cell studies of synergistic TLR-BCR signaling in human diseases like chronic graft-versus-host disease are warranted. Further understanding of the distinct molecular pathways mediating TLR-BCR synergy will lead to the development of therapeutic strategies in autoimmune disease states.

  18. Molecular Cloning and Functional Analysis of the Duck TLR4 Gene

    PubMed Central

    Zhao, Wenming; Huang, Zhengyang; Chen, Yang; Zhang, Yang; Rong, Guanghui; Mu, Chunyu; Xu, Qi; Chen, Guohong

    2013-01-01

    Toll-like receptor 4 (TLR4) recognizes pathogen-associated molecular patterns in some animals and has been shown to be closely associated with several diseases such as tumors, atherosclerosis, and asthma. However, its function in ducks is not clear. Alternative splicing of the TLR4 gene has been identified in pigs, sheep, mice, and other species, but has not yet been reported in the duck. In this study, alternative splicing of the duck TLR4 gene was investigated using reverse transcription-polymerase chain reaction (RT-PCR). Duck TLR4 gene (duTLR4, accession number: KF278109) was found to consist of 3367 nucleotides of coding sequence. An alternative splice form, TLR4-b, was identified and shown by alignment to retain the intron between exons 1 and 2. Real-time quantitative polymerase chain reaction (qPCR) analyses suggested that duTLR4-a (wild-type) mRNA is widely expressed in various healthy tissues, whereas TLR4-b is expressed at only low levels. Following stimulation of normal duck embryo fibroblasts with lipopolysaccharide, the expression of both isoforms initially increased and then decreased. Expression of the wild-type isoform subsequently increased again, while that of the variant remained low. The expression levels of wild-type TLR4 were further analyzed by transient transfection of a pcDNA3.1(+)-TLR4-a overexpression vector into duck embryo fibroblasts. qRT-PCR analyses showed that after stimulation with LPS and poly(I:C) the expression levels of IL-1β, IL6, and MHC II increased with a response-efficacy relationship. Our experimental results indicate that TLR4 plays an important role in resistance to both bacterial and viral infections in the duck. PMID:24025421

  19. Estrogen Receptor Alpha Binding to ERE is Required for Full Tlr7- and Tlr9-Induced Inflammation

    PubMed Central

    Cunningham, Melissa A; Wirth, Jena R; Naga, Osama; Eudaly, Jackie; Gilkeson, Gary S

    2014-01-01

    We previously found that a maximum innate inflammatory response induced by stimulation of Toll-like receptors (TLRs) 3, 7 and 9 requires ERα, but does not require estrogen in multiple cell types from both control and lupus-prone mice. Given the estrogen-independence, we hypothesized that ERα mediates TLR signaling by tethering to, and enhancing, the activity of downstream transcription factors such as NFκB, rather than acting classically by binding EREs on target genes. To investigate the mechanism of ERα impact on TLR signaling, we utilized mice with a knock-in ERα mutant that is unable to bind ERE. After stimulation with TLR ligands, both ex vivo spleen cells and bone marrow-derived dendritic cells (BM-DCs) isolated from mutant ERα (“KIKO”) mice produced significantly less IL-6 compared with cells from wild-type (WT) littermates. These results suggest that ERα modulation of TLR signaling does indeed require ERE binding for its effect on the innate immune response. PMID:25061615

  20. Estrogen Receptor Alpha Binding to ERE is Required for Full Tlr7- and Tlr9-Induced Inflammation.

    PubMed

    Cunningham, Melissa A; Wirth, Jena R; Naga, Osama; Eudaly, Jackie; Gilkeson, Gary S

    2014-01-20

    We previously found that a maximum innate inflammatory response induced by stimulation of Toll-like receptors (TLRs) 3, 7 and 9 requires ERα, but does not require estrogen in multiple cell types from both control and lupus-prone mice. Given the estrogen-independence, we hypothesized that ERα mediates TLR signaling by tethering to, and enhancing, the activity of downstream transcription factors such as NFκB, rather than acting classically by binding EREs on target genes. To investigate the mechanism of ERα impact on TLR signaling, we utilized mice with a knock-in ERα mutant that is unable to bind ERE. After stimulation with TLR ligands, both ex vivo spleen cells and bone marrow-derived dendritic cells (BM-DCs) isolated from mutant ERα ("KIKO") mice produced significantly less IL-6 compared with cells from wild-type (WT) littermates. These results suggest that ERα modulation of TLR signaling does indeed require ERE binding for its effect on the innate immune response.

  1. Stimulants of Toll-like receptor (TLR)-2 and TLR-4 are abundant in certain minimally-processed vegetables.

    PubMed

    Erridge, Clett

    2011-06-01

    Stimulants of the innate immune receptors Toll-like receptor (TLR)-2 and TLR4 have been shown to promote insulin resistance and atherosclerosis in animal models of these diseases. As minimally processed vegetables (MPV) can contain a relatively large bacterial load compared to other foodstuffs, we aimed to quantify the abundance of stimulants of TLR2 and TLR4 in MPV using a transfection-based bioassay calibrated with Escherichia coli LPS and the synthetic lipopeptide Pam(3)CSK(4). Of 5 classes of MPV and 3 classes of related vegetable products considered to be likely to contain a high microbial load, diced onion and bean sprouts contained the highest levels of stimulants of TLR2 (up to 18.5 μg Pam(3)CSK(4)-equivalents per g) and TLR4 (up to 11.4 μg LPS-equivalents per g). By contrast, the majority of fresh whole vegetables examined reproducibly contained minimal or undetectable levels of TLR2- or TLR4-stimulants. The accumulation of TLR-stimulants in MPVs correlated well with growth of enterobacterial spoilage organisms. In conclusion, the modern trend towards eating minimally processed vegetables rather than whole foods is likely to be associated with increased oral exposure to stimulants of TLR2 and TLR4. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Toll-like receptor 4 (TLR4) and typhoid fever in Vietnam.

    PubMed

    Nguyen, Thi Hue; Mai, Ngoc Lanh; Le, Thi Phuong; Ha, Vinh; Nguyen, Tran Chinh; Tran, Tinh Hien; Nguyen, T Hieu; Farrar, Jeremy J; Dunstan, Sarah J

    2009-01-01

    Understanding the host genetic susceptibility to typhoid fever may provide a better understanding of pathogenesis and help in the development of new therapeutics and vaccines. Here we determine the genetic variation within the human TLR4 gene encoding the principal receptor for bacterial endotoxin recognition in typhoid fever patients. It is possible that genetic variants of TLR4 could detrimentally affect the innate immune response against S. typhi infection. Mutation detection and genotyping of TLR4 was performed on DNA from 414 Vietnamese typhoid fever patients and 372 population controls. dHPLC detected a total of 10 polymorphisms within the upstream and exonic regions of TLR4, of which 7 are novel. Two SNPs, T4025A and C4215G, were more frequent in typhoid cases than in controls however due to their low allele frequencies they showed borderline significance (T4025A: OR 1.9, 95%CI 0.9-4.3, P 0.07 and C4215G: OR 6.7, 95%CI 0.8-307, P 0.04). Six missense mutations were identified, with 5/6 positioned in the ectoplasmic domain. Four missense mutations and one promoter SNP (A-271G) were only present in typhoid cases, albeit at low allele frequencies. Here we determined the extent of genetic variation within TLR4 in a Vietnamese population and suggest that TLR4 may be involved in defense against typhoid fever in this population.

  3. Expression of TLR-4 and -2 in peripheral mononuclear cells in renal transplant patients with TLR-4 gene polymorphism.

    PubMed

    Nogueira, Eliana; Salomao, Reinaldo; Brunialti, Milena Karina Colló; Ozaki, Kikumi S; Marques, Geórgia D M; Cenedeze, Marcos A; Câmara, Niels Olsen Saraiva; Pacheco-Silva, Alvaro

    2010-12-01

    TLR-4 has also been identified as a receptor for endogenous alarmins, which are increased post transplantation. TLR-4 has also been associated with a polymorphism that could impact graft outcome. To assess the expression of TLR-4 in kidney transplant patients carrying or not a polymorphism. TLR-4 polymorphism (A299G/T399I) was studied in 200 renal transplant patients. Healthy volunteers were also enrolled as control group. The polymorphism analysis was performed using restriction enzymes technique (RFLP). Functionality of TLR-4 polymorphism was assessed in samples from controls by quantification of TNF-α after LPS stimulus. TLR-4 and -2 expressions were also analyzed by flow cytometry. TLR-4 polymorphism was present in 8.5% of renal transplant patients. This polymorphism was associated with impairment in TNF-α secretion. In general, in renal transplant patients, TLR-4 expression in monocytes and in neutrophils was lower than in health volunteers. TLR-2 and TLR-4 expressions in healthy volunteers with A299G/T399I TLR-4 polymorphism was higher than in wild-type genotype healthy volunteers (p<0.01 and p<0.05, respectively), and also higher than A299G/T399I TLR-4 polymorphism renal transplant patients (p<0.05). TLR-2 expression on neutrophils in wild-type genotype renal transplant patients was higher compared to wild-type genotype healthy volunteers, and was also higher in relation to A299G/T399I kidney transplanted patients (p<0.01). Stable renal transplant patients with TLR-4 polymorphism have a lower expression of TLR-4 and TLR-2 receptors in peripheral mononuclear cells, which ultimately indicate a less responsiveness for alarmins. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Evolution of the Bovine TLR Gene Family and Member Associations with Mycobacterium avium Subspecies paratuberculosis Infection

    PubMed Central

    Fisher, Colleen A.; Bhattarai, Eric K.; Osterstock, Jason B.; Dowd, Scot E.; Seabury, Paul M.; Vikram, Meenu; Whitlock, Robert H.; Schukken, Ynte H.; Schnabel, Robert D.; Taylor, Jeremy F.; Womack, James E.; Seabury, Christopher M.

    2011-01-01

    Members of the Toll-like receptor (TLR) gene family occupy key roles in the mammalian innate immune system by functioning as sentries for the detection of invading pathogens, thereafter provoking host innate immune responses. We utilized a custom next-generation sequencing approach and allele-specific genotyping assays to detect and validate 280 biallelic variants across all 10 bovine TLR genes, including 71 nonsynonymous single nucleotide polymorphisms (SNPs) and one putative nonsense SNP. Bayesian haplotype reconstructions and median joining networks revealed haplotype sharing between Bos taurus taurus and Bos taurus indicus breeds at every locus, and specialized beef and dairy breeds could not be differentiated despite an average polymorphism density of 1 marker/158 bp. Collectively, 160 tagSNPs and two tag insertion-deletion mutations (indels) were sufficient to predict 100% of the variation at 280 variable sites for both Bos subspecies and their hybrids, whereas 118 tagSNPs and 1 tagIndel predictively captured 100% of the variation at 235 variable sites for B. t. taurus. Polyphen and SIFT analyses of amino acid (AA) replacements encoded by bovine TLR SNPs indicated that up to 32% of the AA substitutions were expected to impact protein function. Classical and newly developed tests of diversity provide strong support for balancing selection operating on TLR3 and TLR8, and purifying selection acting on TLR10. An investigation of the persistence and continuity of linkage disequilibrium (r2≥0.50) between adjacent variable sites also supported the presence of selection acting on TLR3 and TLR8. A case-control study employing validated variants from bovine TLR genes recognizing bacterial ligands revealed six SNPs potentially eliciting small effects on susceptibility to Mycobacterium avium spp paratuberculosis infection in dairy cattle. The results of this study will broadly impact domestic cattle research by providing the necessary foundation to explore several

  5. Breed-linked polymorphisms of porcine toll-like receptor 2 (TLR2) and TLR4 and the primary investigation on their relationship with prevention against Mycoplasma pneumoniae and bacterial LPS challenge.

    PubMed

    Fang, Xiaomin; Liu, Xiao; Meng, Cui; Fu, Yanfeng; Wang, Xuemin; Li, Bixia; Tu, Feng; Zhao, Fang; Ren, Shouwen

    2013-11-01

    Toll-like receptors (TLRs) play a crucial role in innate immunity, serving as pattern-recognition receptors and the first barrier in host defense against microbial infections. Genetic variations of TLR2 and TLR4 are closely associated with a variety of infectious diseases, particularly lung diseases. In this study, we detected six and four single nucleotide polymorphisms (SNPs) in the coding sequences of porcine TLR2 and TLR4 genes, respectively. Only SNP 1027C>A of TLR4 was shown to be markedly biased in Western and Oriental pig populations. Hence, the susceptibility of pigs with different genotype at position 1027C>A to Mycoplasma hyopneumoniae (Mhp) infection was investigated, and changes to the expression of TLR2, TLR4, TNF-α and IL-1β were monitored. The results showed that there was no significant difference in susceptibility to Mhp infection between AA and CC individuals despite expression levels for all detected genes of the challenge groups being significantly higher than the corresponding control groups. Furthermore, porcine alveolar macrophages of different genotype were collected and stimulated by lipopolysaccharide. We found that the expression of TLR2, TLR4, TNF-α and IL-1β genes were enhanced to different levels by lipopolysaccharide stimulation. TLR2 and TLR4 gene expressions and their rates of increase of 1027CC pigs were significantly higher than for 1027AC pigs (P < 0.01), while TNF-α and IL-1β expressions were significantly lower than for 1027AC pigs (P < 0.01). We predict that allele C at position 1027 of the TLR4 gene contributes to the pig's immune response to gram-negative bacterial infections.

  6. Acanthamoeba infection in lungs of mice expressed by toll-like receptors (TLR2 and TLR4).

    PubMed

    Derda, Monika; Wojtkowiak-Giera, Agnieszka; Kolasa-Wołosiuk, Agnieszka; Kosik-Bogacka, Danuta; Hadaś, Edward; Jagodziński, Paweł P; Wandurska-Nowak, Elżbieta

    2016-06-01

    Toll-like receptors (TLRs) play a key role in the innate immune responses to a variety of pathogens including parasites. TLRs are among the most highly conserved in the evolution of the receptor family, localized mainly on cells of the immune system and on other cells such as lung cells. The aim of this study was to determine for the first time the expression of TLR2 and TLR4 in the lung of Acanthamoeba spp. infected mice using quantitative real-time polymerase chain reaction (Q-PCR) and immunohistochemical (IHC) staining. The Acanthamoeba spp. were isolated from a patient with Acanthamoeba keratitis (AK) (strain Ac 55) and from environmental samples of water from Malta Lake (Poznań, Poland - strain Ac 43). We observed a significantly increased level of expression of TLR2 as well as TLR4 mRNA from 2 to 30 days post Acanthamoeba infection (dpi) in the lungs of mice infected with Ac55 (KP120880) and Ac43 (KP120879) strains. According to our observations, increased TLR2 and TLR4 expression in the pneumocytes, interstitial cells and epithelial cells of the bronchial tree may suggest an important role of these receptors in protective immunity against Acanthamoeba infection in the lung. Moreover, increased levels of TLR2 and TLR4 mRNA expression in infected Acanthamoeba mice may suggest the involvement of these TLRs in the recognition of this amoeba pathogen-associated molecular pattern (PAMP).

  7. Identification and characterisation of TLR18-21 genes in Atlantic salmon (Salmo salar).

    PubMed

    Lee, P T; Zou, J; Holland, J W; Martin, S A M; Collet, B; Kanellos, T; Secombes, C J

    2014-12-01

    Teleost fish possess many types of toll-like receptor (TLR) some of which exist in other vertebrate groups and some that do not (ie so-called "fish-specific" TLRs). In this study, we identified in Atlantic salmon (Salmo salar) whole-genome shotgun (WGS) contigs seven TLRs that are not found in mammals, including six types of fish-specific TLRs (one TLR18, one TLR19, and four TLR20 members (two of which are putative soluble forms (s)) and one TLR21. Phylogenetic analysis revealed that teleost TLR19-21 are closely related with murine TLR11-TLR13, whilst teleost TLR18 groups with mammalian TLR1, 2, 6 and 10. A typical TLR protein domain structure was found in all these TLRs with the exception of TLR20b(s) and TLR20c(s). TLR-GFP expression plasmids transfected into SHK-1 cells showed that salmon TLR19, TLR20a and TLR20d were preferentially localised to the intracellular compartment. Real time PCR analysis suggested that salmon TLR19-TLR21 are mainly expressed in immune related organs, such as spleen, head kidney and gills, while TLR18 transcripts are more abundant in muscle. In vitro stimulation of primary head kidney cells with type I IFN, IFNγ and IL-1β had no impact on TLR expression. Infectious salmon anaemia virus (ISAV) infection, in vivo, down-regulated TLR20a, TLR20b(s), TLR20d and TLR21 in infected salmon kidney tissue. In contrast, up-regulation of TLR19 and TLR20a expression was found in posterior kidney in rainbow trout with clinical proliferative kidney disease (PKD).

  8. Hypermethylation and low transcription of TLR2 gene in chronic periodontitis.

    PubMed

    de Faria Amormino, Simone Angélica; Arão, Telma Cristina; Saraiva, Adriana Machado; Gomez, Ricardo Santiago; Dutra, Walderez Ornelas; da Costa, José Eustáquio; de Fátima Correia Silva, Jeane; Moreira, Paula Rocha

    2013-09-01

    Periodontitis is an inflammatory disorder characterized by interactions between periodontal pathogens and host's immune response. Epigenetic may contribute to disease development and outcome by influencing the expression of genes involved in the immune response. It has been shown that Toll-like receptors (TLR) play an important role in the response to periodontopathic bacteria. The aim of study was to evaluate the methylation status and the expression of TLR2 gene in gingival samples from individuals with and without periodontitis. DNA was analyzed using the Methyl Profiler DNA Methylation qPCR assay. DNA methylation and transcript levels were evaluated by real-time polymerase chain reaction. The periodontitis group showed a hypermethylated profile and a low expression of gene. Positive correlation between the TLR2 methylation frequency and probing depth was observed. This study gives the first evidence of methylation frequency in inflamed periodontal tissues and of the possible participation of methylation in the development of periodontitis.

  9. Increased Toll-Like Receptor (TLR) Activation and TLR Ligands in Recently Diagnosed Type 2 Diabetic Subjects

    PubMed Central

    Dasu, Mohan R.; Devaraj, Sridevi; Park, Samuel; Jialal, Ishwarlal

    2010-01-01

    OBJECTIVE Individuals with type 2 diabetes have a myriad of metabolic aberrations including increased inflammation, increasing their cardiovascular risk. Toll-like receptors (TLRs) and their ligands play a key role in insulin resistance and atherosclerosis. However, there is a paucity of data examining the expression and activity of TLRs in type 2 diabetes. Thus, in the present study, we examined TLR2 and TLR4 mRNA and protein expression, their ligands, and signaling in monocytes of recently diagnosed type 2 diabetic patients. RESEARCH DESIGN AND METHODS TLR mRNA, protein expression, TLR ligands, and TLR signaling were measured in freshly isolated monocytes from healthy human control subjects (n = 23) and type 2 diabetic subjects (n = 23) using real-time RT-PCR, Western blot, and flow cytometric assays. RESULTS Type 2 diabetic subjects had significantly increased TLR2, TLR4 mRNA, and protein in monocytes compared with control subjects (P < 0.05). Increased TLR2 and TLR4 expression correlated with BMI, homeostasis model assessment–insulin resistance (HOMA-IR), glucose, A1C, Nε-(carboxymethyl) lysine (CML), and free fatty acid (FFA). Ligands of TLR2 and TLR4, namely, HSP60, HSP70, HMGB1, endotoxin, and hyaluronan levels, were elevated in type 2 diabetic subjects and positively correlated with TLR2 and TLR4. Type 2 diabetic subjects showed increased MyD88, phosphorylated IRAK-1, Trif, TICAM-1, IRF-3, and NF-κB p65 expression in monocytes compared with control subjects. Furthermore, TLR-MyD88-NF-κB signaling resulted in elevated levels of cytokines (P < 0.05), but increased interleukin (IL)-1β, interferon (IFN)-γ, and endotoxin were not significant when adjusted for BMI. CONCLUSIONS In this comprehensive study, we make the novel observation that TLR2 and TLR4 expression and their ligands, signaling, and functional activation are increased in recently diagnosed type 2 diabetes and contribute to the proinflammatory state. PMID:20067962

  10. Metalloproteinase-Dependent TLR2 Ectodomain Shedding is Involved in Soluble Toll-Like Receptor 2 (sTLR2) Production

    PubMed Central

    Langjahr, Patricia; Díaz-Jiménez, David; De la Fuente, Marjorie; Rubio, Estefhany; Golenbock, Douglas; Bronfman, Francisca C.; Quera, Rodrigo; González, María-Julieta; Hermoso, Marcela A.

    2014-01-01

    Toll-like receptor (TLR) 2, a type I membrane receptor that plays a key role in innate immunity, recognizes conserved molecules in pathogens, and triggering an inflammatory response. It has been associated with inflammatory and autoimmune diseases. Soluble TLR2 (sTLR2) variants have been identified in human body fluids, and the TLR2 ectodomain can negatively regulate TLR2 activation by behaving as a decoy receptor. sTLR2 generation does not involve alternative splicing mechanisms, indicating that this process might involve a post-translational modification of the full-length receptor; however, the specific mechanism has not been studied. Using CD14+ peripheral human monocytes and the THP-1 monocytic leukemia-derived cell line, we confirm that sTLR2 generation increases upon treatment with pro-inflammatory agents and requires a post-translational mechanism. We also find that the constitutive and ligand-induced release of sTLR2 is sensitive to pharmacological metalloproteinase activator and inhibitors leading us to conclude that metalloproteinase TLR2 shedding contributes to soluble receptor production. By expressing human TLR2 in ADAM10- or ADAM17-deficient MEF cells, we find both enzymes to be implicated in TLR2 ectodomain shedding. Moreover, using a deletion mutant of the TLR2 juxtamembrane region, we demonstrate that this domain is required for sTLR2 generation. Functional analysis suggests that sTLR2 generated by metalloproteinase activation inhibitsTLR2-induced cytokine production by this monocytic leukemia-derived cell line. The identification of the mechanisms involved in regulating the availability of soluble TLR2 ectodomain and cell surface receptors may contribute further research on TLR2-mediated processes in innate immunity and inflammatory disorders. PMID:25531754

  11. Variation in the TLR4 gene influences the risk of organ failure and shock post-trauma: a cohort study

    PubMed Central

    Shalhub, Sherene; Junker, Christopher E.; Imahara, Scott D.; Mindrinos, Michael N.; Dissanaike, Sharmila; O’Keefe, Grant E.

    2009-01-01

    Background Genetic variation contributes to risk and outcomes of sepsis. We sought to determine if variation in inflammation related genes is associated with severity of sepsis in trauma patients. Methods A cohort of severely injured Caucasian patients was studied and genotyped for candidate single nucleotide polymorphisms (SNPs). These were toll-like receptor 4 (TLR4) A896G, tumor necrosis factor-α G-308A, interleukin-6 G-174C, interleukin-1β C-31T, and cluster of differentiation marker-14 C-159T. SNP genotypes among patients with sepsis and complicated sepsis were analyzed by chi-square and logistic regression. Six haplotype-tagging SNPs in the TLR4 gene were subsequently examined to determine their influence on TLR4 A896G SNP’s relationship to sepsis severity. Results We enrolled 598 patients. Complicated sepsis developed in 147 (25%). Adjusting for independent risk factors, carriage of the variant TLR4 896 G allele was associated with decreased risk of complicated sepsis (OR = 0.3, 95%CI = 0.1–0.7, p = 0.008). Furthermore, two haplotypes seemed to better characterize this risk than the variant TLR4 896 G allele. The variant TLR4 896G allele is linked to one common haplotype, which seems to confer a considerably reduced risk of complicated sepsis. (aOR = 0.2 95% CI = 0.05–0.7, p = 0.01) Conclusions Variation within TLR4 gene is associated with severity of post-traumatic sepsis. This risk may not be solely related to TLR4 A896G SNP. It is likely that other, uncharacterized variations in the TLR4 gene contribute to sepsis severity. A thorough evaluation of variability within the TLR4 gene is needed to characterize sepsis risk. PMID:19131814

  12. Nonbilayer Phospholipid Arrangements Are Toll-Like Receptor-2/6 and TLR-4 Agonists and Trigger Inflammation in a Mouse Model Resembling Human Lupus.

    PubMed

    Wong-Baeza, Carlos; Tescucano, Alonso; Astudillo, Horacio; Reséndiz, Albany; Landa, Carla; España, Luis; Serafín-López, Jeanet; Estrada-García, Iris; Estrada-Parra, Sergio; Flores-Romo, Leopoldo; Wong, Carlos; Baeza, Isabel

    2015-01-01

    Systemic lupus erythematosus is characterized by dysregulated activation of T and B cells and autoantibodies to nuclear antigens and, in some cases, lipid antigens. Liposomes with nonbilayer phospholipid arrangements induce a disease resembling human lupus in mice, including IgM and IgG antibodies against nonbilayer phospholipid arrangements. As the effect of these liposomes on the innate immune response is unknown and innate immune system activation is necessary for efficient antibody formation, we evaluated the effect of these liposomes on Toll-like receptor (TLR) signaling, cytokine production, proinflammatory gene expression, and T, NKT, dendritic, and B cells. Liposomes induce TLR-4- and, to a lesser extent, TLR-2/TLR-6-dependent signaling in TLR-expressing human embryonic kidney (HEK) cells and bone marrow-derived macrophages. Mice with the lupus-like disease had increased serum concentrations of proinflammatory cytokines, C3a and C5a; they also had more TLR-4-expressing splenocytes, a higher expression of genes associated with TRIF-dependent TLR-4-signaling and complement activation, and a lower expression of apoptosis-related genes, compared to healthy mice. The percentage of NKT and the percentage and activation of dendritic and B2 cells were also increased. Thus, TLR-4 and TLR-2/TLR-6 activation by nonbilayer phospholipid arrangements triggers an inflammatory response that could contribute to autoantibody production and the generation of a lupus-like disease in mice.

  13. Nonbilayer Phospholipid Arrangements Are Toll-Like Receptor-2/6 and TLR-4 Agonists and Trigger Inflammation in a Mouse Model Resembling Human Lupus

    PubMed Central

    Wong-Baeza, Carlos; Tescucano, Alonso; Astudillo, Horacio; Reséndiz, Albany; Landa, Carla; España, Luis; Serafín-López, Jeanet; Estrada-García, Iris; Estrada-Parra, Sergio; Flores-Romo, Leopoldo; Wong, Carlos; Baeza, Isabel

    2015-01-01

    Systemic lupus erythematosus is characterized by dysregulated activation of T and B cells and autoantibodies to nuclear antigens and, in some cases, lipid antigens. Liposomes with nonbilayer phospholipid arrangements induce a disease resembling human lupus in mice, including IgM and IgG antibodies against nonbilayer phospholipid arrangements. As the effect of these liposomes on the innate immune response is unknown and innate immune system activation is necessary for efficient antibody formation, we evaluated the effect of these liposomes on Toll-like receptor (TLR) signaling, cytokine production, proinflammatory gene expression, and T, NKT, dendritic, and B cells. Liposomes induce TLR-4- and, to a lesser extent, TLR-2/TLR-6-dependent signaling in TLR-expressing human embryonic kidney (HEK) cells and bone marrow-derived macrophages. Mice with the lupus-like disease had increased serum concentrations of proinflammatory cytokines, C3a and C5a; they also had more TLR-4-expressing splenocytes, a higher expression of genes associated with TRIF-dependent TLR-4-signaling and complement activation, and a lower expression of apoptosis-related genes, compared to healthy mice. The percentage of NKT and the percentage and activation of dendritic and B2 cells were also increased. Thus, TLR-4 and TLR-2/TLR-6 activation by nonbilayer phospholipid arrangements triggers an inflammatory response that could contribute to autoantibody production and the generation of a lupus-like disease in mice. PMID:26568960

  14. Role of the Toll Like receptor (TLR) radical cycle in chronic inflammation: possible treatments targeting the TLR4 pathway.

    PubMed

    Lucas, Kurt; Maes, Michael

    2013-08-01

    Activation of the Toll-like receptor 4 (TLR4) complex, a receptor of the innate immune system, may underpin the pathophysiology of many human diseases, including asthma, cardiovascular disorder, diabetes, obesity, metabolic syndrome, autoimmune disorders, neuroinflammatory disorders, schizophrenia, bipolar disorder, autism, clinical depression, chronic fatigue syndrome, alcohol abuse, and toluene inhalation. TLRs are pattern recognition receptors that recognize damage-associated molecular patterns and pathogen-associated molecular patterns, including lipopolysaccharide (LPS) from gram-negative bacteria. Here we focus on the environmental factors, which are known to trigger TLR4, e.g., ozone, atmosphere particulate matter, long-lived reactive oxygen intermediate, pentachlorophenol, ionizing radiation, and toluene. Activation of the TLR4 pathways may cause chronic inflammation and increased production of reactive oxygen and nitrogen species (ROS/RNS) and oxidative and nitrosative stress and therefore TLR-related diseases. This implies that drugs or substances that modify these pathways may prevent or improve the abovementioned diseases. Here we review some of the most promising drugs and agents that have the potential to attenuate TLR-mediated inflammation, e.g., anti-LPS strategies that aim to neutralize LPS (synthetic anti-LPS peptides and recombinant factor C) and TLR4/MyD88 antagonists, including eritoran, CyP, EM-163, epigallocatechin-3-gallate, 6-shogaol, cinnamon extract, N-acetylcysteine, melatonin, and molecular hydrogen. The authors posit that activation of the TLR radical (ROS/RNS) cycle is a common pathway underpinning many "civilization" disorders and that targeting the TLR radical cycle may be an effective method to treat many inflammatory disorders.

  15. Inosine-Mediated Modulation of RNA Sensing by Toll-Like Receptor 7 (TLR7) and TLR8

    PubMed Central

    Sarvestani, Soroush T.; Tate, Michelle D.; Moffat, Jessica M.; Jacobi, Ashley M.; Behlke, Mark A.; Miller, Alistair R.; Beckham, Simone A.; McCoy, Claire E.; Chen, Weisan; Mintern, Justine D.; O'Keeffe, Meredith; John, Matthias

    2014-01-01

    RNA-specific adenosine deaminase (ADAR)-mediated adenosine-to-inosine (A-to-I) editing is a critical arm of the antiviral response. However, mechanistic insights into how A-to-I RNA editing affects viral infection are lacking. We posited that inosine incorporation into RNA facilitates sensing of nonself RNA by innate immune sensors and accordingly investigated the impact of inosine-modified RNA on Toll-like receptor 7 and 8 (TLR7/8) sensing. Inosine incorporation into synthetic single-stranded RNA (ssRNA) potentiated tumor necrosis factor alpha (TNF-α) or alpha interferon (IFN-α) production in human peripheral blood mononuclear cells (PBMCs) in a sequence-dependent manner, indicative of TLR7/8 recruitment. The effect of inosine incorporation on TLR7/8 sensing was restricted to immunostimulatory ssRNAs and was not seen with inosine-containing short double-stranded RNAs or with a deoxy-inosine-modified ssRNA. Inosine-mediated increase of self-secondary structure of an ssRNA resulted in potentiated IFN-α production in human PBMCs through TLR7 recruitment, as established through the use of a TLR7 antagonist and Tlr7-deficient cells. There was a correlation between hyperediting of influenza A viral ssRNA and its ability to stimulate TNF-α, independent of 5′-triphosphate residues, and involving Adar-1. Furthermore, A-to-I editing of viral ssRNA directly enhanced mouse Tlr7 sensing, when present in proportions reproducing biologically relevant levels of RNA editing. Thus, we demonstrate for the first time that inosine incorporation into immunostimulatory ssRNA can potentiate TLR7/8 activation. Our results suggest a novel function of A-to-I RNA editing, which is to facilitate TLR7/8 sensing of phagocytosed viral RNA. PMID:24227841

  16. Polymorphisms of the TLR2 and TLR4 genes are associated with risk of gastric cancer in a Brazilian population

    PubMed Central

    de Oliveira, Juliana Garcia; Silva, Ana Elizabete

    2012-01-01

    AIM: To investigate toll-like receptor 2 (TLR2) -196 to -174 del, and TLR4 (+896A/G rs4986790 and +1196C/T rs4986791) polymorphisms at risk of chronic gastritis and gastric cancer in a Brazilian population and association of gastric lesions with risk factors such as smoking, alcohol intake and Helicobacter pylori infection. METHODS: In this case-control study, polymorphism at TLR2 -196 to -174 del was investigated by using the allele-specific polymerase chain reaction (PCR) method, while the PCR-restriction fragment length polymorphism technique was carried out to identify the TLR4 (rs4986790 and rs4986791) genotypes in 607 Brazilian individuals (208 with chronic gastritis-CG, 174 with gastric cancer-GC and 225 controls -C). RESULTS: The single nucleotide polymorphisms TLR4+1196C/T was not associated with risk of chronic gastritis or gastric cancer and the homozygous genotypes TLR4+896GG and TLR4+1196TT were absent in the studied population. However, the frequency of TLR2 -196 to -174 ins/del + del/del and TLR4+896AG genotypes was significantly higher (P < 0.01 and P = 0.01, respectively) in the cancer group (33.4% and 11.5%, respectively) than in the control group (16.9% and 4.5%, respectively). It was also observed that the G-C haplotype of the TLR4+896A/G+1196C/T (P = 0.02) and the combination of variant alleles of the TLR2/TLR4+896G (P = 0.02) are associated with susceptibility to gastric cancer. In addition, the multiple logistic regression showed that male gender [odds ratio (OR) = 2.70; 95% CI: 1.66-4.41; P < 0.01], alcohol intake (OR = 2.93; 95% CI: 1.76-4.87; P < 0.01), TLR2 -196 to -174 del (OR = 2.64; 95% CI: 1.56-4.44; P < 0.01) and TLR4+896G (OR = 3.19; 95% CI: 1.34- 7.61; P < 0.01) polymorphisms were associated with a higher susceptibility to developing this neoplasm. CONCLUSION: Our data indicate that TLR2 -196 to -174 del and TLR4+896G may increase the risk of gastric cancer in a Brazilian population. PMID:22468087

  17. Establishing targeted carp TLR22 gene disruption via homologous recombination using CRISPR/Cas9.

    PubMed

    Chakrapani, Vemulawada; Patra, Swagat Kumar; Panda, Rudra Prasanna; Rasal, Kiran Dashrath; Jayasankar, Pallipuram; Barman, Hirak Kumar

    2016-08-01

    Recent advances in gene editing techniques have not been exploited in farmed fishes. We established a gene targeting technique, using the CRISPR/Cas9 system in Labeo rohita, a farmed carp (known as rohu). We demonstrated that donor DNA was integrated via homologous recombination (HR) at the site of targeted double-stranded nicks created by CRISPR/Cas9 nuclease. This resulted in the successful disruption of rohu Toll-like receptor 22 (TLR22) gene, involved in innate immunity and exclusively present in teleost fishes and amphibians. The null mutant, thus, generated lacked TLR22 mRNA expression. Altogether, this is the first evidence that the CRISPR/Cas9 system is a highly efficient tool for targeted gene disruption via HR in teleosts for generating model large-bodied farmed fishes.

  18. Low TLR7 gene expression in atherosclerotic plaques is associated with major adverse cardio- and cerebrovascular events

    PubMed Central

    Karadimou, Glykeria; Folkersen, Lasse; Berg, Martin; Perisic, Ljubica; Discacciati, Andrea; Roy, Joy; Hansson, Göran K.; Persson, Jonas; Paulsson-Berne, Gabrielle

    2017-01-01

    Aims Processes in the development of atherosclerotic lesions can lead to plaque rupture or erosion, which can in turn elicit myocardial infarction or ischaemic stroke. The aims of this study were to determine whether Toll-like receptor 7 (TLR7) gene expression levels influence patient outcome and to explore the mechanisms linked to TLR7 expression in atherosclerosis. Methods and results Atherosclerotic plaques were removed by carotid endarterectomy (CEA) and subjected to gene array expression analysis (n = 123). Increased levels of TLR7 transcript in the plaques were associated with better outcome in a follow-up study over a maximum of 8 years. Patients with higher TLR7 transcript levels had a lower risk of experiencing major cardiovascular and cerebrovascular events (MACCE) during the follow-up period after CEA (hazard ratio: 2.38, P = 0.012, 95% CI 1.21–4.67). TLR7 was expressed in all plaques by T cells, macrophages and endothelial cells in capillaries, as shown by immunohistochemistry. In short-term tissue cultures, ex vivo treatment of plaques with the TLR7 ligand imiquimod elicited dose-dependent secretion of IL-10, TNF-α, GM-CSF, and IL-12/IL-23p40. This secretion was blocked with a TLR7 inhibitor. Immunofluorescent tissue analysis after TLR7 stimulation showed IL-10 expression in T cells, macrophages and vascular smooth muscle cells. TLR7 mRNA levels in the plaques were correlated with IL-10 receptor (r = 0.4031, P < 0.0001) and GM-CSF receptor A (r = 0.4354, P < 0.0001) transcripts. Conclusion These findings demonstrate that TLR7 is abundantly expressed in human atherosclerotic plaques. TLR7 ligation elicits the secretion of pro-inflammatory and anti-inflammatory cytokines, and high TLR7 expression in plaques is associated with better patient outcome, suggesting that TLR7 is a potential therapeutic target for prevention of complications of atherosclerosis. PMID:27864310

  19. Genetic variation of toll-like receptor genes and infection by Mycobacterium avium ssp. paratuberculosis in Holstein-Friesian cattle.

    PubMed

    Ruiz-Larrañaga, O; Manzano, C; Iriondo, M; Garrido, J M; Molina, E; Vazquez, P; Juste, R A; Estonba, A

    2011-07-01

    Toll-like receptors (TLR) are membrane proteins that play a key role in innate immunity, by recognizing pathogens and subsequently activating appropriate responses. Mutations in TLR genes are associated with susceptibility to inflammatory and infectious diseases in humans. In cattle, 3 members of the TLR family, TLR1, TLR2, and TLR4, are associated with Mycobacterium avium ssp. paratuberculosis infection, although the extent of this association for the TLR1 and TLR4 receptors has not yet been determined. Moreover, the causal variant in the TLR2 gene has not yet been unequivocally established. In this study, 24 single nucleotide polymorphisms (SNP) in the bovine TLR1, TLR2, and TLR4 genes were selected from the literature, databases, and in silico searches, for a population-based genetic association study of a Spanish Holstein-Friesian sample. Whereas previous results regarding the TLR1 gene were not corroborated, a risk haplotype was detected in TLR2; however, its low frequency indicates that this detected association should be interpreted with caution. In the case of the TLR4 gene, 3 tightly linked SNP were found to be associated with susceptibility to M. avium ssp. paratuberculosis infection. Moreover, one of these SNP, the SNP c.-226G>C, which is localized in the 5'UTR region of the TLR4 gene, has been reported to be able to alter TLR4 expression, raising the possibility that this mutation may contribute to the response of the individual to infection.

  20. Polymorphisms in genes TLR1, 2 and 4 are associated with differential cytokine and chemokine serum production in patients with leprosy.

    PubMed

    Santana, Nadja de Lima; Rêgo, Jamile Leão; Oliveira, Joyce Moura; Almeida, Lucas Frederico de; Braz, Marcos; Machado, Lídia Maria Medeiros; Machado, Paulo Roberto Lima; Castellucci, Léa Cristina

    2017-04-01

    Leprosy or hansen's disease is a spectral disease whose clinical forms mostly depends on host's immune and genetic factors. Different Toll-like receptors (TLR) variants have been described associated with leprosy, but with some lack of replication across different populations. To evaluate the role of polymorphisms in genes TLR1, TLR2 and TLR4 and susceptibility to leprosy in a genetic case control study; to verify the association between genotypes of these markers and the immunological profile in the serum of patients with leprosy. Pre-designed TaqMan® assays were used to genotype markers at TLR1 (rs4833095, rs5743551), TLR2 (rs7656411, rs3804099) and TLR4 (rs1927914, rs1927911). A panel of cytokines and chemokines was accessed by enzime-linked immunosorbent assay (ELISA) test in the serum of a subgroup of patients with and without leprosy reactions. Our results show an association between the T allele of rs3804099 at the TLR2 gene and increased risk for leprosy per se [Odds ratio (OR) = 1.296, p = 0,022]. In addition, evaluating the association between different genotypes of the TLR1, 2 and 4 markers and cytokine/chemokine serological levels, IL-17 appears as an immunological marker regulated by the polymorphism of the three TLR genes evaluated, whereas different TLR1 genotypes were associated with differential production of IL-12p40 and MCP-1(CCL2). Furthermore, other relevant serum markers such as CXCL-10 and IL-6 seemed to be regulated by TLR2 variants and IL-1β was related to TLR4 genotypes. All together our data points that the tested TLR markers may have a regulatory role in the immunity against Mycobacterium leprae, by driving the host's production of key cytokines and chemokines involved in the pathogenesis of this disease.

  1. Polymorphisms in genes TLR1, 2 and 4 are associated with differential cytokine and chemokine serum production in patients with leprosy

    PubMed Central

    Santana, Nadja de Lima; Rêgo, Jamile Leão; Oliveira, Joyce Moura; de Almeida, Lucas Frederico; Braz, Marcos; Machado, Lídia Maria Medeiros; Machado, Paulo Roberto Lima; Castellucci, Léa Cristina

    2017-01-01

    BACKGROUND Leprosy or hansen’s disease is a spectral disease whose clinical forms mostly depends on host’s immune and genetic factors. Different Toll-like receptors (TLR) variants have been described associated with leprosy, but with some lack of replication across different populations. OBJECTIVES To evaluate the role of polymorphisms in genes TLR1, TLR2 and TLR4 and susceptibility to leprosy in a genetic case control study; to verify the association between genotypes of these markers and the immunological profile in the serum of patients with leprosy. METHODS Pre-designed TaqMan® assays were used to genotype markers at TLR1 (rs4833095, rs5743551), TLR2 (rs7656411, rs3804099) and TLR4 (rs1927914, rs1927911). A panel of cytokines and chemokines was accessed by enzime-linked immunosorbent assay (ELISA) test in the serum of a subgroup of patients with and without leprosy reactions. FINDINGS Our results show an association between the T allele of rs3804099 at the TLR2 gene and increased risk for leprosy per se [Odds ratio (OR) = 1.296, p = 0,022]. In addition, evaluating the association between different genotypes of the TLR1, 2 and 4 markers and cytokine/chemokine serological levels, IL-17 appears as an immunological marker regulated by the polymorphism of the three TLR genes evaluated, whereas different TLR1 genotypes were associated with differential production of IL-12p40 and MCP-1(CCL2). Furthermore, other relevant serum markers such as CXCL-10 and IL-6 seemed to be regulated by TLR2 variants and IL-1β was related to TLR4 genotypes. MAIN CONCLUSIONS All together our data points that the tested TLR markers may have a regulatory role in the immunity against Mycobacterium leprae, by driving the host’s production of key cytokines and chemokines involved in the pathogenesis of this disease. PMID:28327786

  2. Evolutionary analysis of TLR9 genes reveals the positive selection of extant teleosts in Perciformes.

    PubMed

    Zhu, Zhihuang; Sun, Yuena; Wang, Rixin; Xu, Tianjun

    2013-08-01

    The innate immune system can recognize non-self through pattern recognition receptors. Toll-like receptors were the best-known members of these receptors, and they could sense, recognize, and bind pathogen-associated molecular patterns. TLRs played an important role in innate immune system and were conserved in both invertebrate and vertebrate lineages. Thereinto, TLR9 could detect unmethylated CpG motifs in dsDNA and was expected to undergo coevolution with its microbial ligands. It was known that aquatic and terrestrial organisms dwelled in different environments which contained different pathogens, and they had to adapt to their local environmental conditions. Therefore, we collected TLR9 genes from invertebrate to vertebrate to further explore whether the huge differences between aquatic and terrestrial environments affected the TLR9s evolution between aquatic and terrestrial organisms. Molecular evolution analysis detected positively selected sites in the ancestral lineages of vertebrates, teleosts, and Perciformes but not in the ancestral lineage of mammals. In PAML, site model revealed that extant mammalian TLR9 genes underwent positive selection. However, the positive selection of extant teleosts appeared primarily in Perciformes in which there were 14 positively selected sites. Among these sites, two of them were located on the amino acid insertions of the leucine-rich repeats which could create DNA binding sites, three were found on the convex surface which might possibly affect the flexibility of the TLR solenoids, and six were located on the β-face of concave surface which contained the ligand-binding sites of the TLR solenoids. In other ML methods, we also found three sites under selection that coincided with the codons identified by M8 and these sites were all located in LRRs. The diverse aquatic and terrestrial environments might possess different pathogens to make the living organisms adapt to their local environmental conditions. The positive

  3. Molecular characterization and expression profile of partial TLR4 gene in association to mastitis in crossbred cattle.

    PubMed

    Panigrahi, Manjit; Sharma, Arjava; Bhushan, Bharat

    2014-01-01

    Crossbred cattle are more prone to mastitis in comparison to indigenous cattle. Toll-like receptor 4 (TLR4) recognizes pathogen ligands, for example, lipopolysaccharide (LPS) endotoxin from Escherichia coli and mediates signaling to initiate innate and adaptive immune responses. Mutations in TLR4 can compromise the host immune response to certain pathogens, so it may be a potential candidate for marker assisted selection to enhance mastitis resistance in dairy cattle. Hence, in this study role of bovine TLR4 gene in mastitis resistance was investigated by association as well as expression profiling analysis in crossbred cattle. The animals were divided into mastitis affected and unaffected groups on the basis of history of animals and California Mastitis Test (CMT). PCR-SSCP and Sequence analysis revealed three genotypes of coreceptor binding region 1 (CRBR1) fragment of TLR4 gene namely AA, AB, and BB in both groups of cattle. The logistic regression model did not show any significant effect of these genotypes on the occurrence of clinical mastitis. Moreover, in vitro challenge of peripheral blood mononuclear cells (PBMCs) with LPS failed to show any association of the genotypes with TLR4 gene expression. In a nutshell, in the present study enough evidence was not found for association of the SNP variants of CRBR1 fragment of TLR4 gene with mastitis susceptibility in crossbred cattle.

  4. The TLR4 D299G and T399I SNPs are constitutively active to up-regulate expression of Trif-dependent genes.

    PubMed

    Hold, Georgina L; Berry, Susan; Saunders, Karin A; Drew, Janice; Mayer, Claus; Brookes, Heather; Gay, Nick J; El-Omar, Emad M; Bryant, Clare E

    2014-01-01

    Dysregulated Toll-Like Receptor (TLR) signalling and genetic polymorphisms in these proteins are linked to many human diseases. We investigated TLR4 functional variants D299G and T399I to assess the impact on LPS-induced responsiveness in comparison to wild-type TLR4. The mechanism by which this occurs in unclear as these SNPs do not lie within the lipid A binding domain or dimerisation sites of the LPS-TLR4/MD2 receptor complexes. Transfection of TLR4D299G, TLR4T399I or TLR4D299G. T399I into HEK cells resulted in constitutive activation of an NF-κB reporter gene and a blunting of the LPS-induced reporter activation compared to WT-TLR4. Unstimulated human monocyte/macrophages, from patients with the D299G and T399I SNPs demonstrated a downregulation of many genes, particularly Tram/Trif signalling pathway constitutents compared to the TLR4 wild-type subjects supporting the concept of basal receptor activity. Monocyte/macrophages from carriers of the TLR4 D299G and T399I polymorphisms stimulated with LPS showed >6 fold lower levels of NF-κB and ∼12 fold higher IFN-β gene expression levels compared to wild-type subjects (P<0.05; MWU test) and dramatically altered resultant cytokine profiles. We conclude that these TLR4 SNPs affect constitutive receptor activity which impacts on the hosts ability to respond to LPS challenge leading to a dysregulated sub-optimal immune response to infection.

  5. The TLR4 D299G and T399I SNPs Are Constitutively Active to Up-Regulate Expression of Trif-Dependent Genes

    PubMed Central

    Hold, Georgina L.; Berry, Susan; Saunders, Karin A.; Drew, Janice; Mayer, Claus; Brookes, Heather; Gay, Nick J.; El-Omar, Emad M.; Bryant, Clare E.

    2014-01-01

    Dysregulated Toll-Like Receptor (TLR) signalling and genetic polymorphisms in these proteins are linked to many human diseases. We investigated TLR4 functional variants D299G and T399I to assess the impact on LPS-induced responsiveness in comparison to wild-type TLR4. The mechanism by which this occurs in unclear as these SNPs do not lie within the lipid A binding domain or dimerisation sites of the LPS-TLR4/MD2 receptor complexes. Transfection of TLR4D299G, TLR4T399I or TLR4D299G. T399I into HEK cells resulted in constitutive activation of an NF-κB reporter gene and a blunting of the LPS-induced reporter activation compared to WT-TLR4. Unstimulated human monocyte/macrophages, from patients with the D299G and T399I SNPs demonstrated a downregulation of many genes, particularly Tram/Trif signalling pathway constitutents compared to the TLR4 wild-type subjects supporting the concept of basal receptor activity. Monocyte/macrophages from carriers of the TLR4 D299G and T399I polymorphisms stimulated with LPS showed >6 fold lower levels of NF-κB and ∼12 fold higher IFN-β gene expression levels compared to wild-type subjects (P<0.05; MWU test) and dramatically altered resultant cytokine profiles. We conclude that these TLR4 SNPs affect constitutive receptor activity which impacts on the hosts ability to respond to LPS challenge leading to a dysregulated sub-optimal immune response to infection. PMID:25365308

  6. Apolipoprotein E inhibits toll-like receptor (TLR)-3- and TLR-4-mediated macrophage activation through distinct mechanisms.

    PubMed

    Zhu, Yanjuan; Kodvawala, Ahmer; Hui, David Y

    2010-04-28

    Previous studies have shown that apoE (apolipoprotein E) expression in macrophages suppresses inflammatory responses; however, whether endogenously synthesized apoE acts intracellularly or after its secretion in suppressing macrophage inflammation remains unclear. The present study used the murine monocyte macrophage cell line RAW 264.7 to examine the influence of exogenous apoE on macrophage inflammatory responses induced by TLR (Toll-like receptor)-4 and TLR-3 agonists LPS (lipopolysaccharide) and poly(I-C) respectively. Results showed that exogenously added apoE suppressed the LPS and poly(I-C) induction of IL (interleukin)-6, IL-1beta and TNF-alpha (tumour necrosis factor-alpha) secretion by RAW 264.7 cells. The mechanism was related to apoE suppression of TLR-agonist-induced phosphorylation of JNK (c-Jun N-terminal kinase) and c-Jun. A peptide containing the tandem repeat sequence of the receptor-binding domain of apoE, apoE-(141-155)2, was similarly effective in inhibiting LPS- and poly(I-C)-induced macrophage inflammatory responses. Reductive methylation of lysine residues in apoE, which abolished its receptor-binding capability without affecting its ability to interact with HSPGs (heparin sulfate proteoglycans), inhibited the ability of apoE to suppress macrophage responses to LPS, but had no effect on apoE suppression of poly(I-C)-induced macrophage activation. The ability of apoE to suppress poly(I-C)-induced pro-inflammatory cytokine production was abolished by heparinase treatment of RAW 264.7 cells to remove cell-surface HSPGs. Taken together, these results indicate that exogenous apoE inhibits macrophage inflammatory responses to TLR-4 and TLR-3 agonists through distinct mechanisms related to receptor and HSPG binding respectively, and that these inhibitory effects converged on suppression of JNK and c-Jun activation which are necessary for macrophage activation.

  7. Concomitant high expression of Toll-like receptor (TLR) and B-cell receptor (BCR) signalling molecules has clinical implications in mantle cell lymphoma.

    PubMed

    Akhter, Ariz; Street, Lesley; Ghosh, Sunita; Burns, Bruce F; Elyamany, Ghaleb; Shabani-Rad, Meer-Taher; Stewart, Douglas A; Mansoor, Adnan

    2017-03-01

    Mantle cell lymphoma (MCL) is an aggressive disease with frequent relapse. Targeted therapies against B-cell receptor (BCR) molecules have demonstrated improved outcomes in relapsed cases. However, clinical responses are slow and selective, with failure to attain complete remission in a significant subset of patients. Complex interaction of BCR signal transduction with toll-like receptor (TLR) and other pathways in MCL remains unknown, thus averting progress in development of targeted therapies. We have performed detailed digital quantification of BCR/TLR signalling molecules and their effector pathways in a cohort (n = 81) of MCL patients and correlated these data with overall survival. Hierarchical clustering model based on BCR/TLR genes revealed two distinct (BCR(high) and BCR(low) ) subsets of patients (n = 32; 40%) with significant differences in expression (>1.5-fold change; p < 0.05). Higher levels of BTK/SYK/BLNK/CARD11/PLCG signalosome and lower expression of MALT1/BCL10 genes suggested tonic pattern of BCR activation. Amplified expression of TLR6/TLR7/TLR9 was noted in concert with hyper-responsiveness of BCR machinery. MYD88, a key TLR adaptor molecule, was not upregulated in any of these clusters, which may suggest a 'cross-talk' between BCR and TLR pathways. In sync with BCR/TLR signalling, we recorded significantly enhanced expression of genes associated with NF-kB pathway in BCR(high) subset of MCL patients. On univariate analysis, the BCR(high) patients showed a trend towards inferior clinical response to a standardized treatment protocol, compared with the BCR(low) group (log rank, p = 0.043). In conclusion, we have identified hyperactive BCR/TLR signalling pathways and their effector downstream targets in a subset of MCL patients and associated it with poor clinical outcomes. Our study provides quantitative evidence at RNA expression level of possible concomitant collaboration between TLR and BCR signalling molecules in MCL. These

  8. Toll-like Receptor 4 (TLR4) modulation by synthetic and natural compounds: an update

    PubMed Central

    Peri, Francesco; Calabrese, Valentina

    2014-01-01

    Toll-like receptor 4 (TLR4), together with MD-2, binds bacterial endotoxins (E) with high affinity, triggering formation of the activated homodimer (E-MD-2-TLR4)2. Activated TLR4 induces intracellular signaling leading to activation of transcription factors that result in cytokine and chemokine production and initiation of inflammatory and immune responses. TLR4 also responds to endogenous ligands called danger associated molecular patterns (DAMPs). Increased sensitivity to infection and a variety of immune pathologies have been associated with either too little or too much TLR4 activation. We review here the molecular mechanisms of TLR4 activation (agonism) or inhibition (antagonism) by small organic molecules of both natural and synthetic origin. The role of co-receptors MD-2 and CD14 in the TLR4 modulation process is also discussed. Recent achievements in the field of chemical TLR4 modulation are reviewed, with special focus on non-classical TLR4 ligands with a chemical structure different from lipid A. PMID:24188011

  9. Studies on expression pattern of toll-like receptor 5 (TLR5) in Edwardsiella tarda infected Pangasianodon hypophthalmus.

    PubMed

    Jayaramu, Poojashree Kachigere; Tripathi, Gayatri; Pavan Kumar, A; Keezhedath, Jeena; Pathan, Mujahid Khan; Kurcheti, Pani Prasad

    2017-04-01

    TLR5 is one of the important PRR (pathogen recognition receptors) and plays a fundamental role in pathogen recognition and activation of innate immune responses. It recognizes bacterial flagellin and stimulates the production of proinflammatory cytokines, through signalling via the adaptor protein MyD88. In this study, we characterized partial TLR5 (soluble form) gene from Pangasianodon hypophthalmus and analysed its expression profile upon challenge by Edwardsiella tarda. Bioinformatic analysis of gene sequence revealed a putative protein of 266 amino acids with four Leucine rich repeats. Quantitative expression analysis of TLR 5S showed its wide distribution in various organs and tissues. However, significant expression of TLR5S was observed in liver and spleen at 12 h (∼207.8 fold, p < 0.05). Significant upregulation was observed in kidney at 72 h.p.i. (50 folds, p < 0.05) indicating that the kidney provides longer protection almost till the activation of the adaptive immune system. This study enriches the knowledge of TLR5S in boosting the innate immunity against bacterial invasion in fish.

  10. Identification, characterization, and genetic mapping of TLR7, TLR8a1 and TLR8a2 genes in rainbow trout (Oncorhynchus mykiss)

    USDA-ARS?s Scientific Manuscript database

    Induction of the innate immune pathways is critical for early antiviral defense but there is limited understanding of how teleost fish recognize viral molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 7 and 8 bind single-stranded RNA of viral origin and are activated by s...

  11. Combined effect of TLR2 gene polymorphism and early life stress on the age at onset of bipolar disorders.

    PubMed

    Oliveira, José; Etain, Bruno; Lajnef, Mohamed; Hamdani, Nora; Bennabi, Meriem; Bengoufa, Djaouida; Sundaresh, Aparna; Chaabane, Arij Ben; Bellivier, Frank; Henry, Chantal; Kahn, Jean-Pierre; Charron, Dominique; Krishnamoorthy, Rajagopal; Leboyer, Marion; Tamouza, Ryad

    2015-01-01

    Gene-environment interactions may play an important role in modulating the impact of early-life stressful events on the clinical course of bipolar disorder (BD), particularly associated to early age at onset. Immune dysfunction is thought to be an important mechanism linking childhood trauma with early-onset BD, thus the genetic diversity of immune-related loci may account for an important part of the interindividual susceptibility to this severe subform. Here we investigated the potential interaction between genetic variants of Toll-like receptors 2 (TLR2) and 4 (TLR4), major innate immune response molecules to pathogens, and the childhood trauma questionnaire (CTQ) in age at onset of BD. We recruited 531 BD patients (type I and II or not otherwise specified), genotyped for the TLR2 rs4696480 and rs3804099 and TLR4 rs1927914 and rs11536891 single-nucleotide polymorphisms and recorded for history of childhood trauma using the CTQ. TLR2 and TLR4 risk genotype carrier state and history of childhood emotional, physical and sexual abuses were evaluated in relation to age at onset as defined by the age at first manic or depressive episode. We observed a combined effect of TLR2 rs3804099 TT genotype and reported sexual abuse on determining an earlier age at onset of BD by means of a Kaplan-Meier survival curve (p = 0.002; corrected p = 0.02). Regression analysis, however, was non-significant for the TLR2-CTQ sexual abuse interaction term. The negative effects of childhood sexual abuse on age at onset of BD may be amplified in TLR2 rs3804099 risk genotype carriers through immune-mediated pathways. Clinical characteristics of illness severity, immune phenotypes and history of early life infectious insults should be included in future studies involving large patient cohorts.

  12. Escherichia coli brain abscess in a twin pair associated with TLR4 gene mutation.

    PubMed

    Erdemir, Aydin; Kahramaner, Zelal; Cosar, Hese; Turkoglu, Ebru; Sutcuoglu, Sumer; Uygun, Dilara Kocacik; Yegin, Olcay; Berdeli, Afig; Ozer, Esra Arun

    2013-08-01

    Brain abscesses are uncommon complications of bacterial meningitis or sepsis in neonates and infants. The causative pathogens of brain abscess in newborns are various. Of those, Escherichia coli is rarely seen as a pathogen in brain abscess at this age. Herein we reported brain abscesses in twin infants caused by E. coli sepsis. Interestingly, genetic analysis identified heterozygous Toll-like receptor 4 (TLR4) gene mutation in the twins. Because TLR plays an important role in the natural response to bacterial products and initiates specific immune response against these pathogens, this may explain the development of brain abscess in the present case. © 2013 The Authors. Pediatrics International © 2013 Japan Pediatric Society.

  13. TLR9 gene region polymorphisms and susceptibility to tuberculosis in Vietnam.

    PubMed

    Graustein, A D; Horne, D J; Arentz, M; Bang, N D; Chau, T T H; Thwaites, G E; Caws, M; Thuong, N T T; Dunstan, S J; Hawn, T R

    2015-03-01

    Humans exposed to Mycobacterium tuberculosis (Mtb) show variation in susceptibility to infection and differences in tuberculosis (TB) disease outcome. Toll-like receptor 9 (TLR9) is a pattern recognition receptor that mediates recognition of Mtb and modulates Mtb-specific T-cell responses. Using a case-population design, we evaluated whether single nucleotide polymorphisms (SNPs) in the TLR9 gene region are associated with susceptibility to pulmonary or meningeal TB as well as neurologic presentation and mortality in the meningeal TB group. In a discovery cohort (n = 352 cases, 382 controls), three SNPs were associated with TB (all forms, p < 0.05) while three additional SNPs neared significance (0.05 < p < 0.1). When these six SNPs were evaluated in a validation cohort (n = 339 cases, 367 controls), one was significant (rs352142) while another neared significance (rs352143). When the cohorts were combined, rs352142 was most strongly associated with meningeal tuberculosis (dominant model; p = 0.0002, OR 2.36, CI 1.43-3.87) while rs352143 was associated with pulmonary tuberculosis (recessive model; p = 0.006, OR 5.3, CI 1.26-31.13). None of the SNPs were associated with mortality. This is the first demonstration of an association between a TLR9 gene region SNP and tuberculous meningitis. In addition, this extends previous findings that support associations of TLR9 SNPs with pulmonary tuberculosis.

  14. Epithelial and Stromal Cells of Bovine Endometrium Have Roles in Innate Immunity and Initiate Inflammatory Responses to Bacterial Lipopeptides In Vitro via Toll-Like Receptors TLR2, TLR1, and TLR6

    PubMed Central

    Turner, Matthew L.; Cronin, James G.; Healey, Gareth D.

    2014-01-01

    Bacteria often infect the endometrium of cattle to cause endometritis, uterine disease, and infertility. Lipopeptides are commonly found among bacteria and are detected by the Toll-like receptor (TLR) cell surface receptor TLR2 on immune cells. Heterodimers of TLR2 with TLR1 or TLR6 activate MAPK and nuclear factor-κB intracellular signaling pathways to stimulate inflammatory responses. In the endometrium, epithelial and stromal cells are the first to encounter invading bacteria, so the present study explored whether endometrial cells can also mount inflammatory responses to bacterial lipopeptides via TLRs. The supernatants of pure populations of primary bovine endometrial epithelial and stromal cells accumulated the cytokine IL-6 and the chemokine IL-8 in response to triacylated or diacylated bacterial lipopeptides. The accumulation of IL-6 and IL-8 in response to triacylated lipopeptides was reduced by small interfering RNA targeting TLR2 or TLR1 but not TLR6, whereas cellular responses to diacylated lipopeptide were reduced by small interfering RNA targeting TLR2, TLR1, or TLR6. Both lipopeptides induced rapid phosphorylation of ERK1/2, p38, and nuclear factor-κB in endometrial cells, and inhibitors of ERK1/2 or p38 limited the accumulation of IL-6. The ovarian steroids estradiol and progesterone had little impact on inflammatory responses to lipopeptides. The endometrial epithelial and stromal cell responses to lipopeptides via TLR2, TLR1, and TLR6 provide a mechanism linking a wide range of bacterial infections to inflammation of the endometrium. PMID:24437488

  15. Epithelial and stromal cells of bovine endometrium have roles in innate immunity and initiate inflammatory responses to bacterial lipopeptides in vitro via Toll-like receptors TLR2, TLR1, and TLR6.

    PubMed

    Turner, Matthew L; Cronin, James G; Healey, Gareth D; Sheldon, Iain Martin

    2014-04-01

    Bacteria often infect the endometrium of cattle to cause endometritis, uterine disease, and infertility. Lipopeptides are commonly found among bacteria and are detected by the Toll-like receptor (TLR) cell surface receptor TLR2 on immune cells. Heterodimers of TLR2 with TLR1 or TLR6 activate MAPK and nuclear factor-κB intracellular signaling pathways to stimulate inflammatory responses. In the endometrium, epithelial and stromal cells are the first to encounter invading bacteria, so the present study explored whether endometrial cells can also mount inflammatory responses to bacterial lipopeptides via TLRs. The supernatants of pure populations of primary bovine endometrial epithelial and stromal cells accumulated the cytokine IL-6 and the chemokine IL-8 in response to triacylated or diacylated bacterial lipopeptides. The accumulation of IL-6 and IL-8 in response to triacylated lipopeptides was reduced by small interfering RNA targeting TLR2 or TLR1 but not TLR6, whereas cellular responses to diacylated lipopeptide were reduced by small interfering RNA targeting TLR2, TLR1, or TLR6. Both lipopeptides induced rapid phosphorylation of ERK1/2, p38, and nuclear factor-κB in endometrial cells, and inhibitors of ERK1/2 or p38 limited the accumulation of IL-6. The ovarian steroids estradiol and progesterone had little impact on inflammatory responses to lipopeptides. The endometrial epithelial and stromal cell responses to lipopeptides via TLR2, TLR1, and TLR6 provide a mechanism linking a wide range of bacterial infections to inflammation of the endometrium.

  16. Toll-Like Receptor (TLR)-Associated Sequence Variants and Prostate Cancer Risk among Men of African Descent

    PubMed Central

    Rogers, Erica N.; Jones, Dominique; Kidd, Nayla C.; Yeyeodu, Susan; Brock, Guy; Ragin, Camille; Jackson, Maria; McFarlane-Anderson, Norma; Tulloch-Reid, Marshall; Kimbro, K. Sean; Kidd, LaCreis R.

    2013-01-01

    BACKGROUND Recent advances demonstrate a relationship between chronic/recurrent inflammation and prostate cancer (PCA). Among inflammatory regulators, toll-like receptors (TLRs) play a critical role in innate immune responses. However, it remains unclear whether variant TLR genes influence PCA risk among men of African descent. Therefore, we evaluated the impact of 32 TLR-associated single nucleotide polymorphisms (SNPs) on PCA risk among African-Americans and Jamaicans. METHODS SNP profiles of 814 subjects were evaluated using Illumina’s Veracode genotyping platform. Single and combined effects of SNPs in relation to PCA risk were assessed using age-adjusted logistic regression and entropy-based multifactor dimensionality reduction (MDR) models. RESULTS Seven sequence variants detected in TLR6, TOLLIP, IRAK4, IRF3 were marginally related to PCA. However, none of these effects remained significant after adjusting for multiple hypothesis testing. Nevertheless, MDR modeling revealed a complex interaction between IRAK4 rs4251545 and TLR2 rs1898830 as a significant predictor of PCA risk among U.S. men (permutation testing p-value = 0.001). CONCLUSIONS MDR identified an interaction between IRAK4 and TLR2 as the best two factor model for predicting PCA risk among men of African descent. However, these findings require further assessment and validation. PMID:23657238

  17. Age-related changes and distribution of T cell markers (CD3 and CD4) and toll-like receptors(TLR2, TLR3,TLR4 and TLR7) in the duck lymphoid organs.

    PubMed

    Zhang, Aiguo; Xu, Jiahua; Lai, Hanzhang; Huang, Wenke; Fang, Niran; Chen, Ruiai

    2017-03-10

    T lymphocytes and Toll-like receptors have been confirmed to have correlation with the ability to resistance to pathogenic challenges and play an important role in duck immune system. However, the information of ontogeny of T lymphocytes and Toll-like receptors is scarcely in duck. Therefore, to address these questions, we report the development and distribution of CD3 and CD4 by immunocytochemistry and the age-related mRNA level of duck T cell markers (CD3 and CD4) and Toll-like receptors (TLR2, TLR3, TLR4 and TLR7) by real time quantitative PCR in duck lymphoid organs (thymus, bursa of Fabricius and spleen). Results indicated that CD3 and CD4 positive cells can be observed in all test organs and partly change in an age-related way. CD4 positive T cell of duck spleen mainly distributed in periarterial lymphatic sheaths and red pulp, not in white pulp. Both of CD3 and CD4 were experienced significant increased wave twice in duck lymphoid organs and T cell dependent cellular immunity of duck may well established until 5 weeks old. The mRNA expression levels of duck TLRs were age and organ dependent, and duck TLR3 and TLR7 were significantly lower abundance in the spleen but higher in thymus and bursa of Fabricius, respectively. This study provide the essential knowledge of the ontogeny of T cells and Toll-like receptors in duck, which may shed lights on the T-cell mediate immunity and innate immunity in duck.

  18. Toll-Like Receptor 7/8 (TLR7/8) and TLR9 Agonists Cooperate To Enhance HIV-1 Envelope Antibody Responses in Rhesus Macaques

    PubMed Central

    Santra, Sampa; Vandergrift, Nathan A.; Sutherland, Laura L.; Gurley, Thaddeus C.; Drinker, Mark S.; Allen, Ashley A.; Xia, Shi-Mao; Meyerhoff, R. Ryan; Parks, Robert; Lloyd, Krissey E.; Easterhoff, David; Alam, S. Munir; Liao, Hua-Xin; Ward, Brandy M.; Ferrari, Guido; Montefiori, David C.; Tomaras, Georgia D.; Seder, Robert A.; Letvin, Norman L.; Haynes, Barton F.

    2014-01-01

    ABSTRACT The development of a vaccine that can induce high titers of functional antibodies against HIV-1 remains a high priority. We have developed an adjuvant based on an oil-in-water emulsion that incorporates Toll-like receptor (TLR) ligands to test whether triggering multiple pathogen-associated molecular pattern receptors could enhance immunogenicity. Compared to single TLR agonists or other pairwise combinations, TLR7/8 and TLR9 agonists combined were able to elicit the highest titers of binding, neutralizing, and antibody-dependent cellular cytotoxicity-mediating antibodies against the protein immunogen, transmitted/founder HIV-1 envelope gp140 (B.63521). We further found that the combination of TLR7/8 and TLR9 agonists was associated with the release of CXCL10 (IP-10), suggesting that this adjuvant formulation may have optimally stimulated innate and adaptive immunity to elicit high titers of antibodies. IMPORTANCE Combining TLR agonists in an adjuvant formulation resulted in higher antibody levels compared to an adjuvant without TLR agonists. Adjuvants that combine TLR agonists may be useful for enhancing antibody responses to HIV-1 vaccines. PMID:24390332

  19. Lung cell-specific modulation of LPS-induced TLR4 receptor and adaptor localization

    PubMed Central

    Sender, Vicky; Stamme, Cordula

    2014-01-01

    Lung infection by Gram-negative bacteria is a major cause of morbidity and mortality in humans. Lipopolysaccharide (LPS), located in the outer membrane of the Gram-negative bacterial cell wall, is a highly potent stimulus of immune and structural cells via the TLR4/MD2 complex whose function is sequentially regulated by defined subsets of adaptor proteins. Regulatory mechanisms of lung-specific defense pathways point at the crucial role of resident alveolar macrophages, alveolar epithelial cells, the TLR4 receptor pathway, and lung surfactant in shaping the innate immune response to Gram-negative bacteria and LPS. During the past decade intracellular spatiotemporal localization of TLR4 emerged as a key feature of TLR4 function. Here, we briefly review lung cell type- and compartment-specific mechanisms of LPS-induced TLR4 regulation with a focus on primary resident hematopoietic and structural cells as well as modifying microenvironmental factors involved. PMID:25136402

  20. Association of Toll-like receptor 4 (TLR4) with chronic plaque type psoriasis and psoriatic arthritis.

    PubMed

    Smith, Rh Ll; Hébert, H L; Massey, J; Bowes, J; Marzo-Ortega, H; Ho, P; McHugh, N J; Worthington, J; Barton, A; Griffiths, C E M; Warren, R B

    2016-04-01

    Family studies have provided overwhelming evidence for an underlying genetic component to psoriasis. Toll-like receptors (TLRs) are key transmembrane proteins in both the innate and adaptive immune responses which are known to be integral processes in psoriasis. Recent functional studies support this notion having suggested a role for TLR4 in the pathogenesis of psoriasis. Furthermore a missense polymorphism in the TLR4 gene has been associated with a number of autoimmune conditions, including Crohn diseases, making TLR4 a viable candidate gene for investigation. The aim of this study was to investigate polymorphisms across the TLR4 region with a high-density single nucleotide polymorphism (SNP) panel in a large cohort of patients with chronic plaque type psoriasis. Twenty SNPs were successfully genotyped using Sequenom iPLEX Gold platform in 2826 UK chronic plaque type psoriasis patients including subgroup data on presence of confirmed psoriatic arthritis (n = 1839) and early-onset psoriasis (n = 1466) was available. Allele frequencies for psoriasis patients were compared against imputed Wellcome Trust Case Control Consortium controls (n = 4861). Significant association was observed between a missense variant rs4986790 of TLR4 (Asp229Gly) and plaque type psoriasis (p = 2 × 10(-4)) which was also notable in those with psoriatic arthritis (p = 2 × 10(-4)) and early-onset psoriasis (p = 8 × 10(-4)). We present data suggestive of an association between a functional variant and an intronic variant of TLR4 and chronic plaque type psoriasis and psoriatic arthritis. However, validation of this association in independent cohorts will be necessary.

  1. Porcine CD14 gene silencing partially inhibited the bacterial immune response mediated by TLR4 signaling pathway.

    PubMed

    Dai, Chaohui; Wang, Haifei; Zhu, Guoqiang; Wu, Shenglong; Bao, Wenbin

    2017-09-10

    Cluster of differentiation antigen 14 (CD14) is the membrane receptor protein in Toll-like Receptor 4 (TLR4) signaling pathway, which plays an important regulation role in not only innate immune response but also adaptive immune response. In this study, the pig kidney epithelial cell (PK15) line with CD14 gene silencing mediated by lentivirus was established and cells of CD14-RNAi and NC group were exposed to three kinds of Escherichia coli (E. coli F18ab, E. coli F18ac and E. coli K88ac) and LPS. Then qPCR and western blot were used to detect expression levels of TLR4 signaling pathway-related genes. Finally, ELISA was used to detect the level of proinflammatory cytokines in the cell culture supernatant. The results showed that the expression level of TLR4 signaling pathway-related genes in the entire signal pathway had obvious increases when cells were exposed to the stimulation induced by E. coli and LPS. In addition, the expression levels of CD14-RNAi group were overall significantly lower than NC group (P<0.05 or P<0.01), which was the same with the release levels of proinflammatory cytokines. This study revealed that pig CD14 gene silencing partially inhibited immune response to E. coli F18 invasion mediated by TLR4 signaling pathway. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Profile of gene expression of TLR-signaling pathways in colorectal cancer tissues.

    PubMed

    Bednarczyk, Martyna; Muc-Wierzgoń, Małgorzata; Walkiewicz, Katarzyna; Kokot, Teresa; Fatyga, Edyta; Mazurek, Urszula

    2017-09-01

    Toll-like receptors (TLRs) are involved in transduction of molecular signals in immune process such as induction and regulation of immunity, production of cytokines, and recognition of specific molecular patterns on the surface of microorganisms, but also in cancer development-which was partially proven in previous studies. There is a lack of detailed research on differentiating levels of TLR expression in colorectal cancer at different stages of its advancement, so in our study we want to determine whether there is such a difference of TLRs and TLR-connected protein expression. In this study, 83 samples of colorectal adenocarcinoma (varying clinical degrees) and 40 slices of healthy colon tissue have been analyzed. The delivered material was subjected to homogenization and extraction of total RNA. The isolated RNA was subsequently purified and valued quantitatively and qualitatively. Quantification was performed using a spectrophotometer GeneQuant II. The RNA concentration in the tested samples was determined spectrophotometrically. A qualitative assessment was performed by performing electrophoresis on a 1% agarose gel stained with ethidium bromide. The expression profile of the genes encoding the TLRs was determined using oligonucleotide microarray HG-U133A. To determine the mRNA (messenger RNA), differentiate cancerous tissue from normal colon using PL-Grid Infrastructure. The results were analyzed statistically, taking a significance level P < 0.05. In the study were found three proteins, DUSP2, IFNγ, EIF4A1, associated with TLR system, that differentiate early stages of colorectal cancer of healthy tissue, moreover eleven, inter alia: vascular endothelial growth factor (VEGF), which differentiate high stage of cancer of healthy tissues. The results emphasize the role of pathways associated with TLR activation in the pathogenesis of colorectal cancer. In summary, molecular studies on the development of colorectal cancer will enable the introduction of

  3. In Vitro Reconstitution of the Toll/Interleukin-1 Receptor (TIR) Domain Complex Between TLR5/6 and Myd88.

    PubMed

    Jang, Tae-Ho; Narayanan, Kannan Badri; Park, Hyun Ho

    2016-01-01

    Toll-like receptors (TLRs) are evolutionarily conserved receptors with trimodular structure to respond to endogenous ligands and exogenous ligands from microbial pathogens. The highly conserved cytoplasmic C-terminal Toll/interleukin-1 receptor (TIR) domain of TLRs plays a crucial role in inflammatory reactions. In myeloid differentiation primary-response protein 88 (MyD88)- dependent signaling pathway, the interaction of TLRsTIR with cytosolic adaptor protein, MyD88TIR recruits IL-1R-associated kinases (IRAK) for subsequent activation of transcription factors nuclear factor kB (NF-kB) and activation protein 1 (AP-1) and other effector molecules. In the present investigation, TLR5TIR, TLR6TIR and MyD88TIR genes were subcloned and overexpressed in bacterium Escherichia coli strain BL- 21 (DE3). The purification and biochemical characterization of TLR5TIR and TLR6TIR&, and MyD88TIR proteins were also performed. The protein-protein interactions between TIR domains of TLR5 and TLR6 with MyD88, respectively, were evaluated in vitro at physiological pH and salt concentration. The in vitro reconstitution results showed that under physiological pH and salt concentration, MyD88TIR interacted with TLR5TIR, and did not interact with TLR6TIR protein. Both TIR domain-containing TLR5 and TLR6 proteins were prone to aggregation in a temperature-dependent manner at room temperature. At normal physiological pH and salt concentration, with the addition of binding partner MyD88TIR to TLR5/6TIR, time-dependent aggregation was not observed in both TLRsTIR at both room temperature and 4 ºC for 2 d, influencing the solubility of TLR5/6TIR. Moreover, TLR5TIR alone exhibited increase in solubility of the protein with increase in the salt concentration of the buffered solution from 0.025 M to 1.25 M at room temperature.

  4. A Novel Toll-Like Receptor (TLR) Influences Compatibility between the Gastropod Biomphalaria glabrata, and the Digenean Trematode Schistosoma mansoni

    PubMed Central

    Pila, Emmanuel A.; Tarrabain, Mahmoud; Kabore, Alethe L.; Hanington, Patrick C.

    2016-01-01

    Schistosomiasis, a devastating disease caused by parasitic flatworms of the genus Schistosoma, affects over 260 million people worldwide especially in tropical and sub-tropical regions. Schistosomes must undergo their larval development within specific species of snail intermediate hosts, a trait that is shared among almost all digenean trematodes. This unique and long-standing host-parasite relationship presents an opportunity to study both the importance of conserved immunological features in novel immunological roles, as well as new immunological adaptations that have arisen to combat a very specific type of immunological challenge. While it is well supported that the snail immune response is important for protecting against schistosome infection, very few specific snail immune factors have been identified and even fewer have been functionally characterized. Here, we provide the first functional report of a snail Toll-like receptor, which we demonstrate as playing an important role in the cellular immune response of the snail Biomphalaria glabrata following challenge with Schistosoma mansoni. This TLR (BgTLR) was identified as part of a peptide screen of snail immune cell surface proteins that differed in abundance between B. glabrata snails that differ in their compatibility phenotype to challenge by S. mansoni. The S. mansoni-resistant strain of B. glabrata (BS-90) displayed higher levels of BgTLR compared to the susceptible (M-line) strain. Transcript expression of BgTLR was found to be very responsive in BS-90 snails when challenged with S. mansoni, increasing 27 fold relative to β-actin (non-immune control gene); whereas expression in susceptible M-line snails was not significantly increased. Knockdown of BgTLR in BS-90 snails via targeted siRNA oligonucleotides was confirmed using a specific anti-BgTLR antibody and resulted in a significant alteration of the resistant phenotype, yielding patent infections in 43% of the normally resistant snails, which

  5. A Novel Toll-Like Receptor (TLR) Influences Compatibility between the Gastropod Biomphalaria glabrata, and the Digenean Trematode Schistosoma mansoni.

    PubMed

    Pila, Emmanuel A; Tarrabain, Mahmoud; Kabore, Alethe L; Hanington, Patrick C

    2016-03-01

    Schistosomiasis, a devastating disease caused by parasitic flatworms of the genus Schistosoma, affects over 260 million people worldwide especially in tropical and sub-tropical regions. Schistosomes must undergo their larval development within specific species of snail intermediate hosts, a trait that is shared among almost all digenean trematodes. This unique and long-standing host-parasite relationship presents an opportunity to study both the importance of conserved immunological features in novel immunological roles, as well as new immunological adaptations that have arisen to combat a very specific type of immunological challenge. While it is well supported that the snail immune response is important for protecting against schistosome infection, very few specific snail immune factors have been identified and even fewer have been functionally characterized. Here, we provide the first functional report of a snail Toll-like receptor, which we demonstrate as playing an important role in the cellular immune response of the snail Biomphalaria glabrata following challenge with Schistosoma mansoni. This TLR (BgTLR) was identified as part of a peptide screen of snail immune cell surface proteins that differed in abundance between B. glabrata snails that differ in their compatibility phenotype to challenge by S. mansoni. The S. mansoni-resistant strain of B. glabrata (BS-90) displayed higher levels of BgTLR compared to the susceptible (M-line) strain. Transcript expression of BgTLR was found to be very responsive in BS-90 snails when challenged with S. mansoni, increasing 27 fold relative to β-actin (non-immune control gene); whereas expression in susceptible M-line snails was not significantly increased. Knockdown of BgTLR in BS-90 snails via targeted siRNA oligonucleotides was confirmed using a specific anti-BgTLR antibody and resulted in a significant alteration of the resistant phenotype, yielding patent infections in 43% of the normally resistant snails, which

  6. Structural basis of species-specific endotoxin sensing by innate immune receptor TLR4/MD-2

    PubMed Central

    Ohto, Umeharu; Fukase, Koichi; Miyake, Kensuke; Shimizu, Toshiyuki

    2012-01-01

    Lipopolysaccharide (LPS), also known as endotoxin, activates the innate immune response through toll-like receptor 4 (TLR4) and its coreceptor, MD-2. MD-2 has a unique hydrophobic cavity that directly binds to lipid A, the active center of LPS. Tetraacylated lipid IVa, a synthetic lipid A precursor, acts as a weak agonist to mouse TLR4/MD-2, but as an antagonist to human TLR4/MD-2. However, it remains unclear as to how LPS and lipid IVa show agonistic or antagonistic activities in a species-specific manner. The present study reports the crystal structures of mouse TLR4/MD-2/LPS and TLR4/MD-2/lipid IVa complexes at 2.5 and 2.7 Å resolutions, respectively. Mouse TLR4/MD-2/LPS exhibited an agonistic “m”-shaped 2:2:2 complex similar to the human TLR4/MD-2/LPS complex. Mouse TLR4/MD-2/lipid IVa complex also showed an agonistic structural feature, exhibiting architecture similar to the 2:2:2 complex. Remarkably, lipid IVa in the mouse TLR4/MD-2 complex occupied nearly the same space as LPS, although lipid IVa lacked the two acyl chains. Human MD-2 binds lipid IVa in an antagonistic manner completely differently from the way mouse MD-2 does. Together, the results provide structural evidence of the agonistic property of lipid IVa on mouse TLR4/MD-2 and deepen understanding of the ligand binding and dimerization mechanism by the structurally diverse LPS variants. PMID:22532668

  7. Structural basis of species-specific endotoxin sensing by innate immune receptor TLR4/MD-2.

    PubMed

    Ohto, Umeharu; Fukase, Koichi; Miyake, Kensuke; Shimizu, Toshiyuki

    2012-05-08

    Lipopolysaccharide (LPS), also known as endotoxin, activates the innate immune response through toll-like receptor 4 (TLR4) and its coreceptor, MD-2. MD-2 has a unique hydrophobic cavity that directly binds to lipid A, the active center of LPS. Tetraacylated lipid IVa, a synthetic lipid A precursor, acts as a weak agonist to mouse TLR4/MD-2, but as an antagonist to human TLR4/MD-2. However, it remains unclear as to how LPS and lipid IVa show agonistic or antagonistic activities in a species-specific manner. The present study reports the crystal structures of mouse TLR4/MD-2/LPS and TLR4/MD-2/lipid IVa complexes at 2.5 and 2.7 Å resolutions, respectively. Mouse TLR4/MD-2/LPS exhibited an agonistic "m"-shaped 2:2:2 complex similar to the human TLR4/MD-2/LPS complex. Mouse TLR4/MD-2/lipid IVa complex also showed an agonistic structural feature, exhibiting architecture similar to the 2:2:2 complex. Remarkably, lipid IVa in the mouse TLR4/MD-2 complex occupied nearly the same space as LPS, although lipid IVa lacked the two acyl chains. Human MD-2 binds lipid IVa in an antagonistic manner completely differently from the way mouse MD-2 does. Together, the results provide structural evidence of the agonistic property of lipid IVa on mouse TLR4/MD-2 and deepen understanding of the ligand binding and dimerization mechanism by the structurally diverse LPS variants.

  8. Bacterial lipopolysaccharide induces increased expression of toll-like receptor (TLR) 4 and downstream TLR signaling molecules in bovine mammary epithelial cells

    USDA-ARS?s Scientific Manuscript database

    Bovine mammary epithelial cells contribute to the innate immune response to intramammary infections by recognizing pathogens through specialized pattern recognition receptors. Toll-like receptor 4 (TLR4) is one such receptor that binds and is activated by lipopolysaccharide (LPS), a component of the...

  9. Robust TLR4-induced gene expression patterns are not an accurate indicator of human immunity

    PubMed Central

    2010-01-01

    Background Activation of Toll-like receptors (TLRs) is widely accepted as an essential event for defence against infection. Many TLRs utilize a common signalling pathway that relies on activation of the kinase IRAK4 and the transcription factor NFκB for the rapid expression of immunity genes. Methods 21 K DNA microarray technology was used to evaluate LPS-induced (TLR4) gene responses in blood monocytes from a child with an IRAK4-deficiency. In vitro responsiveness to LPS was confirmed by real-time PCR and ELISA and compared to the clinical predisposition of the child and IRAK4-deficient mice to Gram negative infection. Results We demonstrated that the vast majority of LPS-responsive genes in IRAK4-deficient monocytes were greatly suppressed, an observation that is consistent with the described role for IRAK4 as an essential component of TLR4 signalling. The severely impaired response to LPS, however, is inconsistent with a remarkably low incidence of Gram negative infections observed in this child and other children with IRAK4-deficiency. This unpredicted clinical phenotype was validated by demonstrating that IRAK4-deficient mice had a similar resistance to infection with Gram negative S. typhimurium as wildtype mice. A number of immunity genes, such as chemokines, were expressed at normal levels in human IRAK4-deficient monocytes, indicating that particular IRAK4-independent elements within the repertoire of TLR4-induced responses are expressed. Conclusions Sufficient defence to Gram negative immunity does not require IRAK4 or a robust, 'classic' inflammatory and immune response. PMID:20105294

  10. Determination of the physiological 2:2 TLR5:flagellin activation stoichiometry revealed by the activity of a fusion receptor

    SciTech Connect

    Ivičak-Kocjan, Karolina; Panter, Gabriela; Benčina, Mojca; Jerala, Roman

    2013-05-24

    Highlights: •The chimeric protein fusing flagellin to the TLR5 ectodomain is constitutively active. •Mutation P736H within the BB-loop of TLR5 TIR domain renders the receptor inactive. •The R90D mutation in flagellin inactivated autoactivation of the chimeric protein. •The 2:2 stoichiometry of the TLR5:flagellin complex is physiologically relevant. -- Abstract: Toll-like receptor 5 (TLR5) recognizes flagellin of most flagellated bacteria, enabling activation of the MyD88-dependent signaling pathway. The recently published crystal structure of a truncated zebrafish TLR5 ectodomain in complex with an inactive flagellin fragment indicated binding of two flagellin molecules to a TLR5 homodimer, however this complex did not dimerize in solution. In the present study, we aimed to determine the physiological stoichiometry of TLR5:flagellin activation by the use of a chimeric protein composed of an active flagellin fragment linked to the N-terminus of human TLR5 (SF-TLR5). This construct was constitutively active. Inactivation by the R90D mutation within flagellin demonstrated that autoactivation of the chimeric protein depended solely on the specific interaction between TLR5 and flagellin. Addition of wild-type hTLR5 substantially lowered autoactivation of SF-TLR5 in a concentration dependent manner, an effect which was reversible by the addition of exogenous Salmonella typhimurium flagellin, indicating the biological activity of a TLR5:flagellin complex with a 2:2 stoichiometry. These results, in addition to the combinations of inactive P736H mutation within the BB-loop of the TIR domain of TLR5 and SF-TLR5, further confirm the mechanism of TLR5 activation.

  11. Molecular characterization and transcriptional analysis of non-mammalian type Toll like receptor (TLR21) from rock bream (Oplegnathus fasciatus).

    PubMed

    Priyathilaka, Thanthrige Thiunuwan; Elvitigala, Don Anushka Sandaruwan; Whang, Ilson; Lim, Bong-Soo; Jeong, Hyung-Bok; Yeo, Sang-Yeob; Choi, Cheol Young; Lee, Jehee

    2014-12-15

    Toll-like receptors (TLRs) are a large family of pattern recognition receptors, which are involved in triggering host immune responses against various pathogens by detecting their evolutionarily conserved pathogen associated molecular patterns (PAMPs). TLR21 is a non-mammalian type TLR, which recognizes unmethylated CpG DNA, and is considered as a functional homolog of mammalian TLR9. In this study, we attempted to identify and characterize a novel TLR21 counterpart from rock bream (Oplegnathus fasciatus) designated as RbTLR21, at molecular level. The complete coding sequence of RbTLR21 was 2919bp in length, which encodes a polypeptide of 973 amino acids with a predicted molecular mass of 112kDa and a theoretical isoelectric point of 8.6. The structure of the deduced RbTLR21 protein is similar to that of the members of typical TLR family, and includes the ectodomain, which consists of 16 leucine rich repeats (LRRs), a transmembrane domain, and a cytoplasmic Toll/interleukin-1 receptor (TIR) domain. According to the pairwise sequence analysis data, RbTLR21 was homologous to that of the orange-spotted grouper (Epinephelus coioides) with 76.9% amino acid identity. Furthermore, our phylogenetic analysis revealed that RbTLR21 is closely related to E. coioides TLR21. The RbTLR21 was ubiquitously expressed in all the tissues tested, but the highest expression was found in spleen. Additionally, upon stimulation with Streptococcus iniae, rock bream iridovirus (RBIV), and Edwardsiella tarda, RbTLR21 mRNA was significantly up-regulated in spleen tissues. Collectively, our findings suggest that RbTLR21 is indeed an ortholog of the TLR21 family and may be important in mounting host immune responses against pathogenic infections. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Localization of Type I Interferon Receptor Limits Interferon-Induced TLR3 in Epithelial Cells

    PubMed Central

    Ciencewicki, Jonathan M.; Brighton, Luisa E.

    2009-01-01

    Previous studies have shown that influenza infections increase Toll-like receptor 3 (TLR3) expression and that type I interferons (IFNs) may play a role in this response. This study aimed to expand on the role of type I IFNs in the influenza-induced upregulation of TLR3 and determine whether and how the localization of the IFN-α/β receptor (IFNAR) in respiratory epithelial cells could modify IFN-induced responses. Using differentiated primary human airway epithelial cells this study demonstrates that soluble mediators secreted in response to influenza infection upregulate TLR3 expression in naive cells. This response was associated with an upregulation of type I IFNs and stimulation with type I, but not type II, IFNs enhanced TLR3 expression. Interestingly, although influenza infection results in IFN-β release both toward the apical and basolateral sides of the epithelium, TLR3 expression is only enhanced in cells stimulated with IFN-β from the basolateral side. Immunohistochemical analysis demonstrates that IFNAR expression is limited to the basolateral side of differentiated human airway epithelial cells. However, non- or poorly differentiated epithelial cells express IFNAR more toward the apical side. These data demonstrate that restricted expression of the IFNAR in the differentiated airway epithelium presents a potential mechanism of regulating type I IFN-induced TLR3 expression. PMID:19231996

  13. Recognition of lipid A variants by the TLR4-MD-2 receptor complex

    PubMed Central

    Maeshima, Nina; Fernandez, Rachel C.

    2012-01-01

    Lipopolysaccharide (LPS) is a component of the outer membrane of almost all Gram-negative bacteria and consists of lipid A, core sugars, and O-antigen. LPS is recognized by Toll-like receptor 4 (TLR4) and MD-2 on host innate immune cells and can signal to activate the transcription factor NFκB, leading to the production of pro-inflammatory cytokines that initiate and shape the adaptive immune response. Most of what is known about how LPS is recognized by the TLR4-MD-2 receptor complex on animal cells has been studied using Escherichia coli lipid A, which is a strong agonist of TLR4 signaling. Recent work from several groups, including our own, has shown that several important pathogenic bacteria can modify their LPS or lipid A molecules in ways that significantly alter TLR4 signaling to NFκB. Thus, it has been hypothesized that expression of lipid A variants is one mechanism by which pathogens modulate or evade the host immune response. Additionally, several key differences in the amino acid sequences of human and mouse TLR4-MD-2 receptors have been shown to alter the ability to recognize these variations in lipid A, suggesting a host-specific effect on the immune response to these pathogens. In this review, we provide an overview of lipid A variants from several human pathogens, how the basic structure of lipid A is recognized by mouse and human TLR4-MD-2 receptor complexes, as well as how alteration of this pattern affects its recognition by TLR4 and impacts the downstream immune response. PMID:23408095

  14. S-adenosylmethionine prevents the up regulation of Toll-like receptor (TLR) signaling caused by chronic ethanol feeding in rats.

    PubMed

    Oliva, Joan; Bardag-Gorce, Fawzia; Li, Jun; French, Barbara A; French, Samuel W

    2011-06-01

    Toll-like receptors (TLR) play a role in mediating the proinflammatory response, fibrogenesis and carcinogenesis in chronic liver diseases such as alcoholic liver disease, non-alcoholic liver disease, hepatitis C and hepatocellular carcinoma. This is true in experimental models of these diseases. For this reason, we investigated the TLR proinflammatory response in the chronic intragastric tube feeding rat model of alcohol liver disease. The methyl donor S-adenosylmethionine was also fed to prevent the gene expression changes induced by ethanol. Ethanol feeding tended to increase the up regulation of the gene expression of TLR2 and TLR4. SAMe feeding prevented this. TLR4 and MyD88 protein levels were significantly increased by ethanol and this was prevented by SAMe. This is the first report where ethanol feeding induced TLR2 and SAMe prevented the induction by ethanol. CD34, FOS, interferon responsive factor 1 (IRF-1), Jun, TLR 1,2,3,4,6 and 7 and Traf-6 were found to be up regulated as seen by microarray analysis where rats were sacrificed at high blood alcohol levels compared to pair fed controls. Il-6, IL-10 and IFNγ were also up regulated by high blood levels of ethanol. The gene expression of CD14, MyD88 and TNFR1SF1 were not up regulated by ethanol but were down regulated by SAMe. The gene expression of IL-1R1 and IRF1 tended to be up regulated by ethanol and this was prevented by feeding SAMe. The results suggest that SAMe, fed chronically prevents the activation of TLR pathways caused by ethanol. In this way the proinflammatory response, fibrogenesis, cirrhosis and hepatocellular carcinoma formation due to alcohol liver disease could be prevented by SAMe.

  15. S-ADENOSYLMETHIONINE PREVENTS THE UP REGULATION OF TOLL-LIKE RECEPTOR (TLR) SIGNALING CAUSED BY CHRONIC ETHANOL FEEDING IN RATS

    PubMed Central

    Oliva, Joan; Bardag-Gorce, Fawzia; Li, Jun; French, Barbara A; French, Samuel W

    2011-01-01

    Toll-like receptors (TLR) play a role in mediating the proinflammatory response, fibrogenesis and carcinogenesis in chronic liver diseases such as alcoholic liver disease, non-alcoholic liver disease, hepatitis C and hepatocellular carcinoma. This is true in experimental models of these diseases. For this reason, we investigated the TLR proinflammatory response in the chronic intragastric tube feeding rat model of alcohol liver disease. The methyl donor S-adenosylmethionine was also fed to prevent the gene expression changes induced by ethanol. Ethanol feeding tended to increase the up regulation of the gene expression of TLR2 and TLR4. SAMe feeding prevented this. TLR4 and MyD88 protein levels were significantly increased by ethanol and this was prevented by SAMe. This is the first report where ethanol feeding induced TLR2 and SAMe prevented the induction by ethanol. CD34, FOS, interferon responsive factor 1 (IRF-1), Jun, TLR 1,2,3,4,6 and 7 and Traf-6 were found to be up regulated as seen by microarray analysis where rats were sacrified at high blood alcohol levels compared to pair fed controls. Il-6, IL-10 and IFNγ were also up regulated by high blood levels of ethanol. The gene expression of CD14, MyD88 and TNFR1SF1 were not up regulated by ethanol but were down regulated by SAMe. The gene expression of IL-1R1 and IRF1 tended to be up regulated by ethanol and this was prevented by feeding SAMe. The results suggest that SAMe, fed chronically prevents activation of TLR pathways caused by ethanol. In this way the proinflammatory response, fibrogenesis, cirrhosis and hepatocellular carcinoma formation due to alcohol liver disease could be prevented by SAMe. PMID:21276439

  16. MD-2-mediated ionic interactions between lipid A and TLR4 are essential for receptor activation.

    PubMed

    Meng, Jianmin; Lien, Egil; Golenbock, Douglas T

    2010-03-19

    Lipopolysaccharide (LPS) activates innate immune responses through TLR4.MD-2. LPS binds to the MD-2 hydrophobic pocket and bridges the dimerization of two TLR4.MD-2 complexes to activate intracellular signaling. However, exactly how lipid A, the endotoxic moiety of LPS, activates myeloid lineage cells remains unknown. Lipid IV(A), a tetra-acylated lipid A precursor, has been used widely as a model for lipid A activation. For unknown reasons, lipid IV(A) activates proinflammatory responses in rodent cells but inhibits the activity of LPS in human cells. Using stable TLR4-expressing cell lines and purified monomeric MD-2, as well as MD-2-deficient bone marrow-derived macrophages, we found that both mouse TLR4 and mouse MD-2 are required for lipid IV(A) activation. Computational studies suggested that unique ionic interactions exist between lipid IV(A) and TLR4 at the dimerization interface in the mouse complex only. The negatively charged 4'-phosphate on lipid IV(A) interacts with two positively charged residues on the opposing mouse, but not human, TLR4 (Lys(367) and Arg(434)) at the dimerization interface. When replaced with their negatively charged human counterparts Glu(369) and Gln(436), mouse TLR4 was no longer responsive to lipid IV(A). In contrast, human TLR4 gained lipid IV(A) responsiveness when ionic interactions were enabled by charge reversal at the dimerization interface, defining the basis of lipid IV(A) species specificity. Thus, using lipid IV(A) as a selective lipid A agonist, we successfully decoupled and coupled two sequential events required for intracellular signaling: receptor engagement and dimerization, underscoring the functional role of ionic interactions in receptor activation.

  17. Expression of toll-like receptor genes in leukocytes of patients with sudden sensorineural hearing loss.

    PubMed

    Yang, Chao-Hui; Hwang, Chung-Feng; Yang, Ming-Yu; Lin, Pai-Mei; Chuang, Jiin-Haur

    2015-12-01

    Sudden sensorineural hearing loss (SNNHL) is a disease entity that could be caused by multiple etiologies in which the innate immunity status of the patients might be involved. The aim of this study is to investigate the expression of Toll-like receptor (TLR) genes in peripheral blood leukocytes of SNNHL patients. Basic research. We examined the expression of six TLR genes in the peripheral blood leukocytes of SNNHL patients and normal controls using real-time quantitative reverse transcriptase-polymerase chain reaction. We found significantly higher expression of TLR2, TLR3, TLR4, TLR7, TLR8, and TLR9 genes in SNNHL patients as compared with normal controls (P < 0.05). Higher expression of the TLR2 gene was found in patients with profound hearing loss compared with those with less severe hearing loss (P < 0.05). The result was validated by the positively stained leukocytes for TLR2 protein in SNNHL patients using the immunocytochemical study. In addition, the percentage of CD14(+) monocytes expressing TLR2 in SNNHL patients was higher than in normal controls assessed by flow cytometry and significantly correlated with the hearing thresholds of the affected ear (P < 0.05). Our study implies a role for TLRs in SNNHL. The expression of TLR2 in particular correlates with the severity of the disease. N/A. © 2015 The American Laryngological, Rhinological and Otological Society, Inc.

  18. Toll-Like Receptor (TLR) 2 and TLR9 Expressed in Trigeminal Ganglia are Critical to Viral Control During Herpes Simplex Virus 1 Infection

    PubMed Central

    Lima, Graciela Kunrath; Zolini, Guilherme Pimenta; Mansur, Daniel Santos; Freire Lima, Bráulio Henrique; Wischhoff, Uschi; Astigarraga, Ruiz Gerhardt; Dias, Marcela França; Silva, Mariana das Graças Almeida; Béla, Samantha Ribeiro; do Valle Antonelli, Lis Ribeiro; Arantes, Rosa Maria; Gazzinelli, Ricardo Tostes; Báfica, André; Kroon, Erna Geessien; Campos, Marco Antônio

    2010-01-01

    Herpes simplex virus 1 (HSV-1) is a neurotropic DNA virus that is responsible for several clinical manifestations in humans, including encephalitis. HSV-1 triggers toll-like receptors (TLRs), which elicit cytokine production. Viral multiplication and cytokine expression in C57BL/6 wild-type (WT) mice infected with HSV-1 were evaluated. Virus was found in the trigeminal ganglia (TG), but not in the brains of animals without signs of encephalitis, between 2 and 6 days postinfection (d.p.i.). Cytokine expression in the TG peaked at 5 d.p.i. TLR9−/− and TLR2/9−/− mice were more susceptible to the virus, with 60% and 100% mortality, respectively, as opposed to 10% in the WT and TLR2−/− mice. Increased levels of both CXCL10/IP-10 and CCL2/MCP-1, as well as reduced levels of interferon-γ and interleukin 1-β transcripts, measured in both the TG and brains at 5 d.p.i., and the presence of virus in the brain were correlated with total mortality in TLR2/9−/− mice. Cytokine alterations in TLR2/9−/− mice coincided with histopathological changes in their brains, which did not occur in WT and TLR2−/− mice and occurred only slightly in TLR9−/− mouse brain. Increased cellularity, macrophages, CD8 T cells producing interferon-γ, and expression levels of TLR2 and TLR9 were detected in the TG of WT-infected mice. We hypothesize that HSV-1 infection is controlled by TLR-dependent immune responses in the TG, which prevent HSV-1 encephalitis. PMID:20864677

  19. Genetic Variants in Toll-Like Receptor 2 (TLR2), TLR4, TLR9, and FCγ Receptor II Are Associated with Antibody Response to Quadrivalent Meningococcal Conjugate Vaccine in HIV-Infected Youth

    PubMed Central

    Qin, Min; Lujan-Zilbermann, Jorge; Singh, Kumud K.; Warshaw, Meredith G.; Williams, Paige L.; Jean-Philippe, Patrick; Fenton, Terence; Siberry, George K.

    2013-01-01

    This study examined the association of host genetic variants with the antibody response to the quadrivalent meningococcal conjugate vaccine (MCV4) in HIV-infected youth. Genetic variants associated with severity of meningococcal disease, including the IgG Fc receptor (FCγRII)-A484T, interleukin-10 (IL-10)-A1082G, -C819T, and -C627A, IL-4-C589T, mannose binding lectin-2 (MBL2)-A/O, -H/L, -P/Q, and -X/Y, toll-like receptor 2 (TLR2)-G2408A, TLR4-A12874G and -C13174T, and TLR9-T1237C and -T1486C were determined by real-time PCR (RT-PCR) for 271 HIV-infected subjects (median, 17 years). Response was defined as a ≥4-fold increase from entry in bactericidal antibody titers to each serogroup. Generalized estimating equation (GEE) models were used to evaluate the association of allelic variants with the immunologic response to all serogroups within each subject with and without adjusting for CD4 percentage and HIV viral load. At week 4, but not after, subjects with TLR2-2408-G/A versus -G/G genotypes and the TLR4-12874-A/A genotype were more likely to achieve a ≥4-fold increase overall in the four serogroups (unadjusted P of 0.006 and adjusted P of 0.008 and unadjusted P of 0.008 and adjusted P of 0.019, respectively). At week 28, the TLR9-1237 T allele was associated with enhanced antibody response (T allele versus C/C, unadjusted P of 0.014 and adjusted P of 0.009), which was maintained at week 72 (unadjusted and adjusted P of 0.008). At week 72, the FcγRII-131Arg allotype was associated with a ≥4-fold increase in antibody titer versus those with His/His (unadjusted P of 0.009; adjusted P of <0.001). These findings suggest that for HIV-infected youth, the initial antibody response to MCV4 is associated with variants in TLR2 and TLR4 while the long-term response is associated with genetic polymorphisms in TLR9 and FcγRIIa. PMID:23595505

  20. Sialylation of Helicobacter bizzozeronii lipopolysaccharides modulates Toll-like receptor (TLR) 2 mediated response.

    PubMed

    Kondadi, Pradeep Kumar; Revez, Joana; Hänninen, Marja-Liisa; Rossi, Mirko

    2015-01-21

    Sialic acid in lipopolysaccharides (LPS) of mucosal pathogens is known to be an important virulence factor. Few strains of Helicobacter pylori express sialyl-Lewis-X and we have reported that human and canine Helicobacter bizzozeronii strains express sialyl-lactoseamine in their LPS. However, the role of sialyation of Helicobacter LPS in the interaction with the host cells is still unknown. In this study H. bizzozeronii LPS is shown to activate the TLR2 in a dose and strain dependent manner in the in vitro HEK-293 cells model expressing TLR2, but not the cells expressing TLR4. These results indicate that TLR2 is the specific receptor for H. bizzozzeronii LPS, as previously described for H. pylori. To further explore the role of sialylation of H. bizzozeronii LPS on TLR2 response, H. bizzozeronii Δhbs2 mutant strains deficient in sialyltransferase activity were constructed by homologous recombination. LPS from H. bizzozeronii Δhbs2 strains enhanced the NF-ĸB induction via TLR2 compared to the respective wild types, leading to the conclusion that the sialylation of H. bizzozeronii LPS in wild-type strains may modulate host immune response.

  1. A toll-like receptor 4 (TLR4) variant is associated with asthma severity

    PubMed Central

    Zhang, Long; Xu, Ai-Guo; Zhao, Wei; Xu, Qin-Fu; Zhao, Yu-Miao; Li, Dan-Dan; Shi, Xiao-Ya; Zhao, Jun-Jie

    2015-01-01

    Asthma is a complex airways disease resulting from the input of both biological and environmental factors. Previous studies of single-nucleotide polymorphisms in toll-like receptor 4 (TLR4), which produces a protein involved in regulating T cell populations, have presented conflicting results regarding its role in asthma severity. In the current study, individuals with asthma were genotyped for variants of TLR4, and the genotypes were compared with asthma severity and T cell subpopulations. TLR4 rs11536879 (A>G) and rs1927907 (G>A) genotypes were determined in 350 asthma patients using TaqMan. Asthma severity was graded by clinical symptoms, and blood markers and lung function measures were also collected. T cell subpopulations were identified from peripheral blood by flow cytometry. No significant correlations were observed between genotypes at TLR4 rs11536879 or rs1927907 and eosinophil counts, total serum IgE, serum hypersensitive C-reactive protein, forced expiratory volume in 1 second (FEV1%), or FEV1/forced vital capacity (FVC) in asthma patients (P > 0.05). However, the GG genotype of rs1927907 was correlated with higher asthma severity (P < 0.05). No associations were detected between genotypes at rs11536879 or rs1927907 and CD4+CD25high regulatory T cell counts in peripheral blood from asthmatic patients (P > 0.05), but the rs1927907 genotype was associated with TLR4 expression on the surface of CD4+CD25high regulatory T cells (P < 0.05). Therefore, the TLR4 variant rs1927907 appears to be related to asthma severity and TLR4 expression on the surface of CD4+CD25high regulatory T cells, suggesting the potential influence of TLR4 on T cell population balances. PMID:26221339

  2. Role of Toll-Like Receptor (TLR) 2 in Experimental Bacillus cereus Endophthalmitis

    PubMed Central

    Novosad, Billy D.; Astley, Roger A.; Callegan, Michelle C.

    2011-01-01

    Bacillus cereus causes a uniquely rapid and blinding intraocular infection, endophthalmitis. B. cereus replicates in the eye, synthesizes numerous toxins, and incites explosive intraocular inflammation. The mechanisms involved in the rapid and explosive intraocular immune response have not been addressed. Because Toll-like receptors (TLRs) are integral to the initial recognition of organisms during infection, we hypothesized that the uniquely explosive immune response observed during B. cereus endophthalmitis is directly influenced by the presence of TLR2, a known Gram-positive pathogen recognition receptor. To address this hypothesis, we compared the courses of experimental B. cereus endophthalmitis in wild type C57BL/6J mice to that of age-matched homozygous TLR2-/- mice. Output parameters included analysis of bacterial growth, inflammatory cell (PMN) infiltration, cytokine/chemokine kinetics, retinal function testing, and histology, with N≥4 eyes/assay/time point/mouse strain. B. cereus grew at similar rates to108 CFU/eye by 12 h, regardless of the mouse strain. Retinal function was preserved to a greater degree in infected TLR2-/- eyes compared to that of infected wild type eyes, but infected eyes of both mouse strains lost significant function. Retinal architecture was preserved in infected TLR2-/- eyes, with limited retinal and vitreal cellular infiltration compared to that of infected wild type eyes. Ocular myeloperoxidase activities corroborated these results. In general, TNFα, IFNγ, IL6, and KC were detected in greater concentrations in infected wild type eyes than in infected TLR2-/- eyes. The absence of TLR2 resulted in decreased intraocular proinflammatory cytokine/chemokine levels and altered recruitment of inflammatory cells into the eye, resulting in less intraocular inflammation and preservation of retinal architecture, and a slightly greater degree of retinal function. These results demonstrate TLR2 is an important component of the initial

  3. Role of Toll-like receptor (TLR) 2 in experimental Bacillus cereus endophthalmitis.

    PubMed

    Novosad, Billy D; Astley, Roger A; Callegan, Michelle C

    2011-01-01

    Bacillus cereus causes a uniquely rapid and blinding intraocular infection, endophthalmitis. B. cereus replicates in the eye, synthesizes numerous toxins, and incites explosive intraocular inflammation. The mechanisms involved in the rapid and explosive intraocular immune response have not been addressed. Because Toll-like receptors (TLRs) are integral to the initial recognition of organisms during infection, we hypothesized that the uniquely explosive immune response observed during B. cereus endophthalmitis is directly influenced by the presence of TLR2, a known gram-positive pathogen recognition receptor. To address this hypothesis, we compared the courses of experimental B. cereus endophthalmitis in wild type C57BL/6J mice to that of age-matched homozygous TLR2(-/-) mice. Output parameters included analysis of bacterial growth, inflammatory cell (PMN) infiltration, cytokine/chemokine kinetics, retinal function testing, and histology, with N≥4 eyes/assay/time point/mouse strain. B. cereus grew at similar rates to10(8) CFU/eye by 12 h, regardless of the mouse strain. Retinal function was preserved to a greater degree in infected TLR2(-/-) eyes compared to that of infected wild type eyes, but infected eyes of both mouse strains lost significant function. Retinal architecture was preserved in infected TLR2(-/-) eyes, with limited retinal and vitreal cellular infiltration compared to that of infected wild type eyes. Ocular myeloperoxidase activities corroborated these results. In general, TNFα, IFNγ, IL6, and KC were detected in greater concentrations in infected wild type eyes than in infected TLR2(-/-) eyes. The absence of TLR2 resulted in decreased intraocular proinflammatory cytokine/chemokine levels and altered recruitment of inflammatory cells into the eye, resulting in less intraocular inflammation and preservation of retinal architecture, and a slightly greater degree of retinal function. These results demonstrate TLR2 is an important component of the

  4. Inhibition of Toll-like receptors TLR4 and 7 signaling pathways by SIGIRR: a computational approach.

    PubMed

    Gong, Jing; Wei, Tiandi; Stark, Robert W; Jamitzky, Ferdinand; Heckl, Wolfgang M; Anders, Hans J; Lech, Maciej; Rössle, Shaila C

    2010-03-01

    Toll-like receptors (TLRs) belong to the Toll-like receptor/interleukin-1 receptor (TLR/IL-1R) superfamily which is defined by a common cytoplasmic Toll/interleukin-1 receptor (TIR) domain. TLRs recognize pathogen-associated molecular patterns and initiate an intracellular kinase cascade to trigger an immediate defensive response. SIGIRR (single immunoglobulin interleukin-1 receptor-related molecule), another member of the TLR/IL-1R superfamily, acts as a negative regulator of MyD88-dependent TLR signaling. It attenuates the recruitment of MyD88 adaptors to the receptors with its intracellular TIR domain. Thus, SIGIRR is a highly important molecule for the therapy of autoimmune diseases caused by TLRs. So far, the structural mechanism of interactions between SIGIRR, TLRs and adaptor molecules is unclear. To develop a working hypothesis for this interaction, we constructed three-dimensional models for the TIR domains of TLR4, TLR7, MyD88 and SIGIRR based on computational modeling. Through protein-protein docking analysis, we developed models of essential complexes involved in the TLR4 and 7 signaling and the SIGIRR inhibiting processes. We suggest that SIGIRR may exert its inhibitory effect through blocking the molecular interface of TLR4, TLR7 and the MyD88 adaptor mainly via its BB-loop region. (c) 2009 Elsevier Inc. All rights reserved.

  5. Inhibitory Effect of TLR4 Gene Silencing on Intimal Hyperplasia of Vein Grafting.

    PubMed

    Zhu, Zhicheng; Xu, Rihao; Zheng, Xiaomei; Wang, Tiance; Li, Dan; Wang, Yong; Liu, Kexiang

    2016-10-01

    The present study aimed to explore the regulating effect of Toll-like receptor 4 (TLR4) on intimal hyperplasia in rat vein grafts. Rat models of external jugular vein carotid artery bypass grafting were established. Afterward, TLR4 small interfering RNA (siRNA) recombinant plasmids were constructed, which were transfected into rat vein graft bypass to study the effect of TLR4 silencing on intimal hyperplasia and to explore the underlying mechanisms. Real-time polymerase chain reaction and Western blot were used to detect the expression levels of TLR4 and inflammatory factors in TLR4 siRNA-transfected vein graft bypass. The intimal thickness was evaluated using hematoxylin-eosin staining. Compared with the scramble siRNA group, the intimal thickness of vein grafting was decreased significantly, while the inflammatory factors including interleukin (IL) 1β, IL-6, and tumor necrosis factor α in grafted vein were dramatically downregulated in the TLR4 siRNA group. These results showed that local silencing of TLR4 in the vein grafts could inhibit intimal hyperplasia by downregulating the expression of inflammatory factors in the vein grafts, suggesting that TLR4 can be used as a new target for therapy of vascular intimal hyperplasia. © The Author(s) 2016.

  6. [The role of TLR4 receptor in the stress response of lymphocytes].

    PubMed

    Novoselova, E G; Khrenov, M O; Cherenkov, D A; Glushkova, O V; Novoselova, T V; Lunin, S M; Lysenko, E A; Fesenko, E E

    2008-01-01

    In vitro effects of low-level electromagnetic waves (8.18 GHz, frequency swings within 1 s, intensity 1 microW/cm, exposure for 1 h) and low-energy laser light (He-Ne laser with 632.8 nm, 0.2 mW/cm, dose 1.2 x 10(-2) J/cm2) on the expression of receptor protein TLR4, which is known as a part of the system for microbal toxin recognition, were studied in mouse lymphocytes. In addition, TLR4 expression was examined in situations when stress responses to low-level nonionizing radiation were modified by the antibiotic geldanamycin, which suppresses the activity of the heat shock protein Hsp90. It was found that low-level microwaves significantly raised the amount of TLR4; in contrast, laser light decreased the expression of the receptor in lymphocytes. In cells pretreated with geldanamycin, the TLR4 expression in irradiated cells was reduced to minimum levels, much lower than control values. The results showed that TLR4, which is involved in specific binding of toxin from gram-negative bacteria, can regulate cell responses to signals of other origin, in particular to nonionizig radiation, including low-level microwaves and laser light.

  7. Toll-like receptor 2 (TLR2) mediates intracellular signalling in human keratinocytes in response to Malassezia furfur.

    PubMed

    Baroni, Adone; Orlando, Manuela; Donnarumma, Giovanna; Farro, Pietro; Iovene, Maria Rosaria; Tufano, Maria Antonietta; Buommino, Elisabetta

    2006-01-01

    Toll-like receptors (TLRs) are crucial players in the innate immune response to microbial invaders. The lipophilic yeast Malassezia furfur has been implicated in the triggering of scalp lesions in psoriasis. The aim of the present study was to assess the role of TLRs in the defence against M. furfur infection. The expression of the myeloid differentiation factor 88 (MyD88) gene, which is involved in the signalling pathway of many TLRs, was also analysed. In addition, a possible correlation of antimicrobial peptides of the beta-defensin family to TLRs was tested. Human keratinocytes infected with M. furfur and a variety of M. furfur-positive psoriatic skin biopsies were analysed by RT-PCR, for TLRs, MyD88, human beta-defensin 2 (HBD-2), HBD-3 and interleukin-8 (IL-8) mRNA expression. When keratinocytes were infected with M. furfur, an up-regulation for TLR2, MyD88, HBD-2, HBD-3 and IL-8 mRNA was demonstrated, compared to the untreated cells. The same results were obtained when psoriatic skin biopsies were analysed. The M. furfur-induced increase in HBD-2 and IL-8 gene expression is inhibited by anti-TLR2 neutralising antibodies, suggesting that TLR2 is involved in the M. furfur-induced expression of these molecules. These findings suggest the importance of TLRs in skin protection against fungi and the importance of keratinocytes as a component of innate immunity.

  8. Localization of type I interferon receptor limits interferon-induced TLR-3 in epithelial cells

    EPA Science Inventory

    This study aimed to expand on the role of type I IFNs in the influenza-induced upregulation of TLR3 and determine whether and how the localization of the IFN-alpha/beta receptor (IFNAR) in respiratory epithelial cells could modify IFN-induced responses. Using differentiated prima...

  9. Localization of type I interferon receptor limits interferon-induced TLR-3 in epithelial cells

    EPA Science Inventory

    This study aimed to expand on the role of type I IFNs in the influenza-induced upregulation of TLR3 and determine whether and how the localization of the IFN-alpha/beta receptor (IFNAR) in respiratory epithelial cells could modify IFN-induced responses. Using differentiated prima...

  10. Inhibition of TLR2 signaling by small molecule inhibitors targeting a pocket within the TLR2 TIR domain.

    PubMed

    Mistry, Pragnesh; Laird, Michelle H W; Schwarz, Ryan S; Greene, Shannon; Dyson, Tristan; Snyder, Greg A; Xiao, Tsan Sam; Chauhan, Jay; Fletcher, Steven; Toshchakov, Vladimir Y; MacKerell, Alexander D; Vogel, Stefanie N

    2015-04-28

    Toll-like receptor (TLR) signaling is initiated by dimerization of intracellular Toll/IL-1 receptor resistance (TIR) domains. For all TLRs except TLR3, recruitment of the adapter, myeloid differentiation primary response gene 88 (MyD88), to TLR TIR domains results in downstream signaling culminating in proinflammatory cytokine production. Therefore, blocking TLR TIR dimerization may ameliorate TLR2-mediated hyperinflammatory states. The BB loop within the TLR TIR domain is critical for mediating certain protein-protein interactions. Examination of the human TLR2 TIR domain crystal structure revealed a pocket adjacent to the highly conserved P681 and G682 BB loop residues. Using computer-aided drug design (CADD), we sought to identify a small molecule inhibitor(s) that would fit within this pocket and potentially disrupt TLR2 signaling. In silico screening identified 149 compounds and 20 US Food and Drug Administration-approved drugs based on their predicted ability to bind in the BB loop pocket. These compounds were screened in HEK293T-TLR2 transfectants for the ability to inhibit TLR2-mediated IL-8 mRNA. C16H15NO4 (C29) was identified as a potential TLR2 inhibitor. C29, and its derivative, ortho-vanillin (o-vanillin), inhibited TLR2/1 and TLR2/6 signaling induced by synthetic and bacterial TLR2 agonists in human HEK-TLR2 and THP-1 cells, but only TLR2/1 signaling in murine macrophages. C29 failed to inhibit signaling induced by other TLR agonists and TNF-α. Mutagenesis of BB loop pocket residues revealed an indispensable role for TLR2/1, but not TLR2/6, signaling, suggesting divergent roles. Mice treated with o-vanillin exhibited reduced TLR2-induced inflammation. Our data provide proof of principle that targeting the BB loop pocket is an effective approach for identification of TLR2 signaling inhibitors.

  11. Influence of age, sex and rearing systems on Toll-like receptor 7 (TLR7) expression pattern in gut, lung and lymphoid tissues of indigenous ducks.

    PubMed

    Kolluri, Gautham; Ramamurthy, N; Churchil, R R; Dhinakar Raj, G; Kannaki, T R

    2014-02-01

    Abstract 1. The objective of the experiment was to determine the influence of age, sex and rearing system on Toll-like receptor 7 (TLR7) gene expression in gut, lung and lymphoid tissues and physiological responses to stress in male and female indigenous ducks of Tamil Nadu, India. 2. A total of 36 ducks (12 males and 24 females) were obtained from local farmers and tissue samples of gut tissues (duodenum, jejunum, ileum and caecum), lymphoid organs (spleen and bursa) and lungs were collected in RNAlater solution followed by RNA extraction. 3. After normalisation to β-actin (endogenous control) qPCR analysis identified a significant effect of age, sex and rearing system on TLR7 expression in the ducks. 4. A significant up-regulation of TLR7 expression was observed in lungs, duodenum, jejunum, ileum and caecum of sexually mature (45 wk) compared with that of immature ducks (16 wk). Among sexes, male ducks had significantly higher TLR7 expression than female ducks. 5. Age and sex interactions were significant in lungs, duodenum, jejunum and caecum. Ducks reared in an extensive housing system showed significantly higher TLR7 expression in bursa, lungs, duodenum, ileum and caecum compared to intensively reared ducks. There were no effects of age, sex and rearing systems on TLR7 expression in the spleen. 6. The heterophil-to-lymphocyte ratio and serum corticosterone were higher in ducks reared on an intensive system compared with ducks from an extensive rearing system.

  12. Discovery and Validation of a New Class of Small Molecule Toll-Like Receptor 4 (TLR4) Inhibitors

    PubMed Central

    Neal, Matthew D.; Jia, Hongpeng; Eyer, Benjamin; Good, Misty; Guerriero, Christopher J.; Sodhi, Chhinder P.; Afrazi, Amin; Prindle, Thomas; Ma, Congrong; Branca, Maria; Ozolek, John; Brodsky, Jeffrey L.; Wipf, Peter; Hackam, David J.

    2013-01-01

    Many inflammatory diseases may be linked to pathologically elevated signaling via the receptor for lipopolysaccharide (LPS), toll-like receptor 4 (TLR4). There has thus been great interest in the discovery of TLR4 inhibitors as potential anti-inflammatory agents. Recently, the structure of TLR4 bound to the inhibitor E5564 was solved, raising the possibility that novel TLR4 inhibitors that target the E5564-binding domain could be designed. We utilized a similarity search algorithm in conjunction with a limited screening approach of small molecule libraries to identify compounds that bind to the E5564 site and inhibit TLR4. Our lead compound, C34, is a 2-acetamidopyranoside (MW 389) with the formula C17H27NO9, which inhibited TLR4 in enterocytes and macrophages in vitro, and reduced systemic inflammation in mouse models of endotoxemia and necrotizing enterocolitis. Molecular docking of C34 to the hydrophobic internal pocket of the TLR4 co-receptor MD-2 demonstrated a tight fit, embedding the pyran ring deep inside the pocket. Strikingly, C34 inhibited LPS signaling ex-vivo in human ileum that was resected from infants with necrotizing enterocolitis. These findings identify C34 and the β-anomeric cyclohexyl analog C35 as novel leads for small molecule TLR4 inhibitors that have potential therapeutic benefit for TLR4-mediated inflammatory diseases. PMID:23776545

  13. Synergistic Induction of Interferon α through TLR-3 and TLR-9 Agonists Identifies CD21 as Interferon α Receptor for the B Cell Response

    PubMed Central

    Kim, Dhohyung; Niewiesk, Stefan

    2013-01-01

    Maternal antibodies inhibit seroconversion and the generation of measles virus (MeV)-specific antibodies (both neutralizing and non-neutralizing antibodies) after vaccination whereas T cell responses are usually unaffected. The lack of seroconversion leaves individuals susceptible to vaccine-preventable infections. Inhibition of antibody secretion is due to the inhibition of B cells through a cross-link of the B cell receptor with the inhibitory FcγIIB receptor (CD32) by maternal antibody/vaccine complexes. Here, we demonstrate that a combination of TLR-3 and TLR-9 agonists induces synergistically higher levels of type I interferon in vitro and in vivo than either agonist alone. The synergistic action of TLR-3 and TLR-9 agonists is based on a feedback loop through the interferon receptor. Finally, we have identified CD21 as a potential receptor for interferon α on B cells which contributes to interferon α-mediated activation of B cells in the presence of maternal antibodies. The combination leads to complete restoration of B cell and antibody responses after immunization in the presence of inhibitory MeV-specific IgG. The strong stimulatory action of type I interferon is due to the fact that type I interferon uses not only the interferon receptor but also CD21 as a functional receptor for B cell activation. PMID:23516365

  14. Diversity in the Toll-like receptor genes of the Tasmanian devil (Sarcophilus harrisii).

    PubMed

    Cui, Jian; Cheng, Yuanyuan; Belov, Katherine

    2015-03-01

    The Tasmanian devil is an endangered marsupial species that has survived several historical bottlenecks and now has low genetic diversity. Here we characterize the Toll-like receptor (TLR) genes and their diversity in the Tasmanian devil. TLRs are a key innate immune gene family found in all animals. Ten TLR genes were identified in the Tasmanian devil genome. Unusually low levels of diversity were found in 25 devils from across Tasmania. We found two alleles at TLR2, TLR3 and TLR6. The other seven genes were monomorphic. The insurance population, which safeguards the species from extinction, has successfully managed to capture all of these TLR alleles, but concerns remain for the long-term survival of this species.

  15. Genetic drift outweighs natural selection at toll-like receptor (TLR) immunity loci in a re-introduced population of a threatened species.

    PubMed

    Grueber, Catherine E; Wallis, Graham P; Jamieson, Ian G

    2013-09-01

    During population establishment, genetic drift can be the key driver of changes in genetic diversity, particularly while the population is small. However, natural selection can also play a role in shaping diversity at functionally important loci. We used a well-studied, re-introduced population of the threatened Stewart Island robin (N = 722 pedigreed individuals) to determine whether selection shaped genetic diversity at innate immunity toll-like receptor (TLR) genes, over a 9-year period of population growth following establishment with 12 genetic founders. We found no evidence for selection operating with respect to TLR diversity on first-year overwinter survival for the majority of loci, genotypes and alleles studied. However, survival of individuals with TLR4BE genotype was significantly improved: these birds were less than half as likely to die prior to maturity compared with all other TLR4 genotypes. Furthermore, the population frequency of this genotype, at a two-fold excess over Hardy-Weinberg expectation, was increased by nonrandom mating. Near-complete sampling and full pedigree and reproductive data enabled us to eliminate other potential causes of these patterns including inbreeding, year effects, density dependence, selection on animals at earlier life history stages or genome-level association of the TLR4E allele with 'good genes'. However, comparison of observed levels of gene diversity to predictions under simulated genetic drift revealed results consistent with neutral expectations for all loci, including TLR4. Although selection favoured TLR4BE heterozygotes in this population, these effects were insufficient to outweigh genetic drift. This is the first empirical study to show that genetic drift can overwhelm natural selection in a wild population immediately following establishment.

  16. Evolutionary redesign of the Atlantic cod (Gadus morhua L.) Toll-like receptor repertoire by gene losses and expansions

    PubMed Central

    Solbakken, Monica H.; Tørresen, Ole K.; Nederbragt, Alexander J.; Seppola, Marit; Gregers, Tone F.; Jakobsen, Kjetill S.; Jentoft, Sissel

    2016-01-01

    Genome sequencing of the teleost Atlantic cod demonstrated loss of the Major Histocompatibility Complex (MHC) class II, an extreme gene expansion of MHC class I and gene expansions and losses in the innate pattern recognition receptor (PRR) family of Toll-like receptors (TLR). In a comparative genomic setting, using an improved version of the genome, we characterize PRRs in Atlantic cod with emphasis on TLRs demonstrating the loss of TLR1/6, TLR2 and TLR5 and expansion of TLR7, TLR8, TLR9, TLR22 and TLR25. We find that Atlantic cod TLR expansions are strongly influenced by diversifying selection likely to increase the detectable ligand repertoire through neo- and subfunctionalization. Using RNAseq we find that Atlantic cod TLRs display likely tissue or developmental stage-specific expression patterns. In a broader perspective, a comprehensive vertebrate TLR phylogeny reveals that the Atlantic cod TLR repertoire is extreme with regards to losses and expansions compared to other teleosts. In addition we identify a substantial shift in TLR repertoires following the evolutionary transition from an aquatic vertebrate (fish) to a terrestrial (tetrapod) life style. Collectively, our findings provide new insight into the function and evolution of TLRs in Atlantic cod as well as the evolutionary history of vertebrate innate immunity. PMID:27126702

  17. Evolutionary redesign of the Atlantic cod (Gadus morhua L.) Toll-like receptor repertoire by gene losses and expansions.

    PubMed

    Solbakken, Monica H; Tørresen, Ole K; Nederbragt, Alexander J; Seppola, Marit; Gregers, Tone F; Jakobsen, Kjetill S; Jentoft, Sissel

    2016-04-29

    Genome sequencing of the teleost Atlantic cod demonstrated loss of the Major Histocompatibility Complex (MHC) class II, an extreme gene expansion of MHC class I and gene expansions and losses in the innate pattern recognition receptor (PRR) family of Toll-like receptors (TLR). In a comparative genomic setting, using an improved version of the genome, we characterize PRRs in Atlantic cod with emphasis on TLRs demonstrating the loss of TLR1/6, TLR2 and TLR5 and expansion of TLR7, TLR8, TLR9, TLR22 and TLR25. We find that Atlantic cod TLR expansions are strongly influenced by diversifying selection likely to increase the detectable ligand repertoire through neo- and subfunctionalization. Using RNAseq we find that Atlantic cod TLRs display likely tissue or developmental stage-specific expression patterns. In a broader perspective, a comprehensive vertebrate TLR phylogeny reveals that the Atlantic cod TLR repertoire is extreme with regards to losses and expansions compared to other teleosts. In addition we identify a substantial shift in TLR repertoires following the evolutionary transition from an aquatic vertebrate (fish) to a terrestrial (tetrapod) life style. Collectively, our findings provide new insight into the function and evolution of TLRs in Atlantic cod as well as the evolutionary history of vertebrate innate immunity.

  18. CD200 receptor controls sex-specific TLR7 responses to viral infection.

    PubMed

    Karnam, Guruswamy; Rygiel, Tomasz P; Raaben, Matthijs; Grinwis, Guy C M; Coenjaerts, Frank E; Ressing, Maaike E; Rottier, Peter J M; de Haan, Cornelis A M; Meyaard, Linde

    2012-01-01

    Immunological checkpoints, such as the inhibitory CD200 receptor (CD200R), play a dual role in balancing the immune system during microbial infection. On the one hand these inhibitory signals prevent excessive immune mediated pathology but on the other hand they may impair clearance of the pathogen. We studied the influence of the inhibitory CD200-CD200R axis on clearance and pathology in two different virus infection models. We find that lack of CD200R signaling strongly enhances type I interferon (IFN) production and viral clearance and improves the outcome of mouse hepatitis corona virus (MHV) infection, particularly in female mice. MHV clearance is known to be dependent on Toll like receptor 7 (TLR7)-mediated type I IFN production and sex differences in TLR7 responses previously have been reported for humans. We therefore hypothesize that CD200R ligation suppresses TLR7 responses and that release of this inhibition enlarges sex differences in TLR7 signaling. This hypothesis is supported by our findings that in vivo administration of synthetic TLR7 ligand leads to enhanced type I IFN production, particularly in female Cd200(-/-) mice and that CD200R ligation inhibits TLR7 signaling in vitro. In influenza A virus infection we show that viral clearance is determined by sex but not by CD200R signaling. However, absence of CD200R in influenza A virus infection results in enhanced lung neutrophil influx and pathology in females. Thus, CD200-CD200R and sex are host factors that together determine the outcome of viral infection. Our data predict a sex bias in both beneficial and pathological immune responses to virus infection upon therapeutic targeting of CD200-CD200R.

  19. Aberrant intestinal microbiota due to IL-1 receptor antagonist deficiency promotes IL-17- and TLR4-dependent arthritis.

    PubMed

    Rogier, Rebecca; Ederveen, Thomas H A; Boekhorst, Jos; Wopereis, Harm; Scher, Jose U; Manasson, Julia; Frambach, Sanne J C M; Knol, Jan; Garssen, Johan; van der Kraan, Peter M; Koenders, Marije I; van den Berg, Wim B; van Hijum, Sacha A F T; Abdollahi-Roodsaz, Shahla

    2017-06-23

    Perturbation of commensal intestinal microbiota has been associated with several autoimmune diseases. Mice deficient in interleukin-1 receptor antagonist (Il1rn (-/-) mice) spontaneously develop autoimmune arthritis and are susceptible to other autoimmune diseases such as psoriasis, diabetes, and encephalomyelitis; however, the mechanisms of increased susceptibility to these autoimmune phenotypes are poorly understood. We investigated the role of interleukin-1 receptor antagonist (IL-1Ra) in regulation of commensal intestinal microbiota, and assessed the involvement of microbiota subsets and innate and adaptive mucosal immune responses that underlie the development of spontaneous arthritis in Il1rn (-/-) mice. Using high-throughput 16S rRNA gene sequencing, we show that IL-1Ra critically maintains the diversity and regulates the composition of intestinal microbiota in mice. IL-1Ra deficiency reduced the intestinal microbial diversity and richness, and caused specific taxonomic alterations characterized by overrepresented Helicobacter and underrepresented Ruminococcus and Prevotella. Notably, the aberrant intestinal microbiota in IL1rn (-/-) mice specifically potentiated IL-17 production by intestinal lamina propria (LP) lymphocytes and skewed the LP T cell balance in favor of T helper 17 (Th17) cells, an effect transferable to WT mice by fecal microbiota. Importantly, LP Th17 cell expansion and the development of spontaneous autoimmune arthritis in IL1rn (-/-) mice were attenuated under germ-free condition. Selective antibiotic treatment revealed that tobramycin-induced alterations of commensal intestinal microbiota, i.e., reduced Helicobacter, Flexispira, Clostridium, and Dehalobacterium, suppressed arthritis in IL1rn (-/-) mice. The arthritis phenotype in IL1rn (-/-) mice was previously shown to depend on Toll-like receptor 4 (TLR4). Using the ablation of both IL-1Ra and TLR4, we here show that the aberrations in the IL1rn (-/-) microbiota are partly TLR4

  20. Association of TLR5 Gene Polymorphisms in Ulcerative Colitis Patients of North India and Their Role in Cytokine Homeostasis

    PubMed Central

    Meena, Naresh Kumar; Ahuja, Vineet; Meena, Kusumlata; Paul, Jaishree

    2015-01-01

    Background and Aim In health, TLR signaling protects the intestinal epithelial barrier and in disease, aberrant TLR signaling stimulates diverse inflammatory responses. Association of TLR polymorphisms is ethnicity dependent but how they impact the complex pathogenesis of IBD is not clearly defined. So we propose to study the status of polymorphisms in TLR family of genes and their effect on cytokines level in UC patients. Methods The genotypes of the six loci TLR1-R80T, TLR2-R753Q, TLR3-S258G, TLR5-R392X, TLR5-N592S and TLR6-S249P were determined in 350 controls and 328 UC patients by PCR-RFLP and sequencing. Cytokine levels were measured by ELISA in blood plasma samples. Data were analyzed statistically by SPSS software. Results TLR5 variants R392X and N592S showed significant association (p = 0.007, 0.021) with UC patients but TLR 1, 2, 3, 6 variants did not show any association. Unlike other studies carried out in different ethnic groups, TLR 6 (S249P) SNP was universally present in our population irrespective of disease. Genotype-phenotype correlation analysis revealed that the patients having combination of multiple SNPs both in TLR5 and TLR4 gene suffered from severe disease condition and diagnosed at an early age. The level of TNFα (p = 0.004), IL-6 (p = 0.0001) and IFNγ (p = 0.006) significantly increased in patients as compared to controls having wild genotypes for the studied SNPs. However, there was decreased level of TNFα (p = 0.014), IL-6 (p = 0.028) and IFNγ (p = 0.001) in patients carrying TLR5-R392X variant as compared to wild type patients. Patients carrying two simultaneous SNPs D299G in TLR4 gene and N592S in TLR5 gene showed significant decrease in the levels of TNFα (p = 0.011) and IFNγ (p = 0.016). Conclusion Polymorphisms in TLR 5 genes were significantly associated with the UC in North Indian population. The cytokine level was significantly modulated in patients with different genotypes of TLR4 and TLR5 SNPs. PMID:25789623

  1. Genetic predisposition of variants in TLR2 and its co-receptors to severe malaria in Odisha, India.

    PubMed

    Panigrahi, Subhendu; Kar, Avishek; Tripathy, Sagnika; Mohapatra, Manoj K; Dhangadamajhi, Gunanidhi

    2016-02-01

    Although the role of TLRs signalling in malaria pathogenesis is well established, contribution of individual TLR to clinical outcome of malaria still remains inconclusive. Given the importance of TLR2 and its co-receptors in recognising distinct structural forms of key malaria toxins and mediating innate immune response, it is essential to delineate their genetic contribution. Variants in TLR1 (I602S) and TLR6 (P249S) were genotyped by PCR-RFLP methods, and TLR2 (I/D) was genotyped by PCR in 200 samples each from uncomplicated malaria (UM) and severe malaria (SM). Further, SM was categorised into its sub-clinical groups (CM and NCSM or SOD and MODS) and analysed. The results showed the PP genotype of TLR6 (P249S) to be significantly more common in UM (P < 0.0001), whereas the 'SS' genotype was the risk factor for SM including its sub-clinical categories. The TLR1 (602S) and TLR2 (D) variants were significantly high in patients with CM; however, negative LD was observed between TLR2 and TLR6 in NCSM and MODS. Haplotype analysis showed significantly high frequency of I-I-S haplotype in all forms of subclinical SM and was associated with low parasite load in SM (P = 0.013). The haplotypes I-D-S and S-I-P were significantly high in SOD and CM, respectively. The TLR6 '249S' variant appeared to be the dominant determinant for genetic predisposition to SM and that its association with either TLR2 'D' or TLR1 '602S' modulates for CM development. The present study opens up several new avenues for their exploration and validation in future studies in different global settings for malaria.

  2. Suppression of TLR4-mediated inflammatory response by macrophage class A scavenger receptor (CD204)

    SciTech Connect

    Ohnishi, Koji; Komohara, Yoshihiro; Fujiwara, Yukio; Takemura, Kenichi; Lei, XiaoFeng; Nakagawa, Takenobu; Sakashita, Naomi; Takeya, Motohiro

    2011-08-05

    Highlights: {yields} We focused on the interaction between SR-A and TLR4 signaling in this study. {yields} SR-A deletion promoted NF{kappa}B activation in macrophages in septic model mouse. {yields} SR-A suppresses both MyD88-dependent and -independent TLR4 signaling in vitro. {yields} SR-A clears LPS binding to TLR4 which resulting in the suppression of TLR4 signals. -- Abstract: The class A scavenger receptor (SR-A, CD204), one of the principal receptors expressed on macrophages, has been found to regulate inflammatory response and attenuate septic endotoxemia. However, the detailed mechanism of this process has not yet been well characterized. To clarify the regulative mechanisms of lipopolysaccharide (LPS)-induced macrophage activation by SR-A, we evaluated the activation of Toll-like receptor 4 (TLR4)-mediated signaling molecules in SR-A-deficient (SR-A{sup -/-}) macrophages. In a septic shock model, the blood levels of tumor necrosis factor (TNF)-{alpha}, interleukin (IL)-6 and interferon (IFN)-{beta} were significantly increased in SR-A{sup -/-} mice compared to wild-type mice, and elevated nuclear factor kappa B (NF{kappa}B) activation was detected in SR-A{sup -/-} macrophages. SR-A deletion increased the production of pro-inflammatory cytokines, and the phosphorylation of mitogen-activated protein kinase (MAPK) and NF{kappa}B in vitro. SR-A deletion also promoted the nuclear translocation of NF{kappa}B and IFN regulatory factor (IRF)-3. In addition, a competitive binding assay with acetylated low-density lipoprotein, an SR-A-specific ligand, and anti-SR-A antibody induced significant activation of TLR4-mediated signaling molecules in wild-type macrophages but not in SR-A{sup -/-} macrophages. These results suggest that SR-A suppresses the macrophage activation by inhibiting the binding of LPS to TLR4 in a competitive manner and it plays a pivotal role in the regulation of the LPS-induced inflammatory response.

  3. Mapping toll-like receptor signaling pathway genes of Zhikong scallop ( Chlamys farreri) with FISH

    NASA Astrophysics Data System (ADS)

    Zhao, Bosong; Zhao, Liang; Liao, Huan; Cheng, Jie; Lian, Shanshan; Li, Xuan; Huang, Xiaoting; Bao, Zhenmin

    2015-12-01

    Toll-like receptor (TLR) signaling pathway plays a pivotal role in the innate immune system. Studies on TLR signaling pathway genes in Zhikong scallop ( Chlamys farreri) have mainly focused on sequence analysis and expression profiling, no research has been carried out on their localization. The chromosomal position of TLR signaling pathway genes can be valuable for assemblying scallop genome and analysizing gene regulatory networks. In the present study, five key TLR signaling pathway genes ( CfTLR, CfMyd88, CfTRAF6, CfNFκB, and CfIκB) containing bacterial artificial chromosomes (BACs) were isolated and physically mapped through fluorescence in situ hybridization on five non-homologous chromosome pairs, showing a similar distribution to another five model species. The isolation and mapping of these key immune genes of C. farreri will aid to the research on innate immunity, assignment of interested genes to chromosomes, and integration of physical, linkage and cytogenetic maps of this species.

  4. Binge alcohol drinking is associated with GABAA α2-regulated Toll-like receptor 4 (TLR4) expression in the central amygdala

    PubMed Central

    Liu, Juan; Yang, Andrew R.; Kelly, Timothy; Puche, Adam; Esoga, Chioma; June, Harry L.; Elnabawi, Ahmed; Merchenthaler, Istvan; Sieghart, Werner; June, Harry L.; Aurelian, Laure

    2011-01-01

    Binge drinking (blood-alcohol levels ≥ 0.08 g% in a 2-h period), is a significant public health burden in need of improved treatment. Gene therapy may offer beneficial alternatives to current psychosocial and pharmacotherapeutic interventions, but identification of the target genes is a clinical challenge. We report that a GABAA α2 siRNA vector (pHSVsiLA2) infused into the central nucleus of the amygdala (CeA) of alcohol-preferring (P) rats caused profound and selective reduction of binge drinking associated with inhibition of α2 expression, decreased GABAA receptor density, and inhibition of Toll-like receptor 4 (TLR4). CeA infusion of a TLR4 siRNA vector (pHSVsiLTLR4a) also inhibited binge drinking, but neither vector functioned when infused into the ventral pallidum. Binge drinking was inhibited by a GABAA α1 siRNA vector (pHSVsiLA1) infused into the ventral pallidum, unrelated to TLR4. The vectors did not alter sucrose intake and a scrambled siRNA vector was negative. The data indicate that GABAA α2-regulated TLR4 expression in the CeA contributes to binge drinking and may be a key early neuroadaptation in excessive drinking. PMID:21368176

  5. Toll-Like Receptor 3 (TLR3) Plays a Major Role in the Formation of Rabies Virus Negri Bodies

    PubMed Central

    Ménager, Pauline; Roux, Pascal; Mégret, Françoise; Bourgeois, Jean-Pierre; Le Sourd, Anne-Marie; Danckaert, Anne; Lafage, Mireille; Préhaud, Christophe; Lafon, Monique

    2009-01-01

    Human neurons express the innate immune response receptor, Toll-like receptor 3 (TLR3). TLR3 levels are increased in pathological conditions such as brain virus infection. Here, we further investigated the production, cellular localisation, and function of neuronal TLR3 during neuronotropic rabies virus (RABV) infection in human neuronal cells. Following RABV infection, TLR3 is not only present in endosomes, as observed in the absence of infection, but also in detergent-resistant perinuclear inclusion bodies. As well as TLR3, these inclusion bodies contain the viral genome and viral proteins (N and P, but not G). The size and composition of inclusion bodies and the absence of a surrounding membrane, as shown by electron microscopy, suggest they correspond to the previously described Negri Bodies (NBs). NBs are not formed in the absence of TLR3, and TLR3−/− mice—in which brain tissue was less severely infected—had a better survival rate than WT mice. These observations demonstrate that TLR3 is a major molecule involved in the spatial arrangement of RABV–induced NBs and viral replication. This study shows how viruses can exploit cellular proteins and compartmentalisation for their own benefit. PMID:19247444

  6. Toll-like receptor 3 (TLR3) plays a major role in the formation of rabies virus Negri Bodies.

    PubMed

    Ménager, Pauline; Roux, Pascal; Mégret, Françoise; Bourgeois, Jean-Pierre; Le Sourd, Anne-Marie; Danckaert, Anne; Lafage, Mireille; Préhaud, Christophe; Lafon, Monique

    2009-02-01

    Human neurons express the innate immune response receptor, Toll-like receptor 3 (TLR3). TLR3 levels are increased in pathological conditions such as brain virus infection. Here, we further investigated the production, cellular localisation, and function of neuronal TLR3 during neuronotropic rabies virus (RABV) infection in human neuronal cells. Following RABV infection, TLR3 is not only present in endosomes, as observed in the absence of infection, but also in detergent-resistant perinuclear inclusion bodies. As well as TLR3, these inclusion bodies contain the viral genome and viral proteins (N and P, but not G). The size and composition of inclusion bodies and the absence of a surrounding membrane, as shown by electron microscopy, suggest they correspond to the previously described Negri Bodies (NBs). NBs are not formed in the absence of TLR3, and TLR3(-/-) mice -- in which brain tissue was less severely infected -- had a better survival rate than WT mice. These observations demonstrate that TLR3 is a major molecule involved in the spatial arrangement of RABV-induced NBs and viral replication. This study shows how viruses can exploit cellular proteins and compartmentalisation for their own benefit.

  7. The common food additive carrageenan is not a ligand for Toll-Like- Receptor 4 (TLR4) in an HEK293-TLR4 reporter cell-line model.

    PubMed

    McKim, James M; Wilga, Paul C; Pregenzer, Jeffrey F; Blakemore, William R

    2015-04-01

    Carrageenan (CGN) is widely used in the food manufacturing industry as an additive that stabilizes and thickens food products. Standard animal safety studies in which CGN was administered in diet showed no adverse effects. However, several in vitro studies have reported that intestinal inflammation is caused by CGN and that this effect is mediated through Toll-Like-Receptor 4 (TLR4). The purpose of this study was to evaluate the ability of different types of CGN to bind and activate TLR4 signaling. To accomplish this a TLR4/MD-2/CD14/NFκB/SEAP reporter construct in a HEK293 cell line was used. The reporter molecule, secretable alkaline phosphatase (SEAP), was measured as an indicator of TLR4 activation. The test compounds were exposed to this system at concentrations of 0.1, 1, 10, 50, 100, 500, 1000, and 5000 ng/mL for 24 h. Cytotoxicity was evaluated following the 24 h exposure period by LDH leakage and ATP. CGN binding to serum proteins was characterized by Toluidine Blue. The results show that CGN does not bind to TLR4 and is not cytotoxic to the HEK293 cells at the concentrations and experimental conditions tested and that CGN binds tightly to serum proteins. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Polymorphisms at Locus 4p14 of Toll-Like Receptors TLR-1 and TLR-10 Confer Susceptibility to Gastric Carcinoma in Helicobacter pylori Infection

    PubMed Central

    Ravishankar Ram, M.; Goh, Khean Lee; Leow, Alex Hwong Ruey; Poh, Bee Hoon; Loke, Mun Fai; Harrison, Richard; Shankar, Esaki M.; Vadivelu, Jamuna

    2015-01-01

    Helicobacter pylori (H. pylori) -induced gastric inflammation impacts the functions of leptin- and ghrelin-producing cells in the gastroduodenum. Inflammation resulting from H. pylori sensing via Toll-like receptors (TLRs) and the associated downstream signaling largely remain ambiguous. Here, we investigated the role of gut hormones, pro-inflammatory cytokines and single nucleotide polymorphisms (SNPs) associated with TLR 4p14 in H. pylori disease in 30 subjects with non-ulcer dyspepsia (NUD), 40 with peptic ulcer disease (PUD) and 15 with gastric cancer (GC) subjects positive and negative for H. pylori infection. The level of pro-inflammatory cytokines was directly proportional to the severity of gastritis, and disease status influenced the levels of gut hormones and pro-inflammatory cytokines. TLR-1 SNPs rs4833095 and TLR-10 SNPs rs10004195 and were directly associated with H. pylori disease, and were up-regulated in the presence of H. pylori in a genotype-independent manner. We concluded that TLR-1 rs4833095 and TLR10 rs10004195 confer susceptibility to development of gastroduodenal disease, especially GC in H.pylori disease. PMID:26559190

  9. Novel Role for the Innate Immune Receptor Toll-Like Receptor 4 (TLR4) in the Regulation of the Wnt Signaling Pathway and Photoreceptor Apoptosis

    PubMed Central

    Yi, Hyun; Patel, Amit K.; Sodhi, Chhinder P.; Hackam, David J.; Hackam, Abigail S.

    2012-01-01

    Recent evidence has implicated innate immunity in regulating neuronal survival in the brain during stroke and other neurodegenerations. Photoreceptors are specialized light-detecting neurons in the retina that are essential for vision. In this study, we investigated the role of the innate immunity receptor TLR4 in photoreceptors. TLR4 activation by lipopolysaccharide (LPS) significantly reduced the survival of cultured mouse photoreceptors exposed to oxidative stress. With respect to mechanism, TLR4 suppressed Wnt signaling, decreased phosphorylation and activation of the Wnt receptor LRP6, and blocked the protective effect of the Wnt3a ligand. Paradoxically, TLR4 activation prior to oxidative injury protected photoreceptors, in a phenomenon known as preconditioning. Expression of TNFα and its receptors TNFR1 and TNFR2 decreased during preconditioning, and preconditioning was mimicked by TNFα antagonists, but was independent of Wnt signaling. Therefore, TLR4 is a novel regulator of photoreceptor survival that acts through the Wnt and TNFα pathways. PMID:22615780

  10. MAP1S Protein Regulates the Phagocytosis of Bacteria and Toll-like Receptor (TLR) Signaling.

    PubMed

    Shi, Ming; Zhang, Yifan; Liu, Leyuan; Zhang, Tingting; Han, Fang; Cleveland, Joseph; Wang, Fen; McKeehan, Wallace L; Li, Yu; Zhang, Dekai

    2016-01-15

    Phagocytosis is a critical cellular process for innate immune defense against microbial infection. The regulation of phagocytosis process is complex and has not been well defined. An intracellular molecule might regulate cell surface-initiated phagocytosis, but the underlying molecular mechanism is poorly understood (1). In this study, we found that microtubule-associated protein 1S (MAP1S), a protein identified recently that is involved in autophagy (2), is expressed primarily in macrophages. MAP1S-deficient macrophages are impaired in the phagocytosis of bacteria. Furthermore, we demonstrate that MAP1S interacts directly with MyD88, a key adaptor of Toll-like receptors (TLRs), upon TLR activation and affects the TLR signaling pathway. Intriguingly, we also observe that, upon TLR activation, MyD88 participates in autophagy processing in a MAP1S-dependent manner by co-localizing with MAP1 light chain 3 (MAP1-LC3 or LC3). Therefore, we reveal that an intracellular autophagy-related molecule of MAP1S controls bacterial phagocytosis through TLR signaling.

  11. X-Chromosome complement and estrogen receptor signaling independently contribute to the enhanced TLR7-mediated IFN-α production of plasmacytoid dendritic cells from women.

    PubMed

    Laffont, Sophie; Rouquié, Nelly; Azar, Pascal; Seillet, Cyril; Plumas, Joël; Aspord, Caroline; Guéry, Jean-Charles

    2014-12-01

    Human plasmacytoid dendritic cells (pDCs) play a major role in innate immunity through the production of type I IFNs after TLR engagement by pathogens. Sex-based differences in the innate function of human pDCs have been established, with pDCs from women exhibiting enhanced TLR7-mediated IFN-α production as compared with pDCs from males. In mice, we recently provided evidence for a role of estrogens as a positive regulator of pDC innate functions through cell-intrinsic estrogen receptor α signaling, but did not exclude a role for other X-linked factors, particularly in human pDCs. In this study, we investigated the respective contribution of X chromosome dosage and sex hormones using a humanized mouse model in which male or female NOD-SCID-β2m(-/-) were transplanted with human progenitor cells purified from either male or female cord blood cells. We showed that, in response to TLR7 ligands, the frequency of IFN-α- and TNF-α-producing pDCs from either sex was greater in female than in male host mice, suggesting a positive role for estrogens. Indeed, blockade of estrogen receptor signaling during pDC development in vitro inhibited TLR7-mediated IFN-α production by human pDCs, which expressed both ESR1 and ESR2 genes. Interestingly, we also found that X chromosome dosage contributed to this sex bias as female pDCs have an enhanced TLR7-mediated IFN-α response as compared with male ones, irrespective of the sex of the recipient mice. Together, these results indicate that female sex hormones, estrogens, and X chromosome complement independently contribute to the enhanced TLR7-mediated IFN-α response of pDCs in women.

  12. Expression and activation of intracellular receptors TLR7, TLR8 and TLR9 in peripheral blood monocytes from HIV-infected patients

    PubMed Central

    Pinzón Herrera, Francisc; Cruz López, Juan J; Vera Gamboa, Ligia del Carmen; Pavía Ruiz, Norma; Santos Rivero, Adrián; Sánchez Lugo, Saulo; Puerto, Fernando

    2013-01-01

    Introduction: TLR´s play a role in host defense in HIV infection recognizing the viral DNA or RNA. Their activation induces a signaling pathway that includes the proteins MyD88, IRAK4, TRAF6 and the transcription factor NF-kBp65. Objective: To determine the expression of TLR7, TLR8 and TLR9, and activation of its signaling pathway in monocytes from patients infected with HIV. Methods. Expression of TLR7, TLR8 and TLR9 was determined in monocytes from HIV-infected patients (n= 13) and control subjects (n= 13), which were activated with specific ligands. The expression of MyD88 and NF-kBp65 were determined by flow cytometry; IRAK4 and TRAF6 were studied by immunoblotting. Results: No statistical difference was found in the expression of TLR7, 8 and 9 in monocytes from patients compared to controls, but we observed the non-significant increased expression of TLR9 in patients. The activation showed no significant difference in the expression of MyD88 and NF-kBp65 in patients when compared to controls, but were decreased in stimulated cells over non-stimulated cells. IRAK4 and TRAF6 were not detected. Conclusions: No statistical difference was observed in the expression of intracellular TLRs, MyD88 and NFkBp65 in monocytes from patients compared to controls. This was probably due to effective antiretroviral therapy being received at the time of study entry. Additional studies are needed under controlled conditions that include infected patients with and without ARVT, responders and non-responders, and work with different cell populations. PMID:24892454

  13. Expression and activation of intracellular receptors TLR7, TLR8 and TLR9 in peripheral blood monocytes from HIV-infected patients.

    PubMed

    Valencia Pacheco, Guillermo J; Pinzón Herrera, Francisc; Cruz López, Juan J; Vera Gamboa, Ligia Del Carmen; Pavía Ruiz, Norma; Santos Rivero, Adrián; Sánchez Lugo, Saulo; Puerto, Fernando

    2013-04-01

    TLR´s play a role in host defense in HIV infection recognizing the viral DNA or RNA. Their activation induces a signaling pathway that includes the proteins MyD88, IRAK4, TRAF6 and the transcription factor NF-kBp65. To determine the expression of TLR7, TLR8 and TLR9, and activation of its signaling pathway in monocytes from patients infected with HIV. Methods. Expression of TLR7, TLR8 and TLR9 was determined in monocytes from HIV-infected patients (n= 13) and control subjects (n= 13), which were activated with specific ligands. The expression of MyD88 and NF-kBp65 were determined by flow cytometry; IRAK4 and TRAF6 were studied by immunoblotting. No statistical difference was found in the expression of TLR7, 8 and 9 in monocytes from patients compared to controls, but we observed the non-significant increased expression of TLR9 in patients. The activation showed no significant difference in the expression of MyD88 and NF-kBp65 in patients when compared to controls, but were decreased in stimulated cells over non-stimulated cells. IRAK4 and TRAF6 were not detected. No statistical difference was observed in the expression of intracellular TLRs, MyD88 and NFkBp65 in monocytes from patients compared to controls. This was probably due to effective antiretroviral therapy being received at the time of study entry. Additional studies are needed under controlled conditions that include infected patients with and without ARVT, responders and non-responders, and work with different cell populations.

  14. Identification, characterization and genetic mapping of the TLR1 gene in rainbow trout (Oncorhynchus mykiss)

    USDA-ARS?s Scientific Manuscript database

    Induction of innate immune pathways is critical for early antimicrobial defense but there is limited understanding of how teleosts recognize microbial molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 1 and 2 form a heterodimer involved in recognizing peptidoglycans and l...

  15. Unique Roles of TLR9- and MyD88-Dependent and -Independent Pathways in Adaptive Immune Responses to AAV-Mediated Gene Transfer.

    PubMed

    Rogers, Geoffrey L; Suzuki, Masataka; Zolotukhin, Irene; Markusic, David M; Morel, Laurence M; Lee, Brendan; Ertl, Hildegund C J; Herzog, Roland W

    2015-01-01

    The immune system represents a significant barrier to successful gene therapy with adeno-associated viral (AAV) vectors. In particular, adaptive immune responses to the viral capsid or the transgene product are of concern. The sensing of AAV by toll-like receptors (TLRs) TLR2 and TLR9 has been suggested to play a role in innate immunity to the virus and may also shape subsequent adaptive immune responses. Here, we investigated the functions of TLR2, TLR9 and the downstream signaling adaptor MyD88 in antibody and CD8+ T-cell responses. Antibody formation against the transgene product occurred largely independently of TLR signaling following gene transfer with AAV1 or AAV2 vectors, whereas loss of signaling through the TLR9-MyD88 pathway substantially reduced CD8+ T-cell responses. In contrast, MyD88 (but neither of the TLRs) regulated antibody responses to capsid. B cell-intrinsic MyD88 was required for the formation of anti-capsid IgG2c independently of vector serotype or route of administration. However, MyD88(-/-) mice instead produced anti-capsid IgG1 that emerged with delayed kinetics but nonetheless completely prevented in vivo readministration. We conclude that there are distinct roles for TLR9 and MyD88 in promoting adaptive immune responses to AAV-mediated gene transfer and that there are redundant MyD88-dependent and MyD88-independent mechanisms that stimulate neutralizing antibody formation against AAV.

  16. Should a Toll-like receptor 4 (TLR-4) agonist or antagonist be designed to treat cancer? TLR-4: its expression and effects in the ten most common cancers

    PubMed Central

    Mai, Chun Wai; Kang, Yew Beng; Pichika, Mallikarjuna Rao

    2013-01-01

    Toll-like receptor 4 (TLR-4) is well known for its host innate immunity. Despite the fact that TLR-4 activation confers antitumor responses; emerging evidence suggests that TLR-4 is associated with tumor development and progression. It is now clear that overactivation of TLR-4, through various immune mediators, may cause immune response dysfunction, resulting in tumorigenesis. Different cancers could have different extents of TLR-4 involvement during tumorigenesis or tumor progression. In this review, we focus on infection- and inflammation-related TLR-4 activation in noncancer and cancer cells, as well as on the current evidence about the role of TLR-4 in ten of the most common cancers, viz, head and neck cancer, lung cancer, gastrointestinal cancer, liver cancer, pancreatic cancer, skin cancer, breast cancer, ovarian cancer, cervical cancer, and prostate cancer. PMID:24235843

  17. Short- and long-term regulation of intestinal Na+/H+ exchange by Toll-like receptors TLR4 and TLR5.

    PubMed

    Cabral, José Miguel; Grácio, Daniela; Soares-da-Silva, Patrício; Magro, Fernando

    2015-10-15

    Inappropriate activation of pattern recognition receptors has been described as a potential trigger in the development of inflammatory bowel disease (IBD). In this study, we evaluated the activity and expression of Na(+)/H(+) exchanger (NHE) subtypes in T84 intestinal epithelial cells during Toll-like receptor 4 (TLR4) activation by monophosphoryl lipid A and TLR5 by flagellin. NHE activity and intracellular pH were evaluated by spectrofluorescence. Additionally, kinase activities were evaluated by ELISA, and siRNA was used to specifically inhibit adenylyl cyclase (AC). Monophosphoryl lipid A (MPLA) (0.01-50.00 μg/ml) and flagellin (10-500 ng/ml) inhibited NHE1 activity in a concentration-dependent manner (MPLA short term -25.2 ± 5.0%, long term -31.9 ± 4.0%; flagellin short term -14.9 ± 2.0%, long term -19.1 ± 2.0%). Both ligands triggered AC3, PKA, PLC, and PKC signal molecules. Long-term exposure to flagellin and MPLA induced opposite changes on NHE3 activity; flagellin increased NHE3 activity (∼10%) with overexpression of membrane protein, whereas MPLA decreased NHE3 activity (-17.3 ± 3.0%). MPLA and flagellin simultaneously had synergistic effects on NHE activity. MPLA and flagellin impaired pHi recovery after intracellular acidification. The simultaneous exposure to MPLA and flagellin induced a substantial pHi reduction (-0.55 ± 0.03 pH units). Activation of TLR4 and TLR5 exerts marked inhibition of NHE1 activity in intestinal epithelial cells. Transduction mechanisms set into motion during TLR4-mediated and long-term TLR5-mediated inhibition of NHE1 activity involve AC3, PKA, PLC, and PKC. However, short- and long-term TLR4 activation and TLR5 activation might use different signaling pathways. The physiological alterations on intestinal epithelial cells described here may be useful in the development of better IBD therapeutics.

  18. Activation of Toll-like Receptor 4 (TLR4) Attenuates Adaptive Thermogenesis via Endoplasmic Reticulum Stress*

    PubMed Central

    Okla, Meshail; Wang, Wei; Kang, Inhae; Pashaj, Anjeza; Carr, Timothy; Chung, Soonkyu

    2015-01-01

    Adaptive thermogenesis is the cellular process transforming chemical energy into heat in response to cold. A decrease in adaptive thermogenesis is a contributing factor to obesity. However, the molecular mechanisms responsible for the compromised adaptive thermogenesis in obese subjects have not yet been elucidated. In this study we hypothesized that Toll-like receptor 4 (TLR4) activation and subsequent inflammatory responses are key regulators to suppress adaptive thermogenesis. To test this hypothesis, C57BL/6 mice were either fed a palmitate-enriched high fat diet or administered with chronic low-dose LPS before cold acclimation. TLR4 stimulation by a high fat diet or LPS were both associated with reduced core body temperature and heat release. Impairment of thermogenic activation was correlated with diminished expression of brown-specific markers and mitochondrial dysfunction in subcutaneous white adipose tissue (sWAT). Defective sWAT browning was concomitant with elevated levels of endoplasmic reticulum (ER) stress and autophagy. Consistently, TLR4 activation by LPS abolished cAMP-induced up-regulation of uncoupling protein 1 (UCP1) in primary human adipocytes, which was reversed by silencing of C/EBP homologous protein (CHOP). Moreover, the inactivation of ER stress by genetic deletion of CHOP or chemical chaperone conferred a resistance to the LPS-induced suppression of adaptive thermogenesis. Collectively, our data indicate the existence of a novel signaling network that links TLR4 activation, ER stress, and mitochondrial dysfunction, thereby antagonizing thermogenic activation of sWAT. Our results also suggest that TLR4/ER stress axis activation may be a responsible mechanism for obesity-mediated defective brown adipose tissue activation. PMID:26370079

  19. Diversity of the TLR4 Immunity Receptor in Czech Native Cattle Breeds Revealed Using the Pacific Biosciences Sequencing Platform.

    PubMed

    Novák, Karel; Pikousová, Jitka; Czerneková, Vladimíra; Mátlová, Věra

    2017-07-03

    The allelic variants of immunity genes in historical breeds likely reflect local infection pressure and therefore represent a reservoir for breeding. Screening to determine the diversity of the Toll-like receptor gene TLR4 was conducted in two conserved cattle breeds: Czech Red and Czech Red Pied. High-throughput sequencing of pooled PCR amplicons using the PacBio platform revealed polymorphisms, which were subsequently confirmed via genotyping techniques. Eight SNPs found in coding and adjacent regions were grouped into 18 haplotypes, representing a significant portion of the known diversity in the global breed panel and presumably exceeding diversity in production populations. Notably, the ancient Czech Red breed appeared to possess greater haplotype diversity than the Czech Red Pied breed, a Simmental variant, although the haplotype frequencies might have been distorted by significant crossbreeding and bottlenecks in the history of Czech Red cattle. The differences in haplotype frequencies validated the phenotypic distinctness of the local breeds. Due to the availability of Czech Red Pied production herds, the effect of intensive breeding on TLR diversity can be evaluated in this model. The advantages of the Pacific Biosciences technology for the resequencing of long PCR fragments with subsequent direct phasing were independently validated.

  20. The molecular mechanism of species-specific recognition of lipopolysaccharides by the MD-2/TLR4 receptor complex.

    PubMed

    Oblak, Alja; Jerala, Roman

    2015-02-01

    Lipid A, a component of bacterial lipopolysaccharide, is a conserved microbe-associated molecular pattern that activates the MD-2/TLR4 receptor complex. Nevertheless, bacteria produce lipid A molecules of considerable structural diversity. The human MD-2/TLR4 receptor most efficiently recognizes hexaacylated bisphosphorylated lipid A produced by enterobacteria, but in some animal species the immune response can be elicited also by alternative lipid A varieties, such as tetraacylated lipid IVa or pentaacylated lipid A of Rhodobacter spheroides. Several crystal structures revealed that hexaacylated lipid A and tetraacylated lipid IVa activate the murine MD-2/TLR4 in a similar manner, but failed to explain the antagonistic vs. agonistic activity of lipid IVa in the human vs. equine receptor, respectively. Targeted mutagenesis studies of the receptor complex revealed intricate combination of electrostatic and hydrophobic interactions primarily within the MD-2 co-receptor, but with a contribution of TLR4 as well, that contribute to species-specific recognition of lipid A. We will review current knowledge regarding lipid A diversity and species-specific activation of the MD-2/TLR4 receptor complex in different species (e.g. human, mouse or equine) by lipid A varieties.

  1. Lipopolysaccharide decreases single immunoglobulin interleukin-1 receptor-related molecule (SIGIRR) expression by suppressing specificity protein 1 (Sp1) via the Toll-like receptor 4 (TLR4)-p38 pathway in monocytes and neutrophils.

    PubMed

    Ueno-Shuto, Keiko; Kato, Kosuke; Tasaki, Yukihiro; Sato, Miki; Sato, Keizo; Uchida, Yuji; Sakai, Hiromichi; Ono, Tomomi; Suico, Mary Ann; Mitsutake, Kazunori; Tokutomi, Naofumi; Kai, Hirofumi; Shuto, Tsuyoshi

    2014-06-27

    Single immunoglobulin interleukin-1 receptor-related molecule (SIGIRR) is one of the immunoglobulin-like membrane proteins that is crucial for negative regulation of toll-like receptor 4 (TLR4) and interleukin-1 receptor. Despite the importance of understanding its expression and function, knowledge is limited on the regulatory mechanism in the epithelial tissues, such as the liver, lung, and gut, where its predominant expression is originally described. Here, we found expression of SIGIRR in non-epithelial innate immune cells, including primary peripheral blood monocytes, polymorphonuclear neutrophils, monocytic RAW264 cells, and neutrophilic-differentiated HL-60 cells. Consistent with previous findings in epithelial tissues, SIGIRR gene and protein expression were also down-regulated by LPS treatment in a time-dependent manner in primary blood monocytes and polymorphonuclear neutrophils. A reduction was also observed in RAW264 and differentiated HL-60 cells. Notably, exogenous introduction of the dominant negative form of TLR4 and siRNA of p38 resulted in inhibition of LPS-induced SIGIRR down-regulation, whereas treatment with p38 activator anisomycin showed a dose-dependent decrease in SIGIRR expression, suggesting TLR4-p38 signal as a critical pathway for LPS-induced SIGIRR down-regulation. Finally, reporter gene and chromatin immunoprecipitation assays demonstrated that Sp1 is a key factor that directly binds to the proximal promoter of SIGIRR gene and consequently regulates basal SIGIRR expression, which is negatively regulated by the LPS-dependent TLR4-p38 pathway. In summary, the data precisely demonstrate how LPS down-regulates SIGIRR expression and provide a role of LPS signal that counteracts Sp1-dependent basal promoter activation of SIGIRR gene via TLR4-p38 pathway in non-epithelial innate immune cells. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Lipopolysaccharide Decreases Single Immunoglobulin Interleukin-1 Receptor-related Molecule (SIGIRR) Expression by Suppressing Specificity Protein 1 (Sp1) via the Toll-like Receptor 4 (TLR4)-p38 Pathway in Monocytes and Neutrophils*

    PubMed Central

    Ueno-Shuto, Keiko; Kato, Kosuke; Tasaki, Yukihiro; Sato, Miki; Sato, Keizo; Uchida, Yuji; Sakai, Hiromichi; Ono, Tomomi; Suico, Mary Ann; Mitsutake, Kazunori; Tokutomi, Naofumi; Kai, Hirofumi; Shuto, Tsuyoshi

    2014-01-01

    Single immunoglobulin interleukin-1 receptor-related molecule (SIGIRR) is one of the immunoglobulin-like membrane proteins that is crucial for negative regulation of toll-like receptor 4 (TLR4) and interleukin-1 receptor. Despite the importance of understanding its expression and function, knowledge is limited on the regulatory mechanism in the epithelial tissues, such as the liver, lung, and gut, where its predominant expression is originally described. Here, we found expression of SIGIRR in non-epithelial innate immune cells, including primary peripheral blood monocytes, polymorphonuclear neutrophils, monocytic RAW264 cells, and neutrophilic-differentiated HL-60 cells. Consistent with previous findings in epithelial tissues, SIGIRR gene and protein expression were also down-regulated by LPS treatment in a time-dependent manner in primary blood monocytes and polymorphonuclear neutrophils. A reduction was also observed in RAW264 and differentiated HL-60 cells. Notably, exogenous introduction of the dominant negative form of TLR4 and siRNA of p38 resulted in inhibition of LPS-induced SIGIRR down-regulation, whereas treatment with p38 activator anisomycin showed a dose-dependent decrease in SIGIRR expression, suggesting TLR4-p38 signal as a critical pathway for LPS-induced SIGIRR down-regulation. Finally, reporter gene and chromatin immunoprecipitation assays demonstrated that Sp1 is a key factor that directly binds to the proximal promoter of SIGIRR gene and consequently regulates basal SIGIRR expression, which is negatively regulated by the LPS-dependent TLR4-p38 pathway. In summary, the data precisely demonstrate how LPS down-regulates SIGIRR expression and provide a role of LPS signal that counteracts Sp1-dependent basal promoter activation of SIGIRR gene via TLR4-p38 pathway in non-epithelial innate immune cells. PMID:24821721

  3. Histamine promotes the expression of receptors TLR2 and TLR4 and amplifies sensitivity to lipopolysaccharide and lipoteichoic acid treatment in human gingival fibroblasts.

    PubMed

    Gutiérrez-Venegas, Gloria; Cruz-Arrieta, Sandra; Villeda-Navarro, Mónica; Méndez-Mejía, José Antonio

    2011-10-01

    The vasoactive hydrophilic amine histamine is the most important molecule released by mast cells. However, histamine's role in activating intracellular responses in HGFs (human gingival fibroblasts) has not been evaluated to date. In the present study, we investigated the effect of histamine and of Gram-negative [LPS (lipopolysaccharide)] and Gram-positive [LTA (lipoteichoic acid)] bacterial components on the modulation of the inflammatory response of HGFs. We incubated HGFs with histamine to determine whether this hydrophilic amine regulates overexpression of TLR2 (Toll-like receptor 2) and TLR4, which recognize LTA and LPS respectively. Our experiments demonstrated that histamine increases transcription and translation of TLR2 and TLR4. Incubation with LTA or LPS in the presence of histamine markedly increased expression of COX2 (cyclo-oxygenase 2) and synthesis of prostaglandin E2. These results suggest that histamine plays an important role in modulating the innate immune response, and likewise, that LTA and LPS regulate the adaptive immune response. The present study provides information about the regulation and expression of molecules that promote chronic inflammatory processes leading to the emergence of periodontitis and the consequent loss of the dental organ.

  4. Human decidual macrophages and NK cells differentially express Toll-like receptors and display distinct cytokine profiles upon TLR stimulation

    PubMed Central

    Duriez, Marion; Quillay, Héloïse; Madec, Yoann; El Costa, Hicham; Cannou, Claude; Marlin, Romain; de Truchis, Claire; Rahmati, Mona; Barré-Sinoussi, Françoise; Nugeyre, Marie-Thérèse; Menu, Elisabeth

    2014-01-01

    Maternofetal pathogen transmission is partially controlled at the level of the maternal uterine mucosa at the fetal implantation site (the decidua basalis), where maternal and fetal cells are in close contact. Toll-like receptors (TLRs) may play an important role in initiating rapid immune responses against pathogens in the decidua basalis, however the tolerant microenvironment should be preserved in order to allow fetal development. Here we investigated the expression and functionality of TLRs expressed by decidual macrophages (dMs) and NK cells (dNKs), the major decidual immune cell populations. We report for the first time that both human dMs and dNK cells express mRNAs encoding TLRs 1-9, albeit with a higher expression level in dMs. TLR2, TLR3, and TLR4 protein expression checked by flow cytometry was positive for both dMs and dNK cells. In vitro treatment of primary dMs and dNK cells with specific TLR2, TLR3, TLR4, TLR7/8, and TLR9 agonists enhanced their secretion of pro- and anti-inflammatory cytokines, as well as cytokines and chemokines involved in immune cell crosstalk. Only dNK cells released IFN-γ, whereas only dMs released IL-1β, IL-10, and IL-12. TLR9 activation of dMs resulted in a distinct pattern of cytokine expression compared to the other TLRs. The cytokine profiles expressed by dMs and dNK cells upon TLR activation are compatible with maintenance of the fetotolerant immune environment during initiation of immune responses to pathogens at the maternofetal interface. PMID:25071732

  5. TLR4 single nucleotide polymorphisms (SNPs) associated with Salmonella shedding in pigs

    USDA-ARS?s Scientific Manuscript database

    Toll-like receptor 4 (TLR4) is a key factor in the innate immune recognition of lipopolysaccharide (LPS) from Gram-negative bacteria. Previous studies from our group identified differences in the expression profile of TLR4 and genes affected by the TLR4 signaling pathway among pigs that shed varying...

  6. Interaction of Bordetella pertussis filamentous hemagglutinin with human TLR2: identification of the TLR2-binding domain.

    PubMed

    Asgarian-Omran, Hossein; Amirzargar, Ali Akbar; Zeerleder, Sacha; Mahdavi, Marzieh; van Mierlo, Gerard; Solati, Shabnam; Jeddi-Tehrani, Mahmood; Rabbani, Hodjatallah; Aarden, Leucien; Shokri, Fazel

    2015-02-01

    Filamentous hemagglutinin (FHA) is a major adhesion and virulence factor of Bordetella pertussis and also a main component of acellular pertussis vaccines. Interaction of FHA with different receptors on human epithelial and immune cells facilitates entrance and colonization of bacteria as well as immunomodulation of the host immune response. Three overlapping segments of the FHA gene were cloned in a prokaryotic expression vector and the recombinant proteins were purified. These recombinant fragments along with the native FHA protein were employed to assess their potential Toll-like receptor (TLR) stimulatory effects and to localize the TLR binding region. TLR stimulation was monitored by applying HEK293-Blue cell lines cotransfected with TLR2, 4, or 5 and a NF-κB reporter gene. Culture supernatants were checked for secretion of the reporter gene product and IL-8 as indicators of TLR stimulation. Native FHA was found to strongly stimulate TLR2, but not TLR4 or TLR5 transfected cells. Among recombinant FHA fragments only the fragment spanning amino acid residues 1544-1917 was able to exhibit the TLR2 stimulating property of FHA. Interaction of FHA with TLR2 suggests its involvement in induction of the innate immune system against Bordetella pertussis. The TLR2-binding domain of FHA may contribute to immunoprotection against pertussis infection.

  7. Novel Toll/IL-1 Receptor Homologous Region Adaptors Act as Negative Regulators in Amphioxus TLR Signaling.

    PubMed

    Peng, Jian; Tao, Xin; Li, Rui; Hu, Jingru; Ruan, Jie; Wang, Ruihua; Yang, Manyi; Yang, Rirong; Dong, Xiangru; Chen, Shangwu; Xu, Anlong; Yuan, Shaochun

    2015-10-01

    Studies have shown that the basal chordate amphioxus possesses an extraordinarily complex TLR system, including 39 TLRs and at least 40 Toll/IL-1R homologous region (TIR) adaptors. Besides homologs to MyD88 and TIR domain-containing adaptor molecule (TICAM), most amphioxus TIR adaptors exhibit domain architectures that are not observed in other species. To reveal how these novel TIR adaptors function in amphioxus Branchiostoma belcheri tsingtauense (bbt), four representatives, bbtTIRA, bbtTIRB, bbtTIRC, and bbtTIRD, were selected for functional analyses. We found bbtTIRA to show a unique inhibitory role in amphioxus TICAM-mediated pathway by interacting with bbtTICAM and bbt receptor interacting protein 1b, whereas bbtTIRC specifically inhibits the amphioxus MyD88-dependent pathway by interacting with bbtMyD88 and depressing the polyubiquitination of bbt TNFR-associated factor 6. Although both bbtTIRB and bbtTIRD are located on endosomes, the TIR domain of bbtTIRB can interact with bbtMyD88 in the cytosol, whereas the TIR domain of bbtTIRD is enclosed in endosome, suggesting that bbtTIRD may be a redundant gene in amphioxus. This study indicated that most expanded TIR adaptors play nonredundant regulatory roles in amphioxus TLR signaling, adding a new layer to understanding the diversity and complexity of innate immunity at basal chordate.

  8. Childhood allergic rhinitis, traffic-related air pollution, and variability in the GSTP1, TNF, TLR2, and TLR4 genes: results from the TAG Study.

    PubMed

    Fuertes, Elaine; Brauer, Michael; MacIntyre, Elaina; Bauer, Mario; Bellander, Tom; von Berg, Andrea; Berdel, Dietrich; Brunekreef, Bert; Chan-Yeung, Moira; Gehring, Ulrike; Herbarth, Olf; Hoffmann, Barbara; Kerkhof, Marjan; Klümper, Claudia; Koletzko, Sibylle; Kozyrskyj, Anita; Kull, Inger; Heinrich, Joachim; Melén, Erik; Pershagen, Göran; Postma, Dirkje; Tiesler, Carla M T; Carlsten, Chris

    2013-08-01

    Associations between traffic-related air pollution (TRAP) and allergic rhinitis remain inconsistent, possibly because of unexplored gene-environment interactions. In a pooled analysis of 6 birth cohorts (Ntotal = 15,299), we examined whether TRAP and genetic polymorphisms related to inflammation and oxidative stress predict allergic rhinitis and sensitization. Allergic rhinitis was defined with a doctor diagnosis or reported symptoms at age 7 or 8 years. Associations between nitrogen dioxide, particulate matter 2.5 (PM2.5) mass, PM2.5 absorbance, and ozone, estimated for each child at the year of birth, and single nucleotide polymorphisms within the GSTP1, TNF, TLR2, or TLR4 genes with allergic rhinitis and aeroallergen sensitization were examined with logistic regression. Models were stratified by genotype and interaction terms tested for gene-environment associations. Point estimates for associations between nitrogen dioxide, PM2.5 mass, and PM2.5 absorbance with allergic rhinitis were elevated, but only that for PM2.5 mass was statistically significant (1.37 [1.01, 1.86] per 5 μg/m(3)). This result was not robust to single-cohort exclusions. Carriers of at least 1 minor rs1800629 (TNF) or rs1927911 (TLR4) allele were consistently at an increased risk of developing allergic rhinitis (1.19 [1.00, 1.41] and 1.24 [1.01, 1.53], respectively), regardless of TRAP exposure. No evidence of gene-environment interactions was observed. The generally null effect of TRAP on allergic rhinitis and aeroallergen sensitization was not modified by the studied variants in the GSTP1, TNF, TLR2, or TLR4 genes. Children carrying a minor rs1800629 (TNF) or rs1927911 (TLR4) allele may be at a higher risk of allergic rhinitis. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  9. Post-bronchiolitis wheezing is associated with toll-like receptor 9 rs187084 gene polymorphism

    PubMed Central

    Nuolivirta, Kirsi; Törmänen, Sari; Teräsjärvi, Johanna; Vuononvirta, Juho; Koponen, Petri; Korppi, Matti; Helminen, Merja; Peltola, Ville; He, Qiushui

    2016-01-01

    Innate immunity receptors play a critical role in host defence, as well as in allergy and asthma. The aim of this exploratory study was to evaluate whether there are associations between TLR7 rs179008, TLR8 rs2407992, TLR9 rs187084 or TLR10 rs4129009 polymorphisms and viral findings, clinical characteristics or subsequent wheezing in infants with bronchiolitis. In all, 135 full-term infants were hospitalized for bronchiolitis at age less than 6 months: 129 of them were followed-up until the age of 1.5 years. The outcome measures were repeated wheezing, use of inhaled corticosteroids, atopic dermatitis during the first 1.5 years of life and total serum immunoglobulin E (IgE). There were no significant associations between the genotypes or allele frequencies of TLR7 rs179008, TLR8 rs2407992, TLR9 rs187084 or TLR10 rs4129009 polymorphisms and clinical characteristics or the severity of bronchiolitis during hospitalization. During follow-up, repeated wheezing was more common in children with TLR9 rs187084 variant genotype CC (30.5%) than in children with TLR9 wild-type genotype TT (12.2%) (p = 0.02, aOR 2.73, 95% CI 1.02–7.29). The TLR10 rs4129009 minor allele G was associated with elevated total serum IgE. TLR9 rs187084 gene polymorphism may be associated with post-bronchiolitis wheezing, and TLR10 rs4129009 gene polymorphism may be associated with atopy. PMID:27498757

  10. Histone deacetylase inhibitor SAHA attenuates post-seizure hippocampal microglia TLR4/MYD88 signaling and inhibits TLR4 gene expression via histone acetylation.

    PubMed

    Hu, Qing-Peng; Mao, Ding-An

    2016-05-18

    Epilepsy is a common neurological disorder characterized by recurrent unprovoked seizures. Seizure-induced TLR4/MYD88 signaling plays a critical role in activating microglia and triggering neuron apoptosis. SAHA is a histone deacetylase inhibitor that regulates gene expression by increasing chromatin histone acetylation. In this study, we investigated the role of SAHA in TLR4/MYD88 signaling in a rat seizure model. Sprague-Dawley rats with kainic acid (KA)-induced seizures were treated with SAHA. The expression of TLR4, MYD88, NF-κB P65 and IL-1β in hippocampus was detected at hour 2 and 6 and day 1, 2, and 3 post seizure. SAHA pretreatment increased seizure latency and decreased seizure scores. The expression levels of TLR4, MYD88, NF-κB and IL-1β increased significantly in both activated microglia and apoptotic neurons after KA treatment. The effects were attenuated by SAHA. Chromatin immunoprecipitation assays indicated that the H3 histone acetylation levels significantly decreased while H3K9 levels significantly increased in the KA treatment group. The H3 and H3K9 acetylation levels returned to control levels after SAHA (50 mg/kg) pretreatment. There was a positive correlation between the expression of TLR4 and the acetylation levels of H3K9. Histone deacetylase inhibitor SAHA can suppress seizure-induced TLR4/MYD88 signaling and inhibit TLR4 gene expression through histone acetylation regulation. This suggests that SAHA may protect against seizure-induced brain damage.

  11. TLR2 is required for the altered transcription of p75NGF receptors in gram positive infection.

    PubMed

    Wirz, Sebastian A; Tobias, Peter S; Ulevitch, Richard J; Aribibe, Laurence; Bartfai, Tamas

    2006-02-01

    Neuroimmune interactions play a decisive role in neuronal cell survival and cell death during neuronal injury, oxidative and free radical stress. In neurons, NGF occupancy of p75 neurotrophin receptor (p75(NTR)) has been shown to promote neuronal apoptosis, while occupancy of tropomyosin receptor kinase A (TrkA) promotes survival of injured neurons. In macrophages, recent results suggest that NGF via TrkA mediates resistance to cell death through the interaction with TLR2. We have investigated the transcriptional regulation of TrkA, p75(NTR) and their ligand nerve growth factor beta (NGFbeta) upon stimulation with the TLR2 ligand Staphylococcus aureus in the spleen of C57BL/6 mice, TLR2 (-/-) and p75(NTR) (-/-) mice. S. aureus challenge (i.p.) resulted in a significant increase in NGFbeta mRNA levels in C57BL/6 (100%), TLR2 (-/-) (300%) and p75(NTR) (-/-) mice (355%). TrkA mRNA levels were upregulated only in p75(NTR) (-/-) mice (87%) whereas in TLR2 (-/-) mice they remained unchanged and even decreased in C57BL/6 mice (46%). p75(NTR) mRNA was increased in spleen of C57BL/6 mice (60%) whereas the levels in TLR2 (-/-) mice remained almost unchanged. Finally, TLR2 mRNA was upregulated by 350% in C57BL/6 mice and by 283% in p75(NTR) (-/-) mice. These data suggest that in splenocytes signaling via TLR2 is required for Gram positive infection mediated alteration of neurotrophin receptor expression as observed in an in vivo infection model with transgenic mice. This observation provides a link between Gram-positive infection and neurotrophic responses, which may be important in preserving neurons at sites of the infection.

  12. Serum Amyloid A Stimulates PKR Expression and HMGB1 Release Possibly through TLR4/RAGE Receptors

    PubMed Central

    Li, Wei; Zhu, Shu; Li, Jianhua; D’Amore, Jason; D’Angelo, John; Yang, Huan; Wang, Ping; Tracey, Kevin J; Wang, Haichao

    2015-01-01

    Serum amyloid A (SAA) proteins are known to be surrogate markers of sepsis, but their pathogenic roles remain poorly elucidated. Here we provide evidence to support a possible role of SAA as a pathogenic mediator of lethal sepsis. In a subset of septic patients for which serum high mobility group box 1 (HMGB1) levels paralleled the clinical scores, some anti-HMGB1 antibodies detected a 12-kDa protein belonging to the SAA family. In contrast to the most abundant SAA1, human SAA induced double-stranded RNA-activated protein kinase R (PKR) expression and HMGB1 release in the wild-type, but not toll-like receptor 4/receptor for advanced glycation end products (TLR4/RAGE)-deficient, macrophages. Pharmacological inhibition of PKR phosphorylation blocked SAA-induced HMGB1 release, suggesting an important role of PKR in SAA-induced HMGB1 release. In animal models of lethal endotoxemia and sepsis, recombinant SAA exacerbated endotoxemic lethality, whereas SAA-neutralizing immunoglobulins G (IgGs) significantly improved animal survival. Collectively, these findings have suggested SAA as an important mediator of inflammatory diseases. Highlights of this study include: human SAA is possibly only expressed in a subset of septic patients; SAA induces HMGB1 release via TLR4 and RAGE receptors; SAA supplementation worsens the outcome of lethal endotoxemia; whereas SAA-neutralizing antibodies confer protection against lethal endotoxemia and sepsis. PMID:26052716

  13. Polymorphism of the CD14 and TLR4 genes and post-treatment apical periodontitis.

    PubMed

    Rôças, Isabela N; Siqueira, José F; Del Aguila, Camila A; Provenzano, José C; Guilherme, Bianca P S; Gonçalves, Lucio S

    2014-02-01

    This study investigated the association of CD14 -260C>T and TLR4 +896A>G gene polymorphisms with post-treatment apical periodontitis in Brazilian individuals. The study population consisted of 41 patients with post-treatment apical periodontitis and 42 individuals with root canal-treated teeth exhibiting healed/healing periradicular tissues (controls). All teeth had apical periodontitis lesions at the time of treatment, which was completed at least 1 year previously. Saliva was collected from the participants; DNA was extracted and used for CD14 and TLR4 genotyping using the polymerase chain reaction-restriction fragment length polymorphism approach and a real-time polymerase chain reaction TaqMan assay (Applied Biosystems, Foster City, CA), respectively. No specific genotype or allele of the CD14 and TLR4 genes or any combination thereof was positively associated with post-treatment apical periodontitis (P > .05). Data from the present study suggest that polymorphisms in the CD14 and TLR4 genes do not influence the response to endodontic treatment of teeth with apical periodontitis. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  14. The role of Toll-like receptor 4 (TLR4) in cardiac ischaemic-reperfusion injury, cardioprotection and preconditioning.

    PubMed

    Lee, Sam Man; Hutchinson, Mark; Saint, David A

    2016-09-01

    Cardiac ischaemic-reperfusion injury (IRI) remains the primary cause of mortality throughout the developed world. Molecular mechanisms underlying IRI are complex and are often interlinked with each other driving a synergistic response. Toll-like receptor 4 (TLR4), an immunosurveillance receptor, is known to enhance tissue injury during IRI by enhancing the inflammatory response. The release of endogenous components during IRI bind onto TLR4 leading to the activation of multiple signalling kinases. Once this event occurs these proteins are defined as danger associated molecular patterns molecules (DAMPs) or alarmins. Examples include heat shock proteins, high mobility group box one (HMGB1) and extracellular matrix proteins, all of which are involved in IRI. However, literature in the last two decades suggests that transient stimulation of TLR4 may suppress IRI and thus improve cardiac recovery. Furthermore, it remains to be seen what role TLR4 plays during ischaemic-preconditioning where acute bouts of ischaemia, preceding a harmful bout of ischaemic-reperfusion, is cardioprotective. The other question which also needs to be considered is that if transient TLR4 signalling drives a preconditioning response then what are the ligands which drive this? Hence the second part of this review explores the possible TLR4 ligands which may promote cardioprotection against IRI.

  15. Retinal Photoreceptor Expresses Toll-Like Receptors (TLRs) and Elicits Innate Responses Following TLR Ligand and Bacterial Challenge

    PubMed Central

    Singh, Pawan Kumar; Kumar, Ashok

    2015-01-01

    Toll-like receptors (TLRs) play an important role in host defense against microbial pathogens. Our previous studies have shown that TLRs are expressed on various retinal cells (Microglia and Müller glia) and orchestrate retinal innate responses in bacterial endophthalmitis. In this study, we used a well-characterized mouse cone photoreceptor cell line (661W); and demonstrated that these cells express all known TLRs. Although the stimulation of 661W cells with TLR ligands (Pam3Cys, PolyI:C, LPS, Flagellin, Poly DT, and ODN) did not alter TLR expression, downstream TLR-signaling pathways (NF-κB, p38, and ERK) are activated. Moreover, TLR-activated 661W cells secreted significant amounts of inflammatory mediators (IL-6, IL-1β, MIP-2, and KC) in their culture supernatant, as assessed by ELISA. A similar trend was observed in 661W cells challenged with live bacteria (Staphylococcus aureus). Interestingly, the neutralization of TLR2, a major receptor for S. aureus recognition, did not significantly attenuate bacterial-induced inflammatory mediators, suggesting the existence of TLR2-independent mechanisms in photoreceptor cells. Together, these results indicate that photoreceptors constitutively express functional TLRs and possess the ability to initiate innate responses following pathogen challenge, implicating their role in retinal innate immunity. PMID:25767877

  16. Molecular analysis of the binding mode of Toll/interleukin-1 receptor (TIR) domain proteins during TLR2 signaling.

    PubMed

    Nada, Masatoshi; Ohnishi, Hidenori; Tochio, Hidehito; Kato, Zenichiro; Kimura, Takeshi; Kubota, Kazuo; Yamamoto, Takahiro; Kamatari, Yuji O; Tsutsumi, Naotaka; Shirakawa, Masahiro; Kondo, Naomi

    2012-10-01

    Toll-like receptor (TLR) signaling is initiated by the binding of various adaptor proteins through ligand-induced oligomerization of the Toll/interleukin-1 receptor (TIR) domains of the TLRs. TLR2, which recognizes peptidoglycans, lipoproteins or lipopeptides derived from Gram-positive bacteria, is known to use the TIR domain-containing adaptor proteins myeloid differentiating factor 88 (MyD88) and MyD88 adaptor-like (Mal). Molecular analyses of the binding specificity of MyD88, Mal, and TLR2 are important for understanding the initial defenses mounted against Gram-positive bacterial infections such as Streptococcus pneumoniae. However, the detailed molecular mechanisms involved in the multiple interactions of these TIR domains remain unclear. Our study demonstrates that the TIR domain proteins MyD88, Mal, TLR1, and TLR2 directly bind to each other in vitro. We have also identified two binding interfaces of the MyD88 TIR domain for the TLR2 TIR domain. A residue at these interfaces has recently been found to be mutated in innate immune deficiency patients. These novel insights into the binding mode of TIR proteins will contribute to elucidation of the mechanisms underlying innate immune deficiency diseases, and to future structural studies of hetero-oligomeric TIR-TIR complexes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Preconditioning of Microglia by α-Synuclein Strongly Affects the Response Induced by Toll-like Receptor (TLR) Stimulation

    PubMed Central

    Gonzalez-Rey, Elena; Lachaud, Christian C.; Guilliams, Tim; Fernandez-Montesinos, Rafael; Benitez-Rondan, Alicia; Robledo, Gema; Hmadcha, Abdelkrim; Delgado, Mario; Dobson, Christopher M.; Pozo, David

    2013-01-01

    In recent years, it has become accepted that α-synuclein (αSyn) has a key role in the microglia-mediated neuroinflammation, which accompanies the development of Parkinson’s disease and other related disorders, such as Dementia with Lewy Bodies and Alzheimer’s disease. Nevertheless, the cellular and molecular mechanisms underlying its pathological actions, especially in the sporadic forms of the diseases, are not completely understood. Intriguingly, several epidemiological and animal model studies have revealed a link between certain microbial infections and the onset or progression of sporadic forms of these neurodegenerative disorders. In this work, we have characterized the effect of toll-like receptor (TLR) stimulation on primary murine microglial cultures and analysed the impact of priming cells with extracellular wild-type (Wt) αSyn on the subsequent TLR stimulation of cells with a set of TLR ligands. By assaying key interleukins and chemokines we report that specific stimuli, in particular Pam3Csk4 (Pam3) and single-stranded RNA40 (ssRNA), can differentially affect the TLR2/1- and TLR7-mediated responses of microglia when pre-conditioned with αSyn by augmenting IL-6, MCP-1/CCL2 or IP-10/CXCL10 secretion levels. Furthermore, we report a skewing of αSyn-primed microglia stimulated with ssRNA (TLR7) or Pam3 (TLR2/1) towards intermediate but at the same time differential, M1/M2 phenotypes. Finally, we show that the levels and intracellular location of activated caspase-3 protein change significantly in αSyn-primed microglia after stimulation with these particular TLR agonists. Overall, we report a remarkable impact of non-aggregated αSyn pre-sensitization of microglia on TLR-mediated immunity, a phenomenon that could contribute to triggering the onset of sporadic α-synuclein-related neuropathologies. PMID:24236103

  18. Structural characterisation of Toll-like receptor 1 (TLR1) and Toll-like receptor 6 (TLR6) in elephant and harbor seals.

    PubMed

    Woodman, Sally; Gibson, Amanda J; García, Ana Rubio; Contreras, Guillermo Sanchez; Rossen, John W; Werling, Dirk; Offord, Victoria

    2016-01-01

    Pinnipeds are a diverse clade of semi-aquatic mammals, which act as key indicators of ecosystem health. Their transition from land to marine environments provides a complex microbial milieu, making them vulnerable to both aquatic and terrestrial pathogens, thereby contributing to pinniped population decline. Indeed, viral pathogens such as influenza A virus and phocine distemper virus (PDV) have been identified as the cause of several of these mass mortality events. Furthermore, bacterial infection with mammalian Brucella sp. and methicillin-resistant Staphylococcus aureus strains have also been observed in marine mammals, posing further risk to both co-habiting endangered species and public health. During these disease outbreaks, mortality rates have varied amongst different pinniped species. Analyses of innate immune receptors at the host-pathogen interface have previously identified variants which may drive these species-specific responses. Through a combination of both sequence- and structure-based methods, this study characterises members of the Toll-like receptor (TLR) 1 superfamily from both harbour and elephant seals, identifying variations which will help us to understand these species-specific innate immune responses, potentially aiding the development of specific vaccine-adjuvants for these species.

  19. TLR3 or TLR4 Activation Enhances Mesenchymal Stromal Cell-Mediated Treg Induction via Notch Signaling.

    PubMed

    Rashedi, Iran; Gómez-Aristizábal, Alejandro; Wang, Xing-Hua; Viswanathan, Sowmya; Keating, Armand

    2017-01-01

    Mesenchymal stromal cells (MSCs) are the subject of numerous clinical trials, largely due to their immunomodulatory and tissue regenerative properties. Toll-like receptors (TLRs), especially TLR3 and TLR4, are highly expressed on MSCs and their activation can significantly modulate the immunosuppressive and anti-inflammatory functions of MSCs. While MSCs can recruit and promote the generation of regulatory T cells (Tregs), the effect of TLR activation on MSC-mediated Treg induction is unknown. In this study, we investigated the effect of ligand-mediated activation of TLR3 and TLR4 on Treg induction by human MSCs. We found that generation of Tregs in human CD4(+) lymphocyte and MSC cocultures was enhanced by either TLR3 or TLR4 activation of MSCs and that the increase was abolished by TLR3 and TLR4 gene-silencing. Augmented Treg induction by TLR-activated MSCs was cell contact-dependent and associated with increased gene expression of the Notch ligand, Delta-like 1. Moreover, inhibition of Notch signaling abrogated the augmented Treg levels in the MSC cocultures. Our data show that TLR3 or TLR4 activation of MSCs increases Treg induction via the Notch pathway and suggest new means to enhance the potency of MSCs for treating disorders with an underlying immune dysfunction, including steroid resistant acute graft-versus-host disease. Stem Cells 2017;35:265-275.

  20. [Expression of TLR2 and TLR9 genes by epithelial cells of cervical canal mucous membrane in women with inflammatory diseases of small pelvis organs].

    PubMed

    Shibina, L V; Svitich, O A; Krasnoproshina, L I; Skhodova, S A; Ordiiants, I M; Bisheva, I V

    2013-01-01

    Determine subpopulation composition of blood lymphocytes and the level of expression of TLR2 and TLR9 by epithelial cells of cervical canal mucous membrane in women of reproductive age with inflammatory disease of small pelvis organs (IDSPO) at exacerbation stage and remission period. Clinical-laboratory and gynecological examination of 105 women was carried out and 3 groups were formed based on the results: patients at IDSPO exacerbation stage; patients at remission stage; clinically healthy women. By using real time PCR, TLR2, TLR9 gene expression levels were determined in epithelial cells of cervical canal mucous membrane in women of all the 3 groups. Subpopulation composition of blood lymphocytes was determined by flow cytofluorimetry by using monoclonal antibodies with CD45+ CD3+ -T-cell, CD45+ CD3+ CD4+ -T-helper, CD45+, CD3+, CD8+ -T-suppressors-cytotoxic killers, CD45+, CD3-, CD16+, CD56+ natural killers, CD45+, CD3-, CD19+ -B-lymphocytes. Immune fluorescence reaction evaluation was carried out in flow cytofluorimeter Cytomics FC 500 (Becton Coulter, USA). The level of expression of TLR2 gene in the studied groups of patients was established not to differ significantly from parameters in the comparison groups, however it should be noted that this parameter in women with IDSPO at exacerbation stage (causative agents of the infectious process--ureaplasma, staphylococcus, candida) was somewhat higher than in the comparison group. Significantly high level of TLR9 gene expression in cervical canal epithelial cells was detected to correlate with the presence of infectious causative agents. In the group of women with exacerbation of the infectious process the expression of TLR9 was 14.5 times higher compared with the group of women without IDSPO. Among groups of women with IDSPO significant differences in relation to control group in relative and absolute levels of CD3+ T-lymphocytes; CD4+ T-helpers; CD8+ cytotoxic killer T-suppressors, B-lymphocytes compared with

  1. Relevance of single-nucleotide polymorphisms in human TLR genes to infectious and inflammatory diseases and cancer.

    PubMed

    Trejo-de la O, A; Hernández-Sancén, P; Maldonado-Bernal, C

    2014-04-01

    Innate and adaptive immune responses in humans have evolved as protective mechanisms against infectious microorganisms. Toll-like receptors (TLRs) have an important role in the recognition of invading microorganisms. TLRs are the first receptors to detect potential pathogens and to initiate the immune response, and they form the crucial link between the innate and adaptive immune responses. TLRs also have an important role in the pathophysiology of infectious and inflammatory diseases. Increasing data suggest that the ability of certain individuals to respond properly to TLR ligands may be impaired by single-nucleotide polymorphisms (SNPs) within TLR genes, resulting in an altered susceptibility to infectious or inflammatory disease that might contribute to the pathogenesis of complex diseases such as cancer. The associations between diseases and SNPs are in the early stage of discovery. Important clinical insights are emerging, and these polymorphisms provide new understanding of common diseases. This review summarizes and discusses the studies that shed light on the relevance of these polymorphisms in human infectious and inflammatory diseases and cancer.

  2. Keratinocyte nicotinic acetylcholine receptor activation modulates early TLR2-mediated wound healing responses

    PubMed Central

    Kishibe, Mari; Griffin, Tina M.; Radek, Katherine A.

    2015-01-01

    The cholinergic anti-inflammatory pathway spans several macro- and micro-environments to control inflammation via α7 nicotinic acetylcholine receptors (nAChRs). Physiologic inflammation is necessary for normal wound repair and is triggered, in part, via Toll-like receptors (TLRs). Here, we demonstrate that keratinocyte nAChR activation dampens TLR2-mediated migration and pro-inflammatory cytokine and antimicrobial peptide (AMP) production, which is restored by a α7-selective nAChR antagonist. The mechanism of this response occurs by blocking the NF-κB and Erk1/2 pathway during early and late wound healing. In a mouse model of Staphylococcus aureus wound infection, topical nAChR activation reduces wound AMP and TLR2 production to augment bacterial survival in wild-type mice. These findings suggest that aberrant α7 nAChR activation may impair normal wound healing responses, and that pharmacologic administration of topical nAChR antagonists may improve wound healing outcomes in wounds necessitating a more robust inflammatory response. PMID:26071220

  3. Down-regulation of endothelial TLR4 signalling after apo A-I gene transfer contributes to improved survival in an experimental model of lipopolysaccharide-induced inflammation

    PubMed Central

    Van Linthout, Sophie; Spillmann, Frank; Graiani, Gallia; Miteva, Kapka; Peng, Jun; Van Craeyveld, Eline; Meloni, Marco; Tölle, Markus; Escher, Felicitas; Subasigüller, Aysun; Doehner, Wolfram; Quaini, Federico; De Geest, Bart; Schultheiss, Heinz-Peter

    2010-01-01

    The protective effects of high-density lipoprotein (HDL) under lipopolysaccharide (LPS) conditions have been well documented. Here, we investigated whether an effect of HDL on Toll-like receptor 4 (TLR4) expression and signalling may contribute to its endothelial-protective effects and to improved survival in a mouse model of LPS-induced inflammation and lethality. HDL cholesterol increased 1.7-fold (p < 0.005) and lung endothelial TLR4 expression decreased 8.4-fold (p < 0.005) 2 weeks after apolipoprotein (apo) A-I gene transfer. Following LPS administration in apo A-I gene transfer mice, lung TLR4 and lung MyD88 mRNA expression, reflecting TLR4 signalling, were 3.0-fold (p < 0.05) and 2.1-fold (p < 0.05) lower, respectively, than in LPS control mice. Concomitantly, LPS-induced lung neutrophil infiltration, lung oedema and mortality were significantly attenuated following apo A–I transfer. In vitro, supplementation of HDL or apo A–I to human microvascular endothelial cells-1 24 h before LPS administration reduced TLR4 expression, as assessed by fluorescent-activated cell sorting, and decreased the LPS-induced MyD88 mRNA expression and NF-κB activity, independently of LPS binding. In conclusion, HDL reduces TLR4 expression and signalling in endothelial cells, which may contribute significantly to the protective effects of HDL in LPS-induced inflammation and lethality. Electronic supplementary material The online version of this article (doi:10.1007/s00109-010-0690-6) contains supplementary material, which is available to authorized users. PMID:20972769

  4. Roles of Toll-like receptor 2 (TLR2) and superantigens on adaptive immune responses during CNS staphylococcal infection

    PubMed Central

    Vidlak, Debbie; Mariani, Monica M.; Aldrich, Amy; Liu, Shuliang; Kielian, Tammy

    2010-01-01

    Staphylococcus aureus is a common etiologic agent of brain abscesses and possesses numerous virulence factors that manipulate host immunity. One example is superantigens (SAG) that clonally expand T cell subsets bearing specific Vβ receptors. Toll-like receptor 2 (TLR2) is one receptor implicated in S. aureus recognition. However, the interplay between TLR2, SAG, and adaptive immunity during brain abscess formation has not yet been investigated and could reveal novel insights into host-pathogen interactions for regulating protective immunity. A comprehensive analysis of abscess-associated T cell populations in TLR2 KO and WT mice was performed following infection with a S. aureus clinical isolate. Both natural killer T (NKT) and γδ T cell infiltrates were increased in brain abscesses of TLR2 KO mice and produced more IL-17 and IFN-γ compared to WT populations, which could have resulted from elevated bacterial burdens observed in these animals. Analysis of SAG-reactive T cells revealed a predominant Vβ8.1,8.2 infiltrate reactive with staphylococcal enterotoxin B (SEB), whereas SEA-reactive Vβ11 T cells were less numerous. Brain abscesses of TLR2 KO mice had fewer Vβ8.1,8.2 and Vβ11 T cells and produced less TNF-α and IFN-γ compared to WT animals. Treatment of primary microglia with purified SEB augmented TNF-α production in response to the TLR2 ligand Pam3Cys, which may serve to amplify proinflammatory cascades during CNS S. aureus infection. Collectively, these studies demonstrate that TLR2 impacts adaptive immunity to S. aureus infection and modulates SAG responses. PMID:20868736

  5. The single IgG IL-1-related receptor controls TLR responses in differentiated human intestinal epithelial cells.

    PubMed

    Khan, Mohammed A; Steiner, Theodore S; Sham, Ho Pan; Bergstrom, Kirk S; Huang, Jingtian T; Assi, Kiran; Salh, Bill; Tai, Isabella T; Li, Xiaoxia; Vallance, Bruce A

    2010-03-01

    Intestinal epithelial cells (IECs) are constantly exposed to enteric microbes. Although IECs express TLRs that recognize bacterial products, the activation of these TLRs is strictly controlled through poorly understood mechanisms, producing a state of hyporesponsiveness and preventing unwanted inflammation. The single IgG IL-1-related receptor (Sigirr) is a negative regulator of TLRs that is expressed by IECs and was recently shown to inhibit experimental colitis. However, the importance of Sigirr in IEC hyporesponsiveness and its distribution within the human colon is unknown. In this study, we investigated the role of Sigirr in regulating epithelial-specific TLR responses and characterized its expression in colonic biopsy specimens. Transformed and nontransformed human IECs were cultured as monolayers. Transient gene silencing and stable overexpression of Sigirr was performed to assess innate IEC responses. Sigirr expression in human colonic biopsy specimens was examined by immunohistochemistry. Bacterial infection of IECs and exposure to flagellin transiently decreased Sigirr protein expression, concurrent with secretion of the neutrophil chemokine IL-8. Sigirr gene silencing augmented chemokine responses to bacterial flagellin, Pam3Cys, and the cytokine IL-1beta. Conversely, stable overexpression of Sigirr diminished NF-kappaB-mediated IL-8 responses to TLR ligands. We also found that Sigirr expression increased as IECs differentiated in culture. This observation was confirmed in biopsy sections, in which Sigirr expression within colonic crypts was prominent in IECs at the apex and diminished at the base. Our findings show that Sigirr broadly regulates innate responses in differentiated human IECs; therefore, it may modulate epithelial involvement in infectious and inflammatory bowel diseases.

  6. Toll-like receptors (TLR) 2 and 4 expression of keratinocytes from patients with localized and disseminated dermatophytosis.

    PubMed

    Oliveira, Cristiane Beatriz de; Vasconcellos, Cídia; Sakai-Valente, Neusa Y; Sotto, Mirian Nacagami; Luiz, Fernanda Guedes; Belda Júnior, Walter; Sousa, Maria da Gloria Teixeira de; Benard, Gil; Criado, Paulo Ricardo

    2015-01-01

    There are few studies on the role of innate immune response in dermatophytosis. An investigation was conducted to define the involvement of Toll-Like Receptors (TLRs) 2 and 4 in localized (LD) and disseminated (DD) dermatophytosis due to T. rubrum. Fifteen newly diagnosed patients, eight patients with LD and seven with DD, defined by involvement of at least three body segments were used in this study. Controls comprised twenty skin samples from healthy individuals undergoing plastic surgery. TLR2 and TLR4 were quantified in skin lesions by immunohistochemistry. A reduced expression of TLR4 in the lower and upper epidermis of both LD and DD patients was found compared to controls; TLR2 expression was preserved in the upper and lower epidermis of all three groups. As TLR4 signaling induces the production of inflammatory cytokines and neutrophils recruitment, its reduced expression likely contributed to the lack of resolution of the infection and the consequent chronic nature of the dermatophytosis. As TLR2 expression acts to limit the inflammatory process and preserves the epidermal structure, its preserved expression may also contribute to the persistent infection and limited inflammation that are characteristic of dermatophytic infections.

  7. Toll-like Receptor (TLR) Signaling Interacts with CREBH to Modulate High-density Lipoprotein (HDL) in Response to Bacterial Endotoxin.

    PubMed

    Dandekar, Aditya; Qiu, Yining; Kim, Hyunbae; Wang, Jiemei; Hou, Xia; Zhang, Xuebao; Zheng, Ze; Mendez, Roberto; Yu, Fu-Shin; Kumar, Ashok; Fang, Deyu; Sun, Fei; Zhang, Kezhong

    2016-10-28

    Bacterial endotoxin can induce inflammatory and metabolic changes in the host. In this study, we revealed a molecular mechanism by which a stress-inducible, liver-enriched transcription factor, cAMP-responsive element-binding protein hepatic-specific (CREBH), modulates lipid profiles to protect the liver from injuries upon the bacterial endotoxin lipopolysaccharide (LPS). LPS challenge can activate CREBH in mouse liver tissues in a toll-like receptor (TLR)/MyD88-dependent manner. Upon LPS challenge, CREBH interacts with TNF receptor-associated factor 6 (TRAF6), an E3 ubiquitin ligase that functions as a key mediator of TLR signaling, and this interaction relies on MyD88. Further analysis demonstrated that TRAF6 mediates K63-linked ubiquitination of CREBH to facilitate CREBH cleavage and activation. CREBH directly activates expression of the gene encoding Apolipoprotein A4 (ApoA4) under LPS challenge, leading to modulation of high-density lipoprotein (HDL) in animals. CREBH deficiency led to reduced production of circulating HDL and increased liver damage upon high-dose LPS challenge. Therefore, TLR/MyD88-dependent, TRAF6-facilitated CREBH activation represents a mammalian hepatic defense response to bacterial endotoxin by modulating HDL. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Bryostatin-1, a naturally occurring antineoplastic agent, acts as a Toll-like receptor 4 (TLR-4) ligand and induces unique cytokines and chemokines in dendritic cells.

    PubMed

    Ariza, Maria Eugenia; Ramakrishnan, Rupal; Singh, Narendra P; Chauhan, Ashok; Nagarkatti, Prakash S; Nagarkatti, Mitzi

    2011-01-07

    Bryostatin-1 (Bryo-1), a natural macrocyclic lactone, is clinically used as an anti-cancer agent. In this study, we demonstrate for the first time that Bryo-1 acts as a Toll-like receptor 4 (TLR4) ligand. Interestingly, activation of bone marrow-derived dendritic cells (in vitro with Bryo-1) led to a TLR4-dependent biphasic activation of nuclear factor-κB (NF-κB) and the unique induction of cytokines (IL-5, IL-6, and IL-10) and chemokines, including RANTES (regulated on activation normal T cell expressed and secreted) and macrophage inflammatory protein 1α (MIP1-α). In addition, EMSA demonstrated that Bryo-1-mediated induction of RANTES was regulated by NF-κB and the interferon regulatory factors (IRF)-1, IRF-3, and IRF-7 to the RANTES independently of myeloid differentiation primary response gene-88 (MyD88). Bryo-1 was able to induce the transcriptional activation of IRF-3 through the TLR4/MD2-dependent pathway. In vivo administration of Bryo-1 triggered a TLR-4-dependent T helper cell 2 (Th2) cytokine response and expanded a subset of myeloid dendritic cells that expressed a CD11c(high)CD8α(-) CD11b(+)CD4(+) phenotype. This study demonstrates that Bryo-1 can act as a TLR4 ligand and activate innate immunity. Moreover, the ability of Bryo-1 to trigger RANTES and MIP1-α suggests that Bryo-1 could potentially be used to prevent HIV-1 infection. Finally, induction of a Th2 response by Bryo-1 may help treat inflammatory diseases mediated by Th1 cells. Together, our studies have a major impact on the clinical use of Bryo-1 as an anti-cancer and immunopotentiating agent.

  9. Toll like receptor (TLR)-4 as a regulator of peripheral endogenous opioid-mediated analgesia in inflammation.

    PubMed

    Sauer, Reine-Solange; Hackel, Dagmar; Morschel, Laura; Sahlbach, Henrike; Wang, Ying; Mousa, Shaaban A; Roewer, Norbert; Brack, Alexander; Rittner, Heike L

    2014-02-06

    Leukocytes containing opioid peptides locally control inflammatory pain. In the early phase of complete Freund's adjuvant (CFA)-induced hind paw inflammation, formyl peptides (derived e.g. from Mycobacterium butyricum) trigger the release of opioid peptides from neutrophils contributing to tonic basal antinociception. In the later phase we hypothesized that toll-like-receptor-(TLR)-4 activation of monocytes/macrophages triggers opioid peptide release and thereby stimulates peripheral opioid-dependent antinociception. In Wistar rats with CFA hind paw inflammation in the later inflammatory phase (48-96 h) systemic leukocyte depletion by cyclophosphamide (CTX) or locally injected naloxone (NLX) further decreased mechanical and thermal nociceptive thresholds. In vitro β-endorphin (β-END) content increased during human monocyte differentiation as well as in anti-inflammatory CD14+CD16- or non-classical M2 macrophages. Monocytes expressing TLR4 dose-dependently released β-END after stimulation with lipopolysaccharide (LPS) dependent on intracellular calcium. Despite TLR4 expression proinflammatory M1 and anti-inflammatory M2 macrophages only secreted opioid peptides in response to ionomycin, a calcium ionophore. Intraplantar injection of LPS as a TLR4 agonist into the inflamed paw elicited an immediate opioid- and dose-dependent antinociception, which was blocked by TAK-242, a small-molecule inhibitor of TLR4, or by peripheral applied NLX. In the later phase LPS lowered mechanical and thermal nociceptive thresholds. Furthermore, local peripheral TLR4 blockade worsened thermal and mechanical nociceptive pain thresholds in CFA inflammation. Endogenous opioids from monocytes/macrophages mediate endogenous antinociception in the late phase of inflammation. Peripheral TLR4 stimulation acts as a transient counter-regulatory mechanism for inflammatory pain in vivo, and increases the release of opioid peptides from monocytes in vitro. TLR4 antagonists as new treatments for

  10. Toll like receptor (TLR)-4 as a regulator of peripheral endogenous opioid-mediated analgesia in inflammation

    PubMed Central

    2014-01-01

    Background Leukocytes containing opioid peptides locally control inflammatory pain. In the early phase of complete Freund’s adjuvant (CFA)-induced hind paw inflammation, formyl peptides (derived e.g. from Mycobacterium butyricum) trigger the release of opioid peptides from neutrophils contributing to tonic basal antinociception. In the later phase we hypothesized that toll-like-receptor-(TLR)-4 activation of monocytes/macrophages triggers opioid peptide release and thereby stimulates peripheral opioid-dependent antinociception. Results In Wistar rats with CFA hind paw inflammation in the later inflammatory phase (48–96 h) systemic leukocyte depletion by cyclophosphamide (CTX) or locally injected naloxone (NLX) further decreased mechanical and thermal nociceptive thresholds. In vitro β-endorphin (β-END) content increased during human monocyte differentiation as well as in anti-inflammatory CD14+CD16- or non-classical M2 macrophages. Monocytes expressing TLR4 dose-dependently released β-END after stimulation with lipopolysaccharide (LPS) dependent on intracellular calcium. Despite TLR4 expression proinflammatory M1 and anti-inflammatory M2 macrophages only secreted opioid peptides in response to ionomycin, a calcium ionophore. Intraplantar injection of LPS as a TLR4 agonist into the inflamed paw elicited an immediate opioid- and dose-dependent antinociception, which was blocked by TAK-242, a small-molecule inhibitor of TLR4, or by peripheral applied NLX. In the later phase LPS lowered mechanical and thermal nociceptive thresholds. Furthermore, local peripheral TLR4 blockade worsened thermal and mechanical nociceptive pain thresholds in CFA inflammation. Conclusion Endogenous opioids from monocytes/macrophages mediate endogenous antinociception in the late phase of inflammation. Peripheral TLR4 stimulation acts as a transient counter-regulatory mechanism for inflammatory pain in vivo, and increases the release of opioid peptides from monocytes in vitro. TLR4

  11. Triggering of TLR7 and TLR8 expressed by human lung cancer cells induces cell survival and chemoresistance

    PubMed Central

    Cherfils-Vicini, Julien; Platonova, Sophia; Gillard, Mélanie; Laurans, Ludivine; Validire, Pierre; Caliandro, Rafaele; Magdeleinat, Pierre; Mami-Chouaib, Fathia; Dieu-Nosjean, Marie-Caroline; Fridman, Wolf-Herman; Damotte, Diane; Sautès-Fridman, Catherine; Cremer, Isabelle

    2010-01-01

    Compelling evidence suggests that inflammation, cell survival, and cancer are linked, with a central role played by NF-κB. Recent studies implicate some TLRs in tumor development based on their ability to facilitate tumor growth; however, to our knowledge, involvement of neither TLR7 nor TLR78 has yet been demonstrated. Here we have demonstrated expression of TLR7 and TLR8, the natural receptors for single-stranded RNA, by tumor cells in human lung cancer in situ and in human lung tumor cell lines. Stimulation with TLR7 or TLR8 agonists led to activated NF-κB, upregulated expression of the antiapoptotic protein Bcl-2, increased tumor cell survival, and chemoresistance. Transcriptional analysis performed on human primary lung tumor cells and TLR7- or TLR8-stimulated human lung tumor cell lines revealed a gene expression signature suggestive of chronic stimulation of tumor cells by TLR ligands in situ. Together, these data emphasize that TLR signaling can directly favor tumor development and further suggest that researchers developing anticancer immunotherapy using TLR7 or TLR8 agonists as adjuvants should take into account the expression of these TLRs in lung tumor cells. PMID:20237413

  12. Single-Immunoglobulin Interleukin-1-Related Receptor regulates vulnerability to TLR4-mediated necrotizing enterocolitis in a mouse model.

    PubMed

    Fawley, Jason; Cuna, Alain; Menden, Heather L; McElroy, Steven; Umar, Shahid; Welak, Scott R; Gourlay, David M; Li, Xiaoxia; Sampath, Venkatesh

    2017-10-04

    BackgroundThe mechanisms underlying aberrant activation of intestinal Toll-like receptor 4 (TLR4) signaling in necrotizing enterocolitis (NEC) remain unclear. In this study, we examined the role of single-immunoglobulin interleukin-1 receptor-related molecule (SIGIRR), an inhibitor of TLR signaling, in modulating experimental NEC vulnerability in mice.MethodsExperimental NEC was induced in neonatal wild-type and SIGIRR-/- mice using hypoxia, formula-feeding, and lipopolysaccharide administration. Intestinal TLR canonical signaling, inflammation, apoptosis, and severity of experimental NEC were examined at baseline and after NEC induction in mice.ResultsSIGIRR is developmentally regulated in the neonatal intestine with a restricted expression after birth and a gradual increase by day 8. At baseline, breast-fed SIGIRR-/- mouse pups exhibited low-grade inflammation and TLR pathway activation compared with SIGIRR+/+ pups. With experimental NEC, SIGIRR-/- mice had significantly more intestinal interleukin (IL)-1β, KC (mouse homolog to IL-8), intercellular adhesion molecule-1 (ICAM-1), and interferon-beta (IFN-β) expression in association with the amplified TLR pathway activation. Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining, cleaved caspase 3, and severity of intestinal injury with NEC were worse in SIGIRR-/- mice in comparison with SIGIRR+/+ mice.ConclusionSIGIRR is a negative regulator of TLR4 signaling in the developing intestine, and its insufficiency results in native intestinal TLR hyper-responsiveness conducive to the development of severe experimental NEC in mice.Pediatric Research advance online publication, 4 October 2017; doi:10.1038/pr.2017.211.

  13. Variants in toll-like receptor 9 gene influence susceptibility to tuberculosis in a Mexican population

    PubMed Central

    2013-01-01

    Background The control of Mycobacterium tuberculosis (Mtb) infection begins with the recognition of mycobacterial structural components by toll like receptors (TLRs) and other pattern recognition receptors. Our objective was to determine the influence of TLRs polymorphisms in the susceptibility to develop tuberculosis (TB) in Amerindian individuals from a rural area of Oaxaca, Mexico with high TB incidence. Methods We carried out a case–control association community based study, genotyping 12 polymorphisms of TLR2, TLR4, TLR6 and TLR9 genes in 90 patients with confirmed pulmonary TB and 90 unrelated exposed but asymptomatic household contacts. Results We found a significant increase in the frequency of the allele A of the TLR9 gene polymorphism rs352139 (A>G) in the group of TB patients (g.f. = 0.522) when compared with controls (g.f. = 0.383), (Pcorr = 0.01, OR = 1.75). Under the recessive model (A/G + A/A vs G/G) this polymorphism was also significantly associated with TB (Pcorr = 0.01, OR= 2.37). The association of the SNP rs352139 was statistically significant after adjustment by age, gender and comorbidities by regression logistic analysis (Dominant model: p value = 0.016, OR = 2.31; Additive model: p value = 0.023, OR = 1.68). The haplotype GAA of TLR9 SNPs was also associated with TB susceptibility (Pcorr = 0.02). Differences in the genotype or allele frequencies of TLR2, TLR4 and TLR6 polymorphisms between TB patients and healthy contacts were not detected. Conclusions Our study suggests that the allele A of the intronic polymorphism rs352139 on TLR9 gene might contribute to the risk of developing TB in Mexican Amerindians. PMID:24053111

  14. Functional Effects of Toll-Like Receptor (TLR)3, 7, 9, RIG-I and MDA-5 Stimulation in Nasal Epithelial Cells

    PubMed Central

    Tengroth, Lotta; Millrud, Camilla Rydberg; Kvarnhammar, Anne Månsson; Kumlien Georén, Susanna; Latif, Leith; Cardell, Lars-Olaf

    2014-01-01

    Background The human nasal epithelium is an important physical barrier, and a part of the innate immune defense that protect against pathogens. The epithelial cells recognize microbial components by pattern-recognition receptors (PRRs), and thereby trigger an immune response. Even though TLR3, TLR7, TLR9, RIG-I and MDA-5 are all known to respond to viral stimulation, their potential role in chronic airway inflammation triggered by local cytokine release remains to be established. Methods mRNA and corresponding protein expression of TLR3, TLR7, TLR9, RIG-I and MDA-5 were analyzed in nasal biopsies and various upper airway epithelial cell lines using real-time reverse transcription PCR, immunohistochemistry and flow cytometry. Ligand induced, cytokine release, was evaluated with ELISA. Results Nasal biopsies were found to express TLR3, TLR7, TLR9, RIG-I and MDA-5, with the most abundant expression in the surface epithelium. These receptors were verified in primary human nasal epithelial cell (HNEC) as well as in the airway epithelial cell lines Detroit-562 and FaDu. Poly(I:C) (TLR3) and R-837 (TLR7) stimulation increased secretion of IL-6 and GM-CSF from the nasal mucosa and the epithelial cell lines. CpG (TLR9) stimulation caused release of IL-8 in the nasal mucosa and in FaDu. Poly(I:C)/LyoVec (RIG-I/MDA-5) stimulation activated the secretion of IFN-β in the nasal mucosa. A corresponding release was also detected from HNEC and Detroit-562. Conclusion The nasal epithelium has the ability to recognize viral intrusion through TLR and RLR receptors, and the subsequent response might have a role in exacerbation of inflammatory diseases like allergic rhinitis and chronic rhinosinusitis. PMID:24886842

  15. Association of Toll-Like Receptor 4 Gene Polymorphism and Expression with Urinary Tract Infection Types in Adults

    PubMed Central

    Yin, Xiaolin; Hou, Tianwen; Liu, Ying; Chen, Jing; Yao, Zhiyan; Ma, Cuiqing; Yang, Lijuan; Wei, Lin

    2010-01-01

    Background Innate immunity of which Toll-like receptor (TLR) 4 and CXCR1 are key elements plays a central role in the development of urinary tract infection (UTI). Although the relation between the genetics of TLR4 and CXCR1 and UTI is investigated partly, the polymorphisms and expression of TLR4 and CXCR1 in different types of UTI in adults are not extremely clear. Methodology/Principal Findings This study investigates the presence of TLR4 A (896) G and CXCR1 G (2608) C polymorphisms in 129 UTI patients using RFLP-PCR. Gene and allelic prevalence were compared with 248 healthy controls. Flow cytometry was used to detect TLR4 and CXCR1 expression in the monocytes of UTI patients and healthy controls. TLR4 (896) AG genotype and TLR4 (896) G allele had higher prevalence in UTI (especially in acute cystitis and urethritis) patients, whereas CXCR1 (2608) GC genotype and CXCR1 (2608) C allele had lower prevalence in UTI patients than controls. TLR4 expression was significantly lower in chronic UTI patients than in acute pyelonephritis or healthy controls. CXCR1 expression was similar in both controls and patients. TLR4 expression in chronic UTI patients after astragalus treatment was higher than pre-treatment. Conclusions The results indicate the relationship between the carrier status of TLR4 (896) G alleles and the development of UTI, especially acute cystitis and urethritis, in adults. TLR4 expression levels are correlated with chronic UTI. PMID:21151974

  16. Association of Toll-like receptors 2, 3, and 4 genes polymorphisms with periapical pathosis risk

    PubMed Central

    Özan, Ülkü; Ocak, Zeynep; Özan, Fatih; Oktay, Elif-Aybala; Şahman, Halil; Yikilgan, İhsan; Oruçoğlu, Hasan; Er, Kürşat

    2016-01-01

    Background The aim of this study was to investigate the role of gene variations of Toll-like receptors (TLR) 2, 3, and 4 on genetic susceptibility to periapical pathosis. Material and Methods One hundred patients were included in the study and divided into two groups as follows; Control Group (n=50) that have root canal treatment and no periapical lesion, Patient Group (n=50) that have root canal treatment and periapical lesion. TLR2 Arg753Gln, TLR3 (c.1377C/T) and TLR4 Asp299Gly and Thr399Ile polymorphisms were genotyped by using PCR-RFLP. Genotypical analysis of control and patient groups were investigated to disclose whether there is any association between periapical lesions and gene variations. Results There are no significant statistical differences between control and patient groups according to TLR 2 and 4 gene sequence. On the contrary, CC allele detected 74% for TLR 3 in patient group, and this difference was found to be statistically significant (p < 0.005). Conclusions According to these results, it can be suggested that patients with Toll-like receptor 3 gene polymorphisms could be susceptible to periapical pathosis. Key words:Toll-like receptors, periapical pathosis, endodontics. PMID:27031066

  17. A novel small molecule TLR4 antagonist (IAXO-102) negatively regulates non-hematopoietic toll like receptor 4 signalling and inhibits aortic aneurysms development.

    PubMed

    Huggins, Christopher; Pearce, Stuart; Peri, Francesco; Neumann, Frank; Cockerill, Gillian; Pirianov, Grisha

    2015-10-01

    The toll-like receptors (TLRs), including TLR4, have been shown to play a crucial role in vascular inflammatory diseases, such as atherosclerosis and aneurysm. The main goal of this study was to determine the potential of IAXO-102 (Innaxon, Tewkesbury), a novel small molecule TLR4 antagonist, to modulate non-hematopoietic TLR4 proinflammatory signalling and inhibit experimental abdominal aortic aneurysm (AAA) development. Human umbilical vein endothelial cells (HUVEC) and Angiotensin II-induced experimental AAA development were our in vitro and in vivo models respectively. Western blotting, antibody array and ELISA approaches were used to explore the effect of IAXO-102 on TLR4 functional activity on two levels: modulation of TLR4-induced mitogen activated protein kinases (MAPK) and p65 NF-kB phosphorylation and expression of TLR4 dependent proinflammatory proteins. Following activation of TLR4, in vitro/in vivo data revealed that IAXO-102 inhibited MAPK and p65 NF-kB phosphorylation associated with down regulation of the expression of TLR4 and TLR4 dependent proinflammatory proteins. Furthermore, IAXO-102 decreased Angiotensin II-induced aortic expansion, rupture and incidence of AAA. These results demonstrate the ability of IAXO-102 to negatively regulate TLR4 signalling and to inhibit experimental AAA development, suggesting the potential therapeutic use of this TLR4 antagonist for pharmacological intervention of AAA. Copyright © 2015. Published by Elsevier Ireland Ltd.

  18. Saturated fatty acids activate TLR-mediated proinflammatory signaling pathways.

    PubMed

    Huang, Shurong; Rutkowsky, Jennifer M; Snodgrass, Ryan G; Ono-Moore, Kikumi D; Schneider, Dina A; Newman, John W; Adams, Sean H; Hwang, Daniel H

    2012-09-01

    Toll-like receptor 4 (TLR4) and TLR2 were shown to be activated by saturated fatty acids (SFAs) but inhibited by docosahexaenoic acid (DHA). However, one report suggested that SFA-induced TLR activation in cell culture systems is due to contaminants in BSA used for solubilizing fatty acids. This report raised doubt about proinflammatory effects of SFAs. Our studies herein demonstrate that sodium palmitate (C16:0) or laurate (C12:0) without BSA solubilization induced phosphorylation of inhibitor of nuclear factor-κB α, c-Jun N-terminal kinase (JNK), p44/42 mitogen-activated-kinase (ERK), and nuclear factor-κB subunit p65, and TLR target gene expression in THP1 monocytes or RAW264.7 macrophages, respectively, when cultured in low FBS (0.25%) medium. C12:0 induced NFκB activation through TLR2 dimerized with TLR1 or TLR6, and through TLR4. Because BSA was not used in these experiments, contaminants in BSA have no relevance. Unlike in suspension cells (THP-1), BSA-solubilized C16:0 instead of sodium C16:0 is required to induce TLR target gene expression in adherent cells (RAW264.7). C16:0-BSA transactivated TLR2 dimerized with TLR1 or TLR6 and through TLR4 as seen with C12:0. These results and additional studies with the LPS sequester polymixin B and in MyD88(-/-) macrophages indicated that SFA-induced activation of TLR2 or TLR4 is a fatty acid-specific effect, but not due to contaminants in BSA or fatty acid preparations.

  19. Toll-like receptor 3 (TLR3): a new marker of canine monocytes-derived dendritic cells (cMo-DC).

    PubMed

    Bonnefont-Rebeix, Catherine; Marchal, Thierry; Bernaud, Janine; Pin, Jean-Jacques; Leroux, Caroline; Lebecque, Serge; Chabanne, Luc; Rigal, Dominique

    2007-07-15

    Toll-like receptors (TLRs) are a family of functionally important receptors for recognition of pathogen-associated molecular pattern (PAMP) since they trigger the pro-inflammatory response and upregulation of costimulatory molecules, linking the rapid innate response to adaptative immunity. In human leukocytes, TLR3 has been found to be specifically expressed in dendritic cells (DC). This study examined the expression of TLR3 in canine monocytes-derived DC (cMo-DC) and PBMC using three new anti-TLR3 mAbs (619F7, 722E2 and 713E4 clones). The non-adherent cMo-DC generated after culture in canine IL-4 plus canine GM-CSF were labelled with the three anti-TLR3 clones by flow cytometry, with a strong expression shown for 619F7 and 722E2 clones. By contrast, TLR3 expression was low to moderate in canine monocytes and lymphocytes. These results were confirmed by Western blot using 619F7 and 722E2 clones and several polypeptide bands were observed, suggesting a possible cleavage of TLR3 molecule or different glycosylation states. In addition, TLR3 was detectable in immunocytochemistry by using 722E2 clone. In conclusion, this first approach to study canine TLR3 protein expression shows that three anti-TLR3 clones detect canine TLR3 and can be used to better characterize canine DC and the immune system of dogs.

  20. Flagellin acting via TLR5 is the major activator of key signaling pathways leading to NF-κB and proinflammatory gene program activation in intestinal epithelial cells

    PubMed Central

    Tallant, Thomas; Deb, Amitabha; Kar, Niladri; Lupica, Joseph; de Veer, Michael J; DiDonato, Joseph A

    2004-01-01

    Background Infection of intestinal epithelial cells by pathogenic Salmonella leads to activation of signaling cascades that ultimately initiate the proinflammatory gene program. The transcription factor NF-κB is a key regulator/activator of this gene program and is potently activated. We explored the mechanism by which Salmonella activates NF-κB during infection of cultured intestinal epithelial cells and found that flagellin produced by the bacteria and contained on them leads to NF-κB activation in all the cells; invasion of cells by the bacteria is not required to activate NF-κB. Results Purified flagellin activated the mitogen activated protein kinase (MAPK), stress-activated protein kinase (SAPK) and Ikappa B kinase (IKK) signaling pathways that lead to expression of the proinflammatory gene program in a temporal fashion nearly identical to that of infection of intestinal epithelial cells by Salmonella. Flagellin expression was required for Salmonella invasion of host cells and it activated NF-κB via toll-like receptor 5 (TLR5). Surprisingly, a number of cell lines found to be unresponsive to flagellin express TLR5 and expression of exogenous TLR5 in these cells induces NF-κB activity in response to flagellin challenge although not robustly. Conversely, overexpression of dominant-negative TLR5 alleles only partially blocks NF-κB activation by flagellin. These observations are consistent with the possibility of either a very stable TLR5 signaling complex, the existence of a low abundance flagellin co-receptor or required adapter, or both. Conclusion These collective results provide the evidence that flagellin acts as the main determinant of Salmonella mediated NF-κB and proinflammatory signaling and gene activation by this flagellated pathogen. In addition, expression of the fli C gene appears to play an important role in the proper functioning of the TTSS since mutants that fail to express fli C are defective in expressing a subset of Sip proteins and

  1. NOD1 Cooperates with TLR2 to Enhance T Cell Receptor-Mediated Activation in CD8 T Cells

    PubMed Central

    Mercier, Blandine C.; Debaud, Anne-Laure; Tomkowiak, Martine; Marvel, Jacqueline; Bonnefoy, Nathalie

    2012-01-01

    Pattern recognition receptors (PRR), like Toll-like receptors (TLR) and NOD-like receptors (NLR), are involved in the detection of microbial infections and tissue damage by cells of the innate immune system. Recently, we and others have demonstrated that TLR2 can additionally function as a costimulatory receptor on CD8 T cells. Here, we establish that the intracytosolic receptor NOD1 is expressed and functional in CD8 T cells. We show that C12-iEDAP, a synthetic ligand for NOD1, has a direct impact on both murine and human CD8 T cells, increasing proliferation and effector functions of cells activated via their T cell receptor (TCR). This effect is dependent on the adaptor molecule RIP2 and is associated with an increased activation of the NF-κB, JNK and p38 signaling pathways. Furthermore, we demonstrate that NOD1 stimulation can cooperate with TLR2 engagement on CD8 T cells to enhance TCR-mediated activation. Altogether our results indicate that NOD1 might function as an alternative costimulatory receptor in CD8 T cells. Our study provides new insights into the function of NLR in T cells and extends to NOD1 the recent concept that PRR stimulation can directly control T cell functions. PMID:22848741

  2. Epigenetic regulation of TLR4 gene expression in intestinal epithelial cells for the maintenance of intestinal homeostasis.

    PubMed

    Takahashi, Kyoko; Sugi, Yutaka; Hosono, Akira; Kaminogawa, Shuichi

    2009-11-15

    Intestinal epithelial cells (IECs) are continuously exposed to large numbers of commensal bacteria but are relatively insensitive to them, thereby averting an excessive inflammatory reaction. In this study, we show that the low responsiveness of human IEC lines to LPS was mainly brought about by a down-regulation of TLR4 gene transcription. Additionally, the presence of an IEC-specific repressor element in the 5' region of the TLR4 gene and binding of a NF to the element was shown. The transcription factor ZNF160, which was expressed more abundantly in a LPS-low responder IEC line than in a LPS-high responder IEC line, repressed TLR4 gene transcription. ZNF160 is known to interact with the scaffold protein KAP1 via its N terminus to recruit histone deacetylase. Histone deacetylation, as well as DNA methylation, at the 5' region of the TLR4 gene was significantly higher in LPS-low responder IEC lines than in a monocyte line or a LPS-high responder IEC line. It was demonstrated that TLR4 gene transcription was repressed by these epigenetic regulations, which were, at least in part, dependent on ZNF160. Down-regulaton of TLR4 gene expression by these mechanisms in IECs possibly contributes to the maintainance of homeostasis in the intestinal commensal system.

  3. Maximizing the potency of an anti-TLR4 monoclonal antibody by exploiting proximity to Fcγ receptors

    PubMed Central

    Loyau, Jérémy; Malinge, Pauline; Daubeuf, Bruno; Shang, Limin; Elson, Greg; Kosco-Vilbois, Marie; Fischer, Nicolas; Rousseau, François

    2014-01-01

    In order to treat Toll like receptor 4 (TLR4)-mediated diseases, we generated a potent antagonistic antibody directed against human TLR4, Hu 15C1. This antibody's potency can be modulated by engaging not only TLR4 but also Fcγ receptors (FcγR), a mechanism that is driven by avidity and not cell signaling. Here, using various formats of the antibody, we further dissect the relative contributions of the Fv and Fc portions of Hu 15C1, discovering that the relationship to potency of the different antibody arms is not linear. First, as could be anticipated, we observed that Hu 15C1 co-engages up to 3 receptors on the same plasma membrane, i.e., 2 TLR4 molecules (via its variable regions) and either FcγRI or FcγRIIA (via the Fc). The Kd of these interactions are in the nM range (3 nM of the Fv for TLR4 and 47 nM of the Fc for FcγRI). However, unexpectedly, neutralization experiments revealed that, due to the low level of cell surface TLR4 expression, the avidity afforded by engagement through 2 Fv arms was significantly limited. In contrast, the antibody's neutralization capacity increases by 3 logs when able to exploit Fc-FcγR interactions. Taken together, these results demonstrate an unforeseen level of contribution by FcγRs to an antibody's effectiveness when targeting a cell surface protein of relatively low abundance. These findings highlight an exploitable mechanism by which FcγR-bearing cells may be more powerfully targeted, envisioned to be broadly applicable to other reagents aimed at neutralizing cell surface targets on cells co-expressing FcγRs. PMID:25484053

  4. Dysregulation of toll-like receptor (TLR) 2 expression on monocytes and upregulation of the frequency of T cells expressing TLR2 in patients with chronic hepatitis C virus infection.

    PubMed

    Ronit, Andreas; Salem, Mohammad; Hartling, Hans J; Gaardbo, Julie C; Ullum, Henrik; Gerstoft, Jan; Nielsen, Susanne D

    2013-05-01

    Toll-like receptors (TLRs) initiate inflammatory responses that may play a role in disease progression in patients infected with hepatitis C virus (HCV). TLR2 and TLR4 surface expression were assessed on CD14(+) monocytes, CD4(+) and CD8(+) T cells in treatment naïve patients with chronic HCV infection with fibrosis, without fibrosis, co-infected with human immunodeficiency virus (HIV), and in healthy controls. Increased expression of TLR2 was found on monocytes in HCV-infected patients with fibrosis (p < 0.01), co-infected with HIV (p = 0.03), and possibly in patients without fibrosis (p = 0.07) when compared to controls. TLR2 positive CD4(+) and CD8(+) T cells were upregulated in patients with fibrosis only (p < 0.01). However, expression of TLR2 was not associated with T cell activation. TLR4 expression was similar in patients and healthy controls. In conclusion, TLR2 expression on monocytes and the frequency of T cells expressing TLR2 may contribute to disease progression in chronic HCV infection.

  5. [Nle4, D-Phe7]-α-MSH Inhibits Toll-Like Receptor (TLR)2- and TLR4-Induced Microglial Activation and Promotes a M2-Like Phenotype

    PubMed Central

    Carniglia, Lila; Ramírez, Delia; Durand, Daniela; Saba, Julieta; Caruso, Carla; Lasaga, Mercedes

    2016-01-01

    α-melanocyte stimulating hormone (α-MSH) is an anti-inflammatory peptide, proved to be beneficial in many neuroinflammatory disorders acting through melanocortin receptor 4 (MC4R). We previously determined that rat microglial cells express MC4R and that NDP-MSH, an analog of α-MSH, induces PPAR-γ expression and IL-10 release in these cells. Given the great importance of modulation of glial activation in neuroinflammatory disorders, we tested the ability of NDP-MSH to shape microglial phenotype and to modulate Toll-like receptor (TLR)-mediated inflammatory responses. Primary rat cultured microglia were stimulated with NDP-MSH followed by the TLR2 agonist Pam3CSK4 or the TLR4 agonist LPS. NDP-MSH alone induced expression of the M2a/M2c marker Ag1 and reduced expression of the M2b marker Il-4rα and of the LPS receptor Tlr4. Nuclear translocation of NF-κB subunits p65 and c-Rel was induced by LPS and these effects were partially prevented by NDP-MSH. NDP-MSH reduced LPS- and Pam3CSK4-induced TNF-α release but did not affect TLR-induced IL-10 release. Also, NDP-MSH inhibited TLR2-induced HMGB1 translocation from nucleus to cytoplasm and TLR2-induced phagocytic activity. Our data show that NDP-MSH inhibits TLR2- and TLR4-mediated proinflammatory mechanisms and promotes microglial M2-like polarization, supporting melanocortins as useful tools for shaping microglial activation towards an alternative immunomodulatory phenotype. PMID:27359332

  6. [Nle4, D-Phe7]-α-MSH Inhibits Toll-Like Receptor (TLR)2- and TLR4-Induced Microglial Activation and Promotes a M2-Like Phenotype.

    PubMed

    Carniglia, Lila; Ramírez, Delia; Durand, Daniela; Saba, Julieta; Caruso, Carla; Lasaga, Mercedes

    2016-01-01

    α-melanocyte stimulating hormone (α-MSH) is an anti-inflammatory peptide, proved to be beneficial in many neuroinflammatory disorders acting through melanocortin receptor 4 (MC4R). We previously determined that rat microglial cells express MC4R and that NDP-MSH, an analog of α-MSH, induces PPAR-γ expression and IL-10 release in these cells. Given the great importance of modulation of glial activation in neuroinflammatory disorders, we tested the ability of NDP-MSH to shape microglial phenotype and to modulate Toll-like receptor (TLR)-mediated inflammatory responses. Primary rat cultured microglia were stimulated with NDP-MSH followed by the TLR2 agonist Pam3CSK4 or the TLR4 agonist LPS. NDP-MSH alone induced expression of the M2a/M2c marker Ag1 and reduced expression of the M2b marker Il-4rα and of the LPS receptor Tlr4. Nuclear translocation of NF-κB subunits p65 and c-Rel was induced by LPS and these effects were partially prevented by NDP-MSH. NDP-MSH reduced LPS- and Pam3CSK4-induced TNF-α release but did not affect TLR-induced IL-10 release. Also, NDP-MSH inhibited TLR2-induced HMGB1 translocation from nucleus to cytoplasm and TLR2-induced phagocytic activity. Our data show that NDP-MSH inhibits TLR2- and TLR4-mediated proinflammatory mechanisms and promotes microglial M2-like polarization, supporting melanocortins as useful tools for shaping microglial activation towards an alternative immunomodulatory phenotype.

  7. Characterization of Toll-like receptor 3 gene in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Rodriguez, M F; Wiens, G D; Purcell, M K; Palti, Y

    2005-08-01

    Antiviral immunity in fish is not well understood. In mammals, Toll-like receptor (TLR) 3 is involved in double-stranded RNA recognition and host immune response activation. Here, we report the first identification of a rainbow trout TLR3 ortholog (rtTLR3), its genomic structure, and mRNA regulation. Six exons and five introns were identified from bacterial artificial chromosome (BAC) and expressed sequence tag (EST) sequencing, and this genomic organization is similar to mammalian and fish TLR3 genes. The putative 913 amino acid protein has a Toll/interleukin (IL)-1R (TIR) domain, a transmembrane domain, and leucine-rich repeats. In healthy trout, rtTLR3 is highly expressed in the liver, pyloric ceca, intestine, spleen, and anterior and trunk kidney tissues. To investigate whether rtTLR3 is involved in antiviral immunity, transcriptional regulation in vivo was examined by quantitative real-time polymerase chain reaction (PCR) after poly inosinic:cytidylic (I:C) and infectious hematopoietic necrosis virus (IHNV) treatments. TLR3 mRNA expression peaked 1 day after poly (I:C) injection of live animals, while the peak of gene expression after live IHNV challenge was observed on day 3. In vitro stimulation of rainbow trout anterior kidney leukocytes with poly (I:C) also enhanced rtTLR3 expression. Up-regulation was specific to viral challenge as there was no significant up-regulation of rtTLR3 mRNA levels in the spleen and a modest down-regulation in the anterior kidney after bath challenge with a gram-negative bacterial trout pathogen, Yersinia ruckeri. The sequence conservation of trout TLR3 and mRNA regulation after poly (I:C) or RNA virus exposures strongly suggest a role for trout TLR3 in antiviral immunity.

  8. β-Glucan-supplemented diets increase poly(I:C)-induced gene expression of Mx, possibly via Tlr3-mediated recognition mechanism in common carp (Cyprinus carpio).

    PubMed

    Falco, Alberto; Miest, Joanna J; Pionnier, Nicolas; Pietretti, Danilo; Forlenza, Maria; Wiegertjes, Geert F; Hoole, David

    2014-02-01

    We have previously observed that in common carp (Cyprinus carpio), administration of β-glucan (MacroGard®) as feed additive leads to a lower expression of pro-inflammatory cytokines suggesting that this immunostimulant may be preventing an acute and potentially dangerous response to infection, particularly in the gut. However, in general, mechanisms to detect and eliminate pathogens must also be induced in order to achieve an efficient clearance of the infection. Protection against viral diseases acquired through β-glucan-supplemented feed has been extensively reported for several experimental models in fish but the underlining mechanisms are still unknown. Thus, in order to better characterize the antiviral action induced by β-glucans in fish, MacroGard® was administered daily to common carp in the form of supplemented commercial food pellets. Carp were fed for a period of 25 days prior to intra-peritoneal injection with polyinosinic:polycytidylic acid (poly(I:C)), a well-known double-stranded RNA mimic that triggers a type-I interferon (IFN) response. Subsequently, a set of immune related genes, including mx, were analysed by real-time PCR on liver, spleen, head kidney and mid gut tissues. Results obtained confirmed that treatment with β-glucan alone generally down-regulated the mRNA expression of selected cytokines when compared to untreated fish, while mx gene expression remained stable or was slightly up-regulated. Injection with poly(I:C) induced a similar down-regulated gene expression pattern for cytokines in samples from β-glucan fed fish. In contrast, poly(I:C) injection markedly increased mx gene expression in samples from β-glucan fed fish but hardly in samples from fish fed control feed. In an attempt to explain the high induction of mx, we studied Toll-like receptor 3 (TLR3) gene expression in these carp. TLR3 is a prototypical pattern recognition receptor considered important for the binding of viral double-stranded RNA and triggering of a

  9. Species-specific engagement of human nucleotide oligomerization domain 2 (NOD)2 and Toll-like receptor (TLR) signalling upon intracellular bacterial infection: role of Crohn's associated NOD2 gene variants.

    PubMed

    Salem, M; Seidelin, J B; Eickhardt, S; Alhede, M; Rogler, G; Nielsen, O H

    2015-03-01

    Recognition of bacterial peptidoglycan-derived muramyl-dipeptide (MDP) by nucleotide oligomerization domain 2 (NOD2) induces crucial innate immune responses. Most bacteria carry the N-acetylated form of MDP (A-MDP) in their cell membranes, whereas N-glycolyl MDP (G-MDP) is typical for mycobacteria. Experimental murine studies have reported G-MDP to have a greater NOD2-stimulating capacity than A-MDP. As NOD2 polymorphisms are associated with Crohn's disease (CD), a link has been suggested between mycobacterial infections and CD. Thus, the aim was to investigate if NOD2 responses are dependent upon type of MDP and further to determine the role of NOD2 gene variants for the bacterial recognition in CD. The response pattern to A-MDP, G-MDP, Mycobacterium segmatis (expressing mainly G-MDP) and M. segmatisΔnamH (expressing A-MDP), Listeria monocytogenes (LM) (an A-MDP-containing bacteria) and M. avium paratuberculosis (MAP) (a G-MDP-containing bacteria associated with CD) was investigated in human peripheral blood mononuclear cells (PBMCs). A-MDP and M. segmatisΔnamH induced significantly higher tumour necrosis factor (TNF)-α protein levels in healthy wild-type NOD2 PBMCs compared with G-MDP and M. segmatis. NOD2 mutations resulted in a low tumour necrosis factor (TNF)-α protein secretion following stimulation with LM. Contrary to this, TNF-α levels were unchanged upon MAP stimulation regardless of NOD2 genotype and MAP solely activated NOD2- and Toll-like receptor (TLRs)-pathway with an enhanced production of interleukin (IL)-1β and IL-10. In conclusion, the results indicate that CD-associated NOD2 deficiencies might affect the response towards a broader array of commensal and pathogenic bacteria expressing A-MDP, whereas they attenuate the role of mycobacteria in the pathogenesis of CD. © 2014 British Society for Immunology.

  10. Impact of TLR5 rs5744174 on stroke risk, gene expression and on inflammatory cytokines, and lipid levels in stroke patients.

    PubMed

    Gu, Lian; Huang, Jingyan; Tan, Jinjing; Wei, Qiugui; Jiang, Haiyun; Shen, Tingting; Liang, Baoyun; Tang, Nong

    2016-09-01

    Many studies reported that toll-like receptors (TLRs) played an important role in the process of ischemic stroke (IS). However, the impact of TLR5 rs5744174 on stroke risk, gene expression and on inflammatory cytokines, and lipid levels in ischemic stroke patients has not yet been reported and was therefore the subject of this study. In this case-control study, a total of 816 ischemic stroke patients and 816 healthy controls were genotyped using Sequenom MassArray technology. The mRNA expression of TLR5 was detected through quantitative real-time PCR among 52 ischemic stroke patients. The levels of IL-1b, IL-6, IL-8, and TNFα were measured by ELISA among 62 IS patients. Total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were determined among 816 IS patients using a Hitachi 7600 Automatic Biochemistry Analyzer. Our result showed TLR5 rs5744174 polymorphism was not associated with stroke risk, TLR5 mRNA expression and inflammatory cytokines of IS patients (P > 0.050), but was significantly associated with HDL-C (recessive model: β = - 0.14, 95 % CI: -0.24 to -0.03, P = 0.009). TLR5 rs5744174 polymorphism may have no impact on the stroke risk, gene expression and inflammatory cytokines, but may influence the HDL-C serum level of IS patients in Chinese Han population.

  11. Recent advances in the role of toll-like receptors and TLR agonists in immunotherapy for human glioma.

    PubMed

    Deng, Shuanglin; Zhu, Shan; Qiao, Yuan; Liu, Yong-Jun; Chen, Wei; Zhao, Gang; Chen, Jingtao

    2014-12-01

    Gliomas are extremely aggressive brain tumors with a very poor prognosis. One of the more promising strategies for the treatment of human gliomas is targeted immunotherapy where antigens that are unique to the tumors are exploited to generate vaccines. The approach, however, is complicated by the fact that human gliomas escape immune surveillance by creating an immune suppressed microenvironment. In order to oppose the glioma imposed immune suppression, molecules and pathways involved in immune cell maturation, expansion, and migration are under intensive clinical investigation as adjuvant therapy. Toll-like receptors (TLRs) mediate many of these functions in immune cell types, and TLR agonists, thus, are currently primary candidate molecules to be used as important adjuvants in a variety of cancers. In animal models for glioma, TLR agonists have exhibited antitumor properties by facilitating antigen presentation and stimulating innate and adaptive immunity. In clinical trials, several TLR agonists have achieved survival benefit, and many more trials are recruiting or ongoing. However, a second complicating factor is that TLRs are also expressed on cancer cells where they can participate instead in a variety of tumor promoting activities including cell growth, proliferation, invasion, migration, and even stem cell maintenance. TLR agonists can, therefore, possibly play dual roles in tumor biology. Here, how TLRs and TLR agonists function in glioma biology and in anti-glioma therapies is summarized in an effort to provide a current picture of the sophisticated relationship of glioma with the immune system and the implications for immunotherapy.

  12. TLR9 gene polymorphism -1486T/C (rs187084) is associated with uterine cervical neoplasm in Mexican female population.

    PubMed

    Martínez-Campos, Cecilia; Bahena-Román, Margarita; Torres-Poveda, Kirvis; Burguete-García, Ana I; Madrid-Marina, Vicente

    2017-08-17

    The aim of this work was to evaluate the association of single nucleotide polymorphisms in TLR9 (-1486 T/C [rs187084], -1237T/C [rs5743836] and G2848A [rs352140]) with HPV infection, squamous intraepithelial lesions, and uterine cervical neoplasm in a Mexican population. Additionally, the peripheral expression of TLR9 was evaluated to evaluate the differences in the TLR9 expression associated with every genotype in the locus -1486 of the TLR9 gene. The serum concentration of TLR9 was evaluated in a randomly selected subsample. Genotyping was performed using predesigned 5' endonuc lease assays and the association of the polymorphisms with the diagnosis groups were assessed by performing multinomial regression models. The relative expression of TLR9 in peripheral blood mononuclear cells was evaluated by real-time polymerase chain reaction and the association of the level of TLR9 expression with the diagnosis was evaluated by performing multinomial regression models. The serum concentration of TLR9 was evaluated in a subsample of patients diagnosed with uterine cervical neoplasm by ELISA. The results showed that genotype TT in the -1486 locus of TLR9 was significantly associated with HPV infection (OR = 3.25, 95% CI 1.12-9.46), squamous intraepithelial cervical lesion (OR = 3.76, 95% CI 1.36-10.41), and uterine cervical neoplasm (OR = 5.30, 95% CI 1.81-15.55). Moreover, the highest level of TLR9 expression was significantly associated with a greater risk for developing squamous intraepithelial cervical lesion and uterine cervical neoplasm. The serum TLR9 concentration was higher in patients with uterine cervical cancer than in controls. Our findings indicate that genotype TT in the -1486 locus of the TLR9 gene could comprise a risk genotype for HPV infection, squamous intraepithelial cervical lesion, and uterine cervical neoplasm in Mexican female population. Further studies with larger samples are needed to evaluate if the peripheral expression of TLR9 could be

  13. TLR4 and CD14 receptors expressed in rat pineal gland trigger NFKB pathway.

    PubMed

    da Silveira Cruz-Machado, Sanseray; Carvalho-Sousa, Claudia Emanuele; Tamura, Eduardo Koji; Pinato, Luciana; Cecon, Erika; Fernandes, Pedro Augusto Carlos Magno; de Avellar, Maria Christina Werneck; Ferreira, Zulma Silva; Markus, Regina Pekelmann

    2010-09-01

    Nuclear factor-kappa B (NFKB), a pivotal player in inflammatory responses, is constitutively expressed in the pineal gland. Corticosterone inhibits pineal NFKB leading to an enhancement of melatonin production, while tumor necrosis factor (TNF) leads to inhibition of Aa-nat transcription and the production of N-acetylserotonin in cultured glands. The reduction in nocturnal melatonin surge favors the mounting of the inflammatory response. Despite these data, there is no clear evidence of the ability of the pineal gland to recognize molecules that signal infection. This study investigated whether the rat pineal gland expresses receptors for lipopolysaccharide (LPS), the endotoxin from the membranes of Gram-negative bacteria, and to establish the mechanism of action of LPS. Here, we show that pineal glands possess both CD14 and toll-like receptor 4 (TLR4), membrane proteins that bind LPS and trigger the NFKB pathway. LPS induced the nuclear translocation of p50/p50 and p50/RELA dimers and the synthesis of TNF. The maximal expression of TNF in cultured glands coincides with an increase in the expression of TNF receptor 1 (TNFR1) in isolated pinealocytes. In addition, LPS inhibited the synthesis of N-acetylserotonin and melatonin. Therefore, the pineal gland transduces Gram-negative endotoxin stimulation by producing TNF and inhibiting melatonin synthesis. Here, we provide evidence to reinforce the idea of an immune-pineal axis, showing that the pineal gland is a constitutive player in the innate immune response.

  14. A Polysaccharide from the Culinary-Medicinal Mushroom Pholiota nameko (Agaricomycetes) Inhibits the NF-κB Pathway in Dendritic Cells Through the TLR2 Receptor.

    PubMed

    Li, Haiping; Zhao, Pei; Wang, Fengling; Huai, Lihua; Zhu, Ruixuan; Li, Guoliang; Xu, Yufeng

    2016-01-01

    A polysaccharide purified from Pholiota nameko (PNPS-1) was found to have anticancer and anti-inflammatory activity. This study investigated the effect of PNPS-1 on the nuclear factor (NF)-κB signaling pathway of TLR2 small interfering RNA-silenced murine bone marrow-derived dendritic cells (BMDCs) and relevant mechanisms. The expression of messenger RNA of 4 NF-κB-related genes, including MyD88, IKBKB, RelA(p65), and CCL2, was determined by real-time polymerase chain reaction; the expression of the phenotype molecule intercellular adhesion molecule-1 (ICAM-1) by flow cytometry; the protein expression of IKKβ and p65 by Western blot; the production of p65 by enzyme-linked immunosorbent assay; and the expression of p65 by immunocytochemistry. The results showed that TLR2-specific small interfering RNA could effectively inhibit the decrease in the expression of MyD88, IKBKB, CCL2, p65, and ICAM-1 in BMDCs induced by PNPS-1, and thus the transcription inactivation of NF-κB, which obviously suggests that PNPS-1 could downregulate the NF-κB signaling pathway via the TLR2 receptor.

  15. Human Lipopolysaccharide-binding Protein (LBP) and CD14 Independently Deliver Triacylated Lipoproteins to Toll-like Receptor 1 (TLR1) and TLR2 and Enhance Formation of the Ternary Signaling Complex*

    PubMed Central

    Ranoa, Diana Rose E.; Kelley, Stacy L.; Tapping, Richard I.

    2013-01-01

    Bacterial lipoproteins are the most potent microbial agonists for the Toll-like receptor 2 (TLR2) subfamily, and this pattern recognition event induces cellular activation, leading to host immune responses. Triacylated bacterial lipoproteins coordinately bind TLR1 and TLR2, resulting in a stable ternary complex that drives intracellular signaling. The sensitivity of TLR-expressing cells to lipoproteins is greatly enhanced by two lipid-binding serum proteins known as lipopolysaccharide-binding protein (LBP) and soluble CD14 (sCD14); however, the physical mechanism that underlies this increased sensitivity is not known. To address this, we measured the ability of LBP and sCD14 to drive ternary complex formation between soluble extracellular domains of TLR1 and TLR2 and a synthetic triacylated lipopeptide agonist. Importantly, addition of substoichiometric amounts of either LBP or sCD14 significantly enhanced formation of a TLRTLR2 lipopeptide ternary complex as measured by size exclusion chromatography. However, neither LBP nor sCD14 was physically associated with the final ternary complex. Similar results were obtained using outer surface protein A (OspA), a naturally occurring triacylated lipoprotein agonist from Borrelia burgdorferi. Activation studies revealed that either LBP or sCD14 sensitized TLR-expressing cells to nanogram levels of either the synthetic lipopeptide or OspA lipoprotein agonist. Together, our results show that either LBP or sCD14 can drive ternary complex formation and TLR activation by acting as mobile carriers of triacylated lipopeptides or lipoproteins. PMID:23430250

  16. Expression, subcellular localization and cytokinic modulation of Toll-like receptors (TLRs) in normal human keratinocytes: TLR2 up-regulation in psoriatic skin.

    PubMed

    Begon, Edouard; Michel, Laurence; Flageul, Béatrice; Beaudoin, Isabelle; Jean-Louis, Francette; Bachelez, Hervé; Dubertret, Louis; Musette, Philippe

    2007-01-01

    The aim of the research described here was to investigate the expression of Toll-like receptors (TLRs) in normal human keratinocytes, to study its modulation by proinflammatory cytokines, and to characterize the function of the latter within the epidermis. Our results demonstrate that normal human keratinocytes may present an intra-cytoplasmic expression of TLR2, TLR3, and TLR4. Exposure of keratinocytes to IFN-gamma and TNF-alpha increased intra-cytoplasmic expression and led to partial translocation at the cell surface. Keratinocyte activation by TLR2, TLR3, and TLR4 ligands led to the nuclear translocation of NF-kappab and the release of proinflammatory cytokines TNF-alpha and IL-8. In immunochemistry analysis, psoriatic skin showed a strong over-expression of TLR2 in the epidermis compared with normal skin. Our results thus demonstrate large TLR expression in keratinocytes and the functionality of TLRs 2, 3, and 4. TLR2 over-expression in psoriatic skin provides new insights into TLR implication in the pathogenesis of psoriasis, through inappropriate stimulation by infectious or endogen ligands.

  17. Single nucleotide polymorphisms in toll-like receptor genes and case-control association studies with bovine tuberculosis

    PubMed Central

    Bhaladhare, Ashish; Sharma, Deepak; Kumar, Amit; Sonwane, Arvind; Chauhan, Anuj; Singh, Ranvir; Kumar, Pushpendra; Yadav, Ramji; Baqir, Mohd; Bhushan, Bharat; Prakash, Om

    2016-01-01

    Aim: Toll-like receptor 2 (TLR2) and TLR4 genes play critical roles in host recognition of Mycobacterium bovis infection and initiation of innate and adaptive immune response. The present study was aimed at exploring the association of seven single nucleotide polymorphisms (SNPs) in TLR2 and TLR4 genes with susceptibility/resistance against bovine tuberculosis (bTB) infection in cattle. Materials and Methods: A case-control resource population of 35 positive and 45 negative animals was developed after screening with single intradermal tuberculin test for bTB. Resource population was screened for SNPs in TLR2 and TLR4 genes using polymerase chain reaction-restriction fragment length polymorphism. The PROC LOGISTIC procedure of SAS 9.3 was used to find an association of allelic and genotypic frequencies with bTB. Results: In TLR2 gene, two of SNPs under study (rs55617172 and rs68268253) revealed polymorphism while in the case of TLR4 gene all four SNPs under investigation (rs8193041, rs207836014, rs8193060, and rs8193069) were found to be polymorphic in case-control population. SNP locus rs55617172 in TLR2 gene was found significantly (p<0.01) associated with susceptibility/resistance to TB in cattle. Conclusion: These findings indicate the presence of SNPs in TLR2 and TLR4 genes in our resource population. Upon validation in independent, large resource population and following biological characterization, SNP rs55617172 can be incorporated in marker panel for selection of animals with greater resistance to bTB. PMID:27284220

  18. Analysis of the Toll-Like Receptor 2-2 (TLR2-2) and TLR4 mRNA Expression in the Intestinal Mucosal Immunity of Broilers Fed on Diets Supplemented with Nickel Chloride

    PubMed Central

    Wu, Bangyuan; Cui, Hengmin; Peng, Xi; Fang, Jing; Zuo, Zhicai; Deng, Junliang; Huang, Jianying

    2014-01-01

    Toll-like receptor (TLRs) are important innate immune receptors, and TLR2 and TLR4 play an important role in intestinal mucosal innate immunity. It has been found that nickel (Ni) can affect the immune system in broilers. The purpose of this study was to analyze changes in TLR2-2 and TLR4 mRNA expression levels in the intestinal mucosal immunity system of broilers induced by dietary nickel chloride (NiCl2) using quantitative real-time polymerase chain reaction (qRT-PCR) assays. Two hundred and forty one-day-old avian broilers were divided into four groups and fed on a corn-soybean basal diet as control diet or the same basal diet supplemented with 300, 600 and 900 mg/kg of NiCl2 for 42 days. Results showed that the TLR2-2 and TLR4 mRNA expression levels in the intestinal mucosa and the cecal tonsil were lower (p < 0.05 or p < 0.01) in the 300, 600 and 900 mg/kg groups than those in the control group. It was concluded that dietary NiCl2 in excess of 300 mg/kg could reduce TLR2-2 and TLR4 mRNA expression levels in the intestinal mucosa and cecal tonsil in broilers, implying that the innate immunity in intestinal mucosal immune system could be impaired by pathways involving injured surface epithelium cells or/and the inhibition of the TLR signal transduction. PMID:24394214

  19. Toll-Like Receptor Gene Variants Associated with Bacterial Vaginosis among HIV-1 Infected Adolescents

    PubMed Central

    Royse, Kathryn E; Kempf, Mirjam-Colette; McGwin, Gerald; Wilson, Craig M; Tang, Jianming; Shrestha, Sadeep

    2012-01-01

    Bacterial vaginosis (BV) is a common vaginal disorder in women of reproductive age, especially among women with HIV-1 infection. Several bacterial products including lipopolysaccharides (LPS), lipoteichoic acids (LTA), and peptidoglycans (PGN) are stimulatory ligands for Toll-like receptors (TLRs), and recent evidence indicates the important role of variation in TLR genes for permitting overgrowth of gram negative and BV-type flora. We assessed whether genetic polymorphisms in five TLR genes (TLR1, TLR2, TLR4, TLR6, and TLR9) could be determinants of differential host immune responses to BV in 159 HIV-1-positive African American adolescents enrolled in the Reaching for Excellence in Adolescent Care and Health (REACH) study. BV was assessed biannually and diagnosed either by a Nugent Score of at least 7 of 10, or using the Amsel Criteria. Cox-proportional hazards regression models, adjusted for concurrent Chlamydia and Gonorrhea infections, douching, and absolute CD4 cell count, were used to identify host genetic factors associated with BV. Two SNPs were associated with BV as diagnosed by the Nugent Score and the combined criteria: a minor allele G of rs4986790 (frequency=0.07), which encodes a His to Tyr substitution in TLR4 (HR=1.47, 95% CI 1.15–1.87) and rs187084 (frequency=0.24) on TLR9. The minor allele of rs1898830 (frequency=0.13) was associated with an increased hazard of BV defined by the Amsel criteria (HR=1.86, 95%CI 1.17–2.95). Further studies are warranted to confirm the associations of TLR gene variants and also to understand the underlying pathways and immunogenetic correlates in the context of HIV-1 infection. PMID:23021866

  20. Combined Tlr2 and Tlr4 Deficiency Increases Radiation-Induced Pulmonary Fibrosis in Mice

    SciTech Connect

    Paun, Alexandra; Fox, Jessica; Balloy, Viviane; Chignard, Michel; Qureshi, Salman T.; Haston, Christina K.

    2010-07-15

    Purpose: To determine whether Toll-like receptor 2 or 4 genotype alters the lung response to irradiation in C57BL/6 mice using a model developing a phenotype that resembles radiotherapy-induced fibrosis in both histological characteristics and onset post-treatment. Methods and Materials: The pulmonary phenotype of C57BL/6 mice deficient in each or both of these genes was assessed after an 18-Gy single dose to the thoracic cavity by survival time postirradiation, bronchoalveolar lavage cell differential, histological evidence of alveolitis and fibrosis, and gene expression levels, and compared with that of wild-type mice. Results: The lung phenotype of Tlr4-deficient and Tlr2-deficient mice did not differ from that of wild-type mice in terms of survival time postirradiation, or by histological evidence of alveolitis or fibrosis. In contrast, mice deficient in both receptors developed respiratory distress at an earlier time than did wild-type mice and presented an enhanced fibrotic response (13.5% vs. 5.8% of the lung by image analysis of histological sections, p < 0.001). No differences in bronchoalveolar cell differential counts, nor in numbers of apoptotic cells in the lung as detected through active caspase-3 staining, were evident among the irradiated mice grouped by Tlr genotype. Gene expression analysis of lung tissue revealed that Tlr2,4-deficient mice have increased levels of hyaluronidase 2 compared with both wild-type mice and mice lacking either Tlr2 or Tlr4. Conclusion: We conclude that a combined deficiency in both Tlr2 and Tlr4, but not Tlr2 or Tlr4 alone, leads to enhanced radiation-induced fibrosis in the C57BL/6 mouse model.

  1. Novel transcriptional regulation of the schlafen-2 gene in macrophages in response to TLR-triggered stimulation.

    PubMed

    Sohn, Wern-Joo; Kim, Dongbum; Lee, Keun-Wook; Kim, Min-Soo; Kwon, Sanghoon; Lee, Younghee; Kim, Doo-Sik; Kwon, Hyung-Joo

    2007-07-01

    Schlafen-2 (slfn-2) is a member of slfn family, regulators of T cell development and its expression is altered during infection by microbial pathogens. However, the molecular mechanism involved in slfn expression is still to be determined. In this study, we isolated slfn-2 as a LPS-induced differentially expressed genes (DEGs) in RAW 264.7 cells and examined expression and regulation of slfn-2 in CpG-DNA-treated and LPS-treated macrophages. We defined a transcriptional start site in the slfn-2 gene. To examine the promoter organization of the slfn-2 gene, we cloned a approximately 1.8 kb region upstream of the transcription start site. Sequence analysis indicates consensus sites for AP-1 and NF-kappaB. Comprehensive mutant analyses, ELISA-based transcription factor activation assay, and ChIP assays reveal that functional interaction of AP-1 and NF-kappaB with the promoter element is necessary for the Toll-like receptor (TLR)-mediated slfn-2 gene expression by CpG-DNA and LPS treatment in macrophages. In summary, we identified a slfn-2 promoter for the first time and demonstrated that CpG-DNA and LPS triggers slfn-2 gene expression by activating NF-kappaB and AP-1 pathways in macrophages.

  2. Increased expression of TLR-2, COX-2, and SOD-2 genes in the peripheral blood leukocytes of opisthorchiasis patients induced by Opisthorchis viverrini antigen.

    PubMed

    Yongvanit, Puangrat; Thanan, Raynoo; Pinlaor, Somchai; Sithithaworn, Paiboon; Loilome, Watcharin; Namwat, Nisana; Techasen, Anchalee; Dechakhamphu, Somkid

    2012-05-01

    Re-infection with liver fluke, Opisthorchis viverrini, increases proinflammatory molecules involved in inflammation-mediated disease and carcinogenesis in an animal model. To clarify whether these genes respond to parasite antigen in peripheral blood leukocytes (PBL) of opisthorchiasis patients, we examined the transcriptional level of oxidant-generating (toll-like receptor 2 (TLR-2), nuclear factor-kappa B (NF-KB), and cyclooxygenase 2 (COX-2)), anti-oxidant-generating (manganese superoxide dismutase 2 (SOD-2) and catalase (CAT)), proinflammatory cytokine (interleukin (IL)-1β), and anti-inflammatory cytokine (IL-10), in PBL exposed to parasite antigen in O. viverrini-infected patients compared with healthy individuals in an in vitro experiment. After O. viverrini antigen-treated PBL, quantitative RT-PCR analysis revealed that increased expression of cytokines and oxidant-generating genes in PBL was similar between O. viverrini-infected and healthy groups. Interestingly, compared with healthy subjects, increase of TLR-2, COX-2, and SOD-2 and decreased CAT mRNA expression levels were observed in O. viverrini-infected group. The results indicate that O. viverrini antigen induces upregulation of TLR-2, COX-2, and SOD-2 and downregulation of CAT genes in opisthorchiasis patients, suggesting that imbalance of oxidant/anti-oxidant transcripts during re-infection may be involved in the inflammatory-driven carcinogenesis. These molecules may be used as the chemopreventive target for intervention of opisthorchiasis patients in an endemic area.

  3. Blockade of Toll-Like Receptors (TLR2, TLR4) Attenuates Pain and Potentiates Buprenorphine Analgesia in a Rat Neuropathic Pain Model

    PubMed Central

    Jurga, Agnieszka M.; Rojewska, Ewelina; Makuch, Wioletta; Pilat, Dominika; Przewlocka, Barbara

    2016-01-01

    Accumulating evidence indicates that microglial TLR2 and TLR4 play a significant role in nociception. Experiments were conducted to evaluate the contribution of TLR2 and TLR4 and their adaptor molecules to neuropathy and their ability to amplify opioid effectiveness. Behavioral tests (von Frey's and cold plate) and biochemical (Western blot and qRT-PCR) analysis of spinal cord and DRG tissue were conducted after chronic constriction injury (CCI) to the sciatic nerve. Repeated intrathecal administration of LPS-RS (TLR2 and TLR4 antagonist) and LPS-RS Ultrapure (TLR4 antagonist) attenuated allodynia and hyperalgesia. Biochemical analysis revealed time-dependent upregulation of mRNA and/or protein levels of TLR2 and TLR4 and MyD88 and TRIF adaptor molecules, which was paralleled by an increase in IBA-1/CD40-positive cells under neuropathy. LPS-RS and LPS-RS Ultrapure similarly influenced opioid analgesia by enhancing the effectiveness of buprenorphine but not morphine. Summing up, in light of their upregulation over the course of pain, both TLR2 and TLR4 may indeed play a significant role in neuropathy, which could be linked to the observed activation of IBA-1/CD40-positive cells. Blockade of TLR2 and TLR4 produced analgesia and enhanced buprenorphine's effectiveness, which suggests that they may be a putative target for future pharmacological pain relief tools, especially for opioid rotation, when the effect of morphine is tolerated. PMID:26962463

  4. Blockade of Toll-Like Receptors (TLR2, TLR4) Attenuates Pain and Potentiates Buprenorphine Analgesia in a Rat Neuropathic Pain Model.

    PubMed

    Jurga, Agnieszka M; Rojewska, Ewelina; Piotrowska, Anna; Makuch, Wioletta; Pilat, Dominika; Przewlocka, Barbara; Mika, Joanna

    2016-01-01

    Accumulating evidence indicates that microglial TLR2 and TLR4 play a significant role in nociception. Experiments were conducted to evaluate the contribution of TLR2 and TLR4 and their adaptor molecules to neuropathy and their ability to amplify opioid effectiveness. Behavioral tests (von Frey's and cold plate) and biochemical (Western blot and qRT-PCR) analysis of spinal cord and DRG tissue were conducted after chronic constriction injury (CCI) to the sciatic nerve. Repeated intrathecal administration of LPS-RS (TLR2 and TLR4 antagonist) and LPS-RS Ultrapure (TLR4 antagonist) attenuated allodynia and hyperalgesia. Biochemical analysis revealed time-dependent upregulation of mRNA and/or protein levels of TLR2 and TLR4 and MyD88 and TRIF adaptor molecules, which was paralleled by an increase in IBA-1/CD40-positive cells under neuropathy. LPS-RS and LPS-RS Ultrapure similarly influenced opioid analgesia by enhancing the effectiveness of buprenorphine but not morphine. Summing up, in light of their upregulation over the course of pain, both TLR2 and TLR4 may indeed play a significant role in neuropathy, which could be linked to the observed activation of IBA-1/CD40-positive cells. Blockade of TLR2 and TLR4 produced analgesia and enhanced buprenorphine's effectiveness, which suggests that they may be a putative target for future pharmacological pain relief tools, especially for opioid rotation, when the effect of morphine is tolerated.

  5. Cloning of canine Toll-like receptor 7 gene and its expression in dog tissues.

    PubMed

    Okui, Yasuhumi; Kano, Rui; Maruyama, Haruhiko; Hasegawa, Atsuhiko

    2008-01-15

    Toll-like receptor 7 (TLR7) is activated by single strand RNA and imidazoquinoline compounds, and induces interferon production. In this study, canine TLR7 cDNA was cloned and sequenced. The full-length cDNA of canine TLR7 gene was 3419bp, encoding 1032 amino acids. The similarities of canine TLR7 with human and mouse TLR7 were 84 and 80% at the nucleotide sequence level, and 86 and 79% at amino acid sequence level, respectively. Further, the expression of TLR7 mRNA was investigated in canine normal tissues by semiquantitative RT-PCR analysis. The common expression level of TLR7 mRNA in tissues from three dogs examined was in large intestine, lung, pancreas, small intestine and skin, though the expression level in each tissue was varied among these healthy dogs. In other tissues (kidney, liver, lymph node, spleen, adrenal gland, and PBMCs), the level of TLR7 mRNA expression was different in individuals.

  6. Mice deficient in surfactant protein A (SP-A) and SP-D or in TLR2 manifest delayed parturition and decreased expression of inflammatory and contractile genes.

    PubMed

    Montalbano, Alina P; Hawgood, Samuel; Mendelson, Carole R

    2013-01-01

    Previously we obtained compelling evidence that the fetus provides a critical signal for the initiation of term labor through developmental induction of surfactant protein (SP)-A expression by the fetal lung and secretion into amniotic fluid (AF). We proposed that interactions of AF macrophage (Mϕ) Toll-like receptors (TLRs) with SP-A, at term, or bacterial components, at preterm, result in their activation and migration to the pregnant uterus. Herein the timing of labor in wild-type (WT) C57BL/6 mice was compared with mice homozygous null for TLR2, SP-A, SP-D, or doubly deficient in SP-A and SP-D. Interestingly, TLR2(-/-) females manifested a significant (P < 0.001) delay in timing of labor compared with WT as well as reduced expression of the myometrial contraction-associated protein (CAP) gene, connexin-43, and Mϕ marker, F4/80, at 18.5 d postcoitum (dpc). Whereas in first pregnancies, SP-A(-/-), SP-D(-/-), and SP-A/D(-/-) females delivered at term (∼19.5 dpc), in second pregnancies, parturition was delayed by approximately 12 h in SP-A(-/-) (P = 0.07) and in SP-A/D(-/-) (P <0.001) females. Myometrium of SP-A/D(-/-) females expressed significantly lower levels of IL-1β, IL-6, and CAP genes, connexin-43, and oxytocin receptor at 18.5 dpc compared with WT. F4/80(+) AF Mϕs from TLR2(-/-) and SP-A/D(-/-) mice expressed significantly lower levels of both proinflammatory and antiinflammatory activation markers (e.g. IL-1β, IL-6, ARG1, YM1) compared with gestation-matched WT AF Mϕs. These novel findings suggest that the pulmonary collectins acting via TLR2 serve a modulatory role in the timing of labor; their relative impact may be dependent on parity.

  7. Toll-like receptor 4 gene polymorphism downregulates gene expression and involves in susceptibility to bladder cancer.

    PubMed

    Shen, Yizhen; Bu, Meimei; Zhang, Aimin; Liu, Yi; Fu, Baochen

    2015-04-01

    Bladder cancer is the ninth most frequent malignancy in China. Toll-like receptor 4 (TLR4) is expressed on various cells and greatly involves in immune responses. Genetic polymorphism may affect the pathogenesis of diseases through various pathways. In the current study, we evaluated the association between genetic polymorphisms in TLR4 and risk of bladder cancer. We also examined the effect of the polymorphisms on gene expression. The TLR4 -729G/C and -260G/C polymorphisms were genotyped in 282 bladder cancer patients and 298 healthy controls in the Chinese population. Results showed that subjects with -729GC genotype are at significantly higher risk of bladder cancer than those with GG genotype [odds ratio (OR) = 2.50, 95% confidence interval (CI) = 1.39-4.48, P = 0.002]. Similarly, TLR4 -729C allele revealed a positive association with the disease (OR = 2.39, P = 0.002). The other polymorphism, TLR4 -260G/C, did not present clear correlations with bladder cancer. To understand the function of the polymorphisms, we evaluated TLR4 messenger RNA (mRNA) and protein levels in CD4+ T cells, CD8+ T cells, and monocytes from subjects carrying different TLR4 genotypes. Results revealed that subjects carrying -729GC genotype had significantly downregulated mRNA and protein levels of TLR4 in CD4+ T cells, CD8+ T cells, and monocytes compared to those carrying GG genotype. However, subjects with -260G/C polymorphism did not show any differences in gene expression from immune cells These data suggest that TLR4 polymorphism is associated with increased susceptibility to bladder cancer possibly by downregulating gene expression in various immune cells.

  8. Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

    PubMed

    El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

    2017-04-03

    Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

  9. Systems analysis identifies an essential role for SHANK-associated RH domain-interacting protein (SHARPIN) in macrophage Toll-like receptor 2 (TLR2) responses

    PubMed Central

    Zak, Daniel E.; Schmitz, Frank; Gold, Elizabeth S.; Diercks, Alan H.; Peschon, Jacques J.; Valvo, Joe S.; Niemistö, Antti; Podolsky, Irina; Fallen, Shannon G.; Suen, Rosa; Stolyar, Tetyana; Johnson, Carrie D.; Kennedy, Kathleen A.; Hamilton, M. Kristina; Siggs, Owen M.; Beutler, Bruce; Aderem, Alan

    2011-01-01

    Precise control of the innate immune response is essential to ensure host defense against infection while avoiding inflammatory disease. Systems-level analyses of Toll-like receptor (TLR)-stimulated macrophages suggested that SHANK-associated RH domain-interacting protein (SHARPIN) might play a role in the TLR pathway. This hypothesis was supported by the observation that macrophages derived from chronic proliferative dermatitis mutation (cpdm) mice, which harbor a spontaneous null mutation in the Sharpin gene, exhibited impaired IL-12 production in response to TLR activation. Systems biology approaches were used to define the SHARPIN-regulated networks. Promoter analysis identified NF-κB and AP-1 as candidate transcription factors downstream of SHARPIN, and network analysis suggested selective attenuation of these pathways. We found that the effects of SHARPIN deficiency on the TLR2-induced transcriptome were strikingly correlated with the effects of the recently described hypomorphic L153P/panr2 point mutation in Ikbkg [NF-κB Essential Modulator (NEMO)], suggesting that SHARPIN and NEMO interact. We confirmed this interaction by co-immunoprecipitation analysis and furthermore found it to be abrogated by panr2. NEMO-dependent signaling was affected by SHARPIN deficiency in a manner similar to the panr2 mutation, including impaired p105 and ERK phosphorylation and p65 nuclear localization. Interestingly, SHARPIN deficiency had no effect on IκBα degradation and on p38 and JNK phosphorylation. Taken together, these results demonstrate that SHARPIN is an essential adaptor downstream of the branch point defined by the panr2 mutation in NEMO. PMID:21709223

  10. Crystal structure of TIR domain of TLR6 reveals novel dimeric interface of TIR-TIR interaction for toll-like receptor signaling pathway.

    PubMed

    Jang, Tae-Ho; Park, Hyun Ho

    2014-09-23

    Toll-like receptors (TLRs) are responsible for recognition of particular pathogens during the innate immune response and cytoplasmic Toll/interleukin-1 receptor (TIR) domain responsible for downstream signaling. TLR6 working with TLR2 can detect bacterial lipoprotein leading signal for nuclear factor-kappaB activation for immune response. To better understand TLR-mediated signaling event in the innate immune system, in this study, we report the first crystal structure of the TIR domain of TLR6 at 2.2Å resolution. Our structure reveals novel homo-dimerization interfaces, which might be a critical for the interaction with TIR-containing adaptor proteins and itself. We also report structural similarities and differences of TLR6 with those of other TIR domains, which may be functionally relevant. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Contrasting expression pattern of RNA-sensing receptors TLR7, RIG-I and MDA5 in interferon-positive and interferon-negative patients with primary Sjögren's syndrome.

    PubMed

    Maria, Naomi I; Steenwijk, Eline C; IJpma, Arne S; van Helden-Meeuwsen, Cornelia G; Vogelsang, Petra; Beumer, Wouter; Brkic, Zana; van Daele, Paul L A; van Hagen, P Martin; van der Spek, Peter J; Drexhage, Hemmo A; Versnel, Marjan A

    2017-04-01

    The interferon (IFN) type I signature is present in over half of patients with primary Sjögren's syndrome (pSS) and associated with higher disease-activity and autoantibody presence. Plasmacytoid dendritic cells (pDCs) are considered as the main source of enhanced IFN type I expression. The objective of this study was to unravel the molecular pathways underlying IFN type I bioactivity in pDCs of patients with pSS. Blood samples from 42 healthy controls (HC) and 115 patients with pSS were stratified according to their IFN type I signature. CD123(+)BDCA4(+) pDCs and CD14(+) monocytes were isolated from peripheral blood mononuclear cells (PBMCs). Genome-wide microarray analysis was conducted on sorted pDCs in a small sample set, followed by validation of differentially expressed genes of interest in pDCs and monocytes. We found an upregulation of endosomal toll-like receptor (TLR) 7, but not TLR9, in IFN-positive (IFNpos) pDCs (p<0.05) and monocytes (p=0.024). Additionally, the downstream signalling molecules MyD88, RSAD2 and IRF7 were upregulated, as were the cytoplasmic RNA-sensing receptors DDX58/retinoic acid inducible gene-I (RIG-I) and IFIH1/melanoma differentiation associated gene-5 (MDA5). In vitro triggering of the TLR7-pathway in HC PBMCs induced upregulation of DDX58/RIG-I and IFIH1/MDA5, and downregulated TLR9. The upregulation of TLR7, its downstream signalling pathway, DDX58/RIG-I and IFIH1/MDA5 were confined to patients with IFN-positive pSS. IFN-negative patients had a contrasting expression pattern-TLR7 normal, and decreased TLR9, RIG-I and MDA5. Here we conclude a contrasting expression pattern of the RNA-sensing receptors TLR7, RIG-I and MDA5 in pDCs and monocytes of patients with IFNpos pSS. This profile could explain the pathogenic IFN production and might reveal novel therapeutic targets in these patients. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  12. The Structural Basis for Endotoxin-induced Allosteric Regulation of the Toll-like Receptor 4 (TLR4) Innate Immune Receptor*

    PubMed Central

    Paramo, Teresa; Piggot, Thomas J.; Bryant, Clare E.; Bond, Peter J.

    2013-01-01

    As part of the innate immune system, Toll-like receptor 4 (TLR4) recognizes bacterial cell surface lipopolysaccharide (LPS) by forming a complex with a lipid-binding co-receptor, MD-2. In the presence of agonist, TLR4·MD-2 dimerizes to form an active receptor complex, leading to initiation of intracellular inflammatory signals. TLR4 is of great biomedical interest, but its pharmacological manipulation is complicated because even subtle variations in the structure of LPS can profoundly impact the resultant immunological response. Here, we use atomically detailed molecular simulations to gain insights into the nature of the molecular signaling mechanism. We first demonstrate that MD-2 is extraordinarily flexible. The “clamshell-like” motions of its β-cup fold enable it to sensitively match the volume of its hydrophobic cavity to the size and shape of the bound lipid moiety. We show that MD-2 allosterically transmits this conformational plasticity, in a ligand-dependent manner, to a phenylalanine residue (Phe-126) at the cavity mouth previously implicated in TLR4 activation. Remarkably, within the receptor complex, we observe spontaneous transitions between active and inactive signaling states of Phe-126, and we confirm that Phe-126 is indeed the “molecular switch” in endotoxic signaling. PMID:24178299

  13. The structural basis for endotoxin-induced allosteric regulation of the Toll-like receptor 4 (TLR4) innate immune receptor.

    PubMed

    Paramo, Teresa; Piggot, Thomas J; Bryant, Clare E; Bond, Peter J

    2013-12-20

    As part of the innate immune system, Toll-like receptor 4 (TLR4) recognizes bacterial cell surface lipopolysaccharide (LPS) by forming a complex with a lipid-binding co-receptor, MD-2. In the presence of agonist, TLR4·MD-2 dimerizes to form an active receptor complex, leading to initiation of intracellular inflammatory signals. TLR4 is of great biomedical interest, but its pharmacological manipulation is complicated because even subtle variations in the structure of LPS can profoundly impact the resultant immunological response. Here, we use atomically detailed molecular simulations to gain insights into the nature of the molecular signaling mechanism. We first demonstrate that MD-2 is extraordinarily flexible. The "clamshell-like" motions of its β-cup fold enable it to sensitively match the volume of its hydrophobic cavity to the size and shape of the bound lipid moiety. We show that MD-2 allosterically transmits this conformational plasticity, in a ligand-dependent manner, to a phenylalanine residue (Phe-126) at the cavity mouth previously implicated in TLR4 activation. Remarkably, within the receptor complex, we observe spontaneous transitions between active and inactive signaling states of Phe-126, and we confirm that Phe-126 is indeed the "molecular switch" in endotoxic signaling.

  14. mRNA-Mediated Gene Supplementation of Toll-Like Receptors as Treatment Strategy for Asthma In Vivo

    PubMed Central

    Will, Clara; Carevic, Melanie; Rottenberger, Jennifer; Nürnberg, Bernd; Hartl, Dominik; Handgretinger, Rupert; Beer-Hammer, Sandra; Kormann, Michael S. D.

    2016-01-01

    Asthma is the most common chronic disease in childhood. Although several therapeutic options are currently available to control the symptoms, many drugs have significant side effects and asthma remains an incurable disease. Microbial exposure in early life reduces the risk of asthma and several studies have suggested protective effects of Toll-like receptor (TLR) activation. We showed previously that modified mRNA provides a safe and efficient therapeutic tool for in vivo gene supplementation. Since current asthma drugs do not take patient specific immune and TLR backgrounds into consideration, treatment with tailored mRNA could be an attractive approach to account for the patient’s individual asthma phenotype. Therefore, we investigated the effect of a preventative treatment with combinations of Tlr1, Tlr2 and Tlr6 mRNA in a House Dust Mite-induced mouse model of asthma. We used chemically modified mRNA which is–in contrast to conventional viral vectors–non-integrating and highly efficient in gene transfer. In our study, we found that treatment with either Tlr1/2 mRNA or Tlr2/6 mRNA, but not Tlr2 mRNA alone, resulted in better lung function as well as reduced airway inflammation in vivo. The present results point to a potentially protective effect of TLR heterodimers in asthma pathogenesis. PMID:27101288

  15. Soyasaponin Ab ameliorates colitis by inhibiting the binding of lipopolysaccharide (LPS) to Toll-like receptor (TLR)4 on macrophages.

    PubMed

    Lee, In-Ah; Park, Young-Jun; Joh, Eun-Ha; Kim, Dong-Hyun

    2011-12-28

    Many clinical studies have shown that daily intake of soybean [ Glycine max (L.) Merr., Fabacease] or its foods may reduce the risk of osteoporosis, heart attack, hyperlipidemia, coronary heart disease, cardiovascular and chronic renal diseases, and cancers, including prostate, colon, and breast cancers. Of the soy constituents, soyasaponins exhibit anti-aging, antioxidant, apoptotic, and anti-inflammatory effects. However, the anti-inflammatory effect of soyasaponin Ab has not been thoroughly studied. Therefore, we investigated its anti-inflammatory effects in 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitic mice and lipopolysaccharide (LPS)-stimulated peritoneal macrophages. Soyasaponin Ab inhibited colon shortening, myeloperoxidase activity, the expression of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS), and activation of the transcription factor nuclear factor-κB (NF-κB). Soyasaponin Ab (1, 2, 5, and 10 μM) inhibited the production of NO (IC(50) = 1.6 ± 0.1 μM) and prostaglandin E(2) (IC(50) = 2.0 ± 0.1 ng/mL), the expression of tumor necrosis factor (TNF)-α (IC(50) = 1.3 ± 0.1 ng/mL), interleukin (IL)-1β (IC(50) = 1.5 ± 0.1 pg/mL), and toll-like receptor (TLR)4, and the phosphorylation of interleukin-1 receptor-associated kinase (IRAK)-1 in LPS-stimulated peritoneal macrophages. Soyasaponin Ab weakly inhibited the phosphorylation of ERK, JNK, and p38. Soyasaponin Ab significantly reduced the binding of Alexa-Fluor-594-conjugated LPS to peritoneal macrophages. Soyasaponin Ab did not affect TLR4 expression or LPS-induced NF-κB activation in TLR4 siRNA-treated peritoneal macrophages (knockdown efficiency of TLR4 > 94%). On the basis of these findings, soyasaponin Ab may ameliorate colitis by inhibiting the binding of LPS to TLR4 on macrophages.

  16. TLR4 Antagonist Attenuates Atherogenesis in LDL Receptor-Deficient Mice with Diet-Induced Type 2 Diabetes

    PubMed Central

    Lu, Zhongyang; Zhang, Xiaoming; Li, Yanchun; Lopes-Virella, Maria F.; Huang, Yan

    2015-01-01

    Although a large number of studies have well documented a key role of toll-like receptor (TLR)4 in atherosclerosis, it remains undetermined if TLR4 antagonist attenuates atherogenesis in mouse model for type 2 diabetes. In this study, we induced type 2 diabetes in low-density lipoprotein receptor-deficient (LDLR−/−) mice by high-fat diet (HFD). At 8 weeks old, 20 mice were fed HFD and 20 mice fed regular chow (RC) for 24 weeks. In the last 10 weeks, half HFD-fed mice and half RC-fed mice were treated with Rhodobacter sphaeroides lipopolysaccharide (Rs-LPS), an established TLR4 antagonist. After the treatment, atherosclerotic lesions in aortas were analyzed. Results showed that the HFD significantly increased bodyweight, glucose, lipids including total cholesterol, triglycerides and free fatty acids, and insulin resistance, indicating that the HFD induced type 2 diabetes in LDLR−/− mice. Results also showed that Rs-LPS had no effect on HFD-increased metabolic parameters in both nondiabetic and diabetic mice. Lipid staining of aortas and histological analysis of cross-sections of aortic roots showed that diabetes increased atherosclerotic lesions, but Rs-LPS attenuated atherogenesis in diabetic mice. Furthermore, immunohistochemical studies showed that Rs-LPS reduced infiltration of monocytes/macrophages and expression of interleukin (IL)-6 and matrix metalloproteinase-9 in atherosclerotic lesions of diabetic mice. Finally, the antagonistic effect of Rs-LPS on TLR4 was demonstrated by our in vitro studies showing that Rs-LPS inhibited IL-6 secretion from macrophages and endothelial cells stimulated by LPS or LPS plus saturated fatty acid palmitate. Taken together, our study demonstrated that TLR4 antagonist was capable of attenuating vascular inflammation and atherogenesis in mice with HFD-induced type 2 diabetes. PMID:26162692

  17. Peptidoglycan induces interleukin-6 expression through the TLR2 receptor, JNK, c-Jun, and AP-1 pathways in microglia.

    PubMed

    Lin, Hsiao-Yun; Tang, Chih-Hsin; Chen, Jia-Hong; Chuang, Jing-Yuan; Huang, Ssu-Ming; Tan, Tzu-Wei; Lai, Chih-Ho; Lu, Dah-Yuu

    2011-06-01

    We recently reported that peptidoglycan (PGN), a cell wall component of the Gram-positive bacterium, induces NF-κB activation and microglia activation. However, PGN-regulated AP-1 activation and cytokine expression in microglia remains unclear. This study investigated how PGN influences the signaling pathway involved in IL-6 production in microglia. IL-6 mRNA and protein level up-regulation were increased by PGN in a concentration- and time-dependent manner. In addition, PGN increased toll-like receptor-2 (TLR2) expression, but not TLR4 receptor up-regulation. Administration of TLR2 siRNA or TLR2 neutralized antibody effectively inhibited PGN-induced IL-6 expression. In contrast, PGN-induced IL-6 mRNA and protein up-regulation were attenuated by the SAPK/JNK (c-Jun N-terminal kinases) inhibitor SP600125. Treatment of microglia with PGN increased levels of JNK phosphorylation and c-Jun phosphorylation, and up-regulated of JNK kinase activity. Treatment of microglia with AP-1 inhibitors (Tanshinone IIA and curcumin) effectively reduced PGN-induced IL-6 expression. PGN also significantly increased c-Fos and phospho-c-Jun translocation to nucleus. In line with this, PGN also increased AP-1-DNA complexes formation, as determined by the electrophoretic mobility shift assay. Furthermore, PGN also increased IL-6 transcription activity determined by transfection with IL-6 promoter construct plasmid. Co-transfection with dominant negative mutant of JNK (DN-JNK), or treatment with SP600125, curcumin, or Tanshinone IIA effectively antagonized PGN-increased IL-6 transcription activity. Our data demonstrate that PGN-induced IL-6 expression is mediated by AP-1 activation through the TLR2 and JNK/c-Jun pathways in microglia.

  18. A critical role of toll-like receptor 4 (TLR4) and its' in vivo ligands in basal radio-resistance

    PubMed Central

    Liu, C; Zhang, C; Mitchel, R EJ; Cui, J; Lin, J; Yang, Y; Liu, X; Cai, J

    2013-01-01

    Toll-like receptor-4 (TLR4) plays a critical role in innate and acquired immunity, but its role in radio-resistance is unknown. We used TLR4 knockout (KO,−/−) mice and gut commensal depletion methods, to test the influence of TLR4 and its' in vivo agonist on basal radio-resistance. We found that mice deficient in TLR4 were more susceptible to IR-induced mortality and morbidity. Mortality of TLR4-deficient mice after IR was associated with a severe and persistent bone marrow cell loss. Injection of lipopolysaccharide into normal mice, which is known to activate TLR4 in vivo, induced radio-resistance. Moreover, TLR4 in vivo ligands are required for basal radio-resistance. We found that exposure to radiation leads to significant endotoxemia that also confers endogenous protection from irradiation. The circulating endotoxins appear to originate from the gut, as sterilization of the gut with antibiotics lead to increased mortality from radiation. Further data indicated that Myd88, but not TRIF, may be the critical adaptor in TLR4-induced radio-resistance. Taken together, these data strongly suggest that TLR4 plays a critical role in basal radio-resistance. Our data suggest, it is important not to give antibiotics that may sterilize the gut before the whole body irradiation. Further, these data also suggest that management of gut flora through antibiotic or possibly probiotic therapy may alter the innate response to the total body irradiation. PMID:23722538

  19. Identification, characterization and genetic mapping of TLR1 loci in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Palti, Yniv; Rodriguez, M Fernanda; Gahr, Scott A; Purcell, Maureen K; Rexroad, Caird E; Wiens, Gregory D

    2010-01-01

    Induction of innate immune pathways is critical for early anti-microbial defense but there is limited understanding of how teleosts recognize microbial molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 1 and 2 form a heterodimer involved in recognizing peptidoglycans and lipoproteins of microbial origin. Herein, we identify and describe the rainbow trout (Oncorhynchus mykiss) TLR1 gene ortholog and its mRNA expression. Two TLR1 loci were identified from a rainbow trout bacterial artificial chromosome (BAC) library using DNA sequencing and genetic linkage analyses. Full length cDNA clone and direct sequencing of four BACs revealed an intact omTLR1 open reading frame (ORF) located on chromosome 14 and a second locus on chromosome 25 that contains a TLR1 pseudogene. The duplicated trout loci exhibit conserved synteny with other fish genomes that extends beyond the TLR1 gene sequences. The omTLR1 gene includes a single large coding exon similar to all other described TLR1 genes, but unlike other teleosts it also has a 5' UTR exon and intron preceding the large coding exon. The omTLR1 ORF is predicted to encode an 808 amino-acid protein with 69% similarity to the Fugu TLR1 and a conserved pattern of predicted leucine-rich repeats (LRR). Phylogenetic analysis grouped omTLR1 with other fish TLR1 genes on a separate branch from the avian TLR1 and mammalian TLR1, 6 and 10. omTLR1 expression levels in rainbow trout anterior kidney leukocytes were not affected by the human TLR2/6 and TLR2/1 agonists diacylated lipoprotein (Pam(2)CSK(4)) and triacylated lipoprotein (Pam(3)CSK(4)). However, due to the lack of TLR6 and 10 genes in teleost genomes and up-regulation of TLR1 mRNA in response to LPS and bacterial infection in other fish species we hypothesize an important role for omTLR1 in anti-microbial immunity. Therefore, the identification of a TLR2 ortholog in rainbow trout and the development of assays to measure ligand binding and downstream

  20. Identification, characterization and genetic mapping of TLR1 loci in rainbow trout (Oncorhynchus mykiss)

    USGS Publications Warehouse

    Palti, Y.; Rodriguez, M.F.; Gahr, S.A.; Purcell, M.K.; Rexroad, C. E.; Wiens, G.D.

    2010-01-01

    Induction of innate immune pathways is critical for early anti-microbial defense but there is limited understanding of how teleosts recognize microbial molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 1 and 2 form a heterodimer involved in recognizing peptidoglycans and lipoproteins of microbial origin. Herein, we identify and describe the rainbow trout (Oncorhynchus mykiss) TLR1 gene ortholog and its mRNA expression. Two TLR1 loci were identified from a rainbow trout bacterial artificial chromosome (BAC) library using DNA sequencing and genetic linkage analyses. Full length cDNA clone and direct sequencing of four BACs revealed an intact omTLR1 open reading frame (ORF) located on chromosome 14 and a second locus on chromosome 25 that contains a TLR1 pseudogene. The duplicated trout loci exhibit conserved synteny with other fish genomes that extends beyond the TLR1 gene sequences. The omTLR1 gene includes a single large coding exon similar to all other described TLR1 genes, but unlike other teleosts it also has a 5??? UTR exon and intron preceding the large coding exon. The omTLR1 ORF is predicted to encode an 808 amino-acid protein with 69% similarity to the Fugu TLR1 and a conserved pattern of predicted leucine-rich repeats (LRR). Phylogenetic analysis grouped omTLR1 with other fish TLR1 genes on a separate branch from the avian TLR1 and mammalian TLR1, 6 and 10. omTLR1 expression levels in rainbow trout anterior kidney leukocytes were not affected by the human TLR2/6 and TLR2/1 agonists diacylated lipoprotein (Pam2CSK4) and triacylated lipoprotein (Pam3CSK4). However, due to the lack of TLR6 and 10 genes in teleost genomes and up-regulation of TLR1 mRNA in response to LPS and bacterial infection in other fish species we hypothesize an important role for omTLR1 in anti-microbial immunity. Therefore, the identification of a TLR2 ortholog in rainbow trout and the development of assays to measure ligand binding and downstream signaling

  1. Identification, characterization and genetic mapping of TLR1 loci in rainbow trout (Oncorhynchus mykiss)

    USGS Publications Warehouse

    Palti, Yniv; Rodriguez, M. Fernanda; Gahr, Scott A.; Purcell, Maureen K.; Rexroad, Caird E.; Wiens, Gregory D.

    2010-01-01

    Induction of innate immune pathways is critical for early anti-microbial defense but there is limited understanding of how teleosts recognize microbial molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 1 and 2 form a heterodimer involved in recognizing peptidoglycans and lipoproteins of microbial origin. Herein, we identify and describe the rainbow trout (Oncorhynchus mykiss) TLR1 gene ortholog and its mRNA expression. Two TLR1 loci were identified from a rainbow trout bacterial artificial chromosome (BAC) library using DNA sequencing and genetic linkage analyses. Full length cDNA clone and direct sequencing of four BACs revealed an intact omTLR1 open reading frame (ORF) located on chromosome 14 and a second locus on chromosome 25 that contains a TLR1 pseudogene. The duplicated trout loci exhibit conserved synteny with other fish genomes that extends beyond the TLR1 gene sequences. The omTLR1 gene includes a single large coding exon similar to all other described TLR1 genes, but unlike other teleosts it also has a 5' UTR exon and intron preceding the large coding exon. The omTLR1 ORF is predicted to encode an 808 amino-acid protein with 69% similarity to the Fugu TLR1 and a conserved pattern of predicted leucine-rich repeats (LRR). Phylogenetic analysis grouped omTLR1 with other fish TLR1 genes on a separate branch from the avian TLR1 and mammalian TLR1, 6 and 10. omTLR1 expression levels in rainbow trout anterior kidney leukocytes were not affected by the human TLR2/6 and TLR2/1 agonists diacylated lipoprotein (Pam2CSK4) and triacylated lipoprotein (Pam3CSK4). However, due to the lack of TLR6 and 10 genes in teleost genomes and up-regulation of TLR1 mRNA in response to LPS and bacterial infection in other fish species we hypothesize an important role for omTLR1 in anti-microbial immunity. Therefore, the identification of a TLR2 ortholog in rainbow trout and the development of assays to measure ligand binding and downstream signaling are

  2. Toll-like receptor 4 (TLR4) is correlated with delayed cerebral ischemia (DCI) and poor prognosis in aneurysmal subarachnoid hemorrhage.

    PubMed

    Ma, Chunxiao; Zhou, Wei; Yan, Zhaoyue; Qu, Mingqi; Bu, Xingyao

    2015-12-15

    Toll-like receptor 4 (TLR4) is one of key players in regulation of inflammation. Animal experiments have suggested an important role of TLR4 in the pathophysiology of subarachnoid hemorrhage (SAH). In present study, TLR4 is investigated in clinical SAH patients to explore its clinical significance. 30 patients with aneurysmal subarachnoid hemorrhage (aSAH) and 20 healthy control patients (HC) were enrolled in this prospective study. Blood samples were collected on days 1, 3 and 7 after admission. TLR4 expression level on cell surface of peripheral blood mononuclear cells (PBMCs) was determined by flow cytometry and presented as mean fluorescence intensity (MFI). Patients were clinically assessed every day after admission to monitor the occurrence of delayed cerebral ischemia (DCI). Participants were followed up until completion of 3 months after SAH. Functional outcome was defined by modified Rankin score (mRs). Results show that SAH patients presented a significantly higher TLR4 levels on days 1 and 3 post SAH compared to HC; TLR4 levels in SAH patients on day 1 was highest compared with that on days 3 and 7 and in HC. TLR4 of SAH patients on day 7 declined to the level showing no significant difference with that of HC. In patients with Hunt-Hess grades I-III lower TLR4 levels were observed. Patients with DCI showed significantly higher TLR4 levels than those without DCI. High TLR4 levels were statistically significantly associated with poor functional outcome after 3 months. Logistic regression analysis showed that TLR4 level on day 1 was independent predictor for DCI and 3-month poor neurological outcome of aneurysmal SAH patients. In summary, admission TLR4 level on PBMCs (day 1) is an independent risk factor to predict the occurrence of DCI and 3-month poor neurological outcome in aneurysmal SAH patients.

  3. Synergistic Stimulation with Different TLR7 Ligands Modulates Gene Expression Patterns in the Human Plasmacytoid Dendritic Cell Line CAL-1

    PubMed Central

    Hilbert, Tobias; Steinhagen, Folkert; Weisheit, Christina; Baumgarten, Georg; Hoeft, Andreas; Klaschik, Sven

    2015-01-01

    Objective. TLR7 ligation in plasmacytoid dendritic cells is promising for the treatment of cancer, allergy, and infectious diseases; however, high doses of ligands are required. We hypothesized that the combination of structurally different TLR7 ligands exponentiates the resulting immune response. Methods. CAL-1 (human pDC line) cells were incubated with the TLR7-specific adenine analog CL264 and single-stranded 9.2s RNA. Protein secretion was measured by ELISA. Microarray technique was used to detect modified gene expression patterns upon synergistic stimulation, revealing underlying functional groups and networks. Cell surface binding properties were studied using FACS analysis. Results. CL264 in combination with 9.2s RNA significantly enhanced cytokine and interferon secretion to supra-additive levels. This effect was due to a stronger stimulation of already regulated genes (by monostimulation) as well as to recruitment of thus far unregulated genes. Top scoring canonical pathways referred to immune-related processes. Network analysis revealed IL-1β, IL-6, TNF, and IFN-β as major regulatory nodes, while several minor regulatory nodes were also identified. Binding of CL264 to the cell surface was enhanced by 9.2s RNA. Conclusion. Structurally different TLR7 ligands act synergistically on gene expression patterns and on the resulting inflammatory response. These data could impact future strategies optimizing TLR7-targeted drug design. PMID:26770023

  4. Taste Receptor Genes

    PubMed Central

    Bachmanov, Alexander A.; Beauchamp, Gary K.

    2009-01-01

    In the past several years, tremendous progress has been achieved with the discovery and characterization of vertebrate taste receptors from the T1R and T2R families, which are involved in recognition of bitter, sweet, and umami taste stimuli. Individual differences in taste, at least in some cases, can be attributed to allelic variants of the T1R and T2R genes. Progress with understanding how T1R and T2R receptors interact with taste stimuli and with identifying their patterns of expression in taste cells sheds light on coding of taste information by the nervous system. Candidate mechanisms for detection of salts, acids, fat, complex carbohydrates, and water have also been proposed, but further studies are needed to prove their identity. PMID:17444812

  5. CHK1 and RAD51 activation after DNA damage is regulated via urokinase receptor/TLR4 signaling

    PubMed Central

    Narayanaswamy, Pavan B; Tkachuk, Sergey; Haller, Hermann; Dumler, Inna; Kiyan, Yulia

    2016-01-01

    Mechanisms of DNA damage and repair signaling are not completely understood that hinder the efficiency of cancer therapy. Urokinase-type plasminogen activator receptor (PLAUR) is highly expressed in most solid cancers and serves as a marker of poor prognosis. We show that PLAUR actively promotes DNA repair in cancer cells. On the contrary, downregulation of PLAUR expression results in delayed DNA repair. We found PLAUR to be essential for activation of Checkpoint kinase 1 (CHK1); maintenance of cell cycle arrest after DNA damage in a TP53-dependent manner; expression, nuclear import and recruitment to DNA-damage foci of RAD51 recombinase, the principal protein involved in the homologous recombination repair pathway. Underlying mechanism implies auto-/paracrine signaling of PLAUR/TLR4 receptor complex leading to activation of CHK1 and DNA repair. The signaling is induced by a danger molecule released by DNA-damaged cells and mediates, at least partially, activation of DNA-damage response. This study describes a new mechanism of DNA repair activation initiated by auto-/paracrine signaling of membrane receptors PLAUR/TLR4. It adds to the understanding of role of PLAUR in cancer and provides a rationale for therapeutic targeting of PLAUR/TLR4 interaction in TP53-positive cancers. PMID:27685627

  6. Doxorubicin-Induced Systemic Inflammation Is Driven by Upregulation of Toll-Like Receptor TLR4 and Endotoxin Leakage.

    PubMed

    Wang, Lintao; Chen, Qian; Qi, Haixia; Wang, Chunming; Wang, Cheng; Zhang, Junfeng; Dong, Lei

    2016-11-15

    Doxorubicin is one of the most effective chemotherapeutic agents used for cancer treatment, but it causes systemic inflammation and serious multiorgan side effects in many patients. In this study, we report that upregulation of the proinflammatory Toll-like receptor TLR4 in macrophages by doxorubicin is an important step in generating its toxic side effects. In patient serum, doxorubicin treatment resulted in leakage of endotoxin and inflammatory cytokines into circulation. In mice, doxorubicin damaged the intestinal epithelium, which also resulted in leakage of endotoxin from the gut flora into circulation. Concurrently, doxorubicin increased TLR4 expression in macrophages both in vitro and in vivo, which further enhanced the sensitivity of these cells to endotoxin. Either depletion of gut microorganisms or blockage of TLR4 signaling effectively decreased doxorubicin-induced toxicity. Taken together, our findings suggest that doxorubicin-triggered leakage of endotoxin into the circulation, in tandem with enhanced TLR4 signaling, is a candidate mechanism underlying doxorubicin-induced systemic inflammation. Our study provides new insights for devising relevant strategies to minimize the adverse effects of chemotherapeutic agents such as doxorubicin, which may extend its clinical uses to eradicate cancer cells. Cancer Res; 76(22); 6631-42. ©2016 AACR. ©2016 American Association for Cancer Research.

  7. Differential expression of toll-like receptor genes: sepsis compared with sterile inflammation 1 day before sepsis diagnosis.

    PubMed

    Lissauer, Matthew E; Johnson, Steven B; Bochicchio, Grant V; Feild, Carinda J; Cross, Alan S; Hasday, Jeffrey D; Whiteford, Craig C; Nussbaumer, William A; Towns, Michael; Scalea, Thomas M

    2009-03-01

    Toll-like receptors (TLRs) are critical components of innate immunity. This study was designed to evaluate differential expression of genes for TLR and associated signal transduction molecules in critically ill patients developing sepsis compared with those with sterile inflammation. Uninfected critically ill patients with systemic inflammatory response syndrome were prospectively followed daily for development of sepsis. They were divided into two groups and compared in a case-control manner: (a) preseptic patients (n = 45) who subsequently developed sepsis, and (b) uninfected systemic inflammatory response syndrome patients (n = 45) who remained uninfected. Whole blood RNA was collected (PAXGene tube) at study entry and 1, 2, and 3 days before clinical sepsis diagnosis (or time-matched uninfected control) and analyzed via Affymetrix Hg_U133 Plus 2.0 microarrays. Genes were considered differentially expressed if they met univariate significance controlled for multiple comparisons at P < 0.005. Differentially expressed probes were uploaded into the Database for Annotation, Visualization and Integrated Discovery. The TLR pathway (Kyoto Encyclopedia of Genes and Genomes-KEGG) significance was determined via Expression Analysis Systematic Explorer (EASE) scoring. A total of 2,974 Affymetrix probes representing 2,190 unique genes were differentially expressed 1 day before sepsis diagnosis. Thirty-six probes representing 25 genes were annotated to the TLR pathway (KEGG) via the Database for Annotation, Visualization and Integrated Discovery with an EASE score at P < 0.0004. Notable TLR genes demonstrating increased expression include TLR-4 (median, 1.43-fold change), TLR-5 (2.08-fold change), and MAPK14 (1.90-fold change). An additional 11 unique genes were manually annotated into the TLR pathway based on known relevance such as TLR-8 (1.54-fold change). The total 36 genes contained 28 showing increased expression and 8 showing decreased expression. Differential gene

  8. Polymorphisms in the CD14 and TLR4 genes independently predict CD4+ T-cell recovery in HIV-infected individuals on antiretroviral therapy.

    PubMed

    Yong, Yean K; Shankar, Esaki M; Solomon, Ajantha; Spelman, Tim; Fairley, Christopher K; Elliott, Julian H; Hoy, Jennifer; Cameron, Paul U; Kamarulzaman, Adeeba; Lewin, Sharon R

    2016-09-10

    Chronic HIV infection leads to marked depletion of CD4 T cells in the gastrointestinal tract and increased microbial translocation measured by an increase in circulating lipopolysaccharide (LPS) levels. Here, we hypothesized that single-nucleotide polymorphisms (SNPs) in genes encoding the Toll-like receptor 4 (TLR4) and CD14, the principal receptors for LPS, were associated with CD4 T-cell recovery postantiretroviral therapy (ART). Prospective study of predominantly white HIV-infected participants receiving suppressive ART for at least 12 months. We analysed the CD14 SNPs C-260T and the TLR4 SNPs A+896G, C+1196T. We also determined the levels of LPS and soluble CD14 in plasma samples collected pre-ART and post-ART initiation. CD4 T-cell recovery was assessed by linear mixed models. Following ART, individuals with a TT genotype compared with a CT or CC genotype for CD14 C-260T SNP showed higher levels of soluble CD14 (P = 0.008 and 0.003, respectively). The CC genotype for the CD14 C-260T SNP, compared with CT or TT, and the TLR4 SNP (AC/GT), compared with the homozygous genotype (AA/CC), were both independently associated with enhanced long-term CD4 T-cell recovery (>3 months; P < 0.001). Polymorphisms in CD14 and TLR4 are independently associated with long-term CD4 T-cell recovery in HIV-infected individuals post-ART.

  9. Polymorphisms in the CD14 and TLR4 genes independently predict CD4+ T-cell recovery in HIV-infected individuals on antiretroviral therapy

    PubMed Central

    YONG, Yean K; SHANKAR, Esaki M; SOLOMON, Ajantha; SPELMAN, Tim; FAIRLEY, Christopher K; ELLIOTT, Julian; HOY, Jennifer; CAMERON, Paul; KAMARULZAMAN, Adeeba; LEWIN, Sharon R

    2016-01-01

    Background Chronic HIV infection leads to marked depletion of CD4+ T cells in the gastrointestinal (GI) tract and increased microbial translocation measured by an increase in circulating lipopolysaccharide (LPS) levels. Here, we hypothesised that single-nucleotide polymorphisms (SNPs) in genes encoding the Toll-like receptor 4 (TLR4) and CD14, the principal receptors for LPS, were associated with CD4+ T-cell recovery post-antiretroviral therapy (ART). Methods Prospective study of predominantly Caucasian HIV-infected subjects receiving suppressive ART for at least 12 months. We analysed the CD14 SNPs C-260T and the TLR4 SNPs A+896G, C+1196T. We also determined the levels of LPS and soluble CD14 (sCD14) in plasma samples collected pre- and post-ART initiation. CD4+ T-cell recovery was assessed by linear mixed models. Results Following ART, individuals with a TT genotype compared to a CT or CC genotype for CD14 C-260T SNP showed higher levels of sCD14 (p=0.008 and 0.003 respectively). The CC genotype for the CD14 C-260T SNP, compared to CT or TT and the TLR4 SNP (AC/GT) compared to the homozygous genotype (AA/CC) were both independently associated with enhanced long-term CD4+ T-cell recovery (>3 months; p<0.001). Conclusions Polymorphisms in CD14 and TLR4 are independently associated with long-term CD4+ T-cell recovery in HIV-infected individuals post-ART. PMID:27281059

  10. Activation of Human Toll-like Receptor 4 (TLR4)·Myeloid Differentiation Factor 2 (MD-2) by Hypoacylated Lipopolysaccharide from a Clinical Isolate of Burkholderia cenocepacia.

    PubMed

    Di Lorenzo, Flaviana; Kubik, Łukasz; Oblak, Alja; Lorè, Nicola Ivan; Cigana, Cristina; Lanzetta, Rosa; Parrilli, Michelangelo; Hamad, Mohamad A; De Soyza, Anthony; Silipo, Alba; Jerala, Roman; Bragonzi, Alessandra; Valvano, Miguel A; Martín-Santamaría, Sonsoles; Molinaro, Antonio

    2015-08-28

    Lung infection by Burkholderia species, in particular Burkholderia cenocepacia, accelerates tissue damage and increases post-lung transplant mortality in cystic fibrosis patients. Host-microbe interplay largely depends on interactions between pathogen-specific molecules and innate immune receptors such as Toll-like receptor 4 (TLR4), which recognizes the lipid A moiety of the bacterial lipopolysaccharide (LPS). The human TLR4·myeloid differentiation factor 2 (MD-2) LPS receptor complex is strongly activated by hexa-acylated lipid A and poorly activated by underacylated lipid A. Here, we report that B. cenocepacia LPS strongly activates human TLR4·MD-2 despite its lipid A having only five acyl chains. Furthermore, we show that aminoarabinose residues in lipid A contribute to TLR4-lipid A interactions, and experiments in a mouse model of LPS-induced endotoxic shock confirmed the proinflammatory potential of B. cenocepacia penta-acylated lipid A. Molecular modeling combined with mutagenesis of TLR4-MD-2 interactive surfaces suggests that longer acyl chains and the aminoarabinose residues in the B. cenocepacia lipid A allow exposure of the fifth acyl chain on the surface of MD-2 enabling interactions with TLR4 and its dimerization. Our results provide a molecular model for activation of the human TLR4·MD-2 complex by penta-acylated lipid A explaining the ability of hypoacylated B. cenocepacia LPS to promote proinflammatory responses associated with the severe pathogenicity of this opportunistic bacterium.

  11. Activation of Human Toll-like Receptor 4 (TLR4)·Myeloid Differentiation Factor 2 (MD-2) by Hypoacylated Lipopolysaccharide from a Clinical Isolate of Burkholderia cenocepacia*

    PubMed Central

    Di Lorenzo, Flaviana; Kubik, Łukasz; Oblak, Alja; Lorè, Nicola Ivan; Cigana, Cristina; Lanzetta, Rosa; Parrilli, Michelangelo; Hamad, Mohamad A.; De Soyza, Anthony; Silipo, Alba; Jerala, Roman; Bragonzi, Alessandra; Valvano, Miguel A.; Martín-Santamaría, Sonsoles; Molinaro, Antonio

    2015-01-01

    Lung infection by Burkholderia species, in particular Burkholderia cenocepacia, accelerates tissue damage and increases post-lung transplant mortality in cystic fibrosis patients. Host-microbe interplay largely depends on interactions between pathogen-specific molecules and innate immune receptors such as Toll-like receptor 4 (TLR4), which recognizes the lipid A moiety of the bacterial lipopolysaccharide (LPS). The human TLR4·myeloid differentiation factor 2 (MD-2) LPS receptor complex is strongly activated by hexa-acylated lipid A and poorly activated by underacylated lipid A. Here, we report that B. cenocepacia LPS strongly activates human TLR4·MD-2 despite its lipid A having only five acyl chains. Furthermore, we show that aminoarabinose residues in lipid A contribute to TLR4-lipid A interactions, and experiments in a mouse model of LPS-induced endotoxic shock confirmed the proinflammatory potential of B. cenocepacia penta-acylated lipid A. Molecular modeling combined with mutagenesis of TLR4-MD-2 interactive surfaces suggests that longer acyl chains and the aminoarabinose residues in the B. cenocepacia lipid A allow exposure of the fifth acyl chain on the surface of MD-2 enabling interactions with TLR4 and its dimerization. Our results provide a molecular model for activation of the human TLR4·MD-2 complex by penta-acylated lipid A explaining the ability of hypoacylated B. cenocepacia LPS to promote proinflammatory responses associated with the severe pathogenicity of this opportunistic bacterium. PMID:26160169

  12. [TOLL-LIKE RECEPTORS IN COSMONAUT'S PERIPHERAL BLOOD CELLS AFTER LONG-DURATION MISSIONS TO THE INTERNATIONAL SPACE STATION].

    PubMed

    Berendeeva, T A; Ponomarev, S A; Antropova, E N; Rykova, M P

    2015-01-01

    Studies of Toll-like receptors (TLR) in 20 cosmonauts-members of long-duration (124-199-day) missions to the International space station evidenced changes in relative and absolute counts of peripheral blood monocytes with TLR2, TLR4 and TLR6 on the surface, expression of TLR2 and TLR6 genes, and genes of molecules involved in the TLR signaling pathway and TLR-related NF-KB-, JNK/p38- and IRF pathways on the day of return to Earth. The observed changes displayed individual variability.

  13. Toll-Like Receptor 4 (TLR4) and Triggering Receptor Expressed on Myeloid Cells-2 (TREM-2) Activation Balance Astrocyte Polarization into a Proinflammatory Phenotype.

    PubMed

    Rosciszewski, Gerardo; Cadena, Vanesa; Murta, Veronica; Lukin, Jeronimo; Villarreal, Alejandro; Roger, Thierry; Ramos, Alberto Javier

    2017-05-25

    Astrocytes react to brain injury with a generic response known as reactive gliosis, which involves activation of multiple intracellular pathways including several that may be beneficial for neuronal survival. However, by unknown mechanisms, reactive astrocytes can polarize into a proinflammatory phenotype that induces neurodegeneration. In order to study reactive gliosis and astroglial polarization into a proinflammatory phenotype, we used cortical devascularization-induced brain ischemia in Wistar rats and primary astroglial cell cultures exposed to oxygen-glucose deprivation (OGD). We analyzed the profile of TLR4 expression and the consequences of its activation by gain- and loss-of-function studies, and the effects produced by the activation of triggering receptor expressed on myeloid cells-2 (TREM-2), a negative regulator of TLR4 signaling. Both OGD exposure on primary astroglial cell cultures and cortical devascularization brain ischemia in rats induced TLR4 expression in astrocytes. In vivo, astroglial TLR4 expression was specifically observed in the ischemic penumbra surrounding necrotic core. Functional studies showed that OGD increased the astroglial response to the TLR4 agonist lipopolysaccharide (LPS), and conversely, TLR4 knockout primary astrocytes had impaired nuclear factor kappa-B (NF-κB) activation when exposed to LPS. In gain-of-function studies, plasmid-mediated TLR4 over-expression exacerbated astroglial response to LPS as shown by sustained NF-κB activation and increased expression of proinflammatory cytokines IL-1β and TNFα. TREM-2 expression, although present in naïve primary astrocytes, was induced by OGD, LPS, or high-mobility group box 1 protein (HMGB-1) exposure. TREM-2 activation by antibody cross-linking or the overexpression of TREM-2 intracellular adaptor, DAP12, partially suppressed LPS-induced NF-κB activation in purified astrocytic cultures. In vivo, TREM-2 expression was observed in macrophages and astrocytes located in the

  14. Inhibition of LPS binding to MD-2 co-receptor for suppressing TLR4-mediated expression of inflammatory cytokine by 1-dehydro-10-gingerdione from dietary ginger

    SciTech Connect

    Park, Sun Hong; Kyeong, Min Sik; Hwang, Yuri; Ryu, Shi Yong; Han, Sang-Bae; Kim, Youngsoo

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer 1-Dehydro-10-gingerdione (1D10G) from ginger inhibits LPS binding to MD-2. Black-Right-Pointing-Pointer 1D10G suppresses MyD88- or TRIF-dependent signaling in LPS-activated macrophages. Black-Right-Pointing-Pointer 1D10G down-regulates the expression of NF-{kappa}B-, AP1- or IRF3-target genes. Black-Right-Pointing-Pointer MD-2 is a molecular target in the anti-inflammatory action of 1D10G. -- Abstract: Myeloid differentiation protein 2 (MD-2) is a co-receptor of toll-like receptor 4 (TLR4) for innate immunity. Here, we delineated a new mechanism of 1-dehydro-10-gingerdione (1D10G), one of pungent isolates from ginger (Zingiber officinale), in the suppression of lipopolysaccharide (LPS)-induced gene expression of inflammatory cytokines. 1D10G inhibited LPS binding to MD-2 with higher affinity than gingerol and shogaol from dietary ginger. Moreover, 1D10G down-regulated TLR4-mediated expression of nuclear factor-{kappa}B (NF-{kappa}B) or activating protein 1 (AP1)-target genes such as tumor necrosis factor {alpha} (TNF-{alpha}) and interleukin-1{beta}, as well as those of interferon (IFN) regulatory factor 3 (IRF3)-target IFN-{beta} gene and IFN-{gamma} inducible protein 10 (IP-10) in LPS-activated macrophages. Taken together, MD-2 is a molecular target in the anti-inflammatory action of 1D10G.

  15. TLR15 is unique to avian and reptilian lineages and recognizes a yeast-derived agonist.

    PubMed

    Boyd, Amy C; Peroval, Marylene Y; Hammond, John A; Prickett, Michael D; Young, John R; Smith, Adrian L

    2012-11-15

    The TLRs represent a family of pattern recognition receptors critical in the induction of vertebrate immune responses. Between 10 and 13 different TLR genes can be identified in each vertebrate species, with many represented as orthologous genes in different species. The agonist specificity of orthologous TLR is also highly conserved. In contrast, TLR15 can only be identified in avian and reptilian genomes, suggesting that this receptor arose ~320 million years ago after divergence of the bird/reptile and mammalian lineages. Transfection of a constitutively active form of chicken TLR15 led to NF-κB activation in HEK293 cells and induced cytokine mRNA upregulation in chicken cell lines. Full-length TLR15 mediated NF-κB induction in response to lysates from yeast, but not those derived from viral or bacterial pathogens, or a panel of well-characterized TLR agonists. TLR15 responses were induced by whole-cell lysates derived from Candida albicans, Saccharomyces cerevisiae, and Schizosaccharomyces pombe, but not zymosan preparations from S. cerevisiae. The ability of yeast lysate to activate TLR15-dependent NF-κB pathways (in transfection assays) or stimulate IL-1β mRNA upregulation in chicken macrophages was abrogated by heat inactivation or pre-exposure of the lysate to PMSF. Identification of yeast as an agonist source for TLR15 provides a functional framework for consideration of this TLR within the context of pattern recognition receptor evolution and may impact on the development of novel adjuvants.

  16. Both intrinsic and extrinsic apoptotic pathways are involved in Toll-like receptor 4 (TLR4)-induced cell death in monocytic THP-1 cells.

    PubMed

    Liu, Bei; Sun, Ruili; Luo, Hongbo; Liu, Xueting; Jiang, Manli; Yuan, Chuang; Yang, Li; Hu, Jinyue

    2017-02-01

    Our previous study showed that TLR3 induces apoptosis via both death receptors and mitochondial in human endothelial cells. We report here that the activation of TLR4 induced dose- and time-dependent cell death in moncytic THP-1 cells. LPS treatment of THP-1 cells induced the activation of both caspase 8 and 9, suggesting the involvement of intrinsic and extrinsic apoptosis pathways. TNFα was induced by TLR4 activation at both mRNA and protein levels, but its neutralization did not down-regulated TLR4-induced cell death. TLR4 activation also induced the up-regulation of TRAIL and its receptors DR4 and DR5, and the neutralization of TRAIL ameliorated TLR4 induced apoptosis, suggesting the involvement of TRAIL and its receptors DR4 and DR5 in LPS-induced cell death. Meanwhile, LPS treatment down-regulated the expression of FLICE inhibitory protein (FLIP), a suppressor of death receptor-induced cell death. In addition, TLR4 activation down-regulated the anti-apoptotic protein bcl-2, and up-regulated the pro-apoptotic proteins Noxa and Puma, suggesting that mitochondrial apoptotic pathway was also involved in LPS-induced cell death. Furthermore, we found that TAP63α might confer to the activation of intrinsic and extrinsic apoptotic pathways. The treatment of THP-1 cells with LPS induced the translocation of TAP63α from cytoplasm to nucleus. Taken together, our study suggested that both death receptors and mitochondial were involved in TLR4-induced cell death, and TAP63α may be a target for the prevention of LPS-induced cell death.

  17. Effects of porcine MyD88 knockdown on the expression of TLR4 pathway-related genes and proinflammatory cytokines.

    PubMed

    Dai, Chaohui; Sun, Li; Yu, Lihuai; Zhu, Guoqiang; Wu, Shenglong; Bao, Wenbin

    2016-12-01

    As a critical adapter protein in Toll-like receptor (TLR)/Interleukin (IL)-1R signalling pathway, myeloid differentiation protein 88 (MyD88) plays an important role in immune responses and host defence against pathogens. The present study was designed to provide a foundation and an important reagent for the mechanistic study of MyD88 and its role TLR/IL-1R signalling pathways in porcine immunity. Lentivirus-mediated RNAi was used to generate a porcine PK15 cell line with a silenced MyD88 gene and quantitative real-time PCR (qPCR) and Western blotting were used to detect changes in the expression of critical genes in the Toll-like receptor 4 (TLR4) signalling pathway. ELISA was used to measure the levels of seven proinflammatory cytokines-interleukin-1β (IL-1β), tumour necrosis factor-α (TNF-α), IL-6, IL-8, IL-12, macrophage inflammatory protein (MIP)-1α and MIP-1β-in cell culture supernatants after MyD88 silencing. We successfully obtained a PK15 cell line with 61% MyD88 mRNA transcript down-regulated. In PK15 cells with MyD88 silencing, the transcript levels of TLR4 and IL-1β were significantly reduced, whereas there were no significant changes in the expression levels of cluster of differentiation antigen 14 (CD14), interferon-α (IFN-α) or TNF-α The ELISA results showed that the levels of most cytokines were not significantly changed apart from IL-8 without stimulation, which was significantly up-regulated. When cells were induced by lipopolysaccharide (LPS) (0.1 μg/ml) for 6 h, the global level of seven proinflammatory cytokines up-regulated and the level of IL-1β, TNF-α, IL-6, IL-8 and IL-12 of Blank and negative control (NC) group up-regulated more significantly than RNAi group (P<0.05), which revealed that the MyD88 silencing could reduce the TLR4 signal transduction which inhibited the release of proinflammatory cytokines and finally leaded to immunosuppression.

  18. Gene expression induced by Toll-like receptors in macrophages requires the transcription factor NFAT5.

    PubMed

    Buxadé, Maria; Lunazzi, Giulia; Minguillón, Jordi; Iborra, Salvador; Berga-Bolaños, Rosa; Del Val, Margarita; Aramburu, José; López-Rodríguez, Cristina

    2012-02-13

    Toll-like receptors (TLRs) engage networks of transcriptional regulators to induce genes essential for antimicrobial immunity. We report that NFAT5, previously characterized as an osmostress responsive factor, regulates the expression of multiple TLR-induced genes in macrophages independently of osmotic stress. NFAT5 was essential for the induction of the key antimicrobial gene Nos2 (inducible nitric oxide synthase [iNOS]) in response to low and high doses of TLR agonists but is required for Tnf and Il6 mainly under mild stimulatory conditions, indicating that NFAT5 could regulate specific gene patterns depending on pathogen burden intensity. NFAT5 exhibited two modes of association with target genes, as it was constitutively bound to Tnf and other genes regardless of TLR stimulation, whereas its recruitment to Nos2 or Il6 required TLR activation. Further analysis revealed that TLR-induced recruitment of NFAT5 to Nos2 was dependent on inhibitor of κB kinase (IKK) β activity and de novo protein synthesis, and was sensitive to histone deacetylases. In vivo, NFAT5 was necessary for effective immunity against Leishmania major, a parasite whose clearance requires TLRs and iNOS expression in macrophages. These findings identify NFAT5 as a novel regulator of mammalian anti-pathogen responses.

  19. Gene expression induced by Toll-like receptors in macrophages requires the transcription factor NFAT5

    PubMed Central

    Buxadé, Maria; Lunazzi, Giulia; Minguillón, Jordi; Iborra, Salvador; Berga-Bolaños, Rosa; del Val, Margarita; Aramburu, José

    2012-01-01

    Toll-like receptors (TLRs) engage networks of transcriptional regulators to induce genes essential for antimicrobial immunity. We report that NFAT5, previously characterized as an osmostress responsive factor, regulates the expression of multiple TLR-induced genes in macrophages independently of osmotic stress. NFAT5 was essential for the induction of the key antimicrobial gene Nos2 (inducible nitric oxide synthase [iNOS]) in response to low and high doses of TLR agonists but is required for Tnf and Il6 mainly under mild stimulatory conditions, indicating that NFAT5 could regulate specific gene patterns depending on pathogen burden intensity. NFAT5 exhibited two modes of association with target genes, as it was constitutively bound to Tnf and other genes regardless of TLR stimulation, whereas its recruitment to Nos2 or Il6 required TLR activation. Further analysis revealed that TLR-induced recruitment of NFAT5 to Nos2 was dependent on inhibitor of κB kinase (IKK) β activity and de novo protein synthesis, and was sensitive to histone deacetylases. In vivo, NFAT5 was necessary for effective immunity against Leishmania major, a parasite whose clearance requires TLRs and iNOS expression in macrophages. These findings identify NFAT5 as a novel regulator of mammalian anti-pathogen responses. PMID:22312110

  20. [Construction of a recombined adenovirus vector carrying pri-miR-21 gene and research on it's target gene TLR4].

    PubMed

    Zhao, Jing; Xu, Guang-xian; Jia, Wei; Dong, Hui; Zhang, Yi-lin; Zhao, Zhi-jun; Wei, Jun

    2012-02-01

    To construct the recombined adenovirus vector carrying pri-miR-21 gene, which can express mature miR-21 efficiently, and to study the interaction of miR- 21 with its target gene TLR4. Using healthy mouse's gDNA as template, the primary miR-21 coding sequence was amplified by PCR and cloned into a shuttle vector pAdTrack-CMV. Constructed plasmid was sequenced and linearized for homologous recombination with pAdEasy-1 vector in BJ5183 bacteria. The recombined adenovirus vector carrying pri-miR-21 gene was used to challenge HeLa cell. The candidate target gene of miR-21 was determined by miRNA analysis databases. The expression level of TLR4 protein was detected by western blotting. Through the PCR, restriction enzyme digestion, DNA sequencing and expression of GFP, recombinant adenoviral vector pri-miR-21 gene was constructed successfully. Bioinformatic analysis suggested a few possible binding sites between miR-21 and TLR4. Results showed that miR-21 down-regulated TLR4 at protein levels. The recombinant adenoviral vector containing pri- miR-21 was successfully constructed. miR-21 gene interfered with the expression of TLR4 target gene.

  1. The Structural Basis of Pathogen Recognition by TLR Receptors of the Innate Immune System

    DTIC Science & Technology

    2008-08-01

    bacterial flagellin. Similarly, we learned that TLR11 and TLR12 jointly recognize a protozoan profilin-like protein from the parasite Toxoplasma gondii ...Expression and purification of profilin from Toxoplasma gondii We subcloned the cDNA for Toxoplasma gondii profilin (PFTG) provided by Dr. Sankar Ghosh...10 mM Tris pH 7.5, 40 mM KCl, 2 mM TCEP (Figure 6). 13 Fig. 6. Size exclusion chromatogram of endogenous profilin from Toxoplasma gondii

  2. Involvement of TLR2 and TLR4 in inflammatory immune responses induced by fine and coarse ambient air particulate matter

    PubMed Central

    Shoenfelt, Joanna; Mitkus, Robert J.; Zeisler, Rolf; Spatz, Rabia O.; Powell, Jan; Fenton, Matthew J.; Squibb, Katherine A.; Medvedev, Andrei E.

    2009-01-01

    Induction of proinflammatory mediators by alveolar macrophages exposed to ambient air particulate matter has been suggested to be a key factor in the pathogenesis of inflammatory and allergic diseases in the lungs. However, receptors and mechanisms underlying these responses have not been fully elucidated. In this study, we examined whether TLR2, TLR4, and the key adaptor protein, MyD88, mediate the expression of proinflammatory cytokines and chemokines by mouse peritoneal macrophages exposed to fine and coarse PM. TLR2 deficiency blunted macrophage TNF-α and IL-6 expression in response to fine (PM2.5), while not affecting cytokine-inducing ability of coarse NIST Standard Reference Material (SRM 1648) particles. In contrast, TLR4−/− macrophages showed inhibited cytokine expression upon stimulation with NIST SRM 1648 but exhibited normal responses to PM2.5. Preincubation with polymyxin B markedly suppressed the capacity of NIST SRM 1648 to elicit TNF-α and IL-6, indicating endotoxin as a principal inducer of cytokine responses. Overexpression of TLR2 in TLR2/4-deficient human embryonic kidney 293 cells imparted PM2.5 sensitivity, as judged by IL-8 gene expression, whereas NIST SRM 1648, but not PM2.5 elicited IL-8 expression in 293/TLR4/MD-2 transfectants. Engagement of TLR4 by NIST SRM 1648 induced MyD88-independent expression of the chemokine RANTES, while TLR2-reactive NIST IRM PM2.5 failed to up-regulate this response. Consistent with the shared use of MyD88 by TLR2 and TLR4, cytokine responses of MyD88−/− macrophages to both types of air PM were significantly reduced. These data indicate differential utilization of TLR2 and TLR4 but shared use of MyD88 by fine and coarse air pollution particles. PMID:19406832

  3. Bruton’s Tyrosine Kinase Mediates the Synergistic Signalling between TLR9 and the B Cell Receptor by Regulating Calcium and Calmodulin

    PubMed Central

    Kenny, Elaine F.; Quinn, Susan R.; Doyle, Sarah L.; Vink, Paul M.; van Eenennaam, Hans; O’Neill, Luke A. J.

    2013-01-01

    B cells signal through both the B cell receptor (BCR) which binds antigens and Toll-like receptors (TLRs) including TLR9 which recognises CpG DNA. Activation of TLR9 synergises with BCR signalling when the BCR and TLR9 co-localise within an auto-phagosome-like compartment. Here we report that Bruton’s tyrosine kinase (BTK) is required for synergistic IL6 production and up-regulation of surface expression of MHC-class-II, CD69 and CD86 in primary murine and human B cells. We show that BTK is essential for co-localisation of the BCR and TLR9 within a potential auto-phagosome-like compartment in the Namalwa human B cell line. Downstream of BTK we find that calcium acting via calmodulin is required for this process. These data provide new insights into the role of BTK, an important target for autoimmune diseases, in B cell activation. PMID:23967355

  4. Variants in Toll-like Receptor 1 and 4 Genes Are Associated With Chlamydia trachomatis Among Women With Pelvic Inflammatory Disease

    PubMed Central

    Darville, Toni; Ferrell, Robert E.; Kammerer, Candace M.; Ness, Roberta B.; Haggerty, Catherine L.

    2012-01-01

    Background. Toll-like receptors (TLRs) are involved in the innate immune response. We examined whether TLR variants are associated with Chlamydia trachomatis infection among women with pelvic inflammatory disease (PID). Methods. We tested whether 18 tagging single nucleotide polymorphisms (tagSNPs) assayed in 4 TLR genes (TLR1, TLR2, TLR4, TLR6) and 2 adaptor molecules (TIRAP, MyD88) were associated with C. trachomatis among 205 African American women with clinically suspected PID from the PID Evaluation and Clinical Health Study. Logistic regression was used to calculate odds ratios (ORs) and 95% confidence intervals (CIs). An empirical P value of <.004 was considered significant. Results. Women with PID who carried the TLR4 rs1927911 CC genotype had significantly increased odds of C. trachomatis (OR, 3.7; 95% CI, 1.6–8.8; P = .002). The TLR1 rs5743618TT genotype was also associated with C. trachomatis (OR, 2.8; 95% CI, 1.3–6.2; P = .008). Conclusions. Among African American women with PID, variants in the TLR1 and TLR4 genes, which may increase signaling, were associated with increased C. trachomatis infection. PMID:22238472

  5. Polymorphisms in Toll-like receptors 2 and 4 genes and their expression in chronic suppurative otitis media.

    PubMed

    Jotic, Ana; Jesic, Snezana; Zivkovic, Maja; Tomanovic, Nada; Kuveljic, Jovana; Stankovic, Aleksandra

    2015-12-01

    Toll-like receptors (TLRs) have a prominent role in inducing innate immune response. It has been suggested that regulation of TLRs is involved in the pathogenesis of chronic otitis media. TLR 2 and TLR 4 polymorphisms were connected with susceptibility to acute otitis and chronic otitis with effusion. The objective of this study was to establish expression of TLR 2 and 4 on middle ear mucosa in different types of chronic suppurative otitis media (CSOM), and the influence of gene polymorphisms TLR 2 Arg753Gln and TLR 4 Thr399Ile and Asp299Gly to susceptibility to CSOM. Middle ear mucosa and full blood samples were obtained from 85 patients with chronic suppurative otitis media with and without cholesteatoma. Control group for mucosal TLR expression consisted of 71 samples of middle ear mucosa taken from patients with otosclerosis, and control group for DNA polymorphism consisted of 100 full blood samples in healthy subjects. DNA polymorphism detection was done with restriction fragment length polymorphism in RT PCR. Expression of TLR 2 and 4 was determined with immunohistochemical staining. TLR 2 and TLR 4 expression on the middle ear mucosa was not influenced by age of the patients with chronic otitis media. Incidence of TLR 2 Arg753Gln polymorphism was significantly higher in patients with chronic otitis media, compared to control group. Significant association between TLR 2 Arg753Gln polymorphism and different types of mucosal changes in patients with chronic otitis media was established. TLR 2 and 4 expression on experimental group mucosa was significantly different compared to control group, where there was no expression (p=0.000). Strong dependence of TLR 2 and TLR 4 expression on middle ear mucosa with different mucosal changes and immunohistochemical activity after staining was detected. Certain polymorphisms in TLR genes could be indicative for susceptibility to chronic otitis media. Expression of TLR 2 and 4 on middle ear mucosa was more dependable on

  6. Respiratory Syncytial Virus Fusion Protein-Induced Toll-Like Receptor 4 (TLR4) Signaling Is Inhibited by the TLR4 Antagonists Rhodobacter sphaeroides Lipopolysaccharide and Eritoran (E5564) and Requires Direct Interaction with MD-2

    PubMed Central

    Rallabhandi, Prasad; Phillips, Rachel L.; Boukhvalova, Marina S.; Pletneva, Lioubov M.; Shirey, Kari Ann; Gioannini, Theresa L.; Weiss, Jerrold P.; Chow, Jesse C.; Hawkins, Lynn D.; Vogel, Stefanie N.; Blanco, Jorge C. G.

    2012-01-01

    ABSTRACT Respiratory syncytial virus (RSV) is a leading cause of infant mortality worldwide. Toll-like receptor 4 (TLR4), a signaling receptor for structurally diverse microbe-associated molecular patterns, is activated by the RSV fusion (F) protein and by bacterial lipopolysaccharide (LPS) in a CD14-dependent manner. TLR4 signaling by LPS also requires the presence of an additional protein, MD-2. Thus, it is possible that F protein-mediated TLR4 activation relies on MD-2 as well, although this hypothesis has not been formally tested. LPS-free RSV F protein was found to activate NF-κB in HEK293T transfectants that express wild-type (WT) TLR4 and CD14, but only when MD-2 was coexpressed. These findings were confirmed by measuring F-protein-induced interleukin 1β (IL-1β) mRNA in WT versus MD-2−/− macrophages, where MD-2−/− macrophages failed to show IL-1β expression upon F-protein treatment, in contrast to the WT. Both Rhodobacter sphaeroides LPS and synthetic E5564 (eritoran), LPS antagonists that inhibit TLR4 signaling by binding a hydrophobic pocket in MD-2, significantly reduced RSV F-protein-mediated TLR4 activity in HEK293T-TLR4–CD14–MD-2 transfectants in a dose-dependent manner, while TLR4-independent NF-κB activation by tumor necrosis factor alpha (TNF-α) was unaffected. In vitro coimmunoprecipitation studies confirmed a physical interaction between native RSV F protein and MD-2. Further, we demonstrated that the N-terminal domain of the F1 segment of RSV F protein interacts with MD-2. These data provide new insights into the importance of MD-2 in RSV F-protein-mediated TLR4 activation. Thus, targeting the interaction between MD-2 and RSV F protein may potentially lead to novel therapeutic approaches to help control RSV-induced inflammation and pathology. PMID:22872782

  7. Toll-like receptor 4 mediates microglial activation and production of inflammatory mediators in neonatal rat brain following hypoxia: role of TLR4 in hypoxic microglia

    PubMed Central

    2013-01-01

    Background Hypoxia induces microglial activation which causes damage to the developing brain. Microglia derived inflammatory mediators may contribute to this process. Toll-like receptor 4 (TLR4) has been reported to induce microglial activation and cytokines production in brain injuries; however, its role in hypoxic injury remains uncertain. We investigate here TLR4 expression and its roles in neuroinflammation in neonatal rats following hypoxic injury. Methods One day old Wistar rats were subjected to hypoxia for 2 h. Primary cultured microglia and BV-2 cells were subjected to hypoxia for different durations. TLR4 expression in microglia was determined by RT-PCR, western blot and immunofluorescence staining. Small interfering RNA (siRNA) transfection and antibody neutralization were employed to downregulate TLR4 in BV-2 and primary culture. mRNA and protein expression of tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β) and inducible nitric oxide synthase (iNOS) was assessed. Reactive oxygen species (ROS), nitric oxide (NO) and NF-κB levels were determined by flow cytometry, colorimetric and ELISA assays respectively. Hypoxia-inducible factor-1 alpha (HIF-1α) mRNA and protein expression was quantified and where necessary, the protein expression was depleted by antibody neutralization. In vivo inhibition of TLR4 with CLI-095 injection was carried out followed by investigation of inflammatory mediators expression via double immunofluorescence staining. Results TLR4 immunofluorescence and protein expression in the corpus callosum and cerebellum in neonatal microglia were markedly enhanced post-hypoxia. In vitro, TLR4 protein expression was significantly increased in both primary microglia and BV-2 cells post-hypoxia. TLR4 neutralization in primary cultured microglia attenuated the hypoxia-induced expression of TNF-α, IL-1β and iNOS. siRNA knockdown of TLR4 reduced hypoxia-induced upregulation of TNF-α, IL-1β, iNOS, ROS and NO in BV-2 cells. TLR4

  8. Insights into the European rabbit (Oryctolagus cuniculus) innate immune system: genetic diversity of the toll-like receptor 3 (TLR3) in wild populations and domestic breeds

    PubMed Central

    2013-01-01

    Background Toll-like receptors (TLRs) belong to the innate immune system and are a major class of pattern recognition receptors representing the first line of the innate immune response. The TLR molecule is structurally composed by an ectodomain that contains leucine rich repeats (LRRs) that interact with pathogen associated molecular patterns (PAMPs), a transmembrane domain and a conserved cytoplasmic domain designated TIR (Toll-IL1 receptor) that is responsible for the intracellular signaling. TLR3 has been associated with the direct recognition of double-stranded viral RNA resulting from viral replication, while TLR7 and TLR8 target single-stranded viral RNA. In the European rabbit (Oryctolagus cuniculus), TLR7 and TLR8 were reported to be absent and pseudogenised, respectively, making TLR3 the only available TLR for the recognition of viral RNA. Thus, the levels of diversity of TLR3 were evaluated in the European rabbit by analysing different genetic backgrounds and exposure to pathogen pressures. Results We detected 41 single nucleotide polymorphisms (SNPs) in the coding sequence of TLR3. The highest diversity was observed in the wild populations of Iberian Peninsula, between 22–33 polymorphic positions. In the French population, 18 SNPs were observed and only 4 polymorphic positions were detected in the domestic breeds. 14 non-synonymous substitutions were observed, most of them in the LRR molecules. The remaining were scattered across the transmembrane and TIR domains. Conclusion The study of TLR3 in European rabbit populations might be relevant to understand the interplay between RNA viruses and innate immunity. Wild rabbit populations presented more diversity than domestic breeds and other mammals previously studied. This might be linked to the absence of population bottlenecks during their evolution and to the almost inexistence of man-mediated selection. The observed variability might have also been potentiated by the contact of the wild populations

  9. Toll-like receptor stimulation in splenic marginal zone lymphoma can modulate cell signaling, activation and proliferation

    PubMed Central

    Fonte, Eleonora; Agathangelidis, Andreas; Reverberi, Daniele; Ntoufa, Stavroula; Scarfò, Lydia; Ranghetti, Pamela; Cutrona, Giovanna; Tedeschi, Alessandra; Xochelli, Aliki; Caligaris-Cappio, Federico; Ponzoni, Maurilio; Belessi, Chrysoula; Davis, Zadie; Piris, Miguel A.; Oscier, David; Ghia, Paolo; Stamatopoulos, Kostas; Muzio, Marta

    2015-01-01

    Recent studies on splenic marginal zone lymphoma identified distinct mutations in genes belonging to the B-cell receptor and Toll-like receptor signaling pathways, thus pointing to their potential implication in the biology of the disease. However, limited data is available regarding the exact role of TLRs. We aimed at characterizing the expression pattern of TLRs in splenic marginal zone lymphoma cells and their functional impact on the activation, proliferation and viability of malignant cells in vitro. Cells expressed significant levels of TLR1, TLR6, TLR7, TLR8, TLR9 and TLR10 mRNA; TLR2 and TLR4 showed a low, variable pattern of expression among patients whereas TLR3 and TLR5 mRNAs were undetectable; mRNA specific for TLR signaling molecules and adapters was also expressed. At the protein level, TLR1, TLR6, TLR7, TLR9 and TLR10 were detected. Stimulation of TLR1/2, TLR2/6 and TLR9 with their respective ligands triggered the activation of IRAK kinases, MAPK and NF-κB signaling pathways, and the induction of CD86 and CD25 activation molecules, although in a heterogeneous manner among different patient samples. TLR-induced activation and cell viability were also inhibited by a specific IRAK1/4 inhibitor, thus strongly supporting the specific role of TLR signaling in these processes. Furthermore, TLR2/6 and TLR9 stimulation also significantly increased cell proliferation. In conclusion, we demonstrate that splenic marginal zone lymphoma cells are equipped with functional TLR and signaling molecules and that the stimulation of TLR1/2, TLR2/6 and TLR9 may play a role in regulating disease pathobiology, likely promoting the expansion of the neoplastic clone. PMID:26294727

  10. TLR2 and TLR4 polymorphisms influence mRNA and protein expression in colorectal cancer

    PubMed Central

    Proença, Marcela Alcântara; de Oliveira, Juliana Garcia; Cadamuro, Aline Cristina Targa; Succi, Maysa; Netinho, João Gomes; Goloni-Bertolo, Eny Maria; Pavarino, Érika Cristina; Silva, Ana Elizabete

    2015-01-01

    AIM: To evaluate the effect of promoter region polymorphisms of toll-like receptor (TLR)2-196 to -174del and TLR4-1607T/C (rs10759932) on mRNA and protein expression in tumor tissue and of TLR4+896A/G (rs4986790) on colorectal cancer (CRC) risk. METHODS: The TLR2-196 to -174del polymorphism was investigated using allele-specific polymerase chain reaction (PCR) and the TLR4-1607T/C and TLR4+896A/G by PCR-restriction fragment length polymorphism (RFLP). We genotyped 434 DNA samples from 194 CRC patients and 240 healthy individuals. The mRNA relative quantification (RQ) was performed in 40 tumor tissue samples by quantitative PCR TaqMan assay, using specific probes for TLR2 and TLR4 genes, and ACTB and GAPDH reference genes were used as endogenous controls. Protein expression was analyzed by immunohistochemistry with specific primary antibodies. RESULTS: No association was found for TLR4-1607T/C and TLR4+896A/G by three statistical models (log-additive, dominant and recessive). However, based on dominant and log-additive models, the polymorphic variant TLR2-196 to -174del was associated with increased CRC risk [dominant: odds ratio (OR) = 1.72, 95%CI: 1.03-2.89; P = 0.038 and log-additive: OR =1.59, 95%CI: 1.02-2.48; P = 0.039]. TLR2 mRNA expression was increased in tumor tissue (RQ = 2.36) when compared to adjacent normal tissue (RQ = 1; P < 0.0001), whereas the TLR4 mRNA showed a basal expression (RQ = 0.74 vs RQ = 1, P = 0.452). Immunohistochemistry analysis of TLR2 and TLR4 protein expression was concordant with the findings of mRNA expression. In addition, the TLR2-196 to -174del variant carriers showed mRNA relative expression 2.19 times higher than wild-genotype carriers. The TLR2 protein expression was also higher for the TLR2-196 to -174del variant carriers [117 ± 10 arbitrary unit (a.u.) vs 95 ± 4 a.u., P = 0.03]. However, for the TLR4 -1607T/C polymorphism no significant difference was found for both mRNA (P = 0.56) and protein expression (P = 0

  11. Evaluation of Toll-like-receptor gene family variants as prognostic biomarkers in rheumatoid arthritis.

    PubMed

    Torices, Silvia; Alvarez-Rodríguez, Lorena; Varela, Ignacio; Muñoz, Pedro; Balsa, Alejandro; López-Hoyos, M; Martinez-Taboada, Víctor; Fernández-Luna, Jose L

    2017-07-01

    Rheumatoid arthritis (RA) is a systemic autoimmune disease whose main feature is persistent joint inflammation. Toll-like receptors (TLRs) play critical roles in the activation of innate and adaptive immune responses, and influence the activity of NFκB, a key player in chronic inflammation. We aimed at investigating the association of TLR allelic variants with susceptibility and severity of RA through a systematic, high-throughput, analysis of TLR genes. All coding exons and flanking regions of nine members of the TLR family (TLR1-9) were analyzed in 66 patients with RA and 30 healthy controls by next generation sequencing. We focussed on three single allelic variants, N248S in TLR1, Q11L in TLR7 and M1V in TLR8 based on the allelic frequencies in both patient and control populations, the predicted impact on protein function and the novelty in RA research. Analysis of these selected variants in a larger cohort of 402 patients with RA and in 208 controls revealed no association with susceptibility. However, the M1V allele was associated with a lower need for disease-modifying antirheumatic drugs (DMARDs) (p=0.008) and biologic treatments (p=0.021). Functional studies showed that the M1V variant leads to a reduced production of inflammatory cytokines, IL-1β, IL-6 and TNFα, in response to TLR8 agonists. Thus, the presence of this variant confers a significant protective effect on disease severity. These results show for the first time the association between the M1V variant of TLR8 and reduced disease severity in RA, which could have prognostic value for these patients. Copyright © 2017. Published by Elsevier B.V.

  12. TLR4 Inactivation in Myeloid Cells Accelerates Bone Healing of a Calvarial Defect Model in Mice.

    PubMed

    Wang, Dan; Gilbert, James R; Taylor, Gwen M; Sodhi, Chhinder P; Hackam, David J; Losee, Joseph E; Billiar, Timothy R; Cooper, Gregory M

    2017-08-01

    Toll-like receptor 4 (TLR4) has been implicated in inflammation-induced bone destruction in various chronic bone diseases; however, its direct influence on bone healing is not well understood. The authors' previous study showed accelerated bone healing with higher osteoclastogenesis gene expression in toll-like receptor 4 knockout mice (TLR4). This study aimed to further elucidate the underlying cellular mechanisms during fracture healing by generating a myeloid cell-specific toll-like receptor 4 knockout model (Lyz-TLR4 mice). Calvarial defects, 1.8 mm in diameter, were created in wild-type, TLR4, and Lyz-TLR4 mice. Bone healing was investigated using micro-computed tomography and histologic, histomorphometric, and immunohistochemistry analyses. Primary bone marrow-derived cells were also isolated from wild-type, TLR4, and Lyz-TLR4 mice to measure their osteoclast differentiation and resorption properties. A similar faster bone healing response, with active intramembranous bone formation, intense osteopontin staining, and more osteoblast infiltration, was observed in TLR4 and Lyz-TLR4 mice. Tartrate-resistant acid phosphatase staining showed more osteoclast infiltration in Lyz-TLR4 mice than in wild-type mice at day 7. Primary bone marrow-derived cells isolated from TLR4 and Lyz-TLR4 mice presented enhanced osteoclastogenesis and resorption activity compared with those from wild-type mice. Comparable M0, M1, and M2 macrophage infiltration was found among all groups at days 1, 4, and 7. This study revealed that inactivation of toll-like receptor 4 in myeloid cells enhanced osteoclastogenesis and accelerated healing response during skull repair. Together with the role of toll-like receptor 4 in inflammation-mediated bone destruction, it suggests that toll-like receptor 4 might regulate inflammation-induced osteoclastogenesis under different clinical settings.

  13. TLR4 Inactivation in Myeloid Cells Accelerates Bone Healing of a Calvarial Defect Model in Mice

    PubMed Central

    Wang, Dan; Gilbert, James R.; Taylor, Gwen M.; Sodhi, Chhinder P.; Hackam, David J.; Losee, Joseph E.; Billiar, Timothy R.

    2017-01-01

    Background: Toll-like receptor 4 (TLR4) has been implicated in inflammation-induced bone destruction in various chronic bone diseases; however, its direct influence on bone healing is not well understood. The authors’ previous study showed accelerated bone healing with higher osteoclastogenesis gene expression in toll-like receptor 4 knockout mice (TLR4-/-). This study aimed to further elucidate the underlying cellular mechanisms during fracture healing by generating a myeloid cell-specific toll-like receptor 4 knockout model (Lyz-TLR4-/- mice). Methods: Calvarial defects, 1.8 mm in diameter, were created in wild-type, TLR4-/-, and Lyz-TLR4-/- mice. Bone healing was investigated using micro–computed tomography and histologic, histomorphometric, and immunohistochemistry analyses. Primary bone marrow–derived cells were also isolated from wild-type, TLR4-/-, and Lyz-TLR4-/- mice to measure their osteoclast differentiation and resorption properties. Results: A similar faster bone healing response, with active intramembranous bone formation, intense osteopontin staining, and more osteoblast infiltration, was observed in TLR4-/- and Lyz-TLR4-/- mice. Tartrate-resistant acid phosphatase staining showed more osteoclast infiltration in Lyz-TLR4-/- mice than in wild-type mice at day 7. Primary bone marrow–derived cells isolated from TLR4-/- and Lyz-TLR4-/- mice presented enhanced osteoclastogenesis and resorption activity compared with those from wild-type mice. Comparable M0, M1, and M2 macrophage infiltration was found among all groups at days 1, 4, and 7. Conclusions: This study revealed that inactivation of toll-like receptor 4 in myeloid cells enhanced osteoclastogenesis and accelerated healing response during skull repair. Together with the role of toll-like receptor 4 in inflammation-mediated bone destruction, it suggests that toll-like receptor 4 might regulate inflammation-induced osteoclastogenesis under different clinical settings. PMID:28746278

  14. Up-regulation of TLR2 and TLR4 in high mobility group Box1-stimulated macrophages in pulpitis patients

    PubMed Central

    Mahmoudi, Javad; Sabermarouf, Babak; Baradaran, Behzad; Sadat-Hatamnezhad, Leila; Shotorbani, Siamak Sandoghchian

    2017-01-01

    Objective(s): High Mobility Group Box1 (HMGB1) is a nonhistone, DNA-binding protein that serves a crucial role in regulating gene transcription and is involved in a variety of proinflammatory, extracellular activities. The aim of this study was to explore whether HMGB1 stimulation can up-regulate the expression of Toll-like Receptor 2 (TLR2) and Toll-like Receptor 4 (TLR4) on macrophages from pulpitis and to clarify the subsequent events involving Th17 cells and Th17 cell-associated cytokine changes. Materials and Methods: Having prepared dental pulp tissues of pulpitis and healthy controls, macrophage were isolated and cultured. Macrophages were thereafter stimulated by HMGB1 time course. RT-QPCR, flowcytometer, immunofluorescence, Western blotting, and ELISA techniques were used in the present research. Results: Our results showed that the expression of TLR2 and TLR4 on macrophages stimulated with HMGB1 increased in pulpitis compared with controls (macrophages without HMGB1 stimulation) with a statistical significance (P<0.001). In addition, the levels of IL-17, IL-23, and IL-6 in supernatants from cultured macrophages stimulated with HMGB1 from pulpitis increased, and NF-kB, the downstream target of TLR2 and TLR4, also showed a marked elevation after macrophages’ stimulation by HMGB1. Conclusion: The evidence from the present study suggests that the enhanced TLR2 and TLR4 pathways and Th17 cell polarization may be due to HMGB1 stimulation in pulpitis. PMID:28293399

  15. Identification and optimization of pteridinone Toll-like receptor 7 (TLR7) agonists for the oral treatment of viral hepatitis.

    PubMed

    Roethle, Paul A; McFadden, Ryan M; Yang, Hong; Hrvatin, Paul; Hui, Hon; Graupe, Michael; Gallagher, Brian; Chao, Jessica; Hesselgesser, Joseph; Duatschek, Paul; Zheng, Jim; Lu, Bing; Tumas, Daniel B; Perry, Jason; Halcomb, Randall L

    2013-09-26

    Pteridinone-based Toll-like receptor 7 (TLR7) agonists were identified as potent and selective alternatives to the previously reported adenine-based agonists, leading to the discovery of GS-9620. Analogues were optimized for the immunomodulatory activity and selectivity versus other TLRs, based on differential induction of key cytokines including interferon α (IFN-α) and tumor necrosis factor α (TNF-α). In addition, physicochemical properties were adjusted to achieve desirable in vivo pharmacokinetic and pharmacodynamic properties. GS-9620 is currently in clinical evaluation for the treatment of chronic hepatitis B (HBV) infection.

  16. Enhanced Calvarial Bone Healing in CD11c-TLR4-/- and MyD88-/- Mice.

    PubMed

    Wang, Dan; Taylor, Gwen M; Gilbert, James R; Losee, Joseph E; Sodhi, Chhinder P; Hackam, David J; Billiar, Timothy R; Cooper, Gregory M

    2017-04-01

    Inflammation is integral to the injury response. The inflammatory response is essential to the host defense against infection and also to tissue regeneration and repair. Toll-like receptors (TLRs) are critical activators of the innate immune response and present attractive therapeutic targets for inflammation-modulated tissue regeneration. The authors' previous study showed that depletion of TLR4 resulted in accelerated skull bone healing concurrent with increased expression of osteoclastogenic genes. As such, in the present study, the authors used various knockout mouse models for TLR4 and its associated signaling mediators as tools to further understand the role of Toll-like receptor-mediated inflammation in calvarial bone healing. Calvarial defects (1.8-mm diameter) were created in wild-type, TLR4 knockout (TLR4), TLR2, MyD88, TRIF, TLR4 knockout in myeloid cell (Lyz-TLR4), and TLR4 knockout in dendritic-lineage cell (CD11c-TLR4) mice. Bone healing was examined using micro-computed tomographic, histologic, and histomorphometric analyses. Micro-computed tomographic and histomorphometric analyses revealed that TLR4-deficient mice (TLR4, Lyz-TLR4, and CD11c-TLR4) exhibited a faster intramembraneous healing response at postoperative day 7, whereas MyD88 and CD11c-TLR4 mice showed enhanced bone healing at day 28. The authors' data suggest a detrimental role for TLR4 in CD11c cells, mediated by Myd88 signaling, during calvarial bone healing. The authors have demonstrated that Toll-like receptor signaling components affect calvarial bone healing, establishing a link between the skeletal and immune systems during craniofacial bone healing. Toll-like receptor signaling components might be used to initiate enhanced healing in bone defects to improve clinical outcomes.

  17. Insulin receptor sensitizer, dicholine succinate, prevents both Toll-like receptor 4 (TLR4) upregulation and affective changes induced by a high-cholesterol diet in mice.

    PubMed

    Strekalova, Tatyana; Costa-Nunes, João P; Veniaminova, Ekaterina; Kubatiev, Aslan; Lesch, Klaus-Peter; Chekhonin, Vladimir P; Evans, Matthew C; Steinbusch, Harry W M

    2016-05-15

    High cholesterol intake in mice induces hepatic lipid dystrophy and inflammation, signs of non-alcoholic fatty liver disease (NAFLD), depressive- and anxiety-like behaviors, and the up-regulation of brain and liver Toll-like receptor 4 (Tlr4). Here, we investigated whether dicholine succinate (DS), an insulin receptor sensitizer and mitochondrial complex II substrate would interact with these effects. C57BL/6J mice were given a 0.2%-cholesterol diet for 3 weeks, alone or along with oral DS administration, or a control feed. Outcomes included behavioral measures of anxiety/depression, and Tlr4 and peroxisome-proliferator-activated-receptor-gamma coactivator-1b (PPARGC1b) expression. 50mg/kg DS treatment for 3 weeks partially ameliorated the cholesterol-induced anxiety- and depressive-like changes. Mice were next treated at the higher dose (180mg/kg), either for the 3-week period of dietary intervention, or for the last two weeks. Three-week DS administration normalized behaviors in the forced swim and O-maze tests and abolished the Tlr4 up-regulation in the brain and liver. The delayed, 2-week DS treatment had similar effects on Tlr4 expression and largely rescued the above-mentioned behaviors. Suppression of PPARGC1b, a master regulator of mitochondrial biogenesis, by the high cholesterol diet, was prevented with the 3-week administration, and markedly diminished by the a 2-week administration of DS. None of treatments prevented hepatic dystrophy and triglyceride accumulation. Other conditions have to be tested to define possible limitations of reported effects of DS. DS treatment did not alter the patho-morphological substrates of NAFLD syndrome in mice, but ameliorated its molecular and behavioral consequences, likely by activating mitochondrial functions and anti-inflammatory mechanisms. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Scavenger Receptor SREC-I Mediated Entry of TLR4 into Lipid Microdomains and Triggered Inflammatory Cytokine Release in RAW 264.7 Cells upon LPS Activation

    PubMed Central

    Murshid, Ayesha; Gong, Jianlin; Prince, Thomas; Borges, Thiago J.; Calderwood, Stuart K.

    2015-01-01

    Scavenger receptor associated with endothelial cells I (SREC-I) was shown to be expressed in immune cells and to play a role in the endocytosis of peptides and antigen presentation. As our previous studies indicated that SREC-I required intact Toll-like receptor 4 (TLR4) expression for its functions in tumor immunity, we examined potential interactions between these two receptors. We have shown here that SREC-I became associated with TLR4 on binding bacterial lipopolysaccharides (LPS) in RAW 264.7 and HEK 293 cells overexpressing these two receptors. The receptors then became internalized together in intracellular endosomes. SREC-I promoted TLR4-induced signal transduction through the NF-kB and MAP kinase pathways, leading to enhanced inflammatory cytokine release. Activation of inflammatory signaling through SREC-I/TLR4 complexes appeared to involve recruitment of the receptors into detergent-insoluble, cholesterol-rich lipid microdomains that contained the small GTPase Cdc42 and the non-receptor tyrosine kinase c-src. Under conditions of SREC-I activation by LPS, TLR4 activity required Cdc42 as well as cholesterol and actin polymerization for signaling through NF-kB and MAP kinase pathways in RAW 264.7 cells. SREC-I appeared to respond differently to another ligand, the molecular chaperone Hsp90 that, while triggering SREC-I-TLR4 binding caused only faint activation of the NF-kB pathway. Our experiments therefore indicated that SREC-I could bind LPS and might be involved in innate inflammatory immune responses to extracellular danger signals in RAW 264.7 cells or bone marrow-derived macrophages. PMID:25836976

  19. Activation of adult rat CNS endothelial cells by opioid-induced toll-like receptor 4 (TLR4) signaling induces proinflammatory, biochemical, morphological, and behavioral sequelae

    PubMed Central

    Grace, Peter M.; Ramos, Khara M.; Rodgers, Krista M.; Wang, Xiaohui; Hutchinson, Mark R.; Lewis, Makenzie T.; Morgan, Kelly N.; Kroll, Juliet L.; Taylor, Frederick R.; Strand, Keith A.; Zhang, Yingning; Berkelhammer, Debra; Huey, Madeline G.; Greene, Lisa I.; Cochran, Thomas A.; Yin, Hang; Barth, Daniel S.; Johnson, Kirk W.; Rice, Kenner; Maier, Steven F.; Watkins, Linda R.

    2014-01-01

    CNS immune signaling contributes to deleterious opioid effects including hyperalgesia, tolerance, reward, and dependence/withdrawal. Such effects are mediated by opioid signaling at TLR4, presumptively of glial origin. Whether CNS endothelial cells express TLR4 is controversial. If so, they would be well positioned for activation by blood-borne opioids, contributing to opioid-induced pro-inflammatory responses. These studies examined adult primary rat CNS endothelial cell responses to (-)-morphine or its mu-opioid receptor (MOR) inactive metabolite morphine-3-glucuronide (M3G), both known TLR4 agonists. We demonstrate that adult rat CNS endothelial cells express functional TLR4. M3G activated NFκB, increased tumor necrosis factor-α (TNFα) and cyclooxygenase-2 (COX2) mRNAs, and released prostaglandin E2 from these cells. (-)-Morphine-induced upregulation of TNFα mRNA and prostaglandin E2 release were unmasked by pre-treatment with nalmefene, a MOR antagonist without TLR4 activity (unlike CTAP, shown to have both MOR- and TLR4-activity), suggestive of an interplay between MOR and TLR4 co-activation by (-)-morphine. In support, MOR-dependent Protein Kinase A (PKA) opposed TLR4 signaling, as PKA inhibition (H-89) also unmasked (-)-morphine-induced TNFα and COX2 mRNA upregulation. Intrathecal injection of CNS endothelial cells, stimulated in vitro with M3G, produced TLR4-dependent tactile allodynia. Further, cortical suffusion with M3G in vivo induced TLR4-dependent vasodilation. Finally, endothelial cell TLR4 activation by lipopolysaccharide and/or M3G was blocked by the glial inhibitors AV1013 and propentofylline, demonstrating endothelial cells as a new target of such drugs. These data indicate that (-)-morphine and M3G can activate CNS endothelial cells via TLR4, inducing proinflammatory, biochemical, morphological, and behavioral sequalae. CNS endothelial cells may have previously unanticipated roles in opioid-induced effects, in phenomena blocked by

  20. The Toll-Like Receptor 4 Polymorphism Asp299Gly but Not Thr399Ile Influences TLR4 Signaling and Function

    PubMed Central

    Long, Huaicong; O'Connor, Brian P.; Zemans, Rachel L.; Zhou, Xiaofang; Yang, Ivana V.; Schwartz, David A.

    2014-01-01

    The common, co-segregating Toll-like receptor 4 (TLR4) non-synonymous single nucleotide polymorphisms (SNPs), Asp299Gly and Thr399Ile, are associated with hyporesponsiveness to inhaled lipopolysaccharide (LPS) and increased susceptibility to Gram negative pathogens in humans. The purpose of this study was to identify the relative contributions of the Asp299Gly and the Thr399Ile variants in inhibiting the function of TLR4. 293/hMD2-CD14 cell line was transfected with lentiviral constructs containing human wild type (WT) TLR4-EGFP or TLR4-EGFP with Asp299Gly, Thr399Ile or Asp299Gly/Thr399Ile complementary DNA (cDNA). Multiple stable cell lines were established for each construct: three for WT TLR4, Asp299Gly, and Thr399Ile, and only two for Asp299Gly/Thr399Ile mutants and EGFP control. We did not observe a significant effect of polymorphisms on cell surface and intracellular TLR4 expression nor were there any significant differences in TLR4 and EGFP protein levels assessed by Western blotting and confocal microscopy among the multiple cell lines of each of the constructs. All cell lines had a dose-dependent responsiveness to LPS stimulation. However, compared to the WT TLR4, cells expressing TLR4 with Asp299Gly but not Thr399Ile polymorphism produced significantly less (P<0.05) IL-8 following LPS stimulation. Similarly, cells expressing TLR4 Asp299Gly but not Thr399Ile allele had significantly lower percentage of phosphorylated and total NF-κB P65 following LPS stimulation. While we could not do statistics on the Asp299Gly/Thr399Ile group, we observed a reduced responsiveness to LPS compared to WT TLR4. Taken together, we observed that the TLR4 Asp299Gly variant, but not the Thr399Ile variant, is responsible for impaired responsiveness of TLR4 to LPS and corresponding activation of NF-κB. PMID:24695807

  1. Impact of mutations in Toll-like receptor pathway genes on esophageal carcinogenesis.

    PubMed

    Fels Elliott, Daffolyn Rachael; Perner, Juliane; Li, Xiaodun; Symmons, Martyn F; Verstak, Brett; Eldridge, Matthew; Bower, Lawrence; O'Donovan, Maria; Gay, Nick J; Fitzgerald, Rebecca C

    2017-05-01

    Esophageal adenocarcinoma (EAC) develops in an inflammatory microenvironment with reduced microbial diversity, but mechanisms for these influences remain poorly characterized. We hypothesized that mutations targeting the Toll-like receptor (TLR) pathway could disrupt innate immune signaling and promote a microenvironment that favors tumorigenesis. Through interrogating whole genome sequencing data from 171 EAC patients, we showed that non-synonymous mutations collectively affect the TLR pathway in 25/171 (14.6%, PathScan p = 8.7x10-5) tumors. TLR mutant cases were associated with more proximal tumors and metastatic disease, indicating possible clinical significance of these mutations. Only rare mutations were identified in adjacent Barrett's esophagus samples. We validated our findings in an external EAC dataset with non-synonymous TLR pathway mutations in 33/149 (22.1%, PathScan p = 0.05) tumors, and in other solid tumor types exposed to microbiomes in the COSMIC database (10,318 samples), including uterine endometrioid carcinoma (188/320, 58.8%), cutaneous melanoma (377/988, 38.2%), colorectal adenocarcinoma (402/1519, 26.5%), and stomach adenocarcinoma (151/579, 26.1%). TLR4 was the most frequently mutated gene with eleven mutations in 10/171 (5.8%) of EAC tumors. The TLR4 mutants E439G, S570I, F703C and R787H were confirmed to have impaired reactivity to bacterial lipopolysaccharide with marked reductions in signaling by luciferase reporter assays. Overall, our findings show that TLR pathway genes are recurrently mutated in EAC, and TLR4 mutations have decreased responsiveness to bacterial lipopolysaccharide and may play a role in disease pathogenesis in a subset of patients.

  2. Impact of mutations in Toll-like receptor pathway genes on esophageal carcinogenesis

    PubMed Central

    Fels Elliott, Daffolyn Rachael; Perner, Juliane; Li, Xiaodun; Symmons, Martyn F.; Verstak, Brett; Bower, Lawrence; O’Donovan, Maria; Fitzgerald, Rebecca C.

    2017-01-01

    Esophageal adenocarcinoma (EAC) develops in an inflammatory microenvironment with reduced microbial diversity, but mechanisms for these influences remain poorly characterized. We hypothesized that mutations targeting the Toll-like receptor (TLR) pathway could disrupt innate immune signaling and promote a microenvironment that favors tumorigenesis. Through interrogating whole genome sequencing data from 171 EAC patients, we showed that non-synonymous mutations collectively affect the TLR pathway in 25/171 (14.6%, PathScan p = 8.7x10-5) tumors. TLR mutant cases were associated with more proximal tumors and metastatic disease, indicating possible clinical significance of these mutations. Only rare mutations were identified in adjacent Barrett’s esophagus samples. We validated our findings in an external EAC dataset with non-synonymous TLR pathway mutations in 33/149 (22.1%, PathScan p = 0.05) tumors, and in other solid tumor types exposed to microbiomes in the COSMIC database (10,318 samples), including uterine endometrioid carcinoma (188/320, 58.8%), cutaneous melanoma (377/988, 38.2%), colorectal adenocarcinoma (402/1519, 26.5%), and stomach adenocarcinoma (151/579, 26.1%). TLR4 was the most frequently mutated gene with eleven mutations in 10/171 (5.8%) of EAC tumors. The TLR4 mutants E439G, S570I, F703C and R787H were confirmed to have impaired reactivity to bacterial lipopolysaccharide with marked reductions in signaling by luciferase reporter assays. Overall, our findings show that TLR pathway genes are recurrently mutated in EAC, and TLR4 mutations have decreased responsiveness to bacterial lipopolysaccharide and may play a role in disease pathogenesis in a subset of patients. PMID:28531216

  3. Increased Expression Profile and Functionality of TLR6 in Peripheral Blood Mononuclear Cells and Hepatocytes of Morbidly Obese Patients with Non-Alcoholic Fatty Liver Disease

    PubMed Central

    Arias-Loste, María Teresa; Iruzubieta, Paula; Puente, Ángela; Ramos, David; Santa Cruz, Carolina; Estébanez, Ángel; Llerena, Susana; Alonso-Martín, Carmen; San Segundo, David; Álvarez, Lorena; López Useros, Antonio; Fábrega, Emilio; López-Hoyos, Marcos; Crespo, Javier

    2016-01-01

    Current evidence suggests that gut dysbiosis drives obesity and non-alcoholic fatty liver disease (NAFLD) pathogenesis. Toll-like receptor 2 (TLR2) and TLR6 specifically recognize components of Gram-positive bacteria. Despite the potential implications of TLR2 in NAFLD pathogenesis, the role of TLR6 has not been addressed. Our aim is to study a potential role of TLR6 in obesity-related NAFLD. Forty morbidly obese patients undergoing bariatric surgery were prospectively studied. Cell surface expression of TLR2 and TLR6 was assessed on peripheral blood mononuclear cells (PBMCs) by flow cytometry. Freshly isolated monocytes were cultured with specific TLR2/TLR6 agonists and intracellular production of cytokines was determined by flow-cytometry. In liver biopsies, the expression of TLR2 and TLR6 was analyzed by immunohistochemistry and cytokine gene expression using RT-qPCR. TLR6 expression in PBMCs from non-alcoholic steatohepatitis (NASH) patients was significantly higher when compared to those from simple steatosis. The production of pro-inflammatory cytokines in response to TLR2/TLR6 stimulation was also significantly higher in patients with lobular inflammation. Hepatocyte expression of TLR6 but not that of TLR2 was increased in NAFLD patients compared to normal liver histology. Deregulated expression and activity of peripheral TLR6 in morbidly obese patients can mirror the liver inflammatory events that are well known drivers of obesity-related NASH pathogenesis. Moreover, TLR6 is also significantly overexpressed in the hepatocytes of NAFLD patients compared to their normal counterparts. Thus, deregulated TLR6 expression may potentiate TLR2-mediated liver inflammation in NAFLD pathogenesis, and also serve as a potential peripheral biomarker of obesity-related NASH. PMID:27834919

  4. TLR4 mutant mice are protected from renal fibrosis and chronic kidney disease progression

    PubMed Central

    Souza, Ana C P; Tsuji, Takayuki; Baranova, Irina N; Bocharov, Alexander V; Wilkins, Kenneth J; Street, Jonathan M; Alvarez-Prats, Alejandro; Hu, Xuzhen; Eggerman, Thomas; Yuen, Peter S T; Star, Robert A

    2015-01-01

    Chronic kidney disease (CKD) is associated with persistent low-grade inflammation and immunosuppression. In this study we tested the role of Toll-like receptor 4, the main receptor for endotoxin (LPS), in a mouse model of renal fibrosis and in a model of progressive CKD that better resembles the human disease. C3HeJ (TLR4 mutant) mice have a missense point mutation in the TLR4 gene, rendering the receptor nonfunctional. In a model of renal fibrosis after folic acid injection, TLR4 mutant mice developed less interstititial fibrosis in comparison to wild-type (WT) mice. Furthermore, 4 weeks after 5/6 nephrectomy with continuous low-dose angiotensin II infusion, C3HeOuJ (TLR4 WT) mice developed progressive CKD with albuminuria, increased serum levels of BUN and creatinine, glomerulosclerosis, and interstitial fibrosis, whereas TLR4 mutant mice were significantly protected from CKD progression. TLR4 WT mice also developed low-grade systemic inflammation, splenocyte apoptosis and increased expression of the immune inhibitory receptor PD-1 in the spleen, which were not observed in TLR4 mutant mice. In vitro, endotoxin (LPS) directly upregulated NLRP3 inflammasome expression in renal epithelial cells via TLR4. In summary, TLR4 contributes to renal fibrosis and CKD progression, at least in part, via inflammasome activation in renal epithelial cells, and may also participate in the dysregulated immune response that is associated with CKD. PMID:26416975

  5. The Effect of Estradiol and Progesterone on Toll Like Receptor Gene Expression in A Human Fallopian Tube Epithelial Cell Line

    PubMed Central

    Zandieh, Zahra; Amjadi, Fatemehsadat; Ashrafi, Mahnaz; Aflatoonian, Abbas; Fazeli, Alireza; Aflatoonian, Reza

    2016-01-01

    Objective Toll like receptors (TLRs) are one of the main components of the innate im- mune system. It has been reported that expression of these receptors are altered in the female reproductive tract (FRT) during menstrual cycle. Here we used a fallopian tube epithelial cell line (OE-E6/E7) to evaluate the effect of two sex hormones in modulating TLR expression. Materials and Methods In this experimental study, initially TLR gene expression in OE- E6/E7 cells was evaluated and compared with that of fallopian tube tissue using quanti- tative real time-polymerase chain reaction (qRT-PCR) and immunostaining. Thereafter, OE-E6/E7 cells were cultured with different concentrations of estradiol and progesterone, and combination of both. qRT-PCR was performed to reveal any changes in expression of TLR genes as a result of hormonal treatment. Results TLR1-10 genes were expressed in human fallopian tube tissue. TLR1-6 genes and their respective proteins were expressed in the OE-E6/E7 cell line. Although estradiol and progesterone separately had no significant effect on TLR expression, their combined treatment altered the expression of TLRs in this cell line. Also, the pattern of TLR expres- sion in preovulation (P), mensturation (M) and window of implantation (W) were the same for all TLRs with no significant differences between P, M and W groups. Conclusion These data show the significant involvement of the combination of es- tradiol and progesterone in modulation of TLR gene expression in this human fal- lopian tube cell line. Further experiments may reveal the regulatory mechanism and signalling pathway behind the effect of sex hormones in modulating TLRs in the hu- man FRT. PMID:26862527

  6. Mice Deficient in Surfactant Protein A (SP-A) and SP-D or in TLR2 Manifest Delayed Parturition and Decreased Expression of Inflammatory and Contractile Genes

    PubMed Central

    Montalbano, Alina P.; Hawgood, Samuel

    2013-01-01

    Previously we obtained compelling evidence that the fetus provides a critical signal for the initiation of term labor through developmental induction of surfactant protein (SP)-A expression by the fetal lung and secretion into amniotic fluid (AF). We proposed that interactions of AF macrophage (Mφ) Toll-like receptors (TLRs) with SP-A, at term, or bacterial components, at preterm, result in their activation and migration to the pregnant uterus. Herein the timing of labor in wild-type (WT) C57BL/6 mice was compared with mice homozygous null for TLR2, SP-A, SP-D, or doubly deficient in SP-A and SP-D. Interestingly, TLR2−/− females manifested a significant (P < 0.001) delay in timing of labor compared with WT as well as reduced expression of the myometrial contraction-associated protein (CAP) gene, connexin-43, and Mφ marker, F4/80, at 18.5 d postcoitum (dpc). Whereas in first pregnancies, SP-A−/−, SP-D−/−, and SP-A/D−/− females delivered at term (∼19.5 dpc), in second pregnancies, parturition was delayed by approximately 12 h in SP-A−/− (P = 0.07) and in SP-A/D−/− (P <0.001) females. Myometrium of SP-A/D−/− females expressed significantly lower levels of IL-1β, IL-6, and CAP genes, connexin-43, and oxytocin receptor at 18.5 dpc compared with WT. F4/80+ AF Mφs from TLR2−/− and SP-A/D−/− mice expressed significantly lower levels of both proinflammatory and antiinflammatory activation markers (e.g. IL-1β, IL-6, ARG1, YM1) compared with gestation-matched WT AF Mφs. These novel findings suggest that the pulmonary collectins acting via TLR2 serve a modulatory role in the timing of labor; their relative impact may be dependent on parity. PMID:23183169

  7. Mutations in TLR/MYD88 pathway identify a subset of young chronic lymphocytic leukemia patients with favorable outcome.

    PubMed

    Martínez-Trillos, Alejandra; Pinyol, Magda; Navarro, Alba; Aymerich, Marta; Jares, Pedro; Juan, Manel; Rozman, María; Colomer, Dolors; Delgado, Julio; Giné, Eva; González-Díaz, Marcos; Hernández-Rivas, Jesús M; Colado, Enrique; Rayón, Consolación; Payer, Angel R; Terol, Maria José; Navarro, Blanca; Quesada, Victor; Puente, Xosé S; Rozman, Ciril; López-Otín, Carlos; Campo, Elías; López-Guillermo, Armando; Villamor, Neus

    2014-06-12

    Mutations in Toll-like receptor (TLR) and myeloid differentiation primary response 88 (MYD88) genes have been found in chronic lymphocytic leukemia (CLL) at low frequency. We analyzed the incidence, clinicobiological characteristics, and outcome of patients with TLR/MYD88 mutations in 587 CLL patients. Twenty-three patients (3.9%) had mutations, 19 in MYD88 (one with concurrent IRAK1 mutation), 2 TLR2 (one with concomitant TLR6 mutation), 1 IRAK1, and 1 TLR5. No mutations were found in IRAK2 and IRAK4. TLR/MYD88-mutated CLL overexpressed genes of the nuclear factor κB pathway. Patients with TLR/MYD88 mutations were significantly younger (83% age ≤50 years) than those with no mutations. TLR/MYD88 mutations were the most frequent in young patients. Patients with mutated TLR/MYD88 CLL had a higher frequency of mutated IGHV and low expression of CD38 and ZAP-70. Overall survival (OS) was better in TLR/MYD88-mutated than unmutated patients in the whole series (10-year OS, 100% vs 62%; P = .002), and in the subset of patients age ≤50 years (100% vs 70%; P = .02). In addition, relative OS of TLR/MYD88-mutated patients was similar to that in the age- and gender-matched population. In summary, TLR/MYD88 mutations identify a population of young CLL patients with favorable outcome.

  8. Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9

    PubMed Central

    Newman, Zachary R.; Young, Janet M.; Ingolia, Nicholas T.; Barton, Gregory M.

    2016-01-01

    The innate immune system detects diverse microbial species with a limited repertoire of immune receptors that recognize nucleic acids. The cost of this immune surveillance strategy is the potential for inappropriate recognition of self-derived nucleic acids and subsequent autoimmune disease. The relative expression of two closely related receptors, Toll-like receptor (TLR) 7 and TLR9, is balanced to allow recognition of microbial nucleic acids while limiting recognition of self-derived nucleic acids. Situations that tilt this balance toward TLR7 promote inappropriate responses, including autoimmunity; therefore, tight control of expression is critical for proper homeostasis. Here we report that differences in codon bias limit TLR7 expression relative to TLR9. Codon optimization of Tlr7 increases protein levels as well as responses to ligands, but, unexpectedly, these changes only modestly affect translation. Instead, we find that much of the benefit attributed to codon optimization is actually the result of enhanced transcription. Our findings, together with other recent examples, challenge the dogma that codon optimization primarily increases translation. We propose that suboptimal codon bias, which correlates with low guanine-cytosine (GC) content, limits transcription of certain genes. This mechanism may establish low levels of proteins whose overexpression leads to particularly deleterious effects, such as TLR7. PMID:26903634

  9. An efficient method for gene silencing in human primary plasmacytoid dendritic cells: silencing of the TLR7/IRF-7 pathway as a proof of concept

    PubMed Central

    Smith, Nikaïa; Vidalain, Pierre-Olivier; Nisole, Sébastien; Herbeuval, Jean-Philippe

    2016-01-01

    Plasmacytoid dendritic cells (pDC) are specialized immune cells that produce massive levels of type I interferon in response to pathogens. Unfortunately, pDC are fragile and extremely rare, rendering their functional study a tough challenge. However, because of their central role in numerous pathologies, there is a considerable need for an efficient and reproducible protocol for gene silencing in these cells. In this report, we tested six different methods for siRNA delivery into primary human pDC including viral-based, lipid-based, electroporation, and poly-ethylenimine (PEI) technologies. We show that lipid-based reagent DOTAP was extremely efficient for siRNA delivery into pDC, and did not induce cell death or pDC activation. We successfully silenced Toll-Like Receptor 7 (TLR7), CXCR4 and IFN regulatory factor 7 (IRF-7) gene expression in pDC as assessed by RT-qPCR or cytometry. Finally, we showed that TLR7 or IRF-7 silencing in pDC specifically suppressed IFN-α production upon stimulation, providing a functional validation of our transfection protocol. PMID:27412723

  10. TLR4 inactivation protects from graft-versus-host disease after allogeneic hematopoietic stem cell transplantation

    PubMed Central

    Zhao, Yi; Liu, Qiuyan; Yang, Li; He, Donghua; Wang, Lijuan; Tian, Jun; Li, Yi; Zi, Fuming; Bao, Hanying; Yang, Yang; Zheng, Yuanyuan; Shi, Jimin; Xue, Xingkui; Cai, Zhen

    2013-01-01

    Graft-versus-host disease (GVHD) is the most common complication after hematopoietic stem cell transplantation. To clarify the role of Toll-like receptor 4 (TLR4), which is a major receptor for bacterial lipopolysaccharides (LPS), in the development of acute GVHD, we used a TLR4-knockout (TLR4−/−) mouse GVHD model and analyzed the underlying immunological mechanisms. When TLR4−/− mice were used as bone marrow and splenocyte cell graft donors or recipients, GVHD symptom occurrence and mortality were delayed compared to wild-type (TLR4+/+) mice. In addition, histopathological analyses revealed that in TLR4−/−→BALB/c chimeras, liver and small intestine tissue damage was reduced with minimal lymphocytic infiltration. In contrast to TLR4+/+, TLR4−/− mice dendritic cells did not express CD80, CD86, CD40, MHC-II or IL-12 during LPS induction and remained in an immature state. Furthermore, the ability of TLR4−/− mice spleen dendritic cells to promote allogeneic T-cell proliferation and, in particular, T-helper cell 1 (Th1) development was obviously attenuated compared with TLR4+/+ mice dendritic cells, and the levels of interferon-γ (IFN-γ) and IL-10, Th2-cell specific cytokines, were significantly higher in the serum of TLR4−/−→BALB/c than in TLR4+/+→BALB/c chimeric mice. Overall, our data revealed that TLR4 may play a role in the pathogenesis of GVHD and that targeted TLR4 gene therapy might provide a new treatment approach to reduce the risk of GVHD. PMID:23262974

  11. The localization of Toll-like receptor 2 (TLR2) in the endometrium and the cervix of dogs at different stages of the oestrous cycle and with pyometra.

    PubMed

    Chotimanukul, S; Sirivaidyapong, S

    2012-12-01

    The aim of this study was to localize and evaluate the role of Toll-like receptor 2 (TLR2) in the endometrium and cervix of bitches at different stages of the oestrous cycle and in bitches with pyometra. Sixty-seven nulliparous dogs, ranging in age from 1 to 13 years, were allocated amongst five groups (pro-oestrus; n = 7, oestrus; n = 10, dioestrus; n = 16, anoestrus; n = 11, pyometra; n = 23). Blood samples were collected for the measurement of progesterone concentration. The mean progesterone concentration was analysed as a parameter for validating the stage of the oestrous cycle in bitches. Tissues collected from uterine horn and cervix were fixed in 4% paraformaldehyde for immunohistochemical examination of TLR2. The expression of TLR2 was assessed semi-quantitatively. No pathological changes were found in the uterine samples of healthy dogs. In bitches with pyometra, the glandular epithelium expressed TLR2 more intensely than the surface epithelium. The expression of TLR2 in the glandular epithelium was also significantly higher in healthy dogs at oestrus, dioestrus and dogs with pyometra compared with anoestrous dogs (p < 0.01). The expression of TLR2 in the stroma was not observed in the group of healthy dogs at all stages. The surface epithelium of cervix in dogs with pyometra expressed TLR2 significantly more intensely than did the stoma, whereas the expression of TLR2 during oestrus and dioestrus was absent in the stroma of cervix. This study provides the first report of immunohistochemical localization of TLR2 in the canine reproductive tract. In the present study, TLR2 was expressed in endometrial epithelium but was absent in the endometrial stroma of healthy dogs at all oestrous cycle stages. These findings suggest differential expression of TLR in endometrial cells. On the other hand, the lack of TLR2 in the stroma of healthy uteri of dogs may predispose to infection from the invading pathogens once the epithelial cells have been destroyed by the

  12. TLR3 deficiency impairs spinal cord synaptic transmission, central sensitization, and pruritus in mice

    PubMed Central

    Liu, Tong; Berta, Temugin; Xu, Zhen-Zhong; Park, Chul-Kyu; Zhang, Ling; Lü, Ning; Liu, Qin; Liu, Yang; Gao, Yong-Jing; Liu, Yen-Chin; Ma, Qiufu; Dong, Xinzhong; Ji, Ru-Rong

    2012-01-01

    Itch, also known as pruritus, is a common, intractable symptom of several skin diseases, such as atopic dermatitis and xerosis. TLRs mediate innate immunity and regulate neuropathic pain, but their roles in pruritus are elusive. Here, we report that scratching behaviors induced by histamine-dependent and -independent pruritogens are markedly reduced in mice lacking the Tlr3 gene. TLR3 is expressed mainly by small-sized primary sensory neurons in dorsal root ganglions (DRGs) that coexpress the itch signaling pathway components transient receptor potential subtype V1 and gastrin-releasing peptide. Notably, we found that treatment with a TLR3 agonist induces inward currents and action potentials in DRG neurons and elicited scratching in WT mice but not Tlr3–/– mice. Furthermore, excitatory synaptic transmission in spinal cord slices and long-term potentiation in the intact spinal cord were impaired in Tlr3–/– mice but not Tlr7–/– mice. Consequently, central sensitization–driven pain hypersensitivity, but not acute pain, was impaired in Tlr3–/– mice. In addition, TLR3 knockdown in DRGs also attenuated pruritus in WT mice. Finally, chronic itch in a dry skin condition was substantially reduced in Tlr3–/– mice. Our findings demonstrate a critical role of TLR3 in regulating sensory neuronal excitability, spinal cord synaptic transmission, and central sensitization. TLR3 may serve as a new target for developing anti-itch treatment. PMID:22565312

  13. TLR3 deficiency impairs spinal cord synaptic transmission, central sensitization, and pruritus in mice.

    PubMed

    Liu, Tong; Berta, Temugin; Xu, Zhen-Zhong; Park, Chul-Kyu; Zhang, Ling; Lü, Ning; Liu, Qin; Liu, Yang; Gao, Yong-Jing; Liu, Yen-Chin; Ma, Qiufu; Dong, Xinzhong; Ji, Ru-Rong

    2012-06-01

    Itch, also known as pruritus, is a common, intractable symptom of several skin diseases, such as atopic dermatitis and xerosis. TLRs mediate innate immunity and regulate neuropathic pain, but their roles in pruritus are elusive. Here, we report that scratching behaviors induced by histamine-dependent and -independent pruritogens are markedly reduced in mice lacking the Tlr3 gene. TLR3 is expressed mainly by small-sized primary sensory neurons in dorsal root ganglions (DRGs) that coexpress the itch signaling pathway components transient receptor potential subtype V1 and gastrin-releasing peptide. Notably, we found that treatment with a TLR3 agonist induces inward currents and action potentials in DRG neurons and elicited scratching in WT mice but not Tlr3(-/-) mice. Furthermore, excitatory synaptic transmission in spinal cord slices and long-term potentiation in the intact spinal cord were impaired in Tlr3(-/-) mice but not Tlr7(-/-) mice. Consequently, central sensitization-driven pain hypersensitivity, but not acute pain, was impaired in Tlr3(-/-) mice. In addition, TLR3 knockdown in DRGs also attenuated pruritus in WT mice. Finally, chronic itch in a dry skin condition was substantially reduced in Tlr3(-/-) mice. Our findings demonstrate a critical role of TLR3 in regulating sensory neuronal excitability, spinal cord synaptic transmission, and central sensitization. TLR3 may serve as a new target for developing anti-itch treatment.

  14. Molecular cloning, tissue distribution, and immune function of goose TLR7.

    PubMed

    Qi, Yulin; Chen, Shun; Zhao, Qiurong; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Cheng, Anchun

    2015-02-01

    TLR7 is a transmembrane endosomal protein that plays an essential role in innate antiviral responses via the recognition of conserved viral molecular patterns. Here, we cloned the full-length cDNA of goose TLR7 and carried out a molecular characterization of goose TLR7. The goose TLR7 gene is 3900 bp and encodes a 1045 amino acid protein with high homology to poultry (93% to duck and 83% to chicken). Similar conclusions were made by phylogenetic analysis. The predicted protein secondary structure of goose TLR7 contained a conserved Toll/interleukin-1 receptor domain and characteristic leucine-rich repeat regions, which has also been reported for duck TLR7. Additionally, the tissue distribution of goose TLR7 suggests that immune-associated tissues, especially the cecal tonsil and bursa of Fabricius, have high goose TLR7 expression levels. Goose TLR7 is abundantly expressed in lung tissues, which is distinct from its expression in chickens. Similar to duck TLR7, goose spleen mononuclear cells (MNCs) exposed to the mammalian TLR7 agonists R848 and Imiquimod showed significant induction of the production of proinflammatory cytokines and IFN-α. New type gosling viral enteritis virus (NGVEV) infection resulted in high mRNA expression levels of goose TLR7 in the spleen. By contrast, no direct interaction between NGVEV and goose TLR7 was detected after infecting goose spleen MNCs with NGVEV in vitro. However, triggering of goose TLR7 resulted in the rapid up-regulation of proinflammatory cytokines and anti-viral molecules, suggesting that goose TLR7 plays an important role in anti-viral defense. Copyright © 2014 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  15. Toll-like receptors and microbial exposure: gene-gene and gene-environment interaction in the development of atopy.

    PubMed

    Reijmerink, N E; Kerkhof, M; Bottema, R W B; Gerritsen, J; Stelma, F F; Thijs, C; van Schayck, C P; Smit, H A; Brunekreef, B; Postma, D S; Koppelman, G H

    2011-10-01

    Environmental and genetic factors contribute to atopy development. High microbial exposure may confer a protective effect on atopy. Toll-like receptors (TLRs) bind microbial products and are important in activating the immune system. To assess whether interactions between microbial exposures and genes encoding TLRs (and related genes) result in atopy, genes, environmental factors and gene-environment interactions of 66 single-nucleotide polymorphisms (SNPs) of 12 genes (TLR 1-6, 9 and 10, CD14, MD2, lipopolysaccharide-binding protein (LBP) and Dectin-1), and six proxy parameters of microbial exposure (sibship size, pets (three different parameters), day-care and intrauterine and childhood tobacco smoke exposure) were analysed for association with atopic phenotypes in 3,062 Dutch children (the Allergenic study). The presence of two or more older siblings increased the risk of developing high total immunoglobulin (Ig)E levels at different ages. This risk increased further in children aged 1-2 yrs carrying the minor allele of TLR6 SNP rs1039559. Furthermore, novel two- and three-factor gene-gene and gene-environment interactions were found (e.g. between sibship size, day-care and LBP SNP rs2232596). Larger sibship size is associated with increased total IgE levels. Furthermore, complex two- and three-factor interactions exist between genes and the environment. The TLRs and related genes interact with proxy parameters of high microbial exposure in atopy development.

  16. Vitamin K2 can suppress the expression of Toll-like receptor 2 (TLR2) and TLR4, and inhibit calcification of aortic intima in ApoE(-/-) mice as well as smooth muscle cells.

    PubMed

    Wang, Zhaojun; Wang, Zhongqun; Zhu, Jie; Long, Xinguang; Yan, Jinchuan

    2017-01-01

    Background and objectives Vascular calcification is a common complication in atherosclerosis. Accumulating evidence showed that Toll-like receptors (TLRs) mediate pro-inflammatory and atherosclerosis. Recent studies demonstrated that vascular calcification is one of the detrimental effects of vitamin K (Vit K) antagonists. However, the effects of Vit K on the expression of TLR2 and 4 and intimal calcification in artery remained unidentified. Methods and results Eighteen ApoE(-/-) mice were randomly divided into model group, Vit K-treated group, and control group. The mice of model and Vit K-treated group were fed with high-fat diet, while control group mice were fed with normal diet. Mice of Vit K-treated group were administered orally with vitamin K2 (40 mg.kg(-1).day(-1)) for 12 weeks. Twelve weeks later the aortic sections of mice were acquired and stained with hematoxylin and eosin and von Kossa, respectively. Calcium content and activity of alkaline phosphatase (ALP) at aortic tissues were measured. The expression levels of TLR2 and TLR4 in aorta sections were detected by immunohistochemisty and RT-PCR, respectively. The effects of Vit K on cellular calcification were further studied in A7r5 SMCs. Results demonstrated that high-fat diet induced typical atherosclerosis with intimal calcification in ApoE(-/-) mice, while in Vit K-treated group atherosclerosis and calcium deposits were not serious; Vit K2 also inhibited cellular calcification in A7r5 SMCs. Quantitative analysis showed that calcium and ALP activity at aortic tissues in the Vit K-treated mice were significantly lower than that of the model group ( P < 0.01); Compared to the control group, the expression levels of TLR2 and TLR4 in the model group were significantly higher ( P < 0.05), while in Vit K-treated group the levels of TLR2 and 4 were significantly lower than that in the model group. Furthermore, the content of calcium was positively related to the expression levels of TLR2 and TLR

  17. Epigenetic modification of TLR4 promotes activation of NF-κB by regulating methyl-CpG-binding domain protein 2 and Sp1 in gastric cancer

    PubMed Central

    Oh, Byung Moo; Lee, Heesoo; Uhm, Tae Gi; Min, Jeong-Ki; Park, Young-Jun; Yoon, Suk Ran; Kim, Bo-Yeon; Kim, Jong Wan; Choe, Yong-Kyung; Lee, Hee Gu

    2016-01-01

    Toll-like receptor 4 (TLR4) is important in promoting the immune response in various cancers. Recently, TLR4 is highly expressed in a stage-dependent manner in gastric cancer, but the regulatory mechanism of TLR4 expression has been not elucidated it. Here, we investigated the mechanism underlying regulation of TLR4 expression through promoter methylation and histone modification between transcriptional regulation and silencing of the TLR4 gene in gastric cancer cells. Chromatin immunoprecipitation was carried out to screen for factors related to TLR4 methylation such as MeCP2, HDAC1, and Sp1 on the TLR4 promoter. Moreover, DNA methyltransferase inhibitor 5-aza-deoxycytidine (5-aza-dC) induced demethylation of the TLR4 promoter and increased H3K4 trimethylation and Sp1 binding to reactivate silenced TLR4. In contrast, although the silence of TLR4 activated H3K9 trimethylation and MeCP2 complex, combined treatment with TLR4 agonist and 5-aza-dC upregulated H3K4 trimethylation and activated with transcription factors as Sp1 and NF-κB. This study demonstrates that recruitment of the MeCP2/HDAC1 repressor complex increases the low levels of TLR4 expression through epigenetic modification of DNA and histones on the TLR4 promoter, but Sp1 activates TLR4 high expression by hypomethylation and NF-κB signaling in gastric cancer cells. PMID:26675260

  18. High toll-like receptor (TLR) 9 expression is associated with better prognosis in surgically treated pancreatic cancer patients.

    PubMed

    Leppänen, Joni; Helminen, Olli; Huhta, Heikki; Kauppila, Joonas H; Isohookana, Joel; Haapasaari, Kirsi-Maria; Lehenkari, Petri; Saarnio, Juha; Karttunen, Tuomo J

    2017-04-01

    Pancreatic cancer remains one of the deadliest malignancies in the world. Inflammatory response and tumor environment are thought to play a major role in its pathogenesis. Knowledge on TLR expression and impact on patient survival in pancreatic cancer is limited. The study's aim was to clarify the role of different TLRs in pancreatic cancer. TLR2, TLR4, and TLR9 expression was investigated in 65 surgically resected pancreatic ductal adenocarcinoma specimens by immunohistochemistry. The association between TLR expression, clinical parameters, and local inflammatory response to the tumor was assessed using chi-square test. Relation between patient survival and TLR expression was calculated with multivariable Cox regression, adjusted for age, sex, and tumor stage. We found TLR2, TLR4, and TLR9 to be expressed in pancreatic cancer. There was no association between TLR expression and tumor stage, tumor size, lymph node metastasis, or tumor necrosis. Contrary to our initial hypothesis, high cytoplasmic TLR9 expression was associated with longer patient survival, and multivariate analysis identified low TLR9 expression as an independent risk factor for cancer-specific death (HR 3.090, 95% CI 1.673-5.706). The results suggest that high TLR9 expression in pancreatic ductal adenocarcinoma indicates improved prognosis. The prognostic effect of TLR9 might be associated with bacterial exposure, but this needs further evidence.

  19. Copy Number Variation of TLR-7 Gene and its Association with the Development of Systemic Lupus Erythematosus in Female Patients from Yucatan Mexico

    PubMed Central

    Pacheco, Guillermo Valencia; Cruz, Darig Cámara; González Herrera, Lizbeth J; Pérez Mendoza, Gerardo J; Adrián Amaro, Guadalupe I; Nakazawa Ueji, Yumi E; Angulo Ramírez, Angélica V

    2014-01-01

    Systemic lupus erythematosus (SLE) is a systemic autoimmune disease characterized by the production of autoantibodies against self-antigens, which occurs most often in women between 15 and 40 years of age. The innate immunity is involved in the pathogenesis of SLE through TLR- 7. Genetic factors such as copy number variation (CNV) of target genes may contribute to disease development, but this possible risk has not yet been studied in SLE patients from Yucatan, Mexico. The CNV of TLR-7 gene was determined by quantitative polymerase chain reaction assay using TaqMan probes in 80 SLE women and 150 control subjects. The results showed that 10% of SLE patients exhibited more than two copies of TLR-7 gene, whereas no mRNA overexpression was detected. These data suggested that increased CNV of the TLR-7 gene in Yucatan SLE women can be a risk factor for this disease. PMID:25512712

  20. Investigation of the role of endosomal Toll-like receptors in murine collagen-induced arthritis reveals a potential role for TLR7 in disease maintenance

    PubMed Central

    2012-01-01

    Introduction Endosomal toll-like receptors (TLRs) have recently emerged as potential contributors to the inflammation observed in human and rodent models of rheumatoid arthritis (RA). This study aims to evaluate the role of endosomal TLRs and in particular TLR7 in the murine collagen induced arthritis (CIA) model. Methods CIA was induced by injection of collagen in complete Freund's adjuvant. To investigate the effect of endosomal TLRs in the CIA model, mianserin was administered daily from the day of disease onset. The specific role of TLR7 was examined by inducing CIA in TLR7-deficient mice. Disease progression was assessed by measuring clinical score, paw swelling, serum anti-collagen antibodies histological parameters, cytokine production and the percentage of T regulatory (Treg) cells. Results Therapeutic administration of mianserin to arthritic animals demonstrated a highly protective effect on paw swelling and joint destruction. TLR7-/- mice developed a mild arthritis, where the clinical score and paw swelling were significantly compromised in comparison to the control group. The amelioration of arthritis by mianserin and TLR7 deficiency both corresponded with a reduction in IL-17 responses, histological and clinical scores, and paw swelling. Conclusions These data highlight the potential role for endosomal TLRs in the maintenance of inflammation in RA and support the concept of a role for TLR7 in experimental arthritis models. This study also illustrates the potential benefit that may be afforded by therapeutically inhibiting the endosomal TLRs in RA. PMID:22691272

  1. Whole blood stimulation with Toll-like receptor (TLR)-7/8 and TLR-9 agonists induces interleukin-12p40 expression in plasmacytoid dendritic cells in rhesus macaques but not in humans.

    PubMed

    Koopman, G; Beenhakker, N; Burm, S; Bouwhuis, O; Bajramovic, J; Sommandas, V; Mudde, G; Mooij, P; 't Hart, B A; Bogers, W M J M

    2013-10-01

    Macaques provide important animal models in biomedical research into infectious and chronic inflammatory disease. Therefore, a proper understanding of the similarities and differences in immune function between macaques and humans is needed for adequate interpretation of the data and translation to the human situation. Dendritic cells are important as key regulators of innate and adaptive immune responses. Using a new whole blood assay we investigated functional characteristics of blood plasmacytoid dendritic cells (pDC), myeloid dendritic cells (mDC) and monocytes in rhesus macaques by studying induction of activation markers and cytokine expression upon Toll-like receptor (TLR) stimulation. In a head-to-head comparison we observed that rhesus macaque venous blood contained relatively lower numbers of pDC than human venous blood, while mDC and monocytes were present at similar percentages. In contrast to humans, pDC in rhesus macaques expressed the interleukin (IL)-12p40 subunit in response to TLR-7/8 as well as TLR-9 stimulation. Expression of IL-12p40 was confirmed by using different monoclonal antibodies and by reverse transcription-polymerase chain reaction (RT-PCR). Both in humans and rhesus macaques, TLR-4 stimulation induced IL-12p40 expression in mDC and monocytes, but not in pDC. The data show that, in contrast to humans, pDC in macaques are able to express IL-12p40, which could have consequences for evaluation of human vaccine candidates and viral infection.

  2. Effects of a traditional Chinese medicine, Longdanxiegan formula granule, on Toll-like receptor pathway in female guinea pigs with recurrent genital herpes.

    PubMed

    Kuang, Lin; Deng, Yihui; Liu, Xiaodan; Zou, Zhixiang; Mi, Lan

    2016-04-01

    The aim of the present study was to investigate the effects of Longdanxiegan formula granule (LDXGFG), a Chinese traditional medicine on Toll-like receptor (TLR) pathway in recurrent genital herpes. An experimental recurrent genital herpes model was constructed using herpes guinea pig model. The effect of LDXGFG on expression levels of TLR pathway genes were detected using real-time polymerase chain reaction. Furthermore, the dendritic cells and Langerhans cells were isolated and the TLR pathway genes of these cells were assayed after LDXGFG treatment. The result suggested two different expression patterns of TLR pathway genes in genital herpes and recurrent genital herpes, including upregulated genes and downregulated genes. TLR1, TLR4, TLR6, TLR7, TLR8, TLR9, and TLR10 showed a significant decrease while, TLR2, TLR3, and TLR5 increased in genital herpes and recurrent genital herpes guinea pigs. Meanwhile, the downregulated genes in genital herpes and recurrent genital herpes were stimulated by LDXGFG. By contrast, the upregulated genes decreased significantly after LDXGFG treatment. In both dendritic cells and Langerhans cells, the TLR pathway genes exhibited same pattern: the LDXGFG corrected the abnormal expression of TLR pathway genes. The present results suggest that LDXGFG is an alternative, inexpensive, and lasting-effect medicine for herpes simplex virus 2 infection. Copyright © 2016. Published by Elsevier B.V.

  3. CD14 Is a Co-Receptor for TLR4 in the S100A9-Induced Pro-Inflammatory Response in Monocytes

    PubMed Central

    He, Zhifei; Riva, Matteo; Björk, Per; Swärd, Karl; Mörgelin, Matthias; Leanderson, Tomas; Ivars, Fredrik

    2016-01-01

    The cytosolic Ca2+-binding S100A9 and S100A8 proteins form heterodimers that are primarily expressed in human neutrophils and monocytes. We have recently shown that S100A9 binds to TLR4 in vitro and induces TLR4-dependent NF-κB activation and a pro-inflammatory cytokine response in monocytes. In the present report we have further investigated the S100A9-mediated stimulation of TLR4 in monocytes. Using transmission immunoelectron microscopy, we detected focal binding of S100A9 to monocyte membrane subdomains containing the caveolin-1 protein and TLR4. Furthermore, the S100A9 protein was detected in early endosomes of the stimulated cells, indicating that the protein could be internalized by endocytosis. Although stimulation of monocytes with S100A9 was strictly TLR4-dependent, binding of S100A9 to the plasma membrane and endocytosis of S100A9 was still detectable and coincided with CD14 expression in TLR4-deficient cells. We therefore investigated whether CD14 would be involved in the TLR4-dependent stimulation and could show that the S100A9-induced cytokine response was inhibited both in CD14-deficient cells and in cells exposed to CD14 blocking antibodies. Further, S100A9 was not internalized into CD14-deficient cells suggesting a direct role of CD14 in endocytosis of S100A9. Finally, we could detect satiable binding of S100A9 to CD14 in surface plasmon resonance experiments. Taken together, these results indicate that CD14 is a co-receptor of TLR4 in the S100A9-induced cytokine response. PMID:27228163

  4. Epigallocatechin gallate (EGCG) suppresses lipopolysaccharide-induced Toll-like receptor 4 (TLR4) activity via 67 kDa laminin receptor (67LR) in 3T3-L1 adipocytes.

    PubMed

    Bao, Suqing; Cao, Yanli; Zhou, Haicheng; Sun, Xin; Shan, Zhongyan; Teng, Weiping

    2015-03-18

    Obesity-related insulin resistance is associated with chronic systemic low-grade inflammation, and toll-like receptor 4 (TLR4) regulates inflammation. We investigated the pathways involved in epigallocatechin gallate (EGCG) modulation of insulin and TLR4 signaling in adipocytes. Inflammation was induced in adipocytes by lipopolysaccharide (LPS). An antibody against the 67 kDa laminin receptor (67LR, to which EGCG exclusively binds) was used to examine the effect of EGCG on TLR4 signaling, and a TLR4/MD-2 antibody was used to inhibit TLR4 activity and to determine the insulin sensitivity of differentiated 3T3-L1 adipocytes. We found that EGCG dose-dependently inhibited LPS stimulation of adipocyte inflammation by reducing inflammatory mediator and cytokine levels (IKKβ, p-NF-κB, TNF-α, and IL-6). Pretreatment with the 67LR antibody prevented EGCG inhibition of inflammatory cytokines, decreased glucose transporter isoform 4 (GLUT4) expression, and inhibited insulin-stimulated glucose uptake. TLR4 inhibition attenuated inflammatory cytokine levels and increased glucose uptake by reversing GLUT4 levels. These data suggest that EGCG suppresses TLR4 signaling in LPS-stimulated adipocytes via 67LR and attenuates insulin-stimulated glucose uptake associated with decreased GLUT4 expression.

  5. Emerging Bordetella pertussis Strains Induce Enhanced Signaling of Human Pattern Recognition Receptors TLR2, NOD2 and Secretion of IL-10 by Dendritic Cells

    PubMed Central

    Hovingh, Elise S.; van Gent, Marjolein; Hamstra, Hendrik-Jan; Demkes, Marc; Mooi, Frits R.; Pinelli, Elena

    2017-01-01

    Vaccines against pertussis have been available for more than 60 years. Nonetheless, this highly contagious disease is reemerging even in countries with high vaccination coverage. Genetic changes of Bordetella pertussis over time have been suggested to contribute to the resurgence of pertussis, as these changes may favor escape from vaccine-induced immunity. Nonetheless, studies on the effects of these bacterial changes on the immune response are limited. Here, we characterize innate immune recognition and activation by a collection of genetically diverse B. pertussis strains isolated from Dutch pertussis patients before and after the introduction of the pertussis vaccines. For this purpose, we used HEK-Blue cells transfected with human pattern recognition receptors TLR2, TLR4, NOD2 and NOD1 as a high throughput system for screening innate immune recognition of more than 90 bacterial strains. Physiologically relevant human monocyte derived dendritic cells (moDC), purified from peripheral blood of healthy donors were also used. Findings indicate that, in addition to inducing TLR2 and TLR4 signaling, all B. pertussis strains activate the NOD-like receptor NOD2 but not NOD1. Furthermore, we observed a significant increase in TLR2 and NOD2, but not TLR4, activation by strains circulating after the introduction of pertussis vaccines. When using moDC, we observed that the recently circulating strains induced increased activation of these cells with a dominant IL-10 production. In addition, we observed an increased expression of surface markers including the regulatory molecule PD-L1. Expression of PD-L1 was decreased upon blocking TLR2. These in vitro findings suggest that emerging B. pertussis strains have evolved to dampen the vaccine-induced inflammatory response, which would benefit survival and transmission of this pathogen. Understanding how this disease has resurged in a highly vaccinated population is crucial for the design of improved vaccines against pertussis

  6. PPARγ ameliorated LPS induced inflammation of HEK cell line expressing both human Toll-like receptor 4 (TLR4) and MD2.

    PubMed

    Darehgazani, Reyhaneh; Peymani, Maryam; Hashemi, Motahare-Sadat; Omrani, Mir Davood; Movafagh, Abolfazl; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

    2016-08-01

    TLR4 is transmembrane pattern-recognition receptor that initiates signals in response to diverse pathogen-associated molecular patterns especially LPS. Recently, there have been an increasing number of studies about the role of TLRs in the pathogenesis of several disorders as well as the therapeutic potential of TLR intervention in such diseases. Peroxisome proliferator-activated receptor-gamma (PPARγ) is a ligand-activated transcription factor with numerous biological effects. PPARγ has been shown to exert a potential anti-inflammatory effect through suppression of TLR4-mediated inflammation. Therefore, PPARγ agonists may have a potential to combat inflammatory conditions in pathologic states. The current study aims to show the decrease of inflammation by overexpression of PPARγ in a cell reporter model. To reach this goal, recombinant pBudCE4.1 (+) containing encoding sequences of human TLR4 and MD2 was constructed and used to transfect HEK cells. Subsequently, inflammation was induced by LPS treatment as control group. In the treatment group, overexpression of PPARγ prior to inflammation was performed and the expression of inflammatory markers was assessed in this condition. The expression of inflammatory markers (TNFα and iNOS) was defined by quantitative real time PCR and the amount of phosphorylated NF-κB was measured by western blot. Data indicated expression of TNFα and iNOS increased in LPS induced inflammation of stably transformed HEK cells with MD2 and TLR4. In this cell reporter model overexpression of PPARγ dramatically prevented LPS-induced inflammation through the blocking of TLR4/NF-κB signaling. PPARγ was shown to negatively regulate TLR4 activity and therefore exerts its anti-inflammatory action against LPS induced inflammation.

  7. Lectin-like ox-LDL receptor-1 (LOX-1)-Toll-like receptor 4 (TLR4) interaction and autophagy in CATH.a differentiated cells exposed to angiotensin II.

    PubMed

    Ding, Zufeng; Liu, Shijie; Wang, Xianwei; Khaidakov, Magomed; Dai, Yao; Deng, Xiaoyan; Fan, Yubo; Xiang, David; Mehta, Jawahar L

    2015-04-01

    Toll-like receptors (TLRs) play an essential role in innate immune response. Expression of TLRs has also been linked to autophagy. As the main receptor for oxidized low-density lipoprotein (ox-LDL) on the cell surface, lectin-like ox-LDL receptor-1 (LOX-1) is upregulated by proinflammatory cytokines and has been linked to the development of autophagy. However, the relationship between LOX-1, autophagy, and TLR4 in neurons has not been defined. Here, we show that Angiotensin II (Ang II) treatment of CATH.a differentiated neuronal cells resulted in the expression of TLR4 (and associated signals MyD88 and Toll/interleukin-1 receptor domain-containing adapter-inducing interferon (TRIF)), LOX-1 autophagy. LOX-1 knockdown (transfection with specific small interfering RNA (siRNA)) resulted in reduced expression of TLR4 (and associated signals MyD88 and TRIF) and P-P38 mitogen-activated protein kinase (MAPK) and autophagy. TLR4 knockdown with siRNA resulted in reduced LOX-1 expression and autophagy, indicating a positive feedback between LOX-1 and TLR4. Knockdown of TRIF as well as MyD88 or inhibition of P38 MAPK also inhibited the expression of LOX-1 and TLR4 and autophagy. Importantly, pretreatment with 3-methyladenine (autophagy inhibitor) enhanced while rapamycin (autophagy inducer) decreased the expression of LOX-1, TLR4, and P-P38 MAPK. These studies suggest the presence of a bidirectional link between LOX-1and TLR4 in cultured CATH.a differentiated cells exposed to Ang II with an important role for autophagy in this link.

  8. Role of Toll-like receptors and retinoic acid inducible gene I in endogenous production of type I interferon in dermatomyositis.

    PubMed

    Li, Ling; Dai, Tingjun; Lv, Jingwei; Ji, Kunqian; Liu, Junling; Zhang, Bin; Yan, Chuanzhu

    2015-08-15

    To explore the possible mechanisms implicated in the endogenous production of type I interferons within the muscle tissue of dermatomyositis (DM) patients. We detected the co-localization of plasmacytoid dendritic cells (pDCs) with Toll-like receptors (TLRs) and retinoic acid inducible gene (RIG)-I by immunohistochemistry and immunofluorescence. Western blotting confirmed the expression of TLRs and RIG-I. TLR-3 and RIG-I was preferentially expressed in the perifascicular atrophy fibers of DM. TLR-7 was only in inflammatory infiltrates of a few DM patients. TLR-4 and TLR-9 was expressed mainly in inflammatory infiltrates. Immunofluorescence showed extensive co-localization of BDCA-2 with TLR-9 and little co-localization with TLR-7. Western blotting showed upregulation of expression of TLRs and RIG-I in DM compared with the controls. Our findings indicate that endogenous production of type I IFN in DM is generated by pDCs, mainly through the TLR-9 pathway and in part by TLR-7. TLR-3 and RIG-I are implicated in the formation of perifascicular atrophy in DM.

  9. Study of TLR3, TLR4 and TLR9 in breast carcinomas and their association with metastasis

    PubMed Central

    2010-01-01

    Background Toll-like receptors (TLRs) have garnered an extraordinary amount of interest in cancer research due to their role in tumor progression. By activating the production of several biological factors, TLRs induce type I interferons and other cytokines, which drive an inflammatory response and activate the adaptive immune system. The aim of this study was to investigate the expression and clinical relevance of TLR3, 4 and 9 in breast cancer. Methods The expression levels of TLR3, TLR4 and TLR9 were analyzed on tumors from 74 patients with breast cancer. The analysis was performed by immunohistochemistry. Results Samples of carcinomas with recurrence exhibited a significant increase in the mRNA levels of TLR3, TLR4 and TLR9. Tumors showed high expression of TLRs expression levels by cancer cells, especially TLR4 and 9. Nevertheless, a significant percentage of tumors also showed TLR4 expression by mononuclear inflammatory cells (21.6%) and TLR9 expression by fibroblast-like cells (57.5%). Tumors with high TLR3 expression by tumor cell or with high TLR4 expression by mononuclear inflammatory cells were significantly associated with higher probability of metastasis. However, tumours with high TLR9 expression by fibroblast-like cells were associated with low probability of metastasis. Conclusions The expression levels of TLR3, TLR4 and TLR9 have clinical interest as indicators of tumor aggressiveness in breast cancer. TLRs may represent therapeutic targets in breast cancer. PMID:21129170

  10. TLR2 — EDRN Public Portal

    Cancer.gov

    TLR2, or toll-like receptor 2, is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLR2 is involved in the innate immune response to bacterial lipoproteins and other microbial cell wall components. TLR2 also plays a role in NF-kappa-B activation, cytokine secretion and the inflammatory response.

  11. Orostachys japonicus Inhibits Expression of the TLR4, NOD2, iNOS, and COX-2 Genes in LPS-Stimulated Human PMA-Differentiated THP-1 Cells by Inhibiting NF-κB and MAPK Activation

    PubMed Central

    Woo, Hong-Jung; Kim, Youngchul

    2015-01-01

    Orostachys japonicus is traditionally used as an inflammatory agent. In this report, we investigated the effects of O. japonicus extract on the expression of genes encoding pathogen-recognition receptors (TLR2, TLR4, NOD1, and NOD2) and proinflammatory factors (iNOS, COX-2, and cytokines) in LPS-stimulated PMA-differentiated THP-1 cells and the NF-κB and MAPK pathways. O. japonicus induced toxicity at high concentrations but had no effect at concentrations lower than 25 μg/mL. O. japonicus inhibited LPS-induced TLR4 and NOD2 mRNA levels, suppressed LPS-induced iNOS and COX-2 transcription and translocation, and downregulated LPS-induced proinflammatory cytokine (IL-1β, IL-6, IL-8, and TNF-α) mRNA levels. In addition, O. japonicus inhibited LPS-induced NF-κB activation and IκBα degradation and suppressed LPS-induced JNK, p38 MAPK, and ERK phosphorylation. Overall, our results demonstrate that the anti-inflammatory effects of O. japonicus are mediated by suppression of NF-κB and MAPK signaling, resulting in reduced TLR4, NOD2, iNOS, and COX-2 expression and inhibition of inflammatory cytokine expression. PMID:25810745

  12. The autoimmunity-associated gene PTPN22 potentiates toll-like receptor-driven, type 1 interferon-dependent immunity.

    PubMed

    Wang, Yaya; Shaked, Iftach; Stanford, Stephanie M; Zhou, Wenbo; Curtsinger, Julie M; Mikulski, Zbigniew; Shaheen, Zachary R; Cheng, Genhong; Sawatzke, Kristy; Campbell, Amanda M; Auger, Jennifer L; Bilgic, Hatice; Shoyama, Fernanda M; Schmeling, David O; Balfour, Henry H; Hasegawa, Kiminori; Chan, Andrew C; Corbett, John A; Binstadt, Bryce A; Mescher, Matthew F; Ley, Klaus; Bottini, Nunzio; Peterson, Erik J

    2013-07-25

    Immune cells sense microbial products through Toll-like receptors (TLR), which trigger host defense responses including type 1 interferons (IFNs) secretion. A coding polymorphism in the protein tyrosine phosphatase nonreceptor type 22 (PTPN22) gene is a susceptibility allele for human autoimmune and infectious disease. We report that Ptpn22 selectively regulated type 1 IFN production after TLR engagement in myeloid cells. Ptpn22 promoted host antiviral responses and was critical for TLR agonist-induced, type 1 IFN-dependent suppression of inflammation in colitis and arthritis. PTPN22 directly associated with TNF receptor-associated factor 3 (TRAF3) and promotes TRAF3 lysine 63-linked ubiquitination. The disease-associated PTPN22W variant failed to promote TRAF3 ubiquitination, type 1 IFN upregulation, and type 1 IFN-dependent suppression of arthritis. The findings establish a candidate innate immune mechanism of action for a human autoimmunity "risk" gene in the regulation of host defense and inflammation.

  13. Expression of TLR2 and TLR4 in murine small intestine during postnatal development.

    PubMed

    Inoue, Ryo; Yajima, Takaji; Tsukahara, Takamitsu

    2017-02-01

    The important role played by the gut microbiota in host immunity is mediated, in part, through toll-like receptors (TLRs). We evaluated the postnatal changes in expression of TLR2 and TLR4 in the murine small intestine and assessed how expression is influenced by gut microbiota. The expression of TLR2 and TLR4 in the murine small intestine was highly dynamic during development. The changes were especially profound during the suckling period, with the maximal mRNA levels detected in the mid-suckling period. Immunohistochemical and flow-cytometric analyses indicated that the changes in TLR2 and TLR4 expression involve primarily epithelial cells. The germ-free mice showed minor changes in TLR2/TLR4 mRNA and TLR2 protein during the suckling period. This study demonstrated that the postnatal expression of TLR2 and TLR4 in small intestinal epithelial cells is dynamic and depends on the presence of commensal intestinal microbiota.

  14. B cell-intrinsic TLR7 signaling is essential for the development of spontaneous germinal centers

    PubMed Central

    Soni, Chetna; Wong, Eric B.; Domeier, Phillip P.; Khan, Tahsin N.; Satoh, Takashi; Akira, Shizuo; Rahman, Ziaur S.M.

    2014-01-01

    Spontaneous germinal center (Spt-GC) B cells and follicular helper T cells (Tfh) generate high affinity autoantibodies involved in the development of systemic lupus erythematosus (SLE). Toll like receptors (TLRs) play a pivotal role in SLE pathogenesis. While previous studies have focused on the B cell intrinsic role of TLR-MyD88 signaling on immune activation, autoantibody repertoire and systemic inflammation, a thorough investigation of the mechanisms by which TLRs control the formation of Spt-GCs remains unclear. Using non-autoimmune C57BL/6 (B6) mice deficient in MyD88, TLR2, 3, 4, 7 or 9, we identified B cell-intrinsic TLR7 signaling as a prerequisite to Spt-GC formation without the confounding effects of autoimmune susceptibility genes and the overexpression of TLRs. TLR7 deficiency also rendered autoimmune B6.Sle1b mice unable to form Spt-GCs, leading to markedly decreased autoantibodies. Conversely, B6.yaa and B6.Sle1b.yaa mice expressing an extra copy of TLR7 and B6.Sle1b mice treated with a TLR7 agonist had increased Spt-GCs and Tfh. Further, TLR7/ MyD88 deficiency led to compromised B cell proliferation and survival after B cell stimulation both in vitro and in vivo. In contrast, TLR9 inhibited Spt-GC development. Our findings demonstrate an absolute requirement of TLR7 and a negative regulatory function for TLR9 in Spt-GC formation under non-autoimmune and autoimmune conditions. Our data suggest that, under non-autoimmune conditions, Spt-GCs initiated by TLR7 produce protective antibodies. However, in the presence of autoimmune susceptibility genes, TLR7 dependent Spt-GCs produce pathogenic autoantibodies. Thus, a single copy of TLR7 in B cells is the minimal requirement for breaking the GC-tolerance checkpoint. PMID:25252960

  15. Tissue factor and Toll-like receptor (TLR)4 in hyperglycaemia-hyperinsulinaemia. Effects in healthy subjects, and type 1 and type 2 diabetes mellitus.

    PubMed

    Singh, Anamika; Boden, Guenther; Rao, A Koneti

    2015-04-01

    Diabetes mellitus (DM) patients have an increased incidence of cardiovascular events. Blood tissue factor-procoagulant activity (TF-PCA), the initiating mechanism for blood coagulation, is elevated in DM. We have shown that hyperglycaemia (HG), hyperinsulinaemia (HI) and combined HG+HI (induced using 24-hour infusion clamps) increases TF-PCA in healthy and type 2 DM (T2DM) subjects, but not in type 1 DM (T1DM) subjects. The mechanisms for this are unknown. DM patients have elevated plasma lipopolysaccharide (LPS), a toll-like receptor (TLR) 4 ligand. We postulated that TLR4 plays a role in modulating TF levels. We studied the effect of HG+HI on TLR4 and TF-PCA in vivo during 24-hour HG+HI infusion clamps in healthy subjects, and T1DM and T2DM subjects, and in vitro in blood. In vivo, in healthy subjects, 24-hour HG + HI infusion increased TLR4 six-fold, which correlated with TF-PCA (r= 0.91, p<0.0001). T2DM patients showed smaller increases in both. In T1DM subjects, TLR4 declined (50%, p<0.05) and correlated with TF-PCA (r=0.55; p<0.05). In vitro, HG (200 mg/dl added glucose) and HI (1-100 nM added insulin) increased TF-PCA in healthy subjects (~2-fold, 2-4 hours). Insulin inhibited by ~30% LPS-induced increase in TF-PCA and high glucose reversed it. TLR4 levels paralleled TF-PCA (r=0.71, p<0.0001); HG and HI increased TLR4 and insulin inhibited LPS-induced TLR4 increase. This is first evidence that even in healthy subjects, HG of short duration increases TLR4 and TF-PCA, key players in inflammation and thrombosis. TLR4-TF interplay is strikingly different in non-diabetic, T1DM and T2DM subjects.

  16. Post-traumatic anxiety associates with failure of the innate immune receptor TLR9 to evade the pro-inflammatory NFκB pathway

    PubMed Central

    Zimmerman, G; Shaltiel, G; Barbash, S; Cohen, J; Gasho, C J; Shenhar-Tsarfaty, S; Shalev, H; Berliner, S A; Shelef, I; Shoham, S; Friedman, A; Cohen, H; Soreq, H

    2012-01-01

    Post-traumatic anxiety notably involves inflammation, but its causes and functional significance are yet unclear. Here, we report that failure of the innate immune system Toll-like receptor 9 (TLR9) to limit inflammation is causally involved with anxiety-associated inflammation and that peripheral administration of specific oligonucleotide activators of TLR9 may prevent post-traumatic consequences in stressed mice. Suggesting involvement of NFκB-mediated enhancement of inflammatory reactions in the post-traumatic phenotype, we found association of serum interleukin-1β increases with symptoms severity and volumetric brain changes in post-traumatic stress disorder patients. In predator scent-stressed mice, the moderate NFκB-activating oligonucleotides mEN101 and its human ortholog BL-7040, but not the canonic NFκB activator oligonucleotide ODN1826, induced anxiolytic effects. In stressed mice, peripherally administered mEN101 prevented delayed stress-inducible serum interleukin-1β increases while limiting stress-characteristic hippocampal transcript modifications and the anxiety-induced EGR1-mediated neuronal activation. Attesting to the TLR9 specificity of this response, BL-7040 suppressed NFκB-mediated luciferase in transfected cells co-expressing TLR9, but not other TLRs. Furthermore, TLR9−/− mice were mEN101 and BL-7040 resistant and presented unprovoked anxiety-like behavior and anxiety-characteristic hippocampal transcripts. Our findings demonstrate functional relevance of TLR9 in protecting stressed mammals from overreacting to traumatic experiences and suggest using oligonucleotide-mediated peripheral TLR9 activation to potentiate the innate immune system and prevent post-traumatic inflammation and anxiety. PMID:22832815

  17. Mechanism of bacterial interference with TLR4 signaling by Brucella Toll/interleukin-1 receptor domain-containing protein TcpB.

    PubMed

    Alaidarous, Mohammed; Ve, Thomas; Casey, Lachlan W; Valkov, Eugene; Ericsson, Daniel J; Ullah, M Obayed; Schembri, Mark A; Mansell, Ashley; Sweet, Matthew J; Kobe, Bostjan

    2014-01-10

    Upon activation of Toll-like receptors (TLRs), cytoplasmic Toll/interleukin-1 receptor (TIR) domains of the receptors undergo homo- or heterodimerization. This in turn leads to the recruitment of adaptor proteins, activation of transcription factors, and the secretion of pro-inflammatory cytokines. Recent studies have described the TIR domain-containing protein from Brucella melitensis, TcpB (BtpA/Btp1), to be involved in virulence and suppression of host innate immune responses. TcpB interferes with TLR4 and TLR2 signaling pathways by a mechanism that remains controversial. In this study, we show using co-immunoprecipitation analyses that TcpB interacts with MAL, MyD88, and TLR4 but interferes only with the MAL-TLR4 interaction. We present the crystal structure of the TcpB TIR domain, which reveals significant structural differences in the loop regions compared with other TIR domain structures. We demonstrate that TcpB forms a dimer in solution, and the crystal structure reveals the dimerization interface, which we validate by mutagenesis and biophysical studies. Our study advances the understanding of the molecular mechanisms of host immunosuppression by bacterial pathogens.

  18. Activation of TLR3 in keratinocytes increases expression of genes involved in formation of the epidermis, lipid accumulation and epidermal organelles

    PubMed Central

    Borkowski, Andrew W.; Park, Kyungho; Uchida, Yoshikazu; Gallo, Richard L.

    2013-01-01

    Injury to the skin, and the subsequent release of non-coding double-stranded RNA from necrotic keratinocytes, has been identified as an endogenous activator of Toll-like receptor 3 (TLR3). Since changes in keratinocyte growth and differentiation follow injury, we hypothesized that TLR3 might trigger some elements of the barrier repair program in keratinocytes. Double-stranded RNA was observed to induce TLR3-dependent increases in human keratinocyte mRNA abundance for ABCA12 (ATP-binding cassette, sub-family A, member 12), glucocerebrosidase, acid sphingomyelinase, and transglutaminase 1. Additionally, treatment with double-stranded RNA resulted in increases in sphingomyelin and morphologic changes including increased epidermal lipid staining by oil-red O and TLR3-dependent increases in lamellar bodies and keratohyalin granules. These observations show that double-stranded RNA can stimulate some events in keratinocytes that are important for skin barrier repair and maintenance. PMID:23353987

  19. Characterization and comprehensive analysis of the miiuy croaker TLR2 reveals a direct evidence for intron insert and loss.

    PubMed

    Xu, Tianjun; Meng, Fanxing; Zhu, Zhihuang; Wang, Rixin

    2013-01-01

    Toll-like receptor 2 (TLR2) is a member of an ancient pattern recognition receptor family, conserved from insects to mammals and it is best known as a receptor for recognizing conserved components of Gram-positive bacteria. In present study, the genomic structure of TLR2 gene from miiuy croaker was identified and characterized. It comprises twelve exons and eleven introns. The lengths of exons 3 to 10 of miiuy croaker TLR2 and exons 2 to 9 of fugu and pufferfish TLR2 are exactly the same, but most importantly, both of fugu and pufferfish have only eleven exons and ten introns. An intron insert event probably happened on exon 1 of miiuy croaker TLR2 after its divergence from ancestor of zebrafish, and an intron loss event probably happened on those of Tetraodontiformes TLR2 after the divergence with ancestor of miiuy croaker. Our study showed the direct evidence and strongly supported the intron insert and loss on fish TLR2. The pathogen injection experiments indicated that TLR2 might not be an important responder to Gram-negative bacteria in miiuy croaker. Molecular evolutionary analyses indicated TLR2 genes were under strong purifying selection pressure, showing a quite strong functional constraint in both of fish and mammals, despite of their distinct living environment conditions.

  20. Expression and activity of Toll-like receptors 1-9 in the human term placenta and changes associated with labor at term.

    PubMed

    Patni, Shalini; Wynen, Louise P; Seager, Anna L; Morgan, Gareth; White, John O; Thornton, Catherine A

    2009-02-01

    Inflammatory processes are involved in the initiation and maintenance of labor, suggesting that Toll-like receptor (TLR) activity within gestation-associated tissues, such as the placenta, might contribute to the process of parturition. Expression of transcripts for TLR1-TLR10 was examined in term (>37 wk of gestation) human placentas collected in the absence of labor (elective caesarean sections; ECS; n = 11) and after the completion of labor (normal vaginal delivery; NVD; n = 12). Placental explants were cultured in the presence of agonists for TLR2, TLR3, TLR4, TLR5, TLR7, TLR8, and TLR9, and cytokine production after 24 h was examined. All placentas expressed transcripts for TLR1-TLR10. Reactivity to all agonists except CpG oligonucleotides was observed, indicating that, other than TLR9, all of the receptors studied yielded functional responses. Placental explants prepared from NVD placentas (n = 17) produced significantly more TNFA in response to lipopolysaccharide (TLR4 agonist) and resiquimod (TLR7/8 agonist) than explants from ECS placentas (n = 17). In contrast, gene expression analysis revealed that only transcripts for TLR2 and TLR5 were significantly elevated in association with labor. The human term placenta expresses a variety of functional TLRs, indicating that this family of receptors has an important role in parturition via as yet undetermined cell types and signaling pathways.

  1. Identification and immune functional characterization of pigeon TLR7.

    PubMed

    Xiong, Dan; Song, Li; Pan, Zhiming; Chen, Xiang; Geng, Shizhong; Jiao, Xinan

    2015-04-14

    Toll-like receptor 7 (TLR7) is activated by single-stranded RNA and synthetic imidazoquinoline components, and induces interferon production. In this study, we cloned the TLR7 gene from King pigeon (Columba livia). The TLR7 open reading frame is 3144 bp and encodes a 1047-amino acid protein, consisting of a canonical TLR composition with 15 leucine-rich repeats (LRRs). Amino acid-inserting modifications were found at position 15 of LRR2, LRR11, LRR13, and LRR14 and position 10 of LRR10. The tissue distribution of pigeon TLR7 suggests that immune-associated tissues, especially the spleen and liver, have high TLR7 expression. HEK293T cells transfected with pigeon TLR7 plasmid responded to the agonist R848, indicating a functional TLR7 homolog. Following R848 stimulation of pigeon peripheral blood mononuclear cells, the levels of IFN-γ, IL-6, IL-8, CCL5, and IL-10 mRNA, assessed using quantitative real-time PCR, were significantly up-regulated. After Newcastle disease virus vaccine strain LaSota inoculation and agonist R848 injection, the level of TLR7 mRNA in the spleen of pigeons increased significantly in the R848-injected group, but decreased in the LaSota-inoculated group at three day post-infection (d.p.i.). The mRNA levels of inflammatory cytokines and chemokines were significantly upregulated in both LaSota-inoculated and R848-injected groups. Triggering pigeon TLR7 leads to robust up-regulation of inflammatory cytokines and chemokines, suggesting an important role in the innate immune response.

  2. HIF-regulated HO-1 gene transfer improves the post-ischemic limb recovery and diminishes TLR-triggered immune responses - Effects modified by concomitant VEGF overexpression.

    PubMed

    Jazwa, Agnieszka; Stoszko, Mateusz; Tomczyk, Mateusz; Bukowska-Strakova, Karolina; Pichon, Chantal; Jozkowicz, Alicja; Dulak, Jozef

    2015-08-01

    Heme oxygenase-1 (HO-1) mitigates cellular injury by antioxidant, anti-apoptotic, anti-inflammatory and proangiogenic effects. Vascular endothelial growth factor (VEGF) is a critical regulator of blood vessel growth. Their coordinated action was analyzed in a model of femoral artery ligation (FAL) in mice lacking HO-1 gene (HO-1 KO). Gastrocnemius skeletal muscles of HO-1 KO mice were preemptively injected with plasmids containing hypoxia-response element (HRE) driving the expression of only HO-1 (pHRE-HO1) or both HO-1 and VEGF (pHRE-HO1-VEGF). At day 14th the pHRE-HO1 vector increased an impaired post-ischemic blood flow recovery in HO-1 KO mice to the level observed in wild-type (WT) mice subjected to FAL and pHRE-HO1-VEGF restored it already at day 7. The pHRE-HO1 gene therapy diminished, when compared to control pHRE-empty-treated HO-1 KO mice, the expression of toll-like receptors (TLR4 and TLR9) and inflammatory cytokines (IL-1β, IL-6 and TNFα) at day 3, whereas opposite effects were observed following concomitant HO-1 and VEGF gene transfer. Moreover, HO-1 diminished ischemia-induced expression of MyoD involved in satellite cell differentiation in HO-1 KO mice. Our results confirm the therapeutic potential of HO-1 and VEGF against critical limb ischemia although, their concomitant delivery may have contradictory actions on the resolution of inflammation. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Prevention and mitigation of acute radiation syndrome in mice by synthetic lipopeptide agonists of Toll-like receptor 2 (TLR2).

    PubMed

    Shakhov, Alexander N; Singh, Vijay K; Bone, Frederick; Cheney, Alec; Kononov, Yevgeniy; Krasnov, Peter; Bratanova-Toshkova, Troitza K; Shakhova, Vera V; Young, Jason; Weil, Michael M; Panoskaltsis-Mortari, Angela; Orschell, Christie M; Baker, Patricia S; Gudkov, Andrei; Feinstein, Elena

    2012-01-01

    Bacterial lipoproteins (BLP) induce innate immune responses in mammals by activating heterodimeric receptor complexes containing Toll-like receptor 2 (TLR2). TLR2 signaling results in nuclear factor-kappaB (NF-κB)-dependent upregulation of anti-apoptotic factors, anti-oxidants and cytokines, all of which have been implicated in radiation protection. Here we demonstrate that synthetic lipopeptides (sLP) that mimic the structure of naturally occurring mycoplasmal BLP significantly increase mouse survival following lethal total body irradiation (TBI) when administered between 48 hours before and 24 hours after irradiation. The TBI dose ranges against which sLP are effective indicate that sLP primarily impact the hematopoietic (HP) component of acute radiation syndrome. Indeed, sLP treatment accelerated recovery of bone marrow (BM) and spleen cellularity and ameliorated thrombocytopenia of irradiated mice. sLP did not improve survival of irradiated TLR2-knockout mice, confirming that sLP-mediated radioprotection requires TLR2. However, sLP was radioprotective in chimeric mice containing TLR2-null BM on a wild type background, indicating that radioprotection of the HP system by sLP is, at least in part, indirect and initiated in non-BM cells. sLP injection resulted in strong transient induction of multiple cytokines with known roles in hematopoiesis, including granulocyte colony-stimulating factor (G-CSF), keratinocyte chemoattractant (KC) and interleukin-6 (IL-6). sLP-induced cytokines, particularly G-CSF, are likely mediators of the radioprotective/mitigative activity of sLP. This study illustrates the strong potential of LP-based TLR2 agonists for anti-radiation prophylaxis and therapy in defense and medical scenarios.

  4. Prevention and Mitigation of Acute Radiation Syndrome in Mice by Synthetic Lipopeptide Agonists of Toll-Like Receptor 2 (TLR2)

    PubMed Central

    Shakhov, Alexander N.; Singh, Vijay K.; Bone, Frederick; Cheney, Alec; Kononov, Yevgeniy; Krasnov, Peter; Bratanova-Toshkova, Troitza K.; Shakhova, Vera V.; Young, Jason; Weil, Michael M.; Panoskaltsis-Mortari, Angela; Orschell, Christie M.; Baker, Patricia S.; Gudkov, Andrei; Feinstein, Elena

    2012-01-01

    Bacterial lipoproteins (BLP) induce innate immune responses in mammals by activating heterodimeric receptor complexes containing Toll-like receptor 2 (TLR2). TLR2 signaling results in nuclear factor-kappaB (NF-κB)-dependent upregulation of anti-apoptotic factors, anti-oxidants and cytokines, all of which have been implicated in radiation protection. Here we demonstrate that synthetic lipopeptides (sLP) that mimic the structure of naturally occurring mycoplasmal BLP significantly increase mouse survival following lethal total body irradiation (TBI) when administered between 48 hours before and 24 hours after irradiation. The TBI dose ranges against which sLP are effective indicate that sLP primarily impact the hematopoietic (HP) component of acute radiation syndrome. Indeed, sLP treatment accelerated recovery of bone marrow (BM) and spleen cellularity and ameliorated thrombocytopenia of irradiated mice. sLP did not improve survival of irradiated TLR2-knockout mice, confirming that sLP-mediated radioprotection requires TLR2. However, sLP was radioprotective in chimeric mice containing TLR2-null BM on a wild type background, indicating that radioprotection of the HP system by sLP is, at least in part, indirect and initiated in non-BM cells. sLP injection resulted in strong transient induction of multiple cytokines with known roles in hematopoiesis, including granulocyte colony-stimulating factor (G-CSF), keratinocyte chemoattractant (KC) and interleukin-6 (IL-6). sLP-induced cytokines, particularly G-CSF, are likely mediators of the radioprotective/mitigative activity of sLP. This study illustrates the strong potential of LP-based TLR2 agonists for anti-radiation prophylaxis and therapy in defense and medical scenarios. PMID:22479357

  5. Lactate Boosts TLR4 Signaling and NF-κB Pathway-Mediated Gene Transcription in Macrophages via Monocarboxylate Transporters and MD-2 Up-Regulation1

    PubMed Central

    Samuvel, Devadoss J.; Sundararaj, Kamala P.; Nareika, Alena; Lopes-Virella, Maria F.; Huang, Yan

    2009-01-01

    It has been shown that lactate induces insulin resistance. However, the underlying mechanisms have not been well understood. Based on our observation that lactate augments LPS-stimulated inflammatory gene expression, we proposed that lactate may enhance TLR4 signaling in macrophages, which has been shown to play an important role in insulin resistance in adipocytes. In this study, we demonstrated that lactate stimulated MD-2, a coreceptor for TLR4 signaling activation, NF-κB transcriptional activity, and the expression of inflammatory genes in human U937 histiocytes (resident macrophages). Similar enhancement of the inflammatory gene expression by lactate was also observed in human monocyte-derived macrophages. The essential role of MD-2 in lactate-augmented TLR4 signaling was confirmed by observation that the suppression of MD-2 expression by small interfering RNA led to significant inhibition of inflammatory gene expression. To further elucidate how lactate treatment enhances TLR4 activation, we showed that the augmentation of inflammatory gene expression by lactate was abrogated by antioxidant treatment, suggesting a critical role of reactive oxygen species in the enhancement of TLR4 activation by lactate. Finally, we showed that α-cyano-4-hydroxycinnamic acid, a classic inhibitor for monocarboxylate transporters, blocked lactate-augmented inflammatory gene expression and nuclear NF-κB activity, indicating that lactate transport through monocarboxylate transporters is required for lactate-enhanced TLR4 activation. Collectively, this study documents that lactate boosts TLR4 activation and NF-κB-dependent inflammatory gene expression via monocarboxylate transporters and MD-2 up-regulation. PMID:19201903

  6. Lactate boosts TLR4 signaling and NF-kappaB pathway-mediated gene transcription in macrophages via monocarboxylate transporters and MD-2 up-regulation.

    PubMed

    Samuvel, Devadoss J; Sundararaj, Kamala P; Nareika, Alena; Lopes-Virella, Maria F; Huang, Yan

    2009-02-15

    It has been shown that lactate induces insulin resistance. However, the underlying mechanisms have not been well understood. Based on our observation that lactate augments LPS-stimulated inflammatory gene expression, we proposed that lactate may enhance TLR4 signaling in macrophages, which has been shown to play an important role in insulin resistance in adipocytes. In this study, we demonstrated that lactate stimulated MD-2, a coreceptor for TLR4 signaling activation, NF-kappaB transcriptional activity, and the expression of inflammatory genes in human U937 histiocytes (resident macrophages). Similar enhancement of the inflammatory gene expression by lactate was also observed in human monocyte-derived macrophages. The essential role of MD-2 in lactate-augmented TLR4 signaling was confirmed by observation that the suppression of MD-2 expression by small interfering RNA led to significant inhibition of inflammatory gene expression. To further elucidate how lactate treatment enhances TLR4 activation, we showed that the augmentation of inflammatory gene expression by lactate was abrogated by antioxidant treatment, suggesting a critical role of reactive oxygen species in the enhancement of TLR4 activation by lactate. Finally, we showed that alpha-cyano-4-hydroxycinnamic acid, a classic inhibitor for monocarboxylate transporters, blocked lactate-augmented inflammatory gene expression and nuclear NF-kappaB activity, indicating that lactate transport through monocarboxylate transporters is required for lactate-enhanced TLR4 activation. Collectively, this study documents that lactate boosts TLR4 activation and NF-kappaB-dependent inflammatory gene expression via monocarboxylate transporters and MD-2 up-regulation.

  7. Study of Toll-like receptor and B-defensins genes expression pattern in porcine reproductive organs.

    PubMed

    Marantidis, Apostolos; Laliotis, George P; Michailidis, Georgios; Avdi, Melpomeni

    2015-01-01

    Toll-like receptors (TLRs) and b-defensins (BD) molecules are group of molecules that recognize various microbial components and play a crucial role in the activation of the innate immune system in vertebrate species. Although TLRs gene expression has been studied in various pig tissues, little is known about their expression in porcine reproductive tract. Concerning b-defensins genes, only BD1, 2 and 3 counterparts have been well studied in pigs' reproductive organs. The aim of this study was to investigate the expression pattern of both gene families in pigs' male and female reproductive organs, and embryos, as potential tool for further association studies in respect to immunity and disease resistance. RT-PCR analysis revealed that all of the examined TLR genes were expressed in the reproductive organs of male and female pigs, with TLR3 and TLR5 showing the higher levels and TLR9 the lowest, in all analyzed tissues. BD genes showed a different expression pattern in respect to the examined tissue. In embryos, TLR1 revealed high expression levels, while only BD3, BD108, and BD123 were found to be expressed.

  8. TLR signaling in the gut in health and disease.

    PubMed

    Abreu, Maria T; Fukata, Masayuki; Arditi, Moshe

    2005-04-15

    The human intestine has evolved in the presence of diverse enteric microflora. TLRs convert the recognition of pathogen-associated molecules in the gut into signals for anti-microbial peptide expression, barrier fortification, and proliferation of epithelial cells. Healing of injured intestinal epithelium and clearance of intramucosal bacteria require the presence of intact TLR signaling. Nucleotide oligomerization domain (Nod)1 and Nod2 are additional pattern recognition receptors that are required for defense against invasive enteric pathogens. Through spatial and functional localization of TLR and Nod molecules, the normal gut maintains a state of controlled inflammation. By contrast, patients with inflammatory bowel disease demonstrate inflammation in response to the normal flora. A subset of these patients carry polymorphisms in TLR and CARD15/NOD2 genes. A better understanding of the delicate regulation of TLR and Nod molecules in the gut may lead to improved treatment for enteric infections and idiopathic inflammatory bowel diseases.

  9. Oligonucleotides designed to inhibit TLR9 block Herpes simplex virus type 1 infection at multiple steps.

    PubMed

    Sauter, Monica M; Gauger, Joshua J L; Brandt, Curtis R

    2014-09-01

    Herpes simplex virus type 1 (HSV-1) is an important human pathogen which requires activation of nuclear factor-kappa B (NFκB) during its replication cycle. The persistent nature of HSV-1 infection, and the emergence of drug-resistant strains, highlights the importance of research to develop new antiviral agents. Toll-like receptors (TLRs) play a prominent role during the early antiviral response by recognizing viral nucleic acid and gene products, activating NFκB, and stimulating the production of inflammatory cytokines. We demonstrate a significant effect on HSV-1 replication in ARPE-19 and Vero cells when oligonucleotides designed to inhibit TLR9 are added 2h prior to infection. A greater than 90% reduction in the yield of infectious virus was achieved at oligonucleotide concentrations of 10-20 μM. TLR9 inhibitory oligonucleotides prevented expression of essential immediate early herpes gene products as determined by immunofluorescence microscopy and Western blotting. TLR9 oligonucleotides also interfered with viral attachment and entry. A TLR9 inhibitory oligonucleotide containing five adjacent guanosine residues (G-ODN) exhibited virucidal activity and inhibited HSV-1 replication when added post-infection. The antiviral effect of the TLR9 inhibitory oligonucleotides did not depend on the presence of TLR9 protein, suggesting a mechanism of inhibition that is not TLR9 specific. TLR9 inhibitory oligonucleotides also reduced NFκB activity in nuclear extracts. Studies using these TLR inhibitors in the context of viral infection should be interpreted with caution.

  10. The interaction between farming/rural environment and TLR2, TLR4, TLR6 and CD14 genetic polymorphisms in relation to early- and late-onset asthma

    PubMed Central

    Lau, Melisa Y. Z.; Dharmage, Shyamali C.; Burgess, John A.; Win, Aung K.; Lowe, Adrian J.; Lodge, Caroline; Perret, Jennifer; Hui, Jennie; Thomas, Paul S.; Morrison, Stephen; Giles, Graham G.; Hopper, John; Abramson, Michael J.; Walters, E. Haydn; Matheson, Melanie C.

    2017-01-01

    Asthma phenotypes based on age-of-onset may be differently influenced by the interaction between variation in toll-like receptor (TLR)/CD14 genes and environmental microbes. We examined the associations between single-nucleotide polymorphisms (SNP) in the TLR/CD14 genes and asthma, and their interaction with proxies of microbial exposure (childhood farm exposure and childhood rural environment). Ten SNPs in four genes (TLR2, TLR4, TLR6, CD14) were genotyped for 1,116 participants from the Tasmanian Longitudinal Health Study (TAHS). Using prospectively collected information, asthma was classified as never, early- (before 13 years) or late-onset (after 13 years). Information on childhood farm exposure/childhood rural environment was collected at baseline. Those with early-onset asthma were more likely to be males, had a family history of allergy and a personal history of childhood atopy. We found significant interaction between TLR6 SNPs and childhood farm exposure. For those with childhood farm exposure, carriers of the TLR6-rs1039559 T-allele (p-interaction = 0.009) and TLR6-rs5743810 C-allele (p-interaction = 0.02) were associated with lower risk of early-onset asthma. We suggest the findings to be interpreted as hypothesis-generating as the interaction effect did not withstand correction for multiple testing. In this large, population-based longitudinal study, we found that the risk of early- and late-onset asthma is differently influenced by the interaction between childhood farming exposure and genetic variations. PMID:28262750

  11. Lipoteichoic acid (LTA) of Streptococcus pneumoniae and Staphylococcus aureus activates immune cells via Toll-like receptor (TLR)-2, lipopolysaccharide-binding protein (LBP), and CD14, whereas TLR-4 and MD-2 are not involved.

    PubMed

    Schröder, Nicolas W J; Morath, Siegfried; Alexander, Christian; Hamann, Lutz; Hartung, Thomas; Zähringer, Ulrich; Göbel, Ulf B; Weber, Joerg R; Schumann, Ralf R

    2003-05-02

    Lipoteichoic acid (LTA) derived from Streptococcus pneumoniae, purified employing a chloroform/methanol protocol, and from Staphylococcus aureus, prepared by the recently described butanol extraction procedure, was investigated regarding its interaction with lipopolysaccharide (LPS)-binding protein (LBP), CD14, Toll-like receptors (TLRs)-2 and -4, and MD-2. LTA from both organisms induced cytokine synthesis in human mononuclear phagocytes. Activation was LBP- and CD14-dependent, and formation of complexes of LTA with LBP and soluble CD14 as well as catalytic transfer of LTA to CD14 by LBP was verified by PhastGel(TM) native gel electrophoresis. Human embryonic kidney (HEK) 293/CD14 cells and Chinese hamster ovary (CHO) cells were responsive to LTA only after transfection with TLR-2. Additional transfection with MD-2 did not affect stimulation of these cells by LTA. Our data suggest that innate immune recognition of LTA via LBP, CD14, and TLR-2 represents an important mechanism in the pathogenesis of systemic complications in the course of infectious diseases brought about by the clinically most important Gram-positive pathogens. However, the involvement of TLR-4 and MD-2 in this process was ruled out.

  12. The dual role of TLR3 in metastatic cell line.

    PubMed

    Matijevic, Tanja; Pavelic, Jasminka

    2011-10-01

    Toll-like receptors (TLRs) are members of transmembrane proteins that recognize conserved molecular motifs of viral and bacterial origin and initiate innate immune response. As the role of TLRs in tumors cells is still not clear, our aim was to investigate the role of TLR3 in primary tumor and metastatic cells (SW480, SW620, FaDu and Detroit 562). We have reported here on the dual role of TLR3 in pharynx metastatic cell line (Detroit 562); on one hand TLR3 activation drove cells to apoptosis while on the other its stimulation contributed to tumor progression by altering the expression of tumor promoting genes (PLAUR, RORB) and enhancing the cell migration potential. In addition, we have shown TLR3 signaling pathway is functional in another metastatic cancer cell line (SW620) suggesting TLR3 might be important in the process of tumor metastasis. Since TLR3 agonists have been used in tumor therapy with the aim to activate immune system, scientific contribution of this work is drawing attention to the importance of further work on this topic, especially pro-tumor effect of TLR3, in order to avoid possible side-effects.

  13. Functional activity but not gene expression of toll-like receptors is decreased in the preterm versus term human placenta.

    PubMed

    Patni, Shalini; Bryant, Aled H; Wynen, Louise P; Seager, Anna L; Morgan, Gareth; Thornton, Catherine A

    2015-09-01

    Toll-like receptor (TLR) activity within gestation-associated tissues might have a role in normal pregnancy progression as well as adverse obstetric outcomes such as preterm birth (PTB). The expression and activity of TLRs 1-9 in placentas collected following preterm vaginal delivery after infection-associated preterm labour (IA-PTL) at 25-36 weeks of gestation (preterm-svd, n = 10) were compared with those obtained after normal vaginal delivery at term (term-laboured; n = 17). Placental explants were cultured in the presence of agonists for TLR2, 3, 4, 5, 7, 8 and 9 and cytokine production after 24 h examined. Expression of TLR transcripts was determined using real time quantitative PCR. Reactivity to all agonists except CpG oligonucleotides was observed indicating that other than TLR9 all of the receptors studied yielded functional responses both term and preterm. Significantly less TNFα and IL-6, but not IL-10, were produced by preterm than term samples in response to all TLR agonists. Changes in TLR mRNA expression did not underlie functional differences in the preterm and term groups; nor does a pre-exposure/tolerance model mimic this finding. While glucocorticoids suppressed cytokine production in an in vitro model using term tissue the association between lower gestational age and decreased cytokine outputs suggests a temporally regulated response. Pro-inflammatory cytokine output in response to multiple TLR ligands was decreased in the preterm compared to the term placenta but gene expression for each TLR tended to be similar. Reduced cytokine production by the preterm placenta in response to stimulation of TLRs therefore must be regulated at the post-transcriptional level in a gestational age dependent manner. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Moraxella catarrhalis activates murine macrophages through multiple toll like receptors and has reduced clearance in lungs from TLR4 mutant mice.

    PubMed

    Hassan, Ferdaus; Ren, Dabin; Zhang, Wenhong; Merkel, Tod J; Gu, Xin-Xing

    2012-01-01

    Moraxella catarrhalis is a gram negative bacterium and a leading causative agent of otitis media (OM) in children. Several recent reports have provided strong evidence for an association between toll like receptors and OM. It has been found that both Streptococcus pneumoniae and nontypeable Haemophilus influenzae activate host protective immune responses through toll like receptors (TLRs), however, the precise mechanism by which Moraxella catarrhalis initiates the host immune response is currently unknown. In this report, using murine macrophages generated from a series of knock-out mice, we have demonstrated that M. catarrhalis lipooligosaccharide (LOS) and either heat killed or live bacteria are recognized by one or more TLRs. LOS activates the host immune response through a membrane bound CD14-TLR4 complex, while both heat killed and live M.cat require recognition by multiple toll like receptors such as TLR2, TLR4 and TLR9 without the requirement of CD14. We have also shown that M.cat stimuli are capable of triggering the host innate immune response by both MyD88- and TRIF- dependent signaling pathways. We further showed that M.cat induced activation of mitogen activated protein kinase (MAPK) is essential in order to achieve optimal secretion of pro-inflammatory cytokine TNF-α. We finally showed that TLR4 mutant C3H/HeJ mice produce significantly lower levels of pro-inflammatory cytokines TNF-α and IL-6 in vivo, An increased bacterial loads at 12 and 24 hours (P<0.001) in their lungs upon challenge with live M.cat in an aerosol chamber compared to wild-type (WT) control mice. These data suggest that TLRs are crucial for an effective innate immune response induced by M.cat. The results of these studies contribute to an increased understanding of molecular mechanism and possible novel treatment strategies for diseases caused by M.cat by specifically targeting TLRs and their signaling pathways.

  15. Lipid-induced insulin resistance mediated by the proinflammatory receptor TLR4 requires saturated fatty acid-induced ceramide biosynthesis in mice.

    PubMed

    Holland, William L; Bikman, Benjamin T; Wang, Li-Ping; Yuguang, Guan; Sargent, Katherine M; Bulchand, Sarada; Knotts, Trina A; Shui, Guanghou; Clegg, Deborah J; Wenk, Markus R; Pagliassotti, Michael J; Scherer, Philipp E; Summers, Scott A

    2011-05-01

    Obesity is associated with an enhanced inflammatory response that exacerbates insulin resistance and contributes to diabetes, atherosclerosis, and cardiovascular disease. One mechanism accounting for the increased inflammation associated with obesity is activation of the innate immune signaling pathway triggered by TLR4 recognition of saturated fatty acids, an event that is essential for lipid-induced insulin resistance. Using in vitro and in vivo systems to model lipid induction of TLR4-dependent inflammatory events in rodents, we show here that TLR4 is an upstream signaling component required for saturated fatty acid-induced ceramide biosynthesis. This increase in ceramide production was associated with the upregulation of genes driving ceramide biosynthesis, an event dependent of the activity of the proinflammatory kinase IKKβ. Importantly, increased ceramide production was not required for TLR4-dependent induction of inflammatory cytokines, but it was essential for TLR4-dependent insulin resistance. These findings suggest that sphingolipids such as ceramide might be key components of the signaling networks that link lipid-induced inflammatory pathways to the antagonism of insulin action that contributes to diabetes.

  16. Lipid-induced insulin resistance mediated by the proinflammatory receptor TLR4 requires saturated fatty acid–induced ceramide biosynthesis in mice

    PubMed Central

    Holland, William L.; Bikman, Benjamin T.; Wang, Li-Ping; Yuguang, Guan; Sargent, Katherine M.; Bulchand, Sarada; Knotts, Trina A.; Shui, Guanghou; Clegg, Deborah J.; Wenk, Markus R.; Pagliassotti, Michael J.; Scherer, Philipp E.; Summers, Scott A.

    2011-01-01

    Obesity is associated with an enhanced inflammatory response that exacerbates insulin resistance and contributes to diabetes, atherosclerosis, and cardiovascular disease. One mechanism accounting for the increased inflammation associated with obesity is activation of the innate immune signaling pathway triggered by TLR4 recognition of saturated fatty acids, an event that is essential for lipid-induced insulin resistance. Using in vitro and in vivo systems to model lipid induction of TLR4-dependent inflammatory events in rodents, we show here that TLR4 is an upstream signaling component required for saturated fatty acid–induced ceramide biosynthesis. This increase in ceramide production was associated with the upregulation of genes driving ceramide biosynthesis, an event dependent of the activity of the proinflammatory kinase IKKβ. Importantly, increased ceramide production was not required for TLR4-dependent induction of inflammatory cytokines, but it was essential for TLR4-dependent insulin resistance. These findings suggest that sphingolipids such as ceramide might be key components of the signaling networks that link lipid-induced inflammatory pathways to the antagonism of insulin action that contributes to diabetes. PMID:21490391

  17. Toll-like receptor 2 (TLR2), transforming growth factor-β, hyaluronan (HA), and receptor for HA-mediated motility (RHAMM) are required for surfactant protein A-stimulated macrophage chemotaxis.

    PubMed

    Foley, Joseph P; Lam, David; Jiang, Hongmei; Liao, Jie; Cheong, Naeun; McDevitt, Theresa M; Zaman, Aisha; Wright, Jo Rae; Savani, Rashmin C

    2012-10-26

    The innate immune system protects the host from bacterial and viral invasion. Surfactant protein A (SPA), a lung-specific collectin, stimulates macrophage chemotaxis. However, the mechanisms regulating this function are unknown. Hyaluronan (HA) and its receptors RHAMM (receptor for HA-mediated motility, CD168) and CD44 also regulate cell migration and inflammation. We therefore examined the role of HA, RHAMM, and CD44 in SPA-stimulated macrophage chemotaxis. Using antibody blockade and murine macrophages, SPA-stimulated macrophage chemotaxis was dependent on TLR2 but not the other SPA receptors examined. Anti-TLR2 blocked SPA-induced production of TGFβ. In turn, TGFβ1-stimulated chemotaxis was inhibited by HA-binding peptide and anti-RHAMM antibody but not anti-TLR2 antibody. Macrophages from TLR2(-/-) mice failed to migrate in response to SPA but responded normally to TGFβ1 and HA, effects that were blocked by anti-RHAMM antibody. Macrophages from WT and CD44(-/-) mice had similar responses to SPA, whereas those from RHAMM(-/-) mice had decreased chemotaxis to SPA, TGFβ1, and HA. In primary macrophages, SPA-stimulated TGFβ production was dependent on TLR2, JNK, and ERK but not p38. Pam3Cys, a specific TLR2 agonist, stimulated phosphorylation of JNK, ERK, and p38, but only JNK and ERK inhibition blocked Pam3Cys-stimulated chemotaxis. We have uncovered a novel pathway for SPA-stimulated macrophage chemotaxis where SPA stimulation via TLR2 drives JNK- and ERK-dependent TGFβ production. TGFβ1, in turn, stimulates macrophage chemotaxis in a RHAMM and HA-dependent manner. These findings are highly relevant to the regulation of innate immune responses by SPA with key roles for specific components of the extracellular matrix.

  18. Toll-like Receptor 2 (TLR2), Transforming Growth Factor-β, Hyaluronan (HA), and Receptor for HA-mediated Motility (RHAMM) Are Required for Surfactant Protein A-stimulated Macrophage Chemotaxis*

    PubMed Central

    Foley, Joseph P.; Lam, David; Jiang, Hongmei; Liao, Jie; Cheong, Naeun; McDevitt, Theresa M.; Zaman, Aisha; Wright, Jo Rae; Savani, Rashmin C.

    2012-01-01

    The innate immune system protects the host from bacterial and viral invasion. Surfactant protein A (SPA), a lung-specific collectin, stimulates macrophage chemotaxis. However, the mechanisms regulating this function are unknown. Hyaluronan (HA) and its receptors RHAMM (receptor for HA- mediated motility, CD168) and CD44 also regulate cell migration and inflammation. We therefore examined the role of HA, RHAMM, and CD44 in SPA-stimulated macrophage chemotaxis. Using antibody blockade and murine macrophages, SPA-stimulated macrophage chemotaxis was dependent on TLR2 but not the other SPA receptors examined. Anti-TLR2 blocked SPA-induced production of TGFβ. In turn, TGFβ1-stimulated chemotaxis was inhibited by HA-binding peptide and anti-RHAMM antibody but not anti-TLR2 antibody. Macrophages from TLR2−/− mice failed to migrate in response to SPA but responded normally to TGFβ1 and HA, effects that were blocked by anti-RHAMM antibody. Macrophages from WT and CD44−/− mice had similar responses to SPA, whereas those from RHAMM−/− mice had decreased chemotaxis to SPA, TGFβ1, and HA. In primary macrophages, SPA-stimulated TGFβ production was dependent on TLR2, JNK, and ERK but not p38. Pam3Cys, a specific TLR2 agonist, stimulated phosphorylation of JNK, ERK, and p38, but only JNK and ERK inhibition blocked Pam3Cys-stimulated chemotaxis. We have uncovered a novel pathway for SPA-stimulated macrophage chemotaxis where SPA stimulation via TLR2 drives JNK- and ERK-dependent TGFβ production. TGFβ1, in turn, stimulates macrophage chemotaxis in a RHAMM and HA-dependent manner. These findings are highly relevant to the regulation of innate immune responses by SPA with key roles for specific components of the extracellular matrix. PMID:22948158

  19. The Role of TLR2, TLR4, and TLR9 in the Pathogenesis of Atherosclerosis

    PubMed Central

    2016-01-01

    Toll-like receptors (TLRs) are key players in the pathogenesis of inflammatory conditions including coronary arterial disease (CAD). They are expressed by a variety of immune cells where they recognize pathogen-associated molecular patterns (PAMPs). TLRs recruit adaptor molecules, including myeloid differentiation primary response protein (MYD88) and TIRF-related adaptor protein (TRAM), to mediate activation of MAPKs and NF-kappa B pathways. They are associated with the development of CAD through various mechanisms. TLR4 is expressed in lipid-rich and atherosclerotic plaques. In TLR2−/− and TLR4−/− mice, atherosclerosis-associated inflammation was diminished. Moreover, TLR2 and TLR4 may induce expression of Wnt5a in advanced staged atheromatous plaque leading to activation of the inflammatory processes. TLR9 is activated by CpG motifs in nucleic acids and have been implicated in macrophage activation and the uptake of oxLDL from the circulation. Furthermore, TLR9 also stimulates interferon-α (INF-α) secretion and increases cytotoxic activity of CD4+ T-cells towards coronary artery tunica media smooth muscle cells. This review outlines the pathophysiological role of TLR2, TLR4, and TLR9 in atherosclerosis, focusing on evidence from animal models of the disease. PMID:27795867

  20. Effect of Single Nucleotide Polymorphisms of Toll-Like Receptor 4 (TLR 4) on Reproductive Performance and Immune Function in Dairy Cows.

    PubMed

    Shimizu, Takashi; Kawasaki, Yurie; Aoki, Yuka; Magata, Fumie; Kawashima, Chiho; Miyamoto, Akio

    2017-06-01

    In dairy cows, inflammatory diseases caused by infection with pathogenic bacteria post calving affect ovarian functions. This study examined the relationship between single-nucleotide polymorphisms (SNPs) of Toll-like receptor 4 (TLR4), reproductive performances [the number of artificial insemination (AI) application and days open], and immune cell functions (apoptosis and migration). Two hundred Holstein cows from the Obihiro University farm were included. The SNPs of TLR4 were genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP) method. Polymorphonuclear leukocytes (PMNs) and peripheral blood mononuclear cells (PBMCs) were isolated from whole blood. The number of AI application in the animals with T/C genotype in the TLR4 exon3 was lower than that in animals with C/C genotype (1.6 ± 0.2 and 2.2 ± 0.2, respectively). Among the animals with TLR4 exon3 polymorphisms, the days open was shorter for the T/C cows than that for C/C cows (100.7 ± 6.9 days and 136.6 ± 9.0 days, respectively). The SNPs in the TLR4 intron did not affect the number of AI and days open. The apoptosis percentage of PMNs treated with lipopolysaccharide (LPS; 0.001 and 1 μg/ml) tended to be lower in the T/C genotype compared to that in the C/C genotype. The transmigration rates of PMNs, and IL-1β production in PBMCs were tended to be higher for the animals with the T/C genotype compared to those for animals with the C/C genotype. Taken together, these results suggest that TLR4 polymorphisms offer a meaningful tool to judge the reproductive potential and immune activity in individual cows.

  1. TLR/MyD88 and liver X receptor alpha signaling pathways reciprocally control Chlamydia pneumoniae-induced acceleration of atherosclerosis.

    PubMed

    Naiki, Yoshikazu; Sorrentino, Rosalinda; Wong, Michelle H; Michelsen, Kathrin S; Shimada, Kenichi; Chen, Shuang; Yilmaz, Atilla; Slepenkin, Anatoly; Schröder, Nicolas W J; Crother, Timothy R; Bulut, Yonca; Doherty, Terence M; Bradley, Michelle; Shaposhnik, Zory; Peterson, Ellena M; Tontonoz, Peter; Shah, Prediman K; Arditi, Moshe

    2008-11-15

    Experimental and clinical studies link Chlamydia pneumoniae infection to atherogenesis and atherothrombotic events, but the underlying mechanisms are unclear. We tested the hypothesis that C. pneumoniae-induced acceleration of atherosclerosis in apolipoprotein E (ApoE)(-/-) mice is reciprocally modulated by activation of TLR-mediated innate immune and liver X receptor alpha (LXRalpha) signaling pathways. We infected ApoE(-/-) mice and ApoE(-/-) mice that also lacked TLR2, TLR4, MyD88, or LXRalpha intranasally with C. pneumoniae followed by feeding of a high fat diet for 4 mo. Mock-infected littermates served as controls. Atherosclerosis was assessed in aortic sinuses and in en face preparation of whole aorta. The numbers of activated dendritic cells (DCs) within plaques and the serum levels of cholesterol and proinflammatory cytokines were also measured. C. pneumoniae infection markedly accelerated atherosclerosis in ApoE-deficient mice that was associated with increased numbers of activated DCs in aortic sinus plaques and higher circulating levels of MCP-1, IL-12p40, IL-6, and TNF-alpha. In contrast, C. pneumoniae infection had only a minimal effect on atherosclerosis, accumulation of activated DCs in the sinus plaques, or circulating cytokine increases in ApoE(-/-) mice that were also deficient in TLR2, TLR4, or MyD88. However, C. pneumoniae-induced acceleration of atherosclerosis in ApoE(-/-) mice was further enhanced in ApoE(-/-)LXRalpha(-/-) double knockout mice and was accompanied by higher serum levels of IL-6 and TNF-alpha. We conclude that C. pneumoniae infection accelerates atherosclerosis in hypercholesterolemic mice predominantly through a TLR/MyD88-dependent mechanism and that LXRalpha appears to reciprocally modulate and reduce the proatherogenic effects of C. pneumoniae infection.

  2. Identification and characterization of a novel Toll-like receptor 2 homologue in the large yellow croaker Larimichthys crocea.

    PubMed

    Ao, Jingqun; Mu, Yinnan; Wang, Kunru; Sun, Min; Wang, Xianhui; Chen, Xinhua

    2016-01-01

    Toll-like receptors (TLRs) are key components of innate immunity that play significant roles in immune defence against pathogen invasion. In the present study, we identified a novel TLR2 homologue (LycTLR2b) in large yellow croaker (Larimichthys crocea) that shared low sequence identity with the previously reported large yellow croaker TLR2 (tentatively named LycTLR2a). The full-length cDNA of LycTLR2b was 2926 nucleotides (nt) long and encoded a protein consisting of 797 amino acids (aa). The deduced LycTLR2b protein exhibited a typical TLR domain architecture including a signal peptide, seven leucine-rich repeats (LRRs) in the extracellular region, a transmembrane domain, and a Toll-Interleukin 1 receptor (TIR) domain in the cytoplasmic region. Phylogenetic analysis showed that both LycTLR2a and LycTLR2b fall into a major clade formed by all TLR2 sequences, and are divided into two distinct branches. Genomic organization revealed that the LycTLR2b gene lacks intron, which is similar to zebrafish and human TLR2 genes, whereas the LycTLR2a gene contains multiple introns, as found in damselfish TLR2a and Fugu TLR2 genes. Syntenic analysis suggested that the occurrence of LycTLR2a and LycTLR2b may result from a relatively recent genome duplication event. LycTLR2b mRNA was constitutively expressed in all tissues examined although at different levels. Following bacterial vaccine challenge, LycTLR2b expression levels were significantly up-regulated in both spleen and head kidney tissues. Taken together, these results indicated that two different TLR2 homologues, which may play roles in antibacterial immunity, exist in large yellow croaker. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Toll-like receptor (TLR)21 signalling-mediated antiviral response against avian influenza virus infection correlates with macrophage recruitment and nitric oxide production.

    PubMed

    Abdul-Cader, Mohamed Sarjoon; Ahmed-Hassan, Hanaa; Amarasinghe, Aruna; Nagy, Eva; Sharif, Shayan; Abdul-Careem, Mohamed Faizal

    2017-06-01

    Cytosine-guanosinedeoxynucleotide (CpG) DNA can be used for the stimulation of the toll-like receptor (TLR)21 signalling pathway in avian species which ultimately leads to up-regulation of gene transcription for pro-inflammatory molecules including nitric oxide and recruitment of innate immune cells. The objective of this study was to determine the antiviral effect of NO, produced in response to in ovo delivery of CpG DNA, against avian influenza virus (AIV) infection. We found that when CpG DNA is delivered at embryo day (ED)18 in ovo and subsequently challenged with H4N6 AIV at ED19 pre-hatch and day 1 post-hatching, CpG DNA reduces H4N6 AIV replication associated with enhanced NO production and macrophage recruitment in lungs. In vitro, we showed that NO originating from macrophages is capable of eliciting an antiviral response against H4N6 AIV infection. This study provides insights into the mechanisms of CpG DNA-mediated antiviral response, particularly against AIV infection in avian species.

  4. TLR4/MD-2 activation by a synthetic agonist with no similarity to LPS

    PubMed Central

    Wang, Ying; Su, Lijing; Morin, Matthew D.; Jones, Brian T.; Whitby, Landon R.; Surakattula, Murali M. R. P.; Huang, Hua; Shi, Hexin; Choi, Jin Huk; Wang, Kuan-wen; Moresco, Eva Marie Y.; Berger, Michael; Zhan, Xiaoming; Zhang, Hong; Boger, Dale L.; Beutler, Bruce

    2016-01-01

    Structurally disparate molecules reportedly engage and activate Toll-like receptor (TLR) 4 and other TLRs, yet the interactions that mediate binding and activation by dissimilar ligands remain unknown. We describe Neoseptins, chemically synthesized peptidomimetics that bear no structural similarity to the established TLR4 ligand, lipopolysaccharide (LPS), but productively engage the mouse TLR4 (mTLR4)/myeloid differentiation factor 2 (MD-2) complex. Neoseptin-3 activates mTLR4/MD-2 independently of CD14 and triggers canonical myeloid differentiation primary response gene 88 (MyD88)- and Toll-interleukin 1 receptor (TIR) domain-containing adaptor inducing IFN-beta (TRIF)-dependent signaling. The crystal structure mTLR4/MD-2/Neoseptin-3 at 2.57-Å resolution reveals that Neoseptin-3 binds as an asymmetrical dimer within the hydrophobic pocket of MD-2, inducing an active receptor complex similar to that induced by lipid A. However, Neoseptin-3 and lipid A form dissimilar molecular contacts to achieve receptor activation; hence strong TLR4/MD-2 agonists need not mimic LPS. PMID:26831104

  5. TLR4/MD-2 activation by a synthetic agonist with no similarity to LPS.

    PubMed

    Wang, Ying; Su, Lijing; Morin, Matthew D; Jones, Brian T; Whitby, Landon R; Surakattula, Murali M R P; Huang, Hua; Shi, Hexin; Choi, Jin Huk; Wang, Kuan-wen; Moresco, Eva Marie Y; Berger, Michael; Zhan, Xiaoming; Zhang, Hong; Boger, Dale L; Beutler, Bruce

    2016-02-16

    Structurally disparate molecules reportedly engage and activate Toll-like receptor (TLR) 4 and other TLRs, yet the interactions that mediate binding and activation by dissimilar ligands remain unknown. We describe Neoseptins, chemically synthesized peptidomimetics that bear no structural similarity to the established TLR4 ligand, lipopolysaccharide (LPS), but productively engage the mouse TLR4 (mTLR4)/myeloid differentiation factor 2 (MD-2) complex. Neoseptin-3 activates mTLR4/MD-2 independently of CD14 and triggers canonical myeloid differentiation primary response gene 88 (MyD88)- and Toll-interleukin 1 receptor (TIR) domain-containing adaptor inducing IFN-beta (TRIF)-dependent signaling. The crystal structure mTLR4/MD-2/Neoseptin-3 at 2.57-Å resolution reveals that Neoseptin-3 binds as an asymmetrical dimer within the hydrophobic pocket of MD-2, inducing an active receptor complex similar to that induced by lipid A. However, Neoseptin-3 and lipid A form dissimilar molecular contacts to achieve receptor activation; hence strong TLR4/MD-2 agonists need not mimic LPS.

  6. Macrophages exposed continuously to lipopolysaccharide and other agonists that act via toll-like receptors exhibit a sustained and additive activation state

    PubMed Central

    Hume, David A; Underhill, David M; Sweet, Matthew J; Ozinsky, Adrian O; Liew, Foo Y; Aderem, Alan

    2001-01-01

    Background Macrophages sense microorganisms through activation of members of the Toll-like receptor family, which initiate signals linked to transcription of many inflammation associated genes. In this paper we examine whether the signal from Toll-like receptors [TLRs] is sustained for as long as the ligand is present, and whether responses to different TLR agonists are additive. Results RAW264 macrophage cells were doubly-transfected with reporter genes in which the IL-12p40, ELAM or IL-6 promoter controls firefly luciferase, and the human IL-1β promoter drives renilla luciferase. The resultant stable lines provide robust assays of macrophage activation by TLR stimuli including LPS [TLR4], lipopeptide [TLR2], and bacterial DNA [TLR9], with each promoter demonstrating its own intrinsic characteristics. With each of the promoters, luciferase activity was induced over an 8 hr period, and thereafter reached a new steady state. Elevated expression required the continued presence of agonist. Sustained responses to different classes of agonist were perfectly additive. This pattern was confirmed by measuring inducible cytokine production in the same cells. While homodimerization of TLR4 mediates responses to LPS, TLR2 appears to require heterodimerization with another receptor such as TLR6. Transient expression of constitutively active forms of TLR4 or TLR2 plus TLR6 stimulated IL-12 promoter activity. The effect of LPS, a TLR4 agonist, was additive with that of TLR2/6 but not TLR4, whilst that of lipopeptide, a TLR2 agonist, was additive with TLR4 but not TLR2/6. Actions of bacterial DNA were additive with either TLR4 or TLR2/6. Conclusions These findings indicate that maximal activation by any one TLR pathway does not preclude further activation by another, suggesting that common downstream regulatory components are not limiting. Upon exposure to a TLR agonist, macrophages enter a state of sustained activation in which they continuously sense the presence of a

  7. Microglial Heparan Sulfate Proteoglycans Facilitate the Cluster-of-Differentiation 14 (CD14)/Toll-like Receptor 4 (TLR4)-Dependent Inflammatory Response*

    PubMed Central

    O'Callaghan, Paul; Li, Jin-Ping; Lannfelt, Lars; Lindahl, Ulf; Zhang, Xiao

    2015-01-01

    Microglia rapidly mount an inflammatory response to pathogens in the central nervous system (CNS). Heparan sulfate proteoglycans (HSPGs) have been attributed various roles in inflammation. To elucidate the relevance of microglial HSPGs in a pro-inflammatory response we isolated microglia from mice overexpressing heparanase (Hpa-tg), the HS-degrading endoglucuronidase, and challenged them with lipopolysaccharide (LPS), a bacterial endotoxin. Prior to LPS-stimulation, the LPS-receptor cluster-of-differentiation 14 (CD14) and Toll-like receptor 4 (TLR4; essential for the LPS response) were similarly expressed in Ctrl and Hpa-tg microglia. However, compared with Ctrl microglia, Hpa-tg cells released significantly less tumor necrosis factor-α (TNFα), essentially failed to up-regulate interleukin-1β (IL1β) and did not initiate synthesis of proCD14. Isolated primary astroyctes expressed TLR4, but notably lacked CD14 and in contrast to microglia, LPS challenge induced a similar TNFα response in Ctrl and Hpa-tg astrocytes, while neither released IL1β. The astrocyte TNFα-induction was thus attributed to CD14-independent TLR4 activation and was unaffected by the cells HS status. Equally, the suppressed LPS-response in Hpa-tg microglia indicated a loss of CD14-dependent TLR4 activation, suggesting that microglial HSPGs facilitate this process. Indeed, confocal microscopy confirmed interactions between microglial HS and CD14 in LPS-stimulated microglia and a potential HS-binding motif in CD14 was identified. We conclude that microglial HSPGs facilitate CD14-dependent TLR4 activation and that heparanase can modulate this mechanism. PMID:25869127

  8. Toll-like receptors in bony fish: from genomics to function.

    PubMed

    Palti, Yniv

    2011-12-01

    Receptors that recognize conserved pathogen molecules are the first line of cellular innate immunity defense. Toll-like receptors (TLRs) are the best understood of the innate immune receptors that detect infections in mammals. Key features of the fish TLRs and the factors involved in their signaling cascade have high structural similarity to the mammalian TLR system. However, the fish TLRs also exhibit very distinct features and large diversity which is likely derived from their diverse evolutionary history and the distinct environments that they occupy. Six non-mammalian TLRs were identified in fish. TLR14 shares sequence and structural similarity with TLR1 and 2, and the other five (TLR19, 20, 21, 22 and 23) form a cluster of novel TLRs. TLR4 was lost from the genomes of most fishes, and the TLR4 genes found in zebrafish do not recognize the mammalian agonist LPS and are likely paralogous and not orthologous to mammalian TLR4 genes. TLR6 and 10 are also absent from all fish genomes sequenced to date. Of the at least 16 TLR types identified in fish, direct evidence of ligand specificity has only been shown for TLR2, TLR3, TLR5M, TLR5S and TLR22. The common carp TLR2 was shown to recognize the synthetic triacylated lipopeptide Pam(3)CSK(4) and lipopeptides from gram positive bacteria. The membrane-bound TLR5 (TLR5M) signaling in response to flagellin in rainbow trout is amplified through interaction with the soluble form (TLR5S) in a positive loop feedback. In Fugu, TLR3 is localized to the endoplasmic reticulum (ER) and recognizes relatively short dsRNA, while TLR22 has a surveillance function like the human cell-surface TLR3. Genome and gene duplications have been major contributors to the teleost's rich evolutionary history and genomic diversity. Duplicate or multi-copy TLR genes were identified for TLR3 and 7 in common carp, TLR4b, 5, 8 and 20 in zebrafish, TLR8a in rainbow trout and TLR22 in rainbow trout and Atlantic salmon. The main task for current and near

  9. Expression profiling of TRIM protein family in THP1-derived macrophages following TLR stimulation

    PubMed Central

    Jiang, Mei-Xiu; Hong, Xuan; Liao, Bin-Bin; Shi, Shui-Zhen; Lai, Xiao-Fang; Zheng, Huai-Yu; Xie, Lin; Wang, Yuan; Wang, Xiao-Lei; Xin, Hong-Bo; Fu, Mingui; Deng, Ke-Yu

    2017-01-01

    Activated macrophages play an important role in many inflammatory diseases including septic shock and atherosclerosis. However, the molecular mechanisms limiting macrophage activation are not completely understood. Members of the tripartite motif (TRIM) family have recently emerged as important players in innate immunity and antivirus. Here, we systematically analyzed mRNA expressions of representative TRIM molecules in human THP1-derived macrophages activated by different toll-like receptor (TLR) ligands. Twenty-nine TRIM members were highly induced (>3 fold) by one or more TLR ligands, among which 19 of them belong to TRIM C-IV subgroup. Besides TRIM21, TRIM22 and TRIM38 were shown to be upregulated by TLR3 and TLR4 ligands as previous reported, we identified a novel group of TRIM genes (TRIM14, 15, 31, 34, 43, 48, 49, 51 and 61) that were significantly up-regulated by TLR3 and TLR4 ligands. In contrast, the expression of TRIM59 was down-regulated by TLR3 and TLR4 ligands in both human and mouse macrophages. The alternations of the TRIM proteins were confirmed by Western blot. Finally, overexpression of TRIM59 significantly suppressed LPS-induced macrophage activation, whereas siRNA-mediated knockdown of TRIM59 enhanced LPS-induced macrophage activation. Taken together, the study provided an insight into the TLR ligands-induced expressions of TRIM family in macrophages. PMID:28211536

  10. Expression profiling of TRIM protein family in THP1-derived macrophages following TLR stimulation.

    PubMed

    Jiang, Mei-Xiu; Hong, Xuan; Liao, Bin-Bin; Shi, Shui-Zhen; Lai, Xiao-Fang; Zheng, Huai-Yu; Xie, Lin; Wang, Yuan; Wang, Xiao-Lei; Xin, Hong-Bo; Fu, Mingui; Deng, Ke-Yu

    2017-02-17

    Activated macrophages play an important role in many inflammatory diseases including septic shock and atherosclerosis. However, the molecular mechanisms limiting macrophage activation are not completely understood. Members of the tripartite motif (TRIM) family have recently emerged as important players in innate immunity and antivirus. Here, we systematically analyzed mRNA expressions of representative TRIM molecules in human THP1-derived macrophages activated by different toll-like receptor (TLR) ligands. Twenty-nine TRIM members were highly induced (>3 fold) by one or more TLR ligands, among which 19 of them belong to TRIM C-IV subgroup. Besides TRIM21, TRIM22 and TRIM38 were shown to be upregulated by TLR3 and TLR4 ligands as previous reported, we identified a novel group of TRIM genes (TRIM14, 15, 31, 34, 43, 48, 49, 51 and 61) that were significantly up-regulated by TLR3 and TLR4 ligands. In contrast, the expression of TRIM59 was down-regulated by TLR3 and TLR4 ligands in both human and mouse macrophages. The alternations of the TRIM proteins were confirmed by Western blot. Finally, overexpression of TRIM59 significantly suppressed LPS-induced macrophage activation, whereas siRNA-mediated knockdown of TRIM59 enhanced LPS-induced macrophage activation. Taken together, the study provided an insight into the TLR ligands-induced expressions of TRIM family in macrophages.

  11. A Novel Approach for Effectively Treating SCI Pain, Improving Opioid Efficacy, and Preventing Opioid-Induced Constipation: Key Role of Toll-Like Receptor 4 (TLR4)

    DTIC Science & Technology

    2014-10-01

    opioids, morphine , (+)-naltrexone, analgesia, allodynia, hyperalgesia, toll-like receptor 4 Overall Project Summary Task 1. Obtain approval from...administration of the TLR4 antagonist (+)-naltrexone with morphine prevent detrimental effects of morphine when this opioid is administered shortly...first week post-surgery with co-administration of morphine and (+)-naltrexone (vs. vehicles) starting 1 or 24 hr post surgery; von Frey and motor

  12. Toll-like receptor 4 (TLR4) deficient mice are protected from adipose tissue inflammation in aging.

    PubMed

    Ghosh, Amiya K; O'Brien, Martin; Mau, Theresa; Yung, Raymond

    2017-09-07

    Adipose tissue (AT) inflammation is a central mechanism for metabolic dysfunction in both diet-induced obesity and age-associated obesity. Studies in diet-induced obesity have characterized the role of Fetuin A (Fet A) in Free Fatty Acids (FFA)-mediated TLR4 activation and adipose tissue inflammation. However, the role of Fet A & TLR4 in aging-related adipose tissue inflammation is unknown. In the current study, analysis of epidymymal fat pads of C57/Bl6 male mice, we found that, in contrast to data from diet-induced obesity models, adipose tissue from aged mice have normal Fet A and TLR4 expression. Interestingly, aged TLR4-deficient mice have diminished adipose tissue inflammation compared to normal controls. We further demonstrated that reduced AT inflammation in old TLR4-deficient mice is linked to impaired ER stress, augmented autophagy activity, and diminished senescence phenomenon. Importantly, old TLR4-deficient mice have improved glucose tolerance compared to age-matched wild type mice, suggesting that the observed reduced AT inflammation in aged TLR4-deficient mice has important physiological consequences. Taken together, our present study establishes novel aspect of aging-associated AT inflammation that is distinct from diet-induced AT inflammation. Our results also provide strong evidence that TLR4 plays a significant role in promoting aging adipose tissue inflammation.

  13. Amphiphilic Guanidinocalixarenes Inhibit Lipopolysaccharide (LPS)- and Lectin-Stimulated Toll-like Receptor 4 (TLR4) Signaling.

    PubMed

    Sestito, Stefania E; Facchini, Fabio A; Morbioli, Ilaria; Billod, Jean-Marc; Martin-Santamaria, Sonsoles; Casnati, Alessandro; Sansone, Francesco; Peri, Francesco

    2017-06-22

    We recently reported on the activity of cationic amphiphiles in inhibiting TLR4 activation and subsequent production of inflammatory cytokines in cells and in animal models. Starting from the assumption that opportunely designed cationic amphiphiles can behave as CD14/MD-2 ligands and therefore modulate the TLR4 signaling, we present here a panel of amphiphilic guanidinocalixarenes whose structure was computationally optimized to dock into MD-2 and CD14 binding sites. Some of these calixarenes were active in inhibiting, in a dose-dependent way, the LPS-stimulated TLR4 activation and TLR4-dependent cytokine production in human and mouse cells. Moreover, guanidinocalixarenes also inhibited TLR4 signaling when TLR4 was activated by a non-LPS stimulus, the plant lectin PHA. While the activity of guanidinocalixarenes in inhibiting LPS toxic action has previously been related to their capacity to bind LPS, we suggest a direct antagonist effect of calixarenes on TLR4/MD-2 dimerization, pointing at the calixarene moiety as a potential scaffold for the development of new TLR4-directed therapeutics.

  14. Dectin-1 Controls TLR9 Trafficking to Phagosomes containing β-1,3 glucan123

    PubMed Central

    Khan, Nida S.; Kasperkovitz, Pia V.; Timmons, Allison K.; Mansour, Michael K.; Tam, Jenny M.; Seward, Michael W.; Reedy, Jennifer L.; Puranam, Sravanthi; Feliu, Marianela; Vyas, Jatin M.

    2016-01-01

    Dectin-1 and TLR9 play distinct roles in the recognition and induction of innate immune responses to Aspergillus fumigatus and Candida albicans. Dectin-1 is a receptor for the major fungal cell wall carbohydrate β-1,3 glucan that induces inflammatory cytokines and controls phagosomal maturation through Syk activation. TLR9 is an endosomal Toll-like receptor that also modulates the inflammatory cytokine response to fungal pathogens. In this study, we demonstrate that β-1,3 glucan beads are sufficient to induce dynamic redistribution and accumulation of cleaved TLR9 to phagosomes. Trafficking of TLR9 to A. fumigatus and C. albicans phagosomes requires Dectin-1 recognition. Inhibition of phagosomal acidification blocks TLR9 accumulation on phagosomes containing β-1,3 glucan beads. Dectin-1 mediated Syk activation is required for TLR9 trafficking to β-1,3 glucan, A. fumigatus, and C. albicans containing phagosomes. In addition, Dectin-1 regulates TLR9 dependent gene expression. Collectively, our study demonstrates that recognition of β-1,3 glucan by Dectin-1 triggers TLR9 trafficking to β-1,3 glucan-containing phagosomes, which may be critical in coordinating innate anti-fungal defense. PMID:26829985

  15. The critical role of ABCG1 and PPARγ/LXRα signaling in TLR4 mediates inflammatory responses and lipid accumulation in vascular smooth muscle cells.

    PubMed

    Cao, Xiaojie; Zhang, Lili; Chen, Chunhai; Wang, Qingsong; Guo, Lu; Ma, Qinlong; Deng, Ping; Zhu, Gang; Li, Binghu; Pi, Yan; Long, Chunyan; Zhang, Lei; Yu, Zhengping; Zhou, Zhou; Li, Jingcheng

    2017-04-01

    Toll-like receptor 4 (TLR4) plays critical roles in vascular inflammation, lipid accumulation and atherosclerosis development. However, the mechanisms underlying these processes are still not well established, especially in vascular smooth muscle cells (VSMCs). ATP-binding cassette transporter G1 (ABCG1) is one of the key genes mediating inflammation and cellular lipid accumulation. The function of TLR4 in regulating the expression of ABCG1 and the underlying molecular mechanisms remain to be elucidated. In this study, we cultured VSMCs from the thoracic aortas of mice and treated the cells with 50 μg/ml oxidized low-density lipoprotein (oxLDL) to activate TLR4 signaling. We observed that activating TLR4 with oxLDL induced inflammatory responses and lipid accumulation in VSMCs. The expression of peroxisome proliferator-activated receptor gamma (PPARγ), liver X receptor alpha (LXRα) and ABCG1 was inhibited by TLR4 activation. However, these effects could be reversed by knocking out TLR4. PPARγ activation by rosiglitazone rescued LXRα and ABCG1 expression and reduced TLR4-induced inflammation and lipid accumulation. Silencing PPARγ expression with a specific small interfering RNA (siRNA) inhibited LXRα and ABCG1 expression and, importantly, enhanced TLR4-induced inflammation and lipid accumulation. In conclusion, ABCG1 expression was down-regulated by TLR4, which induces inflammation and lipid accumulation in VSMCs via PPARγ/LXRα signaling. These findings indicate a novel molecular mechanism underlying TLR4-induced inflammation and lipid accumulation.

  16. Analysis of association between TLR-4 Asp299Gly and Thr399Ile gene polymorphisms and chronic periodontitis in a sample of south Indian population

    PubMed Central

    Reddy, Bavigadda Harish; Jayakumar, N. D.; Akula, Sreenivasa Rao; Sharma, Rupali; Kaarthikeyan, G.; Sankari

    2011-01-01

    Background: To analyze the association between TLR-4 Asp299Gly and Thr399Ile gene polymorphisms and chronic periodontitis in a sample of south Indian population. Materials and Methods: Genomic DNA was obtained from peripheral blood of 60 patients with chronic periodontitis and 60 periodontally healthy subjects. TLR-4 Asp299Gly and Thr399Ile gene polymorphisms were genotyped by a polymerase chain reaction–restriction fragment length polymorphism method. The data were analyzed by a χ2-test and by relative risk estimation. Results: Thr399Ile alleles were found in 4% of chronic periodontitis patients and in 1% of periodontally healthy subjects. The prevalence of a Thr399Ile heterozygote was found to be 5% in the chronic periodontitis group and 1.67% in the periodontally healthy group, respectively. Homozygosity for TLR-4 Thr399Ile was seen in chronic periodontitis patients only, which was 1.67%. The TLR-4 Asp299Gly gene polymorphism was not detected in either chronic periodontitis or periodontally healthy groups. Conclusion: There is no significant association between TLR-4 Thr399Ile polymorphism and chronic periodontitis in a sample of south Indian population. PMID:22368361

  17. NF-κB activation primes cells to a pro-inflammatory polarized response to a TLR7 agonist

    PubMed Central

    Lee, Jongdae; Hayashi, Masaaki; Lo, Jeng-Fan; Fearns, Colleen; Chu, Wen-Ming; Luo, Yunping; Xiang, Rong; Chuang, Tsung-Hsien

    2009-01-01

    Toll-like receptor 7 (TLR7) mediates anti-viral immunity by recognizing ssRNA viruses. Small molecular weight TLR7 agonists have been approved, or are being evaluated, for treatment of cancers or infectious diseases. Although TLR7 is predominantly expressed in a restricted set of immune cell types including plasmacytoid dendritic cells (pDCs), it is also expressed in non-native expressing cells (e.g., hepatocytes) under certain circumstances. To elucidate the molecular basis of TLR7 induction by pro-inflammatory stimulation and the subsequent cellular responses in these non-native TLR7-expressing cell types, we firstly cloned and characterized the 5′-promoter region of TLR7. The proximal region of this promoter drives the transcription of the TLR7 gene. Pro-inflammatory stimuli activated TLR7 transcription via a NF-κB binding motif in this region, and this activation could be blocked by mutation of the NF-κB binding site or addition of NF-κB inhibitors. Further studies showed that pretreatment of the Hep3B hepatocytes with TNF-α or IL-1 rendered them responsive to TLR7 activation by a TLR7 agonist. However, distinct from TLR7 activation in pDCs, which respond to stimulation with Th1 polarized cytokine production, TLR7 induction by pro-inflammatory signals in hepatocytes reconstitutes the NF-κB-dependent cascade but not the IRF7-dependent cascade, resulting in a pro-inflammatory polarized response rather than a Th1 polarized response. These results indicate that inflammatory stimulation is capable of priming cells to respond to TLR7 agonist with an immune response that differs from that in native TLR7-expressing cells. PMID:19426145

  18. Enhancement of the antigen-specific cytotoxic T lymphocyte-inducing ability in the PMDC11 leukemic plasmacytoid dendritic cell line via lentiviral vector-mediated transduction of the caTLR4 gene.

    PubMed

    Iwabuchi, Minami; Narita, Miwako; Uchiyama, Takayoshi; Iwaya, Shunpei; Oiwa, Eri; Nishizawa, Yoshinori; Hashimoto, Shigeo; Bonehill, Aude; Kasahara, Noriyuki; Takizawa, Jun; Takahashi, Masuhiro

    2015-08-01

    The aim of the present study was to enhance the efficiency of leukemia immunotherapy by increasing the antigen-specific cytotoxic T lymphocyte-inducing ability of leukemia cells. The leukemic plasmacytoid dendritic cell line PMDC05 containing the HLA-A02/24 antigen, which was previously established in our laboratory (Laboratory of Hematology and Oncology, Graduate School of Health Sciences, Niigata University, Niigata, Japan), was used in the present study. It exhibited higher expression levels of CD80 following transduction with lentiviruses encoding the CD80 gene. This CD80-expressing PMDC05 was named PMDC11. In order to establish a more potent antigen-presenting cell for cellular immunotherapy of tumors or severe infections, PMDC11 cells were transduced with a constitutively active (ca) toll-like receptor 4 (TLR4) gene using the Tet-On system (caTLR4-PMDC11). CD8(+) T cells from healthy donors with HLA-A02 were co-cultured with mutant WT1 peptide-pulsed PMDC11, lipopolysaccharide (LPS)-stimulated PMDC11 or caTLR4-PMDC11 cells. Interleukin (IL)-2 (50 IU/ml) and IL-7 (10 ng/ml) were added on day three of culture. Priming with mutant WT1 peptide-pulsed PMDC11, LPS-stimulated PMDC11 or caTLR4-PMDC11 cells was conducted once per week and two thirds of the IL-2/IL-7 containing medium was replenished every 3-4 days. Immediately prior to the priming with these various PMDC11 cells, the cultured cells were analyzed for the secretion of interferon (IFN)-γ in addition to the percentage and number of CD8(+)/WT1 tetramer(+) T cells using flow cytometry. caTLR4-PMDC11 cells were observed to possess greater antigen-presenting abilities compared with those of PMDC11 or LPS-stimulated PMDC11 cells in a mixed leukocyte culture. CD8 T cells positive for the WT1 tetramer were generated following 3-4 weeks of culture and CD8(+)/WT1 tetramer+ T cells were markedly increased in caTLR4-PMDC11-primed CD8(+) T cell culture compared with PMDC11 or LPS-stimulated PMDC11-primed CD8(+) T

  19. Gene polymorphisms in pattern recognition receptors and susceptibility to idiopathic recurrent vulvovaginal candidiasis

    PubMed Central

    Rosentul, Diana C.; Delsing, Corine E.; Jaeger, Martin; Plantinga, Theo S.; Oosting, Marije; Costantini, Irene; Venselaar, Hanka; Joosten, Leo A. B.; van der Meer, Jos W. M.; Dupont, Bertrand; Kullberg, Bart-Jan; Sobel, Jack D.; Netea, Mihai G.

    2014-01-01

    Objective: Approximately 5% of women suffer from recurrent vulvovaginal candidiasis (RVVC). It has been hypothesized that genetic factors play an important role in the susceptibility to RVVC. The aim of this study was to assess the effect of genetic variants of genes encoding for pattern recognition receptors (PRRs) on susceptibility to RVVC. Study design: For the study, 119 RVVC patients and 263 healthy controls were recruited. Prevalence of polymorphisms in five PRRs involved in recognition of Candida were investigated in patients and controls. In silico and functional studies were performed to assess their functional effects. Results: Single nucleotide polymorphisms (SNPs) in TLR1, TLR4, CLEC7A, and CARD9 did not affect the susceptibility to RVVC. In contrast, a non-synonymous polymorphism in TLR2 (rs5743704, Pro631His) increased the susceptibility to RVVC almost 3-fold. Furthermore, the TLR2 rs5743704 SNP had deleterious effects on protein function as assessed by in silico analysis, and in vitro functional assays suggested that it reduces production of IL-17 and IFNγ upon stimulation of peripheral blood mononuclear cells with Candida albicans. No effects were observed on serum mannose-binding lectin concentrations. Condensation: This study demonstrates the association of susceptibility to RVVC with genetic variation in TLR2, most likely caused by decreased induction of mucosal antifungal host defense. Conclusion: Genetic variation in TLR2 may significantly enhance susceptibility to RVVC by modulating host defense mechanisms against Candida. Additional studies are warranted to assess systematically the role of host genetic variation for susceptibility to RVVC. PMID:25295030

  20. Haplotype structure and positive selection at TLR1

    PubMed Central

    Heffelfinger, Christopher; Pakstis, Andrew J; Speed, William C; Clark, Allison P; Haigh, Eva; Fang, Rixun; Furtado, Mahohar R; Kidd, Kenneth K; Snyder, Michael P

    2014-01-01

    Toll-like receptor 1, when dimerized with Toll-like receptor 2, is a cell surface receptor that, upon recognition of bacterial lipoproteins, activates the innate immune system. Variants in TLR1 associate with the risk of a variety of medical conditions and diseases, including sepsis, leprosy, tuberculosis, and others. The foremost of these is rs5743618 c.2079T>G(p.(Ile602Ser)), the derived allele of which is associated with reduced risk of sepsis, leprosy, and other diseases. Interestingly, 602Ser, which shows signatures of selection, inhibits TLR1 surface trafficking and subsequent activation of NFκB upon recognition of a ligand. This suggests that reduced TLR1 activity may be beneficial for human health. To better understand TLR1 variation and its link to human health, we have typed all 7 high-frequency missense variants (>5% in at least one population) along with 17 other variants in and around TLR1 in 2548 individuals from 56 populations from around the globe. We have also found additional signatures of selection on missense variants not associated with rs5743618, suggesting that there may be multiple functional alleles under positive selection in this gene. PMID:24002163

  1. The emerging role of Toll-like receptor 4 in myocardial inflammation

    PubMed Central

    Yang, Y; Lv, J; Jiang, S; Ma, Z; Wang, D; Hu, W; Deng, C; Fan, C; Di, S; Sun, Y; Yi, W

    2016-01-01

    Toll-like receptors (TLRs) are a family of pattern recognition receptors involved in cardiovascular diseases. Notably, numerous studies have demonstrated that TLR4 activates the expression of several of pro-inflammatory cytokine genes that play pivotal roles in myocardial inflammation, particularly myocarditis, myocardial infarction, ischemia-reperfusion injury, and heart failure. In addition, TLR4 is an emerging target for anti-inflammatory therapies. Given the significance of TLR4, it would be useful to summarize the current literature on the molecular mechanisms and roles of TLR4 in myocardial inflammation. Thus, in this review, we first introduce the basic knowledge of the TLR4 gene and describe the activation and signaling pathways of TLR4 in myocardial inflammation. Moreover, we highlight the recent progress of research on the involvement of TLR4 in myocardial inflammation. The information reviewed here may be useful to further experimental research and to increase the potential of TLR4 as a therapeutic target. PMID:27228349

  2. TLR4 and DC-SIGN receptors recognized Mycobacterium scrofulaceum promoting semi-activated phenotype on bone marrow dendritic cells.

    PubMed

    Cruz-Aguilar, Marisa; Castillo-Rodal, Antonia I; Schcolnik-Cabrera, Alejandro; Bonifaz, Laura C; Molina, Gabriela; López-Vidal, Yolanda

    2016-07-01

    Nontuberculous mycobacteria (NTM) are recognized as emerging pathogens and their immune regulatory mechanisms are not well described yet. From them, Mycobacterium avium is known to be a weak activator of dendritic cells (DCs) that impairs the response induced by BCG vaccine. However, whether other NTM such as Mycobacterium scrofulaceum may modulate the activation of DCs, has not been extensively studied. Here, we exposed bone marrow-derived DCs (BMDCs) to M. scrofulaceum and we analyzed the effect on the activation of DCs. We found that M. scrofulaceum has a comparable ability to induce a semi-mature DC phenotype, which was produced by its interaction with DC-SIGN and TLR4 receptors in a synergic effect. BMDCs exposed to M. scrofulaceum showed high expression of PD-L2 and production of IL-10, as well as low levels of co-stimulatory molecules and pro-inflammatory cytokines. In addition to immunophenotype induced on DCs, changes in morphology, re-organization of cytoskeleton and decreased migratory capacity are consistent with a semi-mature phenotype. However, unlike other pathogenic mycobacteria, the DC-semi-mature phenotype induced by M. scrofulaceum was reversed after re-exposure to BCG, suggesting that modulation mechanisms of DC-activation used by M. scrofulaceum are different to other known pathogenic mycobacteria. This is the first report about the immunophenotypic characterization of DC stimulated by M. scrofulaceum.

  3. TLR4 and NFκB signaling is critical for taxol resistance in ovarian carcinoma cells.

    PubMed

    Sun, Nian-Kang; Huang, Shang-Lang; Chang, Ting-Chang; Chao, Chuck C-K

    2017-08-03

    We report here that toll-like receptor 4 (TLR4) and ABCB1 are upregulated in SKOV3 ovarian carcinoma cells that acquired resistance to the anticancer drug taxol. Silencing of TLR4 using short-hairpin RNA sensitized taxol-resistant SKOV3 cells to taxol (4.6 fold), whereas ectopic expression of TLR4 in parental, taxol-sensitive SKOV3 cells or TLR4-null HEK293 cells induced taxol resistance (∼2 fold). A sub-lethal dose of taxol induced ABCB1 protein expression in taxol-resistant SKOV3 cells. Inactivation of TLR4 using chemical inhibitors (CLI-095 and AO-I) downregulated ABCB1 protein expression and enhanced the cytotoxic activity of taxol in taxol-resistant SKOV3 cells. While the sensitization effect of TLR4 inactivation was also detected in TOV21G ovarian cancer cells, which express moderate level of TLR4, ectopic expression of ABCB1 prevented the sensitization effect in these cells. Notably, the NFκB pathway was significantly activated by taxol, and inhibition of this pathway suppressed TLR4-regulated ABCB1 expression. Furthermore, taxol-induced NFκB signaling was reduced following TLR4 silencing in taxol-resistant SKOV3 cells. Consistent with these results, ectopic expression of TLR4 in taxol-sensitive SKOV3 cells enhanced ABCB1 expression and conferred resistance to taxol. The protective effect of exogenous TLR4 expression against taxol was reduced by treatment with NFκB inhibitor in these cells. These results demonstrate that taxol activates the TLR4-NFκB pathway which in turn induces ABCB1 gene expression. This cellular pathway thus represents a novel target to limit resistance to taxol in ovarian cancer cells. © 2017 Wiley Periodicals, Inc.

  4. The effect of Tlr4 and/or C3 deficiency and of neonatal gene therapy on skeletal disease in mucopolysaccharidosis VII mice.

    PubMed

    Xing, Elizabeth M; Wu, Susan; Ponder, Katherine P

    2015-02-01

    Mucopolysaccharidosis (MPS) VII is a lysosomal storage disorder caused by the deficiency of the enzyme β-glucuronidase (Gusb(-/-)) and results in glycosaminoglycan (GAG) accumulation. Skeletal abnormalities include stunted long bones and bone degeneration. GAGs have been hypothesized to activate toll-like receptor 4 (Tlr4) signaling and the complement pathway, resulting in upregulation of inflammatory cytokines that suppress growth and cause degeneration of the bone. Gusb(-/-) mice were bred with Tlr4- and complement component 3 (C3)-deficient mice, and the skeletal manifestations of the doubly- and triply-deficient mice were compared to those of purebred Gusb(-/-) mice. Radiographs showed that purebred Gusb(-/-) mice had shorter tibias and femurs, and wider femurs, compared to normal mice. No improvement was seen in Tlr4, C3, or Tlr4/C3-deficient Gusb(-/-) mice. The glenoid cavity and humerus were scored on a scale from 0 (normal) to +3 (severely abnormal) for dysplasia and bone irregularities, and the joint space was measured. No improvement was seen in Tlr4, C3, or Tlr4/C3-deficient Gusb(-/-) mice, and their joint space remained abnormally wide. Gusb(-/-) mice treated neonatally with an intravenous retroviral vector (RV) had thinner femurs, longer legs, and a narrowed joint space compared with untreated purebred Gusb(-/-) mice, but no improvement in glenohumeral degeneration. We conclude that Tlr4- and/or C3-deficiency fail to ameliorate skeletal abnormalities, and other pathways may be involved. RV treatment improves some but not all aspects of bone disease. Radiographs may be an efficient method for future evaluation, as they readily show glenohumeral joint abnormalities.

  5. The effect of Tlr4 and/or C3 Deficiency and of Neonatal Gene Therapy on Skeletal Disease in Mucopolysaccharidosis VII mice

    PubMed Central

    Xing, Elizabeth M.; Wu, Susan; Ponder, Katherine P.

    2015-01-01

    Mucopolysaccharidosis (MPS) VII is a lysosomal storage disorder caused by the deficiency of the enzyme β-glucuronidase (Gusb-/-) and results in glycosaminoglycan (GAG) accumulation. Skeletal abnormalities include stunted long bones and bone degeneration. GAGs have been hypothesized to activate toll-like receptor 4 (Tlr4) signaling and the complement pathway, resulting in upregulation of inflammatory cytokines that suppress growth and cause degeneration of bone. Gusb-/- mice were bred with Tlr4- and complement component 3 (C3)-deficient mice, and the skeletal manifestations of the doubly- and triply-deficient mice were compared to those of purebred Gusb-/- mice. Radiographs showed that purebred Gusb-/- mice had shorter tibias and femurs, and wider femurs, compared to normal mice. No improvement was seen in Tlr4, C3, or Tlr4/C3-deficient Gusb-/- mice. The glenoid cavity and humerus were scored on a scale from 0 (normal) to +3 (severely abnormal) for dysplasia and bone irregularities, and the joint space was measured. No improvement was seen in Tlr4, C3, or Tlr4/C3-deficient Gusb-/- mice, and their joint space remained abnormally wide. Gusb-/- mice treated neonatally with an intravenous retroviral vector (RV) had thinner femurs, longer legs, and a narrowed joint space compared with untreated purebred Gusb-/- mice, but no improvement in glenohumeral degeneration. We conclude that Tlr4- and/or C3- deficiency fail to ameliorate skeletal abnormalities, and other pathways may be involved. RV treatment improves some but not all aspects of bone disease. Radiographs may be an efficient method for future evaluation, as they readily show glenohumeral joint abnormalities. PMID:25559179

  6. TLR4 Activation Promotes Podocyte Injury and Interstitial Fibrosis in Diabetic Nephropathy

    PubMed Central

    Ma, Jin; Chadban, Steven J.; Zhao, Cathy Y.; Chen, Xiaochen; Kwan, Tony; Panchapakesan, Usha; Pollock, Carol A.; Wu, Huiling

    2014-01-01

    Toll like receptor (TLR) 4 has been reported to promote inflammation in diabetic nephropathy. However the role of TLR4 in the complicated pathophysiology of diabetic nephropathy is not understood. In this study, we report elevated expression of TLR4, its endogenous ligands and downstream cytokines, chemokines and fibrogenic genes in diabetic nephropathy in WT mice with streptozotocin (STZ) diabetes. Subsequently, we demonstrated that TLR4−/− mice were protected against the development of diabetic nephropathy, exhibiting less albuminuria, inflammation, glomerular hypertrophy and hypercellularity, podocyte and tubular injury as compared to diabetic wild-type controls. Marked reductions in interstitial collagen deposition, myofibroblast activation (α-SMA) and expression of fibrogenic genes (TGF-β and fibronectin) were also evident in TLR4 deficient mice. Consistent with our in vivo results, high glucose directly promoted TLR4 activation in podocytes and tubular epithelial cells in vitro, resulting in NF-κB activation and consequent inflammatory and fibrogenic responses. Our data indicate that TLR4 activation may promote inflammation, podocyte and tubular epithelial cell injury and interstitial fibrosis, suggesting TLR4 is a potential therapeutic target for diabetic nephropathy. PMID:24842252

  7. Expression and Function of TLR2, TLR4, and Nod2 in Primary Canine Colonic Epithelial Cells

    PubMed Central

    Swerdlow, Mathew P.; Kennedy, Douglas R.; Kennedy, Jeffrey S.; Washabau, Robert J.; Henthorn, Paula S.; Moore, Peter F.; Carding, Simon R.; Felsburg, Peter J.

    2007-01-01

    The gut maintains a delicate balance between the downregulation of inflammatory reactions to commensal bacteria and the capacity to respond to pathogens with vigorous cellular and humoral immune responses. Intestinal epithelial cells, including colonic epithelial cells (CECs) possess many properties of cells of the innate immune system, in particular the ability to recognize and respond to microbial antigens. Recognition of microorganisms by CECs is based upon their recognition of signature molecules, called microbe-associated molecular patterns (MAMP), by pattern recognition receptors (PRR) including membrane Toll-like receptors (TLR) and cytosolic Nod2, an intracellular counterpart of TLRs. The purpose of this study was to determine whether primary CECs from normal dogs express a functional TLR2, TLR4 and Nod2 and whether they are regulated by inflammatory mediators. We show that canine primary CECs express TLR2, TLR4, and Nod2 that can be modulated in response to their respective MAMPs, lipopolysaccharides (LPS) or peptidoglycans (PGN). Furthermore, we demonstrate that these receptors are functional as evidenced by the induction of cytokine gene expression in response to LPS or PGN. PMID:17027090

  8. TLR4 single nucleotide polymorphisms (SNPs) associated with Salmonella shedding in pigs

    USDA-ARS?s Scientific Manuscript database

    Background: Toll-like receptor 4 (TLR4) is a key receptor in the innate immune recognition of lipopolysaccharide (LPS) from Gram-negative bacteria; genetic variation in this specific gene has been linked with the host’s response to bacterial infections and disease resistance. Since colonization and ...

  9. Changes in toll-like receptor (TLR)4-NFκB-IL1β signaling in male gout patients might be involved in the pathogenesis of primary gouty arthritis.

    PubMed

    Qing, Yu-Feng; Zhang, Quan-Bo; Zhou, Jing-Guo; Jiang, Li

    2014-02-01

    We undertook this study to determine whether the altered toll-like receptor (TLR)4-nuclear factor κB (NFκB)-interleukin1β (IL1β) signaling in peripheral blood of gout patients could provide insights into the pathogenesis of primary gouty arthritis (GA). TLR4 mRNA, TLR4 and NFκBp65 proteins expression and IL1β production were measured in 52 acute GA (AGA) and 34 non-acute GA (NAGA) male patients and 78 male healthy subjects (HC). NFκBp65 transcriptional activity and IL1β production were measured after TLR4 inhibition with anti-TLR4 antibody in peripheral whole blood from 13 AGA patients. The TLR4, NFκBp65 and IL1β expression was significantly increased in the AGA group than those in the NAGA or HC group (P < 0.05, respectively), also the levels were higher in the NAGA group comparing with those in the HC group (P < 0.05, respectively). Furthermore, moderate positive correlations were observed between concentration of uric acid and the TLR4 mRNA level, serum IL1β production (r = 0.649, 0.616), and strong positive correlation was observed between TLR4 mRNA level and serum IL1β (r = 0.848) in 52 AGA patients. On the other hand, NFκBp65 level and IL1β production were dramatically reduced after TLR4 blockade with anti-TLR4 antibody in peripheral blood from the AGA patients (P < 0.05, respectively). TLR4-NFκB-IL1β signaling might play a crucial role in the development of acute inflammation in primary gout patients.

  10. Ultraviolet B radiation illuminates the role of TLR3 in the epidermis

    PubMed Central

    Borkowski, Andrew W.; Gallo, Richard L.

    2014-01-01

    UV radiation poses a significant risk to human health. The mechanisms that help repair UV-damaged cells have recently been more clearly defined with the observation that Toll-like receptor 3 can sense self RNA released from necrotic keratinocytes following UV damage. TLR3 activation in the skin induces inflammation and increases expression of genes involved in skin barrier repair. Activation of TLR2 in the skin by commensal microbial products prevents excessive inflammation by blocking downstream TLR3 signaling. This review highlights how UV damage induced inflammation in the skin is propagated by host products and regulated by host inhabitants. PMID:24786223

  11. UVB radiation illuminates the role of TLR3 in the epidermis.

    PubMed

    Borkowski, Andrew W; Gallo, Richard L

    2014-09-01

    UV radiation poses a significant risk to human health. The mechanisms that help repair UV-damaged cells have recently been more clearly defined with the observation that Toll-like receptor 3 can sense self RNA released from necrotic keratinocytes following UV damage. TLR3 activation in the skin induces inflammation and increases the expression of genes involved in skin barrier repair. Activation of TLR2 in the skin by commensal microbial products prevents excessive inflammation by blocking downstream TLR3 signaling. This review highlights how UV damage-induced inflammation in the skin is propagated by host products and regulated by host inhabitants.

  12. Identification of single nucleotide polymorphisms in the bovine Toll-like receptor 1 gene and association with health traits in cattle.

    PubMed

    Russell, Christopher D; Widdison, Stephanie; Leigh, James A; Coffey, Tracey J

    2012-03-14

    Bovine mastitis remains the most common and costly disease of dairy cattle worldwide. A complementary control measure to herd hygiene and vaccine development would be to selectively breed cattle with greater resistance to mammary infection. Toll-like receptor 1 (TLR1) has an integral role for the initiation and regulation of the immune response to microbial pathogens, and has been linked to numerous inflammatory diseases. The objective of this study was to investigate whether single nucleotide polymorphisms (SNPs) within the bovine TLR1 gene (boTLR1) are associated with clinical mastitis (CM).Selected boTLR1 SNPs were analysed within a Holstein Friesian herd. Significant associations were found for the tagging SNP -79 T > G and the 3'UTR SNP +2463 C > T. We observed favourable linkage of reduced CM with increased milk fat and protein, indicating selection for these markers would not be detrimental to milk quality. Furthermore, we present evidence that some of these boTLR1 SNPs underpin functional variation in bovine TLR1. Animals with the GG genotype (from the tag SNP -79 T > G) had significantly lower boTLR1 expression in milk somatic cells when compared with TT or TG animals. In addition, stimulation of leucocytes from GG animals with the TLR1-ligand Pam3csk4 resulted in significantly lower levels of CXCL8 mRNA and protein.SNPs in boTLR1 were significantly associated with CM. In addition we have identified a bovine population with impaired boTLR1 expression and function. This may have additional implications for animal health and warrants further investigation to determine the suitability of identified SNPs as markers for disease susceptibility.

  13. Identification of single nucleotide polymorphisms in the bovine Toll-like receptor 1 gene and association with health traits in cattle

    PubMed Central

    2012-01-01

    Bovine mastitis remains the most common and costly disease of dairy cattle worldwide. A complementary control measure to herd hygiene and vaccine development would be to selectively breed cattle with greater resistance to mammary infection. Toll-like receptor 1 (TLR1) has an integral role for the initiation and regulation of the immune response to microbial pathogens, and has been linked to numerous inflammatory diseases. The objective of this study was to investigate whether single nucleotide polymorphisms (SNPs) within the bovine TLR1 gene (boTLR1) are associated with clinical mastitis (CM). Selected boTLR1 SNPs were analysed within a Holstein Friesian herd. Significant associations were found for the tagging SNP -79 T > G and the 3'UTR SNP +2463 C > T. We observed favourable linkage of reduced CM with increased milk fat and protein, indicating selection for these markers would not be detrimental to milk quality. Furthermore, we present evidence that some of these boTLR1 SNPs underpin functional variation in bovine TLR1. Animals with the GG genotype (from the tag SNP -79 T > G) had significantly lower boTLR1 expression in milk somatic cells when compared with TT or TG animals. In addition, stimulation of leucocytes from GG animals with the TLR1-ligand Pam3csk4 resulted in significantly lower levels of CXCL8 mRNA and protein. SNPs in boTLR1 were significantly associated with CM. In addition we have identified a bovine population with impaired boTLR1 expression and function. This may have additional implications for animal health and warrants further investigation to determine the suitability of identified SNPs as markers for disease susceptibility. PMID:22417166

  14. Lactobacillus acidophilus induces virus immune defence genes in murine dendritic cells by a Toll-like receptor-2-dependent mechanism.

    PubMed

    Weiss, Gudrun; Rasmussen, Simon; Zeuthen, Louise Hjerrild; Nielsen, Birgit Nøhr; Jarmer, Hanne; Jespersen, Lene; Frøkiaer, Hanne

    2010-10-01

    Lactobacilli are probiotics that, among other health-promoting effects, have been ascribed immunostimulating and virus-preventive properties. Certain Lactobacillus spp. have been shown to possess strong interleukin-12 (IL-12) -inducing properties. As IL-12 production depends on the up-regulation of type I interferons (IFNs), we hypothesized that the strong IL-12-inducing capacity of Lactobacillus acidophilus NCFM in murine bone-marrow-derived dendritic cells (DCs) is caused by an up-regulation of IFN-β, which subsequently induces IL-12 and the double-stranded RNA binding Toll-like receptor-3 (TLR-3). The expression of the genes encoding IFN-β, TLR-3, IL-12 and IL-10 in DCs upon stimulation with L. acidophilus NCFM was determined. Lactobacillus acidophilus NCFM induced a much stronger expression of Ifn-β, Il-12 and Il-10 compared with the synthetic double-stranded RNA ligand Poly I:C, whereas the levels of expressed Tlr-3 were similar. Whole genome microarray gene expression analysis revealed that other genes related to viral defence were significantly up-regulated and among the strongest induced genes in DCs stimulated with L. acidophilus NCFM. The ability to induce IFN-β was also detected in another L. acidophilus strain (X37), but was not a property of other probiotic strains tested, i.e. Bifidobacterium bifidum Z9 and Escherichia coli Nissle 1917. The IFN-β expression was markedly reduced in TLR-2(-/-) DCs, dependent on endocytosis, and the major cause of the induction of Il-12 and Tlr-3 in DCs stimulated with L. acidophilus NCFM. Collectively, our results reveal that certain lactobacilli trigger the expression of viral defence genes in DCs in a TLR-2 manner dependent on IFN-β.

  15. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2014-01-01

    Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. PMID:21424379

  16. Lactobacillus acidophilus induces virus immune defence genes in murine dendritic cells by a Toll-like receptor-2-dependent mechanism

    PubMed Central

    Weiss, Gudrun; Rasmussen, Simon; Zeuthen, Louise Hjerrild; Nielsen, Birgit Nøhr; Jarmer, Hanne; Jespersen, Lene; Frøkiær, Hanne

    2010-01-01

    Lactobacilli are probiotics that, among other health-promoting effects, have been ascribed immunostimulating and virus-preventive properties. Certain Lactobacillus spp. have been shown to possess strong interleukin-12 (IL-12) -inducing properties. As IL-12 production depends on the up-regulation of type I interferons (IFNs), we hypothesized that the strong IL-12-inducing capacity of Lactobacillus acidophilus NCFM in murine bone-marrow-derived dendritic cells (DCs) is caused by an up-regulation of IFN-β, which subsequently induces IL-12 and the double-stranded RNA binding Toll-like receptor-3 (TLR-3). The expression of the genes encoding IFN-β, TLR-3, IL-12 and IL-10 in DCs upon stimulation with L. acidophilus NCFM was determined. Lactobacillus acidophilus NCFM induced a much stronger expression of Ifn-β, Il-12 and Il-10 compared with the synthetic double-stranded RNA ligand Poly I:C, whereas the levels of expressed Tlr-3 were similar. Whole genome microarray gene expression analysis revealed that other genes related to viral defence were significantly up-regulated and among the strongest induced genes in DCs stimulated with L. acidophilus NCFM. The ability to induce IFN-β was also detected in another L. acidophilus strain (X37), but was not a property of other probiotic strains tested, i.e. Bifidobacterium bifidum Z9 and Escherichia coli Nissle 1917. The IFN-β expression was markedly reduced in TLR-2−/− DCs, dependent on endocytosis, and the major cause of the induction of Il-12 and Tlr-3 in DCs stimulated with L. acidophilus NCFM. Collectively, our results reveal that certain lactobacilli trigger the expression of viral defence genes in DCs in a TLR-2 manner dependent on IFN-β. PMID:20545783

  17. Polymorphism in the promoter region of the Toll-like receptor 9 gene and cervical human papillomavirus infection.

    PubMed

    Oliveira, Lucas Boeno; Louvanto, Karolina; Ramanakumar, Agnihotram V; Franco, Eduardo L; Villa, Luisa L

    2013-08-01

    Polymorphism in the Toll-like receptor (TLR) 9 gene has been shown to have a significant role in some diseases; however, little is known about its possible role in the natural history of human papillomavirus (HPV) infections. We investigated the association between a single-nucleotide polymorphism (SNP) (rs5743836) in the promoter region of TLR9 (T1237C) and type-specific HPV infections. Specimens were derived from a cohort of 2462 women enrolled in the Ludwig-McGill Cohort Study. We randomly selected 500 women who had a cervical HPV infection detected at least once during the study as cases. We defined two control groups: (i) a random sample of 300 women who always tested HPV negative, and (ii) a sample of 234 women who were always HPV negative but had a minimum of ten visits during the study. TLR9 genotyping was performed using bidirectional PCR amplification of specific alleles. Irrespective of group, the WT homozygous TLR9 genotype (TT) was the most common form, followed by the heterozygous (TC) and the mutant homozygous (CC) forms. There were no consistent associations between polymorphism and infection risk, either overall or by type or species. Likewise, there were no consistently significant associations between polymorphism and HPV clearance or persistence. We concluded that this polymorphism in the promoter region of TLR9 gene does not seem to have a mediating role in the natural history of the HPV infection.

  18. Lactobacillus rhamnosus GG increases Toll-like receptor 3 gene expression in murine small intestine ex vivo and in vivo.

    PubMed

    Aoki-Yoshida, A; Saito, S; Fukiya, S; Aoki, R; Takayama, Y; Suzuki, C; Sonoyama, K

    2016-06-01

    Administration of Lactobacillus rhamnosus GG (LGG) has been reported to be therapeutically effective against acute secretory diarrhoea resulting from the structural and functional intestinal mucosal lesions induced by rotavirus infection; however, the underlying mechanisms remain to be completely elucidated. Because Toll-like receptor 3 (TLR3) plays a key role in the innate immune responses following the recognition of rotavirus, the present study examined whether LGG influences TLR3 gene expression in murine small intestine ex vivo and in vivo. We employed cultured intestinal organoids derived from small intestinal crypts as an ex vivo tissue model. LGG supplementation increased TLR3 mRNA levels in the intestinal organoids, as estimated by quantitative real-time polymerase chain reaction. Likewise, single and 7-day consecutive daily administrations of LGG increased TLR3 mRNA levels in the small intestine of C57BL/6N mice. The mRNA levels of other TLRs were not substantially altered both ex vivo and in vivo. In addition, LGG supplementation increased the mRNA levels of an antiviral type 1 interferon, interferon-α (IFN-α), and a neutrophil chemokine, CXCL1, upon stimulation with a synthetic TLR3 ligand, poly(I:C) in the intestinal organoids. LGG administration did not alter IFN-α and CXCL1 mRNA levels in the small intestine in vivo. Supplementation of other bacterial strains, Bifidobacterium bifidum and Lactobacillus paracasei, failed to increase TLR3 and poly(I:C)-stimulated CXCL1 mRNA levels ex vivo. We propose that upregulation of TLR3 gene expression may play a pivotal role in the therapeutic efficacy of LGG against rotavirus-associated diarrhoea. In addition, we demonstrated that intestinal organoids may be a promising ex vivo tissue model for investigating host-pathogen interactions and the antiviral action of probiotics in the intestinal epithelium.

  19. TLR7 and TLR8 expression increases tumor cell proliferation and promotes chemoresistance in human pancreatic cancer

    PubMed Central

    GRIMMIG, TANJA; MATTHES, NIELS; HOELAND, KATHARINA; TRIPATHI, SUDIPTA; CHANDRAKER, ANIL; GRIMM, MARTIN; MOENCH, ROMANA; MOLL, EVA-MARIA; FRIESS, HELMUT; TSAUR, IGOR; BLAHETA, ROMAN A.; GERMER, CRISTOPH T.; WAAGA-GASSER, ANA MARIA; GASSER, MARTIN

    2015-01-01

    Chronic inflammation as an important epigenetic and environmental factor for putative tumorigenesis and tumor progression may be associated with specific activation of Toll-like receptors (TLR). Recently, carcinogenesis has been suggested to be dependent on TLR7 signaling. In the present study, we determined the role of both TLR7 and TLR8 expression and signaling in tumor cell proliferation and chemoresistance in pancreatic cancer. Expression of TLR7/TLR8 in UICC stage I–IV pancreatic cancer, chronic pancreatitis, normal pancreatic tissue and human pancreatic (PANC1) cancer cell line was examined. For in vitro/in vivo studies TLR7/TLR8 overexpressing PANC1 cell lines were generated and analyzed for effects of (un-)stimulated TLR expression on tumor cell proliferation and chemoresistance. TLR expression was increased in pancreatic cancer, with stage-dependent upregulation in advanced tumors, compared to earlier stages and chronic pancreatitis. Stimulation of TLR7/TLR8 overexpressing PANC1 cells resulted in elevated NF-κB and COX-2 expression, increased cancer cell proliferation and reduced chemosensitivity. More importantly, TLR7/TLR8 expression increased tumor growth in vivo. Our data demonstrate a stage-dependent upregulation of both TLR7 and TLR8 expression in pancreatic cancer. Functional analysis in human pancreatic cancer cells point to a significant role of both TLRs in chronic inflammation-mediated TLR7/TLR8 signaling leading to tumor cell proliferation and chemoresistance. PMID:26134824

  20. TLR polymorphisms in FMF: association of TLR-2 (Arg753Gln) and TLR-4 (Asp299Gly, Thre399Ile) polymorphisms and myeloid cell TLR-2 and TLR-4 expression with the development of secondary amyloidosis in FMF.

    PubMed

    Soylu, Alper; Ateş, Halil; Cingöz, Sultan; Türkmen, Mehmet; Demir, Belde Kasap; Tunca, Mehmet; Sakızlı, Meral; Cirit, Mustafa; Ersoy, Rıfkı; Ulgenalp, Ayfer; Kavukçu, Salih

    2011-10-01

    Amyloidosis is the major complication of familial Mediterranean fever (FMF). Toll-like receptors (TLR) are involved in the activation of an innate immune system TLR-2 and TLR-4 recognize lipoteichoic acid and lipopolysaccharides (LPS), respectively. While TLR-2 Arg753Gln polymorphism upregulates, TLR-4 Asp299Gly and Thre399Ile polymorphisms downregulate inflammation. We investigated the effect of these polymorphisms on the development of amyloidosis in FMF patients. We also investigated myeloid cell TLR-2 and TLR-4 expressions in these patients. We studied 26 FMF patients and 13 FMF patients with amyloidosis. TLR-2 Arg753Gln and TLR-4 Asp299Gly and Thr399Ile polymorphisms were analyzed with the polymerase chain reaction-restriction fragment length polymorphism method. Myeloid cell baseline TLR-2 and TLR-4 and LPS-induced TLR-4 expressions were evaluated. The TLR-2 and TLR-4 polymorphism rate was compared with the results of 100 healthy subjects in our previous study. In addition, 13 healthy controls were enrolled for leukocyte TLR-2 and TLR-4 expressions. Serum amyloid A (SAA) levels were measured in these 13 control cases and in FMF patients during attack-free periods. The frequency of TLR-2 Arg753Gln, TLR-4 Asp299Gly, and Thr399Ile polymorphisms in healthy controls in our previous study were 1%, 3%, and 2%, respectively. The frequency of these polymorphisms were not different in FMF patients (with or without amyloidosis) compared to the control group. Likewise, myeloid cell TLR-2 and TLR-4 expressions were not different among the controls and FMF patients. However, LPS-induced TLR-4 expression in granulocytes was more prominent in FMF patients. There was no correlation between TLR-2 and TLR-4 expressions and SAA levels. Neither myeloid cell TLR-2 and TLR-4 expressions nor TLR-2 Arg753Gln, TLR-4 Asp299Gly, and Thr399Ile polymorphisms seem to affect the development of secondary amyloidosis in FMF patients in our study population.

  1. Bruton's tyrosine kinase regulates TLR9 but not TLR7 signaling in human plasmacytoid dendritic cells.

    PubMed

    Wang, Jingming; Lau, Kai-Yeung; Jung, Jimmy; Ravindran, Palanikumar; Barrat, Franck J

    2014-04-01

    Plasmacytoid dendritic cells (PDCs) represent a key cell type for both innate and adaptive immunity. PDCs express both TLR7 and TLR9 and the recognition of nucleic acids by these two receptors triggers the production of a large amount of type-I IFN and the induction of PDC maturation into APCs. This unique feature of PDCs is at the basis of clinical development of both TLR7 and TLR9 agonists for infectious diseases, allergy, cancer, and asthma. However, TLR7 and TLR9 recognition of self-nucleic acids is linked to many autoimmune diseases including lupus, and a better understanding of the signaling pathways of these two receptors in PDCs is thus important. We have identified Bruton's tyrosine kinase (Btk) as an important player for TLR9 but not TLR7 signaling in human PDCs. Blocking Btk using a specific inhibitor leads to the reduction of all TLR9-induced responses in PDCs, including cytokine production and expression of costimulatory molecules, while this has no impact on the TLR7 response. This identifies Btk as a key molecule in TLR9 signaling in PDCs and is the first demonstration that the TLR7 and TLR9 pathways can be dissociated in human PDCs. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Aggregation behavior of an ultra-pure lipopolysaccharide that stimulates TLR-4 receptors.

    PubMed

    Sasaki, Hirotaka; White, Stephen H

    2008-07-01

    The innate immune systems of humans and other animals are activated by lipopolysaccharides (LPS), which are glucosamine-based phospholipids that form the outer leaflet of the outer membranes of Gram-negative bacteria. Activation involves interactions of LPS with the innate immunity-receptor comprised of toll-like receptor 4 in complex with so-called MD-2 protein and accessory proteins, such as CD14 and LPS binding protein. The Lipid Metabolites and Pathways Strategy (LIPID MAPS) Consortium has isolated in large amounts a nearly homogeneous LPS, Kdo(2)-Lipid A, and demonstrated that it activates macrophages via toll-like receptor 4. The active form of LPS, monomer or aggregate, is controversial. We have therefore examined the aggregation behavior and other physical properties of Kdo(2)-Lipid A. Differential scanning calorimetry of Kdo(2)-Lipid A suspensions revealed a gel-to-liquid crystalline phase transition at 36.4 degrees C (T(m)). The nominal critical aggregation concentration, determined by dynamic light scattering, was found to be 41.2 +/- 1.6 nM below the T(m) (25 degrees C), but only 8.1 +/- 0.3 nM above the T(m) (37 degrees C). The specific molecular volume of Kdo(2)-Lipid A, obtained by densitometry measurements was found to be 3159 +/- 71 A(3) at 25 degrees C, from which the number of molecules in each aggregate was estimated to be 5.8 x 10(5). The aggregation behavior of Kdo(2)-Lipid A in the presence of lipoprotein-deficient serum suggests that Re LPS monomers and multimers are the active units for the immune system in the CD14-dependent and -independent pathways, respectively.

  3. Differential expression of Toll-like receptor pathway genes in chicken embryo fibroblasts from chickens resistant and susceptible to Marek's disease.

    PubMed

    Haunshi, Santosh; Cheng, Hans H

    2014-03-01

    The Toll-like receptor (TLR) signaling pathway is one of the innate immune defense mechanisms against pathogens in vertebrates and invertebrates. However, the role of TLR in non-MHC genetic resistance or susceptibility to Marek's disease (MD) in the chicken is yet to be elucidated. Chicken embryo fibroblast (CEF) cells from MD susceptible and resistant lines were infected either with Marek's disease virus (MDV) or treated with polyionosinic-polycytidylic acid, a synthetic analog of dsRNA, and the expression of TLR and pro-inflammatory cytokines was studied at 8 and 36 h posttreatment by quantitative reverse transcriptase PCR. Findings of the present study reveal that MDV infection and polyionosinic-polycytidylic acid treatment significantly elevated the mRNA expression of TLR3, IL6, and IL8 in both susceptible and resistant lines. Furthermore, basal expression levels in uninfected CEF for TLR3, TLR7, and IL8 genes were significantly higher in resistant chickens compared with those of susceptible chickens. Our results suggest that TLR3 together with pro-inflammatory cytokines may play a significant role in genetic resistance to MD.

  4. TLR4 antagonist FP7 inhibits LPS-induced cytokine production and glycolytic reprogramming in dendritic cells, and protects mice from lethal influenza infection

    PubMed Central

    Perrin-Cocon, Laure; Aublin-Gex, Anne; Sestito, Stefania E.; Shirey, Kari Ann; Patel, Mira C.; André, Patrice; Blanco, Jorge C.; Vogel, Stefanie N.; Peri, Francesco; Lotteau, Vincent

    2017-01-01

    Dysregulated Toll-like receptor (TLR)-4 activation is involved in acute systemic sepsis, chronic inflammatory diseases, such as atherosclerosis and diabetes, and in viral infections, such as influenza infection. Thus, therapeutic control of the TLR4 signalling pathway is of major interest. Here we tested the activity of the small-molecule synthetic TLR4 antagonist, FP7, in vitro on human monocytes and monocyte-derived dendritic cells (DCs) and in vivo during influenza virus infection of mice. Our results indicate that FP7 antagonized the secretion of proinflammatory cytokines (IL-6, IL-8, and MIP-1β) by monocytes and DCs (IC50 < 1 μM) and prevented DC maturation upon TLR4 activation by ultrapure lipopolysaccharide (LPS). FP7 selectively blocked TLR4 stimulation, but not TLR1/2, TLR2/6, or TLR3 activation. TLR4 stimulation of human DCs resulted in increased glycolytic activity that was also antagonized by FP7. FP7 protected mice from influenza virus-induced lethality and reduced both proinflammatory cytokine gene expression in the lungs and acute lung injury (ALI). Therefore, FP7 can antagonize TLR4 activation in vitro and protect mice from severe influenza infection, most likely by reducing TLR4-dependent cytokine storm mediated by damage-associated molecular patterns (DAMPs) like HMGB1. PMID:28106157

  5. TLR4 signaling induces TLR3 up-regulation in alveolar macrophages during acute lung injury

    PubMed Central

    Ding, Xibing; Jin, Shuqing; Tong, Yao; Jiang, Xi; Chen, Zhixia; Mei, Shuya; Zhang, Liming; Billiar, Timothy R.; Li, Quan

    2017-01-01

    Acute lung injury is a life-threatening inflammatory response caused by severe infection. Toll-like receptors in alveolar macrophages (AMΦ) recognize the molecular constituents of pathogens and activate the host’s innate immune responses. Numerous studies have documented the importance of TLR-TLR cross talk, but few studies have specifically addressed the relationship between TLR4 and TLR3. We explored a novel mechanism of TLR3 up-regulation that is induced by LPS-TLR4 signaling in a dose- and time-dependent manner in AMΦ from C57BL/6 mice, while the LPS-induced TLR3 expression was significantly reduced in TLR4−/− and Myd88−/− mice and following pretreatment with a NF-κB inhibitor. The enhanced TLR3 up-regulation in AMΦ augmented the expression of cytokines and chemokines in response to sequential challenges with LPS and Poly I:C, a TLR3 ligand, which was physiologically associated with amplified AMΦ-induced PMN migration into lung alveoli. Our study demonstrates that the synergistic effect between TLR4 and TLR3 in macrophages is an important determinant in acute lung injury and, more importantly, that TLR3 up-regulation is dependent on TLR4-MyD88-NF-κB signaling. These results raise the possibility that bacterial infections can induce sensitivity to viral infections, which may have important implications for the therapeutic manipulation of the innate immune system. PMID:28198368

  6. Expression of Toll-like receptors and their association with cytokine responses in peripheral blood mononuclear cells of children with acute rotavirus diarrhoea.

    PubMed

    Xu, J; Yang, Y; Sun, J; Ding, Y; Su, L; Shao, C; Jiang, B

    2006-06-01

    To understand virus and host interactions and host responses to rotavirus infection in children, we analysed by real-time polymerase chain reaction (PCR) the expression of mRNA for five Toll-like receptors (TLRs) (TLR2, TLR3, TLR4, TLR7 and TLR8) and four T helper (Th)1 and Th2 cytokines [interleukin (IL)-2, IL-12, interferon (IFN)-gamma and IL-4) in peripheral blood mononuclear cells (PBMC) of children with acute rotavirus diarrhoea. We observed significantly higher expression of genes encoding TLR2, TLR3, TLR4, TLR7 and TLR8 in PBMC of 41% (31/75) patients within 3 days of illness onset than those in healthy children. After 3 days of illness onset, only TLR3 and TLR8 mRNA expressions were still significantly (P<0.05) increased in 59% (44/75) children with diarrhoea. We also observed significantly (P<0.05) elevated expression of IL-12p40 and IFN-gamma in PBMC of patients during the entire period of illness and the first 3 days of illness, respectively. We further demonstrated a weak but significant association between elevated levels of gene expression of four TLRs (TLR2, TLR3, TLR4 and TLR8) and IFN-gamma. Our results suggest that multiple TLRs may modulate the immune response in the acute phase of rotavirus infection and play a role in the activation of IFN-gamma.

  7. Toll-like Receptor (TLR) 2 Mediates Inflammatory Responses to Oligomerized RrgA Pneumococcal Pilus Type 1 Protein*

    PubMed Central

    Basset, Alan; Zhang, Fan; Benes, Cyril; Sayeed, Sabina; Herd, Muriel; Thompson, Claudette; Golenbock, Douglas T.; Camilli, Andrew; Malley, Richard

    2013-01-01

    The pneumococcal type 1 pilus is an inflammatory and adherence-promoting structure associated with increased virulence in mouse models. We show that RrgA, an ancillary pilus subunit devoid of a lipidation motif, particularly when presented as part of an oligomer, is a TLR2 agonist. The surface-exposed domain III, and in particular a 49-amino acid sequence (P3), of the protein is responsible for the TLR2 activity of RrgA. A pneumococcal mutant carrying RrgA with a deletion of the P3 region was significantly reduced in its ability to activate TLR2 and induce TNF-α responses after mouse intraperitoneal infection, whereas no such difference could be noted when TLR2−/− mice were challenged, further implicating this region in recognition by TLR2. Thus, we conclude that the type 1 pneumococcal pilus can activate cells via TLR2, and the ancillary pilus subunit RrgA is a key component of this activation. PMID:23233677

  8. Differential gene expression following TLR stimulation in rag1-/- mutant zebrafish tissues and morphological descriptions of lymphocyte-like cell populations.

    PubMed

    Muire, Preeti J; Hanson, Larry A; Wills, Robert; Petrie-Hanson, Lora

    2017-01-01

    In the absence of lymphocytes, rag1-/- mutant zebrafish develop protective immunity to bacteria. In mammals, induction of protection by innate immunity can be mediated by macrophages or natural killer (NK) cells. To elucidate potential responsive cell populations, we morphologically characterized lymphocyte-like cells (LLCs) from liver, spleen and kidney hematopoietic tissues. In fish, these cells include NK cells and Non-specific cytotoxic cells (NCCs). We also evaluated the transcriptional expression response of select genes that are important indicators of NK and macrophage activation after exposure to specific TLR ligands. The LLC cell populations could be discriminated by size and further discriminated by the presence of cytoplasmic granules. Expression levels of mx, tnfα, ifnγ, t-bet and nitr9 demonstrated dynamic changes in response to intra-coelomically administered β glucan (a TLR2/6 ligand), Poly I:C (a TLR3 ligand) and resiquimod (R848) (a TLR7/8 ligand). Following TLR 2/6 stimulation, there was a greater than 100 fold increase in ifnγ in liver, kidney and spleen and moderate increases in tnfα in liver and kidney. TLR3 stimulation caused broad up regulation of mx, down-regulation of tnfα in kidney and spleen tissues and up regulation of nitr9 in the kidney. Following TLR 7/8 stimulation, there was a greater than 100 fold increase in ifnγ in liver and kidney and t-bet in liver. Our gene expression findings suggest that LLCs and macrophages are stimulated following β glucan exposure. Poly I:C causes type I interferon response and mild induction of LLC in the kidney and R-848 exposure causes the strongest LLC stimulation. Overall, the strongest NK like gene expression occurred in the liver. These differential effects of TLR ligands in rag1-/- mutant zebrafish shows strong NK cell-like gene expression responses, especially in the liver, and provides tools to evaluate the basis for protective immunity mediated by the innate immune cells of fish.

  9. A functional variant at miR-34a binding site in toll-like receptor 4 gene alters susceptibility to hepatocellular carcinoma in a Chinese Han population.

    PubMed

    Jiang, Zi-Cheng; Tang, Xian-Mei; Zhao, Ying-Ren; Zheng, Lei

    2014-12-01

    Toll-like receptor 4 (TLR4) plays a key role in prompting the innate or immediate response. A growing body of evidence suggests that genetic variants of TLR4 gene were associated with the development of cancers. This study aimed to investigate the relationship of a functional variant (rs1057317) at microRNA-34a (miR-34a) binding site in toll-like receptor 4 gene and the risk of hepatocellular carcinoma. A single center-based case-control study was conducted. In this study, the polymerase chain reaction (PCR) and direct sequencing were used to genotype sequence variants of TLR4 in 426 hepatocellular carcinoma cases and 438 controls. The modification of rs1057317 on the binding of hsa-miR-34a to TLR4 messenger RNA (mRNA) was measured by luciferase activity assay. Individuals carrying the AA genotypes for the rs1057317 were associated significantly with increased risk of hepatocellular carcinoma comparing with those carrying wild-type homozygous CC genotypes (adjusted odds ratio [OR] by sex and age, from 1.116 to 2.452, P = 0.013). The activity of the reporter vector was lower in the reporter vector carrying C allele than the reporter vector carrying A allele. Furthermore, the expression of TLR4 was detected in the peripheral blood mononucleated cell of hepatocellular carcinoma (HCC) patients, suggesting that mRNA and protein levels of TLR4 might be associated with SNP rs1057317. Collectively, these results suggested that the risk of hepatocellular carcinoma was associated with a functional variant at miR-34a binding site in toll-like receptor 4 gene. miR-34a/TLR4 axis may play an important role in the development of hepatocellular carcinoma.

  10. A pilot study examining the impact of exercise training on skeletal muscle genes related to the TLR signaling pathway in older adults following hip fracture recovery.

    PubMed

    McKenzie, Alec I; Briggs, Robert A; Barrows, Katherine M; Nelson, Daniel S; Kwon, Oh Sung; Hopkins, Paul N; Higgins, Thomas F; Marcus, Robin L; Drummond, Micah J

    2017-01-01

    Older adults after hip fracture surgery experience progressive muscle atrophy and weakness, limiting full recovery. Further understanding of the molecular mechanisms in muscle with adaptation to exercise training in this vulnerable population is necessary. Therefore, we conducted a pilot study to investigate the skeletal muscle inflammatory and ceramide biosynthesis gene expression levels associated with the toll-like receptor (TLR) pathway before (Pre) and following a 3-mo multicomponent exercise training program in older adults (3M, 4F; 78.4 ± 13.3 yr; 25.5 ± 2.3 kg/m(2)) ~4 mo after repair from hip fracture (HipFx). Vastus lateralis biopsies from the surgical limb were obtained before (Pre) and after training. Molecular end points and muscle function data were also compared with matched nonexercise healthy controls (CON). As a follow-up analysis, we evaluated specific sphingolipid pools in HipFx and CON muscle. Following training, quadriceps cross-sectional area, strength, and 6-min walk (6MW) increased in the surgical limb (P < 0.05). Additionally, MYD88, TAK1, NFKB1, IL6, SPT2, and CERS1 gene expression decreased after training (P ≤ 0.05), but some remained elevated above CON levels. Interestingly, MYD88 mRNA was inversely correlated to quadriceps CSA, strength, and 6MW. Finally, muscle dihydroceramides and phosphoceramides in HipFx were lower than CON at Pre (P ≤ 0.05), but after training differences from CON were removed. Together, our pilot data support that exercise training alters skeletal muscle inflammation and ceramide metabolism associated with TLR signaling in older adults recovering from hip fracture surgery and may be related to improvements in muscle function recovery. These pilot data demonstrate that 3 mo of exercise training in older adults recovering from hip fracture surgery was able to mitigate skeletal muscle gene expression related to inflammation and ceramide metabolism while also improving surgical limb lean tissue, strength, and

  11. Upregulation of PSCDBP, TLR2, TWIST1, FLJ35382, EDNRB, and RGS12 gene expression in human myometrium at labor.

    PubMed

    O'Brien, Margaret; Morrison, John J; Smith, Terry J

    2008-04-01

    The regulatory mechanisms underlying myometrial smooth muscle contractility during labor are poorly understood. The authors therefore investigated the transcriptional profile of the changes that occur in the human myometrium at term pregnancy when compared with that at labor. Microarray technology was used to identify differentially expressed genes in human myometrium at labor. Real-time fluorescence reversetranscriptase polymerase chain reaction (RT-PCR) was subsequently performed to verify the microarray data. Semiquantitative RT-PCR, Western blotting, and microscopy methodologies were also used. Certain novel genes were found to be upregulated in human myometrium at labor. Of these, PSCDBP, TLR2, TWIST1 , FLJ35382, andRGS12 have not been previously characterized or identified in human myometrium. EDNRB is the other novel labor-associated gene whose reported expression is also upregulated at labor. All 6 genes were expressed on human myometrial smooth muscle cells. These novel upregulated genes are involved in multiple pathways that may be associated with a variety of cellular processes including inflammation, transcriptional regulation, and intracellular signaling.

  12. Cell-specific expression of TLR9 isoforms in inflammation.

    PubMed

    McKelvey, Kelly J; Highton, John; Hessian, Paul A

    2011-02-01

    Toll-like receptors (TLRs) are key pattern recognition receptors during an immune response. With five isoforms of human TLR9 described, we hypothesised that differential expression of TLR9 isoforms in different cell types would result in variable contributions to the overall input from TLR9 during inflammation. We assessed the molecular expression of the TLR9 isoforms, TLR9-A, -C and -D. In normal peripheral blood mononuclear cells, B-lymphocytes express ∼100-fold more TLR9-A transcript than monocytes or T-lymphocytes, which predominantly express the TLR9-C transcript. Switches in isoform predominance accompany B-lymphocyte development. TLR9 protein expression in rheumatoid inflammatory lesions reflected the TLR9 isoform expression by immune cells. Herein we suggest that B-lymphocytes and plasmacytoid dendritic cells contribute the ∼3-fold higher TLR9-A transcript levels observed in inflamed synovium when compared to subcutaneous rheumatoid nodules. In contrast, macrophages and T-lymphocytes contribute the ∼4-fold higher TLR9-C transcript levels seen in nodules, compared to synovia. From protein sequence, predictions of subcellular localisation suggest TLR9-B may locate to the mitochondria, whereas TLR9-D adopts an opposing orientation in the endoplasmic reticulum. Consistent with this, structure models raise the possibility of alternative ligands for the TLR9-B and TLR9-D variants. Our results highlight differences in the expression of human TLR9 isoforms in normal and inflamed tissues, with differing contributions to inflammation.

  13. Augmentation of autologous T cell reactivity with acute myeloid leukemia (AML) blasts by Toll-like receptor (TLR) agonists

    PubMed Central

    Zhong, RuiKun; Li, Hongying; Messer, Karen; Lane, Thomas A.; Zhou, Jiehua; Ball, Edward D.

    2016-01-01

    This study investigated whether TNF-α, Toll-like receptors (TLRs) 7/8 agonist resiquimod (R848), the TLR4 agonist lipopolysaccharide (LPS) and their combinations can enhance autologous AML-reactive T cell generation in an in vitro culture. AML peripheral blood or bone marrow mononuclear cells were cultured in medium supplemented with GM-CSF/IL-4 to induce dendritic cell (DC) differentiation of AML blasts (AML-DC). The impact of TNF-α, LPS, R848 and their combinations on AML-DC cultures was analyzed. Significantly enhanced CD80, CD40, CD83, CD54, HLADR and CD86 expression of AML cells was observed by addition of TNF-α, LPS, R848 alone or combinations. Induced CD80 expression of AML cells was significantly higher through the combination of TNF-α, LPS and R848 (T + L + R) than that by T alone. CTL induced from T + L + R, T + R, T + L, L + R and R, but not T, L alone stimulated cultures showed significantly higher IFN-γ release than the medium control in response to autologous AML cells. IFN-γ release by T + L + R was significantly higher than T or L alone, and T + R was significantly higher than T alone. CTL generated from T + L + R, T + L, T + R, L + R and L alone exerted significantly higher AML cell killing than medium control. AML cell killing by T + L + R and T + R was significantly higher than T or R alone. These results indicate that the combination of T + L + R induces a significantly enhanced antigen presentation effect of AML-DC. We speculate that the complementary effects of reagent combinations may better address the heterogeneity of responses to any single agent in AML cells from different patients. PMID:25795133

  14. Expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and mitochondrial oxidative phosphorylation in septic patients

    PubMed Central

    Nucci, Laura A.; Santos, Sidnéia S.; Brunialti, Milena K. C.; Sharma, Narendra Kumar; Machado, Flavia R.; Assunção, Murillo; de Azevedo, Luciano C. P.

    2017-01-01

    Background and objectives Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients. Materials and methods Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0), and after 7 days (D7, N = 10) of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant. Results Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients. Conclusion Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by

  15. Effect of TLR ligands co-encapsulated with multiepitopic antigen in nanoliposomes targeted to human DCs via Fc receptor for cancer vaccines.

    PubMed

    Rueda, Felix; Eich, Christina; Cordobilla, Begoña; Domingo, Pere; Acosta, Gerardo; Albericio, Fernando; Cruz, Luis J; Domingo, Joan C

    2017-11-01

    Nanoliposomes (NLs) hold promise as new highly specific nanomedicine for anti-tumor vaccines, since they could be targeted to specific receptors on dendritic cell (DC) to induce maturation and activation and increase the anti-tumor immune response. Here we studied a NLs formulation targeted or not to FcR (the receptor for the IgG Fc fragment) for the treatment of androgen-responsive prostate cancer. Luteinizing-hormone-releasing hormone (LHRH) peptide (B- and T-cell epitopes), in tandem with a tetanus toxoid T-helper epitope (830-844 region) and several TLR (Toll-Like Receptor) ligands as adjuvants were co-encapsulated. Specific uptake in vitro of LHRH-TT liposomes targeted to the FcRs of human DCs was enhanced. DC maturation/activation, cytokine production and lymphocyte activation were consistently higher in targeted than non-targeted liposomes. Similar increase was observed as more adjuvants were administrated. Targeting to specific receptor and co-encapsulation of several TLR adjuvants are essential factors for the immune response in peptide based liposome vaccine. Copyright © 2017 Elsevier GmbH. All rights reserved.

  16. mRNA levels of TLR4 and TLR5 are independent of H pylori

    PubMed Central

    Garza-González, Elvira; Bocanegra-García, Virgilio; Bosques-Padilla, Francisco Javier; Flores-Gutiérrez, Juan Pablo; Moreno, Francisco; Perez-Perez, Guillermo Ignacio

    2008-01-01

    AIM: To determine if the presence H pylori or its virulence affect toll-like receptor 4 (TLR4) and TLR5 mRNA expression levels. METHODS: For the in vivo assays, gastric biopsies were obtained from 40 patients and H pylori status was determined. For the in vitro assays, human gastric adenocarcinoma mucosal cells (AGS) were cultured in the presence or absence of twelve selected H pylori strains. H pylori strains isolated from culture-positive patients and selected strains were genotyped for cagA and vacA. The cDNA was obtained from mRNA extracted from biopsies and from infected AGS cells. TLR4 and TLR5 mRNA levels were examined by real-time PCR. RESULTS: The presence of H pylori did not affect the mRNA levels of TLR4 or TLR5 in gastric biopsies. The mRNA levels of both receptors were not influenced by the vacA status (P > 0.05 for both receptors) and there were no differences in TLR4 or TLR5 mRNA levels among the different clinical presentations/histological findings (P > 0.05). In the in vitro assay, the mRNA levels of TLR4 or TLR5 in AGS cells were not influenced by the vacAs1 status or the clinical condition associated with the strains (P > 0.05 for both TLR4 and TLR5). CONCLUSION: The results of this study show that the mRNA levels of TLR4 and TLR5 in gastric cells, both in vivo and in vitro, are independent of H pylori colonization and suggest that vacA may not be a significant player in the first step of innate immune recognition mediated by TLR4 or TLR5. PMID:18785283

  17. Toll-like receptor 3 gene polymorphisms in South African Blacks with type 1 diabetes.

    PubMed

    Pirie, F J; Pegoraro, R; Motala, A A; Rauff, S; Rom, L; Govender, T; Esterhuizen, T M

    2005-08-01

    Type 1 diabetes is the consequence of exposure of genetically susceptible individuals to specific environmental precipitants. The innate immune system provides the initial response to exogenous antigen and links with the adaptive immune system. The aim of this study was to assess the role of polymorphisms occurring in the cytoplasmic region of toll-like receptor (TLR) 3 gene and immediate 5' sequence, in subjects of Zulu descent with type 1 diabetes in KwaZulu-Natal, South Africa. Seventy-nine subjects with type 1 diabetes and 74 healthy normal glucose tolerant gender-matched control subjects were studied. Parts of exon 4 and exon 3/intron 3 of the TLR3 gene were studied by polymerase chain reaction, direct sequencing and restriction enzyme digestion with Bts 1. Of the nine polymorphisms studied, a significant association with type 1 diabetes was found for the major allele in the 2593 C/T polymorphism and for the minor alleles in the 2642 C/A and 2690 A/G polymorphisms, which were found to be in complete linkage disequilibrium. Correction of the P-values for the number of alleles studied, however, rendered the results no longer significant. These results suggest that polymorphisms in the TLR3 gene, which is part of the innate immune system, may be associated with type 1 diabetes in this population.

  18. Variation at Innate Immunity Toll-Like Receptor Genes in a Bottlenecked Population of a New Zealand Robin

    PubMed Central

    Grueber, Catherine E.; Wallis, Graham P.; King, Tania M.; Jamieson, Ian G.

    2012-01-01

    Toll-like receptors (TLRs) are an ancient family of genes encoding transmembrane proteins that bind pathogen-specific molecules and initiate both innate and adaptive aspects of the immune response. Our goal was to determine whether these genes show sufficient genetic diversity in a bottlenecked population to be a useful addition or alternative to the more commonly employed major histocompatibility complex (MHC) genotyping in a conservation genetics context. We amplified all known avian TLR genes in a severely bottlenecked population of New Zealand's Stewart Island robin (Petroica australis rakiura), for which reduced microsatellite diversity was previously observed. We genotyped 17–24 birds from a reintroduced island population (including the 12 founders) for nine genes, seven of which were polymorphic. We observed a total of 24 single-nucleotide polymorphisms overall, 15 of which were non-synonymous, representing up to five amino-acid variants at a locus. One locus (TLR1LB) showed evidence of past directional selection. Results also confirmed a passerine duplication of TLR7. The levels of TLR diversity that we observe are sufficient to justify their further use in addressing conservation genetic questions, even in bottlenecked populations. PMID:23024782

  19. TLR-Induced Murine Dendritic Cell (DC) Activation Requires DC-Intrinsic Complement.

    PubMed

    Sheen, Joong-Hyuk; Strainic, Michael G; Liu, Jinbo; Zhang, Weijia; Yi, Zhengzi; Medof, M Edward; Heeger, Peter S

    2017-07-01

    Induction of proinflammatory T cell immunity is augmented by innate dendritic cell (DC) maturation commonly initiated by TLR signaling. We demonstrate that ligation of TLR3, TLR4, and TLR9 induces murine DC production of complement components and local production of the anaphylatoxin C5a. In vitro, ex vivo, and in vivo analyses show that TLR-induced DC maturation, as assessed by surface phenotype, expression profiling by gene array, and functional ability to stimulate T cell responses, requires autocrine C3a receptor and C5a receptor (C3ar1/C5ar1) signaling. Studies using bone marrow chimeric animals and Foxp3-GFP/ERT2-Cre/dTomato fate-mapping mice show that TLR-initiated DC autocrine C3ar1/C5ar1 signaling causes expansion of effector T cells and instability of regulatory T cells and contributes to T cell-dependent transplant rejection. Together, our data position immune cell-derived complement production and autocrine/paracrine C3ar1/C5ar1 signaling as crucial intermediary processes that link TLR stimulation to DC maturation and the subsequent development of effector T cell responses. Copyright © 2017 by The American Association of Immunologists, Inc.

  20. Association of Toll-like receptor 7 and 8 gene polymorphisms with Graves' disease in Chinese Cantonese population.

    PubMed

    Xiao, WenJuan; Liu, ZeLin; Lin, JiangHai; Li, JingBo; Wu, KeJing; Ma, Yun; Xiong, ChunJiang; Gong, YingXue; Liu, ZeHuan

    2015-01-01

    Graves' disease (GD) is a common polygenic multifactorial autoimmune disease. Toll-like receptors (TLRs) play critical roles in the activation of innate and adaptive immune responses. This study investigated the association of TLR7 and TLR8 gene polymorphisms with susceptibility of GD. Five single nucleotide polymorphisms (SNPs), namely, rs179019, rs179010 and rs3853839 in TLR7 and rs3764880 and rs5744088 in TLR8, were evaluated in 332 GD patients and 351 controls using High-Resolution Melting analysis. After adjusting for age, SNP rs179010 was found to decrease the risk of GD in females (OR(T vs C) = 0.64, P = 0.004). In the additive model, the risk of GD decreased significantly as the number of T alleles increased in females [odds ratio (OR) = 0.67 (0.50-0.90), P = 0.007]. The multivariate logistic regression analysis confirmed the independent contribution of rs179010 to the protective effect against GD. This study indicates that rs179010 in TLR7 may be associated with the decreased susceptibility to GD in Chinese Cantonese. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Effect of herbal melanin on IL-8: a possible role of Toll-like receptor 4 (TLR4).

    PubMed

    El-Obeid, Adila; Hassib, Adil; Pontén, Fredrik; Westermark, Bengt

    2006-06-16

    The production of IL-8 can be induced by LPS via TLR4 signaling pathway. In this study, we tested the effect of a herbal melanin (HM) extract, from black cumin seeds (Nigella sativa L.), on IL-8 production. We used HM and LPS in parallel to induce IL-8 production by THP-I, PBMCs, and TLR4-transfected HEK293 cells. Both HM and LPS induced IL-8 mRNA expression and protein production in THP-1 and PBMCs. On applying similar treatment to HEK293 cells that express TLR4, MD2, and CD14, both HM and LPS significantly induced IL-8 protein production. We have also demonstrated that HM and LPS had identical effects in terms of IL-8 stimulation by HEK293 transfected with either TLR4 or MD2-CD14. Melanin extracted from N. sativa L. mimics the action of LPS in the induction of IL-8 by PBMC and the other used cell lines. Our results suggest that HM may share a signaling pathway with LPS that involves TLR4.

  2. Green tea polyphenol epigallocatechin-3-gallate inhibits TLR4 signaling through the 67-kDa laminin receptor on lipopolysaccharide-stimulated dendritic cells

    SciTech Connect

    Byun, Eui-Baek; Choi, Han-Gyu; Sung, Nak-Yun; Byun, Eui-Hong

    2012-10-05

    Highlights: Black-Right-Pointing-Pointer Expressions of CD80, CD86, and MHC class I/II were inhibited by EGCG via 67LR. Black-Right-Pointing-Pointer EGCG-treated DCs inhibited LPS-induced pro-inflammatory cytokines via 67LR. Black-Right-Pointing-Pointer EGCG-treated DCs inhibited MAPKs activation and NF-{kappa}B p65 translocation via 67LR. Black-Right-Pointing-Pointer EGCG elevated the expression of the Tollip protein through 67LR in DCs. -- Abstract: Epigallocatechin-3-gallate (EGCG), a major active polyphenol of green tea, has been shown to down-regulate inflammatory responses in dendritic cells (DCs); however, the underlying mechanism has not been understood. Recently, we identified the 67-kDa laminin receptor (67LR) as a cell-surface EGCG receptor. In this study, we showed the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by EGCG in DCs. The expressions of CD80, CD86, and MHC class I and II, which are molecules essential for antigen presentation by DCs, were inhibited by EGCG via 67LR. In addition, EGCG-treated DCs inhibited lipopolysaccharide (LPS)-induced production of pro-inflammatory cytokines (tumor necrosis factor [TNF]-{alpha}, interleukin [IL]-1{beta}, and IL-6) and activation of mitogen-activated protein kinases (MAPKs), e.g., extracellular signal-regulated kinase 1/2 (ERK1/2), p38, c-Jun N-terminal kinase (JNK), and nuclear factor {kappa}B (NF-{kappa}B) p65 translocation through 67LR. Interestingly, we also found that EGCG markedly elevated the expression of the Tollip protein, a negative regulator of TLR signaling, through 67LR. These novel findings provide new insight into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and consequent inflammatory responses that are implicated in the development and progression of many chronic diseases.

  3. Toll-like receptor cascade and gene polymorphism in host–pathogen interaction in Lyme disease

    PubMed Central

    Rahman, Shusmita; Shering, Maria; Ogden, Nicholas H; Lindsay, Robbin; Badawi, Alaa

    2016-01-01

    Lyme disease (LD) risk occurs in North America and Europe where the tick vectors of the causal agent Borrelia burgdorferi sensu lato are found. It is associated with local and systemic manifestations, and has persistent posttreatment health complications in some individuals. The innate immune system likely plays a critical role in both host defense against B. burgdorferi and disease severity. Recognition of B. burgdorferi, activation of the innate immune system, production of proinflammatory cytokines, and modulation of the host adaptive responses are all initiated by Toll-like receptors (TLRs). A number of Borrelia outer-surface proteins (eg, OspA and OspB) are recognized by TLRs. Specifically, TLR1 and TLR2 were identified as the receptors most relevant to LD. Several functional single-nucleotide polymorphisms have been identified in TLR genes, and are associated with varying cytokines types and synthesis levels, altered pathogen recognition, and disruption of the downstream signaling cascade. These single-nucleotide polymorphism-related functional alterations are postulated to be linked to disease development and posttreatment persistent illness. Elucidating the role of TLRs in LD may facilitate a better understanding of disease pathogenesis and can provide an insight into novel therapeutic targets during active disease or postinfection and posttreatment stages. PMID:27330321

  4. Toll-like receptor 9 gene polymorphism in chronic and aggressive periodontitis patients

    PubMed Central

    Ashok, Nipun; Warad, Shivaraj; Kalburgi, Nagaraj Balasaheb; Bilichodmath, Shivaprasad; Prabhakaran, Prabath Singh Valiyaparambil; Tarakji, Bassel

    2014-01-01

    Aim: Periodontitis is a multifactorial disease, with microbial dental plaque as the primary etiological factor. However, the manifestation and progression of periodontitis is influenced by a wide variety of other determinants and factors such as social and behavioral factors, systemic factors, microbial composition of dental plaque, genetic, and many other emerging risk factors. The aim of this study was to analyze genetic polymorphisms in the toll-like receptor 9 (TLR9) gene at - 1237C/T and its association with chronic and generalized aggressive periodontitis (GAgP) in an Indian population. Materials and Methods: This study was carried out on 90 subjects, which included 30 GAgP and 30 chronic periodontitis patients and 30 healthy controls. Within the limitations of our study, only 30 subjects were included in each group due to the low prevalence of GAgP patients. Blood samples were drawn from the subjects and analyzed for TLR9 genetic polymorphism at - 1237C/T by using polymerase chain reaction-restriction fragment length polymorphism method. Results: No significant difference was found in genotype and allele frequency of TLR9 genetic polymorphism (- 1237C/T) in generalized aggressive and chronic periodontitis patients and healthy controls. Conclusion: Toll-like receptor 9 genetic polymorphism at - 1237C/T may not be associated with GAgP and chronic periodontitis patients in Indian population. PMID:25624628

  5. TLR7 Deficiency Leads to TLR8 Compensative Regulation of Immune Response against JEV in Mice

    PubMed Central

    Awais, Muhammad; Wang, Ke; Lin, Xianwu; Qian, Wenjie; Zhang, Nan; Wang, Chong; Wang, Kunlun; Zhao, Ling; Fu, Zhen F.; Cui, Min

    2017-01-01

    Japanese encephalitis virus (JEV) is a highly fatal pathogen to human beings. Toll-like receptor 7 (TLR7) plays a role as the first host defense against most single-stranded RNA flaviviruses. This study aims to investigate the role of TLR7 in inducing adaptive immune response in mice against JEV. In vitro and in vivo studies were conducted to examine the expression of toll-like receptors (TLRs) in mice. After JEV infection, physical parameters of mice (survival rate and body weight) were evaluated, and organs or cells were collected for further analysis. The expression of TLR7 was increased significantly as compare to other TLR molecules post-JEV infection. The expression of CD80, CD86, and CD273 on bone marrow-derived dendritic cells was increased significantly in TLR7−/− mice. Furthermore, viral load was also increased significantly in TLR7−/− mice as compare to C57BL/6 mice. But there was no significant difference among survival rate and body weight in TLR7−/− mice as compare to C57BL/6. Interestingly, we also found that TLR8 was upregulated in TLR7−/− mice. The study concluded that TLR8 was upregulated in TLR7-deficient mice, and it might play a compensatory role in the immune response in TLR7−/− mice. PMID:28265274

  6. Toll like receptors in self-recovering hepatitis E patients with or without pregnancy.

    PubMed

    Arya, Ravi P; Arankalle, Vidya A

    2014-12-01

    Hepatitis E virus (HEV) causes high mortality among pregnant women. Pathogenesis of HEV, especially during pregnancy, is poorly understood. Our aim was to assess the role of Toll-like-receptors (TLRs) in hepatitis E patients with pregnancy (Antenatal care, ANC) or without pregnancy (non-ANC). The patient categories included acute-phase, non-ANC (n=46) and ANC patients (2nd/3rd trimesters, n=13) and non-ANC patients (n=31) during convalescence. Controls included apparently healthy non-ANC (n=30) and ANC subjects in the first (n=10) and later (2nd/3rd, n=20) trimesters. TLR2/TLR3/TLR4/TLR7/TLR8 levels were determined by flow-cytometry. Cytokine responses induced by TLR-specific-ligands-stimulated-PBMCs from ANC/non-ANC-patients and TLR-signaling-molecules (non-ANC-patients) were measured. PBMCs were used to assess gene expression levels by TaqMan-Low-Density-Array. Compared to the temporal activation of TLR4/TLR7/TLR8 at protein and mRNA levels, the ANC-patients and controls exhibited reduced TLRs indicative of impaired TLR response. Stimulation of PBMCs with TLR-specific ligands led to the induction of type-I interferons, IFNβ by the non-ANC group and IFNα by the ANC category. Involvement of MyD88-independent (TLR3/TLR4) and MyD88-dependent (TLR4/TLR7/TLR8) pathways and association of TLR4/TLR7/TLR8 with recovery was documented in the non-ANC-patients. Except for robust type-I-interferon response, HEV infection could not modulate pregnancy-related diminished immune response. The results have implications in the understanding of HEV pathogenesis.

  7. Sam68 is a regulator of Toll-like receptor signaling

    PubMed Central

    Tomalka, Jeffrey A; de Jesus, Tristan J; Ramakrishnan, Parameswaran

    2017-01-01

    Recognition of pathogens by Toll-like receptors (TLR) activate multiple signaling cascades and expression of genes tailored to mount a primary immune response, inflammation, cell survival and apoptosis. Although TLR-induced activation of pathways, such as nuclear factor kappaB (NF-κB) and mitogen-activated protein kinases (MAPK), has been well studied, molecular entities controlling quantitative regulation of these pathways during an immune response remain poorly defined. We identified Sam68 as a novel regulator of TLR-induced NF-κB and MAPK activation. We found that TLR2 and TLR3 are totally dependent, whereas TLR4 is only partially dependent on Sam68 to induce the activation of NF-κB c-Rel. Absence of Sam68 greatly decreased TLR2- and TLR3-induced NF-κB p65 activation, whereas TLR4-induced p65 activation in a Sam68-independent manner. In contrast, Sam68 appeared to be a negative regulator of MAPK pathways because absence of Sam68 enhanced TLR2-induced activation of extracellular signal-regulated kinases (ERK) and c-Jun N-terminal kinases (JNK). Interestingly, TLR2- and TLR3-induced gene expression showed a differential requirement of Sam68. Absence of Sam68 impaired TLR2-induced gene expression, suggesting that Sam68 has a critical role in myeloid differentiation primary response gene 88-dependent TLR2 signaling. TLR3-induced gene expression that utilize Toll/Interleukin-1 receptor-domain-containing adapter-inducing beta interferon pathway, depend only partially on Sam68. Our findings suggest that Sam68 may function as an immune rheostat that balances the activation of NF-κB p65 and c-Rel, as well as MAPK, revealing a potential novel target to manipulate TLR signaling. PMID:27374795

  8. Sam68 is a regulator of Toll-like receptor signaling.

    PubMed

    Tomalka, Jeffrey A; de Jesus, Tristan J; Ramakrishnan, Parameswaran

    2017-01-01

    Recognition of pathogens by Toll-like receptors (TLR) activate multiple signaling cascades and expression of genes tailored to mount a primary immune response, inflammation, cell survival and apoptosis. Although TLR-induced activation of pathways, such as nuclear factor kappaB (NF-κB) and mitogen-activated protein kinases (MAPK), has been well studied, molecular entities controlling quantitative regulation of these pathways during an immune response remain poorly defined. We identified Sam68 as a novel regulator of TLR-induced NF-κB and MAPK activation. We found that TLR2 and TLR3 are totally dependent, whereas TLR4 is only partially dependent on Sam68 to induce the activation of NF-κB c-Rel. Absence of Sam68 greatly decreased TLR2- and TLR3-induced NF-κB p65 activation, whereas TLR4-induced p65 activation in a Sam68-independent manner. In contrast, Sam68 appeared to be a negative regulator of MAPK pathways because absence of Sam68 enhanced TLR2-induced activation of extracellular signal-regulated kinases (ERK) and c-Jun N-terminal kinases (JNK). Interestingly, TLR2- and TLR3-induced gene expression showed a differential requirement of Sam68. Absence of Sam68 impaired TLR2-induced gene expression, suggesting that Sam68 has a critical role in myeloid differentiation primary response gene 88-dependent TLR2 signaling. TLR3-induced gene expression that utilize Toll/Interleukin-1 receptor-domain-containing adapter-inducing beta interferon pathway, depend only partially on Sam68. Our findings suggest that Sam68 may function as an immune rheostat that balances the activation of NF-κB p65 and c-Rel, as well as MAPK, revealing a