Emerging structural insights into the function of ionotropic glutamate receptors
Karakas, Erkan; Regan, Michael C.; Furukawa, Hiro
2015-01-01
Summary Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function including learning and memory formation. Recently a wealth of structural studies on iGluRs, including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available.. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, which illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. Here we review mechanistic insights into iGluR functions gained through structural studies of multiple groups. PMID:25941168
Emerging structural insights into the function of ionotropic glutamate receptors.
Karakas, Erkan; Regan, Michael C; Furukawa, Hiro
2015-06-01
Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function, including learning and memory formation. Recently a wealth of structural studies on iGluRs including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, and this illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. We review mechanistic insights into iGluR functions gained through structural studies of multiple groups. Copyright © 2015 Elsevier Ltd. All rights reserved.
Structure and Function of Serotonin G protein Coupled Receptors
McCorvy, John D.; Roth, Bryan L.
2015-01-01
Serotonin receptors are prevalent throughout the nervous system and the periphery, and remain one of the most lucrative and promising drug discovery targets for disorders ranging from migraine headaches to neuropsychiatric disorders such as schizophrenia and depression. There are 14 distinct serotonin receptors, of which 13 are G protein coupled receptors (GPCRs), which are targets for approximately 40% of the approved medicines. Recent crystallographic and biochemical evidence has provided a converging understanding of the basic structure and functional mechanics of GPCR activation. Currently, two GPCR crystal structures exist for the serotonin family, the 5-HT1B and 5-HT2B receptor, with the antimigraine and valvulopathic drug ergotamine bound. The first serotonin crystal structures not only provide the first evidence of serotonin receptor topography but also provide mechanistic explanations into functional selectivity or biased agonism. This review will detail the findings of these crystal structures from a molecular and mutagenesis perspective for driving rational drug design for novel therapeutics incorporating biased signaling. PMID:25601315
Recent developments in the study of opioid receptors.
Cox, Brian M
2013-04-01
It is now about 40 years since Avram Goldstein proposed the use of the stereoselectivity of opioid receptors to identify these receptors in neural membranes. In 2012, the crystal structures of the four members of the opioid receptor family were reported, providing a structural basis for understanding of critical features affecting the actions of opiate drugs. This minireview summarizes these recent developments in our understanding of opiate receptors. Receptor function is also influenced by amino acid substitutions in the protein sequence. Among opioid receptor genes, one polymorphism is much more frequent in human populations than the many others that have been found, but the functional significance of this single nucleotide polymorphism (SNP) has been unclear. Recent studies have shed new light on how this SNP might influence opioid receptor function. In this minireview, the functional significance of the most prevalent genetic polymorphism among the opioid receptor genes is also considered.
Function and structure in glycine receptors and some of their relatives.
Colquhoun, David; Sivilotti, Lucia G
2004-06-01
In the field of ligand-gated ion channels, recent developments, both in the knowledge of structure and in the measurement of function at the single-channel level, have allowed a sensible start to be made on understanding the relationship between structure and function in these proteins. In this review, the cases of glycine, nicotinic ACh and glutamate receptors are compared and contrasted, and problems such as how binding of agonist causes the channel to open, and why partial agonists are partial, are considered. Some observations, both structural and functional, suggest that more attention needs to be paid to conformational changes that occur before the channel opens. Such changes might account for the interaction found between subunits of the glycine receptor while it is still shut and, perhaps, the agonist-dependent structural changes seen in AMPA receptors. They might also complicate our understanding of the binding-gating problem.
Bill, Anke; Rosethorne, Elizabeth M; Kent, Toby C; Fawcett, Lindsay; Burchell, Lynn; van Diepen, Michiel T; Marelli, Anthony; Batalov, Sergey; Miraglia, Loren; Orth, Anthony P; Renaud, Nicole A; Charlton, Steven J; Gosling, Martin; Gaither, L Alex; Groot-Kormelink, Paul J
2014-01-01
The human prostacyclin receptor (hIP receptor) is a seven-transmembrane G protein-coupled receptor (GPCR) that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR) mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs.
Kent, Toby C.; Fawcett, Lindsay; Burchell, Lynn; van Diepen, Michiel T.; Marelli, Anthony; Batalov, Sergey; Miraglia, Loren; Orth, Anthony P.; Renaud, Nicole A.; Charlton, Steven J.; Gosling, Martin; Gaither, L. Alex; Groot-Kormelink, Paul J.
2014-01-01
The human prostacyclin receptor (hIP receptor) is a seven-transmembrane G protein-coupled receptor (GPCR) that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR) mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs. PMID:24886841
Reconstitution of Homomeric GluA2flop Receptors in Supported Lipid Membranes
Baranovic, Jelena; Ramanujan, Chandra S.; Kasai, Nahoko; Midgett, Charles R.; Madden, Dean R.; Torimitsu, Keiichi; Ryan, John F.
2013-01-01
AMPA receptors (AMPARs) are glutamate-gated ion channels ubiquitous in the vertebrate central nervous system, where they mediate fast excitatory neurotransmission and act as molecular determinants of memory formation and learning. Together with detailed analyses of individual AMPAR domains, structural studies of full-length AMPARs by electron microscopy and x-ray crystallography have provided important insights into channel assembly and function. However, the correlation between the structure and functional states of the channel remains ambiguous particularly because these functional states can be assessed only with the receptor bound within an intact lipid bilayer. To provide a basis for investigating AMPAR structure in a membrane environment, we developed an optimized reconstitution protocol using a receptor whose structure has previously been characterized by electron microscopy. Single-channel recordings of reconstituted homomeric GluA2flop receptors recapitulate key electrophysiological parameters of the channels expressed in native cellular membranes. Atomic force microscopy studies of the reconstituted samples provide high-resolution images of membrane-embedded full-length AMPARs at densities comparable to those in postsynaptic membranes. The data demonstrate the effect of protein density on conformational flexibility and dimensions of the receptors and provide the first structural characterization of functional membrane-embedded AMPARs, thus laying the foundation for correlated structure-function analyses of the predominant mediators of excitatory synaptic signals in the brain. PMID:23382380
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geng, Yong; Xiong, Dazhi; Mosyak, Lidia
2012-10-24
Inhibitory neurotransmission is mediated primarily by GABA. The metabotropic GABA{sub B} receptor is a G protein-coupled receptor central to mammalian brain function. Malfunction of GABA{sub B} receptor has been implicated in several neurological disorders. GABA{sub B} receptor functions as a heterodimeric assembly of GBR1 and GBR2 subunits, where GBR1 is responsible for ligand-binding and GBR2 is responsible for G protein coupling. Here we demonstrate that the GBR2 ectodomain directly interacts with the GBR1 ectodomain to increase agonist affinity by selectively stabilizing the agonist-bound conformation of GBR1. We present the crystal structure of the GBR2 ectodomain, which reveals a polar heterodimericmore » interface. We also identify specific heterodimer contacts from both subunits, and GBR1 residues involved in ligand recognition. Lastly, our structural and functional data indicate that the GBR2 ectodomain adopts a constitutively open conformation, suggesting a structural asymmetry in the active state of GABA{sub B} receptor that is unique to the GABAergic system.« less
Structural studies of G protein-coupled receptors.
Lu, Mengjie; Wu, Beili
2016-11-01
G protein-coupled receptors (GPCRs) comprise the largest membrane protein family. These receptors sense a variety of signaling molecules, activate multiple intracellular signal pathways, and act as the targets of over 40% of marketed drugs. Recent progress on GPCR structural studies provides invaluable insights into the structure-function relationship of the GPCR superfamily, deepening our understanding about the molecular mechanisms of GPCR signal transduction. Here, we review recent breakthroughs on GPCR structure determination and the structural features of GPCRs, and take the structures of chemokine receptor CCR5 and purinergic receptors P2Y 1 R and P2Y 12 R as examples to discuss the importance of GPCR structures on functional studies and drug discovery. In addition, we discuss the prospect of GPCR structure-based drug discovery. © 2016 IUBMB Life, 68(11):894-903, 2016. © 2016 International Union of Biochemistry and Molecular Biology.
Research resource: Update and extension of a glycoprotein hormone receptors web application.
Kreuchwig, Annika; Kleinau, Gunnar; Kreuchwig, Franziska; Worth, Catherine L; Krause, Gerd
2011-04-01
The SSFA-GPHR (Sequence-Structure-Function-Analysis of Glycoprotein Hormone Receptors) database provides a comprehensive set of mutation data for the glycoprotein hormone receptors (covering the lutropin, the FSH, and the TSH receptors). Moreover, it provides a platform for comparison and investigation of these homologous receptors and helps in understanding protein malfunctions associated with several diseases. Besides extending the data set (> 1100 mutations), the database has been completely redesigned and several novel features and analysis tools have been added to the web site. These tools allow the focused extraction of semiquantitative mutant data from the GPHR subtypes and different experimental approaches. Functional and structural data of the GPHRs are now linked interactively at the web interface, and new tools for data visualization (on three-dimensional protein structures) are provided. The interpretation of functional findings is supported by receptor morphings simulating intramolecular changes during the activation process, which thus help to trace the potential function of each amino acid and provide clues to the local structural environment, including potentially relocated spatial counterpart residues. Furthermore, double and triple mutations are newly included to allow the analysis of their functional effects related to their spatial interrelationship in structures or homology models. A new important feature is the search option and data visualization by interactive and user-defined snake-plots. These new tools allow fast and easy searches for specific functional data and thereby give deeper insights in the mechanisms of hormone binding, signal transduction, and signaling regulation. The web application "Sequence-Structure-Function-Analysis of GPHRs" is accessible on the internet at http://www.ssfa-gphr.de/.
Structure-Function of α1-Adrenergic Receptors
Perez, Dianne M.
2007-01-01
Summary The Easson-Stedman hypothesis provided the rationale for the first studies of drug design for the α1-adrenergic receptor. Through chemical modifications of the catecholamine core structure, the need was established for a protonated amine, a β-hydroxyl on a chiral center, and an aromatic ring with substitutions capable of hydrogen bonding. After the receptors were cloned and three α1-adrenergic receptor subtypes were discovered, drug design became focused on the analysis of receptor structure and new interactions were uncovered. It became clear that α1 and β-adrenergic receptors did not share stringent homology in the ligand-binding pocket but this difference has allowed for more selective drug design. Novel discoveries on allosterism and agonist trafficking may be used in the future design of therapeutics with fewer side effects. This review will explore past and current knowledge of the structure-function of the α1-adrenergic receptor subtypes. PMID:17052695
Functional dynamics of cell surface membrane proteins
NASA Astrophysics Data System (ADS)
Nishida, Noritaka; Osawa, Masanori; Takeuchi, Koh; Imai, Shunsuke; Stampoulis, Pavlos; Kofuku, Yutaka; Ueda, Takumi; Shimada, Ichio
2014-04-01
Cell surface receptors are integral membrane proteins that receive external stimuli, and transmit signals across plasma membranes. In the conventional view of receptor activation, ligand binding to the extracellular side of the receptor induces conformational changes, which convert the structure of the receptor into an active conformation. However, recent NMR studies of cell surface membrane proteins have revealed that their structures are more dynamic than previously envisioned, and they fluctuate between multiple conformations in an equilibrium on various timescales. In addition, NMR analyses, along with biochemical and cell biological experiments indicated that such dynamical properties are critical for the proper functions of the receptors. In this review, we will describe several NMR studies that revealed direct linkage between the structural dynamics and the functions of the cell surface membrane proteins, such as G-protein coupled receptors (GPCRs), ion channels, membrane transporters, and cell adhesion molecules.
Functional dynamics of cell surface membrane proteins.
Nishida, Noritaka; Osawa, Masanori; Takeuchi, Koh; Imai, Shunsuke; Stampoulis, Pavlos; Kofuku, Yutaka; Ueda, Takumi; Shimada, Ichio
2014-04-01
Cell surface receptors are integral membrane proteins that receive external stimuli, and transmit signals across plasma membranes. In the conventional view of receptor activation, ligand binding to the extracellular side of the receptor induces conformational changes, which convert the structure of the receptor into an active conformation. However, recent NMR studies of cell surface membrane proteins have revealed that their structures are more dynamic than previously envisioned, and they fluctuate between multiple conformations in an equilibrium on various timescales. In addition, NMR analyses, along with biochemical and cell biological experiments indicated that such dynamical properties are critical for the proper functions of the receptors. In this review, we will describe several NMR studies that revealed direct linkage between the structural dynamics and the functions of the cell surface membrane proteins, such as G-protein coupled receptors (GPCRs), ion channels, membrane transporters, and cell adhesion molecules. Copyright © 2013 Elsevier Inc. All rights reserved.
Cvicek, Vaclav; Goddard, William A.; Abrol, Ravinder
2016-01-01
The understanding of G-protein coupled receptors (GPCRs) is undergoing a revolution due to increased information about their signaling and the experimental determination of structures for more than 25 receptors. The availability of at least one receptor structure for each of the GPCR classes, well separated in sequence space, enables an integrated superfamily-wide analysis to identify signatures involving the role of conserved residues, conserved contacts, and downstream signaling in the context of receptor structures. In this study, we align the transmembrane (TM) domains of all experimental GPCR structures to maximize the conserved inter-helical contacts. The resulting superfamily-wide GpcR Sequence-Structure (GRoSS) alignment of the TM domains for all human GPCR sequences is sufficient to generate a phylogenetic tree that correctly distinguishes all different GPCR classes, suggesting that the class-level differences in the GPCR superfamily are encoded at least partly in the TM domains. The inter-helical contacts conserved across all GPCR classes describe the evolutionarily conserved GPCR structural fold. The corresponding structural alignment of the inactive and active conformations, available for a few GPCRs, identifies activation hot-spot residues in the TM domains that get rewired upon activation. Many GPCR mutations, known to alter receptor signaling and cause disease, are located at these conserved contact and activation hot-spot residue positions. The GRoSS alignment places the chemosensory receptor subfamilies for bitter taste (TAS2R) and pheromones (Vomeronasal, VN1R) in the rhodopsin family, known to contain the chemosensory olfactory receptor subfamily. The GRoSS alignment also enables the quantification of the structural variability in the TM regions of experimental structures, useful for homology modeling and structure prediction of receptors. Furthermore, this alignment identifies structurally and functionally important residues in all human GPCRs. These residues can be used to make testable hypotheses about the structural basis of receptor function and about the molecular basis of disease-associated single nucleotide polymorphisms. PMID:27028541
Vukoti, Krishna; Kimura, Tomohiro; Macke, Laura; Gawrisch, Klaus; Yeliseev, Alexei
2012-01-01
Elucidation of the molecular mechanisms of activation of G protein-coupled receptors (GPCRs) is among the most challenging tasks for modern membrane biology. For studies by high resolution analytical methods, these integral membrane receptors have to be expressed in large quantities, solubilized from cell membranes and purified in detergent micelles, which may result in a severe destabilization and a loss of function. Here, we report insights into differential effects of detergents, lipids and cannabinoid ligands on stability of the recombinant cannabinoid receptor CB2, and provide guidelines for preparation and handling of the fully functional receptor suitable for a wide array of downstream applications. While we previously described the expression in Escherichia coli, purification and liposome-reconstitution of multi-milligram quantities of CB2, here we report an efficient stabilization of the recombinant receptor in micelles - crucial for functional and structural characterization. The effects of detergents, lipids and specific ligands on structural stability of CB2 were assessed by studying activation of G proteins by the purified receptor reconstituted into liposomes. Functional structure of the ligand binding pocket of the receptor was confirmed by binding of 2H-labeled ligand measured by solid-state NMR. We demonstrate that a concerted action of an anionic cholesterol derivative, cholesteryl hemisuccinate (CHS) and high affinity cannabinoid ligands CP-55,940 or SR-144,528 are required for efficient stabilization of the functional fold of CB2 in dodecyl maltoside (DDM)/CHAPS detergent solutions. Similar to CHS, the negatively charged phospholipids with the serine headgroup (PS) exerted significant stabilizing effects in micelles while uncharged phospholipids were not effective. The purified CB2 reconstituted into lipid bilayers retained functionality for up to several weeks enabling high resolution structural studies of this GPCR at physiologically relevant conditions. PMID:23056277
The CCK(-like) receptor in the animal kingdom: functions, evolution and structures.
Staljanssens, Dorien; Azari, Elnaz Karimian; Christiaens, Olivier; Beaufays, Jérôme; Lins, Laurence; Van Camp, John; Smagghe, Guy
2011-03-01
In this review, the cholecystokinin (CCK)(-like) receptors throughout the animal kingdom are compared on the level of physiological functions, evolutionary basis and molecular structure. In vertebrates, the CCK receptor is an important member of the G-protein coupled receptors as it is involved in the regulation of many physiological functions like satiety, gastrointestinal motility, gastric acid secretion, gall bladder contraction, pancreatic secretion, panic, anxiety and memory and learning processes. A homolog for this receptor is also found in nematodes and arthropods, called CK receptor and sulfakinin (SK) receptor, respectively. These receptors seem to have evolved from a common ancestor which is probably still closely related to the nematode CK receptor. The SK receptor is more closely related to the CCK receptor and seems to have similar functions. A molecular 3D-model for the CCK receptor type 1 has been built together with the docking of the natural ligands for the CCK and SK receptors in the CCK receptor type 1. These molecular models can help to study ligand-receptor interactions, that can in turn be useful in the development of new CCK(-like) receptor agonists and antagonists with beneficial health effects in humans or potential for pest control. Copyright © 2010 Elsevier Inc. All rights reserved.
Kleinau, Gunnar; Worth, Catherine L.; Kreuchwig, Annika; Biebermann, Heike; Marcinkowski, Patrick; Scheerer, Patrick; Krause, Gerd
2017-01-01
The thyroid-stimulating hormone receptor (TSHR) is a member of the glycoprotein hormone receptors, a sub-group of class A G-protein-coupled receptors (GPCRs). TSHR and its endogenous ligand thyrotropin (TSH) are of essential importance for growth and function of the thyroid gland and proper function of the TSH/TSHR system is pivotal for production and release of thyroid hormones. This receptor is also important with respect to pathophysiology, such as autoimmune (including ophthalmopathy) or non-autoimmune thyroid dysfunctions and cancer development. Pharmacological interventions directly targeting the TSHR should provide benefits to disease treatment compared to currently available therapies of dysfunctions associated with the TSHR or the thyroid gland. Upon TSHR activation, the molecular events conveying conformational changes from the extra- to the intracellular side of the cell across the membrane comprise reception, conversion, and amplification of the signal. These steps are highly dependent on structural features of this receptor and its intermolecular interaction partners, e.g., TSH, antibodies, small molecules, G-proteins, or arrestin. For better understanding of signal transduction, pathogenic mechanisms such as autoantibody action and mutational modifications or for developing new pharmacological strategies, it is essential to combine available structural data with functional information to generate homology models of the entire receptor. Although so far these insights are fragmental, in the past few decades essential contributions have been made to investigate in-depth the involved determinants, such as by structure determination via X-ray crystallography. This review summarizes available knowledge (as of December 2016) concerning the TSHR protein structure, associated functional aspects, and based on these insights we suggest several receptor complex models. Moreover, distinct TSHR properties will be highlighted in comparison to other class A GPCRs to understand the molecular activation mechanisms of this receptor comprehensively. Finally, limitations of current knowledge and lack of information are discussed highlighting the need for intensified efforts toward TSHR structure elucidation. PMID:28484426
Zhao, Wen-Shan; Sun, Meng-Yang; Sun, Liang-Fei; Liu, Yan; Yang, Yang; Huang, Li-Dong; Fan, Ying-Zhe; Cheng, Xiao-Yang; Cao, Peng; Hu, You-Min; Li, Lingyong; Tian, Yun; Wang, Rui; Yu, Ye
2016-04-08
Significant progress has been made in understanding the roles of crucial residues/motifs in the channel function of P2X receptors during the pre-structure era. The recent structural determination of P2X receptors allows us to reevaluate the role of those residues/motifs. Residues Arg-309 and Asp-85 (rat P2X4 numbering) are highly conserved throughout the P2X family and were involved in loss-of-function polymorphism in human P2X receptors. Previous studies proposed that they participated in direct ATP binding. However, the crystal structure of P2X demonstrated that those two residues form an intersubunit salt bridge located far away from the ATP-binding site. Therefore, it is necessary to reevaluate the role of this salt bridge in P2X receptors. Here, we suggest the crucial role of this structural element both in protein stability and in channel gating rather than direct ATP interaction and channel assembly. Combining mutagenesis, charge swap, and disulfide cross-linking, we revealed the stringent requirement of this salt bridge in normal P2X4 channel function. This salt bridge may contribute to stabilizing the bending conformation of the β2,3-sheet that is structurally coupled with this salt bridge and the α2-helix. Strongly kinked β2,3 is essential for domain-domain interactions between head domain, dorsal fin domain, right flipper domain, and loop β7,8 in P2X4 receptors. Disulfide cross-linking with directions opposing or along the bending angle of the β2,3-sheet toward the α2-helix led to loss-of-function and gain-of-function of P2X4 receptors, respectively. Further insertion of amino acids with bulky side chains into the linker between the β2,3-sheet or the conformational change of the α2-helix, interfering with the kinked conformation of β2,3, led to loss-of-function of P2X4 receptors. All these findings provided new insights in understanding the contribution of the salt bridge between Asp-85 and Arg-309 and its structurally coupled β2,3-sheet to the function of P2X receptors. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Structural Heterogeneity and Functional Domains of Murine Immunoglobulin G Fc Receptors
NASA Astrophysics Data System (ADS)
Ravetch, Jeffrey V.; Luster, Andrew D.; Weinshank, Richard; Kochan, Jarema; Pavlovec, Amalia; Portnoy, Daniel A.; Hulmes, Jeffrey; Pan, Yu-Ching E.; Unkeless, Jay C.
1986-11-01
Binding of antibodies to effector cells by way of receptors to their constant regions (Fc receptors) is central to the pathway that leads to clearance of antigens by the immune system. The structure and function of this important class of receptors on immune cells is addressed through the molecular characterization of Fc receptors (FcR) specific for the murine immunoglobulin G isotype. Structural diversity is encoded by two genes that by alternative splicing result in expression of molecules with highly conserved extracellular domains and different transmembrane and intracytoplasmic domains. The proteins encoded by these genes are members of the immunoglobulin supergene family, most homologous to the major histocompatibility complex molecule Eβ. Functional reconstitution of ligand binding by transfection of individual FcR genes demonstrates that the requirements for ligand binding are encoded in a single gene. These studies demonstrate the molecular basis for the functional heterogeneity of FcR's, accounting for the possible transduction of different signals in response to a single ligand.
Molecular structure of P2X receptors.
Egan, Terrance M; Cox, Jane A; Voigt, Mark M
2004-01-01
P2X receptors are ligand-gated ion channels that transduce many of the physiological effects of extracellular ATP. There has been a dramatic increase in awareness of these receptors over the past 5 or so years, in great part due to their molecular cloning and characterization. The availability of cDNA clones for the various subunits has led to rapid progress in identifying their tissue-specific expression, resulting in new ideas concerning the functional roles these receptors might play in physiological and pathophysiological processes. In addition, molecular approaches have yielded much information regarding the structure and function of the receptor proteins themselves. In this review we seek to review recent findings concerning the molecular determinants of receptor-channel function, with particular focus on ligand binding and gating, ion selectivity, and subunit assembly.
The Significance of G Protein-Coupled Receptor Crystallography for Drug Discovery
Salon, John A.; Lodowski, David T.
2011-01-01
Crucial as molecular sensors for many vital physiological processes, seven-transmembrane domain G protein-coupled receptors (GPCRs) comprise the largest family of proteins targeted by drug discovery. Together with structures of the prototypical GPCR rhodopsin, solved structures of other liganded GPCRs promise to provide insights into the structural basis of the superfamily's biochemical functions and assist in the development of new therapeutic modalities and drugs. One of the greatest technical and theoretical challenges to elucidating and exploiting structure-function relationships in these systems is the emerging concept of GPCR conformational flexibility and its cause-effect relationship for receptor-receptor and receptor-effector interactions. Such conformational changes can be subtle and triggered by relatively small binding energy effects, leading to full or partial efficacy in the activation or inactivation of the receptor system at large. Pharmacological dogma generally dictates that these changes manifest themselves through kinetic modulation of the receptor's G protein partners. Atomic resolution information derived from increasingly available receptor structures provides an entrée to the understanding of these events and practically applying it to drug design. Supported by structure-activity relationship information arising from empirical screening, a unified structural model of GPCR activation/inactivation promises to both accelerate drug discovery in this field and improve our fundamental understanding of structure-based drug design in general. This review discusses fundamental problems that persist in drug design and GPCR structural determination. PMID:21969326
A combined computational and structural model of the full-length human prolactin receptor
Bugge, Katrine; Papaleo, Elena; Haxholm, Gitte W.; Hopper, Jonathan T. S.; Robinson, Carol V.; Olsen, Johan G.; Lindorff-Larsen, Kresten; Kragelund, Birthe B.
2016-01-01
The prolactin receptor is an archetype member of the class I cytokine receptor family, comprising receptors with fundamental functions in biology as well as key drug targets. Structurally, each of these receptors represent an intriguing diversity, providing an exceptionally challenging target for structural biology. Here, we access the molecular architecture of the monomeric human prolactin receptor by combining experimental and computational efforts. We solve the NMR structure of its transmembrane domain in micelles and collect structural data on overlapping fragments of the receptor with small-angle X-ray scattering, native mass spectrometry and NMR spectroscopy. Along with previously published data, these are integrated by molecular modelling to generate a full receptor structure. The result provides the first full view of a class I cytokine receptor, exemplifying the architecture of more than 40 different receptor chains, and reveals that the extracellular domain is merely the tip of a molecular iceberg. PMID:27174498
The Structure of the GM-CSF Receptor Complex Reveals a Distinct Mode of Cytokine Receptor Activation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hansen, Guido; Hercus, Timothy R.; McClure, Barbara J.
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a pleiotropic cytokine that controls the production and function of blood cells, is deregulated in clinical conditions such as rheumatoid arthritis and leukemia, yet offers therapeutic value for other diseases. Its receptors are heterodimers consisting of a ligand-specific {alpha} subunit and a {beta}c subunit that is shared with the interleukin (IL)-3 and IL-5 receptors. How signaling is initiated remains an enigma. We report here the crystal structure of the human GM-CSF/GM-CSF receptor ternary complex and its assembly into an unexpected dodecamer or higher-order complex. Importantly, mutagenesis of the GM-CSF receptor at the dodecamer interface andmore » functional studies reveal that dodecamer formation is required for receptor activation and signaling. This unusual form of receptor assembly likely applies also to IL-3 and IL-5 receptors, providing a structural basis for understanding their mechanism of activation and for the development of therapeutics.« less
Structure of the human M2 muscarinic acetylcholine receptor bound to an antagonist
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haga, Kazuko; Kruse, Andrew C.; Asada, Hidetsugu
2012-03-15
The parasympathetic branch of the autonomic nervous system regulates the activity of multiple organ systems. Muscarinic receptors are G-protein-coupled receptors that mediate the response to acetylcholine released from parasympathetic nerves. Their role in the unconscious regulation of organ and central nervous system function makes them potential therapeutic targets for a broad spectrum of diseases. The M2 muscarinic acetylcholine receptor (M2 receptor) is essential for the physiological control of cardiovascular function through activation of G-protein-coupled inwardly rectifying potassium channels, and is of particular interest because of its extensive pharmacological characterization with both orthosteric and allosteric ligands. Here we report the structuremore » of the antagonist-bound human M2 receptor, the first human acetylcholine receptor to be characterized structurally, to our knowledge. The antagonist 3-quinuclidinyl-benzilate binds in the middle of a long aqueous channel extending approximately two-thirds through the membrane. The orthosteric binding pocket is formed by amino acids that are identical in all five muscarinic receptor subtypes, and shares structural homology with other functionally unrelated acetylcholine binding proteins from different species. A layer of tyrosine residues forms an aromatic cap restricting dissociation of the bound ligand. A binding site for allosteric ligands has been mapped to residues at the entrance to the binding pocket near this aromatic cap. The structure of the M2 receptor provides insights into the challenges of developing subtype-selective ligands for muscarinic receptors and their propensity for allosteric regulation.« less
Probing receptor structure/function with chimeric G-protein-coupled receptors.
Yin, Dezhong; Gavi, Shai; Wang, Hsien-yu; Malbon, Craig C
2004-06-01
Owing its name to an image borrowed from Greek mythology, a chimera is seen to represent a new entity created as a composite from existing creatures or, in this case, molecules. Making use of various combinations of three basic domains of the receptors (i.e., exofacial, transmembrane, and cytoplasmic segments) that couple agonist binding into activation of effectors through heterotrimeric G-proteins, molecular pharmacology has probed the basic organization, structure/function relationships of this superfamily of heptahelical receptors. Chimeric G-protein-coupled receptors obviate the need for a particular agonist ligand when the ligand is resistant to purification or, in the case of orphan receptors, is not known. Chimeric receptors created from distant members of the heptahelical receptors enable new strategies in understanding how these receptors transduce agonist binding into receptor activation and may be able to offer insights into the evolution of G-protein-coupled receptors from yeast to humans.
NASA Astrophysics Data System (ADS)
Grigoriev, V. V.; Proshin, A. N.; Kinzirsky, A. S.; Bachurin, Sergey O.
2009-05-01
Data on the structure and properties of compounds acting on AMPA receptors, the key subtype of ionotropic glutamate receptors of the mammalian central nervous system, are analyzed. Data on the role of these receptors in provision of memory and cognitive function formation and impairment processes are presented. The attention is focused on the modern views on the mechanisms of AMPA receptor desensitization and deactivation and action of substances affecting these processes. The structures of key positive modulators of AMPA receptors are given. The problems of application of these substances as therapeutic means for preventing and treating neurodegenerative and psychoneurological diseases are discussed. Bibliography — 121 references.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lentz, T.L.
1991-11-12
Peptides corresponding to portions of curaremimetic neurotoxin loop 2 and to a structurally similar segment of rabies virus glycoprotein were synthetically modified in order to gain information on structure-function relationships of neurotoxin loop 2 interactions with the acetylcholine receptor. Binding of synthetic peptides to the acetylcholine receptor of Torpedo electric organ membranes was assessed by measuring their ability to inhibit the binding of {sup 125}I-{alpha}-bungarotoxin to the receptor. The peptides showing the highest affinity for the receptor were a peptide corresponding to the sequence of loop 2 (residues 25-44) of Ophiophagus hannah (king cobra) toxin b and the structurally similarmore » segment of CVS rabies virus glycoprotein. These affinities were comparable to those of d-tubocurarine and suberyldicholine. These results demonstrate the importance of loop 2 in the neurotoxin interaction with the receptor. N- and C-terminal deletions of the loop 2 peptides and substitution of residues invariant or highly conserved among neurotoxins were performed in order to determine the role of individual residues in binding. Residues 25-40 are the most crucial in the interaction with the acetylcholine receptor. Since this region of the glycoprotein contains residues corresponding to all of the functionally invariant neurotoxin residues, it may interact with the acetylcholine receptor through a mechanism similar to that of the neurotoxins.« less
Synthesis and structure-activity relationships of N-benzyl phenethylamines as 5-HT2A/2C agonists.
Hansen, Martin; Phonekeo, Karina; Paine, James S; Leth-Petersen, Sebastian; Begtrup, Mikael; Bräuner-Osborne, Hans; Kristensen, Jesper L
2014-03-19
N-Benzyl substitution of 5-HT2A receptor agonists of the phenethylamine structural class of psychedelics (such as 4-bromo-2,5-dimethoxyphenethylamine, often referred to as 2C-B) confer a significant increase in binding affinity as well as functional activity of the receptor. We have prepared a series of 48 compounds with structural variations in both the phenethylamine and N-benzyl part of the molecule to determine the effects on receptor binding affinity and functional activity at 5-HT2A and 5-HT2C receptors. The compounds generally had high affinity for the 5-HT2A receptor with 8b having the highest affinity at 0.29 nM but with several other compounds also exhibiting subnanomolar binding affinities. The functional activity of the compounds was distributed over a wider range with 1b being the most potent at 0.074 nM. Most of the compounds exhibited low to moderate selectivity (1- to 40-fold) for the 5-HT2A receptor in the binding assays, although one compound 6b showed an impressive 100-fold selectivity for the 5-HT2A receptor. In the functional assay, selectivity was generally higher with 1b being more than 400-fold selective for the 5-HT2A receptor.
Baltoumas, Fotis A; Theodoropoulou, Margarita C; Hamodrakas, Stavros J
2016-06-01
A significant amount of experimental evidence suggests that G-protein coupled receptors (GPCRs) do not act exclusively as monomers but also form biologically relevant dimers and oligomers. However, the structural determinants, stoichiometry and functional importance of GPCR oligomerization remain topics of intense speculation. In this study we attempted to evaluate the nature and dynamics of GPCR oligomeric interactions. A representative set of GPCR homodimers were studied through Coarse-Grained Molecular Dynamics simulations, combined with interface analysis and concepts from network theory for the construction and analysis of dynamic structural networks. Our results highlight important structural determinants that seem to govern receptor dimer interactions. A conserved dynamic behavior was observed among different GPCRs, including receptors belonging in different GPCR classes. Specific GPCR regions were highlighted as the core of the interfaces. Finally, correlations of motion were observed between parts of the dimer interface and GPCR segments participating in ligand binding and receptor activation, suggesting the existence of mechanisms through which dimer formation may affect GPCR function. The results of this study can be used to drive experiments aimed at exploring GPCR oligomerization, as well as in the study of transmembrane protein-protein interactions in general.
NASA Astrophysics Data System (ADS)
Baltoumas, Fotis A.; Theodoropoulou, Margarita C.; Hamodrakas, Stavros J.
2016-06-01
A significant amount of experimental evidence suggests that G-protein coupled receptors (GPCRs) do not act exclusively as monomers but also form biologically relevant dimers and oligomers. However, the structural determinants, stoichiometry and functional importance of GPCR oligomerization remain topics of intense speculation. In this study we attempted to evaluate the nature and dynamics of GPCR oligomeric interactions. A representative set of GPCR homodimers were studied through Coarse-Grained Molecular Dynamics simulations, combined with interface analysis and concepts from network theory for the construction and analysis of dynamic structural networks. Our results highlight important structural determinants that seem to govern receptor dimer interactions. A conserved dynamic behavior was observed among different GPCRs, including receptors belonging in different GPCR classes. Specific GPCR regions were highlighted as the core of the interfaces. Finally, correlations of motion were observed between parts of the dimer interface and GPCR segments participating in ligand binding and receptor activation, suggesting the existence of mechanisms through which dimer formation may affect GPCR function. The results of this study can be used to drive experiments aimed at exploring GPCR oligomerization, as well as in the study of transmembrane protein-protein interactions in general.
Structural and Molecular Modeling Features of P2X Receptors
Alves, Luiz Anastacio; da Silva, João Herminio Martins; Ferreira, Dinarte Neto Moreira; Fidalgo-Neto, Antonio Augusto; Teixeira, Pedro Celso Nogueira; de Souza, Cristina Alves Magalhães; Caffarena, Ernesto Raúl; de Freitas, Mônica Santos
2014-01-01
Currently, adenosine 5′-triphosphate (ATP) is recognized as the extracellular messenger that acts through P2 receptors. P2 receptors are divided into two subtypes: P2Y metabotropic receptors and P2X ionotropic receptors, both of which are found in virtually all mammalian cell types studied. Due to the difficulty in studying membrane protein structures by X-ray crystallography or NMR techniques, there is little information about these structures available in the literature. Two structures of the P2X4 receptor in truncated form have been solved by crystallography. Molecular modeling has proven to be an excellent tool for studying ionotropic receptors. Recently, modeling studies carried out on P2X receptors have advanced our knowledge of the P2X receptor structure-function relationships. This review presents a brief history of ion channel structural studies and shows how modeling approaches can be used to address relevant questions about P2X receptors. PMID:24637936
Structure and assembly mechanism for heteromeric kainate receptors.
Kumar, Janesh; Schuck, Peter; Mayer, Mark L
2011-07-28
Native glutamate receptor ion channels are tetrameric assemblies containing two or more different subunits. NMDA receptors are obligate heteromers formed by coassembly of two or three divergent gene families. While some AMPA and kainate receptors can form functional homomeric ion channels, the KA1 and KA2 subunits are obligate heteromers which function only in combination with GluR5-7. The mechanisms controlling glutamate receptor assembly involve an initial step in which the amino terminal domains (ATD) assemble as dimers. Here, we establish by sedimentation velocity that the ATDs of GluR6 and KA2 coassemble as a heterodimer of K(d) 11 nM, 32,000-fold lower than the K(d) for homodimer formation by KA2; we solve crystal structures for the GluR6/KA2 ATD heterodimer and heterotetramer assemblies. Using these structures as a guide, we perform a mutant cycle analysis to probe the energetics of assembly and show that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors. Copyright © 2011 Elsevier Inc. All rights reserved.
Androgen receptor: structure, role in prostate cancer and drug discovery
Tan, MH Eileen; Li, Jun; Xu, H Eric; Melcher, Karsten; Yong, Eu-leong
2015-01-01
Androgens and androgen receptors (AR) play a pivotal role in expression of the male phenotype. Several diseases, such as androgen insensitivity syndrome (AIS) and prostate cancer, are associated with alterations in AR functions. Indeed, androgen blockade by drugs that prevent the production of androgens and/or block the action of the AR inhibits prostate cancer growth. However, resistance to these drugs often occurs after 2–3 years as the patients develop castration-resistant prostate cancer (CRPC). In CRPC, a functional AR remains a key regulator. Early studies focused on the functional domains of the AR and its crucial role in the pathology. The elucidation of the structures of the AR DNA binding domain (DBD) and ligand binding domain (LBD) provides a new framework for understanding the functions of this receptor and leads to the development of rational drug design for the treatment of prostate cancer. An overview of androgen receptor structure and activity, its actions in prostate cancer, and how structural information and high-throughput screening have been or can be used for drug discovery are provided herein. PMID:24909511
NASA Astrophysics Data System (ADS)
Miledi, Ricardo; Eusebi, Fabrizio; Martínez-Torres, Ataúlfo; Palma, Eleonora; Trettel, Flavia
2002-10-01
The Xenopus oocyte is a very powerful tool for studies of the structure and function of membrane proteins, e.g., messenger RNA extracted from the brain and injected into oocytes leads to the synthesis and membrane incorporation of many types of functional receptors and ion channels, and membrane vesicles from Torpedo electroplaques injected into oocytes fuse with the oocyte membrane and cause the appearance of functional Torpedo acetylcholine receptors and Cl channels. This approach was developed further to transplant already assembled neurotransmitter receptors from human brain cells to the plasma membrane of Xenopus oocytes. Membranes isolated from the temporal neocortex of a patient, operated for intractable epilepsy, were injected into oocytes and, within a few hours, the oocyte membrane acquired functional neurotransmitter receptors to -aminobutyric acid, -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, kainate, and glycine. These receptors were also expressed in the plasma membrane of oocytes injected with mRNA extracted from the temporal neocortex of the same patient. All of this makes the Xenopus oocyte a more useful model than it already is for studies of the structure and function of many human membrane proteins and opens the way to novel pathophysiological investigations of some human brain disorders.
1988-03-16
receptors in muscle is responsible for the muscular weakness characteristic of myasthenia gravis . Some insecticides can act like chemical warfare...expresses muscle-like acetyi-.holine receptor by observing that autoantibodies from myasthenia gravis patients reacted as well with these receptors as...Antibodies in sera from patients with myasthenia gravis do not bind to acetylcholine receptors from human brain. J Neuroimmunol 16:205-213. 21. Whiting
Varghese, Leila N; Defour, Jean-Philippe; Pecquet, Christian; Constantinescu, Stefan N
2017-01-01
A well-functioning hematopoietic system requires a certain robustness and flexibility to maintain appropriate quantities of functional mature blood cells, such as red blood cells and platelets. This review focuses on the cytokine receptor that plays a significant role in thrombopoiesis: the receptor for thrombopoietin (TPO-R; also known as MPL). Here, we survey the work to date to understand how this receptor functions at a molecular level throughout its lifecycle, from traffic to the cell surface, dimerization and binding cognate cytokine via its extracellular domain, through to its subsequent activation of associated Janus kinases and initiation of downstream signaling pathways, as well as the regulation of these processes. Atomic level resolution structures of TPO-R have remained elusive. The identification of disease-causing mutations in the receptor has, however, offered some insight into structure and function relationships, as has artificial means of receptor activation, through TPO mimetics, transmembrane-targeting receptor agonists, and engineering in dimerization domains. More recently, a novel activation mechanism was identified whereby mutated forms of calreticulin form complexes with TPO-R via its extracellular N-glycosylated domain. Such complexes traffic pathologically in the cell and persistently activate JAK2, downstream signal transducers and activators of transcription (STATs), and other pathways. This pathologic TPO-R activation is associated with a large fraction of human myeloproliferative neoplasms.
GABA(C) receptors: a molecular view.
Enz, R
2001-08-01
In the central nervous system inhibitory neurotransmission is primarily achieved through activation of receptors for gamma-aminobutyric acid (GABA). Three types of GABA receptors have been identified on the basis of their pharmacological and electrophysiological properties. The predominant type, termed GABA(A), and a recently identified GABA(C) type, form ligand-gated chloride channels, whereas GABA(B) receptors activate separate cation channels via G proteins. Based on their homology to nicotinic acetylcholine receptors, GABA(C) receptors are believed to be oligomeric protein complexes composed of five subunits in a pentameric arrangement. To date up to five different GABA(C) receptors subunits have been identified in various species. Recent studies have shed new light on the biological characteristics of GABA(C) receptors, including the chromosomal localization of its subunit genes and resulting links to deseases, the cloning of new splice variants, the identification of GABA(C) receptor-associated proteins, the identification of domains involved in subunit assembly, and finally structure/function studies examining functional consequences of introduced mutations. This review summarizes recent data in view of the molecular structure of GABA(C) receptors and presents new insights into the biological function of this protein in the retina.
Mahajan, Muktar A.; Samuels, Herbert H.
2000-01-01
We describe the cloning and characterization of a new family of nuclear receptor coregulators (NRCs) which modulate the function of nuclear hormone receptors in a ligand-dependent manner. NRCs are expressed as alternatively spliced isoforms which may exhibit different intrinsic activities and receptor specificities. The NRCs are organized into several modular structures and contain a single functional LXXLL motif which associates with members of the steroid hormone and thyroid hormone/retinoid receptor subfamilies with high affinity. Human NRC (hNRC) harbors a potent N-terminal activation domain (AD1), which is as active as the herpesvirus VP16 activation domain, and a second activation domain (AD2) which overlaps with the receptor-interacting LXXLL region. The C-terminal region of hNRC appears to function as an inhibitory domain which influences the overall transcriptional activity of the protein. Our results suggest that NRC binds to liganded receptors as a dimer and this association leads to a structural change in NRC resulting in activation. hNRC binds CREB-binding protein (CBP) with high affinity in vivo, suggesting that hNRC may be an important functional component of a CBP complex involved in mediating the transcriptional effects of nuclear hormone receptors. PMID:10866662
Species Differences in Androgen and Estrogen Receptor Structure and Function Among Vertebrates and Invertebrates: Interspecies Extrapolations regarding Endocrine Disrupting Chemicals
VS Wilson1, GT Ankley2, M Gooding 1,3, PD Reynolds 1,4, NC Noriega 1, M Cardon 1, P Hartig1,...
Principles and properties of ion flow in P2X receptors
Samways, Damien S. K.; Li, Zhiyuan; Egan, Terrance M.
2014-01-01
P2X receptors are a family of trimeric ion channels that are gated by extracellular adenosine 5′-triphosphate (ATP). These receptors have long been a subject of intense research interest by virtue of their vital role in mediating the rapid and direct effects of extracellular ATP on membrane potential and cytosolic Ca2+ concentration, which in turn underpin the ability of ATP to regulate a diverse range of clinically significant physiological functions, including those associated with the cardiovascular, sensory, and immune systems. An important aspect of an ion channel's function is, of course, the means by which it transports ions across the biological membrane. A concerted effort by investigators over the last two decades has culminated in significant advances in our understanding of how P2X receptors conduct the inward flux of Na+ and Ca2+ in response to binding by ATP. However, this work has relied heavily on results from current recordings of P2X receptors altered by site-directed mutagenesis. In the absence of a 3-dimensional channel structure, this prior work provided only a vague and indirect appreciation of the relationship between structure, ion selectivity and flux. The recent publication of the crystal structures for both the closed and open channel conformations of the zebrafish P2X4 receptor has thus proved a significant boon, and has provided an important opportunity to overview the amassed functional data in the context of a working 3-dimensional model of a P2X receptor. In this paper, we will attempt to reconcile the existing functional data regarding ion permeation through P2X receptors with the available crystal structure data, highlighting areas of concordance and discordance as appropriate. PMID:24550775
Cock, J Mark; Vanoosthuyse, Vincent; Gaude, Thierry
2002-04-01
Plant genomes encode large numbers of receptor kinases that are structurally related to the tyrosine and serine/threonine families of receptor kinase found in animals. Here, we describe recent advances in the characterisation of several of these plant receptor kinases at the molecular level, including the identification of receptor complexes, small polypeptide ligands and cytosolic proteins involved in signal transduction and receptor downregulation. Phylogenetic analysis indicates that plant receptor kinases have evolved independently of the receptor kinase families found in animals. This hypothesis is supported by functional studies that have revealed differences between receptor kinase signalling in plants and animals, particularly concerning their interactions with cytosolic proteins. Despite these dissimilarities, however, plant and animal receptor kinases share many common features, such as their single membrane-pass structure, their inclusion in membrane-associated complexes, the involvement of dimerisation and trans autophosphorylation in receptor activation, and the existence of inhibitors and phosphatases that downregulate receptor activity. These points of convergence may represent features that are essential for a functional receptor-kinase signalling system.
Quaternary structure of a G-protein-coupled receptor heterotetramer in complex with Gi and Gs.
Navarro, Gemma; Cordomí, Arnau; Zelman-Femiak, Monika; Brugarolas, Marc; Moreno, Estefania; Aguinaga, David; Perez-Benito, Laura; Cortés, Antoni; Casadó, Vicent; Mallol, Josefa; Canela, Enric I; Lluís, Carme; Pardo, Leonardo; García-Sáez, Ana J; McCormick, Peter J; Franco, Rafael
2016-04-05
G-protein-coupled receptors (GPCRs), in the form of monomers or homodimers that bind heterotrimeric G proteins, are fundamental in the transfer of extracellular stimuli to intracellular signaling pathways. Different GPCRs may also interact to form heteromers that are novel signaling units. Despite the exponential growth in the number of solved GPCR crystal structures, the structural properties of heteromers remain unknown. We used single-particle tracking experiments in cells expressing functional adenosine A1-A2A receptors fused to fluorescent proteins to show the loss of Brownian movement of the A1 receptor in the presence of the A2A receptor, and a preponderance of cell surface 2:2 receptor heteromers (dimer of dimers). Using computer modeling, aided by bioluminescence resonance energy transfer assays to monitor receptor homomerization and heteromerization and G-protein coupling, we predict the interacting interfaces and propose a quaternary structure of the GPCR tetramer in complex with two G proteins. The combination of results points to a molecular architecture formed by a rhombus-shaped heterotetramer, which is bound to two different interacting heterotrimeric G proteins (Gi and Gs). These novel results constitute an important advance in understanding the molecular intricacies involved in GPCR function.
VPAC receptors: structure, molecular pharmacology and interaction with accessory proteins.
Couvineau, Alain; Laburthe, Marc
2012-05-01
The vasoactive intestinal peptide (VIP) is a neuropeptide with wide distribution in both central and peripheral nervous systems, where it plays important regulatory role in many physiological processes. VIP displays a large biological functions including regulation of exocrine secretions, hormone release, fetal development, immune responses, etc. VIP appears to exert beneficial effect in neuro-degenerative and inflammatory diseases. The mechanism of action of VIP implicates two subtypes of receptors (VPAC1 and VPAC2), which are members of class B receptors belonging to the super-family of GPCR. This article reviews the current knowledge regarding the structure and molecular pharmacology of VPAC receptors. The structure-function relationship of VPAC1 receptor has been extensively studied, allowing to understand the molecular basis for receptor affinity, specificity, desensitization and coupling to adenylyl cyclase. Those studies have clearly demonstrated the crucial role of the N-terminal ectodomain (N-ted) of VPAC1 receptor in VIP recognition. By using different approaches including directed mutagenesis, photoaffinity labelling, NMR, molecular modelling and molecular dynamic simulation, it has been shown that the VIP molecule interacts with the N-ted of VPAC1 receptor, which is itself structured as a 'Sushi' domain. VPAC1 receptor also interacts with a few accessory proteins that play a role in cell signalling of receptors. Recent advances in the structural characterization of VPAC receptor and more generally of class B GPCRs will lead to the design of new molecules, which could have considerable interest for the treatment of inflammatory and neuro-degenerative diseases. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological Society.
Bettler, Bernhard; Fakler, Bernd
2017-08-01
Ionotropic AMPA-type glutamate receptors and G-protein-coupled metabotropic GABA B receptors are key elements of neurotransmission whose cellular functions are determined by their protein constituents. Over the past couple of years unbiased proteomic approaches identified comprehensive sets of protein building blocks of these two types of neurotransmitter receptors in the brain (termed receptor proteomes). This provided the opportunity to match receptor proteomes with receptor physiology and to study the structural organization, regulation and function of native receptor complexes in an unprecedented manner. In this review we discuss the principles of receptor architecture and regulation emerging from the functional characterization of the proteomes of AMPA and GABA B receptors. We also highlight progress in unraveling the role of unexpected protein components for receptor physiology. Copyright © 2017 Elsevier Ltd. All rights reserved.
Vinnikov, Ia A; Gazenko, O G; Titova, L K; Bronshteĭn, A A; Govardovskiĭ, V I
1978-01-01
Vestibular apparatus was investigated in rats subjected to weightlessness for 19.5 days in the satelite "Cosmos-782" and experienced acceleration on launching and landing. Some structural and functional changes were noted. They were seen in otolith clinging to the utricular receptor surface and in the peripheral arrangement of the nucleolus in the nuclei of the receptor cells. It is also possible that increased edema of the vestibular tissue resulted in destruction of some receptor cells, and within the otolith--changes in the form and structure of otoconia. In the horizontal crista the cupula was separated.
[Architecture of receptor-operated ionic channels of biological membranes].
Bregestovski, P D
2011-01-01
Ion channels of biological membranes are the key proteins, which provide bioelectric functioning of living systems. These proteins are homo- or heterooligomers assembled from several identical or different subunits. Understanding the architectural organization and functioning of ion channels has been significantly extended due to resolving the crystal structure of several types of voltage-gated and receptor-operated channels. This review summarizes the information obtained from crystal structures of potassium, nicotinic acetylcholine receptor, P2X, and other ligand-gated ion channels. Despite the differences in the function, topology, ionic selectivity, and the subunit stoichiometry, a high similarity in the principles of organization of these macromolecular complexes has been revealed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Back, J.; Malchiodi, E; Cho, S
2009-01-01
Certain cell-surface receptors engage ligands expressed on juxtaposed cells and ligands on the same cell. The structural basis for trans versus cis binding is not known. Here, we showed that Ly49 natural killer (NK) cell receptors bound two MHC class I (MHC-I) molecules in trans when the two ligand-binding domains were backfolded onto the long stalk region. In contrast, dissociation of the ligand-binding domains from the stalk and their reorientation relative to the NK cell membrane allowed monovalent binding of MHC-I in cis. The distinct conformations (backfolded and extended) define the structural basis for cis-trans binding by Ly49 receptors andmore » explain the divergent functional consequences of cis versus trans interactions. Further analyses identified specific stalk segments that were not required for MHC-I binding in trans but were essential for inhibitory receptor function. These data identify multiple distinct roles of stalk regions for receptor function.« less
Mittal, Rahul; Chan, Brandon; Grati, M'hamed; Mittal, Jeenu; Patel, Kunal; Debs, Luca H; Patel, Amit P; Yan, Denise; Chapagain, Prem; Liu, Xue Zhong
2016-08-01
The P2X purinergic receptors are cation-selective channels gated by extracellular adenosine 5'-triphosphate (ATP). These purinergic receptors are found in virtually all mammalian cell types and facilitate a number of important physiological processes. Within the past few years, the characterization of crystal structures of the zebrafish P2X4 receptor in its closed and open states has provided critical insights into the mechanisms of ligand binding and channel activation. Understanding of this gating mechanism has facilitated to design and interpret new modeling and structure-function experiments to better elucidate how different agonists and antagonists can affect the receptor with differing levels of potency. This review summarizes the current knowledge on the structure, activation, allosteric modulators, function, and location of the different P2X receptors. Moreover, an emphasis on the P2X2 receptors has been placed in respect to its role in the auditory system. In particular, the discovery of three missense mutations in P2X2 receptors could become important areas of study in the field of gene therapy to treat progressive and noise-induced hearing loss. J. Cell. Physiol. 231: 1656-1670, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.
Molecular Dynamics Methodologies for Probing Cannabinoid Ligand/Receptor Interaction
Lynch, Diane L.; Hurst, Dow P.; Shore, Derek M.; Pitman, Mike C.; Reggio, Patricia H.
2018-01-01
The cannabinoid type 1 and 2 G-protein-coupled receptors are currently important pharmacological targets with significant drug discovery potential. These receptors have been shown to display functional selectivity or biased agonism, a property currently thought to have substantial therapeutic potential. Although recent advances in crystallization techniques have provided a wealth of structural information about this important class of membrane-embedded proteins, these structures lack dynamical information. In order to fully understand the interplay of structure and function for this important class of proteins, complementary techniques that address the dynamical aspects of their function are required such as NMR as well as a variety of other spectroscopies. Complimentary to these experimental approaches is molecular dynamics, which has been effectively used to help unravel, at the atomic level, the dynamics of ligand binding and activation of these membrane-bound receptors. Here, we discuss and present several representative examples of the application of molecular dynamics simulations to the understanding of the signatures of ligand-binding and -biased signaling at the cannabinoid type 1 and 2 receptors. PMID:28750815
Song, Wen; Liu, Li; Wang, Jizong; Wu, Zhen; Zhang, Heqiao; Tang, Jiao; Lin, Guangzhong; Wang, Yichuan; Wen, Xing; Li, Wenyang; Han, Zhifu; Guo, Hongwei; Chai, Jijie
2016-06-01
Peptide-mediated cell-to-cell signaling has crucial roles in coordination and definition of cellular functions in plants. Peptide-receptor matching is important for understanding the mechanisms underlying peptide-mediated signaling. Here we report the structure-guided identification of root meristem growth factor (RGF) receptors important for plant development. An assay based on a signature ligand recognition motif (Arg-x-Arg) conserved in a subfamily of leucine-rich repeat receptor kinases (LRR-RKs) identified the functionally uncharacterized LRR-RK At4g26540 as a receptor of RGF1 (RGFR1). We further solved the crystal structure of RGF1 in complex with the LRR domain of RGFR1 at a resolution of 2.6 Å, which reveals that the Arg-x-Gly-Gly (RxGG) motif is responsible for specific recognition of the sulfate group of RGF1 by RGFR1. Based on the RxGG motif, we identified additional four RGFRs. Participation of the five RGFRs in RGF-induced signaling is supported by biochemical and genetic data. We also offer evidence showing that SERKs function as co-receptors for RGFs. Taken together, our study identifies RGF receptors and co-receptors that can link RGF signals with their downstream components and provides a proof of principle for structure-based matching of LRR-RKs with their peptide ligands.
Structural basis for bifunctional peptide recognition at human δ-opioid receptor
Fenalti, Gustavo; Zatsepin, Nadia A.; Betti, Cecilia; ...
2015-02-16
Bi-functional μ- and δ- opioid receptor (OR) ligands are potential therapeutic alternatives to alkaloid opiate analgesics with diminished side effects. We solved the structure of human δ-OR bound to the bi-functional δ-OR antagonist and μ-OR agonist tetrapeptide H-Dmt-Tic-Phe-Phe-NH 2 (DIPP-NH 2) by serial femtosecond crystallography, revealing a cis-peptide bond between H-Dmt and Tic. In summary, the observed receptor-peptide interactions are critical to understand the pharmacological profiles of opioid peptides, and to develop improved analgesics.
Martí-Solano, Maria; Sanz, Ferran; Pastor, Manuel; Selent, Jana
2014-01-01
Functional selectivity is a property of G protein-coupled receptors that allows them to preferentially couple to particular signaling partners upon binding of biased agonists. Publication of the X-ray crystal structure of serotonergic 5-HT1B and 5-HT2B receptors in complex with ergotamine, a drug capable of activating G protein coupling and β-arrestin signaling at the 5-HT1B receptor but clearly favoring β-arrestin over G protein coupling at the 5-HT2B subtype, has recently provided structural insight into this phenomenon. In particular, these structures highlight the importance of specific residues, also called micro-switches, for differential receptor activation. In our work, we apply classical molecular dynamics simulations and enhanced sampling approaches to analyze the behavior of these micro-switches and their impact on the stabilization of particular receptor conformational states. Our analysis shows that differences in the conformational freedom of helix 6 between both receptors could explain their different G protein-coupling capacity. In particular, as compared to the 5-HT1B receptor, helix 6 movement in the 5-HT2B receptor can be constrained by two different mechanisms. On the one hand, an anchoring effect of ergotamine, which shows an increased capacity to interact with the extracellular part of helices 5 and 6 and stabilize them, hinders activation of a hydrophobic connector region at the center of the receptor. On the other hand, this connector region in an inactive conformation is further stabilized by unconserved contacts extending to the intracellular part of the 5-HT2B receptor, which hamper opening of the G protein binding site. This work highlights the importance of considering receptor capacity to adopt different conformational states from a dynamic perspective in order to underpin the structural basis of functional selectivity. PMID:25313636
Martí-Solano, Maria; Sanz, Ferran; Pastor, Manuel; Selent, Jana
2014-01-01
Functional selectivity is a property of G protein-coupled receptors that allows them to preferentially couple to particular signaling partners upon binding of biased agonists. Publication of the X-ray crystal structure of serotonergic 5-HT1B and 5-HT2B receptors in complex with ergotamine, a drug capable of activating G protein coupling and β-arrestin signaling at the 5-HT1B receptor but clearly favoring β-arrestin over G protein coupling at the 5-HT2B subtype, has recently provided structural insight into this phenomenon. In particular, these structures highlight the importance of specific residues, also called micro-switches, for differential receptor activation. In our work, we apply classical molecular dynamics simulations and enhanced sampling approaches to analyze the behavior of these micro-switches and their impact on the stabilization of particular receptor conformational states. Our analysis shows that differences in the conformational freedom of helix 6 between both receptors could explain their different G protein-coupling capacity. In particular, as compared to the 5-HT1B receptor, helix 6 movement in the 5-HT2B receptor can be constrained by two different mechanisms. On the one hand, an anchoring effect of ergotamine, which shows an increased capacity to interact with the extracellular part of helices 5 and 6 and stabilize them, hinders activation of a hydrophobic connector region at the center of the receptor. On the other hand, this connector region in an inactive conformation is further stabilized by unconserved contacts extending to the intracellular part of the 5-HT2B receptor, which hamper opening of the G protein binding site. This work highlights the importance of considering receptor capacity to adopt different conformational states from a dynamic perspective in order to underpin the structural basis of functional selectivity.
Complete Reversible Refolding of a G-Protein Coupled Receptor on a Solid Support
Di Bartolo, Natalie; Compton, Emma L. R.; Warne, Tony; Edwards, Patricia C.; Tate, Christopher G.; Schertler, Gebhard F. X.; Booth, Paula J.
2016-01-01
The factors defining the correct folding and stability of integral membrane proteins are poorly understood. Folding of only a few select membrane proteins has been scrutinised, leaving considerable deficiencies in knowledge for large protein families, such as G protein coupled receptors (GPCRs). Complete reversible folding, which is problematic for any membrane protein, has eluded this dominant receptor family. Moreover, attempts to recover receptors from denatured states are inefficient, yielding at best 40–70% functional protein. We present a method for the reversible unfolding of an archetypal family member, the β1-adrenergic receptor, and attain 100% recovery of the folded, functional state, in terms of ligand binding, compared to receptor which has not been subject to any unfolding and retains its original, folded structure. We exploit refolding on a solid support, which could avoid unwanted interactions and aggregation that occur in bulk solution. We determine the changes in structure and function upon unfolding and refolding. Additionally, we employ a method that is relatively new to membrane protein folding; pulse proteolysis. Complete refolding of β1-adrenergic receptor occurs in n-decyl-β-D-maltoside (DM) micelles from a urea-denatured state, as shown by regain of its original helical structure, ligand binding and protein fluorescence. The successful refolding strategy on a solid support offers a defined method for the controlled refolding and recovery of functional GPCRs and other membrane proteins that suffer from instability and irreversible denaturation once isolated from their native membranes. PMID:26982879
Chemokines and their receptors: insights from molecular modeling and crystallography.
Kufareva, Irina
2016-10-01
Chemokines are small secreted proteins that direct cell migration in development, immunity, inflammation, and cancer. They do so by binding and activating specific G protein coupled receptors on the surface of migrating cells. Despite the importance of receptor:chemokine interactions, their structural basis remained unclear for a long time. In 2015, the first atomic resolution insights were obtained with the publication of X-ray structures for two distantly related receptors bound to chemokines. In conjunction with experiment-guided molecular modeling, the structures suggest a conserved receptor:chemokine complex architecture, while highlighting the diverse details and functional roles of individual interaction epitopes. Novel findings promote the development and detailed structural interpretation of the canonical two-site hypothesis of receptor:chemokine recognition, and suggest new avenues for pharmacological modulation of chemokine receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kanagarajadurai, Karuppiah; Malini, Manoharan; Bhattacharya, Aditi; Panicker, Mitradas M; Sowdhamini, Ramanathan
2009-12-01
The serotonergic system has been implicated in emotional and cognitive function. In particular, 5-HT(2A) (5-hydroxytrytamine receptor 2A) is attributed to a number of disorders like schizophrenia, depression, eating disorders and anxiety. 5-HT(2A), being a GPCR (G-protein coupled receptor), is important in the pharmaceutical industry as a proven target for these disorders. Despite their extensive clinical importance, the structural studies of this protein is lacking due to difficulties in determining its crystal structure. We have performed sequence analysis and molecular modeling of 5-HT(2A) that has revealed a set of conserved residues and motifs considered to play an important role in maintaining structural integrity and function of the receptor. The analysis also revealed a set of residues specific to the receptor which distinguishes them from other members of the subclass and their orthologs. Further, starting from the model structure of human 5-HT(2A) receptor, docking studies were attempted to envisage how it might interact with eight of its ligands (such as serotonin, dopamine, DOI, LSD, haloperidol, ketanserin, risperidone and clozapine). The binding studies of dopamine to 5-HT(2A) receptor can bring up better understanding in the etiology of a number of neurological disorders involving both these two receptors. Our sequence analysis and study of interactions of this receptor with other ligands reveal additional residue hotspots such as Asn 363 and Tyr 370. The function of these residues can be further analyzed by rational design of site-directed mutagenesis. Two distinct binding sites are identified which could play important roles in ligand binding and signaling.
Cook, Brian L.; Steuerwald, Dirk; Kaiser, Liselotte; Graveland-Bikker, Johanna; Vanberghem, Melanie; Berke, Allison P.; Herlihy, Kara; Pick, Horst; Vogel, Horst; Zhang, Shuguang
2009-01-01
Although understanding of the olfactory system has progressed at the level of downstream receptor signaling and the wiring of olfactory neurons, the system remains poorly understood at the molecular level of the receptors and their interaction with and recognition of odorant ligands. The structure and functional mechanisms of these receptors still remain a tantalizing enigma, because numerous previous attempts at the large-scale production of functional olfactory receptors (ORs) have not been successful to date. To investigate the elusive biochemistry and molecular mechanisms of olfaction, we have developed a mammalian expression system for the large-scale production and purification of a functional OR protein in milligram quantities. Here, we report the study of human OR17-4 (hOR17-4) purified from a HEK293S tetracycline-inducible system. Scale-up of production yield was achieved through suspension culture in a bioreactor, which enabled the preparation of >10 mg of monomeric hOR17-4 receptor after immunoaffinity and size exclusion chromatography, with expression yields reaching 3 mg/L of culture medium. Several key post-translational modifications were identified using MS, and CD spectroscopy showed the receptor to be ≈50% α-helix, similar to other recently determined G protein-coupled receptor structures. Detergent-solubilized hOR17-4 specifically bound its known activating odorants lilial and floralozone in vitro, as measured by surface plasmon resonance. The hOR17-4 also recognized specific odorants in heterologous cells as determined by calcium ion mobilization. Our system is feasible for the production of large quantities of OR necessary for structural and functional analyses and research into OR biosensor devices. PMID:19581598
Cook, Brian L; Steuerwald, Dirk; Kaiser, Liselotte; Graveland-Bikker, Johanna; Vanberghem, Melanie; Berke, Allison P; Herlihy, Kara; Pick, Horst; Vogel, Horst; Zhang, Shuguang
2009-07-21
Although understanding of the olfactory system has progressed at the level of downstream receptor signaling and the wiring of olfactory neurons, the system remains poorly understood at the molecular level of the receptors and their interaction with and recognition of odorant ligands. The structure and functional mechanisms of these receptors still remain a tantalizing enigma, because numerous previous attempts at the large-scale production of functional olfactory receptors (ORs) have not been successful to date. To investigate the elusive biochemistry and molecular mechanisms of olfaction, we have developed a mammalian expression system for the large-scale production and purification of a functional OR protein in milligram quantities. Here, we report the study of human OR17-4 (hOR17-4) purified from a HEK293S tetracycline-inducible system. Scale-up of production yield was achieved through suspension culture in a bioreactor, which enabled the preparation of >10 mg of monomeric hOR17-4 receptor after immunoaffinity and size exclusion chromatography, with expression yields reaching 3 mg/L of culture medium. Several key post-translational modifications were identified using MS, and CD spectroscopy showed the receptor to be approximately 50% alpha-helix, similar to other recently determined G protein-coupled receptor structures. Detergent-solubilized hOR17-4 specifically bound its known activating odorants lilial and floralozone in vitro, as measured by surface plasmon resonance. The hOR17-4 also recognized specific odorants in heterologous cells as determined by calcium ion mobilization. Our system is feasible for the production of large quantities of OR necessary for structural and functional analyses and research into OR biosensor devices.
Corin, Karolina; Baaske, Philipp; Ravel, Deepali B; Song, Junyao; Brown, Emily; Wang, Xiaoqiang; Wienken, Christoph J; Jerabek-Willemsen, Moran; Duhr, Stefan; Luo, Yuan; Braun, Dieter; Zhang, Shuguang
2011-01-01
A crucial bottleneck in membrane protein studies, particularly G-protein coupled receptors, is the notorious difficulty of finding an optimal detergent that can solubilize them and maintain their stability and function. Here we report rapid production of 12 unique mammalian olfactory receptors using short designer lipid-like peptides as detergents. The peptides were able to solubilize and stabilize each receptor. Circular dichroism showed that the purified olfactory receptors had alpha-helical secondary structures. Microscale thermophoresis suggested that the receptors were functional and bound their odorants. Blot intensity measurements indicated that milligram quantities of each olfactory receptor could be produced with at least one peptide detergent. The peptide detergents' capability was comparable to that of the detergent Brij-35. The ability of 10 peptide detergents to functionally solubilize 12 olfactory receptors demonstrates their usefulness as a new class of detergents for olfactory receptors, and possibly other G-protein coupled receptors and membrane proteins.
Corin, Karolina; Baaske, Philipp; Ravel, Deepali B.; Song, Junyao; Brown, Emily; Wang, Xiaoqiang; Wienken, Christoph J.; Jerabek-Willemsen, Moran; Duhr, Stefan; Luo, Yuan; Braun, Dieter; Zhang, Shuguang
2011-01-01
A crucial bottleneck in membrane protein studies, particularly G-protein coupled receptors, is the notorious difficulty of finding an optimal detergent that can solubilize them and maintain their stability and function. Here we report rapid production of 12 unique mammalian olfactory receptors using short designer lipid-like peptides as detergents. The peptides were able to solubilize and stabilize each receptor. Circular dichroism showed that the purified olfactory receptors had alpha-helical secondary structures. Microscale thermophoresis suggested that the receptors were functional and bound their odorants. Blot intensity measurements indicated that milligram quantities of each olfactory receptor could be produced with at least one peptide detergent. The peptide detergents' capability was comparable to that of the detergent Brij-35. The ability of 10 peptide detergents to functionally solubilize 12 olfactory receptors demonstrates their usefulness as a new class of detergents for olfactory receptors, and possibly other G-protein coupled receptors and membrane proteins. PMID:22132066
The Physiology and Biochemistry of Receptors.
ERIC Educational Resources Information Center
Spitzer, Judy A., Ed.
1983-01-01
The syllabus for a refresher course on the physiology and biochemistry of receptors (presented at the 1983 American Physiological Society meeting) is provided. Topics considered include receptor regulation, structural/functional aspects of receptors for insulin and insulin-like growth factors, calcium channel inhibitors, and role of lipoprotein…
Vinnikov, Y A; Gazenko, O G; Titova, L K; Bronstein, A A; Govardovskii, V I; Gribakin, F G; Pevzner, R A; Aronova, M Z; Kharkeevich, T A; Tsirulis, T P; Pyatkina, G A; Lichakov, D V; Pal'mbach, L P; Anichin, V F
1979-01-01
This investigation of the vestibular apparatus of rats exposed for 20 days to weightlessness on board an earth satellite and to acceleration during take-off and landing has revealed a set of changes in the structural and functional organization, such as adjoinment of the otolith to the utricle receptor surface and peripheral localization of the nucleoli inside the receptor cells' nuclei. Destruction of some receptor cells, apparently due to increased swelling of the vestibular apparatus tissue and alteration of the shape and structure of the otoconia were observed. In the horizontal crista, detachment of the cupula took place.
Sullivan, Lucy C; Clements, Craig S; Beddoe, Travis; Johnson, Darryl; Hoare, Hilary L; Lin, Jie; Huyton, Trevor; Hopkins, Emma J; Reid, Hugh H; Wilce, Matthew C J; Kabat, Juraj; Borrego, Francisco; Coligan, John E; Rossjohn, Jamie; Brooks, Andrew G
2007-12-01
The CD94-NKG2 receptor family that regulates NK and T cells is unique among the lectin-like receptors encoded within the natural killer cell complex. The function of the CD94-NKG2 receptors is dictated by the pairing of the invariant CD94 polypeptide with specific NKG2 isoforms to form a family of functionally distinct heterodimeric receptors. However, the structural basis for this selective pairing and how they interact with their ligand, HLA-E, is unknown. We describe the 2.5 A resolution crystal structure of CD94-NKG2A in which the mode of dimerization contrasts with that of other homodimeric NK receptors. Despite structural homology between the CD94 and NKG2A subunits, the dimer interface is asymmetric, thereby providing a structural basis for the preferred heterodimeric assembly. Structure-based sequence comparisons of other CD94-NKG2 family members, combined with extensive mutagenesis studies on HLA-E and CD94-NKG2A, allows a model of the interaction between CD94-NKG2A and HLA-E to be established, in which the invariant CD94 chain plays a more dominant role in interacting with HLA-E in comparison to the variable NKG2 chain.
The anatomy of mammalian sweet taste receptors.
Chéron, Jean-Baptiste; Golebiowski, Jérôme; Antonczak, Serge; Fiorucci, Sébastien
2017-02-01
All sweet-tasting compounds are detected by a single G-protein coupled receptor (GPCR), the heterodimer T1R2-T1R3, for which no experimental structure is available. The sweet taste receptor is a class C GPCR, and the recently published crystallographic structures of metabotropic glutamate receptor (mGluR) 1 and 5 provide a significant step forward for understanding structure-function relationships within this family. In this article, we recapitulate more than 600 single point site-directed mutations and available structural data to obtain a critical alignment of the sweet taste receptor sequences with respect to other class C GPCRs. Using this alignment, a homology 3D-model of the human sweet taste receptor is built and analyzed to dissect out the role of key residues involved in ligand binding and those responsible for receptor activation. Proteins 2017; 85:332-341. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
van der Wal, Jaap
2009-01-01
The architecture of the connective tissue, including structures such as fasciae, sheaths, and membranes, is more important for understanding functional meaning than is more traditional anatomy, whose anatomical dissection method neglects and denies the continuity of the connective tissue as integrating matrix of the body. The connective tissue anatomy and architecture exhibits two functional tendencies that are present in all areas of the body in different ways and relationships. In body cavities, the “disconnecting” quality of shaping space enables mobility; between organs and body parts, the “connecting” dimension enables functional mechanical interactions. In the musculoskeletal system, those two features of the connective tissue are also present. They cannot be found by the usual analytic dissection procedures. An architectural description is necessary. This article uses such a methodologic approach and gives such a description for the lateral elbow region. The result is an alternative architectural view of the anatomic substrate involved in the transmission and conveyance of forces over synovial joints. An architectural description of the muscular and connective tissue organized in series with each other to enable the transmission of forces over these dynamic entities is more appropriate than is the classical concept of “passive” force-guiding structures such as ligaments organized in parallel to actively force-transmitting structures such as muscles with tendons. The discrimination between so-called joint receptors and muscle receptors is an artificial distinction when function is considered. Mechanoreceptors, also the so-called muscle receptors, are arranged in the context of force circumstances—that is, of the architecture of muscle and connective tissue rather than of the classical anatomic structures such as muscle, capsules, and ligaments. In the lateral cubital region of the rat, a spectrum of mechanosensitive substrate occurs at the transitional areas between regular dense connective tissue layers and the muscle fascicles organized in series with them. This substrate exhibits features of type and location of the mechanosensitive nerve terminals that usually are considered characteristic for “joint receptors” as well as for “muscle receptors.” The receptors for proprioception are concentrated in those areas where tensile stresses are conveyed over the elbow joint. Structures cannot be divided into either joint receptors or muscle receptors when muscular and collagenous connective tissue structures function in series to maintain joint integrity and stability. In vivo, those connective tissue structures are strained during movements of the skeletal parts, those movements in turn being induced and led by tension in muscular tissue. In principle, because of the architecture, receptors can also be stimulated by changes in muscle tension without skeletal movement, or by skeletal movement without change in muscle tension. A mutual relationship exists between structure (and function) of the mechanoreceptors and the architecture of the muscular and regular dense connective tissue. Both are instrumental in the coding of proprioceptive information to the central nervous system. PMID:21589740
[Roles of G protein-coupled estrogen receptor in the male reproductive system].
Chen, Kai-hong; Zhang, Xian; Jiang, Xue-wu
2016-02-01
The G protein-coupled estrogen receptor (GPER), also known as G protein-coupled receptor 30 (GPR30), was identified in the recent years as a functional membrane receptor different from the classical nuclear estrogen receptors. This receptor is widely expressed in the cortex, cerebellum, hippocampus, heart, lung, liver, skeletal muscle, and the urogenital system. It is responsible for the mediation of nongenomic effects associated with estrogen and its derivatives, participating in the physiological activities of the body. The present study reviews the molecular structure, subcellular localization, signaling pathways, distribution, and function of GPER in the male reproductive system.
Synthesis and Structure–Activity Relationships of N-Benzyl Phenethylamines as 5-HT2A/2C Agonists
2014-01-01
N-Benzyl substitution of 5-HT2A receptor agonists of the phenethylamine structural class of psychedelics (such as 4-bromo-2,5-dimethoxyphenethylamine, often referred to as 2C-B) confer a significant increase in binding affinity as well as functional activity of the receptor. We have prepared a series of 48 compounds with structural variations in both the phenethylamine and N-benzyl part of the molecule to determine the effects on receptor binding affinity and functional activity at 5-HT2A and 5-HT2C receptors. The compounds generally had high affinity for the 5-HT2A receptor with 8b having the highest affinity at 0.29 nM but with several other compounds also exhibiting subnanomolar binding affinities. The functional activity of the compounds was distributed over a wider range with 1b being the most potent at 0.074 nM. Most of the compounds exhibited low to moderate selectivity (1- to 40-fold) for the 5-HT2A receptor in the binding assays, although one compound 6b showed an impressive 100-fold selectivity for the 5-HT2A receptor. In the functional assay, selectivity was generally higher with 1b being more than 400-fold selective for the 5-HT2A receptor. PMID:24397362
Synaptic Neurotransmitter-Gated Receptors
Smart, Trevor G.; Paoletti, Pierre
2012-01-01
Since the discovery of the major excitatory and inhibitory neurotransmitters and their receptors in the brain, many have deliberated over their likely structures and how these may relate to function. This was initially satisfied by the determination of the first amino acid sequences of the Cys-loop receptors that recognized acetylcholine, serotonin, GABA, and glycine, followed later by similar determinations for the glutamate receptors, comprising non-NMDA and NMDA subtypes. The last decade has seen a rapid advance resulting in the first structures of Cys-loop receptors, related bacterial and molluscan homologs, and glutamate receptors, determined down to atomic resolution. This now provides a basis for determining not just the complete structures of these important receptor classes, but also for understanding how various domains and residues interact during agonist binding, receptor activation, and channel opening, including allosteric modulation. This article reviews our current understanding of these mechanisms for the Cys-loop and glutamate receptor families. PMID:22233560
Gahbauer, Stefan; Böckmann, Rainer A.
2016-01-01
The dimerization or even oligomerization of G protein coupled receptors (GPCRs) causes ongoing, controversial debates about its functional role and the coupled biophysical, biochemical or biomedical implications. A continously growing number of studies hints to a relation between oligomerization and function of GPCRs and strengthens the assumption that receptor assembly plays a key role in the regulation of protein function. Additionally, progress in the structural analysis of GPCR-G protein and GPCR-ligand interactions allows to distinguish between actively functional and non-signaling complexes. Recent findings further suggest that the surrounding membrane, i.e., its lipid composition may modulate the preferred dimerization interface and as a result the abundance of distinct dimeric conformations. In this review, the association of GPCRs and the role of the membrane in oligomerization will be discussed. An overview of the different reported oligomeric interfaces is provided and their capability for signaling discussed. The currently available data is summarized with regard to the formation of GPCR oligomers, their structures and dependency on the membrane microenvironment as well as the coupling of oligomerization to receptor function. PMID:27826255
Molecular and functional properties of P2X receptors--recent progress and persisting challenges.
Kaczmarek-Hájek, Karina; Lörinczi, Eva; Hausmann, Ralf; Nicke, Annette
2012-09-01
ATP-gated P2X receptors are trimeric ion channels that assemble as homo- or heteromers from seven cloned subunits. Transcripts and/or proteins of P2X subunits have been found in most, if not all, mammalian tissues and are being discovered in an increasing number of non-vertebrates. Both the first crystal structure of a P2X receptor and the generation of knockout (KO) mice for five of the seven cloned subtypes greatly advanced our understanding of their molecular and physiological function and their validation as drug targets. This review summarizes the current understanding of the structure and function of P2X receptors and gives an update on recent developments in the search for P2X subtype-selective ligands. It also provides an overview about the current knowledge of the regulation and modulation of P2X receptors on the cellular level and finally on their physiological roles as inferred from studies on KO mice.
Structural basis for selectivity and diversity in angiotensin II receptors
Zhang, Haitao; Han, Gye Won; Batyuk, Alexander; ...
2017-04-20
The angiotensin II receptors AT 1R and AT 2R serve as key components of the renin–angiotensin–aldosterone system. AT 1R has a central role in the regulation of blood pressure, but the function of AT 2R is unclear and it has a variety of reported effects. To identify the mechanisms that underlie the differences in function and ligand selectivity between these receptors, here we report crystal structures of human AT 2R bound to an AT 2R-selective ligand and to an AT 1R/AT 2R dual ligand, capturing the receptor in an active-like conformation. Unexpectedly, helix VIII was found in a non-canonical position,more » stabilizing the active-like state, but at the same time preventing the recruitment of G proteins or β-arrestins, in agreement with the lack of signalling responses in standard cellular assays. Structure–activity relationship, docking and mutagenesis studies revealed the crucial interactions for ligand binding and selectivity. Finally, our results thus provide insights into the structural basis of the distinct functions of the angiotensin receptors, and may guide the design of new selective ligands.« less
Structural basis for selectivity and diversity in angiotensin II receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Haitao; Han, Gye Won; Batyuk, Alexander
The angiotensin II receptors AT 1R and AT 2R serve as key components of the renin–angiotensin–aldosterone system. AT 1R has a central role in the regulation of blood pressure, but the function of AT 2R is unclear and it has a variety of reported effects. To identify the mechanisms that underlie the differences in function and ligand selectivity between these receptors, here we report crystal structures of human AT 2R bound to an AT 2R-selective ligand and to an AT 1R/AT 2R dual ligand, capturing the receptor in an active-like conformation. Unexpectedly, helix VIII was found in a non-canonical position,more » stabilizing the active-like state, but at the same time preventing the recruitment of G proteins or β-arrestins, in agreement with the lack of signalling responses in standard cellular assays. Structure–activity relationship, docking and mutagenesis studies revealed the crucial interactions for ligand binding and selectivity. Finally, our results thus provide insights into the structural basis of the distinct functions of the angiotensin receptors, and may guide the design of new selective ligands.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Zhijie; Chakraborty, Sayan; Xu, Guozhou
Tracheary Element Differentiation Inhibitory Factor (TDIF) belongs to the family of post-translationally modified CLE (CLAVATA3/embryo surrounding region (ESR)-related) peptide hormones that control root growth and define the delicate balance between stem cell proliferation and differentiation in SAM (shoot apical meristem) or RAM (root apical meristem). In Arabidopsis, Tracheary Element Differentiation Inhibitory Factor Receptor (TDR) and its ligand TDIF signaling pathway is involved in the regulation of procambial cell proliferation and inhibiting its differentiation into xylem cells. Here we present the crystal structures of the extracellular domains (ECD) of TDR alone and in complex with its ligand TDIF resolved at 2.65more » Åand 2.75 Å respectively. These structures provide insights about the ligand perception and specific interactions between the CLE peptides and their cognate receptors. Our in vitro biochemical studies indicate that the interactions between the ligands and the receptors at the C-terminal anchoring site provide conserved binding. While the binding interactions occurring at the N-terminal anchoring site dictate differential binding specificities between different ligands and receptors. Our studies will open different unknown avenues of TDR-TDIF signaling pathways that will enhance our knowledge in this field highlighting the receptor ligand interaction, receptor activation, signaling network, modes of action and will serve as a structure function relationship model between the ligand and the receptor for various similar leucine-rich repeat receptor-like kinases (LRR-RLKs).« less
Evolution of hormone signaling in elasmobranchs by exploitation of promiscuous receptors.
Carroll, Sean Michael; Bridgham, Jamie T; Thornton, Joseph W
2008-12-01
Specific interactions among proteins, nucleic acids, and metabolites drive virtually all cellular functions and underlie phenotypic complexity and diversity. Despite the fundamental importance of interactions, the mechanisms and dynamics by which they evolve are poorly understood. Here we describe novel interactions between a lineage-specific hormone and its receptors in elasmobranchs, a subclass of cartilaginous fishes, and infer how these associations evolved using phylogenetic and protein structural analyses. The hormone 1alpha-hydroxycorticosterone (1alpha-B) is a physiologically important steroid synthesized only in elasmobranchs. We show that 1alpha-B modulates gene expression in vitro by activating two paralogous intracellular transcription factors, the mineralocorticoid receptor (MR) and glucocorticoid receptor (GR), in the little skate Leucoraja erinacea; MR serves as a high-sensitivity and GR as a low-sensitivity receptor. Using functional analysis of extant and resurrected ancestral proteins, we show that receptor sensitivity to 1alpha-B evolved millions of years before the hormone itself evolved. The 1alpha-B differs from more ancient corticosteroids only by the addition of a hydroxyl group; the three-dimensional structure of the ancestral receptor shows that the ligand pocket contained ample unoccupied space to accommodate this moiety. Our findings indicate that the interactions between 1alpha-B and elasmobranch GR and MR proteins evolved by molecular exploitation: a novel hormone recruited into new functional partnerships two ancient receptors that had previously interacted with other ligands. The ancestral receptor's promiscuous capacity to fortuitously bind compounds that are slight structural variants of its original ligands set the stage for the evolution of this new interaction.
Hydrogen exchange mass spectrometry of functional membrane-bound chemotaxis receptor complexes.
Koshy, Seena S; Eyles, Stephen J; Weis, Robert M; Thompson, Lynmarie K
2013-12-10
The transmembrane signaling mechanism of bacterial chemotaxis receptors is thought to involve changes in receptor conformation and dynamics. The receptors function in ternary complexes with two other proteins, CheA and CheW, that form extended membrane-bound arrays. Previous studies have shown that attractant binding induces a small (∼2 Å) piston displacement of one helix of the periplasmic and transmembrane domains toward the cytoplasm, but it is not clear how this signal propagates through the cytoplasmic domain to control the kinase activity of the CheA bound at the membrane-distal tip, nearly 200 Å away. The cytoplasmic domain has been shown to be highly dynamic, which raises the question of how a small piston motion could propagate through a dynamic domain to control CheA kinase activity. To address this, we have developed a method for measuring dynamics of the receptor cytoplasmic fragment (CF) in functional complexes with CheA and CheW. Hydrogen-deuterium exchange mass spectrometry (HDX-MS) measurements of global exchange of the CF demonstrate that the CF exhibits significantly slower exchange in functional complexes than in solution. Because the exchange rates in functional complexes are comparable to those of other proteins with similar structures, the CF appears to be a well-structured protein within these complexes, which is compatible with its role in propagating a signal that appears to be a tiny conformational change in the periplasmic and transmembrane domains of the receptor. We also demonstrate the feasibility of this protocol for local exchange measurements by incorporating a pepsin digest step to produce peptides with 87% sequence coverage and only 20% back exchange. This method extends HDX-MS to membrane-bound functional complexes without detergents that may perturb the stability or structure of the system.
Hydrogen Exchange Mass Spectrometry of Functional Membrane-bound Chemotaxis Receptor Complexes
Koshy, Seena S.; Eyles, Stephen J.; Weis, Robert M.; Thompson, Lynmarie K.
2014-01-01
The transmembrane signaling mechanism of bacterial chemotaxis receptors is thought to involve changes in receptor conformation and dynamics. The receptors function in ternary complexes with two other proteins, CheA and CheW, that form extended membrane-bound arrays. Previous studies have shown that attractant binding induces a small (~2 Å) piston displacement of one helix of the periplasmic and transmembrane domains towards the cytoplasm, but it is not clear how this signal propagates through the cytoplasmic domain to control the kinase activity of the CheA bound at the membrane-distal tip, nearly 200 Å away. The cytoplasmic domain has been shown to be highly dynamic, which raises the question of how a small piston motion could propagate through a dynamic domain to control CheA kinase activity. To address this, we have developed a method for measuring dynamics of the receptor cytoplasmic fragment (CF) in functional complexes with CheA and CheW. Hydrogen exchange mass spectrometry (HDX-MS) measurements of global exchange of CF demonstrate that CF exhibits significantly slower exchange in functional complexes than in solution. Since the exchange rates in functional complexes are comparable to that of other proteins of similar structure, the CF appears to be a well-structured protein within these complexes, which is compatible with its role in propagating a signal that appears to be a tiny conformational change in the periplasmic and transmembrane domains of the receptor. We also demonstrate the feasibility of this protocol for local exchange measurements, by incorporating a pepsin digest step to produce peptides with 87% sequence coverage and only 20% back exchange. This method extends HDX-MS to membrane-bound functional complexes without detergents that may perturb the stability or structure of the system. PMID:24274333
Spatial Frequency Selectivity Is Impaired in Dopamine D2 Receptor Knockout Mice
Souza, Bruno Oliveira Ferreira; Abou Rjeili, Mira; Quintana, Clémentine; Beaulieu, Jean M.; Casanova, Christian
2018-01-01
Dopamine is a neurotransmitter implicated in several brain functions, including vision. In the present study, we investigated the impacts of the lack of D2 dopamine receptors on the structure and function of the primary visual cortex (V1) of D2-KO mice using optical imaging of intrinsic signals. Retinotopic maps were generated in order to measure anatomo-functional parameters such as V1 shape, cortical magnification factor, scatter, and ocular dominance. Contrast sensitivity and spatial frequency selectivity (SF) functions were computed from responses to drifting gratings. When compared to control mice, none of the parameters of the retinotopic maps were affected by D2 receptor loss of function. While the contrast sensitivity function of D2-KO mice did not differ from their wild-type counterparts, SF selectivity function was significantly affected as the optimal SF and the high cut-off frequency (p < 0.01) were higher in D2-KO than in WT mice. These findings show that the lack of function of D2 dopamine receptors had no influence on cortical structure whereas it had a significant impact on the spatial frequency selectivity and high cut-off. Taken together, our results suggest that D2 receptors play a specific role on the processing of spatial features in early visual cortex while they do not seem to participate in its development. PMID:29379422
NASA Technical Reports Server (NTRS)
Vinnikov, Y. A.; Gazenko, O. G.; Titova, L. K.; Bronshteyn, A. A.; Govardovskiy, V. I.; Pevzner, R. A.; Gribakin, G. G.; Aronova, M. Z.; Kharkeyevich, T. A.; Tsirulis, T. P.
1978-01-01
The vestibular apparatus was investigated in rats subjected to weightlessness for 19.5 days. The vestibular apparatus was removed and its sections were fixed in a glutaraldehyde solution for investigation by light and electron microscopes. Structural and functional charges were noted in the otolith portions of the ear, with the otolith particles clinging to the utricular receptor surface and with the peripheral arrangement of the nucleolus in the nuclei of the receptor cells. It is possible that increased edema of the vestibular tissue resulted in the destruction of some receptor cells and in changes in the form and structure of the otolith. In the horizontal crista, the capula was separated.
Reprogramming cellular functions with engineered membrane proteins.
Arber, Caroline; Young, Melvin; Barth, Patrick
2017-10-01
Taking inspiration from Nature, synthetic biology utilizes and modifies biological components to expand the range of biological functions for engineering new practical devices and therapeutics. While early breakthroughs mainly concerned the design of gene circuits, recent efforts have focused on engineering signaling pathways to reprogram cellular functions. Since signal transduction across cell membranes initiates and controls intracellular signaling, membrane receptors have been targeted by diverse protein engineering approaches despite limited mechanistic understanding of their function. The modular architecture of several receptor families has enabled the empirical construction of chimeric receptors combining domains from distinct native receptors which have found successful immunotherapeutic applications. Meanwhile, progress in membrane protein structure determination, computational modeling and rational design promise to foster the engineering of a broader range of membrane receptor functions. Marrying empirical and rational membrane protein engineering approaches should enable the reprogramming of cells with widely diverse fine-tuned functions. Copyright © 2017 Elsevier Ltd. All rights reserved.
Functional somatostatin receptors on a rat pancreatic acinar cell line
DOE Office of Scientific and Technical Information (OSTI.GOV)
Viguerie, N.; Tahiri-Jouti, N.; Esteve, J.P.
1988-07-01
Somatostatin receptors from a rat pancreatic acinar cell line, AR4-2J, were characterized biochemically, structurally, and functionally. Binding of {sup 125}I-(Tyr{sup 11})Somatostatin to AR4-2J cells was saturable, exhibiting a single class of high-affinity binding sites with a maximal binding capacity of 258 {plus minus} 20 fmol/10{sup 6} cells. Somatostatin receptor structure was analyzed by covalently cross-linking {sup 125}I-(Tyr{sup 11})somatostatin to its plasma membrane receptors. Gel electrophoresis and autoradiography of cross-linked proteins revealed a peptide containing the somatostatin receptor. Somatostatin inhibited vasoactive intestinal peptide (VIP)-stimulated adenosine 3{prime},5{prime}-cyclic monophosphate (cAMP) formation in a dose-dependent manner. The concentration of somatostatin that caused half-maximal inhibitionmore » of cAMP formation was close to the receptor affinity for somatostatin. Pertussis toxin pretreatment of AR4-2J cells prevented somatostatin inhibition of VIP-stimulated cAMP formation as well as somatostatin binding. The authors conclude that AR4-2J cells exhibit functional somatostatin receptors that retain both specificity and affinity of the pancreatic acinar cell somatostatin receptors and act via the pertussis toxin-sensitive guanine nucleotide-binding protein N{sub i} to inhibit adenylate cyclase.« less
Structural determinants of arrestin functions.
Gurevich, Vsevolod V; Gurevich, Eugenia V
2013-01-01
Arrestins are a small protein family with only four members in mammals. Arrestins demonstrate an amazing versatility, interacting with hundreds of different G protein-coupled receptor (GPCR) subtypes, numerous nonreceptor signaling proteins, and components of the internalization machinery, as well as cytoskeletal elements, including regular microtubules and centrosomes. Here, we focus on the structural determinants that mediate various arrestin functions. The receptor-binding elements in arrestins were mapped fairly comprehensively, which set the stage for the construction of mutants targeting particular GPCRs. The elements engaged by other binding partners are only now being elucidated and in most cases we have more questions than answers. Interestingly, even very limited and imprecise identification of structural requirements for the interaction with very few other proteins has enabled the development of signaling-biased arrestin mutants. More comprehensive understanding of the structural underpinning of different arrestin functions will pave the way for the construction of arrestins that can link the receptor we want to the signaling pathway of our choosing. Copyright © 2013 Elsevier Inc. All rights reserved.
Structural Determinants of Arrestin Functions
Gurevich, Vsevolod V.; Gurevich, Eugenia V.
2015-01-01
Arrestins are a small protein family with only four members in mammals. Arrestins demonstrate an amazing versatility, interacting with hundreds of different G protein-coupled receptor (GPCR) subtypes, numerous nonreceptor signaling proteins, and components of the internalization machinery, as well as cytoskeletal elements, including regular microtubules and centrosomes. Here, we focus on the structural determinants that mediate various arrestin functions. The receptor-binding elements in arrestins were mapped fairly comprehensively, which set the stage for the construction of mutants targeting particular GPCRs. The elements engaged by other binding partners are only now being elucidated and in most cases we have more questions than answers. Interestingly, even very limited and imprecise identification of structural requirements for the interaction with very few other proteins has enabled the development of signaling-biased arrestin mutants. More comprehensive understanding of the structural underpinning of different arrestin functions will pave the way for the construction of arrestins that can link the receptor we want to the signaling pathway of our choosing. PMID:23764050
The Janus Kinase (JAK) FERM and SH2 Domains: Bringing Specificity to JAK-Receptor Interactions.
Ferrao, Ryan; Lupardus, Patrick J
2017-01-01
The Janus kinases (JAKs) are non-receptor tyrosine kinases essential for signaling in response to cytokines and interferons and thereby control many essential functions in growth, development, and immune regulation. JAKs are unique among tyrosine kinases for their constitutive yet non-covalent association with class I and II cytokine receptors, which upon cytokine binding bring together two JAKs to create an active signaling complex. JAK association with cytokine receptors is facilitated by N-terminal FERM and SH2 domains, both of which are classical mediators of peptide interactions. Together, the JAK FERM and SH2 domains mediate a bipartite interaction with two distinct receptor peptide motifs, the proline-rich "Box1" and hydrophobic "Box2," which are present in the intracellular domain of cytokine receptors. While the general sidechain chemistry of Box1 and Box2 peptides is conserved between receptors, they share very weak primary sequence homology, making it impossible to posit why certain JAKs preferentially interact with and signal through specific subsets of cytokine receptors. Here, we review the structure and function of the JAK FERM and SH2 domains in light of several recent studies that reveal their atomic structure and elucidate interaction mechanisms with both the Box1 and Box2 receptor motifs. These crystal structures demonstrate how evolution has repurposed the JAK FERM and SH2 domains into a receptor-binding module that facilitates interactions with multiple receptors possessing diverse primary sequences.
Functional Annotation of Ion Channel Structures by Molecular Simulation.
Trick, Jemma L; Chelvaniththilan, Sivapalan; Klesse, Gianni; Aryal, Prafulla; Wallace, E Jayne; Tucker, Stephen J; Sansom, Mark S P
2016-12-06
Ion channels play key roles in cell membranes, and recent advances are yielding an increasing number of structures. However, their functional relevance is often unclear and better tools are required for their functional annotation. In sub-nanometer pores such as ion channels, hydrophobic gating has been shown to promote dewetting to produce a functionally closed (i.e., non-conductive) state. Using the serotonin receptor (5-HT 3 R) structure as an example, we demonstrate the use of molecular dynamics to aid the functional annotation of channel structures via simulation of the behavior of water within the pore. Three increasingly complex simulation analyses are described: water equilibrium densities; single-ion free-energy profiles; and computational electrophysiology. All three approaches correctly predict the 5-HT 3 R crystal structure to represent a functionally closed (i.e., non-conductive) state. We also illustrate the application of water equilibrium density simulations to annotate different conformational states of a glycine receptor. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Panayotatos, N; Radziejewska, E; Acheson, A; Somogyi, R; Thadani, A; Hendrickson, W A; McDonald, N Q
1995-06-09
By rational mutagenesis, receptor-specific functional analysis, and visualization of complex formation in solution, we identified individual amino acid side chains involved specifically in the interaction of ciliary neurotrophic factor (CNTF) with CNTFR alpha and not with the beta-components, gp130 and LIFR. In the crystal structure, the side chains of these residues, which are located in helix A, the AB loop, helix B, and helix D, are surface accessible and are clustered in space, thus constituting an epitope for CNTFR alpha. By the same analysis, a partial epitope for gp130 was also identified on the surface of helix A that faces away from the alpha-epitope. Superposition of the CNTF and growth hormone structures showed that the location of these epitopes on CNTF is analogous to the location of the first and second receptor epitopes on the surface of growth hormone. Further comparison with proposed binding sites for alpha- and beta-receptors on interleukin-6 and leukemia inhibitory factor indicated that this epitope topology is conserved among helical cytokines. In each case, epitope I is utilized by the specificity-conferring component, whereas epitopes II and III are used by accessory components. Thus, in addition to a common fold, helical cytokines share a conserved order of receptor epitopes that is function related.
Gilliland, C. Taylor; Salanga, Catherina L.; Kawamura, Tetsuya; Trejo, JoAnn; Handel, Tracy M.
2013-01-01
Activation of G protein-coupled receptors by their associated ligands has been extensively studied, and increasing structural information about the molecular mechanisms underlying ligand-dependent receptor activation is beginning to emerge with the recent expansion in GPCR crystal structures. However, some GPCRs are also able to adopt active conformations in the absence of agonist binding that result in the initiation of signal transduction and receptor down-modulation. In this report, we show that the CC-type chemokine receptor 1 (CCR1) exhibits significant constitutive activity leading to a variety of cellular responses. CCR1 expression is sufficient to induce inhibition of cAMP formation, increased F-actin content, and basal migration of human and murine leukocytes. The constitutive activity leads to basal phosphorylation of the receptor, recruitment of β-arrestin-2, and subsequent receptor internalization. CCR1 concurrently engages Gαi and β-arrestin-2 in a multiprotein complex, which may be accommodated by homo-oligomerization or receptor clustering. The data suggest the presence of two functional states for CCR1; whereas receptor coupled to Gαi functions as a canonical GPCR, albeit with high constitutive activity, the CCR1·β-arrestin-2 complex is required for G protein-independent constitutive receptor internalization. The pertussis toxin-insensitive uptake of chemokine by the receptor suggests that the CCR1·β-arrestin-2 complex may be related to a potential scavenging function of the receptor, which may be important for maintenance of chemokine gradients and receptor responsiveness in complex fields of chemokines during inflammation. PMID:24056371
Crystal structures of the M 1 and M 4 muscarinic acetylcholine receptors
Thal, David M.; Sun, Bingfa; Feng, Dan; ...
2016-03-09
Muscarinic M1–M5 acetylcholine receptors are G-protein-coupled receptors that regulate many vital functions of the central and peripheral nervous systems. In particular, the M1 and M4 receptor subtypes have emerged as attractive drug targets for treatments of neurological disorders, such as Alzheimer’s disease and schizophrenia, but the high conservation of the acetylcholine-binding pocket has spurred current research into targeting allosteric sites on these receptors. In this paper, we report the crystal structures of the M1 and M4 muscarinic receptors bound to the inverse agonist, tiotropium. Comparison of these structures with each other, as well as with the previously reported M2 andmore » M3 receptor structures, reveals differences in the orthosteric and allosteric binding sites that contribute to a role in drug selectivity at this important receptor family. Finally, we also report identification of a cluster of residues that form a network linking the orthosteric and allosteric sites of the M4 receptor, which provides new insight into how allosteric modulation may be transmitted between the two spatially distinct domains.« less
Crystal structures of the M 1 and M 4 muscarinic acetylcholine receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thal, David M.; Sun, Bingfa; Feng, Dan
Muscarinic M1–M5 acetylcholine receptors are G-protein-coupled receptors that regulate many vital functions of the central and peripheral nervous systems. In particular, the M1 and M4 receptor subtypes have emerged as attractive drug targets for treatments of neurological disorders, such as Alzheimer’s disease and schizophrenia, but the high conservation of the acetylcholine-binding pocket has spurred current research into targeting allosteric sites on these receptors. In this paper, we report the crystal structures of the M1 and M4 muscarinic receptors bound to the inverse agonist, tiotropium. Comparison of these structures with each other, as well as with the previously reported M2 andmore » M3 receptor structures, reveals differences in the orthosteric and allosteric binding sites that contribute to a role in drug selectivity at this important receptor family. Finally, we also report identification of a cluster of residues that form a network linking the orthosteric and allosteric sites of the M4 receptor, which provides new insight into how allosteric modulation may be transmitted between the two spatially distinct domains.« less
Molecular modeling on structure-function analysis of human progesterone receptor modulators.
Pal, Ria; Islam, Md Ataul; Hossain, Tabassum; Saha, Achintya
2011-01-01
Considering the significance of progesterone receptor (PR) modulators, the present study is explored to envisage the biophoric signals for binding to selective PR subtype-A using ligand-based quantitative structure activity relationship (QSAR) and pharmacophore space modeling studies on nonsteroidal substituted quinoline and cyclocymopol monomethyl ether derivatives. Consensus QSAR models (Training set (Tr): n(Tr)=100, R(2) (pred)=0.702; test set (Ts): n(Ts)=30, R(2) (pred)=0.705, R(2) (m)=0.635; validation set (Vs): n(Vs)=40, R(2) (pred)=0.715, R(2) (m)=0.680) suggest that molecular topology, atomic polarizability and electronegativity, atomic mass and van der Waals volume of the ligands have influence on the presence of functional atoms (F, Cl, N and O) and consequently contribute significant relations on ligand binding affinity. Receptor independent space modeling study (Tr: n(Tr)=26, Q(2)=0.927; Ts: n(Ts)=60, R(2) (pred)=0.613, R(2) (m)=0.545; Vs: n(Vs)=84, R(2) (pred)=0.611, R(2) (m)=0.507) indicates the importance of aromatic ring, hydrogen bond donor, molecular hydrophobicity and steric influence for receptor binding. The structure-function characterization is adjudged with the receptor-based docking study, explaining the significance of the mapped molecular attributes for ligand-receptor interaction in the catalytic cleft of PR-A.
A modern ionotropic glutamate receptor with a K(+) selectivity signature sequence.
Janovjak, H; Sandoz, G; Isacoff, E Y
2011-01-01
Glutamate is the major excitatory neurotransmitter in the mammalian central nervous system and gates non-selective cation channels. The origins of glutamate receptors are not well understood as they differ structurally and functionally from simple bacterial ligand-gated ion channels. Here we report the discovery of an ionotropic glutamate receptor that combines the typical eukaryotic domain architecture with the 'TXVGYG' signature sequence of the selectivity filter found in K(+) channels. This receptor exhibits functional properties intermediate between bacterial and eukaryotic glutamate-gated ion channels, suggesting a link in the evolution of ionotropic glutamate receptors.
Structure-informed insights for NLR functioning in plant immunity.
Sukarta, Octavina C A; Slootweg, Erik J; Goverse, Aska
2016-08-01
To respond to foreign invaders, plants have evolved a cell autonomous multilayered immune system consisting of extra- and intracellular immune receptors. Nucleotide binding and oligomerization domain (NOD)-like receptors (NLRs) mediate recognition of pathogen effectors inside the cell and trigger a host specific defense response, often involving controlled cell death. NLRs consist of a central nucleotide-binding domain, which is flanked by an N-terminal CC or TIR domain and a C-terminal leucine-rich repeat domain (LRR). These multidomain proteins function as a molecular switch and their activity is tightly controlled by intra and inter-molecular interactions. In contrast to metazoan NLRs, the structural basis underlying NLR functioning as a pathogen sensor and activator of immune responses in plants is largely unknown. However, the first crystal structures of a number of plant NLR domains were recently obtained. In addition, biochemical and structure-informed analyses revealed novel insights in the cooperation between NLR domains and the formation of pre- and post activation complexes, including the coordinated activity of NLR pairs as pathogen sensor and executor of immune responses. Moreover, the discovery of novel integrated domains underscores the structural diversity of NLRs and provides alternative models for how these immune receptors function in plants. In this review, we will highlight these recent advances to provide novel insights in the structural, biochemical and molecular aspects involved in plant NLR functioning. Copyright © 2016 Elsevier Ltd. All rights reserved.
Is the isolated ligand binding domain a good model of the domain in the native receptor?
Deming, Dustin; Cheng, Qing; Jayaraman, Vasanthi
2003-05-16
Numerous studies have used the atomic level structure of the isolated ligand binding domain of the glutamate receptor to elucidate the agonist-induced activation and desensitization processes in this group of proteins. However, no study has demonstrated the structural equivalence of the isolated ligand binding fragments and the protein in the native receptor. In this report, using visible absorption spectroscopy we show that the electronic environment of the antagonist 6-cyano-7-nitro-2,3-dihydroxyquinoxaline is identical for the isolated protein and the native glutamate receptors expressed in cells. Our results hence establish that the local structure of the ligand binding site is the same in the two proteins and validate the detailed structure-function relationships that have been developed based on a comparison of the structure of the isolated ligand binding domain and electrophysiological consequences in the native receptor.
NASA Astrophysics Data System (ADS)
Jójárt, Balázs; Martinek, Tamás A.; Márki, Árpád
2005-05-01
Molecular docking and 3D-QSAR studies were performed to determine the binding mode for a series of benzoxazine oxytocin antagonists taken from the literature. Structural hypotheses were generated by docking the most active molecule to the rigid receptor by means of AutoDock 3.05. The cluster analysis yielded seven possible binding conformations. These structures were refined by using constrained simulated annealing, and the further ligands were aligned in the refined receptor by molecular docking. A good correlation was found between the estimated Δ G bind and the p K i values for complex F. The Connolly-surface analysis, CoMFA and CoMSIA models q CoMFA 2 = 0.653, q CoMSA 2 = 0.630 and r pred,CoMFA 2 = 0.852 , r pred,CoMSIA 2 = 0.815) confirmed the scoring function results. The structural features of the receptor-ligand complex and the CoMFA and CoMSIA fields are in closely connected. These results suggest that receptor-ligand complex F is the most likely binding hypothesis for the studied benzoxazine analogs.
Structure of the Zinc-Bound Amino-Terminal Domain of the NMDA Receptor NR2B Subunit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karakas, E.; Simorowski, N; Furukawa, H
2009-01-01
N-methyl-D-aspartate (NMDA) receptors belong to the family of ionotropic glutamate receptors (iGluRs) that mediate the majority of fast excitatory synaptic transmission in the mammalian brain. One of the hallmarks for the function of NMDA receptors is that their ion channel activity is allosterically regulated by binding of modulator compounds to the extracellular amino-terminal domain (ATD) distinct from the L-glutamate-binding domain. The molecular basis for the ATD-mediated allosteric regulation has been enigmatic because of a complete lack of structural information on NMDA receptor ATDs. Here, we report the crystal structures of ATD from the NR2B NMDA receptor subunit in the zinc-freemore » and zinc-bound states. The structures reveal the overall clamshell-like architecture distinct from the non-NMDA receptor ATDs and molecular determinants for the zinc-binding site, ion-binding sites, and the architecture of the putative phenylethanolamine-binding site.« less
Crystal Structure of the Frizzled-Like Cysteine-Rich Domain of the Receptor Tyrosine Kinase MuSK
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stiegler, A.; Burden, S; Hubbard, S
Muscle-specific kinase (MuSK) is an essential receptor tyrosine kinase for the establishment and maintenance of the neuromuscular junction (NMJ). Activation of MuSK by agrin, a neuronally derived heparan-sulfate proteoglycan, and LRP4 (low-density lipoprotein receptor-related protein-4), the agrin receptor, leads to clustering of acetylcholine receptors on the postsynaptic side of the NMJ. The ectodomain of MuSK comprises three immunoglobulin-like domains and a cysteine-rich domain (Fz-CRD) related to those in Frizzled proteins, the receptors for Wnts. Here, we report the crystal structure of the MuSK Fz-CRD at 2.1 {angstrom} resolution. The structure reveals a five-disulfide-bridged domain similar to CRDs of Frizzled proteinsmore » but with a divergent C-terminal region. An asymmetric dimer present in the crystal structure implicates surface hydrophobic residues that may function in homotypic or heterotypic interactions to mediate co-clustering of MuSK, rapsyn, and acetylcholine receptors at the NMJ.« less
Solution Structure of the Soluble Receptor for Advanced Glycation End Products (sRAGE)*
Sárkány, Zsuzsa; Ikonen, Teemu P.; Ferreira-da-Silva, Frederico; Saraiva, Maria João; Svergun, Dmitri; Damas, Ana Margarida
2011-01-01
The receptor for advanced glycation end products (RAGE) is a multiligand cell surface receptor involved in various human diseases, as it binds to numerous molecules and proteins that modulate the activity of other proteins. Elucidating the three-dimensional structure of this receptor is therefore most important for understanding its function during activation and cellular signaling. The major alternative splice product of RAGE comprises its extracellular region that occurs as a soluble protein (sRAGE). Although the structures of sRAGE domains were available, their assembly into the functional full-length protein remained unknown. We observed that the protein has concentration-dependent oligomerization behavior, and this is also mediated by the presence of Ca2+ ions. Moreover, using synchrotron small angle x-ray scattering, the solution structure of human sRAGE was determined in the monomeric and dimeric forms. The model for the monomer displays a J-like shape, whereas the dimer is formed through the association of the two N-terminal domains and has an elongated structure. These results provide insights into the assembly of the RAGE homodimer, which is essential for signal transduction, and the sRAGE:RAGE heterodimer that leads to blockage of the receptor signaling, paving the way for the design of therapeutic strategies for a large number of different pathologies. PMID:21865159
EXPRESSION, PURIFICATION AND IN VITRO FUNCTIONAL RECONSTITUTION OF THE CHEMOKINE RECEPTOR CCR1
Allen, Samantha J.; Ribeiro, Sofia; Horuk, Richard; Handel, Tracy M.
2009-01-01
Chemokine receptors are a specific class of G protein-coupled receptors (GPCRs) that control cell migration associated with routine immune surveillance, inflammation and development. In addition to their roles in normal physiology, these receptors and their ligands are involved in a large number of inflammatory diseases, cancer and AIDS, making them prime therapeutic targets in the pharmaceutical industry. Like other GPCRs, a significant obstacle in determining structures and characterizing mechanisms of activation has been the difficulty in obtaining high levels of pure, functional receptor. Here we describe a systematic effort to express the chemokine receptor CCR1 in mammalian cells, and to purify and reconstitute it in functional form. The highest expression levels were obtained using an inducible HEK293 system. The receptor was purified using a combination of N- (StrepII or Hemagglutinin) and C-terminal (His8) affinity tags. Function was assessed by ligand binding using a novel fluorescence polarization assay with fluorescein-labeled chemokine. A strict dependence of function on the detergent composition was observed, as solubilization of CCR1 in n-dodecyl-β-D-maltopyranoside/cholesteryl hemisuccinate yielded functional receptor with a Kd of 21 nM for the chemokine CCL14, whereas it was non-functional in phosphocholine detergents. Differences in function were observed despite the fact that both these detergent types maintained the receptor in a state characterized by monomers and small oligomers, but not large aggregates. While optimization is still warranted, yields of ~ 0.1–0.2mgs of pure functional receptor per 109 cells will permit biophysical studies of this medically important receptor. PMID:19275940
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Hua; Chen, Li-Mei; Carney, Paul J.
2012-02-21
Human infections with subtype H7 avian influenza viruses have been reported as early as 1979. In 1996, a genetically stable 24-nucleotide deletion emerged in North American H7 influenza virus hemagglutinins, resulting in an eight amino acid deletion in the receptor-binding site. The continuous circulation of these viruses in live bird markets, as well as its documented ability to infect humans, raises the question of how these viruses achieve structural stability and functionality. Here we report a detailed molecular analysis of the receptor binding site of the North American lineage subtype H7N2 virus A/New York/107/2003 (NY107), including complexes with an avianmore » receptor analog (3'-sialyl-N-acetyllactosamine, 3'SLN) and two human receptor analogs (6'-sialyl-N-acetyllactosamine, 6'SLN; sialyllacto-N-tetraose b, LSTb). Structural results suggest a novel mechanism by which residues Arg220 and Arg229 (H3 numbering) are used to compensate for the deletion of the 220-loop and form interactions with the receptor analogs. Glycan microarray results reveal that NY107 maintains an avian-type ({alpha}2-3) receptor binding profile, with only moderate binding to human-type ({alpha}2-6) receptor. Thus despite its dramatically altered receptor binding site, this HA maintains functionality and confirms a need for continued influenza virus surveillance of avian and other animal reservoirs to define their zoonotic potential.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yuan, Ping; Thompson, Thomas B.; Wurzburg, Beth A.
2010-03-08
The paramyxovirus hemagglutinin-neuraminidase (HN) functions in virus attachment to cells, cleavage of sialic acid from oligosaccharides, and stimulating membrane fusion during virus entry into cells. The structural basis for these diverse functions remains to be fully understood. We report the crystal structures of the parainfluenza virus 5 (SV5) HN and its complexes with sialic acid, the inhibitor DANA, and the receptor sialyllactose. SV5 HN shares common structural features with HN of Newcastle disease virus (NDV) and human parainfluenza 3 (HPIV3), but unlike the previously determined HN structures, the SV5 HN forms a tetramer in solution, which is thought to bemore » the physiological oligomer. The sialyllactose complex reveals intact receptor within the active site, but no major conformational changes in the protein. The SV5 HN structures do not support previously proposed models for HN action in membrane fusion and suggest alternative mechanisms by which HN may promote virus entry into cells.« less
Greger, Ingo H; Watson, Jake F; Cull-Candy, Stuart G
2017-05-17
AMPA receptors (AMPARs) are tetrameric ion channels that together with other ionotropic glutamate receptors (iGluRs), the NMDA and kainate receptors, mediate a majority of excitatory neurotransmission in the central nervous system. Whereas NMDA receptors gate channels with slow kinetics, responsible primarily for generating long-term synaptic potentiation and depression, AMPARs are the main fast transduction elements at synapses and are critical for the expression of plasticity. The kinetic and conductance properties of AMPARs are laid down during their biogenesis and are regulated by post-transcriptional RNA editing, splice variation, post-translational modification, and subunit composition. Furthermore, AMPAR assembly, trafficking, and functional heterogeneity depends on a large repertoire of auxiliary subunits-a feature that is particularly striking for this type of iGluR. Here, we discuss how the subunit structure, stoichiometry, and auxiliary subunits generate a heterogeneous plethora of receptors, each tailored to fulfill a vital role in fast synaptic signaling and plasticity. Copyright © 2017 Elsevier Inc. All rights reserved.
Gammadelta T cells: functional plasticity and heterogeneity.
Carding, Simon R; Egan, Paul J
2002-05-01
Gammadelta T cells remain an enigma. They are capable of generating more unique antigen receptors than alphabeta T cells and B cells combined, yet their repertoire of antigen receptors is dominated by specific subsets that recognize a limited number of antigens. A variety of sometimes conflicting effector functions have been ascribed to them, yet their biological function(s) remains unclear. On the basis of studies of gammadelta T cells in infectious and autoimmune diseases, we argue that gammadelta T cells perform different functions according to their tissue distribution, antigen-receptor structure and local microenvironment; we also discuss how and at what stage of the immune response they become activated.
Identification of COUP-TFII Orphan Nuclear Receptor as a Retinoic Acid-Activated Receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kruse, Schoen W; Suino-Powell, Kelly; Zhou, X Edward
2010-01-12
The chicken ovalbumin upstream promoter-transcription factors (COUP-TFI and II) make up the most conserved subfamily of nuclear receptors that play key roles in angiogenesis, neuronal development, organogenesis, cell fate determination, and metabolic homeostasis. Although the biological functions of COUP-TFs have been studied extensively, little is known of their structural features or aspects of ligand regulation. Here we report the ligand-free 1.48 {angstrom} crystal structure of the human COUP-TFII ligand-binding domain. The structure reveals an autorepressed conformation of the receptor, where helix {alpha}10 is bent into the ligand-binding pocket and the activation function-2 helix is folded into the cofactor binding site,more » thus preventing the recruitment of coactivators. In contrast, in multiple cell lines, COUP-TFII exhibits constitutive transcriptional activity, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, and ligand binding, substantially reduce the COUP-TFII transcriptional activity. Importantly, retinoid acids are able to promote COUP-TFII to recruit coactivators and activate a COUP-TF reporter construct. Although the concentration needed is higher than the physiological levels of retinoic acids, these findings demonstrate that COUP-TFII is a ligand-regulated nuclear receptor, in which ligands activate the receptor by releasing it from the autorepressed conformation.« less
Functional Validation of Heteromeric Kainate Receptor Models.
Paramo, Teresa; Brown, Patricia M G E; Musgaard, Maria; Bowie, Derek; Biggin, Philip C
2017-11-21
Kainate receptors require the presence of external ions for gating. Most work thus far has been performed on homomeric GluK2 but, in vivo, kainate receptors are likely heterotetramers. Agonists bind to the ligand-binding domain (LBD) which is arranged as a dimer of dimers as exemplified in homomeric structures, but no high-resolution structure currently exists of heteromeric kainate receptors. In a full-length heterotetramer, the LBDs could potentially be arranged either as a GluK2 homomer alongside a GluK5 homomer or as two GluK2/K5 heterodimers. We have constructed models of the LBD dimers based on the GluK2 LBD crystal structures and investigated their stability with molecular dynamics simulations. We have then used the models to make predictions about the functional behavior of the full-length GluK2/K5 receptor, which we confirmed via electrophysiological recordings. A key prediction and observation is that lithium ions bind to the dimer interface of GluK2/K5 heteromers and slow their desensitization. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
X-ray structures define human P2X3 receptor gating cycle and antagonist action
Mansoor, Steven E.; Lü, Wei; Oosterheert, Wout; Shekhar, Mrinal; Tajkhorshid, Emad; Gouaux, Eric
2016-01-01
Summary P2X receptors are trimeric, non-selective cation channels activated by ATP that play important roles in cardiovascular, neuronal and immune systems. Despite their central function in human physiology and as potential targets of therapeutic agents, there are no structures of human P2X receptors. Mechanisms of receptor desensitization and ion permeation, principles of antagonism, and complete structure of the pore-forming transmembrane domains remain unclear. We report x-ray crystal structures of human P2X3 receptor in apo/resting, agonist-bound/open-pore, agonist-bound/desensitized and antagonist-bound closed states. The open state structure harbors an intracellular motif we term the “cytoplasmic cap”, that stabilizes the open state of the ion channel pore and creates lateral, phospholipid-lined cytoplasmic fenestrations for water and ion egress. Competitive antagonists TNP-ATP and A-317491 stabilize the apo/resting state and reveal the interactions responsible for competitive inhibition. These structures illuminate the conformational rearrangements underpinning P2X receptor gating and provide a foundation for development of new pharmacologic agents. PMID:27626375
X-ray structures define human P2X(3) receptor gating cycle and antagonist action.
Mansoor, Steven E; Lü, Wei; Oosterheert, Wout; Shekhar, Mrinal; Tajkhorshid, Emad; Gouaux, Eric
2016-10-06
P2X receptors are trimeric, non-selective cation channels activated by ATP that have important roles in the cardiovascular, neuronal and immune systems. Despite their central function in human physiology and although they are potential targets of therapeutic agents, there are no structures of human P2X receptors. The mechanisms of receptor desensitization and ion permeation, principles of antagonism, and complete structures of the pore-forming transmembrane domains of these receptors remain unclear. Here we report X-ray crystal structures of the human P2X 3 receptor in apo/resting, agonist-bound/open-pore, agonist-bound/closed-pore/desensitized and antagonist-bound/closed states. The open state structure harbours an intracellular motif we term the 'cytoplasmic cap', which stabilizes the open state of the ion channel pore and creates lateral, phospholipid-lined cytoplasmic fenestrations for water and ion egress. The competitive antagonists TNP-ATP and A-317491 stabilize the apo/resting state and reveal the interactions responsible for competitive inhibition. These structures illuminate the conformational rearrangements that underlie P2X receptor gating and provide a foundation for the development of new pharmacological agents.
The Structure of the Mouse Serotonin 5-HT3 Receptor in Lipid Vesicles.
Kudryashev, Mikhail; Castaño-Díez, Daniel; Deluz, Cédric; Hassaine, Gherici; Grasso, Luigino; Graf-Meyer, Alexandra; Vogel, Horst; Stahlberg, Henning
2016-01-05
The function of membrane proteins is best understood if their structure in the lipid membrane is known. Here, we determined the structure of the mouse serotonin 5-HT3 receptor inserted in lipid bilayers to a resolution of 12 Å without stabilizing antibodies by cryo electron tomography and subtomogram averaging. The reconstruction reveals protein secondary structure elements in the transmembrane region, the extracellular pore, and the transmembrane channel pathway, showing an overall similarity to the available X-ray model of the truncated 5-HT3 receptor determined in the presence of a stabilizing nanobody. Structural analysis of the 5-HT3 receptor embedded in a lipid bilayer allowed the position of the membrane to be determined. Interactions between the densely packed receptors in lipids were visualized, revealing that the interactions were maintained by the short horizontal helices. In combination with methodological improvements, our approach enables the structural analysis of membrane proteins in response to voltage and ligand gating. Copyright © 2016 Elsevier Ltd. All rights reserved.
What Do We Know About NOD-Like Receptors in Plant Immunity?
Zhang, Xiaoxiao; Dodds, Peter N; Bernoux, Maud
2017-08-04
The first plant disease resistance (R) genes were identified and cloned more than two decades ago. Since then, many more R genes have been identified and characterized in numerous plant pathosystems. Most of these encode members of the large family of intracellular NLRs (NOD-like receptors), which also includes animal immune receptors. New discoveries in this expanding field of research provide new elements for our understanding of plant NLR function. But what do we know about plant NLR function today? Genetic, structural, and functional analyses have uncovered a number of commonalities and differences in pathogen recognition strategies as well as how NLRs are regulated and activate defense signaling, but many unknowns remain. This review gives an update on the latest discoveries and breakthroughs in this field, with an emphasis on structural findings and some comparison to animal NLRs, which can provide additional insights and paradigms in plant NLR function.
Functional kainate-selective glutamate receptors in cultured hippocampal neurons.
Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B
1993-12-15
Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors.
Functional kainate-selective glutamate receptors in cultured hippocampal neurons.
Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B
1993-01-01
Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors. PMID:7505445
NASA Astrophysics Data System (ADS)
Guerrero, Yadir A.; Bahmani, Baharak; Singh, Sheela P.; Vullev, Valentine I.; Kundra, Vikas; Anvari, Bahman
2015-10-01
Ovarian cancer remains the dominant cause of death due to malignancies of the female reproductive system. The capability to identify and remove all tumors during intraoperative procedures may ultimately reduce cancer recurrence, and lead to increased patient survival. The objective of this study is to investigate the effectiveness of an optical nano-structured system for targeted near infrared (NIR) imaging of ovarian cancer cells that over-express the human epidermal growth factor receptor 2 (HER2), an important biomarker associated with ovarian cancer. The nano-structured system is comprised of genome-depleted plant-infecting brome mosaic virus doped with NIR chromophore, indocyanine green, and functionalized at the surface by covalent attachment of monoclonal antibodies against the HER2 receptor. We use absorption and fluorescence spectroscopy, and dynamic light scattering to characterize the physical properties of the constructs. Using fluorescence imaging and flow cytometry, we demonstrate the effectiveness of these nano-structures for targeted NIR imaging of HER2 receptors in vitro. These functionalized nano-materials may provide a platform for NIR imaging of ovarian cancer.
Krieger, James; Lee, Ji Young; Greger, Ingo H; Bahar, Ivet
2018-02-23
Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that are key players in synaptic transmission and plasticity. They are composed of four subunits, each containing four functional domains, the quaternary packing and collective structural dynamics of which are important determinants of their molecular mechanism of function. With the explosion of structural studies on different members of the family, including the structures of activated open channels, the mechanisms of action of these central signaling machines are now being elucidated. We review the current state of computational studies on two major members of the family, AMPA and NMDA receptors, with focus on molecular simulations and elastic network model analyses that have provided insights into the coupled movements of extracellular and transmembrane domains. We describe the newly emerging mechanisms of activation, allosteric signaling and desensitization, as mainly a selective triggering of pre-existing soft motions, as deduced from computational models and analyses that leverage structural data on intact AMPA and NMDA receptors in different states. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Molecular Structures and Functional Relationships in Clostridial Neurotoxins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Swaminathan S.
2011-12-01
The seven serotypes of Clostridium botulinum neurotoxins (A-G) are the deadliest poison known to humans. They share significant sequence homology and hence possess similar structure-function relationships. Botulinum neurotoxins (BoNT) act via a four-step mechanism, viz., binding and internalization to neuronal cells, translocation of the catalytic domain into the cytosol and finally cleavage of one of the three soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNARE) causing blockage of neurotransmitter release leading to flaccid paralysis. Crystal structures of three holotoxins, BoNT/A, B and E, are available to date. Although the individual domains are remarkably similar, their domain organization is different. These structuresmore » have helped in correlating the structural and functional domains. This has led to the determination of structures of individual domains and combinations of them. Crystal structures of catalytic domains of all serotypes and several binding domains are now available. The catalytic domains are zinc endopeptidases and share significant sequence and structural homology. The active site architecture and the catalytic mechanism are similar although the binding mode of individual substrates may be different, dictating substrate specificity and peptide cleavage selectivity. Crystal structures of catalytic domains with substrate peptides provide clues to specificity and selectivity unique to BoNTs. Crystal structures of the receptor domain in complex with ganglioside or the protein receptor have provided information about the binding of botulinum neurotoxin to the neuronal cell. An overview of the structure-function relationship correlating the 3D structures with biochemical and biophysical data and how they can be used for structure-based drug discovery is presented here.« less
Yadav, Rajeev; Lu, H Peter
2018-03-28
The N-methyl-d-aspartate (NMDA) receptor ion-channel is activated by the binding of ligands, along with the application of action potential, important for synaptic transmission and memory functions. Despite substantial knowledge of the structure and function, the gating mechanism of the NMDA receptor ion channel for electric on-off signals is still a topic of debate. We investigate the NMDA receptor partition distribution and the associated channel's open-close electric signal trajectories using a combined approach of correlating single-molecule fluorescence photo-bleaching, single-molecule super-resolution imaging, and single-channel electric patch-clamp recording. Identifying the compositions of NMDA receptors, their spatial organization and distributions over live cell membranes, we observe that NMDA receptors are organized inhomogeneously: nearly half of the receptor proteins are individually dispersed; whereas others exist in heterogeneous clusters of around 50 nm in size as well as co-localized within the diffraction limited imaging area. We demonstrate that inhomogeneous interactions and partitions of the NMDA receptors can be a cause of the heterogeneous gating mechanism of NMDA receptors in living cells. Furthermore, comparing the imaging results with the ion-channel electric current recording, we propose that the clustered NMDA receptors may be responsible for the variation in the current amplitude observed in the on-off two-state ion-channel electric signal trajectories. Our findings shed new light on the fundamental structure-function mechanism of NMDA receptors and present a conceptual advancement of the ion-channel mechanism in living cells.
Mammalian receptors and assay systems are generally used for in vitro analysis of endocrine disrupting chemicals (EDC) with the assumption that minor differences in amino acid sequences among species do not translate into significant differences in receptor function. We have fou...
Liu, Zhenyu; Szarecka, Agnieszka; Yonkunas, Michael; Speranskiy, Kirill; Kurnikova, Maria; Cascio, Michael
2014-01-01
The glycine receptor (GlyR), a member of the pentameric ligand-gated ion channel superfamily, is the major inhibitory neurotransmitter-gated receptor in the spinal cord and brainstem. In these receptors, the extracellular domain binds agonists, antagonists and various other modulatory ligands that act allosterically to modulate receptor function. The structures of homologous receptors and binding proteins provide templates for modeling of the ligand-binding domain of GlyR, but limitations in sequence homology and structure resolution impact on modeling studies. The determination of distance constraints via chemical crosslinking studies coupled with mass spectrometry can provide additional structural information to aid in model refinement, however it is critical to be able to distinguish between intra- and inter-subunit constraints. In this report we model the structure of GlyBP, a structural and functional homolog of the extracellular domain of human homomeric α1 GlyR. We then show that intra- and intersubunit Lys-Lys crosslinks in trypsinized samples of purified monomeric and oligomeric protein bands from SDS-polyacrylamide gels may be identified and differentiated by MALDI-TOF MS studies of limited resolution. Thus, broadly available MS platforms are capable of providing distance constraints that may be utilized in characterizing large complexes that may be less amenable to NMR and crystallographic studies. Systematic studies of state-dependent chemical crosslinking and mass spectrometric identification of crosslinked sites has the potential to complement computational modeling efforts by providing constraints that can validate and refine allosteric models. PMID:25025226
Back to the future: Rational maps for exploring acetylcholine receptor space and time.
Tessier, Christian J G; Emlaw, Johnathon R; Cao, Zhuo Qian; Pérez-Areales, F Javier; Salameh, Jean-Paul J; Prinston, Jethro E; McNulty, Melissa S; daCosta, Corrie J B
2017-11-01
Global functions of nicotinic acetylcholine receptors, such as subunit cooperativity and compatibility, likely emerge from a network of amino acid residues distributed across the entire pentameric complex. Identification of such networks has stymied traditional approaches to acetylcholine receptor structure and function, likely due to the cryptic interdependency of their underlying amino acid residues. An emerging evolutionary biochemistry approach, which traces the evolutionary history of acetylcholine receptor subunits, allows for rational mapping of acetylcholine receptor sequence space, and offers new hope for uncovering the amino acid origins of these enigmatic properties. Copyright © 2017 Elsevier B.V. All rights reserved.
A nuclear-receptor-dependent phosphatidylcholine pathway with antidiabetic effects
USDA-ARS?s Scientific Manuscript database
Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (also known as NR5A2) regulates bile acid biosynthesis. Structural studies have identified phospholipids as potential LRH-1 ligands, but their functional relevance is unclear. Here we show that an unu...
Bruchas, Michael R.; Calo', Girolamo; Cox, Brian M.; Zaveri, Nurulain T.
2016-01-01
The NOP receptor (nociceptin/orphanin FQ opioid peptide receptor) is the most recently discovered member of the opioid receptor family and, together with its endogenous ligand, N/OFQ, make up the fourth members of the opioid receptor and opioid peptide family. Because of its more recent discovery, an understanding of the cellular and behavioral actions induced by NOP receptor activation are less well developed than for the other members of the opioid receptor family. All of these factors are important because NOP receptor activation has a clear modulatory role on mu opioid receptor-mediated actions and thereby affects opioid analgesia, tolerance development, and reward. In addition to opioid modulatory actions, NOP receptor activation has important effects on motor function and other physiologic processes. This review discusses how NOP pharmacology intersects, contrasts, and interacts with the mu opioid receptor in terms of tertiary structure and mechanism of receptor activation; location of receptors in the central nervous system; mechanisms of desensitization and downregulation; cellular actions; intracellular signal transduction pathways; and behavioral actions with respect to analgesia, tolerance, dependence, and reward. This is followed by a discussion of the agonists and antagonists that have most contributed to our current knowledge. Because NOP receptors are highly expressed in brain and spinal cord and NOP receptor activation sometimes synergizes with mu receptor-mediated actions and sometimes opposes them, an understanding of NOP receptor pharmacology in the context of these interactions with the opioid receptors will be crucial to the development of novel therapeutics that engage the NOP receptor. PMID:26956246
Expression and purification of functional PDGF receptor beta.
Shang, Qingbin; Zhao, Liang; Wang, Xiaojing; Wang, Meimei; Sui, Sen-Fang; Mi, Li-Zhi
2017-07-29
Platelet Derived Growth Factor receptors (PDGFRs), members of receptor tyrosine kinase superfamily, play essential roles in early hematopoiesis, angiogenesis and organ development. Dysregulation of PDGF receptor signaling under pathological conditions associates with cancers, vascular diseases, and fibrotic diseases. Therefore, they are attractive targets in drug development. Like any other membrane proteins with a single-pass transmembrane domain, the high-resolution structural information of the full-length PDGF receptors is still not resolved. It is caused, at least in part, by the technical challenges in the expression and purification of the functional, full-length PDGF receptors. Herein, we reported our experimental details in expression and purification of the full-length PDGFRβ from mammalian cells. We found that purified PDGFRβ remained in two different oligomeric states, presumably the monomer and the dimer, with basal kinase activity in detergent micelles. Addition of PDGF-B promoted dimerization and elevated kinase activity of the receptor, suggesting that purified receptors were functional. Copyright © 2017 Elsevier Inc. All rights reserved.
Structure and signalling functions of C3 receptors on human B cells.
Frade, R
1990-03-01
CR1 (C3b receptor) and CR2 (C3d/EBV receptor) are two C3 receptors expressed on B lymphocytes. CR1 and CR2 have structural similarities and their cross-linking at the B cell surface by antibodies or specific ligands in multimeric forms induce B cell activation. However, activation of human B cells through cell surface interactions or by intracellular protein kinase C activators leads to phosphorylation of CR2 but not CR1. CR2 is phosphorylated on serine and tyrosine residues. Analysis of post-membrane events associated with CR2 revealed intracellular interactions of CR2 with p53, a plasma membrane anti-oncogene-encoded phosphoprotein, and with p120, a nuclear phosphoribonucleoprotein. These intracellular interactions probably represent important steps in the signalling functions of CR2.
Schlinkmann, Karola M; Hillenbrand, Matthias; Rittner, Alexander; Künz, Madeleine; Strohner, Ralf; Plückthun, Andreas
2012-09-21
To identify structural features in a G-protein-coupled receptor (GPCR) crucial for biosynthesis, stability in the membrane and stability in detergent micelles, we developed an evolutionary approach using expression in the inner membrane of Escherichia coli. From the analysis of 800,000 sequences of the rat neurotensin receptor 1, in which every amino acid had been varied to all 64 codons, we uncovered several "shift" positions, where the selected population focuses on a residue different from wild type. Here, we employed in vitro DNA recombination and a comprehensive synthetic binary library made by the Slonomics® technology, allowing us to uncover additive and synergistic effects in the structure that maximize both detergent stability and functional expression. We identified variants with >25,000 functional molecules per E. coli cell, a 50-fold increase over wild type, and observed strong coevolution of detergent stability. We arrived at receptor variants highly stable in short-chain detergents, much more so than those found by alanine scanning on the same receptor. These evolved GPCRs continue to be able to signal through the G-protein. We discuss the structural reasons for these improvements achieved through directed evolution. Copyright © 2012 Elsevier Ltd. All rights reserved.
Sekiguchi, Toshio; Shiraishi, Akira; Satake, Honoo; Kuwasako, Kenji; Takahashi, Hiroki; Sato, Masayuki; Urata, Makoto; Wada, Shuichi; Endo, Masato; Ikari, Takahiro; Hattori, Atsuhiko; Srivastav, Ajai K; Suzuki, Nobuo
2017-05-15
Calcitonin (CT) is a hormone that decreases serum calcium level by suppressing osteoclastic activity in the vertebrate bone. In vertebrates, the structure-function relationship of CTs has been studied extensively. We recently identified three CT superfamily peptides, Bf-CTFP1 to 3, and clarified the molecular and functional characteristics of their receptor and receptor activity-modifying protein in amphioxus, Branchiostoma floridae. However, the CT activity of Bf-CTFPs has yet to be investigated. In the present study, a functional analysis of Bf-CTFPs was performed using goldfish scales having both osteoclasts and osteoblasts. All Bf-CTFPs suppressed osteoclastic activity via a goldfish CT receptor. Although the primary amino acid sequences of the Bf-CTFPs showed low sequence similarity to vertebrate CTs, Bf-CTFP1 to 3 share three amino acids, Thr 25 , Thr 27 , and Pro 32 -NH 2 , that are required for receptor binding, with salmon CT. Moreover, homology model analysis revealed that the Bf-CTFPs form alpha-helical structures. The alpha-helical position and length of Bf-CTFP1 and 2 were conserved with those of a highly potent ligand, teleost CT. Interestingly, the composition of the alpha-helix of Bf-CTFP3 differed from those of teleost CT, despite that the action of Bf-CTFP3 on goldfish scales was the same as that of Bf-CTFP1 and 2. Collectively, the present study provides new insights into the structure-function relationship of CT and its functional evolution in chordates. Copyright © 2017 Elsevier Inc. All rights reserved.
Tie2 and Eph Receptor Tyrosine Kinase Activation and Signaling
Barton, William A.; Dalton, Annamarie C.; Seegar, Tom C.M.; Himanen, Juha P.
2014-01-01
The Eph and Tie cell surface receptors mediate a variety of signaling events during development and in the adult organism. As other receptor tyrosine kinases, they are activated on binding of extracellular ligands and their catalytic activity is tightly regulated on multiple levels. The Eph and Tie receptors display some unique characteristics, including the requirement of ligand-induced receptor clustering for efficient signaling. Interestingly, both Ephs and Ties can mediate different, even opposite, biological effects depending on the specific ligand eliciting the response and on the cellular context. Here we discuss the structural features of these receptors, their interactions with various ligands, as well as functional implications for downstream signaling initiation. The Eph/ephrin structures are already well reviewed and we only provide a brief overview on the initial binding events. We go into more detail discussing the Tie-angiopoietin structures and recognition. PMID:24478383
DOE Office of Scientific and Technical Information (OSTI.GOV)
Booe, Jason M.; Walker, Christopher S.; Barwell, James
Association of receptor activity-modifying proteins (RAMP1-3) with the G protein-coupled receptor (GPCR) calcitonin receptor-like receptor (CLR) enables selective recognition of the peptides calcitonin gene-related peptide (CGRP) and adrenomedullin (AM) that have diverse functions in the cardiovascular and lymphatic systems. How peptides selectively bind GPCR:RAMP complexes is unknown. We report crystal structures of CGRP analog-bound CLR:RAMP1 and AM-bound CLR:RAMP2 extracellular domain heterodimers at 2.5 and 1.8 Å resolutions, respectively. The peptides similarly occupy a shared binding site on CLR with conformations characterized by a β-turn structure near their C termini rather than the α-helical structure common to peptides that bind relatedmore » GPCRs. The RAMPs augment the binding site with distinct contacts to the variable C-terminal peptide residues and elicit subtly different CLR conformations. Lastly, the structures and accompanying pharmacology data reveal how a class of accessory membrane proteins modulate ligand binding of a GPCR and may inform drug development targeting CLR:RAMP complexes.« less
Booe, Jason M.; Walker, Christopher S.; Barwell, James; ...
2015-05-14
Association of receptor activity-modifying proteins (RAMP1-3) with the G protein-coupled receptor (GPCR) calcitonin receptor-like receptor (CLR) enables selective recognition of the peptides calcitonin gene-related peptide (CGRP) and adrenomedullin (AM) that have diverse functions in the cardiovascular and lymphatic systems. How peptides selectively bind GPCR:RAMP complexes is unknown. We report crystal structures of CGRP analog-bound CLR:RAMP1 and AM-bound CLR:RAMP2 extracellular domain heterodimers at 2.5 and 1.8 Å resolutions, respectively. The peptides similarly occupy a shared binding site on CLR with conformations characterized by a β-turn structure near their C termini rather than the α-helical structure common to peptides that bind relatedmore » GPCRs. The RAMPs augment the binding site with distinct contacts to the variable C-terminal peptide residues and elicit subtly different CLR conformations. Lastly, the structures and accompanying pharmacology data reveal how a class of accessory membrane proteins modulate ligand binding of a GPCR and may inform drug development targeting CLR:RAMP complexes.« less
Structural mechanism of ligand activation in human calcium-sensing receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geng, Yong; Mosyak, Lidia; Kurinov, Igor
2016-07-19
Human calcium-sensing receptor (CaSR) is a G-protein-coupled receptor (GPCR) that maintains extracellular Ca 2+homeostasis through the regulation of parathyroid hormone secretion. It functions as a disulfide-tethered homodimer composed of three main domains, the Venus Flytrap module, cysteine-rich domain, and seven-helix transmembrane region. Here, we present the crystal structures of the entire extracellular domain of CaSR in the resting and active conformations. We provide direct evidence that L-amino acids are agonists of the receptor. In the active structure, L-Trp occupies the orthosteric agonist-binding site at the interdomain cleft and is primarily responsible for inducing extracellular domain closure to initiate receptor activation.more » Our structures reveal multiple binding sites for Ca 2+and PO 4 3-ions. Both ions are crucial for structural integrity of the receptor. While Ca 2+ions stabilize the active state, PO 4 3-ions reinforce the inactive conformation. The activation mechanism of CaSR involves the formation of a novel dimer interface between subunits.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bose, Sayantan; Welch, Brett D.; Kors, Christopher A.
2014-10-02
Paramyxovirus entry into cells requires the fusion protein (F) and a receptor binding protein (hemagglutinin-neuraminidase [HN], H, or G). The multifunctional HN protein of some paramyxoviruses, besides functioning as the receptor (sialic acid) binding protein (hemagglutinin activity) and the receptor-destroying protein (neuraminidase activity), enhances F activity, presumably by lowering the activation energy required for F to mediate fusion of viral and cellular membranes. Before or upon receptor binding by the HN globular head, F is believed to interact with the HN stalk. Unfortunately, until recently none of the receptor binding protein crystal structures have shown electron density for the stalkmore » domain. Parainfluenza virus 5 (PIV5) HN exists as a noncovalent dimer-of-dimers on the surface of cells, linked by a single disulfide bond in the stalk. Here we present the crystal structure of the PIV5-HN stalk domain at a resolution of 2.65 {angstrom}, revealing a four-helix bundle (4HB) with an upper (N-terminal) straight region and a lower (C-terminal) supercoiled part. The hydrophobic core residues are a mix of an 11-mer repeat and a 3- to 4-heptad repeat. To functionally characterize the role of the HN stalk in F interactions and fusion, we designed mutants along the PIV5-HN stalk that are N-glycosylated to physically disrupt F-HN interactions. By extensive study of receptor binding, neuraminidase activity, oligomerization, and fusion-promoting functions of the mutant proteins, we found a correlation between the position of the N-glycosylation mutants on the stalk structure and their neuraminidase activities as well as their abilities to promote fusion.« less
Bose, Sayantan; Welch, Brett D.; Kors, Christopher A.; Yuan, Ping; Jardetzky, Theodore S.; Lamb, Robert A.
2011-01-01
Paramyxovirus entry into cells requires the fusion protein (F) and a receptor binding protein (hemagglutinin-neuraminidase [HN], H, or G). The multifunctional HN protein of some paramyxoviruses, besides functioning as the receptor (sialic acid) binding protein (hemagglutinin activity) and the receptor-destroying protein (neuraminidase activity), enhances F activity, presumably by lowering the activation energy required for F to mediate fusion of viral and cellular membranes. Before or upon receptor binding by the HN globular head, F is believed to interact with the HN stalk. Unfortunately, until recently none of the receptor binding protein crystal structures have shown electron density for the stalk domain. Parainfluenza virus 5 (PIV5) HN exists as a noncovalent dimer-of-dimers on the surface of cells, linked by a single disulfide bond in the stalk. Here we present the crystal structure of the PIV5-HN stalk domain at a resolution of 2.65 Å, revealing a four-helix bundle (4HB) with an upper (N-terminal) straight region and a lower (C-terminal) supercoiled part. The hydrophobic core residues are a mix of an 11-mer repeat and a 3- to 4-heptad repeat. To functionally characterize the role of the HN stalk in F interactions and fusion, we designed mutants along the PIV5-HN stalk that are N-glycosylated to physically disrupt F-HN interactions. By extensive study of receptor binding, neuraminidase activity, oligomerization, and fusion-promoting functions of the mutant proteins, we found a correlation between the position of the N-glycosylation mutants on the stalk structure and their neuraminidase activities as well as their abilities to promote fusion. PMID:21994464
Structure of the Full-length VEGFR-1 Extracellular Domain in Complex with VEGF-A.
Markovic-Mueller, Sandra; Stuttfeld, Edward; Asthana, Mayanka; Weinert, Tobias; Bliven, Spencer; Goldie, Kenneth N; Kisko, Kaisa; Capitani, Guido; Ballmer-Hofer, Kurt
2017-02-07
Vascular endothelial growth factors (VEGFs) regulate blood and lymph vessel development upon activation of three receptor tyrosine kinases: VEGFR-1, -2, and -3. Partial structures of VEGFR/VEGF complexes based on single-particle electron microscopy, small-angle X-ray scattering, and X-ray crystallography revealed the location of VEGF binding and domain arrangement of individual receptor subdomains. Here, we describe the structure of the full-length VEGFR-1 extracellular domain in complex with VEGF-A at 4 Å resolution. We combined X-ray crystallography, single-particle electron microscopy, and molecular modeling for structure determination and validation. The structure reveals the molecular details of ligand-induced receptor dimerization, in particular of homotypic receptor interactions in immunoglobulin homology domains 4, 5, and 7. Functional analyses of ligand binding and receptor activation confirm the relevance of these homotypic contacts and identify them as potential therapeutic sites to allosterically inhibit VEGFR-1 activity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Modes of Paramyxovirus Fusion: a Henipavirus perspective
Lee, Benhur; Akyol-Ataman, Zeynep
2011-01-01
Henipavirus is a new genus of paramyxovirus that uses protein-based receptors (EphrinB2 and EphrinB3) for virus entry. Paramyxovirus entry requires the coordinated action of the fusion (F) and attachment viral envelope glycoproteins. Receptor binding to the attachment protein triggers F to undergo a conformational cascade that results in membrane fusion. The accumulation of structural and functional studies on many paramyxoviral fusion and attachment proteins, including recent structures of Nipah and Hendra virus G bound and unbound to cognate ephrinB receptors, indicate that henipavirus entry and fusion differs mechanistically from paramyxoviruses that use glycan-based receptors. PMID:21511478
2013-01-01
This review aims to create an overview of the currently available results of site-directed mutagenesis studies on transient receptor potential vanilloid type 1 (TRPV1) receptor. Systematization of the vast number of data on the functionally important amino acid mutations of TRPV1 may provide a clearer picture of this field, and may promote a better understanding of the relationship between the structure and function of TRPV1. The review summarizes information on 112 unique mutated sites along the TRPV1, exchanged to multiple different residues in many cases. These mutations influence the effect or binding of different agonists, antagonists, and channel blockers, alter the responsiveness to heat, acid, and voltage dependence, affect the channel pore characteristics, and influence the regulation of the receptor function by phosphorylation, glycosylation, calmodulin, PIP2, ATP, and lipid binding. The main goal of this paper is to publish the above mentioned data in a form that facilitates in silico molecular modelling of the receptor by promoting easier establishment of boundary conditions. The better understanding of the structure-function relationship of TRPV1 may promote discovery of new, promising, more effective and safe drugs for treatment of neurogenic inflammation and pain-related diseases and may offer new opportunities for therapeutic interventions. PMID:23800232
Estrogen-related receptor β (ERRβ) – renaissance receptor or receptor renaissance?
Divekar, Shailaja D.; Tiek, Deanna M.; Fernandez, Aileen; Riggins, Rebecca B.
2016-01-01
Estrogen-related receptors (ERRs) are founding members of the orphan nuclear receptor (ONR) subgroup of the nuclear receptor superfamily. Twenty-seven years of study have yet to identify cognate ligands for the ERRs, though they have firmly placed ERRα and ERRγ at the intersection of cellular metabolism and oncogenesis. The pace of discovery for novel functions of ERRβ, however, has until recently been somewhat slower than that of its family members. ERRβ has also been largely ignored in summaries and perspectives of the ONR literature. Here, we provide an overview of established and emerging knowledge of ERRβ in mouse, man, and other species, highlighting unique aspects of ERRβ biology that set it apart from the other two estrogen-related receptors, with a focus on the impact of alternative splicing on the structure and function of this receptor. PMID:27507929
Molecular structures and functional relationships in clostridial neurotoxins.
Swaminathan, Subramanyam
2011-12-01
The seven serotypes of Clostridium botulinum neurotoxins (A-G) are the deadliest poison known to humans. They share significant sequence homology and hence possess similar structure-function relationships. Botulinum neurotoxins (BoNT) act via a four-step mechanism, viz., binding and internalization to neuronal cells, translocation of the catalytic domain into the cytosol and finally cleavage of one of the three soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNARE) causing blockage of neurotransmitter release leading to flaccid paralysis. Crystal structures of three holotoxins, BoNT/A, B and E, are available to date. Although the individual domains are remarkably similar, their domain organization is different. These structures have helped in correlating the structural and functional domains. This has led to the determination of structures of individual domains and combinations of them. Crystal structures of catalytic domains of all serotypes and several binding domains are now available. The catalytic domains are zinc endopeptidases and share significant sequence and structural homology. The active site architecture and the catalytic mechanism are similar although the binding mode of individual substrates may be different, dictating substrate specificity and peptide cleavage selectivity. Crystal structures of catalytic domains with substrate peptides provide clues to specificity and selectivity unique to BoNTs. Crystal structures of the receptor domain in complex with ganglioside or the protein receptor have provided information about the binding of botulinum neurotoxin to the neuronal cell. An overview of the structure-function relationship correlating the 3D structures with biochemical and biophysical data and how they can be used for structure-based drug discovery is presented here. Journal compilation © 2011 FEBS. No claim to original US government works.
Fu, Qin; Hu, Yuting; Wang, Qingtong; Liu, Yongming; Li, Ning; Xu, Bing; Kim, Sungjin; Chiamvimonvat, Nipavan; Xiang, Yang K
2017-03-15
Patients with diabetes show a blunted cardiac inotropic response to β-adrenergic stimulation despite normal cardiac contractile reserve. Acute insulin stimulation impairs β-adrenergically induced contractile function in isolated cardiomyocytes and Langendorff-perfused hearts. In this study, we aimed to examine the potential effects of hyperinsulinaemia associated with high-fat diet (HFD) feeding on the cardiac β 2 -adrenergic receptor signalling and the impacts on cardiac contractile function. We showed that 8 weeks of HFD feeding leads to reductions in cardiac functional reserve in response to β-adrenergic stimulation without significant alteration of cardiac structure and function, which is associated with significant changes in β 2 -adrenergic receptor phosphorylation at protein kinase A and G-protein receptor kinase sites in the myocardium. The results suggest that clinical intervention might be applied to subjects in early diabetes without cardiac symptoms to prevent further cardiac complications. Patients with diabetes display reduced exercise capability and impaired cardiac contractile reserve in response to adrenergic stimulation. We have recently uncovered an insulin receptor and adrenergic receptor signal network in the heart. The aim of this study was to understand the impacts of high-fat diet (HFD) on the insulin-adrenergic receptor signal network in hearts. After 8 weeks of HFD feeding, mice exhibited diabetes, with elevated insulin and glucose concentrations associated with body weight gain. Mice fed an HFD had normal cardiac structure and function. However, the HFD-fed mice displayed a significant elevation of phosphorylation of the β 2 -adrenergic receptor (β 2 AR) at both the protein kinase A site serine 261/262 and the G-protein-coupled receptor kinase site serine 355/356 and impaired adrenergic reserve when compared with mice fed on normal chow. Isolated myocytes from HFD-fed mice also displayed a reduced contractile response to adrenergic stimulation when compared with those of control mice fed normal chow. Genetic deletion of the β 2 AR led to a normalized adrenergic response and preserved cardiac contractile reserve in HFD-fed mice. Together, these data indicate that HFD promotes phosphorylation of the β 2 AR, contributing to impairment of cardiac contractile reserve before cardiac structural and functional remodelling, suggesting that early intervention in the insulin-adrenergic signalling network might be effective in prevention of cardiac complications in diabetes. © 2016 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.
Hu, Yuting; Wang, Qingtong; Liu, Yongming; Li, Ning; Xu, Bing; Kim, Sungjin; Chiamvimonvat, Nipavan
2017-01-01
Key points Patients with diabetes show a blunted cardiac inotropic response to β‐adrenergic stimulation despite normal cardiac contractile reserve.Acute insulin stimulation impairs β‐adrenergically induced contractile function in isolated cardiomyocytes and Langendorff‐perfused hearts.In this study, we aimed to examine the potential effects of hyperinsulinaemia associated with high‐fat diet (HFD) feeding on the cardiac β2‐adrenergic receptor signalling and the impacts on cardiac contractile function.We showed that 8 weeks of HFD feeding leads to reductions in cardiac functional reserve in response to β‐adrenergic stimulation without significant alteration of cardiac structure and function, which is associated with significant changes in β2‐adrenergic receptor phosphorylation at protein kinase A and G‐protein receptor kinase sites in the myocardium.The results suggest that clinical intervention might be applied to subjects in early diabetes without cardiac symptoms to prevent further cardiac complications. Abstract Patients with diabetes display reduced exercise capability and impaired cardiac contractile reserve in response to adrenergic stimulation. We have recently uncovered an insulin receptor and adrenergic receptor signal network in the heart. The aim of this study was to understand the impacts of high‐fat diet (HFD) on the insulin–adrenergic receptor signal network in hearts. After 8 weeks of HFD feeding, mice exhibited diabetes, with elevated insulin and glucose concentrations associated with body weight gain. Mice fed an HFD had normal cardiac structure and function. However, the HFD‐fed mice displayed a significant elevation of phosphorylation of the β2‐adrenergic receptor (β2AR) at both the protein kinase A site serine 261/262 and the G‐protein‐coupled receptor kinase site serine 355/356 and impaired adrenergic reserve when compared with mice fed on normal chow. Isolated myocytes from HFD‐fed mice also displayed a reduced contractile response to adrenergic stimulation when compared with those of control mice fed normal chow. Genetic deletion of the β2AR led to a normalized adrenergic response and preserved cardiac contractile reserve in HFD‐fed mice. Together, these data indicate that HFD promotes phosphorylation of the β2AR, contributing to impairment of cardiac contractile reserve before cardiac structural and functional remodelling, suggesting that early intervention in the insulin–adrenergic signalling network might be effective in prevention of cardiac complications in diabetes. PMID:27983752
Gonadotropin-Releasing Hormone (GnRH) Receptor Structure and GnRH Binding
Flanagan, Colleen A.; Manilall, Ashmeetha
2017-01-01
Gonadotropin-releasing hormone (GnRH) regulates reproduction. The human GnRH receptor lacks a cytoplasmic carboxy-terminal tail but has amino acid sequence motifs characteristic of rhodopsin-like, class A, G protein-coupled receptors (GPCRs). This review will consider how recent descriptions of X-ray crystallographic structures of GPCRs in inactive and active conformations may contribute to understanding GnRH receptor structure, mechanism of activation and ligand binding. The structures confirmed that ligands bind to variable extracellular surfaces, whereas the seven membrane-spanning α-helices convey the activation signal to the cytoplasmic receptor surface, which binds and activates heterotrimeric G proteins. Forty non-covalent interactions that bridge topologically equivalent residues in different transmembrane (TM) helices are conserved in class A GPCR structures, regardless of activation state. Conformation-independent interhelical contacts account for a conserved receptor protein structure and their importance in the GnRH receptor structure is supported by decreased expression of receptors with mutations of residues in the network. Many of the GnRH receptor mutations associated with congenital hypogonadotropic hypogonadism, including the Glu2.53(90) Lys mutation, involve amino acids that constitute the conserved network. Half of the ~250 intramolecular interactions in GPCRs differ between inactive and active structures. Conformation-specific interhelical contacts depend on amino acids changing partners during activation. Conserved inactive conformation-specific contacts prevent receptor activation by stabilizing proximity of TM helices 3 and 6 and a closed G protein-binding site. Mutations of GnRH receptor residues involved in these interactions, such as Arg3.50(139) of the DRY/S motif or Tyr7.53(323) of the N/DPxxY motif, increase or decrease receptor expression and efficiency of receptor coupling to G protein signaling, consistent with the native residues stabilizing the inactive GnRH receptor structure. Active conformation-specific interhelical contacts stabilize an open G protein-binding site. Progress in defining the GnRH-binding site has recently slowed, with evidence that Tyr6.58(290) contacts Tyr5 of GnRH, whereas other residues affect recognition of Trp3 and Gly10NH2. The surprisingly consistent observations that GnRH receptor mutations that disrupt GnRH binding have less effect on “conformationally constrained” GnRH peptides may now be explained by crystal structures of agonist-bound peptide receptors. Analysis of GPCR structures provides insight into GnRH receptor function. PMID:29123501
Krogsgaard-Larsen, Niels; Delgar, Claudia G; Koch, Karina; Brown, Patricia M G E; Møller, Charlotte; Han, Liwei; Huynh, Tri H V; Hansen, Stinne W; Nielsen, Birgitte; Bowie, Derek; Pickering, Darryl S; Kastrup, Jette Sandholm; Frydenvang, Karla; Bunch, Lennart
2017-01-12
Ionotropic glutamate receptor antagonists are valuable tool compounds for studies of neurological pathways in the central nervous system. On the basis of rational ligand design, a new class of selective antagonists, represented by (2S,4R)-4-(2-carboxyphenoxy)pyrrolidine-2-carboxylic acid (1b), for cloned homomeric kainic acid receptors subtype 1 (GluK1) was attained (K i = 4 μM). In a functional assay, 1b displayed full antagonist activity with IC 50 = 6 ± 2 μM. A crystal structure was obtained of 1b when bound in the ligand binding domain of GluK1. A domain opening of 13-14° was seen compared to the structure with glutamate, consistent with 1b being an antagonist. A structure-activity relationship study showed that the chemical nature of the tethering atom (C, O, or S) linking the pyrrolidine ring and the phenyl ring plays a key role in the receptor selectivity profile and that substituents on the phenyl ring are well accommodated by the GluK1 receptor.
Leopoldo, Marcello; Lacivita, Enza; Berardi, Francesco; Perrone, Roberto; Hedlund, Peter B.
2010-01-01
Since its discovery in the 1940s in serum, the mammalian intestinal mucosa, and in the central nervous system, serotonin (5-HT) has been shown to be involved in virtually all cognitive and behavioral human functions, and alterations in its neurochemistry have been implicated in the etiology of a plethora of neuropsychiatric disorders. The cloning of 5-HT receptor subtypes has been of importance in enabling them to be classified as specific protein molecules encoded by specific genes. The 5-HT7 receptor is the most recently classified member of the serotonin receptor family. Since its identification, it has been the subject of intense research efforts driven by its presence in functionally relevant regions of the brain. The availability of some selective antagonists and agonists, in combination with genetically modified mice lacking the 5-HT7 receptor, has allowed for a better understanding of the pathophysiological role of this receptor. This paper reviews data on localization and pharmacological properties of the 5-HT7 receptor, and summarizes the results of structure-activity relationship studies aimed at the discovery of selective 5-HT7 receptor ligands. Additionally, an overview of the potential therapeutic applications of 5-HT7 receptor agonists and antagonists in central nervous system disorders is presented. PMID:20923682
Heifetz, Alexander; Barker, Oliver; Morris, G Benjamin; Law, Richard J; Slack, Mark; Biggin, Philip C
2013-11-19
The class A G-protein-coupled receptors (GPCRs) Orexin-1 (OX1) and Orexin-2 (OX2) are located predominantly in the brain and are linked to a range of different physiological functions, including the control of feeding, energy metabolism, modulation of neuro-endocrine function, and regulation of the sleep-wake cycle. The natural agonists for OX1 and OX2 are two neuropeptides, Orexin-A and Orexin-B, which have activity at both receptors. Site-directed mutagenesis (SDM) has been reported on both the receptors and the peptides and has provided important insight into key features responsible for agonist activity. However, the structural interpretation of how these data are linked together is still lacking. In this work, we produced and used SDM data, homology modeling followed by MD simulation, and ensemble-flexible docking to generate binding poses of the Orexin peptides in the OX receptors to rationalize the SDM data. We also developed a protein pairwise similarity comparing method (ProS) and a GPCR-likeness assessment score (GLAS) to explore the structural data generated within a molecular dynamics simulation and to help distinguish between different GPCR substates. The results demonstrate how these newly developed methods of structural assessment for GPCRs can be used to provide a working model of neuropeptide-Orexin receptor interaction.
Liu, Yue; Canal, Clinton E; Cordova-Sintjago, Tania C; Zhu, Wanying; Booth, Raymond G
2017-01-18
While exploring the structure-activity relationship of 4-phenyl-2-dimethylaminotetralins (PATs) at serotonin 5-HT 2C receptors, we discovered that relatively minor modification of PAT chemistry impacts function at 5-HT 2C receptors. In HEK293 cells expressing human 5-HT 2C-INI receptors, for example, (-)-trans-3'-Br-PAT and (-)-trans-3'-Cl-PAT are agonists regarding Gα q -inositol phosphate signaling, whereas (-)-trans-3'-CF 3 -PAT is an inverse agonist. To investigate the ligand-receptor interactions that govern this change in function, we performed site-directed mutagenesis of 14 amino acids of the 5-HT 2C receptor based on molecular modeling and reported G protein-coupled receptor crystal structures, followed by molecular pharmacology studies. We found that S3.36, T3.37, and F5.47 in the orthosteric binding pocket are critical for affinity (K i ) of all PATs tested, we also found that F6.44, M6.47, C7.45, and S7.46 are primarily involved in regulating EC/IC 50 functional potencies of PATs. We discovered that when residue S5.43, N6.55, or both are mutated to alanine, (-)-trans-3'-CF 3 -PAT switches from inverse agonist to agonist function, and when N6.55 is mutated to leucine, (-)-trans-3'-Br-PAT switches from agonist to inverse agonist function. Notably, most point-mutations that affected PAT pharmacology did not significantly alter affinity (K D ) of the antagonist radioligand [ 3 H]mesulergine, but every mutation tested negatively impacted serotonin binding. Also, amino acid mutations differentially affected the pharmacology of other commercially available 5-HT 2C ligands tested. Collectively, the data show that functional outcomes shared by different ligands are mediated by different amino acids and that some 5-HT 2C receptor residues important for pharmacology of one ligand are not necessarily important for another ligand.
Dewhurst, Henry M.; Choudhury, Shilpa; Torres, Matthew P.
2015-01-01
Predicting the biological function potential of post-translational modifications (PTMs) is becoming increasingly important in light of the exponential increase in available PTM data from high-throughput proteomics. We developed structural analysis of PTM hotspots (SAPH-ire)—a quantitative PTM ranking method that integrates experimental PTM observations, sequence conservation, protein structure, and interaction data to allow rank order comparisons within or between protein families. Here, we applied SAPH-ire to the study of PTMs in diverse G protein families, a conserved and ubiquitous class of proteins essential for maintenance of intracellular structure (tubulins) and signal transduction (large and small Ras-like G proteins). A total of 1728 experimentally verified PTMs from eight unique G protein families were clustered into 451 unique hotspots, 51 of which have a known and cited biological function or response. Using customized software, the hotspots were analyzed in the context of 598 unique protein structures. By comparing distributions of hotspots with known versus unknown function, we show that SAPH-ire analysis is predictive for PTM biological function. Notably, SAPH-ire revealed high-ranking hotspots for which a functional impact has not yet been determined, including phosphorylation hotspots in the N-terminal tails of G protein gamma subunits—conserved protein structures never before reported as regulators of G protein coupled receptor signaling. To validate this prediction we used the yeast model system for G protein coupled receptor signaling, revealing that gamma subunit–N-terminal tail phosphorylation is activated in response to G protein coupled receptor stimulation and regulates protein stability in vivo. These results demonstrate the utility of integrating protein structural and sequence features into PTM prioritization schemes that can improve the analysis and functional power of modification-specific proteomics data. PMID:26070665
Heusser, Stephanie A.; Howard, Rebecca J.; Borghese, Cecilia M.; Cullins, Madeline A.; Broemstrup, Torben; Lee, Ui S.; Lindahl, Erik; Carlsson, Jens
2013-01-01
GABAA receptors play a crucial role in the actions of general anesthetics. The recently published crystal structure of the general anesthetic propofol bound to Gloeobacter violaceus ligand-gated ion channel (GLIC), a bacterial homolog of GABAA receptors, provided an opportunity to explore structure-based ligand discovery for pentameric ligand-gated ion channels (pLGICs). We used molecular docking of 153,000 commercially available compounds to identify molecules that interact with the propofol binding site in GLIC. In total, 29 compounds were selected for functional testing on recombinant GLIC, and 16 of these compounds modulated GLIC function. Active compounds were also tested on recombinant GABAA receptors, and point mutations around the presumed binding pocket were introduced into GLIC and GABAA receptors to test for binding specificity. The potency of active compounds was only weakly correlated with properties such as lipophilicity or molecular weight. One compound was found to mimic the actions of propofol on GLIC and GABAA, and to be sensitive to mutations that reduce the action of propofol in both receptors. Mutant receptors also provided insight about the position of the binding sites and the relevance of the receptor’s conformation for anesthetic actions. Overall, the findings support the feasibility of the use of virtual screening to discover allosteric modulators of pLGICs, and suggest that GLIC is a valid model system to identify novel GABAA receptor ligands. PMID:23950219
Koole, Cassandra; Reynolds, Christopher A.; Mobarec, Juan C.; Hick, Caroline; Sexton, Patrick M.; Sakmar, Thomas P.
2017-01-01
The glucagon-like peptide-1 receptor (GLP-1R) is a key therapeutic target in the management of type II diabetes mellitus, with actions including regulation of insulin biosynthesis and secretion, promotion of satiety, and preservation of β-cell mass. Like most class B G protein-coupled receptors (GPCRs), there is limited knowledge linking biological activity of the GLP-1R with the molecular structure of an intact, full-length, and functional receptor·ligand complex. In this study, we have utilized genetic code expansion to site-specifically incorporate the photoactive amino acid p-azido-l-phenylalanine (azF) into N-terminal residues of a full-length functional human GLP-1R in mammalian cells. UV-mediated photolysis of azF was then carried out to induce targeted photocross-linking to determine the proximity of the azido group in the mutant receptor with the peptide exendin-4. Cross-linking data were compared directly with the crystal structure of the isolated N-terminal extracellular domain of the GLP-1R in complex with exendin(9–39), revealing both similarities as well as distinct differences in the mode of interaction. Generation of a molecular model to accommodate the photocross-linking constraints highlights the potential influence of environmental conditions on the conformation of the receptor·peptide complex, including folding dynamics of the peptide and formation of dimeric and higher order oligomeric receptor multimers. These data demonstrate that crystal structures of isolated receptor regions may not give a complete reflection of peptide/receptor interactions and should be combined with additional experimental constraints to reveal peptide/receptor interactions occurring in the dynamic, native, and full-length receptor state. PMID:28283573
Scavenger Receptors: Emerging Roles in Cancer Biology and Immunology
Yu, Xiaofei; Guo, Chunqing; Fisher, Paul B.; Subjeck, John R.; Wang, Xiang-Yang
2015-01-01
Scavenger receptors constitute a large family of evolutionally conserved protein molecules that are structurally and functionally diverse. Although scavenger receptors were originally identified based on their capacity to scavenge modified lipoproteins, these molecules have been shown to recognize and bind to a broad spectrum of ligands, including modified and unmodified host-derived molecules or microbial components. As a major subset of innate pattern recognition receptors, scavenger receptors are mainly expressed on myeloid cells and function in a wide range of biological processes, such as endocytosis, adhesion, lipid transport, antigen presentation, and pathogen clearance. In addition to playing a crucial role in maintenance of host homeostasis, scavenger receptors have been implicated in the pathogenesis of a number of diseases, e.g., atherosclerosis, neurodegeneration, or metabolic disorders. Emerging evidence has begun to reveal these receptor molecules as important regulators of tumor behavior and host immune responses to cancer. This review summarizes our current understanding on the newly identified, distinct functions of scavenger receptors in cancer biology and immunology. The potential of scavenger receptors as diagnostic biomarkers and novel targets for therapeutic interventions to treat malignancies is also highlighted. PMID:26216637
USDA-ARS?s Scientific Manuscript database
Protease activated receptors (PARs) are expressed on structural cells and immune cells. Control of the initiation, duration, and magnitude of the PAR effects are linked to the level of receptor expression, the availability of proteases, and the intracellular signal transduction machinery. We inve...
Talevi, Alan; Enrique, Andrea V; Bruno-Blanch, Luis E
2012-06-15
A virtual screening campaign based on application of a topological discriminant function capable of identifying novel anticonvulsant agents indicated several widely-used artificial sweeteners as potential anticonvulsant candidates. Acesulfame potassium, cyclamate and saccharin were tested in the Maximal Electroshock Seizure model (mice, ip), showing moderate anticonvulsant activity. We hypothesized a probable structural link between the receptor responsible of sweet taste and anticonvulsant molecular targets. Bioinformatic tools confirmed a highly significant sequence-similarity between taste-related protein T1R3 and several metabotropic glutamate receptors from different species, including glutamate receptors upregulated in epileptogenesis and certain types of epilepsy. Copyright © 2012 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jin, Lihua; Lin, Shengchen; Rong, Hui
2012-03-15
Iloprost is a prostacyclin analog that has been used to treat many vascular conditions. Peroxisome proliferator-activated receptors (PPARs) are ligand-regulated transcription factors with various important biological effects such as metabolic and cardiovascular physiology. Here, we report the crystal structures of the PPAR{alpha} ligand-binding domain and PPAR{delta} ligand-binding domain bound to iloprost, thus providing unambiguous evidence for the direct interaction between iloprost and PPARs and a structural basis for the recognition of PPAR{alpha}/{delta} by this prostacyclin analog. In addition to conserved contacts for all PPAR{alpha} ligands, iloprost also initiates several specific interactions with PPARs using its unique structural groups. Structural andmore » functional studies of receptor-ligand interactions reveal strong functional correlations of the iloprost-PPAR{alpha}/{delta} interactions as well as the molecular basis of PPAR subtype selectivity toward iloprost ligand. As such, the structural mechanism may provide a more rational template for designing novel compounds targeting PPARs with more favorable pharmacologic impact based on existing iloprost drugs.« less
Yakoub, Kirsten; Jung, Sascha; Sattler, Christian; Damerow, Helen; Weber, Judith; Kretzschmann, Annika; Cankaya, Aylin S; Piel, Markus; Rösch, Frank; Haugaard, Anne S; Frølund, Bente; Schirmeister, Tanja; Lüddens, Hartmut
2018-03-08
δ-Selective compounds 1 and 2 (DS1, compound 22; DS2, compound 16) were introduced as functionally selective modulators of δ-containing GABA type A receptors (GABA A R). In our hands, [ 3 H]EBOB-binding experiments with recombinant GABA A R and compound 22 showed no proof of δ-selectivity, although there was a minimally higher preference for the α4β3δ and α6β2/3δ receptors with respect to potency. In order to delineate the structural determinants of δ preferences, we synthesized 25 derivatives of DS1 and DS2, and investigated their structure-activity relationships (SAR). Four of our derivatives showed selectivity for α6β3δ receptors (29, 38, 39, and 41). For all of them, the major factors that distinguished them from compound 22 were variations at the para-positions of their benzamide groups. However, two compounds (29 and 39), when tested in the presence of GABA, revealed effects at several additional GABA A R. The newly synthesized compounds will still serve as useful tools to investigate α6β3δ receptors.
Sensing Structures Inspired by Blind Cave Fish
NASA Astrophysics Data System (ADS)
McConney, Michael E.; Chen, Nannan; Lu, David; Anderson, Kyle D.; Hu, Huan; Liu, Chang; Tsukruk, Vladimir V.
2009-03-01
Blind cave fish, with degenerated non-functioning eyes, have evolved to ``see'' their hydrodynamic environment by using the flow receptors of the lateral line system. The hair-cell receptors are encapsulated in a hydrogel-like material, called a cupula, which increases the sensitivity of the hair-cell receptors by coupling their motion to the surrounding flowing media. We characterized the viscoelastic properties and of blind cave fish cupulae by using colloidal-probe spectroscopy in fluid. A photo-patternable hydrogel with similar properties was developed to mimic the fish receptor coupling structure. Flow-based measurements indicated that the hydrogels enhance drag through increased surface area, but also inherent material properties. These bio-inspired structures endowed micro-fabricated flow sensors with sensitivities rivaling that of fish.
Conformational Changes in the Capsid of a Calicivirus upon Interaction with Its Functional Receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ossiboff, Robert J.; Zhou, Yi; Lightfoot, Patrick J.
2010-07-19
Nonenveloped viral capsids are metastable structures that undergo conformational changes during virus entry that lead to interactions of the capsid or capsid fragments with the cell membrane. For members of the Caliciviridae, neither the nature of these structural changes in the capsid nor the factor(s) responsible for inducing these changes is known. Feline functional adhesion molecule A (fJAM-A) mediates the attachment and infectious viral entry of feline calicivirus (FCV). Here, we show that the infectivity of some FCV isolates is neutralized following incubation with the soluble receptor at 37 C. We used this property to select mutants resistant to preincubationmore » with the soluble receptor. We isolated and sequenced 24 soluble receptor-resistant (srr) mutants and characterized the growth properties and receptor-binding activities of eight mutants. The location of the mutations within the capsid structure of FCV was mapped using a new 3.6-{angstrom} structure of native FCV. The srr mutations mapped to the surface of the P2 domain were buried at the protruding domain dimer interface or were present in inaccessible regions of the capsid protein. Coupled with data showing that both the parental FCV and the srr mutants underwent increases in hydrophobicity upon incubation with the soluble receptor at 37 C, these findings indicate that FCV likely undergoes conformational change upon interaction with its receptor. Changes in FCV capsid conformation following its interaction with fJAM-A may be important for subsequent interactions of the capsid with cellular membranes, membrane penetration, and genome delivery.« less
Quast, Robert B.; Ballion, Biljana; Stech, Marlitt; Sonnabend, Andrei; Varga, Balázs R.; Wüstenhagen, Doreen A.; Kele, Péter; Schiller, Stefan M.; Kubick, Stefan
2016-01-01
Cell-free protein synthesis systems represent versatile tools for the synthesis and modification of human membrane proteins. In particular, eukaryotic cell-free systems provide a promising platform for their structural and functional characterization. Here, we present the cell-free synthesis of functional human epidermal growth factor receptor and its vIII deletion mutant in a microsome-containing system derived from cultured Sf21 cells. We provide evidence for embedment of cell-free synthesized receptors into microsomal membranes and asparagine-linked glycosylation. Using the cricket paralysis virus internal ribosome entry site and a repetitive synthesis approach enrichment of receptors inside the microsomal fractions was facilitated thereby providing analytical amounts of functional protein. Receptor tyrosine kinase activation was demonstrated by monitoring receptor phosphorylation. Furthermore, an orthogonal cell-free translation system that provides the site-directed incorporation of p-azido-L-phenylalanine is characterized and applied to investigate receptor dimerization in the absence of a ligand by photo-affinity cross-linking. Finally, incorporated azides are used to generate stable covalently linked receptor dimers by strain-promoted cycloaddition using a novel linker system. PMID:27670253
Recent advance in the design of small molecular modulators of estrogen-related receptors.
Lu, Xiaoyun; Peng, Lijie; Lv, Man; ding, Ke
2012-01-01
The estrogen-related receptors (ERRs), comprising ERRα, ERRβ and ERRγ, are the members of the nuclear receptor superfamily, which have been functionally implicated in estrogen signal pathway in various patterns. However, no natural ligand of ERRs has been identified to data, so identification of the synthetic modulators (inverse agonist and agonist) of ERRs would be highly effective in the treatment of estrogen-related pathologies, such as diabetes, breast cancer and osteoporosis. This review summarizes the structures and biological functions of ERR subtypes, and the progress in designing the small molecular modulators of ERRs as well as the detailed description of available co-crystal structures of the LBD of ERRs in three distinct states: unligand, inverse agonist bound, and agonist bound.
The molecular determinants of CD8 co-receptor function.
Cole, David K; Laugel, Bruno; Clement, Mathew; Price, David A; Wooldridge, Linda; Sewell, Andrew K
2012-10-01
CD8(+) T cells respond to signals mediated through a specific interaction between the T-cell receptor (TCR) and a composite antigen in the form of an epitopic peptide bound between the polymorphic α1 and α2 helices of an MHC class I (MHCI) molecule. The CD8 glycoprotein 'co-receives' antigen by binding to an invariant region of the MHCI molecule and can enhance ligand recognition by up to 1 million-fold. In recent years, a number of structural and biophysical investigations have shed light on the role of the CD8 co-receptor during T-cell antigen recognition. Here, we provide a collated resource for these data, and discuss how the structural and biophysical parameters governing CD8 co-receptor function further our understanding of T-cell cross-reactivity and the productive engagement of low-affinity antigenic ligands. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.
Structural basis for methylesterase CheB regulation by a phosphorylation-activated domain
Djordjevic, Snezana; Goudreau, Paul N.; Xu, Qingping; Stock, Ann M.; West, Ann H.
1998-01-01
We report the x-ray crystal structure of the methylesterase CheB, a phosphorylation-activated response regulator involved in reversible modification of bacterial chemotaxis receptors. Methylesterase CheB and methyltransferase CheR modulate signaling output of the chemotaxis receptors by controlling the level of receptor methylation. The structure of CheB, which consists of an N-terminal regulatory domain and a C-terminal catalytic domain joined by a linker, was solved by molecular replacement methods using independent search models for the two domains. In unphosphorylated CheB, the N-terminal domain packs against the active site of the C-terminal domain and thus inhibits methylesterase activity by directly restricting access to the active site. We propose that phosphorylation of CheB induces a conformational change in the regulatory domain that disrupts the domain interface, resulting in a repositioning of the domains and allowing access to the active site. Structural similarity between the two companion receptor modification enzymes, CheB and CheR, suggests an evolutionary and/or functional relationship. Specifically, the phosphorylated N-terminal domain of CheB may facilitate interaction with the receptors, similar to the postulated role of the N-terminal domain of CheR. Examination of surfaces in the N-terminal regulatory domain of CheB suggests that despite a common fold throughout the response regulator family, surfaces used for protein–protein interactions differ significantly. Comparison between CheB and other response regulators indicates that analogous surfaces are used for different functions and conversely, similar functions are mediated by different molecular surfaces. PMID:9465023
Molecular recognition of human ephrinB2 cell surface receptor by an emergent African henipavirus
Lee, Benhur; Pernet, Olivier; Ahmed, Asim A.; Zeltina, Antra; Beaty, Shannon M.; Bowden, Thomas A.
2015-01-01
The discovery of African henipaviruses (HNVs) related to pathogenic Hendra virus (HeV) and Nipah virus (NiV) from Southeast Asia and Australia presents an open-ended health risk. Cell receptor use by emerging African HNVs at the stage of host-cell entry is a key parameter when considering the potential for spillover and infection of human populations. The attachment glycoprotein from a Ghanaian bat isolate (GhV-G) exhibits <30% sequence identity with Asiatic NiV-G/HeV-G. Here, through functional and structural analysis of GhV-G, we show how this African HNV targets the same human cell-surface receptor (ephrinB2) as the Asiatic HNVs. We first characterized this virus−receptor interaction crystallographically. Compared with extant HNV-G–ephrinB2 structures, there was significant structural variation in the six-bladed β-propeller scaffold of the GhV-G receptor-binding domain, but not the Greek key fold of the bound ephrinB2. Analysis revealed a surprisingly conserved mode of ephrinB2 interaction that reflects an ongoing evolutionary constraint among geographically distal and phylogenetically divergent HNVs to maintain the functionality of ephrinB2 recognition during virus–host entry. Interestingly, unlike NiV-G/HeV-G, we could not detect binding of GhV-G to ephrinB3. Comparative structure–function analysis further revealed several distinguishing features of HNV-G function: a secondary ephrinB2 interaction site that contributes to more efficient ephrinB2-mediated entry in NiV-G relative to GhV-G and cognate residues at the very C terminus of GhV-G (absent in Asiatic HNV-Gs) that are vital for efficient receptor-induced fusion, but not receptor binding per se. These data provide molecular-level details for evaluating the likelihood of African HNVs to spill over into human populations. PMID:25825759
Structural insights into FRS2α PTB domain recognition by neurotrophin receptor TrkB.
Zeng, Lei; Kuti, Miklos; Mujtaba, Shiraz; Zhou, Ming-Ming
2014-07-01
The fibroblast growth factor receptor (FGFR) substrate 2 (FRS2) family proteins function as scaffolding adapters for receptor tyrosine kinases (RTKs). The FRS2α proteins interact with RTKs through the phosphotyrosine-binding (PTB) domain and transfer signals from the activated receptors to downstream effector proteins. Here, we report the nuclear magnetic resonance structure of the FRS2α PTB domain bound to phosphorylated TrkB. The structure reveals that the FRS2α-PTB domain is comprised of two distinct but adjacent pockets for its mutually exclusive interaction with either nonphosphorylated juxtamembrane region of the FGFR, or tyrosine phosphorylated peptides TrkA and TrkB. The new structural insights suggest rational design of selective small molecules through targeting of the two conjunct pockets in the FRS2α PTB domain. © 2014 Wiley Periodicals, Inc.
Estall, Jennifer L; Koehler, Jacqueline A; Yusta, Bernardo; Drucker, Daniel J
2005-06-10
Classic models of receptor desensitization and internalization have been largely based on the behavior of Family A G-protein-coupled receptors (GPCRs). The glucagon-like peptide-2 receptor (GLP-2R) is a member of the Family B glucagon-secretin GPCR family, which exhibit significant sequence and structural differences from the Family A receptors in their intracellular and extracellular domains. To identify structural motifs that regulate GLP-2R signaling and cell surface receptor expression, we analyzed the functional properties of a series of mutant GLP-2Rs. The majority of the C-terminal receptor tail was dispensable for GLP-2-induced cAMP accumulation, ERK1/2 activation, and endocytosis in transfected cells. However, progressive truncation of the C terminus reduced cell surface receptor expression, altered agonist-induced GLP-2R trafficking, and abrogated protein kinase A-mediated heterologous receptor desensitization. Elimination of the distal 21 amino acids of the receptor was sufficient to promote constitutive receptor internalization and prevent agonist-induced recruitment of beta-arrestin-2. Site-directed mutagenesis identified specific amino acid residues within the distal GLP-2R C terminus that mediate the stable association with beta-arrestin-2. Surprisingly, although the truncated mutant receptors failed to interact with beta-arrestin-2, they underwent homologous desensitization and subsequent resensitization with kinetics similar to that observed with the wild-type GLP-2R. Our data suggest that, although the GLP-2R C terminus is not required for coupling to cellular machinery regulating signaling or desensitization, it may serve as a sorting signal for intracellular trafficking. Taken together with the previously demonstrated clathrin and dynamin-independent, lipid-raft-dependent pathways for internalization, our data suggest that GLP-2 receptor signaling has evolved unique structural and functional mechanisms for control of receptor trafficking, desensitization, and resensitization.
Molecular Determinants of Magnolol Targeting Both RXRα and PPARγ
Chen, Lili; Chen, Jing; Hu, Lihong; Jiang, Hualiang; Shen, Xu
2011-01-01
Nuclear receptors retinoic X receptor α (RXRα) and peroxisome proliferator activated receptor γ (PPARγ) function potently in metabolic diseases, and are both important targets for anti-diabetic drugs. Coactivation of RXRα and PPARγ is believed to synergize their effects on glucose and lipid metabolism. Here we identify the natural product magnolol as a dual agonist targeting both RXRα and PPARγ. Magnolol was previously reported to enhance adipocyte differentiation and glucose uptake, ameliorate blood glucose level and prevent development of diabetic nephropathy. Although magnolol can bind and activate both of these two nuclear receptors, the transactivation assays indicate that magnolol exhibits biased agonism on the transcription of PPAR-response element (PPRE) mediated by RXRα:PPARγ heterodimer, instead of RXR-response element (RXRE) mediated by RXRα:RXRα homodimer. To further elucidate the molecular basis for magnolol agonism, we determine both the co-crystal structures of RXRα and PPARγ ligand-binding domains (LBDs) with magnolol. Structural analyses reveal that magnolol adopts its two 5-allyl-2-hydroxyphenyl moieties occupying the acidic and hydrophobic cavities of RXRα L-shaped ligand-binding pocket, respectively. While, two magnolol molecules cooperatively accommodate into PPARγ Y-shaped ligand-binding pocket. Based on these two complex structures, the key interactions for magnolol activating RXRα and PPARγ are determined. As the first report on the dual agonist targeting RXRα and PPARγ with receptor-ligand complex structures, our results are thus expected to help inspect the potential pharmacological mechanism for magnolol functions, and supply useful hits for nuclear receptor multi-target ligand design. PMID:22140563
Binding modes of dihydroquinoxalinones in a homology model of bradykinin receptor 1.
Ha, Sookhee N; Hey, Pat J; Ransom, Rick W; Harrell, C Meacham; Murphy, Kathryn L; Chang, Ray; Chen, Tsing-Bau; Su, Dai-Shi; Markowitz, M Kristine; Bock, Mark G; Freidinger, Roger M; Hess, Fred J
2005-05-27
We report the first homology model of human bradykinin receptor B1 generated from the crystal structure of bovine rhodopsin as a template. Using an automated docking procedure, two B1 receptor antagonists of the dihydroquinoxalinone structural class were docked into the receptor model. Site-directed mutagenesis data of the amino acid residues in TM1, TM3, TM6, and TM7 were incorporated to place the compounds in the binding site of the homology model of the human B1 bradykinin receptor. The best pose in agreement with the mutation data was selected for detailed study of the receptor-antagonist interaction. To test the model, the calculated antagonist-receptor binding energy was correlated with the experimentally measured binding affinity (K(i)) for nine dihydroquinoxalinone analogs. The model was used to gain insight into the molecular mechanism for receptor function and to optimize the dihydroquinoxalinone analogs.
Singh, Anamika; Wilczynski, Andrzej; Holder, Jerry R.; Witek, Rachel M.; Dirain, Marvin L.; Xiang, Zhimin; Edison, Arthur S.; Haskell-Luevano, Carrie
2011-01-01
Using a solid-phase synthetic approach, a bioactive reverse turn heterocyclic was incorporated into a cyclic peptide template to probe melanocortin receptor potency and ligand structural conformations. The five melanocortin receptor isoforms (MC1R-MC5R) are G-protein coupled receptors (GPCRs) that are regulated by endogenous agonists and antagonists. This pathway is involved in pigmentation, weight, and energy homeostasis. Herein, we report novel analogues of the chimeric AGRP-melanocortin peptide template integrated with a small molecule moiety to probe the structural and functional consequences of the core His-Phe-Arg-Trp peptide domain using a reverse-turn heterocycle. A series of six compounds are reported that result in inactive to full agonists with nM potency. Biophysical structural analysis [2D 1H NMR and computer-assisted molecular modeling (CAMM)] were performed on selected analogues, resulting in the identification that these peptide-small molecule hybrids possessed increased flexibility and fewer discrete conformational families as compared to the reference peptide and result in a novel template for further structure-function studies. PMID:21306168
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schkeryantz, Jeffery M.; Chen, Qi; Ho, Joseph D.
Here, L-2-Amino-4-phosphonobutyric acid (L-AP4) is a known potent and selective agonist for the Group III mGlu receptors. However, it does not show any selectivity among the individual group III mGlu subtypes. In order to understand the molecular basis for this group selectivity, we solved the first human mGlu8 amino terminal domain (ATD) crystal structures in complex with L-glu and L-AP4. In comparison with other published L-glu-bound mGlu ATD structures, we have observed L-glu binds in a significantly different manner in mGlu1. Furthermore, these new structures provided evidence that both the electronic and steric nature of the distal phosphate of L-AP4more » contribute to its exquisite Group III functional agonist potency and selectivity.« less
Molecular targeting of growth factor receptor-bound 2 (Grb2) as an anti-cancer strategy.
Dharmawardana, Pathirage G; Peruzzi, Benedetta; Giubellino, Alessio; Burke, Terrence R; Bottaro, Donald P
2006-01-01
Growth factor receptor-bound 2 (Grb2) is a ubiquitously expressed adapter protein that provides a critical link between cell surface growth factor receptors and the Ras signaling pathway. As such, it has been implicated in the oncogenesis of several important human malignancies. In addition to this function, research over the last decade has revealed other fundamental roles for Grb2 in cell motility and angiogenesis--processes that also contribute to tumor growth, invasiveness and metastasis. This functional profile makes Grb2 a high priority target for anti-cancer drug development. Knowledge of Grb2 protein structure, its component Src homology domains and their respective structure-function relationships has facilitated the rapid development of sophisticated drug candidates that can penetrate cells, bind Grb2 with high affinity and potently antagonize Grb2 signaling. These novel compounds offer considerable promise in our growing arsenal of rationally designed anti-cancer therapeutics.
Gahbauer, Stefan; Pluhackova, Kristyna
2018-01-01
Chemokine receptors, a subclass of G protein coupled receptors (GPCRs), play essential roles in the human immune system, they are involved in cancer metastasis as well as in HIV-infection. A plethora of studies show that homo- and heterodimers or even higher order oligomers of the chemokine receptors CXCR4, CCR5, and CCR2 modulate receptor function. In addition, membrane cholesterol affects chemokine receptor activity. However, structural information about homo- and heterodimers formed by chemokine receptors and their interplay with cholesterol is limited. Here, we report homo- and heterodimer configurations of the chemokine receptors CXCR4, CCR5, and CCR2 at atomistic detail, as obtained from thousands of molecular dynamics simulations. The observed homodimerization patterns were similar for the closely related CC chemokine receptors, yet they differed significantly between the CC receptors and CXCR4. Despite their high sequence identity, cholesterol modulated the CC homodimer interfaces in a subtype-specific manner. Chemokine receptor heterodimers display distinct dimerization patterns for CXCR4/CCR5 and CXCR4/CCR2. Furthermore, associations between CXCR4 and CCR5 reveal an increased cholesterol-sensitivity as compared to CXCR4/CCR2 heterodimerization patterns. This work provides a first comprehensive structural overview over the complex interaction network between chemokine receptors and indicates how heterodimerization and the interaction with the membrane environment diversifies the function of closely related GPCRs. PMID:29529028
Structure of an agonist-bound ionotropic glutamate receptor.
Yelshanskaya, Maria V; Li, Minfen; Sobolevsky, Alexander I
2014-08-29
Ionotropic glutamate receptors (iGluRs) mediate most excitatory neurotransmission in the central nervous system and function by opening their ion channel in response to binding of agonist glutamate. Here, we report a structure of a homotetrameric rat GluA2 receptor in complex with partial agonist (S)-5-nitrowillardiine. Comparison of this structure with the closed-state structure in complex with competitive antagonist ZK 200775 suggests conformational changes that occur during iGluR gating. Guided by the structures, we engineered disulfide cross-links to probe domain interactions that are important for iGluR gating events. The combination of structural information, kinetic modeling, and biochemical and electrophysiological experiments provides insight into the mechanism of iGluR gating. Copyright © 2014, American Association for the Advancement of Science.
Renal dopamine containing nerves. What is their functional significance?
DiBona, G F
1990-06-01
Biochemical and morphological studies indicate that there are nerves within the kidney that contain dopamine and that various structures within the kidney contain dopamine receptors. However, the functional significance of these renal dopamine containing nerves in relation to renal dopamine receptors is unknown. The functional significance could be defined by demonstrating that an alteration in one or more renal functions occurring in response to reflex or electrical activation of efferent renal nerves is dependent on release of dopamine as the neurotransmitter from the renal nerve terminals acting on renal dopamine receptors. Thus, the hypothesis becomes: reflex or electrical activation of efferent renal nerves causes alterations in renal function (eg, renal blood flow, water and solute handling) that are inhibited by specific and selective dopamine receptor antagonists. As reviewed herein, the published experimental data do not support the hypothesis. Therefore, the view that alterations in one or more renal functions occurring in response to reflex or electrical activation of efferent renal nerves are dependent on release of dopamine as the neurotransmitter from the renal nerve terminals acting on renal dopamine receptors remains unproven.
Melanocortin 1 Receptor: Structure, Function, and Regulation
Wolf Horrell, Erin M.; Boulanger, Mary C.; D’Orazio, John A.
2016-01-01
The melanocortin 1 receptor (MC1R) is a melanocytic Gs protein coupled receptor that regulates skin pigmentation, UV responses, and melanoma risk. It is a highly polymorphic gene, and loss of function correlates with a fair, UV-sensitive, and melanoma-prone phenotype due to defective epidermal melanization and sub-optimal DNA repair. MC1R signaling, achieved through adenylyl cyclase activation and generation of the second messenger cAMP, is hormonally controlled by the positive agonist melanocortin, the negative agonist agouti signaling protein, and the neutral antagonist β-defensin 3. Activation of cAMP signaling up-regulates melanin production and deposition in the epidermis which functions to limit UV penetration into the skin and enhances nucleotide excision repair (NER), the genomic stability pathway responsible for clearing UV photolesions from DNA to avoid mutagenesis. Herein we review MC1R structure and function and summarize our laboratory’s findings on the molecular mechanisms by which MC1R signaling impacts NER. PMID:27303435
Platelet dysfunction associated with the novel Trp29Cys thromboxane A₂ receptor variant.
Mumford, A D; Nisar, S; Darnige, L; Jones, M L; Bachelot-Loza, C; Gandrille, S; Zinzindohoue, F; Fischer, A-M; Mundell, S J; Gaussem, P
2013-03-01
Genetic variations that affect the structure of the thromboxane A2 receptor (TP receptor) provide insights into the function of this key platelet and vascular receptor, but are very rare in unselected populations. To determine the functional consequences of the TP receptor Trp29Cys (W29C) substitution. We performed a detailed phenotypic analysis of an index case (P1) with reduced platelet aggregation and secretion responses to TP receptor pathway activators, and a heterozygous TP receptor W29C substitution. An analysis of the variant W29C TP receptor expressed in heterologous cells was performed. Total TP receptor expression in platelets from P1 was similar to that of controls, but there was reduced maximum binding and reduced affinity of binding to the TP receptor antagonist [(3) H]SQ29548. HEK293 cells transfected with W29C TP receptor cDNA showed similar total TP receptor expression to wild-type (WT) controls. However, the TP receptor agonist U46619 was less potent at inducing rises in cytosolic free Ca(2+) in HEK293 cells expressing the W29C TP receptor than in WT controls, indicating reduced receptor function. Immunofluorescence microscopy and cell surface ELISA showed intracellular retention and reduced cell surface expression of the W29C TP receptor in HEK293 cells. Consistent with the platelet phenotype, both maximum binding and the affinity of binding of [(3) H]SQ29548 to the W29C TP receptor were reduced compared to WT controls. These findings extend the phenotypic description of the very rare disorder TP receptor deficiency, and show that the W29C substitution reduces TP receptor function by reducing surface receptor expression and by disrupting ligand binding. © 2012 International Society on Thrombosis and Haemostasis.
Vibrational resonance, allostery, and activation in rhodopsin-like G protein-coupled receptors
Woods, Kristina N.; Pfeffer, Jürgen; Dutta, Arpana; Klein-Seetharaman, Judith
2016-01-01
G protein-coupled receptors are a large family of membrane proteins activated by a variety of structurally diverse ligands making them highly adaptable signaling molecules. Despite recent advances in the structural biology of this protein family, the mechanism by which ligands induce allosteric changes in protein structure and dynamics for its signaling function remains a mystery. Here, we propose the use of terahertz spectroscopy combined with molecular dynamics simulation and protein evolutionary network modeling to address the mechanism of activation by directly probing the concerted fluctuations of retinal ligand and transmembrane helices in rhodopsin. This approach allows us to examine the role of conformational heterogeneity in the selection and stabilization of specific signaling pathways in the photo-activation of the receptor. We demonstrate that ligand-induced shifts in the conformational equilibrium prompt vibrational resonances in the protein structure that link the dynamics of conserved interactions with fluctuations of the active-state ligand. The connection of vibrational modes creates an allosteric association of coupled fluctuations that forms a coherent signaling pathway from the receptor ligand-binding pocket to the G-protein activation region. Our evolutionary analysis of rhodopsin-like GPCRs suggest that specific allosteric sites play a pivotal role in activating structural fluctuations that allosterically modulate functional signals. PMID:27849063
AutoDockFR: Advances in Protein-Ligand Docking with Explicitly Specified Binding Site Flexibility
Ravindranath, Pradeep Anand; Forli, Stefano; Goodsell, David S.; Olson, Arthur J.; Sanner, Michel F.
2015-01-01
Automated docking of drug-like molecules into receptors is an essential tool in structure-based drug design. While modeling receptor flexibility is important for correctly predicting ligand binding, it still remains challenging. This work focuses on an approach in which receptor flexibility is modeled by explicitly specifying a set of receptor side-chains a-priori. The challenges of this approach include the: 1) exponential growth of the search space, demanding more efficient search methods; and 2) increased number of false positives, calling for scoring functions tailored for flexible receptor docking. We present AutoDockFR–AutoDock for Flexible Receptors (ADFR), a new docking engine based on the AutoDock4 scoring function, which addresses the aforementioned challenges with a new Genetic Algorithm (GA) and customized scoring function. We validate ADFR using the Astex Diverse Set, demonstrating an increase in efficiency and reliability of its GA over the one implemented in AutoDock4. We demonstrate greatly increased success rates when cross-docking ligands into apo receptors that require side-chain conformational changes for ligand binding. These cross-docking experiments are based on two datasets: 1) SEQ17 –a receptor diversity set containing 17 pairs of apo-holo structures; and 2) CDK2 –a ligand diversity set composed of one CDK2 apo structure and 52 known bound inhibitors. We show that, when cross-docking ligands into the apo conformation of the receptors with up to 14 flexible side-chains, ADFR reports more correctly cross-docked ligands than AutoDock Vina on both datasets with solutions found for 70.6% vs. 35.3% systems on SEQ17, and 76.9% vs. 61.5% on CDK2. ADFR also outperforms AutoDock Vina in number of top ranking solutions on both datasets. Furthermore, we show that correctly docked CDK2 complexes re-create on average 79.8% of all pairwise atomic interactions between the ligand and moving receptor atoms in the holo complexes. Finally, we show that down-weighting the receptor internal energy improves the ranking of correctly docked poses and that runtime for AutoDockFR scales linearly when side-chain flexibility is added. PMID:26629955
Automated large-scale purification of a G protein-coupled receptor for neurotensin.
White, Jim F; Trinh, Loc B; Shiloach, Joseph; Grisshammer, Reinhard
2004-04-30
Structure determination of integral membrane proteins requires milligram amounts of purified, functional protein on a regular basis. Here, we describe a protocol for the purification of a G protein-coupled neurotensin receptor fusion protein at the 3-mg or 10-mg level using immobilized metal affinity chromatography and a neurotensin column in a fully automated mode. Fermentation at a 200-l scale of Escherichia coli expressing functional receptors provides the material needed to feed into the purification routine. Constructs with tobacco etch virus protease recognition sites at either end of the receptor allow the isolation of neurotensin receptor devoid of its fusion partners. The presented expression and purification procedures are simple and robust, and provide the basis for crystallization experiments of receptors on a routine basis.
Protease‐activated receptor 4: from structure to function and back again
French, Shauna L
2016-01-01
Protease‐activated receptors are a family of four GPCRs (PAR1–PAR4) with a number of unique attributes. Nearly two and a half decades after the discovery of the first PAR, an antagonist targeting this receptor has been approved for human use. The first‐in‐class PAR1 antagonist, vorapaxar, was approved for use in the USA in 2014 for the prevention of thrombotic cardiovascular events in patients with a history of myocardial infarction or with peripheral arterial disease. These recent developments indicate the clinical potential of manipulating PAR function. While much work has been aimed at uncovering the function of PAR1 and, to a lesser extent, PAR2, comparatively little is known regarding the pharmacology and physiology of PAR3 and PAR4. Recent studies have begun to develop the pharmacological and genetic tools required to study PAR4 function in detail, and there is now emerging evidence for the function of PAR4 in disease settings. In this review, we detail the discovery, structure, pharmacology, physiological significance and therapeutic potential of PAR4. Linked Articles This article is part of a themed section on Molecular Pharmacology of G Protein‐Coupled Receptors. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v173.20/issuetoc PMID:26844674
Nie, Zhongzhen; Hirsch, Dianne S; Luo, Ruibai; Jian, Xiaoying; Stauffer, Stacey; Cremesti, Aida; Andrade, Josefa; Lebowitz, Jacob; Marino, Michael; Ahvazi, Bijan; Hinshaw, Jenny E; Randazzo, Paul A
2006-01-24
Arf GAPs are multidomain proteins that function in membrane traffic by inactivating the GTP binding protein Arf1. Numerous Arf GAPs contain a BAR domain, a protein structural element that contributes to membrane traffic by either inducing or sensing membrane curvature. We have examined the role of a putative BAR domain in the function of the Arf GAP ASAP1. ASAP1's N terminus, containing the putative BAR domain together with a PH domain, dimerized to form an extended structure that bound to large unilamellar vesicles containing acidic phospholipids, properties that define a BAR domain. A recombinant protein containing the BAR domain of ASAP1, together with the PH and Arf GAP domains, efficiently bent the surface of large unilamellar vesicles, resulting in the formation of tubular structures. This activity was regulated by Arf1*GTP binding to the Arf GAP domain. In vivo, the tubular structures induced by ASAP1 mutants contained epidermal growth factor receptor (EGFR) and Rab11, and ASAP1 colocalized in tubular structures with EGFR during recycling of receptor. Expression of ASAP1 accelerated EGFR trafficking and slowed cell spreading. An ASAP1 mutant lacking the BAR domain had no effect. The N-terminal BAR domain of ASAP1 mediates membrane bending and is necessary for ASAP1 function. The Arf dependence of the bending activity is consistent with ASAP1 functioning as an Arf effector.
Sengupta, Durba; Prasanna, Xavier; Mohole, Madhura; Chattopadhyay, Amitabha
2018-06-07
Gprotein-coupled receptors (GPCRs) are seven transmembrane receptors that mediate a large number of cellular responses and are important drug targets. One of the current challenges in GPCR biology is to analyze the molecular signatures of receptor-lipid interactions and their subsequent effects on GPCR structure, organization, and function. Molecular dynamics simulation studies have been successful in predicting molecular determinants of receptor-lipid interactions. In particular, predicted cholesterol interaction sites appear to correspond well with experimentally determined binding sites and estimated time scales of association. In spite of several success stories, the methodologies in molecular dynamics simulations are still emerging. In this Feature Article, we provide a comprehensive overview of coarse-grain and atomistic molecular dynamics simulations of GPCR-lipid interaction in the context of experimental observations. In addition, we discuss the effect of secondary and tertiary structural constraints in coarse-grain simulations in the context of functional dynamics and structural plasticity of GPCRs. We envision that this comprehensive overview will help resolve differences in computational studies and provide a way forward.
The family B1 GPCR: structural aspects and interaction with accessory proteins.
Couvineau, Alain; Laburthe, Marc
2012-01-01
G protein coupled receptors (GPCRs) play a crucial role in physiology and pathophysiology in humans. Beside the large family A (rhodopsin-like receptors) and family C GPCR (metabotropic glutamate receptors), the small family B1 GPCR (secretin-like receptors) includes important receptors such as vasoactive intestinal peptide receptors (VPAC), pituitary adenylyl cyclase activating peptide receptor (PAC1R), secretin receptor (SECR), growth hormone releasing factor receptor (GRFR), glucagon receptor (GCGR), glucagon like-peptide 1 and 2 receptors (GLPR), gastric inhibitory peptide receptor (GIPR), parathyroid hormone receptors (PTHR), calcitonin receptors (CTR) and corticotropin-releasing factor receptors (CRFR). They represent very promising targets for the development of drugs having therapeutical impact on many diseases such as chronic inflammation, neurodegeneration, diabetes, stress and osteoporosis. Over the past decade, structure-function relationship studies have demonstrated that the N-terminal ectodomain (N-ted) of family B1 receptors plays a pivotal role in natural ligand recognition. Structural analysis of some family B1 GPCR N-teds revealed the existence of a Sushi domain fold consisting of two antiparallel β sheets stabilized by three disulfide bonds and a salt bridge. The family B1 GPCRs promote cellular responses through a signaling pathway including predominantly the Gsadenylyl cyclase-cAMP pathway activation. Family B1 GPCRs also interact with a few accessory proteins which play a role in cell signaling, receptor expression and/or pharmacological profiles of receptors. These accessory proteins may represent new targets for the design of new drugs. Here, we review the current knowledge regarding: i) the structure of family B1 GPCR binding domain for natural ligands and ii) the interaction of family B1 GPCRs with accessory proteins.
Ligand-biased ensemble receptor docking (LigBEnD): a hybrid ligand/receptor structure-based approach
NASA Astrophysics Data System (ADS)
Lam, Polo C.-H.; Abagyan, Ruben; Totrov, Maxim
2018-01-01
Ligand docking to flexible protein molecules can be efficiently carried out through ensemble docking to multiple protein conformations, either from experimental X-ray structures or from in silico simulations. The success of ensemble docking often requires the careful selection of complementary protein conformations, through docking and scoring of known co-crystallized ligands. False positives, in which a ligand in a wrong pose achieves a better docking score than that of native pose, arise as additional protein conformations are added. In the current study, we developed a new ligand-biased ensemble receptor docking method and composite scoring function which combine the use of ligand-based atomic property field (APF) method with receptor structure-based docking. This method helps us to correctly dock 30 out of 36 ligands presented by the D3R docking challenge. For the six mis-docked ligands, the cognate receptor structures prove to be too different from the 40 available experimental Pocketome conformations used for docking and could be identified only by receptor sampling beyond experimentally explored conformational subspace.
Qiu, Shenfeng; Lu, Zhongming; Levitt, Pat
2014-12-03
The MET receptor tyrosine kinase (RTK), implicated in risk for autism spectrum disorder (ASD) and in functional and structural circuit integrity in humans, is a temporally and spatially regulated receptor enriched in dorsal pallial-derived structures during mouse forebrain development. Here we report that loss or gain of function of MET in vitro or in vivo leads to changes, opposite in nature, in dendritic complexity, spine morphogenesis, and the timing of glutamatergic synapse maturation onto hippocampus CA1 neurons. Consistent with the morphological and biochemical changes, deletion of Met in mutant mice results in precocious maturation of excitatory synapse, as indicated by a reduction of the proportion of silent synapses, a faster GluN2A subunit switch, and an enhanced acquisition of AMPA receptors at synaptic sites. Thus, MET-mediated signaling appears to serve as a mechanism for controlling the timing of neuronal growth and functional maturation. These studies suggest that mistimed maturation of glutamatergic synapses leads to the aberrant neural circuits that may be associated with ASD risk. Copyright © 2014 the authors 0270-6474/14/3416166-14$15.00/0.
Lu, Zhongming; Levitt, Pat
2014-01-01
The MET receptor tyrosine kinase (RTK), implicated in risk for autism spectrum disorder (ASD) and in functional and structural circuit integrity in humans, is a temporally and spatially regulated receptor enriched in dorsal pallial-derived structures during mouse forebrain development. Here we report that loss or gain of function of MET in vitro or in vivo leads to changes, opposite in nature, in dendritic complexity, spine morphogenesis, and the timing of glutamatergic synapse maturation onto hippocampus CA1 neurons. Consistent with the morphological and biochemical changes, deletion of Met in mutant mice results in precocious maturation of excitatory synapse, as indicated by a reduction of the proportion of silent synapses, a faster GluN2A subunit switch, and an enhanced acquisition of AMPA receptors at synaptic sites. Thus, MET-mediated signaling appears to serve as a mechanism for controlling the timing of neuronal growth and functional maturation. These studies suggest that mistimed maturation of glutamatergic synapses leads to the aberrant neural circuits that may be associated with ASD risk. PMID:25471559
Wu, Zhen; Liang, Shan; Song, Wen; Lin, Guangzhong; Wang, Weiguang; Zhang, Heqiao; Han, Zhifu; Chai, Jijie
2017-01-01
Leucine-rich repeat receptor-like kinases (LRR-RLKs) are widespread in different plant species and play important roles in growth and development. Germination inhibition is vital for the completion of seed maturation and cell expansion is a fundamental cellular process driving plant growth. Here, we report genetic and structural characterizations of a functionally uncharacterized LRR-RLK, named GRACE (Germination Repression and Cell Expansion receptor-like kinase). Overexpression of GRACE in Arabidopsis exhibited delayed germination, enlarged cotyledons, rosette leaves and stubbier petioles. Conversely, these phenotypes were reversed in the T-DNA insertion knock-down mutant grace-1 plants. A crystal structure of the extracellular domain of GRACE (GRACE-LRR) determined at the resolution of 3.0 Å revealed that GRACE-LRR assumed a right-handed super-helical structure with an island domain (ID). Structural comparison showed that structure of the ID in GRACE-LRR is strikingly different from those observed in other LRR-RLKs. This structural observation implies that GRACE might perceive a new ligand for signaling. Collectively, our data support roles of GRACE in repressing seed germination and promoting cell expansion of Arabidopsis , presumably by perception of unknown ligand(s).
Wu, Zhen; Liang, Shan; Song, Wen; Lin, Guangzhong; Wang, Weiguang; Zhang, Heqiao; Han, Zhifu; Chai, Jijie
2017-01-01
Leucine-rich repeat receptor-like kinases (LRR-RLKs) are widespread in different plant species and play important roles in growth and development. Germination inhibition is vital for the completion of seed maturation and cell expansion is a fundamental cellular process driving plant growth. Here, we report genetic and structural characterizations of a functionally uncharacterized LRR-RLK, named GRACE (Germination Repression and Cell Expansion receptor-like kinase). Overexpression of GRACE in Arabidopsis exhibited delayed germination, enlarged cotyledons, rosette leaves and stubbier petioles. Conversely, these phenotypes were reversed in the T-DNA insertion knock-down mutant grace-1 plants. A crystal structure of the extracellular domain of GRACE (GRACE-LRR) determined at the resolution of 3.0 Å revealed that GRACE-LRR assumed a right-handed super-helical structure with an island domain (ID). Structural comparison showed that structure of the ID in GRACE-LRR is strikingly different from those observed in other LRR-RLKs. This structural observation implies that GRACE might perceive a new ligand for signaling. Collectively, our data support roles of GRACE in repressing seed germination and promoting cell expansion of Arabidopsis, presumably by perception of unknown ligand(s). PMID:29213277
Männel, Barbara; Jaiteh, Mariama; Zeifman, Alexey; Randakova, Alena; Möller, Dorothee; Hübner, Harald; Gmeiner, Peter; Carlsson, Jens
2017-10-20
Functionally selective ligands stabilize conformations of G protein-coupled receptors (GPCRs) that induce a preference for signaling via a subset of the intracellular pathways activated by the endogenous agonists. The possibility to fine-tune the functional activity of a receptor provides opportunities to develop drugs that selectively signal via pathways associated with a therapeutic effect and avoid those causing side effects. Animal studies have indicated that ligands displaying functional selectivity at the D 2 dopamine receptor (D 2 R) could be safer and more efficacious drugs against neuropsychiatric diseases. In this work, computational design of functionally selective D 2 R ligands was explored using structure-based virtual screening. Molecular docking of known functionally selective ligands to a D 2 R homology model indicated that such compounds were anchored by interactions with the orthosteric site and extended into a common secondary pocket. A tailored virtual library with close to 13 000 compounds bearing 2,3-dichlorophenylpiperazine, a privileged orthosteric scaffold, connected to diverse chemical moieties via a linker was docked to the D 2 R model. Eighteen top-ranked compounds that occupied both the orthosteric and allosteric site were synthesized, leading to the discovery of 16 partial agonists. A majority of the ligands had comparable maximum effects in the G protein and β-arrestin recruitment assays, but a subset displayed preference for a single pathway. In particular, compound 4 stimulated β-arrestin recruitment (EC 50 = 320 nM, E max = 16%) but had no detectable G protein signaling. The use of structure-based screening and virtual libraries to discover GPCR ligands with tailored functional properties will be discussed.
Structural insights into the interaction of IL-33 with its receptors.
Liu, Xi; Hammel, Michal; He, Yanfeng; Tainer, John A; Jeng, U-Ser; Zhang, Linqi; Wang, Shuying; Wang, Xinquan
2013-09-10
Interleukin (IL)-33 is an important member of the IL-1 family that has pleiotropic activities in innate and adaptive immune responses in host defense and disease. It signals through its ligand-binding primary receptor ST2 and IL-1 receptor accessory protein (IL-1RAcP), both of which are members of the IL-1 receptor family. To clarify the interaction of IL-33 with its receptors, we determined the crystal structure of IL-33 in complex with the ectodomain of ST2 at a resolution of 3.27 Å. Coupled with structure-based mutagenesis and binding assay, the structural results define the molecular mechanism by which ST2 specifically recognizes IL-33. Structural comparison with other ligand-receptor complexes in the IL-1 family indicates that surface-charge complementarity is critical in determining ligand-binding specificity of IL-1 primary receptors. Combined crystallography and small-angle X-ray-scattering studies reveal that ST2 possesses hinge flexibility between the D3 domain and D1D2 module, whereas IL-1RAcP exhibits a rigid conformation in the unbound state in solution. The molecular flexibility of ST2 provides structural insights into domain-level conformational change of IL-1 primary receptors upon ligand binding, and the rigidity of IL-1RAcP explains its inability to bind ligands directly. The solution architecture of IL-33-ST2-IL-1RAcP complex from small-angle X-ray-scattering analysis resembles IL-1β-IL-1RII-IL-1RAcP and IL-1β-IL-1RI-IL-1RAcP crystal structures. The collective results confer IL-33 structure-function relationships, supporting and extending a general model for ligand-receptor assembly and activation in the IL-1 family.
What is special about the adolescent (JME) brain?
Craiu, Dana
2013-07-01
Juvenile myoclonic epilepsy (JME) involves cortico-thalamo-cortical networks. Thalamic, frontal gray matter, connectivity, and neurotransmitter disturbances have been demonstrated by structural/functional imaging studies. Few patients with JME show mutations in genes coding ion channels or GABAA (gamma-aminobutyric acid) receptor subunits. Recent research points to EFHC1 gene mutations leading to microdysgenesis and possible aberrant circuitry. Imaging studies have shown massive structural/functional changes of normally developing adolescent brain structures maturing at strikingly different rates and times. Gray matter (GM) volume diminishes in cortical areas (frontal and parietal) and deep structures (anterior thalamus, putamen, and caudate). Diffusion tensor imaging (DTI) findings support continued microstructural change in WM (white matter) during late adolescence with robust developmental changes in thalamocortical connectivity. The GABAA receptor distribution and specific receptor subunits' expression patterns change with age from neonate to adolescent/adult, contributing to age-related changes in brain excitability. Hormonal influence on brain structure development during adolescence is presented. Possible implications of brain changes during adolescence on the course of JME are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.
Crystal Structure of the FERM-SH2 Module of Human Jak2.
McNally, Randall; Toms, Angela V; Eck, Michael J
2016-01-01
Jak-family tyrosine kinases mediate signaling from diverse cytokine receptors. Binding of Jaks to their cognate receptors is mediated by their N-terminal region, which contains FERM and SH2 domains. Here we describe the crystal structure of the FERM-SH2 region of Jak2 at 3.0Å resolution. The structure reveals that these domains and their flanking linker segments interact intimately to form an integrated structural module. The Jak2 FERM-SH2 structure closely resembles that recently described for Tyk2, another member of the Jak family. While the overall architecture and interdomain orientations are preserved between Jak2 and Tyk2, we identify residues in the putative receptor-binding groove that differ between the two and may contribute to the specificity of receptor recognition. Analysis of Jak mutations that are reported to disrupt receptor binding reveals that they lie in the hydrophobic core of the FERM domain, and are thus expected to compromise the structural integrity of the FERM-SH2 unit. Similarly, analysis of mutations in Jak3 that are associated with severe combined immunodeficiency suggests that they compromise Jak3 function by destabilizing the FERM-SH2 structure.
Ionotropic and metabotropic glutamate receptor structure and pharmacology.
Kew, James N C; Kemp, John A
2005-04-01
L: -Glutamate is the major excitatory neurotransmitter in the central nervous system (CNS) and mediates its actions via activation of both ionotropic and metabotropic receptor families. The development of selective ligands, including competitive agonists and antagonists and positive and negative allosteric modulators, has enabled investigation of the functional roles of glutamate receptor family members. In this review we describe the subunit structure and composition of the ionotropic and metabotropic glutamate receptors and discuss their pharmacology, particularly with respect to selective tools useful for investigation of their function in the CNS. A large number of ligands are now available that are selective either for glutamate receptor subfamilies or for particular receptor subtypes. Such ligands have enabled considerable advances in the elucidation of the physiological and pathophysiological roles of receptor family members. Furthermore, efficacy in animal models of neurological and psychiatric disorders has supported the progression of several glutamatergic ligands into clinical studies. These include ionotropic glutamate receptor antagonists, which have entered clinical trials for disorders including epilepsy and ischaemic stroke, alpha-amino-3-hydroxy-5-methyl-4-isoazolepropionic acid (AMPA) receptor positive allosteric modulators which are under evaluation as cognitive enhancers, and metabotropic glutamate receptor 2 (mGluR2) agonists which are undergoing clinical evaluation as anxiolytics. Furthermore, preclinical studies have illustrated therapeutic potential for ligands selective for other receptor subtypes in various disorders. These include mGluR1 antagonists in pain, mGluR5 antagonists in anxiety, pain and drug abuse and mGluR5 positive allosteric modulators in schizophrenia. Selective pharmacological tools have enabled the study of glutamate receptors. However, pharmacological coverage of the family is incomplete and considerable scope remains for the development of novel ligands, particularly those with in vivo utility, and for the their use together with existing tools for the further investigation of the roles of receptor family members in CNS function and as potentially novel therapeutics.
Structure-guided development of dual β2 adrenergic/dopamine D2 receptor agonists.
Weichert, Dietmar; Stanek, Markus; Hübner, Harald; Gmeiner, Peter
2016-06-15
Aiming to discover dual-acting β2 adrenergic/dopamine D2 receptor ligands, a structure-guided approach for the evolution of GPCR agonists that address multiple targets was elaborated. Starting from GPCR crystal structures, we describe the design, synthesis and biological investigation of a defined set of compounds leading to the identification of the benzoxazinone (R)-3, which shows agonist properties at the adrenergic β2 receptor and substantial G protein-promoted activation at the D2 receptor. This directed approach yielded molecular probes with tuned dual activity. The congener desOH-3 devoid of the benzylic hydroxyl function was shown to be a β2 adrenergic antagonist/D2 receptor agonist with Ki values in the low nanomolar range. The compounds may serve as a promising starting point for the investigation and treatment of neurological disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.
Bloch, Yehudi; Bouchareychas, Laura; Merceron, Romain; Składanowska, Katarzyna; Van den Bossche, Lien; Detry, Sammy; Govindarajan, Srinath; Elewaut, Dirk; Haerynck, Filomeen; Dullaers, Melissa; Adamopoulos, Iannis E; Savvides, Savvas N
2018-01-16
Interleukin-23 (IL-23), an IL-12 family cytokine, plays pivotal roles in pro-inflammatory T helper 17 cell responses linked to autoimmune and inflammatory diseases. Despite intense therapeutic targeting, structural and mechanistic insights into receptor complexes mediated by IL-23, and by IL-12 family members in general, have remained elusive. We determined a crystal structure of human IL-23 in complex with its cognate receptor, IL-23R, and revealed that IL-23R bound to IL-23 exclusively via its N-terminal immunoglobulin domain. The structural and functional hotspot of this interaction partially restructured the helical IL-23p19 subunit of IL-23 and restrained its IL-12p40 subunit to cooperatively bind the shared receptor IL-12Rβ1 with high affinity. Together with structural insights from the interaction of IL-23 with the inhibitory antibody briakinumab and by leveraging additional IL-23:antibody complexes, we propose a mechanistic paradigm for IL-23 and IL-12 whereby cognate receptor binding to the helical cytokine subunits primes recruitment of the shared receptors via the IL-12p40 subunit. Copyright © 2017 Elsevier Inc. All rights reserved.
Signaling and sensory adaptation in Escherichia coli chemoreceptors: 2015 update
Parkinson, John S.; Hazelbauer, Gerald L.; Falke, Joseph J.
2015-01-01
Motile Escherichia coli cells track gradients of attractant and repellent chemicals in their environment with transmembrane chemoreceptor proteins. These receptors operate in cooperative arrays to produce large changes in the activity of a signaling kinase CheA in response to small changes in chemoeffector concentration. Recent research has provided much deeper understanding of the structure and function of core receptor signaling complexes and the architecture of higher-order receptor arrays, which in turn has led to new insights into the molecular signaling mechanisms of chemoreceptor networks. Current evidence supports a new view of receptor signaling in which stimulus information travels within receptor molecules through shifts in the dynamic properties of adjoining structural elements rather than through a few discrete conformational states. PMID:25834953
NASA Astrophysics Data System (ADS)
Miledi, R.; Dueñas, Z.; Martinez-Torres, A.; Kawas, C. H.; Eusebi, F.
2004-02-01
About a decade ago, cell membranes from the electric organ of Torpedo and from the rat brain were transplanted to frog oocytes, which thus acquired functional Torpedo and rat neurotransmitter receptors. Nevertheless, the great potential that this method has for studying human diseases has remained virtually untapped. Here, we show that cell membranes from the postmortem brains of humans that suffered Alzheimer's disease can be microtransplanted to the plasma membrane of Xenopus oocytes. We show also that these postmortem membranes carry neurotransmitter receptors and voltage-operated channels that are still functional, even after they have been kept frozen for many years. This method provides a new and powerful approach to study directly the functional characteristics and structure of receptors, channels, and other membrane proteins of the Alzheimer's brain. This knowledge may help in understanding the basis of Alzheimer's disease and also help in developing new treatments. -aminobutyric acid receptors | sodium channels | calcium channels | postmortem brain
Blocker, Kory M; Britton, Zachary T; Naranjo, Andrea N; McNeely, Patrick M; Young, Carissa L; Robinson, Anne S
2015-01-01
G protein-coupled receptors (GPCRs) are membrane proteins that mediate signaling across the cellular membrane and facilitate cellular responses to external stimuli. Due to the critical role that GPCRs play in signal transduction, therapeutics have been developed to influence GPCR function without an extensive understanding of the receptors themselves. Closing this knowledge gap is of paramount importance to improving therapeutic efficacy and specificity, where efforts to achieve this end have focused chiefly on improving our knowledge of the structure-function relationship. The purpose of this chapter is to review methods for the heterologous expression of GPCRs in Saccharomyces cerevisiae, including whole-cell assays that enable quantitation of expression, localization, and function in vivo. In addition, we describe methods for the micellular solubilization of the human adenosine A2a receptor and for reconstitution of the receptor in liposomes that have enabled its biophysical characterization. © 2015 Elsevier Inc. All rights reserved.
Misono, Kunio S; Ogawa, Haruo; Qiu, Yue; Ogata, Craig M
2005-06-01
The atrial natriuretic peptide (ANP) receptor is a single-span transmembrane receptor that is coupled to its intrinsic intracellular guanylate cyclase (GCase) catalytic activity. To investigate the mechanisms of hormone binding and signal transduction, we have expressed the extracellular hormone-binding domain of the ANP receptor (ANPR) and characterized its structure and function. The disulfide-bond structure, state of glycosylation, binding-site residues, chloride-dependence of ANP binding, dimerization, and binding stoichiometry have been determined. More recently, the crystal structures of both the apoANPR dimer and ANP-bound complex have been determined. The structural comparison between the two has shown that, upon ANP binding, two ANPR molecules in the dimer undergo an inter-molecular twist with little intra-molecular conformational change. This motion produces a Ferris wheel-like translocation of two juxtamembrane domains with essentially no change in the inter-domain distance. This movement alters the relative orientation of the two domains equivalent to counter-clockwise rotation of each by 24 degrees . These results suggest that transmembrane signaling by the ANP receptor is mediated by a novel hormone-induced rotation mechanism.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Granier, Sébastien; Manglik, Aashish; Kruse, Andrew C.
The opioid receptor family comprises three members, the {mu}-, {delta}- and {kappa}-opioid receptors, which respond to classical opioid alkaloids such as morphine and heroin as well as to endogenous peptide ligands like endorphins. They belong to the G-protein-coupled receptor (GPCR) superfamily, and are excellent therapeutic targets for pain control. The {delta}-opioid receptor ({delta}-OR) has a role in analgesia, as well as in other neurological functions that remain poorly understood. The structures of the {mu}-OR and {kappa}-OR have recently been solved. Here we report the crystal structure of the mouse {delta}-OR, bound to the subtype-selective antagonist naltrindole. Together with the structuresmore » of the {mu}-OR and {kappa}-OR, the {delta}-OR structure provides insights into conserved elements of opioid ligand recognition while also revealing structural features associated with ligand-subtype selectivity. The binding pocket of opioid receptors can be divided into two distinct regions. Whereas the lower part of this pocket is highly conserved among opioid receptors, the upper part contains divergent residues that confer subtype selectivity. This provides a structural explanation and validation for the 'message-address' model of opioid receptor pharmacology, in which distinct 'message' (efficacy) and 'address' (selectivity) determinants are contained within a single ligand. Comparison of the address region of the {delta}-OR with other GPCRs reveals that this structural organization may be a more general phenomenon, extending to other GPCR families as well.« less
Functional Mimetics of the HIV-1 CCR5 Co-Receptor Displayed on the Surface of Magnetic Liposomes.
Kuzmina, Alona; Vaknin, Karin; Gdalevsky, Garik; Vyazmensky, Maria; Marks, Robert S; Taube, Ran; Engel, Stanislav
2015-01-01
Chemokine G protein coupled receptors, principally CCR5 or CXCR4, function as co-receptors for HIV-1 entry into CD4+ T cells. Initial binding of the viral envelope glycoprotein (Env) gp120 subunit to the host CD4 receptor induces a cascade of structural conformational changes that lead to the formation of a high-affinity co-receptor-binding site on gp120. Interaction between gp120 and the co-receptor leads to the exposure of epitopes on the viral gp41 that mediates fusion between viral and cell membranes. Soluble CD4 (sCD4) mimetics can act as an activation-based inhibitor of HIV-1 entry in vitro, as it induces similar structural changes in gp120, leading to increased virus infectivity in the short term but to virus Env inactivation in the long term. Despite promising clinical implications, sCD4 displays low efficiency in vivo, and in multiple HIV strains, it does not inhibit viral infection. This has been attributed to the slow kinetics of the sCD4-induced HIV Env inactivation and to the failure to obtain sufficient sCD4 mimetic levels in the serum. Here we present uniquely structured CCR5 co-receptor mimetics. We hypothesized that such mimetics will enhance sCD4-induced HIV Env inactivation and inhibition of HIV entry. Co-receptor mimetics were derived from CCR5 gp120-binding epitopes and functionalized with a palmitoyl group, which mediated their display on the surface of lipid-coated magnetic beads. CCR5-peptidoliposome mimetics bound to soluble gp120 and inhibited HIV-1 infectivity in a sCD4-dependent manner. We concluded that CCR5-peptidoliposomes increase the efficiency of sCD4 to inhibit HIV infection by acting as bait for sCD4-primed virus, catalyzing the premature discharge of its fusion potential.
Functional Mimetics of the HIV-1 CCR5 Co-Receptor Displayed on the Surface of Magnetic Liposomes
Kuzmina, Alona; Vaknin, Karin; Gdalevsky, Garik; Vyazmensky, Maria; Marks, Robert S.; Taube, Ran
2015-01-01
Chemokine G protein coupled receptors, principally CCR5 or CXCR4, function as co-receptors for HIV-1 entry into CD4+ T cells. Initial binding of the viral envelope glycoprotein (Env) gp120 subunit to the host CD4 receptor induces a cascade of structural conformational changes that lead to the formation of a high-affinity co-receptor-binding site on gp120. Interaction between gp120 and the co-receptor leads to the exposure of epitopes on the viral gp41 that mediates fusion between viral and cell membranes. Soluble CD4 (sCD4) mimetics can act as an activation-based inhibitor of HIV-1 entry in vitro, as it induces similar structural changes in gp120, leading to increased virus infectivity in the short term but to virus Env inactivation in the long term. Despite promising clinical implications, sCD4 displays low efficiency in vivo, and in multiple HIV strains, it does not inhibit viral infection. This has been attributed to the slow kinetics of the sCD4-induced HIV Env inactivation and to the failure to obtain sufficient sCD4 mimetic levels in the serum. Here we present uniquely structured CCR5 co-receptor mimetics. We hypothesized that such mimetics will enhance sCD4-induced HIV Env inactivation and inhibition of HIV entry. Co-receptor mimetics were derived from CCR5 gp120-binding epitopes and functionalized with a palmitoyl group, which mediated their display on the surface of lipid-coated magnetic beads. CCR5-peptidoliposome mimetics bound to soluble gp120 and inhibited HIV-1 infectivity in a sCD4-dependent manner. We concluded that CCR5-peptidoliposomes increase the efficiency of sCD4 to inhibit HIV infection by acting as bait for sCD4-primed virus, catalyzing the premature discharge of its fusion potential. PMID:26629902
L-tyrosine and L-DOPA as hormone-like regulators of melanocytes functions
Slominski, Andrzej; Zmijewski, Michal; Pawelek, John
2011-01-01
Summary Evidence reveals that L-tyrosine and L-DOPA, besides serving as substrates and intermediates of melanogenesis, are also bioregulatory agents acting not only as inducers and positive regulators of melanogenesis but also as regulators of other cellular functions. These can be mediated through action on specific receptors or through non-receptor mediated mechanisms. The substrate induced (L-tyrosine and/or L-DOPA) melanogenic pathway would autoregulate itself as well as it would regulate the melanocyte functions through activity of its structural or regulatory proteins and through intermediates of melanogenesis and melanin itself. Dissection of regulatory and autoregulatory elements of this process may elucidate how substrate induced autoregulatory pathways have evolved from prokaryotic or simple eukaryotic organisms to complex systems in vertebrates. This could substantiate older theory proposing that receptors for amino-acid derived hormones arose from the receptors for those amino acids, and that nuclear receptors evolved from primitive intracellular receptors binding nutritional factors or metabolic intermediates. PMID:21834848
Structure of colicin I receptor bound to the R-domain of colicin Ia: implications for protein import
Buchanan, Susan K; Lukacik, Petra; Grizot, Sylvestre; Ghirlando, Rodolfo; Ali, Maruf M U; Barnard, Travis J; Jakes, Karen S; Kienker, Paul K; Esser, Lothar
2007-01-01
Colicin Ia is a 69 kDa protein that kills susceptible Escherichia coli cells by binding to a specific receptor in the outer membrane, colicin I receptor (70 kDa), and subsequently translocating its channel forming domain across the periplasmic space, where it inserts into the inner membrane and forms a voltage-dependent ion channel. We determined crystal structures of colicin I receptor alone and in complex with the receptor binding domain of colicin Ia. The receptor undergoes large and unusual conformational changes upon colicin binding, opening at the cell surface and positioning the receptor binding domain of colicin Ia directly above it. We modelled the interaction with full-length colicin Ia to show that the channel forming domain is initially positioned 150 Å above the cell surface. Functional data using full-length colicin Ia show that colicin I receptor is necessary for cell surface binding, and suggest that the receptor participates in translocation of colicin Ia across the outer membrane. PMID:17464289
The heterodimeric sweet taste receptor has multiple potential ligand binding sites.
Cui, Meng; Jiang, Peihua; Maillet, Emeline; Max, Marianna; Margolskee, Robert F; Osman, Roman
2006-01-01
The sweet taste receptor is a heterodimer of two G protein coupled receptors, T1R2 and T1R3. This discovery has increased our understanding at the molecular level of the mechanisms underlying sweet taste. Previous experimental studies using sweet receptor chimeras and mutants show that there are at least three potential binding sites in this heterodimeric receptor. Receptor activity toward the artificial sweeteners aspartame and neotame depends on residues in the amino terminal domain of human T1R2. In contrast, receptor activity toward the sweetener cyclamate and the sweet taste inhibitor lactisole depends on residues within the transmembrane domain of human T1R3. Furthermore, receptor activity toward the sweet protein brazzein depends on the cysteine rich domain of human T1R3. Although crystal structures are not available for the sweet taste receptor, useful homology models can be developed based on appropriate templates. The amino terminal domain, cysteine rich domain and transmembrane helix domain of T1R2 and T1R3 have been modeled based on the crystal structures of metabotropic glutamate receptor type 1, tumor necrosis factor receptor, and bovine rhodopsin, respectively. We have used homology models of the sweet taste receptors, molecular docking of sweet ligands to the receptors, and site-directed mutagenesis of the receptors to identify potential ligand binding sites of the sweet taste receptor. These studies have led to a better understanding of the structure and function of this heterodimeric receptor, and can act as a guide for rational structure-based design of novel non-caloric sweeteners, which can be used in the fighting against obesity and diabetes.
Lentes, K U; Mathieu, E; Bischoff, R; Rasmussen, U B; Pavirani, A
1993-01-01
Current methods for comparative analyses of protein sequences are 1D-alignments of amino acid sequences based on the maximization of amino acid identity (homology) and the prediction of secondary structure elements. This method has a major drawback once the amino acid identity drops below 20-25%, since maximization of a homology score does not take into account any structural information. A new technique called Hydrophobic Cluster Analysis (HCA) has been developed by Lemesle-Varloot et al. (Biochimie 72, 555-574), 1990). This consists of comparing several sequences simultaneously and combining homology detection with secondary structure analysis. HCA is primarily based on the detection and comparison of structural segments constituting the hydrophobic core of globular protein domains, with or without transmembrane domains. We have applied HCA to the analysis of different families of G-protein coupled receptors, such as catecholamine receptors as well as peptide hormone receptors. Utilizing HCA the thrombin receptor, a new and as yet unique member of the family of G-protein coupled receptors, can be clearly classified as being closely related to the family of neuropeptide receptors rather than to the catecholamine receptors for which the shape of the hydrophobic clusters and the length of their third cytoplasmic loop are very different. Furthermore, the potential of HCA to predict relationships between new putative and already characterized members of this family of receptors will be presented.
Yang, Fan; Yu, Xiao; Liu, Chuan; Qu, Chang-Xiu; Gong, Zheng; Liu, Hong-Da; Li, Fa-Hui; Wang, Hong-Mei; He, Dong-Fang; Yi, Fan; Song, Chen; Tian, Chang-Lin; Xiao, Kun-Hong; Wang, Jiang-Yun; Sun, Jin-Peng
2015-01-01
Specific arrestin conformations are coupled to distinct downstream effectors, which underlie the functions of many G-protein-coupled receptors (GPCRs). Here, using unnatural amino acid incorporation and fluorine-19 nuclear magnetic resonance (19F-NMR) spectroscopy, we demonstrate that distinct receptor phospho-barcodes are translated to specific β-arrestin-1 conformations and direct selective signalling. With its phosphate-binding concave surface, β-arrestin-1 ‘reads' the message in the receptor phospho-C-tails and distinct phospho-interaction patterns are revealed by 19F-NMR. Whereas all functional phosphopeptides interact with a common phosphate binding site and induce the movements of finger and middle loops, different phospho-interaction patterns induce distinct structural states of β-arrestin-1 that are coupled to distinct arrestin functions. Only clathrin recognizes and stabilizes GRK2-specific β-arrestin-1 conformations. The identified receptor-phospho-selective mechanism for arrestin conformation and the spacing of the multiple phosphate-binding sites in the arrestin enable arrestin to recognize plethora phosphorylation states of numerous GPCRs, contributing to the functional diversity of receptors. PMID:26347956
Ionotropic glutamate receptors made crystal clear.
Bowie, Derek
2014-12-01
Two recent crystallographic studies of the full-length GluA2 AMPA receptor provide our first insights into how the modular domains of the tetrameric complex coordinate the process of activation. These findings herald a new era in the structure-function analyses of neurotransmitter receptors, a fitting achievement for the 'International Year of Crystallography'. Copyright © 2014 Elsevier Ltd. All rights reserved.
Yau, S Y; Bettio, Luis; Vetrici, M; Truesdell, A; Chiu, C; Chiu, J; Truesdell, E; Christie, B R
2018-05-01
Fragile X Syndrome (FXS) is the most common inherited cause of intellectual disability, and is the leading known single-gene cause of autism spectrum disorder. FXS patients display varied behavioural deficits that include mild to severe cognitive impairments in addition to mood disorders. Currently there is no cure for this condition, however minocycline is becoming commonly prescribed as a treatment for FXS patients. Minocycline has been reported to alleviate social behavioural deficits, and improve verbal functioning in patients with FXS; however, its mode of action is not well understood. Previously we have shown that FXS results in learning impairments that involve deficits in N-methyl-d-aspartate (NMDA) receptor-dependent synaptic plasticity in the hippocampal dentate gyrus (DG). Here we tested whether chronic treatment with minocycline can improve these deficits by enhancing NMDA receptor-dependent functional and structural plasticity in the DG. Minocycline treatment resulted in a significant enhancement in NMDA receptor function in the dentate granule cells. This was accompanied by an increase in PSD-95 and GluN2A and GluN2B subunits in hippocampal synaptoneurosome fractions. Minocycline treatment also enhanced dentate granule cell dendritic length and branching. In addition, our results show that chronic minocycline treatment can rescue performance in novel object recognition in FXS mice. These findings indicate that minocycline treatment has both structural and functional benefits for hippocampal cells, which may partly contribute to the pro-cognitive effects minocycline appears to have for treating FXS. Copyright © 2018 Elsevier Inc. All rights reserved.
Daiyasu, Hiromi; Nemoto, Wataru; Toh, Hiroyuki
2012-01-01
Chemokine receptors (CKRs) function in the inflammatory response and in vertebrate homeostasis. Decoy and viral receptors are two types of CKR homologs with modified functions from those of the typical CKRs. The decoy receptors are able to bind ligands without signaling. On the other hand, the viral receptors show constitutive signaling without ligands. We examined the sites related to the functional difference. At first, the decoy and viral receptors were each classified into five groups, based on the molecular phylogenetic analysis. A multiple amino acid sequence alignment between each group and the CKRs was then constructed. The difference in the amino acid composition between the group and the CKRs was evaluated as the Kullback–Leibler (KL) information value at each alignment site. The KL information value is considered to reflect the difference in the functional constraints at the site. The sites with the top 5% of KL information values were selected and mapped on the structure of a CKR. The comparisons with decoy receptor groups revealed that the detected sites were biased on the intracellular side. In contrast, the sites detected from the comparisons with viral receptor groups were found on both the extracellular and intracellular sides. More sites were found in the ligand binding pocket in the analyses of the viral receptor groups, as compared to the decoy receptor groups. Some of the detected sites were located in the GPCR motifs. For example, the DRY motif of the decoy receptors was often degraded, although the motif of the viral receptors was basically conserved. The observations for the viral receptor groups suggested that the constraints in the pocket region are loose and that the sites on the intracellular side are different from those for the decoy receptors, which may be related to the constitutive signaling activity of the viral receptors. PMID:22855685
Daiyasu, Hiromi; Nemoto, Wataru; Toh, Hiroyuki
2012-01-01
Chemokine receptors (CKRs) function in the inflammatory response and in vertebrate homeostasis. Decoy and viral receptors are two types of CKR homologs with modified functions from those of the typical CKRs. The decoy receptors are able to bind ligands without signaling. On the other hand, the viral receptors show constitutive signaling without ligands. We examined the sites related to the functional difference. At first, the decoy and viral receptors were each classified into five groups, based on the molecular phylogenetic analysis. A multiple amino acid sequence alignment between each group and the CKRs was then constructed. The difference in the amino acid composition between the group and the CKRs was evaluated as the Kullback-Leibler (KL) information value at each alignment site. The KL information value is considered to reflect the difference in the functional constraints at the site. The sites with the top 5% of KL information values were selected and mapped on the structure of a CKR. The comparisons with decoy receptor groups revealed that the detected sites were biased on the intracellular side. In contrast, the sites detected from the comparisons with viral receptor groups were found on both the extracellular and intracellular sides. More sites were found in the ligand binding pocket in the analyses of the viral receptor groups, as compared to the decoy receptor groups. Some of the detected sites were located in the GPCR motifs. For example, the DRY motif of the decoy receptors was often degraded, although the motif of the viral receptors was basically conserved. The observations for the viral receptor groups suggested that the constraints in the pocket region are loose and that the sites on the intracellular side are different from those for the decoy receptors, which may be related to the constitutive signaling activity of the viral receptors.
Klaus-Heisen, Dörte; Nurisso, Alessandra; Pietraszewska-Bogiel, Anna; Mbengue, Malick; Camut, Sylvie; Timmers, Ton; Pichereaux, Carole; Rossignol, Michel; Gadella, Theodorus W J; Imberty, Anne; Lefebvre, Benoit; Cullimore, Julie V
2011-04-01
Phylogenetic analysis has previously shown that plant receptor-like kinases (RLKs) are monophyletic with respect to the kinase domain and share an evolutionary origin with the animal interleukin-1 receptor-associated kinase/Pelle-soluble kinases. The lysin motif domain-containing receptor-like kinase-3 (LYK3) of the legume Medicago truncatula shows 33% amino acid sequence identity with human IRAK-4 over the kinase domain. Using the structure of this animal kinase as a template, homology modeling revealed that the plant RLK contains structural features particular to this group of kinases, including the tyrosine gatekeeper and the N-terminal extension α-helix B. Functional analysis revealed the importance of these conserved features for kinase activity and suggests that kinase activity is essential for the biological role of LYK3 in the establishment of the root nodule nitrogen-fixing symbiosis with rhizobia bacteria. The kinase domain of LYK3 has dual serine/threonine and tyrosine specificity, and mass spectrometry analysis identified seven serine, eight threonine, and one tyrosine residue as autophosphorylation sites in vitro. Three activation loop serine/threonine residues are required for biological activity, and molecular dynamics simulations suggest that Thr-475 is the prototypical phosphorylated residue that interacts with the conserved arginine in the catalytic loop, whereas Ser-471 and Thr-472 may be secondary sites. A threonine in the juxtamembrane region and two threonines in the C-terminal lobe of the kinase domain are important for biological but not kinase activity. We present evidence that the structure-function similarities that we have identified between LYK3 and IRAK-4 may be more widely applicable to plant RLKs in general.
Nuclear Receptors, RXR, and the Big Bang.
Evans, Ronald M; Mangelsdorf, David J
2014-03-27
Isolation of genes encoding the receptors for steroids, retinoids, vitamin D, and thyroid hormone and their structural and functional analysis revealed an evolutionarily conserved template for nuclear hormone receptors. This discovery sparked identification of numerous genes encoding related proteins, termed orphan receptors. Characterization of these orphan receptors and, in particular, of the retinoid X receptor (RXR) positioned nuclear receptors at the epicenter of the "Big Bang" of molecular endocrinology. This Review provides a personal perspective on nuclear receptors and explores their integrated and coordinated signaling networks that are essential for multicellular life, highlighting the RXR heterodimer and its associated ligands and transcriptional mechanism. Copyright © 2014 Elsevier Inc. All rights reserved.
Surface modification of ZnO nanorods with Hamilton receptors.
Zeininger, Lukas; Klaumünzer, Martin; Peukert, Wolfgang; Hirsch, Andreas
2015-04-13
A new prototype of a Hamilton receptor suitable for the functionalization of inorganic nanoparticles was synthesized and characterized. The hydrogen bonding receptor was coupled to a catechol moiety, which served as anchor group for the functionalization of metal oxides, in particular zinc oxide. Synthesized zinc oxide nanorods [ZnO] were used for surface functionalization. The wet-chemical functionalization procedure towards monolayer-grafted particles [ZnO-HR] is described and a detailed characterization study is presented. In addition, the detection of specific cyanurate molecules is demonstrated. The hybrid structures [ZnO-HR-CA] were stable towards agglomeration and exhibited enhanced dispersability in apolar solvents. This observation, in combination with several spectroscopic experiments gave evidence of the highly directional supramolecular recognition at the surface of nanoparticles.
Role of Netrin-1 Signaling in Nerve Regeneration
Dun, Xin-Peng; Parkinson, David B.
2017-01-01
Netrin-1 was the first axon guidance molecule to be discovered in vertebrates and has a strong chemotropic function for axonal guidance, cell migration, morphogenesis and angiogenesis. It is a secreted axon guidance cue that can trigger attraction by binding to its canonical receptors Deleted in Colorectal Cancer (DCC) and Neogenin or repulsion through binding the DCC/Uncoordinated (Unc5) A–D receptor complex. The crystal structures of Netrin-1/receptor complexes have recently been revealed. These studies have provided a structure based explanation of Netrin-1 bi-functionality. Netrin-1 and its receptor are continuously expressed in the adult nervous system and are differentially regulated after nerve injury. In the adult spinal cord and optic nerve, Netrin-1 has been considered as an inhibitor that contributes to axon regeneration failure after injury. In the peripheral nervous system, Netrin-1 receptors are expressed in Schwann cells, the cell bodies of sensory neurons and the axons of both motor and sensory neurons. Netrin-1 is expressed in Schwann cells and its expression is up-regulated after peripheral nerve transection injury. Recent studies indicated that Netrin-1 plays a positive role in promoting peripheral nerve regeneration, Schwann cell proliferation and migration. Targeting of the Netrin-1 signaling pathway could develop novel therapeutic strategies to promote peripheral nerve regeneration and functional recovery. PMID:28245592
Nimmich, Mitchell L.; Heidelberg, Laura S.; Fisher, Janet L.
2009-01-01
RNA editing provides a post-transcriptional mechanism to increase structural heterogeneity of gene products. Recently, the α3 subunit of the GABAA receptors has been shown to undergo RNA editing. As a result, a highly conserved isoleucine residue in the third transmembrane domain is replaced with a methionine. To determine the effect of this structural change on receptor function, we compared the GABA sensitivity, pharmacological properties and macroscopic kinetics of recombinant receptors containing either the edited or unedited forms of the α3 subunit along with β3 and γ2L. Editing substantially altered the GABA sensitivity and deactivation rate of the receptors, with the unedited form showing a lower GABA EC50 and slower decay. Comparable effects were observed with a mutation at the homologous location in the α1 subunit, suggesting a common role for this site in regulation of channel gating. Except for the response to GABA, the pharmacological properties of the receptor were unaffected by editing, with similar enhancement by a variety of modulators. Since RNA editing of the α3 subunit increases through development, our findings suggest that GABAergic neurotransmission may be more effective early in development, with greater GABA sensitivity and slower decay rates conferred by the unedited α3 subunit. PMID:19367790
Functional identification and reconstitution of an odorant receptor in single olfactory neurons
Touhara, Kazushige; Sengoku, Shintaro; Inaki, Koichiro; Tsuboi, Akio; Hirono, Junzo; Sato, Takaaki; Sakano, Hitoshi; Haga, Tatsuya
1999-01-01
The olfactory system is remarkable in its capacity to discriminate a wide range of odorants through a series of transduction events initiated in olfactory receptor neurons. Each olfactory neuron is expected to express only a single odorant receptor gene that belongs to the G protein coupled receptor family. The ligand–receptor interaction, however, has not been clearly characterized. This study demonstrates the functional identification of olfactory receptor(s) for specific odorant(s) from single olfactory neurons by a combination of Ca2+-imaging and reverse transcription–coupled PCR analysis. First, a candidate odorant receptor was cloned from a single tissue-printed olfactory neuron that displayed odorant-induced Ca2+ increase. Next, recombinant adenovirus-mediated expression of the isolated receptor gene was established in the olfactory epithelium by using green fluorescent protein as a marker. The infected neurons elicited external Ca2+ entry when exposed to the odorant that originally was used to identify the receptor gene. Experiments performed to determine ligand specificity revealed that the odorant receptor recognized specific structural motifs within odorant molecules. The odorant receptor-mediated signal transduction appears to be reconstituted by this two-step approach: the receptor screening for given odorant(s) from single neurons and the functional expression of the receptor via recombinant adenovirus. The present approach should enable us to examine not only ligand specificity of an odorant receptor but also receptor specificity and diversity for a particular odorant of interest. PMID:10097159
Structural characterization of the Man5 glycoform of human IgG3 Fc
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shah, Ishan S.; Lovell, Scott; Mehzabeen, Nurjahan
Immunoglobulin G (IgG) consists of four subclasses in humans: IgG1, IgG2, IgG3 and IgG4, which are highly conserved but have unique differences that result in subclass-specific effector functions. Though IgG1 is the most extensively studied IgG subclass, study of other subclasses is important to understand overall immune function and for development of new therapeutics. When compared to IgG1, IgG3 exhibits a similar binding profile to Fcγ receptors and stronger activation of complement. All IgG subclasses are glycosylated at N297, which is required for Fcγ receptor and C1q complement binding as well as maintaining optimal Fc conformation. We have determined themore » crystal structure of homogenously glycosylated human IgG3 Fc with a GlcNAc2Man5 (Man5) high mannose glycoform at 1.8 Å resolution and compared its structural features with published structures from the other IgG subclasses. Although the overall structure of IgG3 Fc is similar to that of other subclasses, some structural perturbations based on sequence differences were revealed. For instance, the presence of R435 in IgG3 (and H435 in the other IgG subclasses) has been implicated to result in IgG3-specific properties related to binding to protein A, protein G and the neonatal Fc receptor (FcRn). The IgG3 Fc structure helps to explain some of these differences. Additionally, protein-glycan contacts observed in the crystal structure appear to correlate with IgG3 affinity for Fcγ receptors as shown by binding studies with IgG3 Fc glycoforms. Finally, this IgG3 Fc structure provides a template for further studies aimed at engineering the Fc for specific gain of function.« less
Muthu Krishnan, S
2018-05-14
The receptor-associated protein (RAP) is an inhibitor of endocytic receptors that belong to the lipoprotein receptor gene family. In this study, a computational approach was tried to find the evolutionarily related fold of the RAP proteins. Through the structural and sequence-based analysis, found various protein folds that are very close to the RAP folds. Remote homolog datasets were used potentially to develop a different support vector machine (SVM) methods to recognize the homologous RAP fold. This study helps in understanding the relationship of RAP homologs folds based on the structure, function and evolutionary history. Copyright © 2018 Elsevier Ltd. All rights reserved.
Wilburn, Damien B; Bowen, Kathleen E; Doty, Kari A; Arumugam, Sengodagounder; Lane, Andrew N; Feldhoff, Pamela W; Feldhoff, Richard C
2014-01-01
In response to pervasive sexual selection, protein sex pheromones often display rapid mutation and accelerated evolution of corresponding gene sequences. For proteins, the general dogma is that structure is maintained even as sequence or function may rapidly change. This phenomenon is well exemplified by the three-finger protein (TFP) superfamily: a diverse class of vertebrate proteins co-opted for many biological functions - such as components of snake venoms, regulators of the complement system, and coordinators of amphibian limb regeneration. All of the >200 structurally characterized TFPs adopt the namesake "three-finger" topology. In male red-legged salamanders, the TFP pheromone Plethodontid Modulating Factor (PMF) is a hypervariable protein such that, through extensive gene duplication and pervasive sexual selection, individual male salamanders express more than 30 unique isoforms. However, it remained unclear how this accelerated evolution affected the protein structure of PMF. Using LC/MS-MS and multidimensional NMR, we report the 3D structure of the most abundant PMF isoform, PMF-G. The high resolution structural ensemble revealed a highly modified TFP structure, including a unique disulfide bonding pattern and loss of secondary structure, that define a novel protein topology with greater backbone flexibility in the third peptide finger. Sequence comparison, models of molecular evolution, and homology modeling together support that this flexible third finger is the most rapidly evolving segment of PMF. Combined with PMF sequence hypervariability, this structural flexibility may enhance the plasticity of PMF as a chemical signal by permitting potentially thousands of structural conformers. We propose that the flexible third finger plays a critical role in PMF:receptor interactions. As female receptors co-evolve, this flexibility may allow PMF to still bind its receptor(s) without the immediate need for complementary mutations. Consequently, this unique adaptation may establish new paradigms for how receptor:ligand pairs co-evolve, in particular with respect to sexual conflict.
Joseph, Prem Raj B.; Sawant, Kirti V.; Isley, Angela; Pedroza, Mesias; Garofalo, Roberto P.; Richardson, Ricardo M.; Rajarathnam, Krishna
2014-01-01
Chemokines mediate diverse functions from organogenesis to mobilizing leucocytes, and are unusual agonists for class-A GPCRs (G-protein-coupled receptors) because of their large size and multi-domain structure. The current model for receptor activation, which involves interactions between chemokine N-loop and receptor N-terminal residues (Site-I) and between chemokine N-terminal and receptor extracellular loop/transmembrane residues (Site-II), fails to describe differences in ligand/receptor selectivity and the activation of multiple signalling pathways. In the present study, we show in neutrophil-activating chemokine CXCL8 that the highly conserved GP (glycine-proline) motif located distal to both N-terminal and N-loop residues couples Site-I and Site-II interactions. Mutations in the GP motif caused various differences from native-like function to complete loss of activity that could not be correlated with the specific mutation, receptor affinity or subtype, or a specific signalling pathway. NMR studies indicated that the GP motif does not influence Site-I interactions, but molecular dynamics simulations suggested that this motif dictates substates of the CXCL8 conformational ensemble. We conclude that the GP motif enables diverse receptor functions by controlling cross-talk between Site-I and Site-II, and further propose that the repertoire of chemokine functions is best described by a conformational ensemble model in which a network of long-range coupled indirect interactions mediate receptor activity. PMID:24032673
Modeling G Protein-Coupled Receptors: a Concrete Possibility
Costanzi, Stefano
2010-01-01
G protein-coupled receptors (GPCRs) are a large superfamily of membrane bound signaling proteins that are involved in the regulation of a wide range of physiological functions and constitute the most common target for therapeutic intervention. Due to the paucity of crystal structures, homology modeling has become a widespread technique for the construction of GPCR models, which have been applied to the study of their structure-function relationships and to the identification of lead ligands through virtual screening. Rhodopsin has been for years the only available template. However, recent breakthroughs in GPCR crystallography have led to the solution of the structures of a few additional receptors. In light of these newly elucidated crystal structures, we have been able to produce a substantial amount of data to demonstrate that accurate models of GPCRs in complex with their ligands can be constructed through homology modeling followed by fully flexible molecular docking. These results have been confirmed by our success in the first blind assessment of GPCR modeling and docking, organized in coordination with the solution of the X-ray structure of the adenosine A2A receptor. Taken together, these data indicate that: a) the transmembrane helical bundle can be modeled with considerable accuracy; b) predicting the binding mode of a ligand, although doable, is challenging; c) modeling of the extracellular and intracellular loops is still problematic. PMID:21253444
New insights into the organization of plasma membrane and its role in signal transduction.
Suzuki, Kenichi G N
2015-01-01
Plasma membranes have heterogeneous structures for efficient signal transduction, required to perform cell functions. Recent evidence indicates that the heterogeneous structures are produced by (1) compartmentalization by actin-based membrane skeleton, (2) raft domains, (3) receptor-receptor interactions, and (4) the binding of receptors to cytoskeletal proteins. This chapter provides an overview of recent studies on diffusion, clustering, raft association, actin binding, and signal transduction of membrane receptors, especially glycosylphosphatidylinositol (GPI)-anchored receptors. Studies on diffusion of GPI-anchored receptors suggest that rafts may be small and/or short-lived in plasma membranes. In steady state conditions, GPI-anchored receptors form transient homodimers, which may represent the "standby state" for the stable homodimers and oligomers upon ligation. Furthermore, It is proposed that upon ligation, the binding of GPI-anchored receptor clusters to cytoskeletal actin filaments produces a platform for downstream signaling, and that the pulse-like signaling easily maintains the stability of the overall signaling activity. Copyright © 2015 Elsevier Inc. All rights reserved.
RFamide Peptides: Structure, Function, Mechanisms and Pharmaceutical Potential
Findeisen, Maria; Rathmann, Daniel; Beck-Sickinger, Annette G.
2011-01-01
Different neuropeptides, all containing a common carboxy-terminal RFamide sequence, have been characterized as ligands of the RFamide peptide receptor family. Currently, five subgroups have been characterized with respect to their N-terminal sequence and hence cover a wide pattern of biological functions, like important neuroendocrine, behavioral, sensory and automatic functions. The RFamide peptide receptor family represents a multiligand/multireceptor system, as many ligands are recognized by several GPCR subtypes within one family. Multireceptor systems are often susceptible to cross-reactions, as their numerous ligands are frequently closely related. In this review we focus on recent results in the field of structure-activity studies as well as mutational exploration of crucial positions within this GPCR system. The review summarizes the reported peptide analogs and recently developed small molecule ligands (agonists and antagonists) to highlight the current understanding of the pharmacophoric elements, required for affinity and activity at the receptor family. Furthermore, we address the biological functions of the ligands and give an overview on their involvement in physiological processes. We provide insights in the knowledge for the design of highly selective ligands for single receptor subtypes to minimize cross-talk and to eliminate effects from interactions within the GPCR system. This will support the drug development of members of the RFamide family.
Differential effects of Cdh23(753A) on auditory and vestibular functional aging in C57BL/6J mice.
Mock, Bruce E; Vijayakumar, Sarath; Pierce, Jessica; Jones, Timothy A; Jones, Sherri M
2016-07-01
The C57BL/6J (B6) mouse strain carries a cadherin 23 mutation (Cdh23(753A), also known as Ahl), which affects inner ear structures and results in age-related hearing loss. The B6.CAST strain harbors the wild type Cdh23 gene, and hence, the influence of Ahl is absent. The purpose of the present study was to characterize the effect of age and gender on gravity receptor function in B6 and B6.CAST strains and to compare functional aging between auditory and vestibular modalities. Auditory sensitivity declined at significantly faster rates than gravity receptor sensitivity for both strains. Indeed, vestibular functional aging was minimal for both strains. The comparatively smaller loss of macular versus cochlear sensitivity in both the B6 and B6.CAST strains suggests that the contribution of Ahl to the aging of the vestibular system is minimal, and thus very different than its influence on aging of the auditory system. Alternatively, there exist unidentified genes or gene modifiers that serve to slow the degeneration of gravity receptor structures and maintain gravity receptor sensitivity into advanced age. Copyright © 2016 Elsevier Inc. All rights reserved.
Fotsch, Christopher; Smith, Duncan M; Adams, Jeffrey A; Cheetham, Janet; Croghan, Michael; Doherty, Elizabeth M; Hale, Clarence; Jarosinski, Mark A; Kelly, Michael G; Norman, Mark H; Tamayo, Nuria A; Xi, Ning; Baumgartner, James W
2003-07-21
The solution structure of a potent melanocortin receptor agonist, Ac-Nle-cyclo[Asp-Pro-DPhe-Arg-Trp-Lys]-NH(2) (1) was calculated using distance restraints determined from 1H NMR spectroscopy. Eight of the lowest energy conformations from this study were used to identify non-peptide cores that mimic the spatial arrangement of the critical tripeptide region, DPhe-Arg-Trp, found in 1. From these studies, compound 2a, containing the cis-cyclohexyl core, was identified as a functional agonist of the melanocortin-4 receptor (MC4R) with an IC(50) and EC(50) below 10 nM. Compound 2a also showed 36- and 7-fold selectivity over MC3R and MC1R, respectively, in the binding assays. Subtle changes in cyclohexane stereochemistry and removal of functional groups led to analogues with lower affinity for the MC receptors.
Structure-function Analysis of Receptor-binding in Adeno-Associated Virus Serotype 6 (AAV-6)
Xie, Qing; Lerch, Thomas F.; Meyer, Nancy L.; Chapman, Michael S.
2011-01-01
Crystal structures of the AAV-6 capsid at 3 Å reveal a subunit fold homologous to other parvoviruses with greatest differences in two external loops. The electrostatic potential suggests that receptor-attachment is mediated by four residues: Arg576, Lys493, Lys459 and Lys531, defining a positively charged region curving up from the valley between adjacent spikes. It overlaps only partially with the receptor-binding site of AAV-2, and the residues endowing the electrostatic character are not homologous. Mutational substitution of each residue decreases heparin affinity, particularly Lys531 and Lys459. Neither is conserved among heparin-binding serotypes, indicating that diverse modes of receptor attachment have been selected in different serotypes. Surface topology and charge are also distinct at the shoulder of the spike, where linear epitopes for AAV-2’s neutralizing monoclonal antibody A20 come together. Evolutionarily, selection of changed side-chain charge may have offered a conservative means to evade immune neutralization while preserving other essential functionality. PMID:21917284
Opioid receptor probes derived from cycloaddition of the hallucinogen natural product salvinorin A.
Lozama, Anthony; Cunningham, Christopher W; Caspers, Michael J; Douglas, Justin T; Dersch, Christina M; Rothman, Richard B; Prisinzano, Thomas E
2011-04-25
As part of our continuing efforts toward more fully understanding the structure-activity relationships of the neoclerodane diterpene salvinorin A, we report the synthesis and biological characterization of unique cycloadducts through [4+2] Diels-Alder cycloaddition. Microwave-assisted methods were developed and successfully employed, aiding in functionalizing the chemically sensitive salvinorin A scaffold. This demonstrates the first reported results for both cycloaddition of the furan ring and functionalization via microwave-assisted methodology of the salvinorin A skeleton. The cycloadducts yielded herein introduce electron-withdrawing substituents and bulky aromatic groups into the C-12 position. Kappa opioid (KOP) receptor space was explored through aromatization of the bent oxanorbornadiene system possessed by the cycloadducts to a planar phenyl ring system. Although dimethyl- and diethylcarboxylate analogues 5 and 6 retain some affinity and selectivity for KOP receptors and are full agonists, their aromatized counterparts 13 and 14 have reduced affinity for KOP receptors. The methods developed herein signify a novel approach toward rapidly probing the structure-activity relationships of furan-containing natural products.
Dewhurst, Henry M; Choudhury, Shilpa; Torres, Matthew P
2015-08-01
Predicting the biological function potential of post-translational modifications (PTMs) is becoming increasingly important in light of the exponential increase in available PTM data from high-throughput proteomics. We developed structural analysis of PTM hotspots (SAPH-ire)--a quantitative PTM ranking method that integrates experimental PTM observations, sequence conservation, protein structure, and interaction data to allow rank order comparisons within or between protein families. Here, we applied SAPH-ire to the study of PTMs in diverse G protein families, a conserved and ubiquitous class of proteins essential for maintenance of intracellular structure (tubulins) and signal transduction (large and small Ras-like G proteins). A total of 1728 experimentally verified PTMs from eight unique G protein families were clustered into 451 unique hotspots, 51 of which have a known and cited biological function or response. Using customized software, the hotspots were analyzed in the context of 598 unique protein structures. By comparing distributions of hotspots with known versus unknown function, we show that SAPH-ire analysis is predictive for PTM biological function. Notably, SAPH-ire revealed high-ranking hotspots for which a functional impact has not yet been determined, including phosphorylation hotspots in the N-terminal tails of G protein gamma subunits--conserved protein structures never before reported as regulators of G protein coupled receptor signaling. To validate this prediction we used the yeast model system for G protein coupled receptor signaling, revealing that gamma subunit-N-terminal tail phosphorylation is activated in response to G protein coupled receptor stimulation and regulates protein stability in vivo. These results demonstrate the utility of integrating protein structural and sequence features into PTM prioritization schemes that can improve the analysis and functional power of modification-specific proteomics data. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
NMDA Receptor Modulators in the Treatment of Drug Addiction.
Tomek, Seven E; Lacrosse, Amber L; Nemirovsky, Natali E; Olive, M Foster
2013-02-06
Glutamate plays a pivotal role in drug addiction, and the N-methyl-D-aspartate (NMDA) glutamate receptor subtype serves as a molecular target for several drugs of abuse. In this review, we will provide an overview of NMDA receptor structure and function, followed by a review of the mechanism of action, clinical efficacy, and side effect profile of NMDA receptor ligands that are currently in use or being explored for the treatment of drug addiction. These ligands include the NMDA receptor modulators memantine and acamprosate, as well as the partial NMDA agonist D-cycloserine. Data collected to date suggest that direct NMDA receptor modulators have relatively limited efficacy in the treatment of drug addiction, and that partial agonism of NMDA receptors may have some efficacy with regards to extinction learning during cue exposure therapy. However, the lack of consistency in results to date clearly indicates that additional studies are needed, as are studies examining novel ligands with indirect mechanisms for altering NMDA receptor function.
Zhang, Chen; Zhang, Tuo; Zou, Juan; Miller, Cassandra Lynn; Gorkhali, Rakshya; Yang, Jeong-Yeh; Schilmiller, Anthony; Wang, Shuo; Huang, Kenneth; Brown, Edward M; Moremen, Kelley W; Hu, Jian; Yang, Jenny J
2016-05-01
Ca(2+)-sensing receptors (CaSRs) modulate calcium and magnesium homeostasis and many (patho)physiological processes by responding to extracellular stimuli, including divalent cations and amino acids. We report the first crystal structure of the extracellular domain (ECD) of human CaSR bound with Mg(2+) and a tryptophan derivative ligand at 2.1 Å. The structure reveals key determinants for cooperative activation by metal ions and aromatic amino acids. The unexpected tryptophan derivative was bound in the hinge region between two globular ECD subdomains, and represents a novel high-affinity co-agonist of CaSR. The dissection of structure-function relations by mutagenesis, biochemical, and functional studies provides insights into the molecular basis of human diseases arising from CaSR mutations. The data also provide a novel paradigm for understanding the mechanism of CaSR-mediated signaling that is likely shared by the other family C GPCR [G protein (heterotrimeric guanine nucleotide-binding protein)-coupled receptor] members and can facilitate the development of novel CaSR-based therapeutics.
Characterization of opiates, neuroleptics, and synthetic analogs at ORL1 and opioid receptors
Zaveri, Nurulain; Polgar, Willma E.; Olsen, Cris M.; Kelson, Andrew B.; Grundt, Peter; Lewis, John W.; Toll, Lawrence
2013-01-01
Nociceptin/orphanin FQ (N/OFQ) was recently identified as the endogenous ligand for the opioid-receptor like (ORL1) receptor. Although the ORL1 receptor shows sequence homology with the opioid receptors, the nociceptin/ORL1 ligand–receptor system has very distinct pharmacological actions compared to the opioid receptor system. Recently, several small-molecule ORL1 receptor ligands were reported by pharmaceutical companies. Most of these ligands had close structural similarities with known neuroleptics and opiates. In this study, we screened several available neuroleptics and opiates for their binding affinity and functional activity at ORL1 and the opioid receptors. We also synthesized several analogs of known opiates with modified piperidine N-substituents in order to characterize the ORL1 receptor ligand binding pocket. Substitution with the large, lipophilic cyclooctylmethyl moiety increased ORL1 receptor affinity and decreased μ receptor affinity and efficacy in the fentanyl series of ligands but had a different effect in the oripavine class of opiate ligands. Our results indicate that opiates and neuroleptics may be good starting points for ORL1 receptor ligand design, and the selectivity may be modulated by appropriate structural modifications. PMID:11779034
2002-01-01
the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N
Aoshima, H; Tenpaku, Y
1997-12-01
To study the effects of 13-L-hydroxylinoleic acid (LOH) and food additives on gamma-aminobutyric acid (GABA) receptors, ionotropic GABA receptors were expressed in Xenopus oocytes by injecting mRNAs prepared from rat whole brain. LOH, which was prepared by reduction of 13-L-hydroperoxylinoleic acid (LOOH), inhibited the response of GABA receptors in the presence of high concentrations of GABA. LOH also inhibited nicotinic acetylcholine, glycine, and kainate receptors, while it had little effect on NMDA receptors expressed in Xenopus oocytes. However, LOH potentiated the response of GABA receptors as well as LOOH in the presence of low concentrations of GABA, possibly increasing the affinity of GABA for the receptors, while linoleic acid did not. Since some modification of the compounds seemed to change their effects on GABA receptors, the responses of GABA receptors elicited by 10 microM GABA were measured in the presence of compounds with various kinds of functional groups or the structural isomers of pentanol. Potentiation of GABA receptors depended strongly on the species of functional groups and also depended on the structure of the isomers. Then effects of various kinds of food additives on GABA receptors were also examined; perfumes such as alcohols or esters potentiated the responses strongly, while hexylamine, nicotinamide, or caffeine inhibited the responses, mainly in a competitive manner, and vanillin inhibited the responses noncompetitively. These results suggest the possibility that production of LOOH and LOH, or intake of much of some food additives, modulates the neural transmission in the brain, especially through ionotropic GABA receptors and changes the frame of the human mind, as alcohol or tobacco does.
Li, Xiang; Anderson, Marie; Collin, Delphine; Muegge, Ingo; Wan, John; Brennan, Debra; Kugler, Stanley; Terenzio, Donna; Kennedy, Charles; Lin, Siqi; Labadia, Mark E; Cook, Brian; Hughes, Robert; Farrow, Neil A
2017-07-14
The nuclear receptor retinoid acid receptor-related orphan receptor γt (RORγt) is a master regulator of the Th17/IL-17 pathway that plays crucial roles in the pathogenesis of autoimmunity. RORγt has recently emerged as a highly promising target for treatment of a number of autoimmune diseases. Through high-throughput screening, we previously identified several classes of inverse agonists for RORγt. Here, we report the crystal structures for the ligand-binding domain of RORγt in both apo and ligand-bound states. We show that apo RORγt adopts an active conformation capable of recruiting coactivator peptides and present a detailed analysis of the structural determinants that stabilize helix 12 (H12) of RORγt in the active state in the absence of a ligand. The structures of ligand-bound RORγt reveal that binding of the inverse agonists disrupts critical interactions that stabilize H12. This destabilizing effect is supported by ab initio calculations and experimentally by a normalized crystallographic B-factor analysis. Of note, the H12 destabilization in the active state shifts the conformational equilibrium of RORγt toward an inactive state, which underlies the molecular mechanism of action for the inverse agonists reported here. Our findings highlight that nuclear receptor structure and function are dictated by a dynamic conformational equilibrium and that subtle changes in ligand structures can shift this equilibrium in opposite directions, leading to a functional switch from agonists to inverse agonists. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Minding the Calcium Store: Ryanodine Receptor Activation as a Convergent Mechanism of PCB Toxicity
Pessah, Isaac N.; Cherednichenko, Gennady; Lein, Pamela J.
2009-01-01
Chronic low level polychlorinated biphenyls (PCB) exposures remain a significant public health concern since results from epidemiological studies indicate PCB burden is associated with immune system dysfunction, cardiovascular disease, and impairment of the developing nervous system. Of these various adverse health effects, developmental neurotoxicity has emerged as a particularly vulnerable endpoint in PCB toxicity. Arguably the most pervasive biological effects of PCBs could be mediated by their ability to alter the spatial and temporal fidelity of Ca2+ signals through one or more receptor mediated processes. This review will focus on our current knowledge of the structure and function of ryanodine receptors (RyRs) in muscle and nerve cells and how PCBs and related non-coplanar structures alter these functions. The molecular and cellular mechanisms by which non-coplanar PCBs and related structures alter local and global Ca2+ signaling properties and the possible short and long-term consequences of these perturbations on neurodevelopment and neurodegeneration are reviewed. PMID:19931307
Multiple roles of the Rho GEF ephexin1 in synapse remodeling
Shi, Lei; Fu, Amy KY
2010-01-01
Synapse remodeling, which involves changes in the synaptic structure and their molecular composition, is required for the maturation and refinement of neural circuits. Although synapse remodeling is known to be tightly dependent on the assembly of local actin cytoskeleton, how actin directs the structural changes of synapse and targeting of synaptic proteins are not fully understood. Recently, we identified ephexin1, a Rho guanine nucleotide exchange factor (GEF) that regulates actin dynamics, to play an essential role in the maturation and functioning of the mammalian neuromuscular junction (NMJ). We showed that ephexin1 regulates the synaptic organization of the neurotransmitter receptor acetylcholine receptor (AChR) clusters through RhoA-dependent actin reorganization. Interestingly, ephexin1 has been implicated in the regulation of postsynaptic structure as well as the presynaptic vesicle release at various types of synapses. Our findings thus establish a novel function of ephexin1 in synapse remodeling through regulating the synaptic targeting of neurotransmitter receptors, revealing a versatile role of ephexin1 at synapses. PMID:21331259
NASA Astrophysics Data System (ADS)
Liu, Fan; Abrol, Ravinder; Goddard, William, III; Dougherty, Dennis
2014-03-01
Entropic effect in GPCR activation is poorly understood. Based on the recent solved structures, researchers in the GPCR structural biology field have proposed several ``local activating switches'' that consisted of a few number of conserved residues, but have long ignored the collective dynamical effect (conformational entropy) of a domain comprised of an ensemble of residues. A new paradigm has been proposed recently that a GPCR can be viewed as a composition of several functional coupling domains, each of which undergoes order-to-disorder or disorder-to-order transitions upon activation. Here we identified and studied these functional coupling domains by comparing the local entropy changes of each residue between the inactive and active states of the β2 adrenergic receptor from computational simulation. We found that agonist and G-protein binding increases the heterogeneity of the entropy distribution in the receptor. This new activation paradigm and computational entropy analysis scheme provides novel ways to design functionally modified mutant and identify new allosteric sites for GPCRs. The authors thank NIH and Sanofi for funding this project.
Li, Yangmei; Cazares, Margret; Wu, Jinhua; Houghten, Richard A; Toll, Laurence; Dooley, Colette
2016-02-11
To optimize the structure of a μ-opioid receptor ligand, analogs H-Tyr-c[D-Lys-Xxx-Tyr-Gly] were synthesized and their biological activity was tested. The analog containing a Phe(3) was identified as not only exhibiting binding affinity 14-fold higher than the original hit but also producing agonist activity 3-fold more potent than morphine. NMR study suggested that a trans conformation at D-Lys(2)-Xxx(3) is crucial for these cyclic peptides to maintain high affinity, selectivity, and functional activity toward the μ-opioid receptor.
Zeng, Qinghong; Langereis, Martijn A.; van Vliet, Arno L. W.; Huizinga, Eric G.; de Groot, Raoul J.
2008-01-01
The hemagglutinin-esterases (HEs) are a family of viral envelope glycoproteins that mediate reversible attachment to O-acetylated sialic acids by acting both as lectins and as receptor-destroying enzymes (RDEs). Related HEs occur in influenza C, toro-, and coronaviruses, apparently as a result of relatively recent lateral gene transfer events. Here, we report the crystal structure of a coronavirus (CoV) HE in complex with its receptor. We show that CoV HE arose from an influenza C-like HE fusion protein (HEF). In the process, HE was transformed from a trimer into a dimer, whereas remnants of the fusion domain were adapted to establish novel monomer–monomer contacts. Whereas the structural design of the RDE-acetylesterase domain remained unaltered, the HE receptor-binding domain underwent remodeling to such extent that the ligand is now bound in opposite orientation. This is surprising, because the architecture of the HEF site was preserved in influenza A HA over a much larger evolutionary distance, a switch in receptor specificity and extensive antigenic variation notwithstanding. Apparently, HA and HEF are under more stringent selective constraints than HE, limiting their exploration of alternative binding-site topologies. We attribute the plasticity of the CoV HE receptor-binding site to evolutionary flexibility conferred by functional redundancy between HE and its companion spike protein S. Our findings offer unique insights into the structural and functional consequences of independent protein evolution after interviral gene exchange and open potential avenues to broad-spectrum antiviral drug design. PMID:18550812
Nile, Aaron H.; Mukund, Susmith; Stanger, Karen; Wang, Weiru; Hannoush, Rami N.
2017-01-01
Frizzled (FZD) receptors mediate Wnt signaling in diverse processes ranging from bone growth to stem cell activity. Moreover, high FZD receptor expression at the cell surface contributes to overactive Wnt signaling in subsets of pancreatic, ovarian, gastric, and colorectal tumors. Despite the progress in biochemical understanding of Wnt–FZD receptor interactions, the molecular basis for recognition of Wnt cis-unsaturated fatty acyl groups by the cysteine-rich domain (CRD) of FZD receptors remains elusive. Here, we determined a crystal structure of human FZD7 CRD unexpectedly bound to a 24-carbon fatty acid. We also report a crystal structure of human FZD5 CRD bound to C16:1 cis-Δ9 unsaturated fatty acid. Both structures reveal a dimeric arrangement of the CRD. The lipid-binding groove exhibits flexibility and spans both monomers, adopting a U-shaped geometry that accommodates the fatty acid. Re-evaluation of the published mouse FZD8 CRD structure reveals that it also shares the same architecture as FZD5 and FZD7 CRDs. Our results define a common molecular mechanism for recognition of the cis-unsaturated fatty acyl group, a necessary posttranslational modification of Wnts, by multiple FZD receptors. The fatty acid bridges two CRD monomers, implying that Wnt binding mediates FZD receptor dimerization. Our data uncover possibilities for the arrangement of Wnt–FZD CRD complexes and shed structural insights that could aide in the identification of pharmacological strategies to modulate FZD receptor function. PMID:28377511
Xu, Min-jie; Zhang, Cong; Yang, Zhigang
2018-01-01
Dopamine (DA) plays a modulatory role in numerous physiological processes such as light adaptation and food intake, and exerts these functions through DA receptors (DARs). This study presents, for the first time, isolation and characterization of the dopamine receptor 2(DA2 receptor) cDNA from the intestinal tissue of Eriocheir sinensis, an economically important freshwater aquaculture species in China. The DA2 receptor cDNA sequence, which was obtained by rapid amplification of cDNA ends, is 2369bp long, encode peptide of 589 amino acid, and is highly homologous to related sequences in crustaceans. Analysis of the deduced amino acid sequence and the structure of the DA2 indicated that this receptor is a member of the family of G protein-coupled receptors (GPCRs), as it contains seven transmembrane domains and other common signatures of GPCRs. RT-PCR showed that the expression of the DA2 receptor gene was distributed in various tissues, and high expression levels were observed in the cranial ganglia and the thoracic ganglia. Further study of the effect of photoperiod on DA2 expression showed that constant darkness induced a significant increase in DA2 expression in the cranial ganglia. Finally, analysis of DA2 receptor expression under different feeding statuses showed that there was significantly greater expression in the hepatopancreas and intestines after feeding than before feeding, but there were no differences in expression between the before feeding and during feeding periods in either tissue. Our results indicate that the DA2 receptor structurally belongs to the family of G protein-coupled receptors, and that the cranial ganglia are the main tissues in which the DA2 receptor participates in light adaptation during dark hours. In addition, the DA2 receptor in E. sinensis may be involved in the physiological regulation of the hepatopancreas and digestive tract after the ingestion of food. This study provides a foundation for further exploration of the light adaptation and digestive functions of the DA2 receptor in decapods. PMID:29554147
Wilczynski, Andrzej; Wilson, Krista R; Scott, Joseph W; Edison, Arthur S; Haskell-Luevano, Carrie
2005-04-21
The melanocortin receptor system consists of endogenous agonists, antagonists, G-protein coupled receptors, and auxiliary proteins that are involved in the regulation of complex physiological functions such as energy and weight homeostasis, feeding behavior, inflammation, sexual function, pigmentation, and exocrine gland function. Herein, we report the structure-activity relationship (SAR) of a new chimeric hAGRP-melanocortin agonist peptide template Tyr-c[beta-Asp-His-DPhe-Arg-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) that was characterized using amino acids previously reported in other melanocortin agonist templates. Twenty peptides were examined in this study, and six peptides were selected for (1)H NMR and computer-assisted molecular modeling structural analysis. The most notable results include the identification that modification of the chimeric template at the His position with Pro and Phe resulted in ligands that were nM mouse melanocortin-3 receptor (mMC3R) antagonists and nM mouse melanocortin-4 receptor (mMC4R) agonists. The peptides Tyr-c[beta-Asp-His-DPhe-Ala-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) and Tyr-c[beta-Asp-His-DNal(1')-Arg-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) resulted in 730- and 560-fold, respectively, mMC4R versus mMC3R selective agonists that also possessed nM agonist potency at the mMC1R and mMC5R. Structural studies identified a reverse turn occurring in the His-DPhe-Arg-Trp domain, with subtle differences observed that may account for the differences in melanocortin receptor pharmacology. Specifically, a gamma-turn secondary structure involving the DPhe(4) in the central position of the Tyr-c[beta-Asp-Phe-DPhe-Arg-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) peptide may differentiate the mixed mMC3R antagonist and mMC4R agonist pharmacology.
Structural basis for corepressor assembly by the orphan nuclear receptor TLX
Zhou, X. Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten
2015-01-01
The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. PMID:25691470
Recent Advances in the Realm of Allosteric Modulators for Opioid Receptors for Future Therapeutics.
Remesic, Michael; Hruby, Victor J; Porreca, Frank; Lee, Yeon Sun
2017-06-21
Opioids, and more specifically μ-opioid receptor (MOR) agonists such as morphine, have long been clinically used as therapeutics for severe pain states but often come with serious side effects such as addiction and tolerance. Many studies have focused on bringing about analgesia from the MOR with attenuated side effects, but its underlying mechanism is not fully understood. Recently, focus has been geared toward the design and elucidation of the orthosteric site with ligands of various biological profiles and mixed subtype opioid activities and selectivities, but targeting the allosteric site is an area of increasing interest. It has been shown that allosteric modulators play key roles in influencing receptor function such as its tolerance to a ligand and affect downstream pathways. There has been a high variance of chemical structures that provide allosteric modulation at a given receptor, but recent studies and reviews tend to focus on the altered cellular mechanisms instead of providing a more rigorous description of the allosteric ligand's structure-function relationship. In this review, we aim to explore recent developments in the structural motifs that potentiate orthosteric binding and their influences on cellular pathways in an effort to present novel approaches to opioid therapeutic design.
Structural basis for corepressor assembly by the orphan nuclear receptor TLX
Zhi, Xiaoyong; Zhou, X. Edward; He, Yuanzheng; ...
2015-02-15
The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conservedmore » ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression.« less
Da Silva Figueiredo Celestino Gomes, Priscila; Panel, Nicolas; Laine, Elodie; Pascutti, Pedro Geraldo; Solary, Eric; Tchertanov, Luba
2014-01-01
The colony stimulating factor-1 receptor (CSF-1R) and the stem cell factor receptor KIT, type III receptor tyrosine kinases (RTKs), are important mediators of signal transduction. The normal functions of these receptors can be compromised by gain-of-function mutations associated with different physiopatological impacts. Whereas KIT D816V/H mutation is a well-characterized oncogenic event and principal cause of systemic mastocytosis, the homologous CSF-1R D802V has not been identified in human cancers. The KIT D816V oncogenic mutation triggers resistance to the RTK inhibitor Imatinib used as first line treatment against chronic myeloid leukemia and gastrointestinal tumors. CSF-1R is also sensitive to Imatinib and this sensitivity is altered by mutation D802V. Previous in silico characterization of the D816V mutation in KIT evidenced that the mutation caused a structure reorganization of the juxtamembrane region (JMR) and facilitated its departure from the kinase domain (KD). In this study, we showed that the equivalent CSF-1R D802V mutation does not promote such structural effects on the JMR despite of a reduction on some key H-bonds interactions controlling the JMR binding to the KD. In addition, this mutation disrupts the allosteric communication between two essential regulatory fragments of the receptors, the JMR and the A-loop. Nevertheless, the mutation-induced shift towards an active conformation observed in KIT D816V is not observed in CSF-1R D802V. The distinct impact of equivalent mutation in two homologous RTKs could be associated with the sequence difference between both receptors in the native form, particularly in the JMR region. A local mutation-induced perturbation on the A-loop structure observed in both receptors indicates the stabilization of an inactive non-inhibited form, which Imatinib cannot bind. PMID:24828813
Harms, Jonathan E.; Benveniste, Morris; Maclean, John K. F.; Partin, Kathryn M.; Jamieson, Craig
2012-01-01
Positive allosteric modulators of α-amino-3-hydroxy-5-methyl-isoxazole-propionic acid (AMPA) receptors facilitate synaptic plasticity and can improve various forms of learning and memory. These modulators show promise as therapeutic agents for the treatment of neurological disorders such as schizophrenia, ADHD, and mental depression. Three classes of positive modulator, the benzamides, the thiadiazides, and the biarylsulfonamides differentially occupy a solvent accessible binding pocket at the interface between the two subunits that form the AMPA receptor ligand-binding pocket. Here, we describe the electrophysiological properties of a new chemotype derived from a structure-based drug design strategy (SBDD), which makes similar receptor interactions compared to previously reported classes of modulator. This pyrazole amide derivative, JAMI1001A, with a promising developability profile, efficaciously modulates AMPA receptor deactivation and desensitization of both flip and flop receptor isoforms. PMID:22735771
[Research advance on role of Coxsackie and adenovirus receptor (CAR) in tumor progression].
Fan, Liang-Sheng; Chen, Gang; Ma, Ding
2009-03-01
Coxsackie and adenovirus receptor (CAR) is originally identified as the cellular receptor of 2-and 5-type adenoviruses. Many researches have suggested that CAR can affect the growth, adhesive ability and cytoskeleton of tumor cells, and has complicated functions in metastasis and invasion of tumors. Moreover, the expression of CAR has close relationship with tumor prognosis and cytoreduction mediated by adenoviruses. CAR has become a new hotspot in the research on mechanism of tumor progression and gene therapy. Our review focuses on the structure and function of CAR and its role in mediating occurrence and progression of tumor.
Structural modeling of G-protein coupled receptors: An overview on automatic web-servers.
Busato, Mirko; Giorgetti, Alejandro
2016-08-01
Despite the significant efforts and discoveries during the last few years in G protein-coupled receptor (GPCR) expression and crystallization, the receptors with known structures to date are limited only to a small fraction of human GPCRs. The lack of experimental three-dimensional structures of the receptors represents a strong limitation that hampers a deep understanding of their function. Computational techniques are thus a valid alternative strategy to model three-dimensional structures. Indeed, recent advances in the field, together with extraordinary developments in crystallography, in particular due to its ability to capture GPCRs in different activation states, have led to encouraging results in the generation of accurate models. This, prompted the community of modelers to render their methods publicly available through dedicated databases and web-servers. Here, we present an extensive overview on these services, focusing on their advantages, drawbacks and their role in successful applications. Future challenges in the field of GPCR modeling, such as the predictions of long loop regions and the modeling of receptor activation states are presented as well. Copyright © 2016 Elsevier Ltd. All rights reserved.
Structural basis of ligand binding modes at the neuropeptide Y Y1 receptor.
Yang, Zhenlin; Han, Shuo; Keller, Max; Kaiser, Anette; Bender, Brian J; Bosse, Mathias; Burkert, Kerstin; Kögler, Lisa M; Wifling, David; Bernhardt, Guenther; Plank, Nicole; Littmann, Timo; Schmidt, Peter; Yi, Cuiying; Li, Beibei; Ye, Sheng; Zhang, Rongguang; Xu, Bo; Larhammar, Dan; Stevens, Raymond C; Huster, Daniel; Meiler, Jens; Zhao, Qiang; Beck-Sickinger, Annette G; Buschauer, Armin; Wu, Beili
2018-04-01
Neuropeptide Y (NPY) receptors belong to the G-protein-coupled receptor superfamily and have important roles in food intake, anxiety and cancer biology 1,2 . The NPY-Y receptor system has emerged as one of the most complex networks with three peptide ligands (NPY, peptide YY and pancreatic polypeptide) binding to four receptors in most mammals, namely the Y 1 , Y 2 , Y 4 and Y 5 receptors, with different affinity and selectivity 3 . NPY is the most powerful stimulant of food intake and this effect is primarily mediated by the Y 1 receptor (Y 1 R) 4 . A number of peptides and small-molecule compounds have been characterized as Y 1 R antagonists and have shown clinical potential in the treatment of obesity 4 , tumour 1 and bone loss 5 . However, their clinical usage has been hampered by low potency and selectivity, poor brain penetration ability or lack of oral bioavailability 6 . Here we report crystal structures of the human Y 1 R bound to the two selective antagonists UR-MK299 and BMS-193885 at 2.7 and 3.0 Å resolution, respectively. The structures combined with mutagenesis studies reveal the binding modes of Y 1 R to several structurally diverse antagonists and the determinants of ligand selectivity. The Y 1 R structure and molecular docking of the endogenous agonist NPY, together with nuclear magnetic resonance, photo-crosslinking and functional studies, provide insights into the binding behaviour of the agonist and for the first time, to our knowledge, determine the interaction of its N terminus with the receptor. These insights into Y 1 R can enable structure-based drug discovery that targets NPY receptors.
Alencar, Allan K N; Pereira, Sharlene L; Montagnoli, Tadeu L; Maia, Rodolfo C; Kümmerle, Arthur E; Landgraf, Sharon S; Caruso-Neves, Celso; Ferraz, Emanuelle B; Tesch, Roberta; Nascimento, José H M; de Sant'Anna, Carlos M R; Fraga, Carlos A M; Barreiro, Eliezer J; Sudo, Roberto T; Zapata-Sudo, Gisele
2013-01-01
Background and Purpose Pulmonary arterial hypertension (PAH) is characterized by enhanced pulmonary vascular resistance, right ventricular hypertrophy and increased right ventricular systolic pressure. Here, we investigated the effects of a N-acylhydrazone derivative, 3,4-dimethoxyphenyl-N-methyl-benzoylhydrazide (LASSBio-1359), on monocrotaline (MCT)-induced pulmonary hypertension in rats. Experimental Approach PAH was induced in male Wistar rats by a single i.p. injection of MCT (60 mg·kg−1) and 2 weeks later, oral LASSBio-1359 (50 mg·kg−1) or vehicle was given once daily for 14 days. Echocardiography was used to measure cardiac function and pulmonary artery dimensions, with histological assay of vascular collagen. Studies of binding to human recombinant adenosine receptors (A1, A2A, A3) and of docking with A2A receptors were also performed. Key Results MCT administration induced changes in vascular and ventricular structure and function, characteristic of PAH. These changes were reversed by treatment with LASSBio-1359. MCT also induced endothelial dysfunction in pulmonary artery, as measured by diminished relaxation of pre-contracted arterial rings, and this dysfunction was reversed by LASSBio-1359. In pulmonary artery rings from normal Wistar rats, LASSBio-1359 induced relaxation, which was decreased by the adenosine A2A receptor antagonist, ZM 241385. In adenosine receptor binding studies, LASSBio-1359 showed most affinity for the A2A receptor and in the docking analyses, binding modes of LASSBio-1359 and the A2A receptor agonist, CGS21680, were very similar. Conclusion and Implications In rats with MCT-induced PAH, structural and functional changes in heart and pulmonary artery were reversed by treatment with oral LASSBio-1359, most probably through the activation of adenosine A2A receptors. PMID:23530610
A Novel Tenebrio molitor Cadherin Is a Functional Receptor for Bacillus thuringiensis Cry3Aa Toxin*
Fabrick, Jeff; Oppert, Cris; Lorenzen, Marcé D.; Morris, Kaley; Oppert, Brenda; Jurat-Fuentes, Juan Luis
2009-01-01
Cry toxins produced by the bacterium Bacillus thuringiensis are effective biological insecticides. Cadherin-like proteins have been reported as functional Cry1A toxin receptors in Lepidoptera. Here we present data that demonstrate that a coleopteran cadherin is a functional Cry3Aa toxin receptor. The Cry3Aa receptor cadherin was cloned from Tenebrio molitor larval midgut mRNA, and the predicted protein, TmCad1, has domain structure and a putative toxin binding region similar to those in lepidopteran cadherin B. thuringiensis receptors. A peptide containing the putative toxin binding region from TmCad1 bound specifically to Cry3Aa and promoted the formation of Cry3Aa toxin oligomers, proposed to be mediators of toxicity in lepidopterans. Injection of TmCad1-specific double-stranded RNA into T. molitor larvae resulted in knockdown of the TmCad1 transcript and conferred resistance to Cry3Aa toxicity. These data demonstrate the functional role of TmCad1 as a Cry3Aa receptor in T. molitor and reveal similarities between the mode of action of Cry toxins in Lepidoptera and Coleoptera. PMID:19416969
Oligomerization of G protein-coupled receptors: computational methods.
Selent, J; Kaczor, A A
2011-01-01
Recent research has unveiled the complexity of mechanisms involved in G protein-coupled receptor (GPCR) functioning in which receptor dimerization/oligomerization may play an important role. Although the first high-resolution X-ray structure for a likely functional chemokine receptor dimer has been deposited in the Protein Data Bank, the interactions and mechanisms of dimer formation are not yet fully understood. In this respect, computational methods play a key role for predicting accurate GPCR complexes. This review outlines computational approaches focusing on sequence- and structure-based methodologies as well as discusses their advantages and limitations. Sequence-based approaches that search for possible protein-protein interfaces in GPCR complexes have been applied with success in several studies, but did not yield always consistent results. Structure-based methodologies are a potent complement to sequence-based approaches. For instance, protein-protein docking is a valuable method especially when guided by experimental constraints. Some disadvantages like limited receptor flexibility and non-consideration of the membrane environment have to be taken into account. Molecular dynamics simulation can overcome these drawbacks giving a detailed description of conformational changes in a native-like membrane. Successful prediction of GPCR complexes using computational approaches combined with experimental efforts may help to understand the role of dimeric/oligomeric GPCR complexes for fine-tuning receptor signaling. Moreover, since such GPCR complexes have attracted interest as potential drug target for diverse diseases, unveiling molecular determinants of dimerization/oligomerization can provide important implications for drug discovery.
The VPAC1 receptor: structure and function of a class B GPCR prototype
Couvineau, A.; Ceraudo, E.; Tan, Y.-V.; Nicole, P.; Laburthe, M.
2012-01-01
The class B G protein-coupled receptors (GPCRs) represents a small sub-family encompassing 15 members, and are very promising targets for the development of drugs to treat many diseases such as chronic inflammation, neurodegeneration, diabetes, stress, and osteoporosis. The VPAC1 receptor which is an archetype of the class B GPCRs binds Vasoactive Intestinal Peptide (VIP), a neuropeptide widely distributed in central and peripheral nervous system modulating many physiological processes including regulation of exocrine secretions, hormone release, foetal development, immune response … VIP appears to exert beneficial effect in neurodegenerative and inflammatory diseases. This article reviews the current knowledge regarding the structure and molecular pharmacology of VPAC1 receptors. Over the past decade, structure–function relationship studies have demonstrated that the N-terminal ectodomain (N-ted) of VPAC1 plays a pivotal role in VIP recognition. The use of different approaches such as directed mutagenesis, photoaffinity labeling, Nuclear Magnetic Resonance (NMR), molecular modeling, and molecular dynamic simulation has led to demonstrate that: (1) the central and C-terminal part of the VIP molecule interacts with the N-ted of VPAC1 receptor which is itself structured as a « Sushi » domain; (2) the N-terminal end of the VIP molecule interacts with the first transmembrane domain of the receptor where three residues (K143, T144, and T147) play an important role in VPAC1 interaction with the first histidine residue of VIP. PMID:23162538
Structure and dynamics of the M3 muscarinic acetylcholine receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kruse, Andrew C.; Hu, Jianxin; Pan, Albert C.
2012-03-01
Acetylcholine, the first neurotransmitter to be identified, exerts many of its physiological actions via activation of a family of G-protein-coupled receptors (GPCRs) known as muscarinic acetylcholine receptors (mAChRs). Although the five mAChR subtypes (M1-M5) share a high degree of sequence homology, they show pronounced differences in G-protein coupling preference and the physiological responses they mediate. Unfortunately, despite decades of effort, no therapeutic agents endowed with clear mAChR subtype selectivity have been developed to exploit these differences. We describe here the structure of the G{sub q/11}-coupled M3 mAChR ('M3 receptor', from rat) bound to the bronchodilator drug tiotropium and identify themore » binding mode for this clinically important drug. This structure, together with that of the G{sub i/o}-coupled M2 receptor, offers possibilities for the design of mAChR subtype-selective ligands. Importantly, the M3 receptor structure allows a structural comparison between two members of a mammalian GPCR subfamily displaying different G-protein coupling selectivities. Furthermore, molecular dynamics simulations suggest that tiotropium binds transiently to an allosteric site en route to the binding pocket of both receptors. These simulations offer a structural view of an allosteric binding mode for an orthosteric GPCR ligand and provide additional opportunities for the design of ligands with different affinities or binding kinetics for different mAChR subtypes. Our findings not only offer insights into the structure and function of one of the most important GPCR families, but may also facilitate the design of improved therapeutics targeting these critical receptors.« less
Extracellular matrix structure.
Theocharis, Achilleas D; Skandalis, Spyros S; Gialeli, Chrysostomi; Karamanos, Nikos K
2016-02-01
Extracellular matrix (ECM) is a non-cellular three-dimensional macromolecular network composed of collagens, proteoglycans/glycosaminoglycans, elastin, fibronectin, laminins, and several other glycoproteins. Matrix components bind each other as well as cell adhesion receptors forming a complex network into which cells reside in all tissues and organs. Cell surface receptors transduce signals into cells from ECM, which regulate diverse cellular functions, such as survival, growth, migration, and differentiation, and are vital for maintaining normal homeostasis. ECM is a highly dynamic structural network that continuously undergoes remodeling mediated by several matrix-degrading enzymes during normal and pathological conditions. Deregulation of ECM composition and structure is associated with the development and progression of several pathologic conditions. This article emphasizes in the complex ECM structure as to provide a better understanding of its dynamic structural and functional multipotency. Where relevant, the implication of the various families of ECM macromolecules in health and disease is also presented. Copyright © 2015 Elsevier B.V. All rights reserved.
Chen, RuiQi; Yu, Yue; Dong, Xuesen
2017-02-01
Advanced prostate cancer undergoing androgen receptor pathway inhibition (ARPI) eventually progresses to castrate-resistant prostate cancer (CRPC), suggesting that (i) androgen receptor (AR) blockage is incomplete, and (ii) there are other critical molecular pathways contributing to prostate cancer (PCa) progression. Although most PCa occurs in the epithelium, prostate stroma is increasingly believed to play a crucial role in promoting tumorigenesis and facilitating tumor progression. In the stroma, sex steroid hormone receptors such as AR and estrogen receptor-α are implicated to have important functions, whereas the progesterone receptor (PR) remains largely under-investigated despite the high sequence and structural similarities between PR and AR. Stromal progesterone/PR signaling may play a critical role in PCa development and progression because not only progesterone is a critical precursor for de novo androgen steroidogenesis and an activator of mutant androgen receptors, but also PR functions in a ligand-independent manner in various important pathways. In fact, recent progress in our understanding of stromal PR function suggests that this receptor may exert an inhibitory effect on benign prostatic hyperplasia (BPH), reactive stroma development, and PCa progression. These early findings of stromal PR warrant further investigations as this receptor could be a potential biomarker and therapeutic target in PCa management. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chen, Zengsheng; Koenig, Steven C; Slaughter, Mark S; Griffith, Bartley P; Wu, Zhongjun J
2017-11-07
The structural integrity of platelet receptors is essential for platelets to play the normal hemostatic function. The high non-physiologic shear stress (NPSS) commonly exists in blood-contacting medical devices and has been shown to cause platelet receptor shedding. The loss of platelet receptors may impair the normal hemostatic function of platelets. The aim of this study was to quantify NPSS-induced shedding of three key receptors on the platelet surface. Human blood was subjected to the matrix of well-defined shear stresses and exposure times, generated by using a custom-designed blood-shearing device. The expression of three key platelet receptors, glycoprotein (GP) Ibα, GPVI, and GPIIb/IIIa, in sheared blood was quantified using flow cytometry. The quantitative relationship between the loss of each of the three receptors on the platelet surface and shear condition (shear stress level and exposure time) was explored. It was found that these relationships followed well the power law functional form. The coefficients of the power law models for the shear-induced shedding of these platelet receptors were derived with coefficients of determination (R) of 0.77, 0.73, and 0.78, respectively. The power law models with these coefficients may be potentially used to predict the shear-induced platelet receptor shedding of human blood.
μ Opioid receptor: novel antagonists and structural modeling
NASA Astrophysics Data System (ADS)
Kaserer, Teresa; Lantero, Aquilino; Schmidhammer, Helmut; Spetea, Mariana; Schuster, Daniela
2016-02-01
The μ opioid receptor (MOR) is a prominent member of the G protein-coupled receptor family and the molecular target of morphine and other opioid drugs. Despite the long tradition of MOR-targeting drugs, still little is known about the ligand-receptor interactions and structure-function relationships underlying the distinct biological effects upon receptor activation or inhibition. With the resolved crystal structure of the β-funaltrexamine-MOR complex, we aimed at the discovery of novel agonists and antagonists using virtual screening tools, i.e. docking, pharmacophore- and shape-based modeling. We suggest important molecular interactions, which active molecules share and distinguish agonists and antagonists. These results allowed for the generation of theoretically validated in silico workflows that were employed for prospective virtual screening. Out of 18 virtual hits evaluated in in vitro pharmacological assays, three displayed antagonist activity and the most active compound significantly inhibited morphine-induced antinociception. The new identified chemotypes hold promise for further development into neurochemical tools for studying the MOR or as potential therapeutic lead candidates.
New horizons for lipoprotein receptors: communication by β-propellers
Andersen, Olav M.; Dagil, Robert; Kragelund, Birthe B.
2013-01-01
The lipoprotein receptor (LR) family constitutes a large group of structurally closely related receptors with broad ligand-binding specificity. Traditionally, ligand binding to LRs has been anticipated to involve merely the complement type repeat (CR)-domains omnipresent in the family. Recently, this dogma has transformed with the observation that β-propellers of some LRs actively engage in complex formation too. Based on an in-depth decomposition of current structures and sequences, we suggest that exploitation of the β-propellers as binding targets depends on receptor subgroups. In particular, we highlight the shutter mechanism of β-propellers as a general recognition motif for NxI-containing ligands, and we present indications that the generalized β-propeller-induced ligand release mechanism is not applicable for the larger LRs. For the giant LR members, we present evidence that their β-propellers may also actively engage in ligand binding. We therefore advocate for an increased focus on solving the structure-function relationship of this group of important biological receptors. PMID:23881912
Functional Classification of Immune Regulatory Proteins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rubinstein, Rotem; Ramagopal, Udupi A.; Nathenson, Stanley G.
2013-05-01
Members of the immunoglobulin superfamily (IgSF) control innate and adaptive immunity and are prime targets for the treatment of autoimmune diseases, infectious diseases, and malignancies. We describe a computational method, termed the Brotherhood algorithm, which utilizes intermediate sequence information to classify proteins into functionally related families. This approach identifies functional relationships within the IgSF and predicts additional receptor-ligand interactions. As a specific example, we examine the nectin/nectin-like family of cell adhesion and signaling proteins and propose receptor-ligand interactions within this family. We were guided by the Brotherhood approach and present the high-resolution structural characterization of a homophilic interaction involving themore » class-I MHC-restricted T-cell-associated molecule, which we now classify as a nectin-like family member. The Brotherhood algorithm is likely to have a significant impact on structural immunology by identifying those proteins and complexes for which structural characterization will be particularly informative.« less
Zhan, Xuanzhi; Gimenez, Luis E.; Gurevich, Vsevolod V.; Spiller, Benjamin W.
2011-01-01
Arrestins are multi-functional proteins that regulate signaling and trafficking of the majority of G protein-coupled receptors (GPCRs), as well as sub-cellular localization and activity of many other signaling proteins. Here we report the first crystal structure of arrestin-3, solved at 3.0Å. Arrestin-3 is an elongated two-domain molecule with the overall fold and key inter-domain interactions that hold free protein in the basal conformation similar to the other subtypes. Arrestin-3 is the least selective member of the family, binding wide variety of GPCRs with high affinity and demonstrating lower preference for active phosphorylated forms of the receptors. In contrast to the other three arrestins, part of the receptor-binding surface in the arrestin-3 C-domain does not form a contiguous β-sheet, consistent with increased flexibility. By swapping the corresponding elements between arrestin-2 and -3 we show that the presence of this loose structure correlates with reduced arrestin selectivity for activated receptor, consistent with a conformational change in this β-sheet upon receptor binding. PMID:21215759
Structure and dynamics of AMPA receptor GluA2 in resting, pre-open and desensitized states
Dürr, Katharina L.; Chen, Lei; Stein, Richard A.; De Zorzi, Rita; MihaelaFolea, I.; Walz, Thomas; Mchaourab, Hassane S.; Gouaux, Eric
2014-01-01
Summary Ionotropic glutamate receptors (iGluRs) mediate the majority of fast excitatory signaling in the nervous system. Despite the profound importance of iGluRs in the nervous system, little is known about the structures and dynamics of intact receptors in distinct functional states. Here we elucidate the structures of the intact GluA2 AMPA receptor in an apo resting/closed state, in an activated/pre-open state bound with the partial agonists and a positive allosteric modulator and in a desensitized/closed state in complex with FW alone. To probe the conformational properties of these states, we carried out double electron-electron resonance experiments on cysteine mutants and cryo-electron microscopy studies. We show how agonist binding modulates the conformation of the ligand binding domain 'layer' of the intact receptors and how, upon desensitization, the receptor undergoes large conformational rearrangements of amino-terminal and ligand-binding domains. We define mechanistic principles by which to understand antagonism, activation and desensitization in AMPA iGluRs. PMID:25109876
Cui, Yanfang; Tae, Han-Shen; Norris, Nicole C; Karunasekara, Yamuna; Pouliquin, Pierre; Board, Philip G; Dulhunty, Angela F; Casarotto, Marco G
2009-03-01
The II-III loop of the dihydropyridine receptor (DHPR) alpha(1s) subunit is a modulator of the ryanodine receptor (RyR1) Ca(2+) release channel in vitro and is essential for skeletal muscle contraction in vivo. Despite its importance, the structure of this loop has not been reported. We have investigated its structure using a suite of NMR techniques which revealed that the DHPR II-III loop is an intrinsically unstructured protein (IUP) and as such belongs to a burgeoning structural class of functionally important proteins. The loop does not possess a stable tertiary fold: it is highly flexible, with a strong N-terminal helix followed by nascent helical/turn elements and unstructured segments. Its residual structure is loosely globular with the N and C termini in close proximity. The unstructured nature of the II-III loop may allow it to easily modify its interaction with RyR1 following a surface action potential and thus initiate rapid Ca(2+) release and contraction. The in vitro binding partner for the II-III was investigated. The II-III loop interacts with the second of three structurally distinct SPRY domains in RyR1, whose function is unknown. This interaction occurs through two preformed N-terminal alpha-helical regions and a C-terminal hydrophobic element. The A peptide corresponding to the helical N-terminal region is a common probe of RyR function and binds to the same SPRY domain as the full II-III loop. Thus the second SPRY domain is an in vitro binding site for the II-III loop. The possible in vivo role of this region is discussed.
Dunne, Aisling; Ejdeback, Mikael; Ludidi, Phumzile L; O'Neill, Luke A J; Gay, Nicholas J
2003-10-17
The Toll/interleukin 1 receptor (TIR) domain is a region found in the cytoplasmic tails of members of the Toll-like receptor/interleukin-1 receptor superfamily. The domain is essential for signaling and is also found in the adaptor proteins Mal (MyD88 adaptor-like) and MyD88, which function to couple activation of the receptor to downstream signaling components. Experimental structures of two Toll/interleukin 1 receptor domains reveal a alpha-beta-fold similar to that of the bacterial chemotaxis protein CheY, and other evidence suggests that the adaptors can make heterotypic interactions with both the receptors and themselves. Here we show that the purified TIR domains of Mal and MyD88 can form stable heterodimers and also that Mal homodimers and oligomers are dissociated in the presence of ATP. To identify structural features that may contribute to the formation of signaling complexes, we produced models of the TIR domains from human Toll-like receptor 4 (TLR4), Mal, and MyD88. We found that although the overall fold is conserved the electrostatic surface potentials are quite distinct. Docking studies of the models suggest that Mal and MyD88 bind to different regions in TLRs 2 and 4, a finding consistent with a cooperative role of the two adaptors in signaling. Mal and MyD88 are predicted to interact at a third non-overlapping site, suggesting that the receptor and adaptors may form heterotetrameric complexes. The theoretical model of the interactions is supported by experimental data from glutathione S-transferase pull-downs and co-immunoprecipitations. Neither theoretical nor experimental data suggest a direct role for the conserved proline in the BB-loop in the association of TLR4, Mal, and MyD88. Finally we show a sequence relationship between the Drosophila protein Tube and Mal that may indicate a functional equivalence of these two adaptors in the Drosophila and vertebrate Toll pathways.
Crystal Structures of the Glutamate Receptor Ion Channel GluK3 and GluK5 Amino-Terminal Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Janesh; Mayer, Mark L.
2010-11-30
Ionotropic glutamate receptors (iGluRs) mediate the majority of fast excitatory synaptic neurotransmission in the central nervous system. The selective assembly of iGluRs into AMPA, kainate, and N-methyl-d-aspartic acid (NMDA) receptor subtypes is regulated by their extracellular amino-terminal domains (ATDs). Kainate receptors are further classified into low-affinity receptor families (GluK1-GluK3) and high-affinity receptor families (GluK4-GluK5) based on their affinity for the neurotoxin kainic acid. These two families share a 42% sequence identity for the intact receptor but only a 27% sequence identity at the level of ATD. We have determined for the first time the high-resolution crystal structures of GluK3 andmore » GluK5 ATDs, both of which crystallize as dimers but with a strikingly different dimer assembly at the R1 interface. By contrast, for both GluK3 and GluK5, the R2 domain dimer assembly is similar to those reported previously for other non-NMDA iGluRs. This observation is consistent with the reports that GluK4-GluK5 cannot form functional homomeric ion channels and require obligate coassembly with GluK1-GluK3. Our analysis also reveals that the relative orientation of domains R1 and R2 in individual non-NMDA receptor ATDs varies by up to 10{sup o}, in contrast to the 50{sup o} difference reported for the NMDA receptor GluN2B subunit. This restricted domain movement in non-NMDA receptor ATDs seems to result both from extensive intramolecular contacts between domain R1 and domain R2 and from their assembly as dimers, which interact at both R1 and R2 domains. Our results provide the first insights into the structure and function of GluK4-GluK5, the least understood family of iGluRs.« less
Molecular dynamics-based model of VEGF-A and its heparin interactions.
Uciechowska-Kaczmarzyk, Urszula; Babik, Sándor; Zsila, Ferenc; Bojarski, Krzysztof Kamil; Beke-Somfai, Tamás; Samsonov, Sergey A
2018-06-01
We present a computational model of the Vascular Endothelial Growth Factor (VEGF), an important regulator of blood vessels formation, which function is affected by its heparin interactions. Although structures of a receptor binding (RBD) and a heparin binding domain (HBD) of VEGF are known, there are structural data neither on the 12 amino acids interdomain linker nor on its complexes with heparin. We apply molecular docking and molecular dynamics techniques combined with circular dichroism spectroscopy to model the full structure of the dimeric VEGF and to propose putative molecular mechanisms underlying the function of VEGF/VEGF receptors/heparin system. We show that both the conformational flexibility of the linker and the formation of HBD-heparin-HBD sandwich-like structures regulate the mutual disposition of HBDs and so affect the VEGF-mediated signalling. Copyright © 2018 Elsevier Inc. All rights reserved.
Key structural features of nonsteroidal ligands for binding and activation of the androgen receptor.
Yin, Donghua; He, Yali; Perera, Minoli A; Hong, Seoung Soo; Marhefka, Craig; Stourman, Nina; Kirkovsky, Leonid; Miller, Duane D; Dalton, James T
2003-01-01
The purposes of the present studies were to examine the androgen receptor (AR) binding ability and in vitro functional activity of multiple series of nonsteroidal compounds derived from known antiandrogen pharmacophores and to investigate the structure-activity relationships (SARs) of these nonsteroidal compounds. The AR binding properties of sixty-five nonsteroidal compounds were assessed by a radioligand competitive binding assay with the use of cytosolic AR prepared from rat prostates. The AR agonist and antagonist activities of high-affinity ligands were determined by the ability of the ligand to regulate AR-mediated transcriptional activation in cultured CV-1 cells, using a cotransfection assay. Nonsteroidal compounds with diverse structural features demonstrated a wide range of binding affinity for the AR. Ten compounds, mainly from the bicalutamide-related series, showed a binding affinity superior to the structural pharmacophore from which they were derived. Several SARs regarding nonsteroidal AR binding were revealed from the binding data, including stereoisomeric conformation, steric effect, and electronic effect. The functional activity of high-affinity ligands ranged from antagonist to full agonist for the AR. Several structural features were found to be determinative of agonist and antagonist activities. The nonsteroidal AR agonists identified from the present studies provided a pool of candidates for further development of selective androgen receptor modulators (SARMs) for androgen therapy. Also, these studies uncovered or confirmed numerous important SARs governing AR binding and functional properties by nonsteroidal molecules, which would be valuable in the future structural optimization of SARMs.
Croy, Carrie H; Schober, Douglas A; Xiao, Hongling; Quets, Anne; Christopoulos, Arthur; Felder, Christian C
2014-07-01
The M(4) receptor is a compelling therapeutic target, as this receptor modulates neural circuits dysregulated in schizophrenia, and there is clinical evidence that muscarinic agonists possess both antipsychotic and procognitive efficacy. Recent efforts have shifted toward allosteric ligands to maximize receptor selectivity and manipulate endogenous cholinergic and dopaminergic signaling. In this study, we present the pharmacological characterization of LY2119620 (3-amino-5-chloro-N-cyclopropyl-4-methyl-6-[2-(4-methylpiperazin-1-yl)-2-oxoethoxy] thieno[2,3-b]pyridine-2-carboxamide), a M(2)/M(4) receptor-selective positive allosteric modulator (PAM), chemically evolved from hits identified through a M4 allosteric functional screen. Although unsuitable as a therapeutic due to M(2) receptor cross-reactivity and, thus, potential cardiovascular liability, LY2119620 surpassed previous congeners in potency and PAM activity and broadens research capabilities through its development into a radiotracer. Characterization of LY2119620 revealed evidence of probe dependence in both binding and functional assays. Guanosine 5'-[γ-(35)S]-triphosphate assays displayed differential potentiation depending on the orthosteric-allosteric pairing, with the largest cooperativity observed for oxotremorine M (Oxo-M) LY2119620. Further [(3)H]Oxo-M saturation binding, including studies with guanosine-5'-[(β,γ)-imido]triphosphate, suggests that both the orthosteric and allosteric ligands can alter the population of receptors in the active G protein-coupled state. Additionally, this work expands the characterization of the orthosteric agonist, iperoxo, at the M(4) receptor, and demonstrates that an allosteric ligand can positively modulate the binding and functional efficacy of this high efficacy ligand. Ultimately, it was the M(2) receptor pharmacology and PAM activity with iperoxo that made LY2119620 the most suitable allosteric partner for the M(2) active-state structure recently solved (Kruse et al., 2013), a structure that provides crucial insights into the mechanisms of orthosteric activation and allosteric modulation of muscarinic receptors. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.
Regulation of T-cell receptor signalling by membrane microdomains
Razzaq, Tahir M; Ozegbe, Patricia; Jury, Elizabeth C; Sembi, Phupinder; Blackwell, Nathan M; Kabouridis, Panagiotis S
2004-01-01
There is now considerable evidence suggesting that the plasma membrane of mammalian cells is compartmentalized by functional lipid raft microdomains. These structures are assemblies of specialized lipids and proteins and have been implicated in diverse biological functions. Analysis of their protein content using proteomics and other methods revealed enrichment of signalling proteins, suggesting a role for these domains in intracellular signalling. In T lymphocytes, structure/function experiments and complementary pharmacological studies have shown that raft microdomains control the localization and function of proteins which are components of signalling pathways regulated by the T-cell antigen receptor (TCR). Based on these studies, a model for TCR phosphorylation in lipid rafts is presented. However, despite substantial progress in the field, critical questions remain. For example, it is unclear if membrane rafts represent a homogeneous population and if their structure is modified upon TCR stimulation. In the future, proteomics and the parallel development of complementary analytical methods will undoubtedly contribute in further delineating the role of lipid rafts in signal transduction mechanisms. PMID:15554919
Design and Discovery of Functionally Selective Serotonin 2C (5-HT2C) Receptor Agonists.
Cheng, Jianjun; McCorvy, John D; Giguere, Patrick M; Zhu, Hu; Kenakin, Terry; Roth, Bryan L; Kozikowski, Alan P
2016-11-10
On the basis of the structural similarity of our previous 5-HT 2C agonists with the melatonin receptor agonist tasimelteon and the putative biological cross-talk between serotonergic and melatonergic systems, a series of new (2,3-dihydro)benzofuran-based compounds were designed and synthesized. The compounds were evaluated for their selectivity toward 5-HT 2A , 5-HT 2B , and 5-HT 2C receptors in the calcium flux assay with the ultimate goal to generate selective 5-HT 2C agonists. Selected compounds were studied for their functional selectivity by comparing their transduction efficiency at the G protein signaling pathway versus β-arrestin recruitment. The most functionally selective compound (+)-7e produced weak β-arrestin recruitment and also demonstrated less receptor desensitization compared to serotonin in both calcium flux and phosphoinositide (PI) hydrolysis assays. We report for the first time that selective 5-HT 2C agonists possessing weak β-arrestin recruitment can produce distinct receptor desensitization properties.
Baptista-Hon, Daniel T.; Deeb, Tarek Z.; Lambert, Jeremy J.; Peters, John A.; Hales, Tim G.
2013-01-01
The 5-HT3A receptor homology model, based on the partial structure of the nicotinic acetylcholine receptor from Torpedo marmorata, reveals an asymmetric ion channel with five portals framed by adjacent helical amphipathic (HA) stretches within the 114-residue loop between the M3 and M4 membrane-spanning domains. The positive charge of Arg-436, located within the HA stretch, is a rate-limiting determinant of single channel conductance (γ). Further analysis reveals that positive charge and volume of residue 436 are determinants of 5-HT3A receptor inward rectification, exposing an additional role for portals. A structurally unresolved stretch of 85 residues constitutes the bulk of the M3-M4 loop, leaving a >45-Å gap in the model between M3 and the HA stretch. There are no additional structural data for this loop, which is vestigial in bacterial pentameric ligand-gated ion channels and was largely removed for crystallization of the Caenorhabditis elegans glutamate-activated pentameric ligand-gated ion channels. We created 5-HT3A subunit loop truncation mutants, in which sequences framing the putative portals were retained, to determine the minimum number of residues required to maintain their functional integrity. Truncation to between 90 and 75 amino acids produced 5-HT3A receptors with unaltered rectification. Truncation to 70 residues abolished rectification and increased γ. These findings reveal a critical M3-M4 loop length required for functions attributable to cytoplasmic portals. Examination of all 44 subunits of the human neurotransmitter-activated Cys-loop receptors reveals that, despite considerable variability in their sequences and lengths, all M3-M4 loops exceed 70 residues, suggesting a fundamental requirement for portal integrity. PMID:23740249
Potent haloperidol derivatives covalently binding to the dopamine D2 receptor.
Schwalbe, Tobias; Kaindl, Jonas; Hübner, Harald; Gmeiner, Peter
2017-10-01
The dopamine D 2 receptor (D 2 R) is a common drug target for the treatment of a variety of neurological disorders including schizophrenia. Structure based design of subtype selective D 2 R antagonists requires high resolution crystal structures of the receptor and pharmacological tools promoting a better understanding of the protein-ligand interactions. Recently, we reported the development of a chemically activated dopamine derivative (FAUC150) designed to covalently bind the L94C mutant of the dopamine D 2 receptor. Using FAUC150 as a template, we elaborated the design and synthesis of irreversible analogs of the potent antipsychotic drug haloperidol forming covalent D 2 R-ligand complexes. The disulfide- and Michael acceptor-functionalized compounds showed significant receptor affinity and an irreversible binding profile in radioligand depletion experiments. Copyright © 2017 Elsevier Ltd. All rights reserved.
Xie, Xiang-Qun; Chowdhury, Ananda
2013-01-01
Structural biology of GPCRs has made significant progress upon recently developed technologies for GPCRs expression/purification and elucidation of GPCRs crystal structures. The crystal structures provide a snapshot of the receptor structural disposition of GPCRs itself or with cocrystallized ligands, and the results are congruent with biophysical and computer modeling studies reported about GPCRs conformational and dynamics flexibility, regulated activation, and the various stabilizing interactions, such as "molecular switches." The molecular switches generally constitute the most conserved domains within a particular GPCR superfamily. Often agonist-induced receptor activation proceeds by the disruption of majority of these interactions, while antagonist and inverse agonist act as blockers and structural stabilizers, respectively. Several elegant studies, particularly for the β2AR, have demonstrated the relationship between ligand structure, receptor conformational changes, and corresponding pharmacological outcomes. Thus, it is of great importance to understand GPCRs activation related to cell signaling pathways. Herein, we summarize the steps to produce functional GPCRs, generate suitably fluorescent labeled GPCRs and the procedure to use that to understand if ligand-induced activation can proceed by activation of the GPCRs via ionic lock switch and/or rotamer toggle switch mechanisms. Such understanding of ligand structure and mechanism of receptor activation will provide great insight toward uncovering newer pathways of GPCR activation and aid in structure-based drug design. Copyright © 2013 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Costanzi, Stefano; Tikhonova, Irina G.; Harden, T. Kendall; Jacobson, Kenneth A.
2009-11-01
Accurate in silico models for the quantitative prediction of the activity of G protein-coupled receptor (GPCR) ligands would greatly facilitate the process of drug discovery and development. Several methodologies have been developed based on the properties of the ligands, the direct study of the receptor-ligand interactions, or a combination of both approaches. Ligand-based three-dimensional quantitative structure-activity relationships (3D-QSAR) techniques, not requiring knowledge of the receptor structure, have been historically the first to be applied to the prediction of the activity of GPCR ligands. They are generally endowed with robustness and good ranking ability; however they are highly dependent on training sets. Structure-based techniques generally do not provide the level of accuracy necessary to yield meaningful rankings when applied to GPCR homology models. However, they are essentially independent from training sets and have a sufficient level of accuracy to allow an effective discrimination between binders and nonbinders, thus qualifying as viable lead discovery tools. The combination of ligand and structure-based methodologies in the form of receptor-based 3D-QSAR and ligand and structure-based consensus models results in robust and accurate quantitative predictions. The contribution of the structure-based component to these combined approaches is expected to become more substantial and effective in the future, as more sophisticated scoring functions are developed and more detailed structural information on GPCRs is gathered.
Structure Prediction of the Second Extracellular Loop in G-Protein-Coupled Receptors
Kmiecik, Sebastian; Jamroz, Michal; Kolinski, Michal
2014-01-01
G-protein-coupled receptors (GPCRs) play key roles in living organisms. Therefore, it is important to determine their functional structures. The second extracellular loop (ECL2) is a functionally important region of GPCRs, which poses significant challenge for computational structure prediction methods. In this work, we evaluated CABS, a well-established protein modeling tool for predicting ECL2 structure in 13 GPCRs. The ECL2s (with between 13 and 34 residues) are predicted in an environment of other extracellular loops being fully flexible and the transmembrane domain fixed in its x-ray conformation. The modeling procedure used theoretical predictions of ECL2 secondary structure and experimental constraints on disulfide bridges. Our approach yielded ensembles of low-energy conformers and the most populated conformers that contained models close to the available x-ray structures. The level of similarity between the predicted models and x-ray structures is comparable to that of other state-of-the-art computational methods. Our results extend other studies by including newly crystallized GPCRs. PMID:24896119
1989-03-16
nucleus robustus archistriatalis 1 1 1 nucleus reticularis gigantocellularis 1 3 3 nucleus reticularis lateralis 1 3 3 nucleus ... reticularis pontis caudalis 1 1 3 nucleus reticularis parvocellularis 1 1 2 nucleus rotundus 1 1 1 nucleus tractus solitarii 1 3 3 nucleus semilunaris...Structure a-bungarotoxin mAb 35 inAb 270 nucleus accumbens 1 1 1 nucleus basalis 1 1 1 nucleus cerebelli intermedium 2 3 3
GPCRdb: an information system for G protein-coupled receptors
Isberg, Vignir; Mordalski, Stefan; Munk, Christian; Rataj, Krzysztof; Harpsøe, Kasper; Hauser, Alexander S.; Vroling, Bas; Bojarski, Andrzej J.; Vriend, Gert; Gloriam, David E.
2016-01-01
Recent developments in G protein-coupled receptor (GPCR) structural biology and pharmacology have greatly enhanced our knowledge of receptor structure-function relations, and have helped improve the scientific foundation for drug design studies. The GPCR database, GPCRdb, serves a dual role in disseminating and enabling new scientific developments by providing reference data, analysis tools and interactive diagrams. This paper highlights new features in the fifth major GPCRdb release: (i) GPCR crystal structure browsing, superposition and display of ligand interactions; (ii) direct deposition by users of point mutations and their effects on ligand binding; (iii) refined snake and helix box residue diagram looks; and (iii) phylogenetic trees with receptor classification colour schemes. Under the hood, the entire GPCRdb front- and back-ends have been re-coded within one infrastructure, ensuring a smooth browsing experience and development. GPCRdb is available at http://www.gpcrdb.org/ and it's open source code at https://bitbucket.org/gpcr/protwis. PMID:26582914
Weiss, Dahlia R; Ahn, SeungKirl; Sassano, Maria F; Kleist, Andrew; Zhu, Xiao; Strachan, Ryan; Roth, Bryan L; Lefkowitz, Robert J; Shoichet, Brian K
2013-05-17
A prospective, large library virtual screen against an activated β2-adrenergic receptor (β2AR) structure returned potent agonists to the exclusion of inverse-agonists, providing the first complement to the previous virtual screening campaigns against inverse-agonist-bound G protein coupled receptor (GPCR) structures, which predicted only inverse-agonists. In addition, two hits recapitulated the signaling profile of the co-crystal ligand with respect to the G protein and arrestin mediated signaling. This functional fidelity has important implications in drug design, as the ability to predict ligands with predefined signaling properties is highly desirable. However, the agonist-bound state provides an uncertain template for modeling the activated conformation of other GPCRs, as a dopamine D2 receptor (DRD2) activated model templated on the activated β2AR structure returned few hits of only marginal potency.
New paradigms in chemokine receptor signal transduction: Moving beyond the two-site model.
Kleist, Andrew B; Getschman, Anthony E; Ziarek, Joshua J; Nevins, Amanda M; Gauthier, Pierre-Arnaud; Chevigné, Andy; Szpakowska, Martyna; Volkman, Brian F
2016-08-15
Chemokine receptor (CKR) signaling forms the basis of essential immune cellular functions, and dysregulated CKR signaling underpins numerous disease processes of the immune system and beyond. CKRs, which belong to the seven transmembrane domain receptor (7TMR) superfamily, initiate signaling upon binding of endogenous, secreted chemokine ligands. Chemokine-CKR interactions are traditionally described by a two-step/two-site mechanism, in which the CKR N-terminus recognizes the chemokine globular core (i.e. site 1 interaction), followed by activation when the unstructured chemokine N-terminus is inserted into the receptor TM bundle (i.e. site 2 interaction). Several recent studies challenge the structural independence of sites 1 and 2 by demonstrating physical and allosteric links between these supposedly separate sites. Others contest the functional independence of these sites, identifying nuanced roles for site 1 and other interactions in CKR activation. These developments emerge within a rapidly changing landscape in which CKR signaling is influenced by receptor PTMs, chemokine and CKR dimerization, and endogenous non-chemokine ligands. Simultaneous advances in the structural and functional characterization of 7TMR biased signaling have altered how we understand promiscuous chemokine-CKR interactions. In this review, we explore new paradigms in CKR signal transduction by considering studies that depict a more intricate architecture governing the consequences of chemokine-CKR interactions. Published by Elsevier Inc.
Examining Myddosome Formation by Luminescence-Based Mammalian Interactome Mapping (LUMIER).
Wolz, Olaf-Oliver; Koegl, Manfred; Weber, Alexander N R
2018-01-01
Recent structural, biochemical, and functional studies have led to the notion that many of the post-receptor signaling complexes in innate immunity have a multimeric, multi-protein architecture whose hierarchical assembly is vital for function. The Myddosome is a post-receptor complex in the cytoplasmic signaling of Toll-like receptors (TLR) and the Interleukin-1 receptor (IL-1R), involving the proteins MyD88, IL-1R-associated kinase 4 (IRAK4), and IRAK2. Its importance is strikingly illustrated by the fact that rare germline mutations in MYD88 causing high susceptibility to infections are characterized by failure to assemble Myddosomes; conversely, gain-of-function MYD88 mutations leading to oncogenic hyperactivation of NF-κB show increased Myddosome formation. Reliable methods to probe Myddosome formation experimentally are therefore vital to further study the properties of this important post-receptor complex and its role in innate immunity, such as its regulation by posttranslational modification. Compared to structural and biochemical analyses, luminescence-based mammalian interactome mapping (LUMIER) is a straightforward, automatable, quantifiable, and versatile technique to study protein-protein interactions in a physiologically relevant context. We adapted LUMIER for Myddosome analysis and provide here a basic background of this technique, suitable experimental protocols, and its potential for medium-throughput screening. The principles presented herein can be adapted to other signaling pathways.
Purification of PRL receptors from toad kidney: Comparisons with rabbit mammary PRL receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dunand, M.; Kraehenbuhl, J.P.; Rossier, B.C.
1988-03-01
The binding characteristics of the prolactin (PRL) receptors present in toad (Bufo marinus) kidneys were investigated and compared to those of PRL receptors present in rabbit mammary glands. The molecular characteristics of the Triton X-100 solubilized renal and mammary PRL receptors were assessed by gel filtration and by migration analysis on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) after affinity labeling of the binding sites with {sup 125}I-human growth hormone. Similar results were obtained for both receptors. Partial purification of the toad PRL receptor could be achieved by affinity chromatography. The molecular weight of this purified receptor could be determined bymore » analysis of SDS-PAGE. With the use of a polyclonal antiserum raised against a purified preparation of rabbit mammary PRL receptor, one or several antigenic epitope(s) could be identified on the core of the toad renal PRL receptor. In conclusion, although the structure and the biological role(s) of PRL have substantially changed during evolution, the receptor for this hormone has retained many of its structural features as could be assessed between an amphibian and a mammalian species on functionally different target tissues.« less
Evolution of strigolactone receptors by gradual neo-functionalization of KAI2 paralogues.
Bythell-Douglas, Rohan; Rothfels, Carl J; Stevenson, Dennis W D; Graham, Sean W; Wong, Gane Ka-Shu; Nelson, David C; Bennett, Tom
2017-06-29
Strigolactones (SLs) are a class of plant hormones that control many aspects of plant growth. The SL signalling mechanism is homologous to that of karrikins (KARs), smoke-derived compounds that stimulate seed germination. In angiosperms, the SL receptor is an α/β-hydrolase known as DWARF14 (D14); its close homologue, KARRIKIN INSENSITIVE2 (KAI2), functions as a KAR receptor and likely recognizes an uncharacterized, endogenous signal ('KL'). Previous phylogenetic analyses have suggested that the KAI2 lineage is ancestral in land plants, and that canonical D14-type SL receptors only arose in seed plants; this is paradoxical, however, as non-vascular plants synthesize and respond to SLs. We have used a combination of phylogenetic and structural approaches to re-assess the evolution of the D14/KAI2 family in land plants. We analysed 339 members of the D14/KAI2 family from land plants and charophyte algae. Our phylogenetic analyses show that the divergence between the eu-KAI2 lineage and the DDK (D14/DLK2/KAI2) lineage that includes D14 occurred very early in land plant evolution. We show that eu-KAI2 proteins are highly conserved, and have unique features not found in DDK proteins. Conversely, we show that DDK proteins show considerable sequence and structural variation to each other, and lack clearly definable characteristics. We use homology modelling to show that the earliest members of the DDK lineage structurally resemble KAI2 and that SL receptors in non-seed plants likely do not have D14-like structure. We also show that certain groups of DDK proteins lack the otherwise conserved MORE AXILLARY GROWTH2 (MAX2) interface, and may thus function independently of MAX2, which we show is highly conserved throughout land plant evolution. Our results suggest that D14-like structure is not required for SL perception, and that SL perception has relatively relaxed structural requirements compared to KAI2-mediated signalling. We suggest that SL perception gradually evolved by neo-functionalization within the DDK lineage, and that the transition from KAI2-like to D14-like protein may have been driven by interactions with protein partners, rather than being required for SL perception per se.
Tóth, András D; Turu, Gábor; Hunyady, László; Balla, András
2018-04-01
AT 1 angiotensin receptor (AT 1 R), a prototypical G protein-coupled receptor (GPCR), is the main receptor, which mediates the effects of the renin-angiotensin system (RAS). AT 1 R plays a crucial role in the regulation of blood pressure and salt-water homeostasis, and in the development of pathological conditions, such as hypertension, heart failure, cardiovascular remodeling, renal fibrosis, inflammation, and metabolic disorders. Stimulation of AT 1 R leads to pleiotropic signal transduction pathways generating arrays of complex cellular responses. Growing amount of evidence shows that AT 1 R is a versatile GPCR, which has multiple unique faces with distinct conformations and signaling properties providing new opportunities for functionally selective pharmacological targeting of the receptor. Biased ligands of AT 1 R have been developed to selectively activate the β-arrestin pathway, which may have therapeutic benefits compared to the conventional angiotensin converting enzyme inhibitors and angiotensin receptor blockers. In this review, we provide a summary about the most recent findings and novel aspects of the AT 1 R function, signaling, regulation, dimerization or oligomerization and its cross-talk with other receptors, including epidermal growth factor (EGF) receptor, adrenergic receptors and CB 1 cannabinoid receptor. Better understanding of the mechanisms and structural aspects of AT 1 R activation and cross-talk can lead to the development of novel type of drugs for the treatment of cardiovascular and other diseases. Copyright © 2018. Published by Elsevier Ltd.
Calcitonin and calcitonin receptor-like receptors: common themes with family B GPCRs?
Barwell, James; Gingell, Joseph J; Watkins, Harriet A; Archbold, Julia K; Poyner, David R; Hay, Debbie L
2012-05-01
The calcitonin receptor (CTR) and calcitonin receptor-like receptor (CLR) are two of the 15 human family B (or Secretin-like) GPCRs. CTR and CLR are of considerable biological interest as their pharmacology is moulded by interactions with receptor activity-modifying proteins. They also have therapeutic relevance for many conditions, such as osteoporosis, diabetes, obesity, lymphatic insufficiency, migraine and cardiovascular disease. In light of recent advances in understanding ligand docking and receptor activation in both the family as a whole and in CLR and CTR specifically, this review reflects how applicable general family B GPCR themes are to these two idiosyncratic receptors. We review the main functional domains of the receptors; the N-terminal extracellular domain, the juxtamembrane domain and ligand interface, the transmembrane domain and the intracellular C-terminal domain. Structural and functional findings from the CLR and CTR along with other family B GPCRs are critically appraised to gain insight into how these domains may function. The ability for CTR and CLR to interact with receptor activity-modifying proteins adds another level of sophistication to these receptor systems but means careful consideration is needed when trying to apply generic GPCR principles. This review encapsulates current thinking in the realm of family B GPCR research by highlighting both conflicting and recurring themes and how such findings relate to two unusual but important receptors, CTR and CLR. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological Society.
A fructose receptor functions as a nutrient sensor in the Drosophila brain
Miyamoto, Tetsuya; Slone, Jesse; Song, Xiangyu; Amrein, Hubert
2012-01-01
SUMMARY Internal nutrient sensors play important roles in feeding behavior, yet their molecular structure and mechanism of action are poorly understood. Using Ca2+ imaging and behavioral assays, we show that the Gustatory Receptor 43a functions as a narrowly tuned fructose receptor in taste neurons. Remarkably, GR43a also functions as a fructose receptor in the brain. Interestingly, hemolymph fructose levels are tightly linked to feeding status: after nutritious carbohydrate consumption, fructose levels rise several fold and reach a concentration sufficient to activate GR43a in the brain. By using different feeding paradigms and artificial activation of Gr43a-expressing brain neurons, we show that GR43a is both necessary and sufficient to sense hemolymph fructose and promote feeding in hungry flies, but suppress feeding in satiated flies. Thus, our studies indicate that the Gr43a-expressing brain neurons function as a nutrient sensor for hemolymph fructose and assign opposing valence to feeding experiences in a satiation-dependent manner. PMID:23178127
Structural analysis of binding functionality of folic acid-PEG dendrimers against folate receptor.
Sampogna-Mireles, Diana; Araya-Durán, Ingrid D; Márquez-Miranda, Valeria; Valencia-Gallegos, Jesús A; González-Nilo, Fernando D
2017-03-01
Dendrimers functionalized with folic acid (FA) are drug delivery systems that can selectively target cancer cells with folate receptors (FR-α) overexpression. Incorporation of polyethylene glycol (PEG) can enhance dendrimers solubility and pharmacokinetics, but ligand-receptor binding must not be affected. In this work we characterized, at atomic level, the binding functionality of conventional site-specific dendrimers conjugated with FA with PEG 750 or PEG 3350 as a linker. After Molecular Dynamics simulation, we observed that both PEG's did not interfere over ligand-receptor binding functionality. Although binding kinetics could be notably affected, the folate fragment from both dendrimers remained exposed to the solvent before approaching selectively to FR-α. PEG 3350 provided better solubility and protection from enzymatic degradation to the dendrimer than PEG 750. Also, FA-PEG3350 dendrimer showed a slightly better interaction with FR-α than FA-PEG750 dendrimer. Therefore, theoretical evidence supports that both dendrimers are suitable as drug delivery systems for cancer therapies. Copyright © 2017 Elsevier Inc. All rights reserved.
Niescierowicz, Katarzyna; Caro, Lydia; Cherezov, Vadim; Vivaudou, Michel; Moreau, Christophe J
2014-01-07
Structural studies of G protein-coupled receptors (GPCRs) extensively use the insertion of globular soluble protein domains to facilitate their crystallization. However, when inserted in the third intracellular loop (i3 loop), the soluble protein domain disrupts their coupling to G proteins and impedes the GPCRs functional characterization by standard G protein-based assays. Therefore, activity tests of crystallization-optimized GPCRs are essentially limited to their ligand binding properties using radioligand binding assays. Functional characterization of additional thermostabilizing mutations requires the insertion of similar mutations in the wild-type receptor to allow G protein-activation tests. We demonstrate that ion channel-coupled receptor technology is a complementary approach for a comprehensive functional characterization of crystallization-optimized GPCRs and potentially of any engineered GPCR. Ligand-induced conformational changes of the GPCRs are translated into electrical signal and detected by simple current recordings, even though binding of G proteins is sterically blocked by the added soluble protein domain. Copyright © 2014 Elsevier Ltd. All rights reserved.
Comparing Plant and Animal Glutamate Receptors: Common Traits but Different Fates?
Wudick, Michael M; Michard, Erwan; Oliveira Nunes, Custódio; Feijó, José A
2018-04-19
Animal ionotropic glutamate receptors (iGluRs) are ligand-gated channels whose evolution is intimately linked to the one of the nervous system, where the agonist glutamate and co-agonists glycine/D-serine act as neuro-transmitters or -modulators. While iGluRs are specialized in neuronal communication, plant glutamate receptor-like (GLR) homologues have evolved many plant-specific physiological functions, such as sperm signaling in moss, pollen tube growth, root meristem proliferation, innate immune and wound responses. GLRs have been associated with Ca2+ signaling by directly channeling its extracellular influx into the cytosol. Nevertheless, very limited information on functional properties of GLRs is available, and we mostly rely on structure/function data obtained for animal iGluRs to interpret experimental results obtained for plant GLRs. Yet, a deeper characterization and better understanding of plant GLRs is progressively unveiling original and different mode of functions when compared to their mammalian counterparts. Here, we review the function of plant GLRs comparing their predicted structure and physiological roles to the well-documented ones of iGluRs. We conclude that interpreting GLR function based on comparison to their animal counterparts calls for caution, especially when presuming physiological roles and mode of action for plant GLRs from comparison to iGluRs in peripheral, non-neuronal tissues.
Yuvaraj, Jothi Kumar; Corcoran, Jacob A.; Andersson, Martin N.; Newcomb, Richard D.; Anderbrant, Olle; Löfstedt, Christer
2017-01-01
Abstract Pheromone receptors (PRs) are essential in moths to detect sex pheromones for mate finding. However, it remains unknown from which ancestral proteins these specialized receptors arose. The oldest lineages of moths, so-called non-ditrysian moths, use short-chain pheromone components, secondary alcohols, or ketones, so called Type 0 pheromones that are similar to many common plant volatiles. It is, therefore, possible that receptors for these ancestral pheromones evolved from receptors detecting plant volatiles. Hence, we identified the odorant receptors (ORs) from a non-ditrysian moth, Eriocrania semipurpurella (Eriocraniidae, Lepidoptera), and performed functional characterization of ORs using HEK293 cells. We report the first receptors that respond to Type 0 pheromone compounds; EsemOR3 displayed highest sensitivity toward (2S, 6Z)-6-nonen-2-ol, whereas EsemOR5 was most sensitive to the behavioral antagonist (Z)-6-nonen-2-one. These receptors also respond to plant volatiles of similar chemical structures, but with lower sensitivity. Phylogenetically, EsemOR3 and EsemOR5 group with a plant volatile-responding receptor from the tortricid moth Epiphyas postvittana (EposOR3), which together reside outside the previously defined lepidopteran PR clade that contains the PRs from more derived lepidopteran families. In addition, one receptor (EsemOR1) that falls at the base of the lepidopteran PR clade, responded specifically to β-caryophyllene and not to any other additional plant or pheromone compounds. Our results suggest that PRs for Type 0 pheromones have evolved from ORs that detect structurally-related plant volatiles. They are unrelated to PRs detecting pheromones in more derived Lepidoptera, which, in turn, also independently may have evolved a novel function from ORs detecting plant volatiles. PMID:29126322
Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bokoch, Michael P.; Zou, Yaozhong; Rasmussen, Søren G.F.
G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the nativemore » ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the {beta}{sub 2} adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.« less
Seibert, Christoph; Sanfiz, Anthony; Sakmar, Thomas P; Veldkamp, Christopher T
2016-01-01
In most chemokine receptors, one or multiple tyrosine residues have been identified within the receptor N-terminal domain that are, at least partially, modified by posttranslational tyrosine sulfation. For example, tyrosine sulfation has been demonstrated for Tyr-3, -10, -14, and -15 of CCR5, for Tyr-3, -14, and -15 of CCR8, and for Tyr-7, -12, and -21 of CXCR4. While there is evidence for several chemokine receptors that tyrosine sulfation is required for optimal interaction with the chemokine ligands, the precise role of tyrosine sulfation for chemokine receptor function remains unclear. Furthermore, the function of the chemokine receptor N-terminal domain in chemokine binding and receptor activation is also not well understood. Sulfotyrosine peptides corresponding to the chemokine receptor N-termini are valuable tools to address these important questions both in structural and functional studies. However, due to the lability of the sulfotyrosine modification, these peptides are difficult to obtain using standard peptide chemistry methods. In this chapter, we provide methods to prepare sulfotyrosine peptides by enzymatic in vitro sulfation of peptides using purified recombinant tyrosylprotein sulfotransferase (TPST) enzymes. In addition, we also discuss alternative approaches for the generation of sulfotyrosine peptides and methods for sulfopeptide analysis. © 2016 Elsevier Inc. All rights reserved.
Seibert, Christoph; Sanfiz, Anthony; Sakmar, Thomas P.; Veldkamp, Christopher T.
2016-01-01
In most chemokine receptors, one or multiple tyrosine residues have been identified within the receptor N-terminal domain that are, at least partially, modified by post-translational tyrosine sulfation. For example, tyrosine sulfation has been demonstrated for Tyr-3, -10, -14, and -15 of CCR5, for Tyr-3, -14, and -15 of CCR8 and for Tyr-7, -12, and -21 of CXCR4. While there is evidence for several chemokine receptors that tyrosine sulfation is required for optimal interaction with the chemokine ligands, the precise role of tyrosine sulfation for chemokine receptor function remains unclear. Furthermore, the function of the chemokine receptor N-terminal domain in chemokine binding and receptor activation is also not well understood. Sulfotyrosine peptides corresponding to the chemokine receptor N-termini are valuable tools to address these important questions both in structural and functional studies. However, due to the liability of the sulfotyrosine modification, these peptides are difficult to obtain using standard peptide chemistry methods. In this chapter, we provide methods to prepare sulfotyrosine peptides by enzymatic in vitro sulfation of peptides using purified recombinant tyrosylprotein sulfotransferase (TPST) enzymes. In addition, we also discuss alternative approaches for the generation of sulfotyrosine peptides and methods from sulfopeptide analysis. PMID:26921955
Arabidopsis CPR5 regulates ethylene signaling via molecular association with the ETR1 receptor.
Wang, Feifei; Wang, Lijuan; Qiao, Longfei; Chen, Jiacai; Pappa, Maria Belen; Pei, Haixia; Zhang, Tao; Chang, Caren; Dong, Chun-Hai
2017-11-01
The plant hormone ethylene plays various functions in plant growth, development and response to environmental stress. Ethylene is perceived by membrane-bound ethylene receptors, and among the homologous receptors in Arabidopsis, the ETR1 ethylene receptor plays a major role. The present study provides evidence demonstrating that Arabidopsis CPR5 functions as a novel ETR1 receptor-interacting protein in regulating ethylene response and signaling. Yeast split ubiquitin assays and bi-fluorescence complementation studies in plant cells indicated that CPR5 directly interacts with the ETR1 receptor. Genetic analyses indicated that mutant alleles of cpr5 can suppress ethylene insensitivity in both etr1-1 and etr1-2, but not in other dominant ethylene receptor mutants. Overexpression of Arabidopsis CPR5 either in transgenic Arabidopsis plants, or ectopically in tobacco, significantly enhanced ethylene sensitivity. These findings indicate that CPR5 plays a critical role in regulating ethylene signaling. CPR5 is localized to endomembrane structures and the nucleus, and is involved in various regulatory pathways, including pathogenesis, leaf senescence, and spontaneous cell death. This study provides evidence for a novel regulatory function played by CPR5 in the ethylene receptor signaling pathway in Arabidopsis. © 2017 Institute of Botany, Chinese Academy of Sciences.
Desai, Aditya J.; Dong, Maoqing; Harikumar, Kaleeckal G.
2015-01-01
Dysfunction of the type 1 cholecystokinin (CCK) receptor (CCK1R) as a result of increased gallbladder muscularis membrane cholesterol has been implicated in the pathogenesis of cholesterol gallstones. Administration of ursodeoxycholic acid, which is structurally related to cholesterol, has been shown to have beneficial effects on gallstone formation. Our aims were to explore the possible direct effects and mechanism of action of bile acids on CCK receptor function. We studied the effects of structurally related hydrophobic chenodeoxycholic acid and hydrophilic ursodeoxycholic acid in vitro on CCK receptor function in the setting of normal and elevated membrane cholesterol. We also examined their effects on a cholesterol-insensitive CCK1R mutant (Y140A) disrupting a key site of cholesterol action. The results show that, similar to the impact of cholesterol on CCK receptors, bile acid effects were limited to CCK1R, with no effects on CCK2R. Chenodeoxycholic acid had a negative impact on CCK1R function, while ursodeoxycholic acid had no effect on CCK1R function in normal membranes but was protective against the negative impact of elevated cholesterol on this receptor. The cholesterol-insensitive CCK1R mutant Y140A was resistant to effects of both bile acids. These data suggest that bile acids compete with the action of cholesterol on CCK1R, probably by interacting at the same site, although the conformational impact of each bile acid appears to be different, with ursodeoxycholic acid capable of correcting the abnormal conformation of CCK1R in a high-cholesterol environment. This mechanism may contribute to the beneficial effect of ursodeoxycholic acid in reducing cholesterol gallstone formation. PMID:26138469
Desai, Aditya J; Dong, Maoqing; Harikumar, Kaleeckal G; Miller, Laurence J
2015-09-01
Dysfunction of the type 1 cholecystokinin (CCK) receptor (CCK1R) as a result of increased gallbladder muscularis membrane cholesterol has been implicated in the pathogenesis of cholesterol gallstones. Administration of ursodeoxycholic acid, which is structurally related to cholesterol, has been shown to have beneficial effects on gallstone formation. Our aims were to explore the possible direct effects and mechanism of action of bile acids on CCK receptor function. We studied the effects of structurally related hydrophobic chenodeoxycholic acid and hydrophilic ursodeoxycholic acid in vitro on CCK receptor function in the setting of normal and elevated membrane cholesterol. We also examined their effects on a cholesterol-insensitive CCK1R mutant (Y140A) disrupting a key site of cholesterol action. The results show that, similar to the impact of cholesterol on CCK receptors, bile acid effects were limited to CCK1R, with no effects on CCK2R. Chenodeoxycholic acid had a negative impact on CCK1R function, while ursodeoxycholic acid had no effect on CCK1R function in normal membranes but was protective against the negative impact of elevated cholesterol on this receptor. The cholesterol-insensitive CCK1R mutant Y140A was resistant to effects of both bile acids. These data suggest that bile acids compete with the action of cholesterol on CCK1R, probably by interacting at the same site, although the conformational impact of each bile acid appears to be different, with ursodeoxycholic acid capable of correcting the abnormal conformation of CCK1R in a high-cholesterol environment. This mechanism may contribute to the beneficial effect of ursodeoxycholic acid in reducing cholesterol gallstone formation. Copyright © 2015 the American Physiological Society.
The TiPS/TINS lecture: the molecular biology of mammalian glutamate receptor channels.
Seeburg, P H
1993-08-01
In native brain membranes the principal excitatory neurotransmitter L-glutamate activates cation-conducting channels with distinct biophysical and pharmacological properties. Molecular cloning has revealed the existence of 16 channel subunits that can assemble in homomeric or heteromeric configurations in vitro to form receptor channels with disparate functional properties. This review describes the different channel types obtained by recombinant means and the genetic mechanisms controlling the expression of functionally important channel structures.
The TINS/TiPS Lecture. The molecular biology of mammalian glutamate receptor channels.
Seeburg, P H
1993-09-01
In native brain membranes the principal excitatory neurotransmitter L-glutamate activates cation-conducting channels with distinct biophysical and pharmacological properties. Molecular cloning has revealed the existence of 16 channel subunits that can assemble in homomeric or heteromeric configurations in vitro to form receptor channels with disparate functional properties. This review describes the different channel types obtained by recombinant means and the genetic mechanisms controlling the expression of functionally important channel structures.
Girard, Tanya; Gaucher, Denis; El-Far, Mohamed; Breton, Gaëlle; Sékaly, Rafick-Pierre
2014-09-01
CD86 and CD80, the ligands for the co-stimulatory molecules CD28 and CTLA-4, are members of the Ig superfamily. Their structure includes Ig variable-like (IgV) domains, Ig constant-like (IgC) domains and intracellular domains. Although crystallographic studies have clearly identified the IgV domain to be responsible for receptor interactions, earlier studies suggested that both Ig domains are required for full co-signaling function. Herein, we have used deletion and chimeric human CD80 and CD86 molecules in co-stimulation assays to study the impact of the multimeric state of IgV and IgC domains on receptor binding properties and on co-stimulatory function in a peptide-specific T cell activation model. We report for the first time the presence of CD80 dimers and CD86 monomers in living cells. Moreover, we show that the IgC domain of both molecules inhibits multimer formation and greatly affects binding to the co-receptors CD28 and CTLA-4. Finally, both IgC and intracellular domains are required for full co-signaling function. These findings reveal the distinct but complementary roles of CD80 and CD86 IgV and IgC domains in T cell activation. Copyright © 2014 Elsevier B.V. All rights reserved.
Zurawski, S M; Zurawski, G
1989-01-01
The function of two alpha-helical regions of mouse interleukin-2 were analyzed by saturation substitution analysis. The functional parts of the first alpha-helix (A) was defined as residues 31-39 by the observation that proline substitutions within this region inactivate the protein. Four residues within alpha-helix A, Leu31, Asp34, Leu35 and Leu38, were found to be crucial for biological activity. Structural modeling suggested that these four residues are clustered on one face of alpha-helix A. Residues 31 and 35 had to remain hydrophobic for the molecule to be functional. At residue 38 there was a preference for hydrophobic side chain residues, while at residue 34 some small side chain residues as well as acidic or amide side chain residues were functionally acceptable. Inactivating changes at residue 34 had no effect upon the ability of the protein to interact with the p55 receptor. Disruption of the fifth alpha-helix (E), which had little effect upon biological activity, resulted in an inability of the protein to interact with the p55 receptor. Mutagenesis of the alpha-helix E region demonstrated that alpha-helicity and the nature of the side chain residues in this region were unimportant for biological activity. The region immediately proximal to alpha-helix E was important only for the single intramolecular disulfide linkage. PMID:2583124
The metabotropic glutamate receptors: structure, activation mechanism and pharmacology.
Pin, Jean-Philippe; Acher, Francine
2002-06-01
The metabotropic glutamate receptors are G-protein coupled receptors (GPCR) involved in the regulation of many synapses, including most glutamatergic fast excitatory synapses. Eight subtypes have been identified that can be classified into three groups. The molecular characterization of these receptors revealed proteins much more complex than any other GPCRs. They are composed of a Venus Flytrap (VFT) module where glutamate binds, connected to a heptahelical domain responsible for G-protein coupling. Recent data including the structure of the VFT module determined with and without glutamate, indicate that these receptors function as dimers. Moreover a number of intracellular proteins can regulate their targeting and transduction mechanism. Such structural features of mGlu receptors offer multiple possibilities for synthetic compounds to modulate their activity. In addition to agonists and competitive antagonists acting at the glutamate binding site, a number of non-competitive antagonists with inverse agonist activity, and positive allosteric modulators have been discovered. These later compounds share specific properties that make them good candidates for therapeutic applications. First, their non-amino acid structure makes them pass more easily the blood brain barrier. Second, they are much more selective than any other compound identified so far, being the first subtype selective molecules. Third, for the negative modulators, their non competitive mechanism of action makes them relatively unaffected by high concentrations of glutamate that may be present in disease states (e.g. stroke, epilepsy, neuropathic pain, etc.). Fourth, like the benzodiazepines acting at the GABA(A) receptors, the positive modulators offer a new way to increase the activity of these receptors in vivo, with a low risk of inducing their desensitization. The present review article focuses on the specific structural features of these receptors and highlights the various possibilities these offer for drug development.
Valkov, Eugene; Stamp, Anna; DiMaio, Frank; Baker, David; Verstak, Brett; Roversi, Pietro; Kellie, Stuart; Sweet, Matthew J.; Mansell, Ashley; Gay, Nicholas J.; Martin, Jennifer L.; Kobe, Bostjan
2011-01-01
Initiation of the innate immune response requires agonist recognition by pathogen-recognition receptors such as the Toll-like receptors (TLRs). Toll/interleukin-1 receptor (TIR) domain-containing adaptors are critical in orchestrating the signal transduction pathways after TLR and interleukin-1 receptor activation. Myeloid differentiation primary response gene 88 (MyD88) adaptor-like (MAL)/TIR domain-containing adaptor protein (TIRAP) is involved in bridging MyD88 to TLR2 and TLR4 in response to bacterial infection. Genetic studies have associated a number of unique single-nucleotide polymorphisms in MAL with protection against invasive microbial infection, but a molecular understanding has been hampered by a lack of structural information. The present study describes the crystal structure of MAL TIR domain. Significant structural differences exist in the overall fold of MAL compared with other TIR domain structures: A sequence motif comprising a β-strand in other TIR domains instead corresponds to a long loop, placing the functionally important “BB loop” proline motif in a unique surface position in MAL. The structure suggests possible dimerization and MyD88-interacting interfaces, and we confirm the key interface residues by coimmunoprecipitation using site-directed mutants. Jointly, our results provide a molecular and structural basis for the role of MAL in TLR signaling and disease protection. PMID:21873236
Crystal structure of mouse coronavirus receptor-binding domain complexed with its murine receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peng, Guiqing; Sun, Dawei; Rajashankar, Kanagalaghatta R.
2011-09-28
Coronaviruses have evolved diverse mechanisms to recognize different receptors for their cross-species transmission and host-range expansion. Mouse hepatitis coronavirus (MHV) uses the N-terminal domain (NTD) of its spike protein as its receptor-binding domain. Here we present the crystal structure of MHV NTD complexed with its receptor murine carcinoembryonic antigen-related cell adhesion molecule 1a (mCEACAM1a). Unexpectedly, MHV NTD contains a core structure that has the same {beta}-sandwich fold as human galectins (S-lectins) and additional structural motifs that bind to the N-terminal Ig-like domain of mCEACAM1a. Despite its galectin fold, MHV NTD does not bind sugars, but instead binds mCEACAM1a through exclusivemore » protein-protein interactions. Critical contacts at the interface have been confirmed by mutagenesis, providing a structural basis for viral and host specificities of coronavirus/CEACAM1 interactions. Sugar-binding assays reveal that galectin-like NTDs of some coronaviruses such as human coronavirus OC43 and bovine coronavirus bind sugars. Structural analysis and mutagenesis localize the sugar-binding site in coronavirus NTDs to be above the {beta}-sandwich core. We propose that coronavirus NTDs originated from a host galectin and retained sugar-binding functions in some contemporary coronaviruses, but evolved new structural features in MHV for mCEACAM1a binding.« less
Durdagi, Serdar; Salmas, Ramin Ekhteiari; Stein, Matthias; Yurtsever, Mine; Seeman, Philip
2016-02-17
We have recently reported G-protein coupled receptor (GPCR) model structures for the active and inactive states of the human dopamine D2 receptor (D2R) using adrenergic crystal structures as templates. Since the therapeutic concentrations of dopamine agonists that suppress the release of prolactin are the same as those that act at the high-affinity state of the D2 receptor (D2High), D2High in the anterior pituitary gland is considered to be the functional state of the receptor. In addition, the therapeutic concentrations of anti-Parkinson drugs are also related to the dissociation constants in the D2High form of the receptor. The discrimination between the high- and low-affinity (D2Low) components of the D2R is not obvious and requires advanced computer-assisted structural biology investigations. Therefore, in this work, the derived D2High and D2Low receptor models (GPCR monomer and dimer three-dimensional structures) are used as drug-binding targets to investigate binding interactions of dopamine and apomorphine. The study reveals a match between the experimental dissociation constants of dopamine and apomorphine at their high- and low-affinity sites of the D2 receptor in monomer and dimer and their calculated dissociation constants. The allosteric receptor-receptor interaction for dopamine D2R dimer is associated with the accessibility of adjacent residues of transmembrane region 4. The measured negative cooperativity between agonist ligand at dopamine D2 receptor is also correctly predicted using the D2R homodimerization model.
Structural organization of G-protein-coupled receptors
NASA Astrophysics Data System (ADS)
Lomize, Andrei L.; Pogozheva, Irina D.; Mosberg, Henry I.
1999-07-01
Atomic-resolution structures of the transmembrane 7-α-helical domains of 26 G-protein-coupled receptors (GPCRs) (including opsins, cationic amine, melatonin, purine, chemokine, opioid, and glycoprotein hormone receptors and two related proteins, retinochrome and Duffy erythrocyte antigen) were calculated by distance geometry using interhelical hydrogen bonds formed by various proteins from the family and collectively applied as distance constraints, as described previously [Pogozheva et al., Biophys. J., 70 (1997) 1963]. The main structural features of the calculated GPCR models are described and illustrated by examples. Some of the features reflect physical interactions that are responsible for the structural stability of the transmembrane α-bundle: the formation of extensive networks of interhelical H-bonds and sulfur-aromatic clusters that are spatially organized as 'polarity gradients' the close packing of side-chains throughout the transmembrane domain; and the formation of interhelical disulfide bonds in some receptors and a plausible Zn2+ binding center in retinochrome. Other features of the models are related to biological function and evolution of GPCRs: the formation of a common 'minicore' of 43 evolutionarily conserved residues; a multitude of correlated replacements throughout the transmembrane domain; an Na+-binding site in some receptors, and excellent complementarity of receptor binding pockets to many structurally dissimilar, conformationally constrained ligands, such as retinal, cyclic opioid peptides, and cationic amine ligands. The calculated models are in good agreement with numerous experimental data.
X-ray structure, symmetry and mechanism of an AMPA-subtype glutamate receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sobolevsky, Alexander I.; Rosconi, Michael P.; Gouaux, Eric
2010-02-02
Ionotropic glutamate receptors mediate most excitatory neurotransmission in the central nervous system and function by opening a transmembrane ion channel upon binding of glutamate. Despite their crucial role in neurobiology, the architecture and atomic structure of an intact ionotropic glutamate receptor are unknown. Here we report the crystal structure of the {alpha}-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA)-sensitive, homotetrameric, rat GluA2 receptor at 3.6 {angstrom} resolution in complex with a competitive antagonist. The receptor harbours an overall axis of two-fold symmetry with the extracellular domains organized as pairs of local dimers and with the ion channel domain exhibiting four-fold symmetry. A symmetry mismatchmore » between the extracellular and ion channel domains is mediated by two pairs of conformationally distinct subunits, A/C and B/D. Therefore, the stereochemical manner in which the A/C subunits are coupled to the ion channel gate is different from the B/D subunits. Guided by the GluA2 structure and site-directed cysteine mutagenesis, we suggest that GluN1 and GluN2A NMDA (N-methyl-D-aspartate) receptors have a similar architecture, with subunits arranged in a 1-2-1-2 pattern. We exploit the GluA2 structure to develop mechanisms of ion channel activation, desensitization and inhibition by non-competitive antagonists and pore blockers.« less
Wu, Kailang; Chen, Lang; Peng, Guiqing; Zhou, Wenbo; Pennell, Christopher A; Mansky, Louis M; Geraghty, Robert J; Li, Fang
2011-06-01
How viruses evolve to select their receptor proteins for host cell entry is puzzling. We recently determined the crystal structures of NL63 coronavirus (NL63-CoV) and SARS coronavirus (SARS-CoV) receptor-binding domains (RBDs), each complexed with their common receptor, human angiotensin-converting enzyme 2 (hACE2), and proposed the existence of a virus-binding hot spot on hACE2. Here we investigated the function of this hypothetical hot spot using structure-guided biochemical and functional assays. The hot spot consists of a salt bridge surrounded by hydrophobic tunnel walls. Mutations that disturb the hot spot structure have significant effects on virus/receptor interactions, revealing critical energy contributions from the hot spot structure. The tunnel structure at the NL63-CoV/hACE2 interface is more compact than that at the SARS-CoV/hACE2 interface, and hence RBD/hACE2 binding affinities are decreased either by NL63-CoV mutations decreasing the tunnel space or by SARS-CoV mutations increasing the tunnel space. Furthermore, NL63-CoV RBD inhibits hACE2-dependent transduction by SARS-CoV spike protein, a successful application of the hot spot theory that has the potential to become a new antiviral strategy against SARS-CoV infections. These results suggest that the structural features of the hot spot on hACE2 were among the driving forces for the convergent evolution of NL63-CoV and SARS-CoV.
Hot and Spicy versus Cool and Minty as an Example of Organic Structure-Activity Relationships
NASA Astrophysics Data System (ADS)
Kimbrough, Doris R.
1997-07-01
There are two classes of substances that activate neural receptors that are involved in temperature perception. Structures of substances found in spices and food that we normally associate with "hot" (or spicy) and "cool" (or minty) flavors are presented and discussed. Functional group similarities within the two groups provide an interesting example of the relationship between molecular structure and molecular function in organic chemistry.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Shiva; Pioszak, Augen; Zhang, Chenghai
2012-02-21
Pituitary adenylate cyclase activating polypeptide (PACAP) is a member of the PACAP/glucagon family of peptide hormones, which controls many physiological functions in the immune, nervous, endocrine, and muscular systems. It activates adenylate cyclase by binding to its receptor, PAC1R, a member of class B G-protein coupled receptors (GPCR). Crystal structures of a number of Class B GPCR extracellular domains (ECD) bound to their respective peptide hormones have revealed a consensus mechanism of hormone binding. However, the mechanism of how PACAP binds to its receptor remains controversial as an NMR structure of the PAC1R ECD/PACAP complex reveals a different topology ofmore » the ECD and a distinct mode of ligand recognition. Here we report a 1.9 {angstrom} crystal structure of the PAC1R ECD, which adopts the same fold as commonly observed for other members of Class B GPCR. Binding studies and cell-based assays with alanine-scanned peptides and mutated receptor support a model that PAC1R uses the same conserved fold of Class B GPCR ECD for PACAP binding, thus unifying the consensus mechanism of hormone binding for this family of receptors.« less
Janero, David R; Korde, Anisha; Makriyannis, Alexandros
2017-01-01
Detailed characterization of the ligand-binding motifs and structure-function correlates of the principal GPCRs of the endocannabinoid-signaling system, the cannabinoid 1 (CB1R) and cannabinoid 2 (CB2R) receptors, is essential to inform the rational design of drugs that modulate CB1R- and CB2R-dependent biosignaling for therapeutic gain. We discuss herein an experimental paradigm termed "ligand-assisted protein structure" (LAPS) that affords a means of characterizing, at the amino acid level, CB1R and CB2R structural features key to ligand engagement and receptor-dependent information transmission. For this purpose, LAPS integrates three key disciplines and methodologies: (a) medicinal chemistry: design and synthesis of high-affinity, pharmacologically active probes as reporters capable of reacting irreversibly with particular amino acids at (or in the immediate vicinity of) the ligand-binding domain of the functionally active receptor; (b) molecular and cellular biology: introduction of discrete, conservative point mutations into the target GPCR and determination of their effect on probe binding and pharmacological activity; (c) analytical chemistry: identification of the site(s) of probe-GPCR interaction through focused, bottom-up, amino acid-level proteomic identification of the probe-receptor complex using liquid chromatography tandem mass spectrometry. Subsequent in silico methods including ligand docking and computational modeling provide supplementary data on the probe-receptor interaction as defined by LAPS. Examples of LAPS as applied to human CB2R orthosteric binding site characterization for a biarylpyrazole antagonist/inverse agonist and a classical cannabinoid agonist belonging to distinct chemical classes of cannabinergic compounds are given as paradigms for further application of this methodology to other therapeutic protein targets. LAPS is well positioned to complement other experimental and in silico methods in contemporary structural biology such as X-ray crystallography. © 2017 Elsevier Inc. All rights reserved.
Kleinau, Gunnar; Kreuchwig, Annika; Worth, Catherine L; Krause, Gerd
2010-06-01
The collection, description and molecular analysis of naturally occurring (pathogenic) mutations are important for understanding the functional mechanisms and malfunctions of biological units such as proteins. Numerous databases collate a huge amount of functional data or descriptions of mutations, but tools to analyse the molecular effects of genetic variations are as yet poorly provided. The goal of this work was therefore to develop a translational web-application that facilitates the interactive linkage of functional and structural data and which helps improve our understanding of the molecular basis of naturally occurring gain- or loss- of function mutations. Here we focus on the human glycoprotein hormone receptors (GPHRs), for which a huge number of mutations are known to cause diseases. We describe new options for interactive data analyses within three-dimensional structures, which enable the assignment of molecular relationships between structure and function. Strikingly, as the functional data are converted into relational percentage values, the system allows the comparison and classification of data from different GPHR subtypes and different experimental approaches. Our new application has been incorporated into a freely available database and website for the GPHRs (http://www.ssfa-gphr.de), but the principle development would also be applicable to other macromolecules.
Studying Nuclear Receptor Complexes in the Cellular Environment.
Schaufele, Fred
2016-01-01
The ligand-regulated structure and biochemistry of nuclear receptor complexes are commonly determined by in vitro studies of isolated receptors, cofactors, and their fragments. However, in the living cell, the complexes that form are governed not just by the relative affinities of isolated cofactors for the receptor but also by the cell-specific sequestration or concentration of subsets of competing or cooperating cofactors, receptors, and other effectors into distinct subcellular domains and/or their temporary diversion into other cellular activities. Most methods developed to understand nuclear receptor function in the cellular environment involve the direct tagging of the nuclear receptor or its cofactors with fluorescent proteins (FPs) and the tracking of those FP-tagged factors by fluorescence microscopy. One of those approaches, Förster resonance energy transfer (FRET) microscopy, quantifies the transfer of energy from a higher energy "donor" FP to a lower energy "acceptor" FP attached to a single protein or to interacting proteins. The amount of FRET is influenced by the ligand-induced changes in the proximities and orientations of the FPs within the tagged nuclear receptor complexes, which is an indicator of the structure of the complexes, and by the kinetics of the interaction between FP-tagged factors. Here, we provide a guide for parsing information about the structure and biochemistry of nuclear receptor complexes from FRET measurements in living cells.
2010-07-01
also will determine if ORL1 antagonists block downstream gene transcription subsequent to enzyme activation. BODY: Task 1a was to optimize blast...value between 60 and 80 psi at which defects in vestibulomotor function can be detected. These findings could potentially become a clinical...nociceptin-mediated desensitization of opioid receptor-like 1 receptor and mu opioid receptors involves protein kinase C: a molecular mechanism for
A novel system of polymorphic and diverse NK cell receptors in primates.
Averdam, Anne; Petersen, Beatrix; Rosner, Cornelia; Neff, Jennifer; Roos, Christian; Eberle, Manfred; Aujard, Fabienne; Münch, Claudia; Schempp, Werner; Carrington, Mary; Shiina, Takashi; Inoko, Hidetoshi; Knaust, Florian; Coggill, Penny; Sehra, Harminder; Beck, Stephan; Abi-Rached, Laurent; Reinhardt, Richard; Walter, Lutz
2009-10-01
There are two main classes of natural killer (NK) cell receptors in mammals, the killer cell immunoglobulin-like receptors (KIR) and the structurally unrelated killer cell lectin-like receptors (KLR). While KIR represent the most diverse group of NK receptors in all primates studied to date, including humans, apes, and Old and New World monkeys, KLR represent the functional equivalent in rodents. Here, we report a first digression from this rule in lemurs, where the KLR (CD94/NKG2) rather than KIR constitute the most diverse group of NK cell receptors. We demonstrate that natural selection contributed to such diversification in lemurs and particularly targeted KLR residues interacting with the peptide presented by MHC class I ligands. We further show that lemurs lack a strict ortholog or functional equivalent of MHC-E, the ligands of non-polymorphic KLR in "higher" primates. Our data support the existence of a hitherto unknown system of polymorphic and diverse NK cell receptors in primates and of combinatorial diversity as a novel mechanism to increase NK cell receptor repertoire.
A Novel System of Polymorphic and Diverse NK Cell Receptors in Primates
Rosner, Cornelia; Neff, Jennifer; Roos, Christian; Eberle, Manfred; Aujard, Fabienne; Münch, Claudia; Schempp, Werner; Carrington, Mary; Shiina, Takashi; Inoko, Hidetoshi; Knaust, Florian; Coggill, Penny; Sehra, Harminder; Beck, Stephan; Abi-Rached, Laurent; Reinhardt, Richard; Walter, Lutz
2009-01-01
There are two main classes of natural killer (NK) cell receptors in mammals, the killer cell immunoglobulin-like receptors (KIR) and the structurally unrelated killer cell lectin-like receptors (KLR). While KIR represent the most diverse group of NK receptors in all primates studied to date, including humans, apes, and Old and New World monkeys, KLR represent the functional equivalent in rodents. Here, we report a first digression from this rule in lemurs, where the KLR (CD94/NKG2) rather than KIR constitute the most diverse group of NK cell receptors. We demonstrate that natural selection contributed to such diversification in lemurs and particularly targeted KLR residues interacting with the peptide presented by MHC class I ligands. We further show that lemurs lack a strict ortholog or functional equivalent of MHC-E, the ligands of non-polymorphic KLR in “higher” primates. Our data support the existence of a hitherto unknown system of polymorphic and diverse NK cell receptors in primates and of combinatorial diversity as a novel mechanism to increase NK cell receptor repertoire. PMID:19834558
Structure and Dynamics of the M3 Muscarinic Acetylcholine Receptor
Kruse, Andrew C.; Hu, Jianxin; Pan, Albert C.; Arlow, Daniel H.; Rosenbaum, Daniel M.; Rosemond, Erica; Green, Hillary F.; Liu, Tong; Chae, Pil Seok; Dror, Ron O.; Shaw, David E.; Weis, William I.; Wess, Jurgen; Kobilka, Brian
2012-01-01
Acetylcholine (ACh), the first neurotransmitter to be identified1, exerts many of its physiological actions via activation of a family of G protein-coupled receptors (GPCRs) known as muscarinic ACh receptors (mAChRs). Although the five mAChR subtypes (M1-M5) share a high degree of sequence homology, they show pronounced differences in G protein coupling preference and the physiological responses they mediate.2–4 Unfortunately, despite decades of effort, no therapeutic agents endowed with clear mAChR subtype selectivity have been developed to exploit these differences.5–6 We describe here the structure of the Gq/11-coupled M3 mAChR bound to the bronchodilator drug tiotropium and identify the binding mode for this clinically important drug. This structure, together with that of the Gi/o-coupled M2 receptor, offers new possibilities for the design of mAChR subtype-selective ligands. Importantly, the M3 receptor structure allows the first structural comparison between two members of a mammalian GPCR subfamily displaying different G-protein coupling selectivities. Furthermore, molecular dynamics simulations suggest that tiotropium binds transiently to an allosteric site en route to the binding pocket of both receptors. These simulations offer a structural view of an allosteric binding mode for an orthosteric GPCR ligand and raise additional opportunities for the design of ligands with different affinities or binding kinetics for different mAChR subtypes. Our findings not only offer new insights into the structure and function of one of the most important GPCR families, but may also facilitate the design of improved therapeutics targeting these critical receptors. PMID:22358844
Chen, Xiaobing; Levy, Jonathan M.; Hou, Austin; Winters, Christine; Azzam, Rita; Sousa, Alioscka A.; Leapman, Richard D.; Nicoll, Roger A.; Reese, Thomas S.
2015-01-01
The postsynaptic density (PSD)-95 family of membrane-associated guanylate kinases (MAGUKs) are major scaffolding proteins at the PSD in glutamatergic excitatory synapses, where they maintain and modulate synaptic strength. How MAGUKs underlie synaptic strength at the molecular level is still not well understood. Here, we explore the structural and functional roles of MAGUKs at hippocampal excitatory synapses by simultaneous knocking down PSD-95, PSD-93, and synapse-associated protein (SAP)102 and combining electrophysiology and transmission electron microscopic (TEM) tomography imaging to analyze the resulting changes. Acute MAGUK knockdown greatly reduces synaptic transmission mediated by α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate receptors (AMPARs) and N-methyl-d-aspartate receptors (NMDARs). This knockdown leads to a significant rise in the number of silent synapses, diminishes the size of PSDs without changes in pre- or postsynaptic membrane, and depletes the number of membrane-associated PSD-95–like vertical filaments and transmembrane structures, identified as AMPARs and NMDARs by EM tomography. The differential distribution of these receptor-like structures and dependence of their abundance on PSD size matches that of AMPARs and NMDARs in the hippocampal synapses. The loss of these structures following MAGUK knockdown tracks the reduction in postsynaptic AMPAR and NMDAR transmission, confirming the structural identities of these two types of receptors. These results demonstrate that MAGUKs are required for anchoring both types of glutamate receptors at the PSD and are consistent with a structural model where MAGUKs, corresponding to membrane-associated vertical filaments, are the essential structural proteins that anchor and organize both types of glutamate receptors and govern the overall molecular organization of the PSD. PMID:26604311
Chen, Xiaobing; Levy, Jonathan M; Hou, Austin; Winters, Christine; Azzam, Rita; Sousa, Alioscka A; Leapman, Richard D; Nicoll, Roger A; Reese, Thomas S
2015-12-15
The postsynaptic density (PSD)-95 family of membrane-associated guanylate kinases (MAGUKs) are major scaffolding proteins at the PSD in glutamatergic excitatory synapses, where they maintain and modulate synaptic strength. How MAGUKs underlie synaptic strength at the molecular level is still not well understood. Here, we explore the structural and functional roles of MAGUKs at hippocampal excitatory synapses by simultaneous knocking down PSD-95, PSD-93, and synapse-associated protein (SAP)102 and combining electrophysiology and transmission electron microscopic (TEM) tomography imaging to analyze the resulting changes. Acute MAGUK knockdown greatly reduces synaptic transmission mediated by α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate receptors (AMPARs) and N-methyl-d-aspartate receptors (NMDARs). This knockdown leads to a significant rise in the number of silent synapses, diminishes the size of PSDs without changes in pre- or postsynaptic membrane, and depletes the number of membrane-associated PSD-95-like vertical filaments and transmembrane structures, identified as AMPARs and NMDARs by EM tomography. The differential distribution of these receptor-like structures and dependence of their abundance on PSD size matches that of AMPARs and NMDARs in the hippocampal synapses. The loss of these structures following MAGUK knockdown tracks the reduction in postsynaptic AMPAR and NMDAR transmission, confirming the structural identities of these two types of receptors. These results demonstrate that MAGUKs are required for anchoring both types of glutamate receptors at the PSD and are consistent with a structural model where MAGUKs, corresponding to membrane-associated vertical filaments, are the essential structural proteins that anchor and organize both types of glutamate receptors and govern the overall molecular organization of the PSD.
Brambilla, R; Schnapp, A; Casagranda, F; Labrador, J P; Bergemann, A D; Flanagan, J G; Pasquale, E B; Klein, R
1995-01-01
The Eph-related family of receptor tyrosine kinases consists of at least 13 members, several of which display distinctive expression patterns in the developing and adult nervous system. Recently, a small family of ligands, structurally related to the B61 protein, was identified. Binding of these ligands to Eph-related receptors did not, however, elicit measurable biological signals in cultured cells. In order to study functional interactions between B61-related ligands and Eph-related receptors, we constructed chimeric receptors, containing an Eph-related ectodomain and the cytoplasmic domain of the TrkB neurotrophin receptor. Expression and activation of such chimeric receptors in NIH 3T3 cells induced transformation in focus formation assays. Membrane-bound LERK2 ligand is shown to signal through three different Eph-related receptors, namely Cek5, Cek10 and Elk. LERK2, however, fails to interact functionally with the Cek9 receptor. Quantitative analysis including binding assays indicates that Cek10 is the preferred LERK2 receptor. Preliminary mutagenesis of the LERK2 protein suggests a negative regulatory role for its cytoplasmic domain in LERK2 signaling. Images PMID:7621826
In vitro screening assays designed to identify hormone minics or antagonists, including the EDSTAC Tier 1 Screening (TIS) Battery, typically use only mammalian estrogen (ER) and androgen receptors (AR). However, there is uncertainty concerning species differences in binding affin...
Differentiation in the angiotensin II receptor 1 blocker class on autonomic function.
Krum, H
2001-09-01
Autonomic function is disordered in cardiovascular disease states such as chronic heart failure (CHF) and hypertension. Interactions between the renin-angiotensin-aldosterone system (RAAS) and the sympathetic nervous system (SNS) may potentially occur at a number of sites. These include central sites (eg, rostral ventrolateral medulla), at the level of baroreflex control, and at the sympathetic prejunctional angiotensin II receptor 1 (AT(1)) receptor, which is facilitatory for norepinephrine release from the sympathetic nerve terminal. Therefore, drugs that block the RAAS may be expected to improve autonomic dysfunction in cardiovascular disease states. In order to test the hypothesis that RAAS inhibition directly reduces SNS activity, a pithed rat model of sympathetic stimulation has been established. In this model, an increase in frequency of stimulation results in a pressor response that is sympathetically mediated and highly reproducible. This pressor response is enhanced in the presence of angiotensin II and is reduced in the presence of nonselective AIIRAs that block both AT(1) and AT(2) receptor subtypes (eg, saralasin). AT(1)-selective antagonists have also been studied in this model, at pharmacologically relevant doses. In one such study, only the AT(1) blocker eprosartan reduced sympathetically stimulated increases in blood pressure, whereas comparable doses of losartan, valsartan, and irbesartan did not. The reason(s) for the differences between eprosartan and other agents of this class on sympathetic modulation are not clear, but may relate to the chemical structure of the drug (a non- biphenyl tetrazole structure that is chemically distinct from the structure of other AIIRAs), receptor binding characteristics (competitive), or unique effects on presynaptic AT(1) receptors.
Yeast as a model system for mammalian seven-transmembrane segment receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jeansonne, N.E.
1994-05-01
Investigators have used the budding yeast Saccharomyces cerevisiae as a model system in which to study the {beta}-adrenergic receptor, the T-cell receptor pathway, initiation of mammalian DNA replication, initiation of mammalian transcription, secretion, the CDC2 kinase system, cell cycle control, and aging, as well as the function of oncogenes. This list continues to growth with the discovery of an immunoglobulin heavy-chain binding homologue in yeast, an Rb binding protein homologue, and a possible yeast arrestin. Yeast is relatively easy to maintain, to grow, and to genetically manipulate. A single gene can be overexpressed, selectively mutated or deleted from its chromosomalmore » location. In this way, the in vivo function of a gene can be studied. It has become reasonable to consider yeast as a model system for studying the seven transmembrane segments (7-TMS) receptor family. Currently, subtypes of the {beta}-adrenergic receptor are being studied in yeast. The receptor and its G{sub {alpha}}-G-protein, trigger the mating pheromone receptor pathway. This provides a powerful assay for determining receptor function. Studies expressing the muscarinic cholinergic receptor in yeast are underway. The yeast pheromone receptor belongs to this receptor family, sharing sequences and secondary structure homology. An effective strategy has been to identify a yeast pathway or process which is homologous to a mammalian system. The pathway is delineated in yeast, identifying other genetic components. Then yeast genes are used to screen for human homologues of these components. The putative human homologues are then expressed in yeast and in mammalian cells to determine function. When this type of {open_quotes}mixing and matching{close_quotes} works, yeast genetics can be a powerful tool. 115 refs.« less
Opioid Receptor Probes Derived from Cycloaddition of the Hallucinogen Natural Product Salvinorin A†
Lozama, Anthony; Cunningham, Christopher W.; Caspers, Michael J.; Douglas, Justin T.; Dersch, Christina M.; Rothman, Richard B.; Prisinzano, Thomas E.
2011-01-01
As part of our continuing efforts toward more fully understanding the structure-activity relationships of the neoclerodane diterpene salvinorin A, we report the synthesis and biological characterization of unique cycloadducts through [4+2] Diels-Alder cycloaddition. Microwave-assisted methods were developed and successfully employed, aiding in functionalizing the chemically sensitive salvinorin A scaffold. This demonstrates the first reported results for both cycloaddition of the furan ring and functionalization via microwave-assisted methodology of the salvinorin A skeleton. The cycloadducts yielded herein introduce electron-withdrawing substituents and bulky aromatic groups into the C-12 position. Kappa opioid (KOP) receptor space was explored through aromatization of the bent oxanorbornadiene system possessed by the cycloadducts to a planar phenyl ring system. Although dimethyl- and diethylcarboxylate analogues 5 and 6 retain some affinity and selectivity for KOP receptors and are full agonists, their aromatized counterparts 13 and 14 have reduced affinity for KOP receptors. The methods developed herein signify a novel approach toward rapidly probing the structure-activity relationships of furan containing natural products. PMID:21338114
Characterizing Spatial Organization of Cell Surface Receptors in Human Breast Cancer with STORM
NASA Astrophysics Data System (ADS)
Lyall, Evan; Chapman, Matthew R.; Sohn, Lydia L.
2012-02-01
Regulation and control of complex biological functions are dependent upon spatial organization of biological structures at many different length scales. For instance Eph receptors and their ephrin ligands bind when opposing cells come into contact during development, resulting in spatial organizational changes on the nanometer scale that lead to changes on the macro scale, in a process known as organ morphogenesis. One technique able to probe this important spatial organization at both the nanometer and micrometer length scales, including at cell-cell junctions, is stochastic optical reconstruction microscopy (STORM). STORM is a technique that localizes individual fluorophores based on the centroids of their point spread functions and then reconstructs a composite image to produce super resolved structure. We have applied STORM to study spatial organization of the cell surface of human breast cancer cells, specifically the organization of tyrosine kinase receptors and chemokine receptors. A better characterization of spatial organization of breast cancer cell surface proteins is necessary to fully understand the tumorigenisis pathways in the most common malignancy in United States women.
Jensen, Mette H; Sukumaran, Madhav; Johnson, Christopher M; Greger, Ingo H; Neuweiler, Hannes
2011-11-18
Ionotropic glutamate receptors (iGluRs) mediate excitatory neurotransmission in the central nervous system and play key roles in brain development and disease. iGluRs have two distinct extracellular domains, but the functional role of the distal N-terminal domain (NTD) is poorly understood. Crystal structures of the NTD from some non-N-methyl-d-aspartate (NMDA) iGluRs are consistent with a rigid body that facilitates receptor assembly but suggest an additional dynamic role that could modulate signaling. Here, we moved beyond spatial and temporal limitations of conventional protein single-molecule spectroscopy by employing correlation analysis of extrinsic oxazine fluorescence fluctuations. We observed nanosecond (ns)-to-microsecond (μs) motions of loop segments and helices within a region of an AMPA-type iGluR NTD, which has been identified previously to be structurally variable. Our data reveal that the AMPA receptor NTD undergoes rapid conformational fluctuations, suggesting an inherent allosteric capacity for this domain in addition to its established assembly function. Copyright © 2011 Elsevier Ltd. All rights reserved.
Kino, Tomoshige
2018-05-11
The human genome contains numerous single nucleotide variations (SNVs), and the human GR gene harbors ∼450 of these genetic changes. Among them, extremely rare non-synonymous variants known as pathologic GR gene mutations develop a characteristic pathologic condition, familial/sporadic generalized glucocorticoid resistance syndrome, by replacing the amino acids critical for GR protein structure and functions, whereas others known as pathologic polymorphisms develop mild manifestations recognized mainly at population bases by changing the GR activities slightly. Recent progress on the structural analysis to the GR protein and subsequent computer-based structural simulation revealed details of the molecular defects caused by such pathologic GR gene mutations, including their impact on the receptor interaction to ligands, nuclear receptor coactivators (NCoAs) or DNA glucocorticoid response elements (GREs). Indeed, those found in the GR ligand-binding domain significantly damage protein structure of the ligand-binding pocket and/or the activation function-2 transactivation domain and change their molecular interaction to glucocorticoids or the LxxLL signature motif of NCoAs. Two mutations found in GR DBD also affect interaction of the mutant receptors to GRE DNA by affecting the critical amino acid for the interaction or changing local hydrophobic circumstance. In this review, we discuss recent findings on the structural simulation of the pathologic GR mutants in connection to their functional and clinical impacts along with brief explanation to recent research achievement on the GR polymorphisms.
Biochemical and Structural Characterization of the Human TL1A Ectodomain†¶
Zhan, Chenyang; Yan, Qingrong; Patskovsky, Yury; Li, Zhenhong; Toro, Rafael; Meyer, Amanda; Cheng, Huiyong; Brenowitz, Michael; Nathenson, Stanley G; Almo, Steven C
2009-01-01
TNF-like 1A (TL1A) is a newly described member of the TNF superfamily that is directly implicated in the pathogenesis of autoimmune diseases, including inflammatory bowel disease, atherosclerosis and rheumatoid arthritis. We report the crystal structure of the human TL1A extracellular domain at a resolution of 2.5 Å, which reveals a jelly-roll fold typical of the TNF superfamily. This structural information, in combination with complementary mutagenesis and biochemical characterization, provides insights into the binding interface and the specificity of the interactions between TL1A and the DcR3 and DR3 receptors. These studies suggest that the mode of interaction between TL1A and DcR3 differs from other characterized TNF ligand/receptor complexes. In addition, we have generated functional TL1A mutants with altered disulfide bonding capability that exhibit enhanced solution properties, which will facilitate the production of materials for future cell-based and whole animal studies. In summary, these studies provide insights into the structure and function of TL1A and provide the basis for the rational manipulation of its interactions with cognate receptors. PMID:19522538
Biochemical and Structural Characterization of the Human TL1A Ectodomain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhan, C.; Yan, Q; Patskovsky, Y
TNF-like 1A (TL1A) is a newly described member of the TNF superfamily that is directly implicated in the pathogenesis of autoimmune diseases, including inflammatory bowel disease, atherosclerosis, and rheumatoid arthritis. We report the crystal structure of the human TL1A extracellular domain at a resolution of 2.5 {angstrom}, which reveals a jelly-roll fold typical of the TNF superfamily. This structural information, in combination with complementary mutagenesis and biochemical characterization, provides insights into the binding interface and the specificity of the interactions between TL1A and the DcR3 and DR3 receptors. These studies suggest that the mode of interaction between TL1A and DcR3more » differs from other characterized TNF ligand/receptor complexes. In addition, we have generated functional TL1A mutants with altered disulfide bonding capability that exhibit enhanced solution properties, which will facilitate the production of materials for future cell-based and whole animal studies. In summary, these studies provide insights into the structure and function of TL1A and provide the basis for the rational manipulation of its interactions with cognate receptors.« less
Guo, Xiaomei; Chen, Huan; Han, Ling; Haulon, Stephan; Kassab, Ghassan S
2018-02-15
Arterial stiffness may contribute to the pathogenesis of hypertension. The goal of this study is to elucidate the role of Endothelin-1 (ET-1) in aortic stiffening-induced hypertension through ET A receptor activation. An increase in aortic stiffness was created by use of a non-constrictive restraint, NCR on the abdominal aortic surface. A group of rats underwent aortic NCR or sham operation for 12 weeks and were then treated with ET A receptor antagonist BQ-123 for 3 weeks. We found that 12 weeks of aortic NCR significantly increased pulse and mean pressure and altered peripheral flow pattern, accompanied by an increased serum ET-1 level (p < 0.05). The increase in aortic stiffness (evidenced by an elevated pulse wave velocity) caused hypertrophic structural remodeling and decreased arterial compliance, along with an impaired endothelial function in peripheral small arteries. BQ-123 treatment only partially attenuated peripheral arterial hypertrophy and restored arterial compliance, but completely recovered endothelium function, and consequently restored local flow and lowered blood pressure. Our findings underscore the hemodynamic coupling between aortic stiffening and peripheral arterial vessels and flow dynamics through an ET A -dependent mechanism. ET A receptor blockade may have therapeutic potential for improving peripheral vessel structure and function in the treatment of aortic stiffness-induced hypertension.
Oldham, William M.; Van Eps, Ned; Preininger, Anita M.; Hubbell, Wayne L.; Hamm, Heidi E.
2007-01-01
Heterotrimeric G proteins function as molecular relays that mediate signal transduction from heptahelical receptors in the cell membrane to intracellular effector proteins. Crystallographic studies have demonstrated that guanine nucleotide exchange on the Gα subunit causes specific conformational changes in three key “switch” regions of the protein, which regulate binding to Gβγ subunits, receptors, and effector proteins. In the present study, nitroxide side chains were introduced at sites within the switch I region of Gαi to explore the structure and dynamics of this region throughout the G protein cycle. EPR spectra obtained for each of the Gα(GDP), Gα(GDP)βγ heterotrimer and Gα(GTPγS) conformations are consistent with the local environment observed in the corresponding crystal structures. Binding of the heterotrimer to activated rhodopsin to form the nucleotide-free (empty) complex, for which there is no crystal structure, causes prominent changes relative to the heterotrimer in the structure of switch I and contiguous sequences. The data identify a putative pathway of allosteric changes triggered by receptor binding and, together with previously published data, suggest elements of a mechanism for receptor-catalyzed nucleotide exchange. PMID:17463080
Structural basis for corepressor assembly by the orphan nuclear receptor TLX.
Zhi, Xiaoyong; Zhou, X Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten; Xu, H Eric
2015-02-15
The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX-Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. © 2015 Zhi et al.; Published by Cold Spring Harbor Laboratory Press.
Jatana, Nidhi; Thukral, Lipi; Latha, N
2016-01-01
Human Dopamine Receptor D4 (DRD4) orchestrates several neurological functions and represents a target for many psychological disorders. Here, we examined two rare variants in DRD4; V194G and R237L, which elicit functional alterations leading to disruption of ligand binding and G protein coupling, respectively. Using atomistic molecular dynamics (MD) simulations, we provide in-depth analysis to reveal structural signatures of wild and mutant complexes with their bound agonist and antagonist ligands. We constructed intra-protein network graphs to discriminate the global conformational changes induced by mutations. The simulations also allowed us to elucidate the local side-chain dynamical variations in ligand-bound mutant receptors. The data suggest that the mutation in transmembrane V (V194G) drastically disrupts the organization of ligand binding site and causes disorder in the native helical arrangement. Interestingly, the R237L mutation leads to significant rewiring of side-chain contacts in the intracellular loop 3 (site of mutation) and also affects the distant transmembrane topology. Additionally, these mutations lead to compact ICL3 region compared to the wild type, indicating that the receptor would be inaccessible for G protein coupling. Our findings thus reveal unreported structural determinants of the mutated DRD4 receptor and provide a robust framework for design of effective novel drugs.
Structural Characterization of the Predominant Family of Histidine Kinase Sensor Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Z.; Hendrickson, W
2010-01-01
Histidine kinase (HK) receptors are used ubiquitously by bacteria to monitor environmental changes, and they are also prevalent in plants, fungi, and other protists. Typical HK receptors have an extracellular sensor portion that detects a signal, usually a chemical ligand, and an intracellular transmitter portion that includes both the kinase domain itself and the site for histidine phosphorylation. While kinase domains are highly conserved, sensor domains are diverse. HK receptors function as dimers, but the molecular mechanism for signal transduction across cell membranes remains obscure. In this study, eight crystal structures were determined from five sensor domains representative of themore » most populated family, family HK1, found in a bioinformatic analysis of predicted sensor domains from transmembrane HKs. Each structure contains an inserted repeat of PhoQ/DcuS/CitA (PDC) domains, and similarity between sequence and structure is correlated across these and other double-PDC sensor proteins. Three of the five sensors crystallize as dimers that appear to be physiologically relevant, and comparisons between ligated structures and apo-state structures provide insights into signal transmission. Some HK1 family proteins prove to be sensors for chemotaxis proteins or diguanylate cyclase receptors, implying a combinatorial molecular evolution.« less
NASA Technical Reports Server (NTRS)
Singer, M. S.; Oliveira, L.; Vriend, G.; Shepherd, G. M.
1995-01-01
A family of G-protein-coupled receptors is believed to mediate the recognition of odor molecules. In order to identify potential ligand-binding residues, we have applied correlated mutation analysis to receptor sequences from the rat. This method identifies pairs of sequence positions where residues remain conserved or mutate in tandem, thereby suggesting structural or functional importance. The analysis supported molecular modeling studies in suggesting several residues in positions that were consistent with ligand-binding function. Two of these positions, dominated by histidine residues, may play important roles in ligand binding and could confer broad specificity to mammalian odor receptors. The presence of positive (overdominant) selection at some of the identified positions provides additional evidence for roles in ligand binding. Higher-order groups of correlated residues were also observed. Each group may interact with an individual ligand determinant, and combinations of these groups may provide a multi-dimensional mechanism for receptor diversity.
GABAA Receptors, Anesthetics and Anticonvulsants in Brain Development
Henschel, Oliver; Gipson, Keith E.; Bordey, Angelique
2008-01-01
GABA, acting via GABAA receptors, is well-accepted as the main inhibitory neurotransmitter of the mature brain, where it dampens neuronal excitability. The receptor's properties have been studied extensively, yielding important information about its structure, pharmacology, and regulation that are summarized in this review. Several GABAergic drugs have been commonly used as anesthetics, sedatives, and anticonvulsants for decades. However, findings that GABA has critical functions in brain development, in particular during the late embryonic and neonatal period, raise worthwhile questions regarding the side effects of GABAergic drugs that may lead to long-term cognitive deficits. Here, we will review some of these drugs in parallel with the control of CNS development that GABA exerts via activation of GABAA receptors. This review aims to provide a basic science and clinical perspective on the function of GABA and related pharmaceuticals acting at GABAA receptors. PMID:18537647
Kainate receptors coming of age: milestones of two decades of research
Contractor, Anis; Mulle, Christophe; Swanson, Geoffrey T
2011-01-01
Two decades have passed since the first report of the cloning of a kainate receptor (KAR) subunit. The intervening years have seen a rapid growth in our understanding of the biophysical properties and function of kainate receptors in the brain. This research has led to an appreciation that kainate receptors play quite distinct roles at synapses relative to other members of the glutamate-gated ion channel receptor family, despite structural and functional commonalities. The surprisingly diverse and complex nature of KAR signaling underlies their unique impact on neuronal networks through their direct and indirect effects on synaptic transmission, and their prominent role in regulating cellular excitability. This review pieces together highlights from the two decades of research subsequent to the cloning of the first subunit, and provides an overview of our current understanding of the role of KARs in the CNS and their potential importance to neurological and neuropsychiatric disorders. PMID:21256604
Glutamate Receptor Homologs in Plants: Functions and Evolutionary Origins
Price, Michelle Beth; Jelesko, John; Okumoto, Sakiko
2012-01-01
The plant glutamate-like receptor homologs (GLRs) are homologs of mammalian ionotropic glutamate receptors (iGluRs) which were discovered more than 10 years ago, and are hypothesized to be potential amino acid sensors in plants. Although initial progress on this gene family has been hampered by gene redundancy and technical issues such as gene toxicity; genetic, pharmacological, and electrophysiological approaches are starting to uncover the functions of this protein family. In parallel, there has been tremendous progress in elucidating the structure of animal glutamate receptors (iGluRs), which in turn will help understanding of the molecular mechanisms of plant GLR functions. In this review, we will summarize recent progress on the plant GLRs. Emerging evidence implicates plant GLRs in various biological processes in and beyond N sensing, and implies that there is some overlap in the signaling mechanisms of amino acids between plants and animals. Phylogenetic analysis using iGluRs from metazoans, plants, and bacteria showed that the plant GLRs are no more closely related to metazoan iGluRs as they are to bacterial iGluRs, indicating the separation of plant, other eukaryotic, and bacterial GLRs might have happened as early on as the last universal common ancestor. Structural similarities and differences with animal iGluRs, and the implication thereof, are also discussed. PMID:23115559
NASA Astrophysics Data System (ADS)
Neves, Marco A. C.; Simões, Sérgio; Sá e Melo, M. Luisa
2010-12-01
CXCR4 is a G-protein coupled receptor for CXCL12 that plays an important role in human immunodeficiency virus infection, cancer growth and metastasization, immune cell trafficking and WHIM syndrome. In the absence of an X-ray crystal structure, theoretical modeling of the CXCR4 receptor remains an important tool for structure-function analysis and to guide the discovery of new antagonists with potential clinical use. In this study, the combination of experimental data and molecular modeling approaches allowed the development of optimized ligand-receptor models useful for elucidation of the molecular determinants of small molecule binding and functional antagonism. The ligand-guided homology modeling approach used in this study explicitly re-shaped the CXCR4 binding pocket in order to improve discrimination between known CXCR4 antagonists and random decoys. Refinement based on multiple test-sets with small compounds from single chemotypes provided the best early enrichment performance. These results provide an important tool for structure-based drug design and virtual ligand screening of new CXCR4 antagonists.
Huang, Jianyun; Chen, Shuai; Zhang, J. Jillian; Huang, Xin-Yun
2013-01-01
G protein-coupled receptors (GPCRs) mediate transmembrane signaling. Before ligand binding, GPCRs exist in a basal state. Crystal structures of several GPCRs bound with antagonists or agonists have been solved. However, the crystal structure of the ligand-free basal state of a GPCR, the starting point of GPCR activation and function, has not been determined. Here we report the X-ray crystal structure of the first ligand-free basal state of a GPCR in a lipid membrane-like environment. Oligomeric turkey β1-adrenergic receptors display two alternating dimer interfaces. One interface involves the transmembrane domain (TM) 1, TM2, the C-terminal H8, and the extracellular loop 1. The other interface engages residues from TM4, TM5, the intracellular loop 2 and the extracellular loop 2. Structural comparisons show that this ligand-free state is in an inactive conformation. This provides the structural information regarding GPCR dimerization and oligomerization. PMID:23435379
Structure of a nanobody-stabilized active state of the β(2) adrenoceptor.
Rasmussen, Søren G F; Choi, Hee-Jung; Fung, Juan Jose; Pardon, Els; Casarosa, Paola; Chae, Pil Seok; Devree, Brian T; Rosenbaum, Daniel M; Thian, Foon Sun; Kobilka, Tong Sun; Schnapp, Andreas; Konetzki, Ingo; Sunahara, Roger K; Gellman, Samuel H; Pautsch, Alexander; Steyaert, Jan; Weis, William I; Kobilka, Brian K
2011-01-13
G protein coupled receptors (GPCRs) exhibit a spectrum of functional behaviours in response to natural and synthetic ligands. Recent crystal structures provide insights into inactive states of several GPCRs. Efforts to obtain an agonist-bound active-state GPCR structure have proven difficult due to the inherent instability of this state in the absence of a G protein. We generated a camelid antibody fragment (nanobody) to the human β(2) adrenergic receptor (β(2)AR) that exhibits G protein-like behaviour, and obtained an agonist-bound, active-state crystal structure of the receptor-nanobody complex. Comparison with the inactive β(2)AR structure reveals subtle changes in the binding pocket; however, these small changes are associated with an 11 Å outward movement of the cytoplasmic end of transmembrane segment 6, and rearrangements of transmembrane segments 5 and 7 that are remarkably similar to those observed in opsin, an active form of rhodopsin. This structure provides insights into the process of agonist binding and activation.
Structure of the Angiotensin Receptor Revealed by Serial Femtosecond Crystallography
Zhang, Haitao; Unal, Hamiyet; Gati, Cornelius; ...
2015-05-07
We report that angiotensin II type 1 receptor (AT 1R) is a G protein-coupled receptor that serves as a primary regulator for blood pressure maintenance. Although several anti-hypertensive drugs have been developed as AT 1R blockers (ARBs), the structural basis for AT 1R ligand-binding and regulation has remained elusive, mostly due to the difficulties of growing high quality crystals for structure determination using synchrotron radiation. By applying the recently developed method of serial femtosecond crystallography at an X-ray free-electron laser, we successfully determined the room-temperature crystal structure of the human AT 1R in complex with its selective antagonist ZD7155 atmore » 2.9 Å resolution. The AT 1R-ZD7155 complex structure revealed key structural features ofAT 1R and critical interactions for ZD7155 binding. Finally, docking simulations of the clinically used ARBs into the AT 1R structure further elucidated both the common and distinct binding modes for these anti-hypertensive drugs. Our results thereby provide fundamental insights into AT 1R structure-function relationship and structure-based drug design.« less
Structure of the Angiotensin Receptor Revealed by Serial Femtosecond Crystallography
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Haitao; Unal, Hamiyet; Gati, Cornelius
We report that angiotensin II type 1 receptor (AT 1R) is a G protein-coupled receptor that serves as a primary regulator for blood pressure maintenance. Although several anti-hypertensive drugs have been developed as AT 1R blockers (ARBs), the structural basis for AT 1R ligand-binding and regulation has remained elusive, mostly due to the difficulties of growing high quality crystals for structure determination using synchrotron radiation. By applying the recently developed method of serial femtosecond crystallography at an X-ray free-electron laser, we successfully determined the room-temperature crystal structure of the human AT 1R in complex with its selective antagonist ZD7155 atmore » 2.9 Å resolution. The AT 1R-ZD7155 complex structure revealed key structural features ofAT 1R and critical interactions for ZD7155 binding. Finally, docking simulations of the clinically used ARBs into the AT 1R structure further elucidated both the common and distinct binding modes for these anti-hypertensive drugs. Our results thereby provide fundamental insights into AT 1R structure-function relationship and structure-based drug design.« less
Glutamate receptors as seen by light: Spectroscopic studies of structure-function relationships
Mankiewicz, Kimberly A.; Jayaraman, Vasanthi
2010-01-01
Ionotropic glutamate receptors are major excitatory receptors in the central nervous system and also have far reaching influence in other areas of the body. Their modular nature has allowed for the isolation of the ligand binding domain and subsequent structural studies using a variety of spectroscopic techniques. This review will discuss the role of specific ligand:protein interactions in mediating activation in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) subtype of glutamate receptors as established by various spectroscopic investigations of the GluR2 and GluR4 subunits of this receptor. Specifically, this review will provide an introduction of the insight gained from X-ray crystallography and nuclear magnetic resonance (NMR) investigations and then go on to focus on studies utilizing vibrational spectroscopy and fluorescence resonance energy transfer (FRET) to study the behavior of the isolated ligand binding domain in solution and discuss the importance of specific ligand:protein interactions in the mechanism of receptor activation. PMID:17934637
Homology Modeling of Class A G Protein-Coupled Receptors
Costanzi, Stefano
2012-01-01
G protein-coupled receptors (GPCRs) are a large superfamily of membrane bound signaling proteins that hold great pharmaceutical interest. Since experimentally elucidated structures are available only for a very limited number of receptors, homology modeling has become a widespread technique for the construction of GPCR models intended to study the structure-function relationships of the receptors and aid the discovery and development of ligands capable of modulating their activity. Through this chapter, various aspects involved in the constructions of homology models of the serpentine domain of the largest class of GPCRs, known as class A or rhodopsin family, are illustrated. In particular, the chapter provides suggestions, guidelines and critical thoughts on some of the most crucial aspect of GPCR modeling, including: collection of candidate templates and a structure-based alignment of their sequences; identification and alignment of the transmembrane helices of the query receptor to the corresponding domains of the candidate templates; selection of one or more templates receptor; election of homology or de novo modeling for the construction of specific extracellular and intracellular domains; construction of the three-dimensional models, with special consideration to extracellular regions, disulfide bridges, and interhelical cavity; validation of the models through controlled virtual screening experiments. PMID:22323225
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fenalti, Gustavo; Zatsepin, Nadia A.; Betti, Cecilia
Bi-functional μ- and δ- opioid receptor (OR) ligands are potential therapeutic alternatives to alkaloid opiate analgesics with diminished side effects. We solved the structure of human δ-OR bound to the bi-functional δ-OR antagonist and μ-OR agonist tetrapeptide H-Dmt-Tic-Phe-Phe-NH 2 (DIPP-NH 2) by serial femtosecond crystallography, revealing a cis-peptide bond between H-Dmt and Tic. In summary, the observed receptor-peptide interactions are critical to understand the pharmacological profiles of opioid peptides, and to develop improved analgesics.
Cacciarini, Martina; Nativi, Cristina; Norcini, Martina; Staderini, Samuele; Francesconi, Oscar; Roelens, Stefano
2011-02-21
The contribution from several H-bonding groups and the impact of geometric requirements on the binding ability of benzene-based tripodal receptors toward carbohydrates have been investigated by measuring the affinity of a set of structures toward octyl β-D-glucopyranoside, selected as a representative monosaccharide. The results reported in the present study demonstrate that a judicious choice of correct geometry and appropriate functional groups is critical to achieve the complementary hydrogen bonding interactions required for an effective carbohydrate recognition.
Hou, Zhi-Shuai; Ulloa-Aguirre, Alfredo; Tao, Ya-Xiong
2018-06-01
Conformational diseases are caused by structurally abnormal proteins that cannot fold properly and achieve their native conformation. Misfolded proteins frequently originate from genetic mutations that may lead to loss-of-function diseases involving a variety of structurally diverse proteins including enzymes, ion channels, and membrane receptors. Pharmacoperones are small molecules that cross the cell surface plasma membrane and reach their target proteins within the cell, serving as molecular scaffolds to stabilize the native conformation of misfolded or well-folded but destabilized proteins, to prevent their degradation and promote correct trafficking to their functional site of action. Because of their high specificity toward the target protein, pharmacoperones are currently the focus of intense investigation as therapy for several conformational diseases. Areas covered: This review summarizes data on the mechanisms leading to protein misfolding and the use of pharmacoperone drugs as an experimental approach to rescue function of distinct misfolded/misrouted proteins associated with a variety of diseases, such as lysosomal storage diseases, channelopathies, and G protein-coupled receptor misfolding diseases. Expert commentary: The fact that many misfolded proteins may retain function, offers a unique therapeutic opportunity to cure disease by directly correcting misrouting through administering pharmacoperone drugs thereby rescuing function of disease-causing, conformationally abnormal proteins.
Hawkins, Sara J; Weiss, Lukas; Offner, Thomas; Dittrich, Katarina; Hassenklöver, Thomas; Manzini, Ivan
2017-01-01
Understanding the mechanisms involved in maintaining lifelong neurogenesis has a clear biological and clinical interest. In the present study, we performed olfactory nerve transection on larval Xenopus to induce severe damage to the olfactory circuitry. We surveyed the timing of the degeneration, subsequent rewiring and functional regeneration of the olfactory system following injury. A range of structural labeling techniques and functional calcium imaging were performed on both tissue slices and whole brain preparations. Cell death of olfactory receptor neurons and proliferation of stem cells in the olfactory epithelium were immediately increased following lesion. New olfactory receptor neurons repopulated the olfactory epithelium and once again showed functional responses to natural odorants within 1 week after transection. Reinnervation of the olfactory bulb (OB) by newly formed olfactory receptor neuron axons also began at this time. Additionally, we observed a temporary increase in cell death in the OB and a subsequent loss in OB volume. Mitral/tufted cells, the second order neurons of the olfactory system, largely survived, but transiently lost dendritic tuft complexity. The first odorant-induced responses in the OB were observed 3 weeks after nerve transection and the olfactory network showed signs of major recovery, both structurally and functionally, after 7 weeks.
Hawkins, Sara J.; Weiss, Lukas; Offner, Thomas; Dittrich, Katarina; Hassenklöver, Thomas; Manzini, Ivan
2017-01-01
Understanding the mechanisms involved in maintaining lifelong neurogenesis has a clear biological and clinical interest. In the present study, we performed olfactory nerve transection on larval Xenopus to induce severe damage to the olfactory circuitry. We surveyed the timing of the degeneration, subsequent rewiring and functional regeneration of the olfactory system following injury. A range of structural labeling techniques and functional calcium imaging were performed on both tissue slices and whole brain preparations. Cell death of olfactory receptor neurons and proliferation of stem cells in the olfactory epithelium were immediately increased following lesion. New olfactory receptor neurons repopulated the olfactory epithelium and once again showed functional responses to natural odorants within 1 week after transection. Reinnervation of the olfactory bulb (OB) by newly formed olfactory receptor neuron axons also began at this time. Additionally, we observed a temporary increase in cell death in the OB and a subsequent loss in OB volume. Mitral/tufted cells, the second order neurons of the olfactory system, largely survived, but transiently lost dendritic tuft complexity. The first odorant-induced responses in the OB were observed 3 weeks after nerve transection and the olfactory network showed signs of major recovery, both structurally and functionally, after 7 weeks. PMID:29234276
The function of metabotropic glutamate receptors in thalamus and cortex.
Sherman, S Murray
2014-04-01
Metabotropic glutamate receptors (mGluRs) are found throughout thalamus and cortex and are clearly important to circuit behavior in both structures, and so considering only participation of ionotropic glutamate receptors (e.g., [R,S]-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid [AMPA] and N-methyl-d-aspartate receptors [NMDA] receptors) in glutamatergic processing would be an unfortunate oversimplification. These mGluRs are found both postsynaptically, on target cells of glutamatergic afferents, and presynaptically, on various synaptic terminals themselves, and when activated, they produce prolonged effects lasting at least hundreds of msec to several sec and perhaps longer. Two main types exist: activation of group I mGluRs causes postsynaptic depolarization, and group II, hyperpolarization. Both types are implicated in synaptic plasticity, both short term and long term. Their evident importance in functioning of thalamus and cortex makes it critical to develop a better understanding of how these receptors are normally activated, especially because they also seem implicated in a wide range of neurological and cognitive pathologies.
The Function of Metabotropic Glutamate Receptors in Thalamus and Cortex
Sherman, S. Murray
2016-01-01
Metabotropic glutamate receptors (mGluRs) are found throughout thalamus and cortex and are clearly important to circuit behavior in both structures, and so considering only participation of ionotropic glutamate receptors (e.g., [R,S]-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid [AMPA] and N-methyl-d-aspartate receptors [NMDA] receptors) in glutamatergic processing would be an unfortunate oversimplification. These mGluRs are found both postsynaptically, on target cells of glutamatergic afferents, and presynaptically, on various synaptic terminals themselves, and when activated, they produce prolonged effects lasting at least hundreds of msec to several sec and perhaps longer. Two main types exist: activation of group I mGluRs causes postsynaptic depolarization, and group II, hyperpolarization. Both types are implicated in synaptic plasticity, both short term and long term. Their evident importance in functioning of thalamus and cortex makes it critical to develop a better understanding of how these receptors are normally activated, especially because they also seem implicated in a wide range of neurological and cognitive pathologies. PMID:23459618
Functional map of arrestin binding to phosphorylated opsin, with and without agonist.
Peterhans, Christian; Lally, Ciara C M; Ostermaier, Martin K; Sommer, Martha E; Standfuss, Jörg
2016-06-28
Arrestins desensitize G protein-coupled receptors (GPCRs) and act as mediators of signalling. Here we investigated the interactions of arrestin-1 with two functionally distinct forms of the dim-light photoreceptor rhodopsin. Using unbiased scanning mutagenesis we probed the individual contribution of each arrestin residue to the interaction with the phosphorylated apo-receptor (Ops-P) and the agonist-bound form (Meta II-P). Disruption of the polar core or displacement of the C-tail strengthened binding to both receptor forms. In contrast, mutations of phosphate-binding residues (phosphosensors) suggest the phosphorylated receptor C-terminus binds arrestin differently for Meta II-P and Ops-P. Likewise, mutations within the inter-domain interface, variations in the receptor-binding loops and the C-edge of arrestin reveal different binding modes. In summary, our results indicate that arrestin-1 binding to Meta II-P and Ops-P is similarly dependent on arrestin activation, although the complexes formed with these two receptor forms are structurally distinct.
Nutrient Sensing at the Plasma Membrane of Fungal Cells.
Van Dijck, Patrick; Brown, Neil Andrew; Goldman, Gustavo H; Rutherford, Julian; Xue, Chaoyang; Van Zeebroeck, Griet
2017-03-01
To respond to the changing environment, cells must be able to sense external conditions. This is important for many processes including growth, mating, the expression of virulence factors, and several other regulatory effects. Nutrient sensing at the plasma membrane is mediated by different classes of membrane proteins that activate downstream signaling pathways: nontransporting receptors, transceptors, classical and nonclassical G-protein-coupled receptors, and the newly defined extracellular mucin receptors. Nontransporting receptors have the same structure as transport proteins, but have lost the capacity to transport while gaining a receptor function. Transceptors are transporters that also function as a receptor, because they can rapidly activate downstream signaling pathways. In this review, we focus on these four types of fungal membrane proteins. We mainly discuss the sensing mechanisms relating to sugars, ammonium, and amino acids. Mechanisms for other nutrients, such as phosphate and sulfate, are discussed briefly. Because the model yeast Saccharomyces cerevisiae has been the most studied, especially regarding these nutrient-sensing systems, each subsection will commence with what is known in this species.
FKBP51 and FKBP52 in Signaling and Disease
Storer, Cheryl L.; Dickey, Chad A.; Galigniana, Mario D.; Rein, Theo; Cox, Marc B.
2011-01-01
FKBP51 and FKBP52 are diverse regulators of steroid hormone receptor signaling including regulation of receptor maturation, hormone binding, and nuclear translocation. Although structurally similar, they are functionally divergent, which is largely attributed to differences in the FK1 domain and the proline-rich loop. FKBP51 and FKBP52 have emerged as likely contributors to a variety of hormone-dependent diseases including stress-related diseases, immune function, reproductive functions and a variety of cancers. In addition, recent studies have implicated FKBP51 and FKBP52 in Alzheimer’s disease and other protein aggregation disorders. This review summarizes our current understanding of FKBP51 and FKBP52 interactions within the receptor-chaperone complex, their contributions to health and disease, and their potential as therapeutic targets for the treatment of these diseases. PMID:21889356
Structural interpretation of P2X receptor mutagenesis studies on drug action
Evans, Richard J
2010-01-01
P2X receptors for ATP are ligand gated cation channels that form from the trimeric assembly of subunits with two transmembrane segments, a large extracellular ligand binding loop, and intracellular amino and carboxy termini. The receptors are expressed throughout the body, involved in functions ranging from blood clotting to inflammation, and may provide important targets for novel therapeutics. Mutagenesis based studies have been used to develop an understanding of the molecular basis of their pharmacology with the aim of developing models of the ligand binding site. A crystal structure for the zebra fish P2X4 receptor in the closed agonist unbound state has been published recently, which provides a major advance in our understanding of the receptors. This review gives an overview of mutagenesis studies that have led to the development of a model of the ATP binding site, as well as identifying residues contributing to allosteric regulation and antagonism. These studies are discussed with reference to the crystal to provide a structural interpretation of the molecular basis of drug action. PMID:20977449
Molecular Mechanisms of Fibroblast Growth Factor Signaling in Physiology and Pathology
Belov, Artur A.; Mohammadi, Moosa
2013-01-01
Fibroblast growth factors (FGFs) signal in a paracrine or endocrine fashion to mediate a myriad of biological activities, ranging from issuing developmental cues, maintaining tissue homeostasis, and regulating metabolic processes. FGFs carry out their diverse functions by binding and dimerizing FGF receptors (FGFRs) in a heparan sulfate (HS) cofactor- or Klotho coreceptor-assisted manner. The accumulated wealth of structural and biophysical data in the past decade has transformed our understanding of the mechanism of FGF signaling in human health and development, and has provided novel concepts in receptor tyrosine kinase (RTK) signaling. Among these contributions are the elucidation of HS-assisted receptor dimerization, delineation of the molecular determinants of ligand–receptor specificity, tyrosine kinase regulation, receptor cis-autoinhibition, and tyrosine trans-autophosphorylation. These structural studies have also revealed how disease-associated mutations highjack the physiological mechanisms of FGFR regulation to contribute to human diseases. In this paper, we will discuss the structurally and biophysically derived mechanisms of FGF signaling, and how the insights gained may guide the development of therapies for treatment of a diverse array of human diseases. PMID:23732477
Molecular mechanisms of fibroblast growth factor signaling in physiology and pathology.
Belov, Artur A; Mohammadi, Moosa
2013-06-01
Fibroblast growth factors (FGFs) signal in a paracrine or endocrine fashion to mediate a myriad of biological activities, ranging from issuing developmental cues, maintaining tissue homeostasis, and regulating metabolic processes. FGFs carry out their diverse functions by binding and dimerizing FGF receptors (FGFRs) in a heparan sulfate (HS) cofactor- or Klotho coreceptor-assisted manner. The accumulated wealth of structural and biophysical data in the past decade has transformed our understanding of the mechanism of FGF signaling in human health and development, and has provided novel concepts in receptor tyrosine kinase (RTK) signaling. Among these contributions are the elucidation of HS-assisted receptor dimerization, delineation of the molecular determinants of ligand-receptor specificity, tyrosine kinase regulation, receptor cis-autoinhibition, and tyrosine trans-autophosphorylation. These structural studies have also revealed how disease-associated mutations highjack the physiological mechanisms of FGFR regulation to contribute to human diseases. In this paper, we will discuss the structurally and biophysically derived mechanisms of FGF signaling, and how the insights gained may guide the development of therapies for treatment of a diverse array of human diseases.
Crystal structures of a GABAA-receptor chimera reveal new endogenous neurosteroid-binding sites.
Laverty, Duncan; Thomas, Philip; Field, Martin; Andersen, Ole J; Gold, Matthew G; Biggin, Philip C; Gielen, Marc; Smart, Trevor G
2017-11-01
γ-Aminobutyric acid receptors (GABA A Rs) are vital for controlling excitability in the brain. This is emphasized by the numerous neuropsychiatric disorders that result from receptor dysfunction. A critical component of most native GABA A Rs is the α subunit. Its transmembrane domain is the target for many modulators, including endogenous brain neurosteroids that impact anxiety, stress and depression, and for therapeutic drugs, such as general anesthetics. Understanding the basis for the modulation of GABA A R function requires high-resolution structures. Here we present the first atomic structures of a GABA A R chimera at 2.8-Å resolution, including those bound with potentiating and inhibitory neurosteroids. These structures define new allosteric binding sites for these modulators that are associated with the α-subunit transmembrane domain. Our findings will enable the exploitation of neurosteroids for therapeutic drug design to regulate GABA A Rs in neurological disorders.
Vessey, Kirstan A; Gu, Ben J; Jobling, Andrew I; Phipps, Joanna A; Greferath, Ursula; Tran, Mai X; Dixon, Michael A; Baird, Paul N; Guymer, Robyn H; Wiley, James S; Fletcher, Erica L
2017-08-01
Age-related macular degeneration (AMD) is a leading cause of irreversible, severe vision loss in Western countries. Recently, we identified a novel pathway involving P2X7 receptor scavenger function expressed on ocular immune cells as a risk factor for advanced AMD. In this study, we investigate the effect of loss of P2X7 receptor function on retinal structure and function during aging. P2X7-null and wild-type C57bl6J mice were investigated at 4, 12, and 18 months of age for macrophage phagocytosis activity, ocular histological changes, and retinal function. Phagocytosis activity of blood-borne macrophages decreased with age at 18 months in the wild-type mouse. Lack of P2X7 receptor function reduced phagocytosis at all ages compared to wild-type mice. At 12 months of age, P2X7-null mice had thickening of Bruchs membrane and retinal pigment epithelium dysfunction. By 18 months of age, P2X7-null mice displayed phenotypic characteristics consistent with early AMD, including Bruchs membrane thickening, retinal pigment epithelium cell loss, retinal functional deficits, and signs of subretinal inflammation. Our present study shows that loss of function of the P2X7 receptor in mice induces retinal changes representing characteristics of early AMD, providing a valuable model for investigating the role of scavenger receptor function and the immune system in the development of this age-related disease. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Differential modulation of FXR activity by chlorophacinone and ivermectin analogs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hsu, Chia-Wen
Chemicals that alter normal function of farnesoid X receptor (FXR) have been shown to affect the homeostasis of bile acids, glucose, and lipids. Several structural classes of environmental chemicals and drugs that modulated FXR transactivation were previously identified by quantitative high-throughput screening (qHTS) of the Tox21 10 K chemical collection. In the present study, we validated the FXR antagonist activity of selected structural classes, including avermectin anthelmintics, dihydropyridine calcium channel blockers, 1,3-indandione rodenticides, and pyrethroid pesticides, using in vitro assay and quantitative structural-activity relationship (QSAR) analysis approaches. (Z)-Guggulsterone, chlorophacinone, ivermectin, and their analogs were profiled for their ability to altermore » CDCA-mediated FXR binding using a panel of 154 coregulator motifs and to induce or inhibit transactivation and coactivator recruitment activities of constitutive androstane receptor (CAR), liver X receptor alpha (LXRα), or pregnane X receptor (PXR). Our results showed that chlorophacinone and ivermectin had distinct modes of action (MOA) in modulating FXR-coregulator interactions and compound selectivity against the four aforementioned functionally-relevant nuclear receptors. These findings collectively provide mechanistic insights regarding compound activities against FXR and possible explanations for in vivo toxicological observations of chlorophacinone, ivermectin, and their analogs. - Highlights: • A subset of Tox21 chemicals was investigated for FXR antagonism. • In vitro and computational approaches were used to evaluate FXR antagonists. • Chlorophacinone and ivermectin had distinct patterns in modulating FXR activity.« less
Muraki, Michiro
2016-01-01
Human Fas ligand extracellular domain has been investigated as an important target protein in the field of medical biotechnology. In a recent study, the author developed an effective method to produce biologically active human Fas ligand extracellular domain derivatives using site-specific chemical modifications. A human Fas ligand extracellular domain derivative containing a reactive cysteine residue within its N-terminal tag sequence, which locates not proximal to the binding interface between the ligand and the receptor in terms of the three-dimensional structure, was modified by Fluorescein-5-Maleimide without impairing the specific binding activity toward human Fas receptor extracellular domain. The purified protein sample free of low molecular-weight contaminants showed a characteristic fluorescence spectrum derived from the attached Fluorescein moieties, and formed a stable binding complex with human Fas receptor extracellular domain-human IgG1 Fc domain fusion protein in solution. The conjugation number of the fluorochrome was estimated to be 2.5 per a single human Fas ligand extracellular domain trimer from the ratio of the absorbance value at 280 nm to that at 495 nm. A functional fluorescent human Fas ligand extracellular domain derivative was prepared via a site-specific conjugation of fluorochrome, which was guided by the three-dimensional structure information on the ligand-receptor complex. Fluorescent derivatives created by this method may contribute to the development of an improved diagnosis system for the diseases related to Fas receptor.
Canela, Laia; Luján, Rafael; Lluís, Carme; Burgueño, Javier; Mallol, Josefa; Canela, Enric I; Franco, Rafael; Ciruela, Francisco
2007-09-01
Heptaspanning membrane also known as G protein-coupled receptors (GPCR) do interact with a variety of intracellular proteins whose function is regulate receptor traffic and/or signaling. Using a yeast two-hybrid screen, NECAB2, a neuronal calcium binding protein, was identified as a binding partner for the adenosine A(2A) receptor (A(2A)R) interacting with its C-terminal domain. Co-localization, co-immunoprecipitation and pull-down experiments showed a close and specific interaction between A(2A)R and NECAB2 in both transfected HEK-293 cells and also in rat striatum. Immunoelectron microscopy detection of NECAB2 and A(2A)R in the rat striatopallidal structures indicated that both proteins are co-distributed in the same glutamatergic nerve terminals. The interaction of NECAB2 with A(2A)R modulated the cell surface expression, the ligand-dependent internalization and the receptor-mediated activation of the MAPK pathway. Overall, these results show that A(2A)R interacts with NECAB2 in striatal neurones co-expressing the two proteins and that the interaction is relevant for A(2A)R function.
Faury, G; Molinari, J; Rusova, E; Mariko, B; Raveaud, S; Huber, P; Velebny, V; Robert, A M; Robert, L
2011-01-01
Qualitative and quantitative modifications of receptors were shown to play a key role in cell and tissue aging. We recently described the properties of a rhamnose-recognizing receptor on fibroblasts involved in the mediation of age-dependent functions of these cells. Using Ca(2+)-mobilization and DNA-microarrays we could show in the presence of rhamnose-rich oligo- and polysaccharides (RROPs) Ca(2+)-mobilization and changes in gene regulation. Here, we compared the effects of several RROPs, differing in their carbohydrate sequence and molecular weights, in normal human dermal fibroblasts (NHDFs). It appeared that different structural features were required for maximal effects on Ca(2+)-mobilization and gene-expression profiles. Maximal effect on Ca(2+) influx and intracellular free calcium regulation was exhibited by RROP-1, a 50 kDa average molecular weight polysaccharide, and RROP-3, a 5 kDa average molecular weight oligosaccharide with a different carbohydrate sequence. Maximal effect on gene-expression profiles was obtained with RROP-3. These results suggest the possibility of several different transmission pathways from the rhamnose-receptor to intracellular targets, differentially affecting these two intracellular functions, with potential consequences on aging. Although of only relative specificity, this receptor site exhibits a high affinity for rhamnose, absent from vertebrate glycoconjugates. The rhamnose-receptor might well represent an evolutionary conserved conformation of a prokaryote lectin. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Zhang, Qing; Yang, Hui; Li, Jing; Xie, Xin
2016-05-01
G protein-coupled receptor 84 (GPR84) is a free fatty acid receptor activated by medium-chain free fatty acids with 9-14 carbons. It is expressed mainly in the immune-related tissues, such as spleen, bone marrow, and peripheral blood leukocytes. GPR84 plays significant roles in inflammatory processes and may represent a novel drug target for the treatment of immune-mediated diseases. However, the lack of potent and specific ligands for GPR84 hindered the study of its functions and the development of potential clinical applications. Here, we report the screen of 160,000 small-molecule compounds with a calcium mobilization assay using a human embryonic kidney 293 cell line stably expressing GPR84 and Gα16, and the identification of 2-(hexylthio)pyrimidine-4,6-diol (ZQ-16) as a potent and selective agonist of GPR84 with a novel structure. ZQ-16 activates several GPR84-mediated signaling pathways, including calcium mobilization, inhibition of cAMP accumulation, phosphorylation of extracellular signal-regulated protein kinase 1/2, receptor desensitization and internalization, and receptor-β-arrestin interaction. This compound may be a useful tool to study the functions of GPR84 and a potential candidate for further structural optimization. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.
Villmann, Carmen; Hoffmann, Jutta; Werner, Markus; Kott, Sabine; Strutz-Seebohm, Nathalie; Nilsson, Tanja; Hollmann, Michael
2008-10-01
Although considerable progress has been made in characterizing the physiological function of the high-affinity kainate (KA) receptor subunits KA1 and KA2, no homomeric ion channel function has been shown. An ion channel transplantation approach was employed in this study to directly test if homomerically expressed KA1 and KA2 pore domains are capable of conducting currents. Transplantation of the ion pore of KA1 or KA2 into GluR6 generated perfectly functional ion channels that allowed characterization of those electrophysiological and pharmacological properties that are determined exclusively by the ion pore of KA1 or KA2. This demonstrates for the first time that KA1 and KA2 ion pore domains are intrinsically capable of conducting ions even in homomeric pore assemblies. NMDA receptors, similar to KA1- or KA2-containing receptors, function only as heteromeric complexes. They are composed of NR1 and NR2 subunits, which both are non-functional when expressed homomerically. In contrast to NR1, the homomeric NR2B ion pore failed to translate ligand binding into pore opening when transplanted into GluR6. Similarly, heteromeric coexpression of the ion channel domains of both NR1 and NR2 inserted into GluR6 failed to produce functional channels. Therefore, we conclude that the mechanism underlying the ion channel opening in the obligatorily heterotetrameric NMDA receptors differs significantly from that in the facultatively heterotetrameric alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate and KA receptors.
Linger, Rachel M. A.; Keating, Amy K.; Earp, H. Shelton; Graham, Douglas K.
2011-01-01
Tyro-3, Axl, and Mer constitute the TAM family of receptor tyrosine kinases (RTKs) characterized by a conserved sequence within the kinase domain and adhesion molecule-like extracellular domains. This small family of RTKs regulates an intriguing mix of processes, including cell proliferation/survival, cell adhesion and migration, blood clot stabilization, and regulation of inflammatory cytokine release. Genetic or experimental alteration of TAM receptor function can contribute to a number of disease states, including coagulopathy, autoimmune disease, retinitis pigmentosa, and cancer. In this chapter, we first provide a comprehensive review of the structure, regulation, biologic functions, and down-stream signaling pathways of these receptors. In addition, we discuss recent evidence which suggests a role for TAM receptors in oncogenic mechanisms as family members are over-expressed in a spectrum of human cancers and have prognostic significance in some. Possible strategies for targeted inhibition of the TAM family in the treatment of human cancer are described. Further research will be necessary to evaluate the full clinical implications of TAM family expression and activation in cancer. PMID:18620092
Spitzweck, Bettina; Brankatschk, Marko; Dickson, Barry J
2010-02-05
The orthogonal array of axon pathways in the Drosophila CNS is constructed in part under the control of three Robo family axon guidance receptors: Robo1, Robo2 and Robo3. Each of these receptors is responsible for a distinct set of guidance decisions. To determine the molecular basis for these functional specializations, we used homologous recombination to create a series of 9 "robo swap" alleles: expressing each of the three Robo receptors from each of the three robo loci. We demonstrate that the lateral positioning of longitudinal axon pathways relies primarily on differences in gene regulation, not distinct combinations of Robo proteins as previously thought. In contrast, specific features of the Robo1 and Robo2 proteins contribute to their distinct functions in commissure formation. These specializations allow Robo1 to prevent crossing and Robo2 to promote crossing. These data demonstrate how diversification of expression and structure within a single family of guidance receptors can shape complex patterns of neuronal wiring. 2010 Elsevier Inc. All rights reserved.
Yamashita, Takahiro; Tose, Koji; Shichida, Yoshinori
2008-01-01
G protein-coupled receptors (GPCRs) are classified into several families based on their amino acid sequences. In family 1, GPCRs such as rhodopsin and adrenergic receptor, the structure-function relationship has been extensively investigated to demonstrate that exposure of the third cytoplasmic loop is essential for selective G protein activation. In contrast, much less is known about other families. Here we prepared chimeric mutants between Gt-coupled rhodopsin and Gi/Go- and Gs-coupled glucagon-like peptide-1 (GLP-1) receptor of family 2 and tried to identify the loop region that functions at the third cytoplasmic loop position of rhodopsin. We succeeded in expressing a mutant having the first cytoplasmic loop of GLP-1 receptor and found that this mutant activated Gi and Go efficiently but did not activate Gt. Moreover, the rhodopsin mutant having the first loop of Gs-coupled secretin receptor of family 2 decreased the Gi and Go activation efficiencies. Therefore, the first loop of GLP-1 receptor would share a similar role to the third loop of rhodopsin in G protein activation. This result strongly suggested that different families of GPCRs have maintained molecular architectures of their ancestral types to generate a common mechanism, namely exposure of the cytoplasmic loop, to activate peripheral G protein.
Fibroblast growth factor receptors in breast cancer.
Wang, Shuwei; Ding, Zhongyang
2017-05-01
Fibroblast growth factor receptors are growth factor receptor tyrosine kinases, exerting their roles in embryogenesis, tissue homeostasis, and development of breast cancer. Recent genetic studies have identified some subtypes of fibroblast growth factor receptors as strong genetic loci associated with breast cancer. In this article, we review the recent epidemiological findings and experiment results of fibroblast growth factor receptors in breast cancer. First, we summarized the structure and physiological function of fibroblast growth factor receptors in humans. Then, we discussed the common genetic variations in fibroblast growth factor receptors that affect breast cancer risk. In addition, we also introduced the potential roles of each fibroblast growth factor receptors isoform in breast cancer. Finally, we explored the potential therapeutics targeting fibroblast growth factor receptors for breast cancer. Based on the biological mechanisms of fibroblast growth factor receptors leading to the pathogenesis in breast cancer, targeting fibroblast growth factor receptors may provide new opportunities for breast cancer therapeutic strategies.
Provasi, Davide; Artacho, Marta Camacho; Negri, Ana; Mobarec, Juan Carlos; Filizola, Marta
2011-01-01
Extensive experimental information supports the formation of ligand-specific conformations of G protein-coupled receptors (GPCRs) as a possible molecular basis for their functional selectivity for signaling pathways. Taking advantage of the recently published inactive and active crystal structures of GPCRs, we have implemented an all-atom computational strategy that combines different adaptive biasing techniques to identify ligand-specific conformations along pre-determined activation pathways. Using the prototypic GPCR β2-adrenergic receptor as a suitable test case for validation, we show that ligands with different efficacies (either inverse agonists, neutral antagonists, or agonists) modulate the free-energy landscape of the receptor by shifting the conformational equilibrium towards active or inactive conformations depending on their elicited physiological response. Notably, we provide for the first time a quantitative description of the thermodynamics of the receptor in an explicit atomistic environment, which accounts for the receptor basal activity and the stabilization of different active-like states by differently potent agonists. Structural inspection of these metastable states reveals unique conformations of the receptor that may have been difficult to retrieve experimentally. PMID:22022248
Conformational Transitions upon Ligand Binding: Holo-Structure Prediction from Apo Conformations
Seeliger, Daniel; de Groot, Bert L.
2010-01-01
Biological function of proteins is frequently associated with the formation of complexes with small-molecule ligands. Experimental structure determination of such complexes at atomic resolution, however, can be time-consuming and costly. Computational methods for structure prediction of protein/ligand complexes, particularly docking, are as yet restricted by their limited consideration of receptor flexibility, rendering them not applicable for predicting protein/ligand complexes if large conformational changes of the receptor upon ligand binding are involved. Accurate receptor models in the ligand-bound state (holo structures), however, are a prerequisite for successful structure-based drug design. Hence, if only an unbound (apo) structure is available distinct from the ligand-bound conformation, structure-based drug design is severely limited. We present a method to predict the structure of protein/ligand complexes based solely on the apo structure, the ligand and the radius of gyration of the holo structure. The method is applied to ten cases in which proteins undergo structural rearrangements of up to 7.1 Å backbone RMSD upon ligand binding. In all cases, receptor models within 1.6 Å backbone RMSD to the target were predicted and close-to-native ligand binding poses were obtained for 8 of 10 cases in the top-ranked complex models. A protocol is presented that is expected to enable structure modeling of protein/ligand complexes and structure-based drug design for cases where crystal structures of ligand-bound conformations are not available. PMID:20066034
Structural and Functional Impacts of ER Coactivator Sequential Recruitment.
Yi, Ping; Wang, Zhao; Feng, Qin; Chou, Chao-Kai; Pintilie, Grigore D; Shen, Hong; Foulds, Charles E; Fan, Guizhen; Serysheva, Irina; Ludtke, Steven J; Schmid, Michael F; Hung, Mien-Chie; Chiu, Wah; O'Malley, Bert W
2017-09-07
Nuclear receptors recruit multiple coactivators sequentially to activate transcription. This "ordered" recruitment allows different coactivator activities to engage the nuclear receptor complex at different steps of transcription. Estrogen receptor (ER) recruits steroid receptor coactivator-3 (SRC-3) primary coactivator and secondary coactivators, p300/CBP and CARM1. CARM1 recruitment lags behind the binding of SRC-3 and p300 to ER. Combining cryo-electron microscopy (cryo-EM) structure analysis and biochemical approaches, we demonstrate that there is a close crosstalk between early- and late-recruited coactivators. The sequential recruitment of CARM1 not only adds a protein arginine methyltransferase activity to the ER-coactivator complex, it also alters the structural organization of the pre-existing ERE/ERα/SRC-3/p300 complex. It induces a p300 conformational change and significantly increases p300 HAT activity on histone H3K18 residues, which, in turn, promotes CARM1 methylation activity on H3R17 residues to enhance transcriptional activity. This study reveals a structural role for a coactivator sequential recruitment and biochemical process in ER-mediated transcription. Copyright © 2017 Elsevier Inc. All rights reserved.
Bali, Alka; Singh, Shalu
2015-01-01
The serotonin 5-HT(6) receptor (5- HT(6)R) is amongst the recently discovered serotonergic receptors with almost exclusive localization in the brain. Hence, this receptor is fast emerging as a promising target for cognition enhancement in central nervous system (CNS) diseases such as Alzheimer's disease (cognitive function), obesity, schizophrenia and anxiety. The last decade has seen a surge of literature reports on the functional role of this receptor in learning and memory processes and investigations related to the chemistry and pharmacology of 5-HT(6) receptor ligands, especially 5- HT(6) receptor antagonists. Studies show the involvement of multiple neurotransmitter systems in cognitive enhancement by 5-HT(6)R antagonists including cholinergic, glutamatergic, and GABAergic systems. Several of the 5-HT(6)R ligands are indole based agents bearing structural similarity to the endogenous neurotransmitter serotonin. Based on the pharmacophoric models proposed for these agents, drug designing has been carried out incorporating various heterocyclic replacements for the indole nucleus. In this review, we have broadly summarized the medicinal chemistry and current status of this fairly recent class of drugs along with their potential therapeutic applications.
Cooper, Gareth R; Moir, Anne
2011-05-01
The paradigm gerA operon is required for endospore germination in response to c-alanine as the sole germinant, and the three protein products, GerAA, GerAB, and GerAC are predicted to form a receptor complex in the spore inner membrane. GerAB shows homology to the amino acid-polyamine-organocation (APC) family of single-component transporters and is predicted to be an integral membrane protein with 10 membrane-spanning helices. Site-directed mutations were introduced into the gerAB gene at its natural location on the chromosome. Alterations to some charged or potential helix-breaking residues within membrane spans affected receptor function dramatically. In some cases, this is likely to reflect the complete loss of the GerA receptor complex, as judged by the absence of the germinant receptor protein GerAC, which suggests that the altered GerAB protein itself may be unstable or that the altered structure destabilizes the complex. Mutants that have a null phenotype for Instituto de Biotecnología de León, INBIOTEC, Parque Científico de León, Av. Real, 1, 24006 León, Spain-alanine germination but retain GerAC protein at near-normal levels are more likely to define amino acid residues of functional, rather than structural, importance. Single-amino-acid substitutions in each of the GerAB and GerAA proteins can prevent incorporation of GerAC protein into the spore; this provides strong evidence that the proteins within a specific receptor interact and that these interactions are required for receptor assembly. The lipoprotein nature of the GerAC receptor subunit is also important; an amino acid change in the prelipoprotein signal sequence in the gerAC1 mutant results in the absence of GerAC protein from the spore.
Gotzes, F; Balfanz, S; Baumann, A
1994-01-01
Members of the superfamily of G-protein coupled receptors share significant similarities in sequence and transmembrane architecture. We have isolated a Drosophila homologue of the mammalian dopamine receptor family using a low stringency hybridization approach. The deduced amino acid sequence is approximately 70% homologous to the human D1/D5 receptors. When expressed in HEK 293 cells, the Drosophila receptor stimulates cAMP production in response to dopamine application. This effect was mimicked by SKF 38393, a specific D1 receptor agonist, but inhibited by dopaminergic antagonists such as butaclamol and flupentixol. In situ hybridization revealed that the Drosophila dopamine receptor is highly expressed in the somata of the optic lobes. This suggests that the receptor might be involved in the processing of visual information and/or visual learning in invertebrates.
Structure prediction of the second extracellular loop in G-protein-coupled receptors.
Kmiecik, Sebastian; Jamroz, Michal; Kolinski, Michal
2014-06-03
G-protein-coupled receptors (GPCRs) play key roles in living organisms. Therefore, it is important to determine their functional structures. The second extracellular loop (ECL2) is a functionally important region of GPCRs, which poses significant challenge for computational structure prediction methods. In this work, we evaluated CABS, a well-established protein modeling tool for predicting ECL2 structure in 13 GPCRs. The ECL2s (with between 13 and 34 residues) are predicted in an environment of other extracellular loops being fully flexible and the transmembrane domain fixed in its x-ray conformation. The modeling procedure used theoretical predictions of ECL2 secondary structure and experimental constraints on disulfide bridges. Our approach yielded ensembles of low-energy conformers and the most populated conformers that contained models close to the available x-ray structures. The level of similarity between the predicted models and x-ray structures is comparable to that of other state-of-the-art computational methods. Our results extend other studies by including newly crystallized GPCRs. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Dolciami, Daniela; Gargaro, Marco; Cerra, Bruno; Scalisi, Giulia; Bagnoli, Luana; Servillo, Giuseppe; Fazia, Maria Agnese Della; Puccetti, Paolo; Quintana, Francisco J; Fallarino, Francesca; Macchiarulo, Antonio
2018-02-06
Discovered as a modulator of the toxic response to environmental pollutants, aryl hydrocarbon receptor (AhR) has recently gained attention for its involvement in various physiological and pathological pathways. AhR is a ligand-dependent transcription factor activated by a large array of chemical compounds, which include metabolites of l-tryptophan (l-Trp) catabolism as endogenous ligands of the receptor. Among these, 2-(1'H-indole-3'-carbonyl)thiazole-4-carboxylic acid methyl ester (ITE) has attracted interest in the scientific community, being endowed with nontoxic, immunomodulatory, and anticancer AhR-mediated functions. So far, no information about the binding mode and interactions of ITE with AhR is available. In this study, we used docking and molecular dynamics to propose a putative binding mode of ITE into the ligand binding pocket of AhR. Mutagenesis studies were then instrumental in validating the proposed binding mode, identifying His 285 and Tyr 316 as important key residues for ligand-dependent receptor activation. Finally, a set of ITE analogues was synthesized and tested to further probe molecular interactions of ITE to AhR and characterize the relevance of specific functional groups in the chemical structure for receptor activity. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Whittaker, Jonathan; Whittaker, Linda J.; Roberts, Charles T.; Phillips, Nelson B.; Ismail-Beigi, Faramarz; Lawrence, Michael C.; Weiss, Michael A.
2012-01-01
The primary hormone-binding surface of the insulin receptor spans one face of the N-terminal β-helix of the α-subunit (the L1 domain) and an α-helix in its C-terminal segment (αCT). Crystallographic analysis of the free ectodomain has defined a contiguous dimer-related motif in which the αCT α-helix packs against L1 β-strands 2 and 3. To relate structure to function, we exploited expanded genetic-code technology to insert photo-activatable probes at key sites in L1 and αCT. The pattern of αCT-mediated photo–cross-linking within the free and bound receptor is in accord with the crystal structure and prior mutagenesis. Surprisingly, L1 photo-probes in β-strands 2 and 3, predicted to be shielded by αCT, efficiently cross-link to insulin. Furthermore, anomalous mutations were identified on neighboring surfaces of αCT and insulin that impair hormone-dependent activation of the intracellular receptor tyrosine kinase (contained within the transmembrane β-subunit) disproportionately to their effects on insulin binding. Taken together, these results suggest that αCT, in addition to its hormone-recognition role, provides a signaling element in the mechanism of receptor activation. PMID:22736795
Whittaker, Jonathan; Whittaker, Linda J; Roberts, Charles T; Phillips, Nelson B; Ismail-Beigi, Faramarz; Lawrence, Michael C; Weiss, Michael A
2012-07-10
The primary hormone-binding surface of the insulin receptor spans one face of the N-terminal β-helix of the α-subunit (the L1 domain) and an α-helix in its C-terminal segment (αCT). Crystallographic analysis of the free ectodomain has defined a contiguous dimer-related motif in which the αCT α-helix packs against L1 β-strands 2 and 3. To relate structure to function, we exploited expanded genetic-code technology to insert photo-activatable probes at key sites in L1 and αCT. The pattern of αCT-mediated photo-cross-linking within the free and bound receptor is in accord with the crystal structure and prior mutagenesis. Surprisingly, L1 photo-probes in β-strands 2 and 3, predicted to be shielded by αCT, efficiently cross-link to insulin. Furthermore, anomalous mutations were identified on neighboring surfaces of αCT and insulin that impair hormone-dependent activation of the intracellular receptor tyrosine kinase (contained within the transmembrane β-subunit) disproportionately to their effects on insulin binding. Taken together, these results suggest that αCT, in addition to its hormone-recognition role, provides a signaling element in the mechanism of receptor activation.
Caers, Jelle; Janssen, Tom; Van Rompay, Liesbeth; Broeckx, Valérie; Van Den Abbeele, Jan; Gäde, Gerd; Schoofs, Liliane; Beets, Isabel
2016-03-01
Adipokinetic hormones (AKH) are well known regulators of energy metabolism in insects. These neuropeptides are produced in the corpora cardiaca and perform their hormonal function by interacting with specific G protein-coupled receptors (GPCRs) at the cell membranes of target tissues, mainly the fat body. Here, we investigated the sequences, spatial and temporal distributions, and pharmacology of AKH neuropeptides and receptors in the tsetse fly, Glossina morsitans morsitans. The open reading frames of two splice variants of the Glomo-akh receptor (Glomo-akhr) gene and of the AKH neuropeptide encoding genes, gmmhrth and gmmakh, were cloned. Both tsetse AKHR isoforms show strong sequence conservation when compared to other insect AKHRs. Glomo-AKH prepropeptides also have the typical architecture of AKH precursors. In an in vitro Ca(2+) mobilization assay, Glomo-AKH neuropeptides activated each receptor isoform up to nanomolar concentrations. We identified structural features of tsetse AKH neuropeptides essential for receptor activation in vitro. Gene expression profiles suggest a function for AKH signaling in regulating Glossina energy metabolism, where AKH peptides are released from the corpora cardiaca and activate receptors mainly expressed in the fat body. This analysis of the ligand-receptor coupling, expression, and pharmacology of the two Glomo-AKHR variants facilitates further elucidation of the function of AKH in G. m. morsitans. Copyright © 2015 Elsevier Ltd. All rights reserved.
Koshimizu, Taka-aki; Ueno, Susumu; Tanoue, Akito; Yanagihara, Nobuyuki; Stojilkovic, Stanko S; Tsujimoto, Gozoh
2002-12-06
P2X purinergic receptors (P2XRs) differ among themselves with respect to their ligand preferences and channel kinetics during activation, desensitization, and recovery. However, the contributions of distinct receptor subdomains to the subtype-specific behavior have been incompletely characterized. Here we show that homomeric receptors having the extracellular domain of the P2X(3) subunit in the P2X(2a)-based backbone (P2X(2a)/X(3)ex) mimicked two intrinsic functions of P2X(3)R, sensitivity to alphabeta-methylene ATP and ecto-ATPase-dependent recovery from endogenous desensitization; these two functions were localized to the N- and C-terminal halves of the P2X(3) extracellular loop, respectively. The chimeric P2X(2a)R/X(3)ex receptors also desensitized with accelerated rates compared with native P2X(2a)R, and the introduction of P2X(2) C-terminal splicing into the chimeric subunit (P2X(2b)/X(3)ex) further increased the rate of desensitization. Physical and functional heteromerization of native P2X(2a) and P2X(2b) subunits was also demonstrated. In heteromeric receptors, the ectodomain of P2X(3) was a structural determinant for ligand selectivity and recovery from desensitization, and the C terminus of P2X(2) was an important factor for the desensitization rate. Furthermore, [gamma-(32)P]8-azido ATP, a photoreactive agonist, was effectively cross-linked to P2X(3) subunit in homomeric receptors but not in heteromeric P2X(2) + P2X(3)Rs. These results indicate that heteromeric receptors formed by distinct P2XR subunits develop new functions resulting from integrative effects of the participating extracellular and C-terminal subdomains.
Burg, John S; Ingram, Jessica R; Venkatakrishnan, A J; Jude, Kevin M; Dukkipati, Abhiram; Feinberg, Evan N; Angelini, Alessandro; Waghray, Deepa; Dror, Ron O; Ploegh, Hidde L; Garcia, K Christopher
2015-03-06
Chemokines are small proteins that function as immune modulators through activation of chemokine G protein-coupled receptors (GPCRs). Several viruses also encode chemokines and chemokine receptors to subvert the host immune response. How protein ligands activate GPCRs remains unknown. We report the crystal structure at 2.9 angstrom resolution of the human cytomegalovirus GPCR US28 in complex with the chemokine domain of human CX3CL1 (fractalkine). The globular body of CX3CL1 is perched on top of the US28 extracellular vestibule, whereas its amino terminus projects into the central core of US28. The transmembrane helices of US28 adopt an active-state-like conformation. Atomic-level simulations suggest that the agonist-independent activity of US28 may be due to an amino acid network evolved in the viral GPCR to destabilize the receptor's inactive state. Copyright © 2015, American Association for the Advancement of Science.
Structural basis of GM-CSF and IL-2 sequestration by the viral decoy receptor GIF
Felix, Jan; Kandiah, Eaazhisai; De Munck, Steven; Bloch, Yehudi; van Zundert, Gydo C.P.; Pauwels, Kris; Dansercoer, Ann; Novanska, Katka; Read, Randy J.; Bonvin, Alexandre M.J.J.; Vergauwen, Bjorn; Verstraete, Kenneth; Gutsche, Irina; Savvides, Savvas N.
2016-01-01
Subversion of the host immune system by viruses is often mediated by molecular decoys that sequester host proteins pivotal to mounting effective immune responses. The widespread mammalian pathogen parapox Orf virus deploys GIF, a member of the poxvirus immune evasion superfamily, to antagonize GM-CSF (granulocyte macrophage colony-stimulating factor) and IL-2 (interleukin-2), two pleiotropic cytokines of the mammalian immune system. However, structural and mechanistic insights into the unprecedented functional duality of GIF have remained elusive. Here we reveal that GIF employs a dimeric binding platform that sequesters two copies of its target cytokines with high affinity and slow dissociation kinetics to yield distinct complexes featuring mutually exclusive interaction footprints. We illustrate how GIF serves as a competitive decoy receptor by leveraging binding hotspots underlying the cognate receptor interactions of GM-CSF and IL-2, without sharing any structural similarity with the cytokine receptors. Our findings contribute to the tracing of novel molecular mimicry mechanisms employed by pathogenic viruses. PMID:27819269
Formation and Decay of the Arrestin·Rhodopsin Complex in Native Disc Membranes*
Beyrière, Florent; Sommer, Martha E.; Szczepek, Michal; Bartl, Franz J.; Hofmann, Klaus Peter; Heck, Martin; Ritter, Eglof
2015-01-01
In the G protein-coupled receptor rhodopsin, light-induced cis/trans isomerization of the retinal ligand triggers a series of distinct receptor states culminating in the active Metarhodopsin II (Meta II) state, which binds and activates the G protein transducin (Gt). Long before Meta II decays into the aporeceptor opsin and free all-trans-retinal, its signaling is quenched by receptor phosphorylation and binding of the protein arrestin-1, which blocks further access of Gt to Meta II. Although recent crystal structures of arrestin indicate how it might look in a precomplex with the phosphorylated receptor, the transition into the high affinity complex is not understood. Here we applied Fourier transform infrared spectroscopy to monitor the interaction of arrestin-1 and phosphorylated rhodopsin in native disc membranes. By isolating the unique infrared signature of arrestin binding, we directly observed the structural alterations in both reaction partners. In the high affinity complex, rhodopsin adopts a structure similar to Gt-bound Meta II. In arrestin, a modest loss of β-sheet structure indicates an increase in flexibility but is inconsistent with a large scale structural change. During Meta II decay, the arrestin-rhodopsin stoichiometry shifts from 1:1 to 1:2. Arrestin stabilizes half of the receptor population in a specific Meta II protein conformation, whereas the other half decays to inactive opsin. Altogether these results illustrate the distinct binding modes used by arrestin to interact with different functional forms of the receptor. PMID:25847250
Patra, Mahesh Chandra; Kwon, Hyuk-Kwon; Batool, Maria; Choi, Sangdun
2018-01-01
Toll-like receptors (TLRs) are a unique category of pattern recognition receptors that recognize distinct pathogenic components, often utilizing the same set of downstream adaptors. Specific molecular features of extracellular, transmembrane (TM), and cytoplasmic domains of TLRs are crucial for coordinating the complex, innate immune signaling pathway. Here, we constructed a full-length structural model of TLR4—a widely studied member of the interleukin-1 receptor/TLR superfamily—using homology modeling, protein–protein docking, and molecular dynamics simulations to understand the differential domain organization of TLR4 in a membrane-aqueous environment. Results showed that each functional domain of the membrane-bound TLR4 displayed several structural transitions that are biophysically essential for plasma membrane integration. Specifically, the extracellular and cytoplasmic domains were partially immersed in the upper and lower leaflets of the membrane bilayer. Meanwhile, TM domains tilted considerably to overcome the hydrophobic mismatch with the bilayer core. Our analysis indicates an alternate dimerization or a potential oligomerization interface of TLR4-TM. Moreover, the helical properties of an isolated TM dimer partly agree with that of the full-length receptor. Furthermore, membrane-absorbed or solvent-exposed surfaces of the toll/interleukin-1 receptor domain are consistent with previous X-ray crystallography and biochemical studies. Collectively, we provided a complete structural model of membrane-bound TLR4 that strengthens our current understanding of the complex mechanism of receptor activation and adaptor recruitment in the innate immune signaling pathway. PMID:29593733
Kalli, Antreas C; Rog, Tomasz; Vattulainen, Ilpo; Campbell, Iain D; Sansom, Mark S P
2017-08-01
Integrins are heterodimeric (αβ) cell surface receptors that are potential therapeutic targets for a number of diseases. Despite the existence of structural data for all parts of integrins, the structure of the complete integrin receptor is still not available. We have used available structural data to construct a model of the complete integrin receptor in complex with talin F2-F3 domain. It has been shown that the interactions of integrins with their lipid environment are crucial for their function but details of the integrin/lipid interactions remain elusive. In this study an integrin/talin complex was inserted in biologically relevant bilayers that resemble the cell plasma membrane containing zwitterionic and charged phospholipids, cholesterol and sphingolipids to study the dynamics of the integrin receptor and its effect on bilayer structure and dynamics. The results of this study demonstrate the dynamic nature of the integrin receptor and suggest that the presence of the integrin receptor alters the lipid organization between the two leaflets of the bilayer. In particular, our results suggest elevated density of cholesterol and of phosphatidylserine lipids around the integrin/talin complex and a slowing down of lipids in an annulus of ~30 Å around the protein due to interactions between the lipids and the integrin/talin F2-F3 complex. This may in part regulate the interactions of integrins with other related proteins or integrin clustering thus facilitating signal transduction across cell membranes.
Tala, Srinivasa R; Singh, Anamika; Lensing, Cody J; Schnell, Sathya M; Freeman, Katie T; Rocca, James R; Haskell-Luevano, Carrie
2018-05-16
The melanocortin system is involved in the regulation of complex physiological functions, including energy and weight homeostasis, feeding behavior, inflammation, sexual function, pigmentation, and exocrine gland function. The five melanocortin receptors that belong to the superfamily of G protein-coupled receptors (GPCRs) are regulated by endogenously expressed agonists and antagonists. The aim of this study was to explore the potential of replacing the disulfide bridge in chimeric AGRP-melanocortin peptide Tyr-c[Cys-His-d-Phe-Arg-Trp-Asn-Ala-Phe-Cys]-Tyr-NH 2 (1) with 1,2,3-triazole moieties. A series of 1,2,3-triazole-bridged peptidomimetics were designed, synthesized, and pharmacologically evaluated at the mouse melanocortin receptors. The ligands possessed nanomolar to micromolar agonist cAMP signaling potency. A key finding was that the disulfide bond in peptide 1 can be replaced with the monotriazole ring with minimal effect on the functional activity at the melanocortin receptors. The 1,5-disubstituted triazole-bridged peptide 6 showed equipotent functional activity at the mMC3R and modest 5-fold decreased agonist potency at the mMC4R compared to those of 1. Interestingly, the 1,4- and 1,5-disubstituted isomers of the triazole ring resulted in different selectivities at the receptor subtypes, indicating subtle structural features that may be exploited in the generation of selective melanocortin ligands. Introducing cyclic and acyclic bis-triazole moieties into chimeric AGRP template 1 generally decreased agonist activity. These results will be useful for the further design of neuronal chemical probes for the melanocortin receptors as well as in other receptor systems.
Structural determinants of ubiquitin-CXC chemokine receptor 4 interaction.
Saini, Vikas; Marchese, Adriano; Tang, Wei-Jen; Majetschak, Matthias
2011-12-23
Ubiquitin, a post-translational protein modifier inside the cell, functions as a CXC chemokine receptor (CXCR) 4 agonist outside the cell. However, the structural determinants of the interaction between extracellular ubiquitin and CXCR4 remain unknown. Utilizing C-terminal truncated ubiquitin and ubiquitin mutants, in which surface residues that are known to interact with ubiquitin binding domains in interacting proteins are mutated (Phe-4, Leu-8, Ile-44, Asp-58, Val-70), we provide evidence that the ubiquitin-CXCR4 interaction follows a two-site binding mechanism in which the hydrophobic surfaces surrounding Phe-4 and Val-70 are important for receptor binding, whereas the flexible C terminus facilitates receptor activation. Based on these findings and the available crystal structures, we then modeled the ubiquitin-CXCR4 interface with the RosettaDock software followed by small manual adjustments, which were guided by charge complementarity and anticipation of a conformational switch of CXCR4 upon activation. This model suggests three residues of CXCR4 (Phe-29, Phe-189, Lys-271) as potential interaction sites. Binding studies with HEK293 cells overexpressing wild type and CXCR4 after site-directed mutagenesis confirm that these residues are important for ubiquitin binding but that they do not contribute to the binding of stromal cell-derived factor 1α. Our findings suggest that the structural determinants of the CXCR4 agonist activity of ubiquitin mimic the typical structure-function relationship of chemokines. Furthermore, we provide evidence for separate and specific ligand binding sites on CXCR4. As exogenous ubiquitin has been shown to possess therapeutic potential, our findings are expected to facilitate the structure-based design of new compounds with ubiquitin-mimetic actions on CXCR4.
Bolívar-G, Wilmar; Antoniazzi, Marta M; Grant, Taran; Jared, Carlos
2014-01-01
The facial pits of rattlesnakes, copperheads, lanceheads, bushmasters and other American and Asian pitvipers (Crotalinae) are highly innervated and densely vascularized infrared (IR) receptor organs. For over a century, studies have focused on a small sample of model species from North America and Asia. Based on an expanded survey of Central and South American crotalines, we report a conspicuous accessory structure composed of well-defined papillae that project from the anterior orbital adnexa. The papillae are continuous with the inner chamber of the IR receptor organ and our histological and ultrastructural data suggest that they possess a well-developed nervous network and extensive vascularization; however, they lack the characteristic IR-sensitive terminal nerve masses found in the IR-receptive pit membrane. The function of the IR receptor organ papillae is unknown.
Structural basis for signal recognition and transduction by platelet-activating-factor receptor.
Cao, Can; Tan, Qiuxiang; Xu, Chanjuan; He, Lingli; Yang, Linlin; Zhou, Ye; Zhou, Yiwei; Qiao, Anna; Lu, Minmin; Yi, Cuiying; Han, Gye Won; Wang, Xianping; Li, Xuemei; Yang, Huaiyu; Rao, Zihe; Jiang, Hualiang; Zhao, Yongfang; Liu, Jianfeng; Stevens, Raymond C; Zhao, Qiang; Zhang, Xuejun C; Wu, Beili
2018-06-01
Platelet-activating-factor receptor (PAFR) responds to platelet-activating factor (PAF), a phospholipid mediator of cell-to-cell communication that exhibits diverse physiological effects. PAFR is considered an important drug target for treating asthma, inflammation and cardiovascular diseases. Here we report crystal structures of human PAFR in complex with the antagonist SR 27417 and the inverse agonist ABT-491 at 2.8-Å and 2.9-Å resolution, respectively. The structures, supported by molecular docking of PAF, provide insights into the signal-recognition mechanisms of PAFR. The PAFR-SR 27417 structure reveals an unusual conformation showing that the intracellular tips of helices II and IV shift outward by 13 Å and 4 Å, respectively, and helix VIII adopts an inward conformation. The PAFR structures, combined with single-molecule FRET and cell-based functional assays, suggest that the conformational change in the helical bundle is ligand dependent and plays a critical role in PAFR activation, thus greatly extending knowledge about signaling by G-protein-coupled receptors.
Parmar, Vikas K; Grinde, Ellinor; Mazurkiewicz, Joseph E; Herrick-Davis, Katharine
2017-09-01
Even though there are hundreds of reports in the published literature supporting the hypothesis that G protein-coupled receptors (GPCR) form and function as dimers this remains a highly controversial area of research and mechanisms governing homodimer formation are poorly understood. Crystal structures revealing homodimers have been reported for many different GPCR. For adrenergic receptors, a potential dimer interface involving transmembrane domain 1 (TMD1) and helix 8 (H8) was identified in crystal structures of the beta 1 -adrenergic (β 1 -AR) and β 2 -AR. The purpose of this study was to investigate a potential role for TMD1 and H8 in dimerization and plasma membrane expression of functional β 2 -AR. Charged residues at the base of TMD1 and in the distal portion of H8 were replaced, singly and in combination, with non-polar residues or residues of opposite charge. Wild type and mutant β 2 -AR, tagged with YFP and expressed in HEK293 cells, were evaluated for plasma membrane expression and function. Homodimer formation was evaluated using bioluminescence resonance energy transfer, bimolecular fluorescence complementation, and fluorescence correlation spectroscopy. Amino acid substitutions at the base of TMD1 and in the distal portion of H8 disrupted homodimer formation and caused receptors to be retained in the endoplasmic reticulum. Mutations in the proximal region of H8 did not disrupt dimerization but did interfere with plasma membrane expression. This study provides biophysical evidence linking a potential TMD1/H8 interface with ER export and the expression of functional β 2 -AR on the plasma membrane. This article is part of a Special Issue entitled: Interactions between membrane receptors in cellular membranes edited by Kalina Hristova. Copyright © 2016 Elsevier B.V. All rights reserved.
Lensing, Cody J.; Freeman, Katie T.; Schnell, Sathya M.; Adank, Danielle N.; Speth, Robert C.; Haskell-Luevano, Carrie
2017-01-01
Pharmacological probes for the melanocortin receptors have been utilized for studying various disease states including cancer, sexual function disorders, Alzheimer's disease, social disorders, cachexia, and obesity. This study focused on the design and synthesis of bivalent ligands to target melanocortin receptor homodimers. Lead ligands increased binding affinity by 14- to 25-fold and increased cAMP signaling potency by 3- to 5-fold compared to their monovalent counterparts. Unexpectedly, different bivalent ligands showed preferences for particular melanocortin receptor subtypes depending on the linker that connected the binding scaffolds suggesting structural differences between the various dimer subtypes. Homobivalent compound 12 (CJL-1-140) possessed a functional profile that was unique from its monovalent counterparts providing evidence of the discrete effects of bivalent ligands. Lead compound 7 (CJL-1-87) significantly decreased feeding in mice after intracerebroventricular administration. To the best of our knowledge, this is the first report of a melanocortin bivalent ligand's in vivo physiological effects. PMID:26959173
Unveiling TRPV1 Spatio-Temporal Organization in Live Cell Membranes
Storti, Barbara; Di Rienzo, Carmine; Cardarelli, Francesco; Bizzarri, Ranieri; Beltram, Fabio
2015-01-01
Transient Receptor Potential Vanilloid 1 (TRPV1) is a non-selective cation channel that integrates several stimuli into nociception and neurogenic inflammation. Here we investigated the subtle TRPV1 interplay with candidate membrane partners in live cells by a combination of spatio-temporal fluctuation techniques and fluorescence resonance energy transfer (FRET) imaging. We show that TRPV1 is split into three populations with fairly different molecular properties: one binding to caveolin-1 and confined into caveolar structures, one actively guided by microtubules through selective binding, and one which diffuses freely and is not directly implicated in regulating receptor functionality. The emergence of caveolin-1 as a new interactor of TRPV1 evokes caveolar endocytosis as the main desensitization pathway of TRPV1 receptor, while microtubule binding agrees with previous data suggesting the receptor stabilization in functional form by these cytoskeletal components. Our results shed light on the hitherto unknown relationships between spatial organization and TRPV1 function in live-cell membranes. PMID:25764349
TRPV2 is critical for the maintenance of cardiac structure and function in mice
Katanosaka, Yuki; Iwasaki, Keiichiro; Ujihara, Yoshihiro; Takatsu, Satomi; Nishitsuji, Koki; Kanagawa, Motoi; Sudo, Atsushi; Toda, Tatsushi; Katanosaka, Kimiaki; Mohri, Satoshi; Naruse, Keiji
2014-01-01
The heart has a dynamic compensatory mechanism for haemodynamic stress. However, the molecular details of how mechanical forces are transduced in the heart are unclear. Here we show that the transient receptor potential, vanilloid family type 2 (TRPV2) cation channel is critical for the maintenance of cardiac structure and function. Within 4 days of eliminating TRPV2 from hearts of the adult mice, cardiac function declines severely, with disorganization of the intercalated discs that support mechanical coupling with neighbouring myocytes and myocardial conduction defects. After 9 days, cell shortening and Ca2+ handling by single myocytes are impaired in TRPV2-deficient hearts. TRPV2-deficient neonatal cardiomyocytes form no intercalated discs and show no extracellular Ca2+-dependent intracellular Ca2+ increase and insulin-like growth factor (IGF-1) secretion in response to stretch stimulation. We further demonstrate that IGF-1 receptor/PI3K/Akt pathway signalling is significantly downregulated in TRPV2-deficient hearts, and that IGF-1 administration partially prevents chamber dilation and impairment in cardiac pump function in these hearts. Our results improve our understanding of the molecular processes underlying the maintenance of cardiac structure and function. PMID:24874017
TRPV2 is critical for the maintenance of cardiac structure and function in mice.
Katanosaka, Yuki; Iwasaki, Keiichiro; Ujihara, Yoshihiro; Takatsu, Satomi; Nishitsuji, Koki; Kanagawa, Motoi; Sudo, Atsushi; Toda, Tatsushi; Katanosaka, Kimiaki; Mohri, Satoshi; Naruse, Keiji
2014-05-29
The heart has a dynamic compensatory mechanism for haemodynamic stress. However, the molecular details of how mechanical forces are transduced in the heart are unclear. Here we show that the transient receptor potential, vanilloid family type 2 (TRPV2) cation channel is critical for the maintenance of cardiac structure and function. Within 4 days of eliminating TRPV2 from hearts of the adult mice, cardiac function declines severely, with disorganization of the intercalated discs that support mechanical coupling with neighbouring myocytes and myocardial conduction defects. After 9 days, cell shortening and Ca(2+) handling by single myocytes are impaired in TRPV2-deficient hearts. TRPV2-deficient neonatal cardiomyocytes form no intercalated discs and show no extracellular Ca(2+)-dependent intracellular Ca(2+) increase and insulin-like growth factor (IGF-1) secretion in response to stretch stimulation. We further demonstrate that IGF-1 receptor/PI3K/Akt pathway signalling is significantly downregulated in TRPV2-deficient hearts, and that IGF-1 administration partially prevents chamber dilation and impairment in cardiac pump function in these hearts. Our results improve our understanding of the molecular processes underlying the maintenance of cardiac structure and function.
He, Yongning; Bjorkman, Pamela J.
2011-01-01
Fc receptors transport maternal antibodies across epithelial cell barriers to passively immunize newborns. FcRY, the functional counterpart of mammalian FcRn (a major histocompatibility complex homolog), transfers IgY across the avian yolk sac, and represents a new class of Fc receptor related to the mammalian mannose receptor family. FcRY and FcRn bind immunoglobulins at pH ≤6.5, but not pH ≥7, allowing receptor–ligand association inside intracellular vesicles and release at the pH of blood. We obtained structures of monomeric and dimeric FcRY and an FcRY–IgY complex and explored FcRY's pH-dependent binding mechanism using electron cryomicroscopy (cryoEM) and small-angle X-ray scattering. The cryoEM structure of FcRY at pH 6 revealed a compact double-ring “head,” in which the N-terminal cysteine-rich and fibronectin II domains were folded back to contact C-type lectin-like domains 1–6, and a “tail” comprising C-type lectin-like domains 7–8. Conformational changes at pH 8 created a more elongated structure that cannot bind IgY. CryoEM reconstruction of FcRY dimers at pH 6 and small-angle X-ray scattering analysis at both pH values confirmed both structures. The cryoEM structure of the FcRY–IgY revealed symmetric binding of two FcRY heads to the dimeric FcY, each head contacting the CH4 domain of one FcY chain. FcRY shares structural properties with mannose receptor family members, including a head and tail domain organization, multimerization that may regulate ligand binding, and pH-dependent conformational changes. Our results facilitate understanding of immune recognition by the structurally related mannose receptor family and comparison of diverse methods of Ig transport across evolution. PMID:21746914
Structure and Dynamics of the Liver Receptor Homolog 1-PGC1α Complex.
Mays, Suzanne G; Okafor, C Denise; Tuntland, Micheal L; Whitby, Richard J; Dharmarajan, Venkatasubramanian; Stec, Józef; Griffin, Patrick R; Ortlund, Eric A
2017-07-01
Peroxisome proliferator-activated gamma coactivator 1- α (PGC1 α ) regulates energy metabolism by directly interacting with transcription factors to modulate gene expression. Among the PGC1 α binding partners is liver receptor homolog 1 (LRH-1; NR5A2), an orphan nuclear hormone receptor that controls lipid and glucose homeostasis. Although PGC1 α is known to bind and activate LRH-1, mechanisms through which PGC1 α changes LRH-1 conformation to drive transcription are unknown. Here, we used biochemical and structural methods to interrogate the LRH-1-PGC1 α complex. Purified, full-length LRH-1, as well as isolated ligand binding domain, bound to PGC1 α with higher affinity than to the coactivator, nuclear receptor coactivator-2 (Tif2), in coregulator peptide recruitment assays. We present the first crystal structure of the LRH-1-PGC1 α complex, which depicts several hydrophobic contacts and a strong charge clamp at the interface between these partners. In molecular dynamics simulations, PGC1 α induced correlated atomic motion throughout the entire LRH-1 activation function surface, which was dependent on charge-clamp formation. In contrast, Tif2 induced weaker signaling at the activation function surface than PGC1 α but promoted allosteric signaling from the helix 6/ β -sheet region of LRH-1 to the activation function surface. These studies are the first to probe mechanisms underlying the LRH-1-PGC1 α interaction and may illuminate strategies for selective therapeutic targeting of PGC1 α -dependent LRH-1 signaling pathways. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Albin, Stephanie D; Davis, Graeme W
2004-08-04
Here, we show that postsynaptic p21-activated kinase (Pak) signaling diverges into two genetically separable pathways at the Drosophila neuromuscular junction. One pathway controls glutamate receptor abundance. Pak signaling within this pathway is specified by a required interaction with the adaptor protein Dreadlocks (Dock). We demonstrate that Dock is localized to the synapse via an Src homology 2-mediated protein interaction. Dock is not necessary for Pak localization but is necessary to restrict Pak signaling to control glutamate receptor abundance. A second genetically separable function of Pak kinase signaling controls muscle membrane specialization through the regulation of synaptic Discs-large. In this pathway, Dock is dispensable. We present a model in which divergent Pak signaling is able to coordinate two different features of postsynaptic maturation, receptor abundance, and muscle membrane specialization.
Asatryan, Liana; Yardley, Megan M.; Khoja, Sheraz; Trudell, James R.; Hyunh, Nhat; Louie, Stan G.; Petasis, Nicos A.; Alkana, Ronald L.; Davies, Daryl L.
2014-01-01
Our laboratory is investigating ivermectin (IVM) and other members of the avermectin family as new pharmaco-therapeutics to prevent and/or treat alcohol use disorders (AUDs). Prior work found that IVM significantly reduced ethanol intake in mice and that this effect likely reflects IVM’s ability to modulate ligand-gated ion channels. We hypothesized that structural modifications that enhance IVM’s effects on key receptors and/or increase its brain concentration should improve its anti-alcohol efficacy. We tested this hypothesis by comparing the abilities of IVM and two other avermectins, abamectin (ABM) and selamectin (SEL), to reduce ethanol intake in mice, to alter modulation of GABA ARs and P2X4Rs expressed in Xenopus oocytes and to increase their ability to penetrate the brain. IVM and ABM significantly reduced ethanol intake and antagonized the inhibitory effects of ethanol on P2X4R function. In contrast, SEL did not affect either measure, despite achieving higher brain concentrations than IVM and ABM. All three potentiated GABAA receptor function. These findings suggest that chemical structure and effects on receptor function play key roles in the ability of avermectins to reduce ethanol intake and that these factors are more important than brain penetration alone. The direct relationship between the effect of these avermectins on P2X4R function and ethanol intake suggest that the ability to antagonize ethanol-mediated inhibition of P2X4R function may be a good predictor of the potential of an avermectin to reduce ethanol intake and support the use of avermectins as a platform for developing novel drugs to prevent and/or treat AUDs. PMID:24451653
Todorovic, Aleksandar; Ericson, Mark D; Palusak, Ryan D; Sorensen, Nicholas B; Wood, Michael S; Xiang, Zhimin; Haskell-Luevano, Carrie
2016-07-20
The melanocortin system has been implicated in the regulation of various physiological functions including melanogenesis, steroidogenesis, energy homeostasis, and feeding behavior. Five melanocortin receptors have been identified to date and belong to the family of G protein-coupled receptors (GPCR). Post-translational modification of the proopiomelanocortin (POMC) prohormone leads to the biosynthesis of the endogenous melanocortin agonists, including α-melanocyte stimulating hormone (α-MSH), β-MSH, γ-MSH, and adrenocorticotropic hormone (ACTH). All the melanocortin agonists derived from the POMC prohormone contain a His-Phe-Arg-Trp tetrapeptide sequence that has been implicated in eliciting the pharmacological responses at the melanocortin receptors. Herein, an alanine (Ala) positional scan is reported for the endogenous α-MSH ligand and the synthetic, more potent, NDP-MSH peptide (Ac-Ser(1)-Tyr(2)-Ser(3)-Nle(4)-Glu(5)-His(6)-DPhe(7)-Arg(8)-Trp(9)-Gly(10)-Lys(11)-Pro(12)-Val(13)-NH2) at the cloned mouse melanocortin receptors to test the assumption that the structure-activity relationships of one ligand would apply to the other. Several residues outside of the postulated pharmacophore altered potency at the melanocortin receptors, most notably the 1560-, 37-, and 15-fold potency loss when the Glu(5) position of α-MSH was substituted with Ala at the mMC1R, mMC3R, and mMC4R, respectively. Importantly, the altered potencies due to Ala substitutions in α-MSH did not necessarily correlate with equivalent Ala substitutions in NDP-MSH, indicating that structural modifications and corresponding biological activities in one of these melanocortin ligands may not be predictive for the other agonist.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Lianying; College of Life Science, Dezhou University, Dezhou 253023; Ren, Xiao-Min
2014-09-15
Perfluorinated compounds (PFCs) have been shown to disrupt lipid metabolism and even induce cancer in rodents through activation of peroxisome proliferator-activated receptors (PPARs). Lines of evidence showed that PPARα was activated by PFCs. However, the information on the binding interactions between PPARγ and PFCs and subsequent alteration of PPARγ activity is still limited and sometimes inconsistent. In the present study, in vitro binding of 16 PFCs to human PPARγ ligand binding domain (hPPARγ-LBD) and their activity on the receptor in cells were investigated. The results showed that the binding affinity was strongly dependent on their carbon number and functional group.more » For the eleven perfluorinated carboxylic acids (PFCAs), the binding affinity increased with their carbon number from 4 to 11, and then decreased slightly. The binding affinity of the three perfluorinated sulfonic acids (PFSAs) was stronger than their PFCA counterparts. No binding was detected for the two fluorotelomer alcohols (FTOHs). Circular dichroim spectroscopy showed that PFC binding induced distinctive structural change of the receptor. In dual luciferase reporter assays using transiently transfected Hep G2 cells, PFCs acted as hPPARγ agonists, and their potency correlated with their binding affinity with hPPARγ-LBD. Molecular docking showed that PFCs with different chain length bind with the receptor in different geometry, which may contribute to their differences in binding affinity and transcriptional activity. - Highlights: • Binding affinity between PFCs and PPARγ was evaluated for the first time. • The binding strength was dependent on fluorinated carbon chain and functional group. • PFC binding induced distinctive structural change of the receptor. • PFCs could act as hPPARγ agonists in Hep G2 cells.« less
Sigma receptors: biology and therapeutic potential.
Guitart, Xavier; Codony, Xavier; Monroy, Xavier
2004-07-01
More than 20 years after the identification of the sigma receptors as a unique binding site in the brain and in the peripheral organs, several questions regarding this receptor are still open. Only one of the subtypes of the receptor has been cloned to date, but the endogenous ligand still remains unknown, and the possible association of the receptor with a conventional second messenger system is controversial. From the very beginning, the sigma receptors were associated with various central nervous system disorders such as schizophrenia or movement disorders. Today, after hundreds of papers dealing with the importance of sigma receptors in brain function, it is widely accepted that sigma receptors represent a new and different avenue in the possible pharmacological treatment of several brain-related disorders. In this review, what is known about the biology of the sigma receptor regarding its putative structure and its distribution in the central nervous system is summarized first. The role of sigma receptors regulating cellular functions and other neurotransmitter systems is also addressed, as well as a short overview of the possible endogenous ligands. Finally, although no specific sigma ligand has reached the market, different pharmacological approaches to the alleviation and treatment of several central nervous system disorders and deficits, including schizophrenia, pain, memory deficits, etc., are discussed, with an overview of different compounds and their potential therapeutic use.
EGFR oligomerization organizes kinase-active dimers into competent signalling platforms
Needham, Sarah R.; Roberts, Selene K.; Arkhipov, Anton; Mysore, Venkatesh P.; Tynan, Christopher J.; Zanetti-Domingues, Laura C.; Kim, Eric T.; Losasso, Valeria; Korovesis, Dimitrios; Hirsch, Michael; Rolfe, Daniel J.; Clarke, David T.; Winn, Martyn D.; Lajevardipour, Alireza; Clayton, Andrew H. A.; Pike, Linda J.; Perani, Michela; Parker, Peter J.; Shan, Yibing; Shaw, David E.; Martin-Fernandez, Marisa L.
2016-01-01
Epidermal growth factor receptor (EGFR) signalling is activated by ligand-induced receptor dimerization. Notably, ligand binding also induces EGFR oligomerization, but the structures and functions of the oligomers are poorly understood. Here, we use fluorophore localization imaging with photobleaching to probe the structure of EGFR oligomers. We find that at physiological epidermal growth factor (EGF) concentrations, EGFR assembles into oligomers, as indicated by pairwise distances of receptor-bound fluorophore-conjugated EGF ligands. The pairwise ligand distances correspond well with the predictions of our structural model of the oligomers constructed from molecular dynamics simulations. The model suggests that oligomerization is mediated extracellularly by unoccupied ligand-binding sites and that oligomerization organizes kinase-active dimers in ways optimal for auto-phosphorylation in trans between neighbouring dimers. We argue that ligand-induced oligomerization is essential to the regulation of EGFR signalling. PMID:27796308
Chen, Derek E; Willick, Darryl L; Ruckel, Joseph B; Floriano, Wely B
2015-01-01
Directed evolution is a technique that enables the identification of mutants of a particular protein that carry a desired property by successive rounds of random mutagenesis, screening, and selection. This technique has many applications, including the development of G protein-coupled receptor-based biosensors and designer drugs for personalized medicine. Although effective, directed evolution is not without challenges and can greatly benefit from the development of computational techniques to predict the functional outcome of single-point amino acid substitutions. In this article, we describe a molecular dynamics-based approach to predict the effects of single amino acid substitutions on agonist binding (salicin) to a human bitter taste receptor (hT2R16). An experimentally determined functional map of single-point amino acid substitutions was used to validate the whole-protein molecular dynamics-based predictive functions. Molecular docking was used to construct a wild-type agonist-receptor complex, providing a starting structure for single-point substitution simulations. The effects of each single amino acid substitution in the functional response of the receptor to its agonist were estimated using three binding energy schemes with increasing inclusion of solvation effects. We show that molecular docking combined with molecular mechanics simulations of single-point mutants of the agonist-receptor complex accurately predicts the functional outcome of single amino acid substitutions in a human bitter taste receptor.
Ligand-based receptor tyrosine kinase partial agonists: New paradigm for cancer drug discovery?
Riese, David J
2011-02-01
INTRODUCTION: Receptor tyrosine kinases (RTKs) are validated targets for oncology drug discovery and several RTK antagonists have been approved for the treatment of human malignancies. Nonetheless, the discovery and development of RTK antagonists has lagged behind the discovery and development of agents that target G-protein coupled receptors. In part, this is because it has been difficult to discover analogs of naturally-occurring RTK agonists that function as antagonists. AREAS COVERED: Here we describe ligands of ErbB receptors that function as partial agonists for these receptors, thereby enabling these ligands to antagonize the activity of full agonists for these receptors. We provide insights into the mechanisms by which these ligands function as antagonists. We discuss how information concerning these mechanisms can be translated into screens for novel small molecule- and antibody-based antagonists of ErbB receptors and how such antagonists hold great potential as targeted cancer chemotherapeutics. EXPERT OPINION: While there have been a number of important key findings into this field, the identification of the structural basis of ligand functional specificity is still of the greatest importance. While it is true that, with some notable exceptions, peptide hormones and growth factors have not proven to be good platforms for oncology drug discovery; addressing the fundamental issues of antagonistic partial agonists for receptor tyrosine kinases has the potential to steer oncology drug discovery in new directions. Mechanism based approaches are now emerging to enable the discovery of RTK partial agonists that may antagonize both agonist-dependent and -independent RTK signaling and may hold tremendous promise as targeted cancer chemotherapeutics.
Chan, Y H; Cheng, C H K; Chan, K M
2007-03-01
Using goldfish as a model, the structure-function relationship of goldfish growth hormone was studied using the strategy of homologous domain swapping. Chimeric mutants were constructed by exchanging homologous regions between goldfish growth hormone (gfGH II) and goldfish prolactin (gfPRL) with their cloned complementary DNAs. Six mutants, with their domain-swapped, were generated to have different combinations of three target regions, including the helix a, helix d and the large section in between these helices (possess the helices b, c and other random coiled regions). After expression in E. coli and refolding, these mutants were characterized by using competitive receptor binding assay (RRA) and growth hormone responding promoter activation assay. The different activity profiles of mutants in Spi 2.1 gene promoter assays from that in RRA shows that, for gfGH, receptor binding dose not confer receptor signal activations. When either helices a or d of gfGH was maintained with other helices replaced by their gfPRL counterparts, both receptor binding and hence gene activation activities are reduced. In mutants with helices b and c in gfGH maintained, containing the gfGH middle section, and helices a and d swapped with gfPRL, the had reduced RRA activities but the promoter activation activities retained. In conclusion, as in the case of human GH, the gfGH molecule possesses two functional sites: one of them is composed of discontinuous epitopes located on the target regions of this study and is for receptor binding; another site is located on the middle section of the molecule that helices a and d are not involved, and it is for activation of GH receptor and intracellular signals.
Atak, Sinem; Langlhofer, Georg; Schaefer, Natascha; Kessler, Denise; Meiselbach, Heike; Delto, Carolyn; Schindelin, Hermann; Villmann, Carmen
2015-01-01
Ligand-binding of Cys-loop receptors is determined by N-terminal extracellular loop structures from the plus as well as from the minus side of two adjacent subunits in the pentameric receptor complex. An aromatic residue in loop B of the glycine receptor (GlyR) undergoes direct interaction with the incoming ligand via a cation-π interaction. Recently, we showed that mutated residues in loop B identified from human patients suffering from hyperekplexia disturb ligand-binding. Here, we exchanged the affected human residues by amino acids found in related members of the Cys-loop receptor family to determine the effects of side chain volume for ion channel properties. GlyR variants were characterized in vitro following transfection into cell lines in order to analyze protein expression, trafficking, degradation and ion channel function. GlyR α1 G160 mutations significantly decrease glycine potency arguing for a positional effect on neighboring aromatic residues and consequently glycine-binding within the ligand-binding pocket. Disturbed glycinergic inhibition due to T162 α1 mutations is an additive effect of affected biogenesis and structural changes within the ligand-binding site. Protein trafficking from the ER toward the ER-Golgi intermediate compartment, the secretory Golgi pathways and finally the cell surface is largely diminished, but still sufficient to deliver ion channels that are functional at least at high glycine concentrations. The majority of T162 mutant protein accumulates in the ER and is delivered to ER-associated proteasomal degradation. Hence, G160 is an important determinant during glycine binding. In contrast, T162 affects primarily receptor biogenesis whereas exchanges in functionality are secondary effects thereof. PMID:26733802
G Protein-Coupled Receptor Rhodopsin: A Prospectus
Filipek, Sławomir; Stenkamp, Ronald E.; Teller, David C.; Palczewski, Krzysztof
2006-01-01
Rhodopsin is a retinal photoreceptor protein of bipartite structure consisting of the transmembrane protein opsin and a light-sensitive chromophore 11-cis-retinal, linked to opsin via a protonated Schiff base. Studies on rhodopsin have unveiled many structural and functional features that are common to a large and pharmacologically important group of proteins from the G protein-coupled receptor (GPCR) superfamily, of which rhodopsin is the best-studied member. In this work, we focus on structural features of rhodopsin as revealed by many biochemical and structural investigations. In particular, the high-resolution structure of bovine rhodopsin provides a template for understanding how GPCRs work. We describe the sensitivity and complexity of rhodopsin that lead to its important role in vision. PMID:12471166
Understanding Cytokine and Growth Factor Receptor Activation Mechanisms
Atanasova, Mariya; Whitty, Adrian
2012-01-01
Our understanding of the detailed mechanism of action of cytokine and growth factor receptors – and particularly our quantitative understanding of the link between structure, mechanism and function – lags significantly behind our knowledge of comparable functional protein classes such as enzymes, G protein-coupled receptors, and ion channels. In particular, it remains controversial whether such receptors are activated by a mechanism of ligand-induced oligomerization, versus a mechanism in which the ligand binds to a pre-associated receptor dimer or oligomer that becomes activated through subsequent conformational rearrangement. A major limitation to progress has been the relative paucity of methods for performing quantitative mechanistic experiments on unmodified receptors expressed at endogenous levels on live cells. In this article we review the current state of knowledge on the activation mechanisms of cytokine and growth factor receptors, critically evaluate the evidence for and against the different proposed mechanisms, and highlight other key questions that remain unanswered. New approaches and techniques have led to rapid recent progress in this area, and the field is poised for major advances in the coming years, which promises to revolutionize our understanding of this large and biologically and medically important class of receptors. PMID:23046381
Dahlhoff, Maik; Schäfer, Matthias; Wolf, Eckhard; Schneider, Marlon R
2013-02-15
The epidermal growth factor receptor (EGFR) is a tyrosine kinase receptor with manifold functions during development, tissue homeostasis and disease. EGFR activation, the formation of homodimers or heterodimers (with the related ERBB2-4 receptors) and downstream signaling is initiated by the binding of a family of structurally related growth factors, the EGFR ligands. Genetic deletion experiments clarified the biological function of all family members except for the last characterized ligand, epigen. We employed gene targeting in mouse embryonic stem cells to generate mice lacking epigen expression. Loss of epigen did not affect mouse development, fertility, or organ physiology. Quantitative RT-PCR analysis revealed increased expression of betacellulin and EGF in a few organs of epigen-deficient mice, suggesting a functional compensation by these ligands. In conclusion, we completed the genetic analysis of EGFR ligands and show that epigen has non-essential functions or functions that can be compensated by other EGFR ligands during growth and tissue homeostasis. Copyright © 2012 Elsevier Inc. All rights reserved.
Noeske, Tobias; Trifanova, Dina; Kauss, Valerjans; Renner, Steffen; Parsons, Christopher G; Schneider, Gisbert; Weil, Tanja
2009-08-01
We report the identification of novel potent and selective metabotropic glutamate receptor 1 (mGluR1) antagonists by virtual screening and subsequent hit optimization. For ligand-based virtual screening, molecules were represented by a topological pharmacophore descriptor (CATS-2D) and clustered by a self-organizing map (SOM). The most promising compounds were tested in mGluR1 functional and binding assays. We identified a potent chemotype exhibiting selective antagonistic activity at mGluR1 (functional IC(50)=0.74+/-0.29 microM). Hit optimization yielded lead structure 16 with an affinity of K(i)=0.024+/-0.001 microM and greater than 1000-fold selectivity for mGluR1 versus mGluR5. Homology-based receptor modelling suggests a binding site compatible with previously reported mutation studies. Our study demonstrates the usefulness of ligand-based virtual screening for scaffold-hopping and rapid lead structure identification in early drug discovery projects.
[Production, specificity and structure of immunoglobulins].
Goujard, C; Delfraissy, J F
1991-03-21
Immunoglobulin is a key factor of the immune response resulting from B-cell activation and associated with T-cell stimulation. Because of its structure, this antibody has a dual function: it specifically recognizes the inducer antigen in the variable region and eliminates it by a constant portion which is responsible for effector properties. Surface immunoglobulin, therefore, is the B-cell antigen receptor; it differs from the T-cell receptor in that it recognizes the antigen unbound to the major istocompatibility complex; binding the antigen results in direct signal transduction first in the cytoplasm, then in the nucleus. This receptor can be secreted in the body: it is made up of circulating immunoglobulins. Human immunoglobulins are divided into 5 classes, each of them with its own response kinetics, distribution and functions. The variability of the antibody response accounts for a genetic organization involving numerous genes which may be associated with each other, or mutate, or recombine during maturation of the lymphocytes. Altogether, this system has a theoretical capacity of response to three hundred million different antigens.
RNA structure in splicing: An evolutionary perspective.
Lin, Chien-Ling; Taggart, Allison J; Fairbrother, William G
2016-09-01
Pre-mRNA splicing is a key post-transcriptional regulation process in which introns are excised and exons are ligated together. A novel class of structured intron was recently discovered in fish. Simple expansions of complementary AC and GT dimers at opposite boundaries of an intron were found to form a bridging structure, thereby enforcing correct splice site pairing across the intron. In some fish introns, the RNA structures are strong enough to bypass the need of regulatory protein factors for splicing. Here, we discuss the prevalence and potential functions of highly structured introns. In humans, structured introns usually arise through the co-occurrence of C and G-rich repeats at intron boundaries. We explore the potentially instructive example of the HLA receptor genes. In HLA pre-mRNA, structured introns flank the exons that encode the highly polymorphic β sheet cleft, making the processing of the transcript robust to variants that disrupt splicing factor binding. While selective forces that have shaped HLA receptor are fairly atypical, numerous other highly polymorphic genes that encode receptors contain structured introns. Finally, we discuss how the elevated mutation rate associated with the simple repeats that often compose structured intron can make structured introns themselves rapidly evolving elements.
Regulation of AMPA receptors by phosphorylation.
Carvalho, A L; Duarte, C B; Carvalho, A P
2000-10-01
The AMPA receptors for glutamate are oligomeric structures that mediate fast excitatory responses in the central nervous system. Phosphorylation of AMPA receptors is an important mechanism for short-term modulation of their function, and is thought to play an important role in synaptic plasticity in different brain regions. Recent studies have shown that phosphorylation of AMPA receptors by cAMP-dependent protein kinase (PKA) and Ca2+- and calmodulin-dependent protein kinase II (CaMKII) potentiates their activity, but phosphorylation of the receptor subunits may also affect their interaction with intracellular proteins, and their expression at the plasma membrane. Phosphorylation of AMPA receptor subunits has also been investigated in relation to processes of synaptic plasticity. This review focuses on recent advances in understanding the molecular mechanisms of regulation of AMPA receptors, and their implications in synaptic plasticity.
Albensi, Benedict C
2007-01-01
A recent search on PubMed for the phrase NMDA receptor results in 2,190 hits on this topic for review articles and 20,100 hits for experimental papers. This is a direct reflection of the intensiveness, significance, and complexity associated with the research on this key receptor protein over the last several decades. In this review, we briefly describe the NMDA receptor structure, discuss the role of NMDA receptors in modulating synaptic plasticity and excitotoxicity, explore age-dependent changes in NMDA receptor functioning, and survey interesting NMDA receptor blockers. Given the huge existing literature on the subject, an exhaustive review has not been endeavored. Instead, an attempt was made to point out those studies that have been instrumental in the field or that are of special interest.
D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W
1995-09-01
Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.
Insulin receptor substrate signaling controls cardiac energy metabolism and heart failure.
Guo, Cathy A; Guo, Shaodong
2017-06-01
The heart is an insulin-dependent and energy-consuming organ in which insulin and nutritional signaling integrates to the regulation of cardiac metabolism, growth and survival. Heart failure is highly associated with insulin resistance, and heart failure patients suffer from the cardiac energy deficiency and structural and functional dysfunction. Chronic pathological conditions, such as obesity and type 2 diabetes mellitus, involve various mechanisms in promoting heart failure by remodeling metabolic pathways, modulating cardiac energetics and impairing cardiac contractility. Recent studies demonstrated that insulin receptor substrates 1 and 2 (IRS-1,-2) are major mediators of both insulin and insulin-like growth factor-1 (IGF-1) signaling responsible for myocardial energetics, structure, function and organismal survival. Importantly, the insulin receptor substrates (IRS) play an important role in the activation of the phosphatidylinositide-3-dependent kinase (PI-3K) that controls Akt and Foxo1 signaling cascade, regulating the mitochondrial function, cardiac energy metabolism and the renin-angiotensin system. Dysregulation of this branch in signaling cascades by insulin resistance in the heart through the endocrine system promotes heart failure, providing a novel mechanism for diabetic cardiomyopathy. Therefore, targeting this branch of IRS→PI-3K→Foxo1 signaling cascade and associated pathways may provide a fundamental strategy for the therapeutic and nutritional development in control of metabolic and cardiovascular diseases. In this review, we focus on insulin signaling and resistance in the heart and the role energetics play in cardiac metabolism, structure and function. © 2017 Society for Endocrinology.
Mager, Peter P; Weber, Anje; Illes, Peter
2004-01-01
No details on P2X receptor architecture had been known at the atomic resolution level. Using comparative homology-based molecular modelling and threading, it was attempted to predict the three-dimensional structure of P2X receptors. This prediction could not be carried out, however, because important properties of the P2X family differ considerably from that of the potential template proteins. This paper reviews an alternative approach consisting of three research fields: bioinformatics, structural modelling, and a variety of the results of biological experiments. Starting point is the amino acid sequence. Using the sequential data, the first step is a secondary structure prediction. The resulting secondary structure is converted into a three-dimensional geometry. Then, the secondary and tertiary structures are optimized by using the quantum chemistry RHF/3-21G minimal basic set and the all-atom molecular mechanics AMBER96 force field. The fold of the membrane-embedded protein is simulated by a suitable dielectricum. The structure is refined using a conjugate gradient minimizer (Fletcher-Reeves modification of the Polak-Ribiere method). The results of the geometry optimization were checked by a Ramanchandran plot, rotamer analysis, all-atom contact dots, and the C(beta) deviation. As additional tools for the model building, multiple alignment analysis and comparative sequence-function analysis were used. The approach is exemplified on the membrane-embedded, ligand-gated P2X3 receptor subunit, a monovalent-bivalent cation channel-forming glycoprotein that is activated by extracellular adenosine 5'-triphosphate. From these results, a topology of the pore-forming motif of the P2X3 receptor subunit was proposed. It is believed that a fully functional P2X channel requires a precise coupling between (i) two distinct peptide modules, an extracellularly occurring ATP-binding module and a pore module that includes a long transmembrane and short intracellular part, (ii) an interaction surface with membranes, and (iii) hydrogen bonding forces of the residues and hydrated cations. Furthermore, this paper demonstrates the role of quantitative structure-activity relationships (QSARs) in P2X research (calcium ion permeability of the wild-type and after site-directed mutagenesis of the rat P2X2 receptor protein, KN-62 analogs as competitive antagonists of the human P2X7 receptor). EXPERIMENTAL PROOFS: The predictions are experimentally testable and may provide an additional interpretation of experimental observations published in literature. In particular, there is the good agreement of the geometry optimized P2X3 structure with experimentally proposed P2X receptor models obtained by neurophysiological, biochemical, pharmacological, and mutation experiments. Although the rat P2X3 receptor subunit is more complex (397 amino acids) than the KcsA protein (160 amino acids), the overall folds of the peptide backbone atoms are similar. To avoid semantic confusion, it should be noted that "prediction" is defined in a probabilistic sense. Matches to generic rules do not mean "this is true" but rather "this might be true". Only biological and chemical knowledge can determine whether or not these predictions are meaningful. Thus, the results from the computational tools are probabilistic predictions and subject to further experimental verification. The geometry optimized P2X3 receptor subunit is freely available for academic researchers on e-mail request (PDB format).
Phytoestrogens and Mycoestrogens Induce Signature Structure Dynamics Changes on Estrogen Receptor α
Chen, Xueyan; Uzuner, Ugur; Li, Man; Shi, Weibing; Yuan, Joshua S.; Dai, Susie Y.
2016-01-01
Endocrine disrupters include a broad spectrum of chemicals such as industrial chemicals, natural estrogens and androgens, synthetic estrogens and androgens. Phytoestrogens are widely present in diet and food supplements; mycoestrogens are frequently found in grains. As human beings and animals are commonly exposed to phytoestrogens and mycoestrogens in diet and environment, it is important to understand the potential beneficial or hazardous effects of estrogenic compounds. Many bioassays have been established to study the binding of estrogenic compounds with estrogen receptor (ER) and provided rich data in the literature. However, limited assays can offer structure information with regard to the ligand/ER complex. Our current study surveys the global structure dynamics changes for ERα ligand binding domain (LBD) when phytoestrogens and mycoestrogens bind. The assay is based on the structure dynamics information probed by hydrogen deuterium exchange mass spectrometry and offers a unique viewpoint to elucidate the mechanism how phytoestrogens and mycoestrogens interact with estrogen receptor. The cluster analysis based on the hydrogen deuterium exchange (HDX) assay data reveals a unique pattern when phytoestrogens and mycoestrogens bind with ERα LBD compared to that of estradiol and synthetic estrogen modulators. Our study highlights that structure dynamics could play an important role in the structure function relationship when endocrine disrupters interact with estrogen receptors. PMID:27589781
Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia
Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.
2013-01-01
BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein structures, and assessment on the basis of in vitro expression showed that familial hypocalciuric hypercalcemia type 2–associated mutations decreased the sensitivity of cells expressing calcium-sensing receptors to changes in extracellular calcium concentrations, whereas autosomal dominant hypocalcemia type 2–associated mutations increased cell sensitivity. CONCLUSIONS Gα11 mutants with loss of function cause familial hypocalciuric hypercalcemia type 2, and Gα11 mutants with gain of function cause a clinical disorder designated as autosomal dominant hypocalcemia type 2. (Funded by the United Kingdom Medical Research Council and others.) PMID:23802516
Characterization of Three Venom Peptides from the Spitting Spider Scytodes thoracica
Ariki, Nathanial K.; Muñoz, Lisa E.; Armitage, Elizabeth L.; Goodstein, Francesca R.; George, Kathryn G.; Smith, Vanessa L.; Vetter, Irina; Herzig, Volker; King, Glenn F.; Loening, Nikolaus M.
2016-01-01
We present the solution-state NMR structures and preliminary functional characterizations of three venom peptides identified from the spitting spider Scytodes thoracica. Despite little sequence identity to other venom peptides, structural characterization reveals that these peptides contain an inhibitor cystine knot motif common to many venom peptides. These are the first structures for any peptide or protein from spiders of the Scytodidae family. Many venom peptides target neuronal ion channels or receptors. However, we have not been able to determine the target of these Scytodes peptides so we can only state with certainty the channels and receptors that they do not target. PMID:27227898
The β-Arrestins: Multifunctional Regulators of G Protein-coupled Receptors*
Smith, Jeffrey S.; Rajagopal, Sudarshan
2016-01-01
The β-arrestins (βarrs) are versatile, multifunctional adapter proteins that are best known for their ability to desensitize G protein-coupled receptors (GPCRs), but also regulate a diverse array of cellular functions. To signal in such a complex fashion, βarrs adopt multiple conformations and are regulated at multiple levels to differentially activate downstream pathways. Recent structural studies have demonstrated that βarrs have a conserved structure and activation mechanism, with plasticity of their structural fold, allowing them to adopt a wide array of conformations. Novel roles for βarrs continue to be identified, demonstrating the importance of these dynamic regulators of cellular signaling. PMID:26984408
Tissue Architecture and Microenvironment Sustain Hormone Signaling | Center for Cancer Research
Cells interact with their environments in part through protein receptors embedded in the cell membrane. Activation of a receptor by external signaling molecules sets off a complex chain of events within the cell that can result in alterations in protein structure and function and/or changes in gene expression. Proper integration of these signals is crucial for normal cell
Deeper Insights into the Allosteric Modulation of Ionotropic Glutamate Receptors.
Regan, Michael C; Furukawa, Hiro
2016-09-21
Two articles in this issue of Neuron (Yelshanskaya et al., 2016; Yi et al., 2016) explore the structural basis of allosteric inhibition in ionotropic glutamate receptors, providing key insights into how iGluRs function in the brain as well as how they might be pharmacologically modulated in neurological disorders and disease. Copyright © 2016. Published by Elsevier Inc.
Primitive ATP-activated P2X receptors: discovery, function and pharmacology
Fountain, Samuel J.
2013-01-01
Adenosine 5-triphosphate (ATP) is omnipresent in biology. It is therefore no surprise that organisms have evolved multifaceted roles for ATP, exploiting its abundance and restriction of passive diffusion across biological membranes. A striking role is the emergence of ATP as a bona fide transmitter molecule, whereby the movement of ATP across membranes serves as a chemical message through a direct ligand-receptor interaction. P2X receptors are ligand-gated ion channels that mediate fast responses to the transmitter ATP in mammalian cells including central and sensory neurons, vascular smooth muscle, endothelium, and leukocytes. Molecular cloning of P2X receptors and our understanding of structure-function relationships has provided sequence information with which to query an exponentially expanding wealth of genome sequence information including protist, early animal and human pathogen genomes. P2X receptors have now been cloned and characterized from a number of simple organisms. Such work has led to surprising new cellular roles for the P2X receptors family and an unusual phylogeny, with organisms such as Drosophila and C. elegans notably lacking P2X receptors despite retaining ionotropic receptors for other common transmitters that are present in mammals. This review will summarize current work on the evolutionary biology of P2X receptors and ATP as a signaling molecule, discuss what can be drawn from such studies when considering the action of ATP in higher animals and plants, and outline how simple organisms may be exploited experimentally to inform P2X receptor function in a wider context. PMID:24367292
Marino, Kristen A.; Prada-Gracia, Diego; Provasi, Davide; Filizola, Marta
2016-01-01
The lipid composition of cell membranes has increasingly been recognized as playing an important role in the function of various membrane proteins, including G Protein-Coupled Receptors (GPCRs). For instance, experimental and computational evidence has pointed to lipids influencing receptor oligomerization directly, by physically interacting with the receptor, and/or indirectly, by altering the bulk properties of the membrane. While the exact role of oligomerization in the function of class A GPCRs such as the μ-opioid receptor (MOR) is still unclear, insight as to how these receptors oligomerize and the relevance of the lipid environment to this phenomenon is crucial to our understanding of receptor function. To examine the effect of lipids and different MOR conformations on receptor oligomerization we carried out extensive coarse-grained molecular dynamics simulations of crystal structures of inactive and/or activated MOR embedded in an idealized mammalian plasma membrane composed of 63 lipid types asymmetrically distributed across the two leaflets. The results of these simulations point, for the first time, to specific direct and indirect effects of the lipids, as well as the receptor conformation, on the spatio-temporal organization of MOR in the plasma membrane. While sphingomyelin-rich, high-order lipid regions near certain transmembrane (TM) helices of MOR induce an effective long-range attractive force on individual protomers, both long-range lipid order and interface formation are found to be conformation dependent, with a larger number of different interfaces formed by inactive MOR compared to active MOR. PMID:27959924
Engelke, Michael; Friedrich, Olaf; Budde, Petra; Schäfer, Christina; Niemann, Ursula; Zitt, Christof; Jüngling, Eberhard; Rocks, Oliver; Lückhoff, Andreas; Frey, Jürgen
2002-07-17
Transient receptor potential proteins (TRP) are supposed to participate in the formation of store-operated Ca(2+) influx channels by co-assembly. However, little is known which domains facilitate the interaction of subunits. Contribution of the N-terminal coiled-coil domain and ankyrin-like repeats and the putative pore region of the mouse TRP1beta (mTRP1beta) variant to the formation of functional cation channels were analyzed following overexpression in HEK293 (human embryonic kidney) cells. MTRP1beta expressing cells exhibited enhanced Ca(2+) influx and enhanced whole-cell membrane currents compared to mTRP1beta deletion mutants. Using a yeast two-hybrid assay only the coiled-coil domain facilitated homodimerization of the N-terminus. These results suggest that the N-terminus of mTRP1beta is required for structural organization thus forming functional channels.
Neuhaus, J; Heinrich, M; Schlichting, N; Oberbach, A; Fitzl, G; Schwalenberg, T; Horn, L-C; Stolzenburg, J-U
2007-09-01
Myofibroblasts play a pivotal role in numerous pathological alterations. Clarification of the structure and function and of the cellular plasticity of this cell type in the bladder may lead to new insights into the pathogenesis of lower urinary tract disorders. Bladder biopsies from patients with bladder carcinoma and interstitial cystitis were used to analyse the morphology and receptor expression using confocal immunofluorescence and electron microscopy. Cytokine effects and coupling behavior were tested in cultured myofibroblasts and detrusor smooth muscle cells. Myofibroblasts are in close contact with the suburothelial capillary network. They express Cx43 and form functional syncytia. The expression of muscarinic and purinergic receptors is highly variable. Dye coupling experiments showed differences to detrusor myocytes. Upregulation of smooth muscle cell alpha-actin and/or transdifferentiation into smooth muscle cells may contribute to the etiology of urge incontinence. A multi-step model is presented as a working hypothesis.
Structure and Function of the Intracellular Region of the Plexin-B1 Transmembrane Receptor*
Tong, Yufeng; Hota, Prasanta K.; Penachioni, Junia Y.; Hamaneh, Mehdi B.; Kim, SoonJeung; Alviani, Rebecca S.; Shen, Limin; He, Hao; Tempel, Wolfram; Tamagnone, Luca; Park, Hee-Won; Buck, Matthias
2009-01-01
Members of the plexin family are unique transmembrane receptors in that they interact directly with Rho family small GTPases; moreover, they contain a GTPase-activating protein (GAP) domain for R-Ras, which is crucial for plexin-mediated regulation of cell motility. However, the functional role and structural basis of the interactions between the different intracellular domains of plexins remained unclear. Here we present the 2.4 Å crystal structure of the complete intracellular region of human plexin-B1. The structure is monomeric and reveals that the GAP domain is folded into one structure from two segments, separated by the Rho GTPase binding domain (RBD). The RBD is not dimerized, as observed previously. Instead, binding of a conserved loop region appears to compete with dimerization and anchors the RBD to the GAP domain. Cell-based assays on mutant proteins confirm the functional importance of this coupling loop. Molecular modeling based on structural homology to p120GAP·H-Ras suggests that Ras GTPases can bind to the plexin GAP region. Experimentally, we show that the monomeric intracellular plexin-B1 binds R-Ras but not H-Ras. These findings suggest that the monomeric form of the intracellular region is primed for GAP activity and extend a model for plexin activation. PMID:19843518
Richter, K; Mathes, V; Fronius, M; Althaus, M; Hecker, A; Krasteva-Christ, G; Padberg, W; Hone, A J; McIntosh, J M; Zakrzewicz, A; Grau, V
2016-06-28
We demonstrated previously that phosphocholine and phosphocholine-modified macromolecules efficiently inhibit ATP-dependent release of interleukin-1β from human and murine monocytes by a mechanism involving nicotinic acetylcholine receptors (nAChR). Interleukin-1β is a potent pro-inflammatory cytokine of innate immunity that plays pivotal roles in host defence. Control of interleukin-1β release is vital as excessively high systemic levels cause life threatening inflammatory diseases. In spite of its structural similarity to acetylcholine, there are no other reports on interactions of phosphocholine with nAChR. In this study, we demonstrate that phosphocholine inhibits ion-channel function of ATP receptor P2X7 in monocytic cells via nAChR containing α9 and α10 subunits. In stark contrast to choline, phosphocholine does not evoke ion current responses in Xenopus laevis oocytes, which heterologously express functional homomeric nAChR composed of α9 subunits or heteromeric receptors containing α9 and α10 subunits. Preincubation of these oocytes with phosphocholine, however, attenuated choline-induced ion current changes, suggesting that phosphocholine may act as a silent agonist. We conclude that phophocholine activates immuno-modulatory nAChR expressed by monocytes but does not stimulate canonical ionotropic receptor functions.
Bruna-Larenas, Tamara; Gómez-Jeria, Juan S
2012-01-01
We report the results of a search for model-based relationships between mu, delta, and kappa opioid receptor binding affinity and molecular structure for a group of molecules having in common a morphine structural core. The wave functions and local reactivity indices were obtained at the ZINDO/1 and B3LYP/6-31G(∗∗) levels of theory for comparison. New developments in the expression for the drug-receptor interaction energy expression allowed several local atomic reactivity indices to be included, such as local electronic chemical potential, local hardness, and local electrophilicity. These indices, together with a new proposal for the ordering of the independent variables, were incorporated in the statistical study. We found and discussed several statistically significant relationships for mu, delta, and kappa opioid receptor binding affinity at both levels of theory. Some of the new local reactivity indices incorporated in the theory appear in several equations for the first time in the history of model-based equations. Interaction pharmacophores were generated for mu, delta, and kappa receptors. We discuss possible differences regulating binding and selectivity in opioid receptor subtypes. This study, contrarily to the statistically backed ones, is able to provide a microscopic insight of the mechanisms involved in the binding process.
The structural basis of arrestin-mediated regulation of G-protein-coupled receptors
Gurevich, Vsevolod V.; Gurevich, Eugenia V.
2008-01-01
The 4 mammalian arrestins serve as almost universal regulators of the largest known family of signaling proteins, G-protein-coupled receptors (GPCRs). Arrestins terminate receptor interactions with G proteins, redirect the signaling to a variety of alternative pathways, and orchestrate receptor internalization and subsequent intracellular trafficking. The elucidation of the structural basis and fine molecular mechanisms of the arrestin–receptor interaction paved the way to the targeted manipulation of this interaction from both sides to produce very stable or extremely transient complexes that helped to understand the regulation of many biologically important processes initiated by active GPCRs. The elucidation of the structural basis of arrestin interactions with numerous non-receptor-binding partners is long overdue. It will allow the construction of fully functional arrestins in which the ability to interact with individual partners is specifically disrupted or enhanced by targeted mutagenesis. These “custom-designed” arrestin mutants will be valuable tools in defining the role of various interactions in the intricate interplay of multiple signaling pathways in the living cell. The identification of arrestin-binding sites for various signaling molecules will also set the stage for designing molecular tools for therapeutic intervention that may prove useful in numerous disorders associated with congenital or acquired disregulation of GPCR signaling. PMID:16460808
Structural architecture of the human long non-coding RNA, steroid receptor RNA activator
Novikova, Irina V.; Hennelly, Scott P.; Sanbonmatsu, Karissa Y.
2012-01-01
While functional roles of several long non-coding RNAs (lncRNAs) have been determined, the molecular mechanisms are not well understood. Here, we report the first experimentally derived secondary structure of a human lncRNA, the steroid receptor RNA activator (SRA), 0.87 kB in size. The SRA RNA is a non-coding RNA that coactivates several human sex hormone receptors and is strongly associated with breast cancer. Coding isoforms of SRA are also expressed to produce proteins, making the SRA gene a unique bifunctional system. Our experimental findings (SHAPE, in-line, DMS and RNase V1 probing) reveal that this lncRNA has a complex structural organization, consisting of four domains, with a variety of secondary structure elements. We examine the coevolution of the SRA gene at the RNA structure and protein structure levels using comparative sequence analysis across vertebrates. Rapid evolutionary stabilization of RNA structure, combined with frame-disrupting mutations in conserved regions, suggests that evolutionary pressure preserves the RNA structural core rather than its translational product. We perform similar experiments on alternatively spliced SRA isoforms to assess their structural features. PMID:22362738
Investigation of pyrazolo-sulfonamides as putative small molecule oxytocin receptor agonists.
Katte, Timothy A; Reekie, Tristan A; Werry, Eryn L; Jorgensen, William T; Boyd, Rochelle; Wong, Erick C N; Gulliver, Damien W; Connor, Mark; Kassiou, Michael
2017-08-18
The neuropeptide oxytocin has been implicated in multiple central nervous system functions in mammalian species. Increased levels have been reported to improve trust, alleviate symptoms related to autism and social phobias, and reduce social anxiety. Hoffman-La Roche published a patent claiming to have found potent small molecule oxytocin receptor agonists, smaller than the first non-peptide oxytocin agonist reported, WAY 267,464. We selected two of the more potent compounds from the patent and, in addition, created WAY 267,464 hybrid structures and determined their oxytocin and vasopressin receptor activity. Human embryonic kidney and Chinese hamster ovary cells were used for the expression of oxytocin or vasopressin 1a receptors and activity assessed via IP1 accumulation assays and calcium FLIPR assays. The results concluded that the reported compounds in the patent and the hybrid structures have no activity at the oxytocin or vasopressin 1a receptors. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Mechanism of partial agonism in AMPA-type glutamate receptors
Salazar, Hector; Eibl, Clarissa; Chebli, Miriam; Plested, Andrew
2017-01-01
Neurotransmitters trigger synaptic currents by activating ligand-gated ion channel receptors. Whereas most neurotransmitters are efficacious agonists, molecules that activate receptors more weakly—partial agonists—also exist. Whether these partial agonists have weak activity because they stabilize less active forms, sustain active states for a lesser fraction of the time or both, remains an open question. Here we describe the crystal structure of an α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (AMPAR) ligand binding domain (LBD) tetramer in complex with the partial agonist 5-fluorowillardiine (FW). We validate this structure, and others of different geometry, using engineered intersubunit bridges. We establish an inverse relation between the efficacy of an agonist and its promiscuity to drive the LBD layer into different conformations. These results suggest that partial agonists of the AMPAR are weak activators of the receptor because they stabilize multiple non-conducting conformations, indicating that agonism is a function of both the space and time domains. PMID:28211453
Iacovelli, Federico; Tucci, Fabio Giovanni; Macari, Gabriele; Falconi, Mattia
2017-10-01
Multiple classical molecular dynamics simulations have been applied to the human LOX-1 receptor to clarify the role of the Trp150Ala mutation in the loss of binding activity. Results indicate that the substitution of this crucial residue, located at the dimer interface, markedly disrupts the wild-type receptor dynamics. The mutation causes an irreversible rearrangement of the subunits interaction pattern that in the wild-type protein allows the maintaining of a specific symmetrical motion of the monomers. The subunits dislocation determines a loss of linearity of the arginines residues composing the basic spine and a consequent alteration of the long-range electrostatic attraction of the substrate. Moreover, the anomalous subunits arrangement observed in the mutated receptor also affects the integrity of the hydrophobic tunnel, actively involved in the short-range hydrophobic recognition of the substrate. The combined effect of these structural rearrangements generates the impairing of the receptor function. © 2017 Wiley Periodicals, Inc.
Unal, Hamiyet; Kemp, Jacqueline R.; Tirupula, Kalyan C.; Eguchi, Satoru; Vanderheyden, Patrick M. L.; Thomas, Walter G.
2015-01-01
The renin angiotensin system (RAS) produced hormone peptides regulate many vital body functions. Dysfunctional signaling by receptors for RAS peptides leads to pathologic states. Nearly half of humanity today would likely benefit from modern drugs targeting these receptors. The receptors for RAS peptides consist of three G-protein–coupled receptors—the angiotensin II type 1 receptor (AT1 receptor), the angiotensin II type 2 receptor (AT2 receptor), the MAS receptor—and a type II trans-membrane zinc protein—the candidate angiotensin IV receptor (AngIV binding site). The prorenin receptor is a relatively new contender for consideration, but is not included here because the role of prorenin receptor as an independent endocrine mediator is presently unclear. The full spectrum of biologic characteristics of these receptors is still evolving, but there is evidence establishing unique roles of each receptor in cardiovascular, hemodynamic, neurologic, renal, and endothelial functions, as well as in cell proliferation, survival, matrix-cell interaction, and inflammation. Therapeutic agents targeted to these receptors are either in active use in clinical intervention of major common diseases or under evaluation for repurposing in many other disorders. Broad-spectrum influence these receptors produce in complex pathophysiological context in our body highlights their role as precise interpreters of distinctive angiotensinergic peptide cues. This review article summarizes findings published in the last 15 years on the structure, pharmacology, signaling, physiology, and disease states related to angiotensin receptors. We also discuss the challenges the pharmacologist presently faces in formally accepting newer members as established angiotensin receptors and emphasize necessary future developments. PMID:26315714
Minireview: More Than Just a Hammer: Ligand “Bias” and Pharmaceutical Discovery
2014-01-01
Conventional orthosteric drug development programs targeting G protein-coupled receptors (GPCRs) have focused on the concepts of agonism and antagonism, in which receptor structure determines the nature of the downstream signal and ligand efficacy determines its intensity. Over the past decade, the emerging paradigms of “pluridimensional efficacy” and “functional selectivity” have revealed that GPCR signaling is not monolithic, and that ligand structure can “bias” signal output by stabilizing active receptor states in different proportions than the native ligand. Biased ligands are novel pharmacologic entities that possess the unique ability to qualitatively change GPCR signaling, in effect creating “new receptors” with distinct efficacy profiles driven by ligand structure. The promise of biased agonism lies in this ability to engender “mixed” effects not attainable using conventional agonists or antagonists, promoting therapeutically beneficial signals while antagonizing deleterious ones. Indeed, arrestin pathway-selective agonists for the type 1 parathyroid hormone and angiotensin AT1 receptors, and G protein pathway-selective agonists for the GPR109A nicotinic acid and μ-opioid receptors, have demonstrated unique, and potentially therapeutic, efficacy in cell-based assays and preclinical animal models. Conversely, activating GPCRs in “unnatural” ways may lead to downstream biological consequences that cannot be predicted from prior knowledge of the actions of the native ligand, especially in the case of ligands that selectively activate as-yet poorly characterized G protein-independent signaling networks mediated via arrestins. Although much needs to be done to realize the clinical potential of functional selectivity, biased GPCR ligands nonetheless appear to be important new additions to the pharmacologic toolbox. PMID:24433041
DRD4 dopamine receptor genotype and CSF monoamine metabolites in Finnish alcoholics and controls
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adamson, M.D.; Dean, M.; Goldman, D.
1995-06-19
The DRD4 dopamine receptor is thus far unique among neurotransmitter receptors in having a highly polymorphic gene structure that has been reported to produce altered receptor functioning. These allelic variations are caused by a 48-bp segment in exon III of the coding region which may be repeated from 2-10 times. Varying the numbers of repeated segments changes the length, structure, and, possibly, the functional efficiency of the receptor, which makes this gene an intriguing candidate for variations in dopamine-related behaviors, such as alcoholism and drug abuse. Thus far, these DRD4 alleles have been investigated for association with schizophrenia, bipolar disorder,more » Parkinson`s disease, and chronic alcoholism, and all have been largely negative for a direct association. We evaluated the DRD4 genotype in 226 Finish adult males, 113 of whom were alcoholics, many of the early onset type with features of impulsivity and antisocial traits. Genotype frequencies were compared to 113 Finnish controls who were free of alcohol abuse, substance abuse, and major mental illness. In 70 alcoholics and 20 controls, we measured CSF homovanillic acid (HVA), the major metabolite of dopamine, and 5-hydroxyindoleacetic acid (5-HIAA). No association was found between a particular DRD4 dopamine receptor allele and alcoholism. CSF concentrations of the monoamine metabolites showed no significant difference among the DRD4 genotypes. This study of the DRD4 dopamine receptor in alcoholics is the first to be conducted in a clinically and ethnically homogeneous population and to relate the DRD4 genotype to CSF monoamine concentrations. The results indicate that there is no association of the DRD4 receptor with alcoholism. 52 refs., 3 figs., 1 tab.« less
Lotti, L V; Lanfrancone, L; Migliaccio, E; Zompetta, C; Pelicci, G; Salcini, A E; Falini, B; Pelicci, P G; Torrisi, M R
1996-01-01
The intracellular localization of Shc proteins was analyzed by immunofluorescence and immunoelectron microscopy in normal cells and cells expressing the epidermal growth factor receptor or the EGFR/erbB2 chimera. In unstimulated cells, the immunolabeling was localized in the central perinuclear area of the cell and mostly associated with the cytosolic side of rough endoplasmic reticulum membranes. Upon epidermal growth factor treatment and receptor tyrosine kinase activation, the immunolabeling became peripheral and was found to be associated with the cytosolic surface of the plasma membrane and endocytic structures, such as coated pits and endosomes, and with the peripheral cytosol. Receptor activation in cells expressing phosphorylation-defective mutants of Shc and erbB-2 kinase showed that receptor autophosphorylation, but not Shc phosphorylation, is required for redistribution of Shc proteins. The rough endoplasmic reticulum localization of Shc proteins in unstimulated cells and their massive recruitment to the plasma membrane, endocytic structures, and peripheral cytosol following receptor tyrosine kinase activation could account for multiple putative functions of the adaptor protein. PMID:8628261
Enhanced sampling of glutamate receptor ligand-binding domains.
Lau, Albert Y
2018-04-14
The majority of excitatory synaptic transmission in the central nervous system is mediated by ionotropic glutamate receptors (iGluRs). These membrane-bound protein assemblies consist of modular domains that can be genetically isolated and expressed, which has resulted in a plethora of crystal structures of individual domains in different conformations bound to different ligands. These structures have presented opportunities for molecular dynamics (MD) simulation studies. To examine the free energies that govern molecular behavior, simulation strategies and algorithms have been developed, collectively called enhanced sampling methods This review focuses on the use of enhanced sampling MD simulations of isolated iGluR ligand-binding domains to characterize thermodynamic properties important to receptor function. Copyright © 2018 Elsevier B.V. All rights reserved.
Neuregulin: First Steps Towards a Structure
NASA Technical Reports Server (NTRS)
Ferree, D. S.; Malone, C. C.; Karr, L. J.
2003-01-01
Neuregulins are growth factor domain proteins with diverse bioactivities, such as cell proliferation, receptor binding, and differentiation. Neureguh- 1 binds to two members of the ErbB class I tyrosine kinase receptors, ErbB3 and ErbB4. A number of human cancers overexpress the ErbB receptors, and neuregulin can modulate the growth of certain cancer types. Neuregulin-1 has been shown to promote the migration of invasive gliomas of the central nervous system. Neuregulin has also been implicated in schizophrenia, multiple sclerosis and abortive cardiac abnormalities. The full function of neuregulin-1 is not known. In this study we are inserting a cDNA clone obtained from American Type Culture Collection into E.coli expression vectors to express neuregulin- 1 protein. Metal chelate affinity chromatography is used for recombinant protein purification. Crystallization screening will proceed for X-ray diffraction studies following expression, optimization, and protein purification. In spite of medical and scholarly interest in the neuregulins, there are currently no high-resolution structures available for these proteins. Here we present the first steps toward attaining a high-resolution structure of neuregulin- 1, which will help enable us to better understand its function
Coevolution of T-cell receptors with MHC and non-MHC ligands
Castro, Caitlin C.; Luoma, Adrienne M.; Adams, Erin J.
2015-01-01
Summary The structure and amino acid diversity of the T-cell receptor (TCR), similar in nature to that of Fab portions of antibodies, would suggest these proteins have a nearly infinite capacity to recognize antigen. Yet all currently defined native T cells expressing an α and β chain in their TCR can only sense antigen when presented in the context of a major histocompatibility complex (MHC) molecule. This MHC molecule can be one of many that exist in vertebrates, presenting small peptide fragments, lipid molecules, or small molecule metabolites. Here we review the pattern of TCR recognition of MHC molecules throughout a broad sampling of species and T-cell lineages and also touch upon T cells that do not appear to require MHC presentation for their surveillance function. We review the diversity of MHC molecules and information on the corresponding T-cell lineages identified in divergent species. We also discuss TCRs with structural domains unlike that of conventional TCRs of mouse and human. By presenting this broad view of TCR sequence, structure, domain organization, and function, we seek to explore how this receptor has evolved across time and been selected for alternative antigen-recognition capabilities in divergent lineages. PMID:26284470
Taking The Time To Study Competitive Antagonism
Wyllie, D J A; Chen, P E
2007-01-01
Selective receptor antagonists are one of the most powerful resources in a pharmacologist's toolkit and are essential for the identification and classification of receptor subtypes and dissecting their roles in normal and abnormal body function. However, when the actions of antagonists are measured inappropriately and misleading results are reported, confusion and wrong interpretations ensue. This article gives a general overview of Schild analysis and the method of determining antagonist equilibrium constants. We demonstrate why this technique is preferable in the study of competitive receptor antagonism than the calculation of antagonist concentration that inhibit agonist-evoked responses by 50%. In addition we show how the use of Schild analysis can provide information on the outcome of single amino acid mutations in structure-function studies of receptors. Finally, we illustrate the need for caution when studying the effects of potent antagonists on synaptic transmission where the timescale of events under investigation is such that ligands and receptors never reach steady-state occupancy. PMID:17245371
The collagen receptor uPARAP/Endo180 in tissue degradation and cancer (Review)
MELANDER, MARIA C.; JÜRGENSEN, HENRIK J.; MADSEN, DANIEL H.; ENGELHOLM, LARS H.; BEHRENDT, NIELS
2015-01-01
The collagen receptor uPARAP/Endo180, the product of the MRC2 gene, is a central component in the collagen turnover process governed by various mesenchymal cells. Through the endocytosis of collagen or large collagen fragments, this recycling receptor serves to direct basement membrane collagen as well as interstitial collagen to lysosomal degradation. This capacity, shared only with the mannose receptor from the same protein family, endows uPARAP/Endo180 with a critical role in development and homeostasis, as well as in pathological disruptions of the extracellular matrix structure. Important pathological functions of uPARAP/Endo180 have been identified in various cancers and in several fibrotic conditions. With a particular focus on matrix turnover in cancer, this review presents the necessary background for understanding the function of uPARAP/Endo180 at the molecular and cellular level, followed by an in-depth survey of the available knowledge of the expression and role of this receptor in various types of cancer and other degenerative diseases. PMID:26316068
Structural interpretation of P2X receptor mutagenesis studies on drug action.
Evans, Richard J
2010-11-01
P2X receptors for ATP are ligand gated cation channels that form from the trimeric assembly of subunits with two transmembrane segments, a large extracellular ligand binding loop, and intracellular amino and carboxy termini. The receptors are expressed throughout the body, involved in functions ranging from blood clotting to inflammation, and may provide important targets for novel therapeutics. Mutagenesis based studies have been used to develop an understanding of the molecular basis of their pharmacology with the aim of developing models of the ligand binding site. A crystal structure for the zebra fish P2X4 receptor in the closed agonist unbound state has been published recently, which provides a major advance in our understanding of the receptors. This review gives an overview of mutagenesis studies that have led to the development of a model of the ATP binding site, as well as identifying residues contributing to allosteric regulation and antagonism. These studies are discussed with reference to the crystal to provide a structural interpretation of the molecular basis of drug action. © 2010 The Author. British Journal of Pharmacology © 2010 The British Pharmacological Society.
[Severe type A insulin resistance syndrome due to a mutation in the insulin receptor gene].
Ros, P; Colino-Alcol, E; Grasso, V; Barbetti, F; Argente, J
2015-01-01
Insulin resistance syndromes without lipodystrophy are an infrequent and heterogeneous group of disorders with variable clinical phenotypes, associated with hyperglycemia and hyperinsulinemia. The three conditions related to mutations in the insulin receptor gene are leprechaunism or Donohue syndrome, Rabson-Mendenhall syndrome, and Type A syndrome. A case is presented on a patient diagnosed with type A insulin resistance, defined by the triad of extreme insulin resistance, acanthosis nigricans, and hyperandrogenism, carrying a heterozygous mutation in exon 19 of the insulin receptor gene coding for its tyrosine kinase domain that is crucial for the catalytic activity of the receptor. The molecular basis of the syndrome is reviewed, focusing on the structure-function relationships of the insulin receptor, knowing that the criteria for survival are linked to residual insulin receptor function. It is also pointed out that, although type A insulin resistance appears to represent a somewhat less severe condition, these patients have a high morbidity and their treatment is still unsatisfactory. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.
Rebrov, I G; Kalinina, M V
2013-01-01
Functional activity of the CGABA(A)-receptor/Cl(-) ionophore complex was investigated the muscimol-stimulated entry of the radioactive isotope 36Cl(-) in synaptoneurosomes in changing the structure and permeability of neuronal membranes. Integrity of the membranes was damaged by removal of Ca(+2) and Mg(+2) from the incubation medium and by the method of freezing-thawing synaptoneurosomes. In both cases, an increase in basal 36Cl(-) entry into synaptoneurosomes, indicating increased nonspecific permeability of neuronal membranes, and decreased activity the CABA(A)-receptor/Cl(-) ionophore complex. The conclusion about the relationship of processes damage neuronal membranes and reducing the inhibitory processes in the epileptic focus.
Peroxisome protein import: a complex journey.
Baker, Alison; Lanyon-Hogg, Thomas; Warriner, Stuart L
2016-06-15
The import of proteins into peroxisomes possesses many unusual features such as the ability to import folded proteins, and a surprising diversity of targeting signals with differing affinities that can be recognized by the same receptor. As understanding of the structure and function of many components of the protein import machinery has grown, an increasingly complex network of factors affecting each step of the import pathway has emerged. Structural studies have revealed the presence of additional interactions between cargo proteins and the PEX5 receptor that affect import potential, with a subtle network of cargo-induced conformational changes in PEX5 being involved in the import process. Biochemical studies have also indicated an interdependence of receptor-cargo import with release of unloaded receptor from the peroxisome. Here, we provide an update on recent literature concerning mechanisms of protein import into peroxisomes. © 2016 The Author(s).
Resnick, D; Chatterton, J E; Schwartz, K; Slayter, H; Krieger, M
1996-10-25
Structures of secreted forms of the human type I and II class A macrophage scavenger receptors were studied using biochemical and biophysical methods. Proteolytic analysis was used to determine the intramolecular disulfide bonds in the type I-specific scavenger receptor cysteine-rich (SRCR) domain: Cys2-Cys7, Cys3-Cys8, and Cys5-Cys6. This pattern is likely to be shared by the highly homologous domains in the many other members of the SRCR domain superfamily. Electron microscopy using rotary shadowing and negative staining showed that the type I and II receptors are extended molecules whose contour lengths are approximately 440 A. They comprised two adjacent fibrous segments, an alpha-helical coiled-coil ( approximately 230 A, including a contribution from the N-terminal spacer domain) and a collagenous triple helix ( approximately 210 A). The type I molecules also contained a C-terminal globular structure ( approximately 58 x 76 A) composed of three SRCR domains. The fibrous domains were joined by an extremely flexible hinge. The angle between these domains varied from 0 to 180 degrees and depended on the conditions of sample preparation. Unexpectedly, at physiologic pH, the prevalent angle seen using rotary shadowing was 0 degrees , resulting in a structure that is significantly more compact than previously suggested. The apparent juxtaposition of the fibrous domains at neutral pH provides a framework for future structure-function studies of these unusual multiligand receptors.
Formation and decay of the arrestin·rhodopsin complex in native disc membranes.
Beyrière, Florent; Sommer, Martha E; Szczepek, Michal; Bartl, Franz J; Hofmann, Klaus Peter; Heck, Martin; Ritter, Eglof
2015-05-15
In the G protein-coupled receptor rhodopsin, light-induced cis/trans isomerization of the retinal ligand triggers a series of distinct receptor states culminating in the active Metarhodopsin II (Meta II) state, which binds and activates the G protein transducin (Gt). Long before Meta II decays into the aporeceptor opsin and free all-trans-retinal, its signaling is quenched by receptor phosphorylation and binding of the protein arrestin-1, which blocks further access of Gt to Meta II. Although recent crystal structures of arrestin indicate how it might look in a precomplex with the phosphorylated receptor, the transition into the high affinity complex is not understood. Here we applied Fourier transform infrared spectroscopy to monitor the interaction of arrestin-1 and phosphorylated rhodopsin in native disc membranes. By isolating the unique infrared signature of arrestin binding, we directly observed the structural alterations in both reaction partners. In the high affinity complex, rhodopsin adopts a structure similar to Gt-bound Meta II. In arrestin, a modest loss of β-sheet structure indicates an increase in flexibility but is inconsistent with a large scale structural change. During Meta II decay, the arrestin-rhodopsin stoichiometry shifts from 1:1 to 1:2. Arrestin stabilizes half of the receptor population in a specific Meta II protein conformation, whereas the other half decays to inactive opsin. Altogether these results illustrate the distinct binding modes used by arrestin to interact with different functional forms of the receptor. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Sequencing and characterizing odorant receptors of the cerambycid beetle Megacyllene caryae
Mitchell, Robert F.; Hughes, David T.; Luetje, Charles W.; Millar, Jocelyn G.; Soriano-Agatón, Flor; Hanks, Lawrence M.; Robertson, Hugh M.
2012-01-01
Odorant receptors (Ors) are a unique family of ligand-gated ion channels and the primary mechanism by which insects detect volatile chemicals. Here, we describe 57 putative Ors sequenced from an antennal transcriptome of the cerambycid beetle Megacyllene caryae (Gahan). The male beetles produce a pheromone blend of nine components, and we functionally characterized Ors tuned to three of these chemicals: receptor McOr3 is sensitive to (S)-2-methyl-1-butanol; McOr20 is sensitive to (2S,3R)-2,3-hexanediol; and McOr5 is sensitive to 2-phenylethanol. McOr3 and McOr20 are also sensitive to structurally-related chemicals that are pheromones of other cerambycid beetles, suggesting that orthologous receptors may be present across many cerambycid species. These Ors are the first to be functionally characterized from any species of beetle and lay the groundwork for understanding the evolution of pheromones within the Cerambycidae. PMID:22504490
Kellici, Tahsin F; Tzakos, Andreas G; Mavromoustakos, Thomas
2015-03-02
The angiotensin II (Ang II) type 1 and type 2 receptors (AT1R and AT2R) orchestrate an array of biological processes that regulate human health. Aberrant function of these receptors triggers pathophysiological responses that can ultimately lead to death. Therefore, it is important to design and synthesize compounds that affect beneficially these two receptors. Cardiovascular disease, which is attributed to the overactivation of the vasoactive peptide hormone Αng II, can now be treated with commercial AT1R antagonists. Herein, recent achievements in rational drug design and synthesis of molecules acting on the two AT receptors are reviewed. Quantitative structure activity relationships (QSAR) and molecular modeling on the two receptors aim to assist the search for new active compounds. As AT1R and AT2R are GPCRs and drug action is localized in the transmembrane region the role of membrane bilayers is exploited. The future perspectives in this field are outlined. Tremendous progress in the field is expected if the two receptors are crystallized, as this will assist the structure based screening of the chemical space and lead to new potent therapeutic agents in cardiovascular and other diseases.
Glutamatergic synapses in neurodevelopmental disorders.
Moretto, Edoardo; Murru, Luca; Martano, Giuseppe; Sassone, Jenny; Passafaro, Maria
2018-06-08
Neurodevelopmental disorders (NDDs) are a group of diseases whose symptoms arise during childhood or adolescence and that impact several higher cognitive functions such as learning, sociability and mood. Accruing evidence suggests that a shared pathogenic mechanism underlying these diseases is the dysfunction of glutamatergic synapses. We summarize present knowledge on autism spectrum disorders (ASD), intellectual disability (ID), Down syndrome (DS), Rett syndrome (RS) and attention-deficit hyperactivity disorder (ADHD), highlighting the involvement of glutamatergic synapses and receptors in these disorders. The most commonly shared defects involve α-amino-3-hydroxy-5-methyl- 4-isoxazole propionic acid receptors (AMPARs), N-methyl-d-aspartate receptors (NMDARs) and metabotropic glutamate receptors (mGluRs), whose functions are strongly linked to synaptic plasticity, affecting both cell-autonomous features as well as circuit formation. Moreover, the major scaffolding proteins and, thus, the general structure of the synapse are often deregulated in neurodevelopmental disorders, which is not surprising considering their crucial role in the regulation of glutamate receptor positioning and functioning. This convergence of defects supports the definition of neurodevelopmental disorders as a continuum of pathological manifestations, suggesting that glutamatergic synapses could be a therapeutic target to ameliorate patient symptomatology. Copyright © 2017. Published by Elsevier Inc.
Ogawa, Haruo; Qiu, Yue; Philo, John S; Arakawa, Tsutomu; Ogata, Craig M; Misono, Kunio S
2010-03-01
The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(-)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. A new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(-) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(-) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ogawa, H.; Qiu, Y; Philo, J
2010-01-01
The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(-)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. Amore » new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(-) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(-) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis.« less
Ogawa, Haruo; Qiu, Yue; Philo, John S; Arakawa, Tsutomu; Ogata, Craig M; Misono, Kunio S
2010-01-01
The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(−)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. A new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(−) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(−) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis. PMID:20066666
Update on melatonin receptors: IUPHAR Review 20.
Jockers, Ralf; Delagrange, Philippe; Dubocovich, Margarita L; Markus, Regina P; Renault, Nicolas; Tosini, Gianluca; Cecon, Erika; Zlotos, Darius P
2016-09-01
Melatonin receptors are seven transmembrane-spanning proteins belonging to the GPCR superfamily. In mammals, two melatonin receptor subtypes exist - MT1 and MT2 - encoded by the MTNR1A and MTNR1B genes respectively. The current review provides an update on melatonin receptors by the corresponding subcommittee of the International Union of Basic and Clinical Pharmacology. We will highlight recent developments of melatonin receptor ligands, including radioligands, and give an update on the latest phenotyping results of melatonin receptor knockout mice. The current status and perspectives of the structure of melatonin receptor will be summarized. The physiological importance of melatonin receptor dimers and biologically important and type 2 diabetes-associated genetic variants of melatonin receptors will be discussed. The role of melatonin receptors in physiology and disease will be further exemplified by their functions in the immune system and the CNS. Finally, antioxidant and free radical scavenger properties of melatonin and its relation to melatonin receptors will be critically addressed. © 2016 The British Pharmacological Society.
The N-terminal domain of GluR6-subtype glutamate receptor ion channels
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Janesh; Schuck, Peter; Jin, Rongsheng
2009-09-25
The amino-terminal domain (ATD) of glutamate receptor ion channels, which controls their selective assembly into AMPA, kainate and NMDA receptor subtypes, is also the site of action of NMDA receptor allosteric modulators. Here we report the crystal structure of the ATD from the kainate receptor GluR6. The ATD forms dimers in solution at micromolar protein concentrations and crystallizes as a dimer. Unexpectedly, each subunit adopts an intermediate extent of domain closure compared to the apo and ligand-bound complexes of LIVBP and G protein-coupled glutamate receptors (mGluRs), and the dimer assembly has a markedly different conformation from that found in mGluRs.more » This conformation is stabilized by contacts between large hydrophobic patches in the R2 domain that are absent in NMDA receptors, suggesting that the ATDs of individual glutamate receptor ion channels have evolved into functionally distinct families.« less
NASA Astrophysics Data System (ADS)
Ivanova, Bojidarka B.; Spiteller, Michael
2012-09-01
A comprehensive screening of fifteen functionalized Ergot-alkaloids, containing bulk aliphatic cyclic substituents at D-ring of the ergoline molecular skeleton was performed, studying their structure-active relationships and model interactions with α2A-adreno-, serotonin (5HT2A) and dopamine D3 (D3A) receptors. The accounted high affinity to the receptors binding loops and unusual bonding situations, joined with the molecular flexibility of the substituents and the presence of proton accepting/donating functional groups in the studied alkaloids, may contribute to further understanding the mechanisms of biological activity in vivo and in predicting their therapeutic potential in central nervous system (CNS), including those related the Schizophrenia. Since the presented correlation between the molecular structure and properties, was based on the comprehensively theoretical computational and experimental physical study on the successfully isolated derivatives, through using routine synthetic pathways in a relatively high yields, marked these derivatives as 'treasure' for further experimental and theoretical studied in areas such as: (a) pharmacological and clinical testing; (b) molecular-drugs design of novel psychoactive substances; (c) development of the analytical protocols for determination of Ergot-alkaloids through a functionalization of the ergoline-skeleton, and more.
Wood, J; Verma, D; Lach, G; Bonaventure, P; Herzog, H; Sperk, G; Tasan, R O
2016-09-01
The amygdala is essential for generating emotional-affective behaviors. It consists of several nuclei with highly selective, elaborate functions. In particular, the central extended amygdala, consisting of the central amygdala (CEA) and the bed nucleus of the stria terminalis (BNST) is an essential component actively controlling efferent connections to downstream effectors like hypothalamus and brain stem. Both, CEA and BNST contain high amounts of different neuropeptides that significantly contribute to synaptic transmission. Among these, neuropeptide Y (NPY) has emerged as an important anxiolytic and fear-reducing neuromodulator. Here, we characterized the expression, connectivity and electrophysiological function of NPY and Y2 receptors within the CEA. We identified several NPY-expressing neuronal populations, including somatostatin- and calretinin-expressing neurons. Furthermore, in the main intercalated nucleus, NPY is expressed primarily in dopamine D1 receptor-expressing neurons but also in interspersed somatostatin-expressing neurons. Interestingly, NPY neurons did not co-localize with the Y2 receptor. Retrograde tract tracing experiments revealed that NPY neurons reciprocally connect the CEA and BNST. Functionally, the Y2 receptor agonist PYY3-36, reduced both, inhibitory as well as excitatory synaptic transmission in the centromedial amygdala (CEm). However, we also provide evidence that lack of NPY or Y2 receptors results in increased GABA release specifically at inhibitory synapses in the CEm. Taken together, our findings suggest that NPY expressed by distinct populations of neurons can modulate afferent and efferent projections of the CEA via presynaptic Y2 receptors located at inhibitory and excitatory synapses.
Posttranslational Modifications Regulate the Postsynaptic Localization of PSD-95.
Vallejo, Daniela; Codocedo, Juan F; Inestrosa, Nibaldo C
2017-04-01
The postsynaptic density (PSD) consists of a lattice-like array of interacting proteins that organizes and stabilizes synaptic receptors, ion channels, structural proteins, and signaling molecules required for normal synaptic transmission and synaptic function. The scaffolding and hub protein postsynaptic density protein-95 (PSD-95) is a major element of central chemical synapses and interacts with glutamate receptors, cell adhesion molecules, and cytoskeletal elements. In fact, PSD-95 can regulate basal synaptic stability as well as the activity-dependent structural plasticity of the PSD and, therefore, of the excitatory chemical synapse. Several studies have shown that PSD-95 is highly enriched at excitatory synapses and have identified multiple protein structural domains and protein-protein interactions that mediate PSD-95 function and trafficking to the postsynaptic region. PSD-95 is also a target of several signaling pathways that induce posttranslational modifications, including palmitoylation, phosphorylation, ubiquitination, nitrosylation, and neddylation; these modifications determine the synaptic stability and function of PSD-95 and thus regulate the fates of individual dendritic spines in the nervous system. In the present work, we review the posttranslational modifications that regulate the synaptic localization of PSD-95 and describe their functional consequences. We also explore the signaling pathways that induce such changes.
Structural insights into ligand recognition and selectivity for class A, B, and C GPCRs
Lee, Sang-Min; Booe, Jason M.; Pioszak, Augen A.
2015-01-01
The G protein-coupled receptor (GPCR) superfamily constitutes the largest collection of cell surface signaling proteins with approximately 800 members in the human genome. GPCRs regulate virtually all aspects of physiology and they are an important class of drug targets with ~30% of drugs on the market targeting a GPCR. Breakthroughs in GPCR structural biology in recent years have significantly expanded our understanding of GPCR structure and function and ushered in a new era of structure-based drug design for GPCRs. Crystal structures for nearly thirty distinct GPCRs are now available including receptors from each of the major classes, A, B, C, and F. These structures provide a foundation for understanding the molecular basis of GPCR pharmacology. Here, we review structural mechanisms of ligand recognition and selectivity of GPCRs with a focus on selected examples from classes A, B, and C, and we highlight major unresolved questions for future structural studies. PMID:25981303
Function of OPG as a traffic regulator for RANKL is crucial for controlled osteoclastogenesis.
Aoki, Shigeki; Honma, Masashi; Kariya, Yoshiaki; Nakamichi, Yuko; Ninomiya, Tadashi; Takahashi, Naoyuki; Udagawa, Nobuyuki; Suzuki, Hiroshi
2010-09-01
The amount of the receptor activator of NF-κB ligand (RANKL) on the osteoblastic cell surface is considered to determine the magnitude of the signal input to osteoclast precursors and the degree of osteoclastogenesis. Previously, we have shown that RANKL is localized predominantly in lysosomal organelles, but little is found on the osteoblastic cell surface, and consequently, the regulated subcellular trafficking of RANKL in osteoblastic cells is important for controlled osteoclastogenesis. Here we have examined the involvement of osteoprotegerin (OPG), which is currently recognized as a decoy receptor for RANKL, in the regulation of RANKL behavior. It was suggested that OPG already makes a complex with RANKL in the Golgi apparatus and that the complex formation is necessary for RANKL sorting to the secretory lysosomes. It was also shown that each structural domain of OPG is indispensable for exerting OPG function as a traffic regulator. In particular, the latter domains of OPG, whose physiologic functions have been unclear, were indicated to sort RANKL molecules to lysosomes from the Golgi apparatus. In addition, the overexpression of RANK-OPG chimeric protein, which retained OPG function as a decoy receptor but lost the function as a traffic regulator, inhibited endogenous OPG function as a traffic regulator selectively in osteoblastic cells and resulted in the upregulation of osteoclastogenic ability despite the increased number of decoy receptor molecules. Conclusively, OPG function as a traffic regulator for RANKL is crucial for regulating osteoclastogenesis at least as well as that as a decoy receptor. © 2010 American Society for Bone and Mineral Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Rui; McBride, Ryan; Paulson, James C.
2010-03-04
The hemagglutinin (HA) envelope protein of influenza viruses mediates essential viral functions, including receptor binding and membrane fusion, and is the major viral antigen for antibody neutralization. The 1957 H2N2 subtype (Asian flu) was one of the three great influenza pandemics of the last century and caused 1 million deaths globally from 1957 to 1968. Three crystal structures of 1957 H2 HAs have been determined at 1.60 to 1.75 {angstrom} resolutions to investigate the structural basis for their antigenicity and evolution from avian to human binding specificity that contributed to its introduction into the human population. These structures, which representmore » the highest resolutions yet recorded for a complete ectodomain of a glycosylated viral surface antigen, along with the results of glycan microarray binding analysis, suggest that a hydrophobicity switch at residue 226 and elongation of receptor-binding sites were both critical for avian H2 HA to acquire human receptor specificity. H2 influenza viruses continue to circulate in birds and pigs and, therefore, remain a substantial threat for transmission to humans. The H2 HA structure also reveals a highly conserved epitope that could be harnessed in the design of a broader and more universal influenza A virus vaccine.« less
Miszta, Przemyslaw; Pasznik, Pawel; Jakowiecki, Jakub; Sztyler, Agnieszka; Latek, Dorota; Filipek, Slawomir
2018-05-21
Due to the involvement of G protein-coupled receptors (GPCRs) in most of the physiological and pathological processes in humans they have been attracting a lot of attention from pharmaceutical industry as well as from scientific community. Therefore, the need for new, high quality structures of GPCRs is enormous. The updated homology modeling service GPCRM (http://gpcrm.biomodellab.eu/) meets those expectations by greatly reducing the execution time of submissions (from days to hours/minutes) with nearly the same average quality of obtained models. Additionally, due to three different scoring functions (Rosetta, Rosetta-MP, BCL::Score) it is possible to select accurate models for the required purposes: the structure of the binding site, the transmembrane domain or the overall shape of the receptor. Currently, no other web service for GPCR modeling provides this possibility. GPCRM is continually upgraded in a semi-automatic way and the number of template structures has increased from 20 in 2013 to over 90 including structures the same receptor with different ligands which can influence the structure not only in the on/off manner. Two types of protein viewers can be used for visual inspection of obtained models. The extended sortable tables with available templates provide links to external databases and display ligand-receptor interactions in visual form.
New functions and signaling mechanisms for the class of adhesion G protein–coupled receptors
Liebscher, Ines; Ackley, Brian; Araç, Demet; Ariestanti, Donna M.; Aust, Gabriela; Bae, Byoung-il; Bista, Bigyan R.; Bridges, James P.; Duman, Joseph G.; Engel, Felix B.; Giera, Stefanie; Goffinet, André M.; Hall, Randy A.; Hamann, Jörg; Hartmann, Nicole; Lin, Hsi-Hsien; Liu, Mingyao; Luo, Rong; Mogha, Amit; Monk, Kelly R.; Peeters, Miriam C.; Prömel, Simone; Ressl, Susanne; Schiöth, Helgi B.; Sigoillot, Séverine M.; Song, Helen; Talbot, William S.; Tall, Gregory G.; White, James P.; Wolfrum, Uwe; Xu, Lei; Piao, Xianhua
2014-01-01
The class of adhesion G protein–coupled receptors (aGPCRs), with 33 human homologs, is the second largest family of GPCRs. In addition to a seven-transmembrane α-helix—a structural feature of all GPCRs—the class of aGPCRs is characterized by the presence of a large N-terminal extracellular region. In addition, all aGPCRs but one (GPR123) contain a GPCR autoproteolysis–inducing (GAIN) domain that mediates autoproteolytic cleavage at the GPCR autoproteolysis site (GPS) motif to generate N- and a C-terminal fragments (NTF and CTF, respectively) during protein maturation. Subsequently, the NTF and CTF are associated non-covalently as a heterodimer at the plasma membrane. While the biological function of the GAIN domain–mediated autocleavage is not fully understood, mounting evidence suggests that the NTF and CTF possess distinct biological activities in addition to their function as a receptor unit. We discuss recent advances in understanding the biological functions, signaling mechanisms, and disease associations of the aGPCRs. PMID:25424900
Hamiaux, Cyril; Drummond, Revel S M; Luo, Zhiwei; Lee, Hui Wen; Sharma, Prachi; Janssen, Bart J; Perry, Nigel B; Denny, William A; Snowden, Kimberley C
2018-04-27
The strigolactone (SL) family of plant hormones regulates a broad range of physiological processes affecting plant growth and development and also plays essential roles in controlling interactions with parasitic weeds and symbiotic fungi. Recent progress elucidating details of SL biosynthesis, signaling, and transport offers many opportunities for discovering new plant-growth regulators via chemical interference. Here, using high-throughput screening and downstream biochemical assays, we identified N -phenylanthranilic acid derivatives as potent inhibitors of the SL receptors from petunia (DAD2), rice (OsD14), and Arabidopsis (AtD14). Crystal structures of DAD2 and OsD14 in complex with inhibitors further provided detailed insights into the inhibition mechanism, and in silico modeling of 19 other plant strigolactone receptors suggested that these compounds are active across a large range of plant species. Altogether, these results provide chemical tools for investigating SL signaling and further define a framework for structure-based approaches to design and validate optimized inhibitors of SL receptors for specific plant targets. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Chemistry and Structure-Activity Relationships of Psychedelics.
Nichols, David E
2018-01-01
This chapter will summarize structure-activity relationships (SAR) that are known for the classic serotonergic hallucinogens (aka psychedelics), focusing on the three chemical types: tryptamines, ergolines, and phenethylamines. In the brain, the serotonin 5-HT 2A receptor plays a key role in regulation of cortical function and cognition, and also appears to be the principal target for hallucinogenic/psychedelic drugs such as LSD. It is one of the most extensively studied of the 14 known types of serotonin receptors. Important structural features will be identified for activity and, where possible, those that the psychedelics have in common will be discussed. Because activation of the 5-HT 2A receptor is the principal mechanism of action for psychedelics, compounds with 5-HT 2A agonist activity generally are quickly discarded by the pharmaceutical industry. Thus, most of the research on psychedelics can be related to activation of 5-HT 2A receptors. Therefore, much of the discussion will include not only clinical or anecdotal studies, but also will consider data from animal models as well as a certain amount of molecular pharmacology where it is known.
Feese, Michael D.; Tamada, Taro; Kato, Yoichi; Maeda, Yoshitake; Hirose, Masako; Matsukura, Yasuko; Shigematsu, Hideki; Muto, Takanori; Matsumoto, Atsushi; Watarai, Hiroshi; Ogami, Kinya; Tahara, Tomoyuki; Kato, Takashi; Miyazaki, Hiroshi; Kuroki, Ryota
2004-01-01
The cytokine thrombopoietin (TPO), the ligand for the hematopoietic receptor c-Mpl, acts as a primary regulator of megakaryocytopoiesis and platelet production. We have determined the crystal structure of the receptor-binding domain of human TPO (hTPO163) to a 2.5-Å resolution by complexation with a neutralizing Fab fragment. The backbone structure of hTPO163 has an antiparallel four-helix bundle fold. The neutralizing Fab mainly recognizes the C–D crossover loop containing the species invariant residue Q111. Titration calorimetric experiments show that hTPO163 interacts with soluble c-Mpl containing the extracellular cytokine receptor homology domains with 1:2 stoichiometry with the binding constants of 3.3 × 109 M–1 and 1.1 × 106 M–1. The presence of the neutralizing Fab did not inhibit binding of hTPO163 to soluble c-Mpl fragments, but the lower-affinity binding disappeared. Together with prior genetic data, these define the structure–function relationships in TPO and the activation scheme of c-Mpl. PMID:14769915
Smits, Guillaume; Campillo, Mercedes; Govaerts, Cédric; Janssens, Véronique; Richter, Christine; Vassart, Gilbert; Pardo, Leonardo; Costagliola, Sabine
2003-01-01
Glycoprotein hormone receptors [thyrotropin (TSHr), luteinizing hormone/chorionic gonadotropin (LH/CGr), follicle stimulating hormone (FSHr)] are rhodopsin-like G protein-coupled receptors with a large extracellular N-terminal portion responsible for hormone recognition and binding. In structural models, this ectodomain is composed of two cysteine clusters flanking nine leucine-rich repeats (LRRs). The LRRs form a succession of β-strands and α-helices organized into a horseshoe-shaped structure. It has been proposed that glycoprotein hormones interact with residues of the β-strands making the concave surface of the horseshoe. Gain-of-function homology scanning of the β-strands of glycoprotein hormone receptors allowed identification of the critical residues responsible for the specificity towards human chorionic gonadotropin (hCG). Substitution of eight or two residues of the LH/CGr into the TSHr or FSHr, respectively, resulted in constructs displaying almost the same affinity and sensitivity for hCG as wild-type LH/CGr. Molecular dynamics simulations and additional site-directed mutagenesis provided a structural rationale for the evolution of binding specificity in this duplicated gene family. PMID:12773385
Scheidel, Jennifer; Lindauer, Klaus; Ackermann, Jörg; Koch, Ina
2015-12-17
The insulin-dependent activation and recycling of the insulin receptor play an essential role in the regulation of the energy metabolism, leading to a special interest for pharmaceutical applications. Thus, the recycling of the insulin receptor has been intensively investigated, experimentally as well as theoretically. We developed a time-resolved, discrete model to describe stochastic dynamics and study the approximation of non-linear dynamics in the context of timed Petri nets. Additionally, using a graph-theoretical approach, we analyzed the structure of the regulatory system and demonstrated the close interrelation of structural network properties with the kinetic behavior. The transition invariants decomposed the model into overlapping subnetworks of various sizes, which represent basic functional modules. Moreover, we computed the quasi-steady states of these subnetworks and demonstrated that they are fundamental to understand the dynamic behavior of the system. The Petri net approach confirms the experimental results of insulin-stimulated degradation of the insulin receptor, which represents a common feature of insulin-resistant, hyperinsulinaemic states.
Key issues in the computational simulation of GPCR function: representation of loop domains
NASA Astrophysics Data System (ADS)
Mehler, E. L.; Periole, X.; Hassan, S. A.; Weinstein, H.
2002-11-01
Some key concerns raised by molecular modeling and computational simulation of functional mechanisms for membrane proteins are discussed and illustrated for members of the family of G protein coupled receptors (GPCRs). Of particular importance are issues related to the modeling and computational treatment of loop regions. These are demonstrated here with results from different levels of computational simulations applied to the structures of rhodopsin and a model of the 5-HT2A serotonin receptor, 5-HT2AR. First, comparative Molecular Dynamics (MD) simulations are reported for rhodopsin in vacuum and embedded in an explicit representation of the membrane and water environment. It is shown that in spite of a partial accounting of solvent screening effects by neutralization of charged side chains, vacuum MD simulations can lead to severe distortions of the loop structures. The primary source of the distortion appears to be formation of artifactual H-bonds, as has been repeatedly observed in vacuum simulations. To address such shortcomings, a recently proposed approach that has been developed for calculating the structure of segments that connect elements of secondary structure with known coordinates, is applied to 5-HT2AR to obtain an initial representation of the loops connecting the transmembrane (TM) helices. The approach consists of a simulated annealing combined with biased scaled collective variables Monte Carlo technique, and is applied to loops connecting the TM segments on both the extra-cellular and the cytoplasmic sides of the receptor. Although this initial calculation treats the loops as independent structural entities, the final structure exhibits a number of interloop interactions that may have functional significance. Finally, it is shown here that in the case where a given loop from two different GPCRs (here rhodopsin and 5-HT2AR) has approximately the same length and some degree of sequence identity, the fold adopted by the loops can be similar. Thus, in such special cases homology modeling might be used to obtain initial structures of these loops. Notably, however, all other loops in these two receptors appear to be very different in sequence and structure, so that their conformations can be found reliably only by ab initio, energy based methods and not by homology modeling.
Visualization of arrestin recruitment by a G Protein-Coupled Receptor
Reis, Rosana I.; Huang, Li-Yin; Tripathi-Shukla, Prachi; Qian, Jiang; Li, Sheng; Blanc, Adi; Oleskie, Austin N.; Dosey, Anne M.; Su, Min; Liang, Cui-Rong; Gu, Ling-Ling; Shan, Jin-Ming; Chen, Xin; Hanna, Rachel; Choi, Minjung; Yao, Xiao Jie; Klink, Bjoern U.; Kahsai, Alem W.; Sidhu, Sachdev S.; Koide, Shohei; Penczek, Pawel A.; Kossiakoff, Anthony A.; Jr, Virgil L. Woods; Kobilka, Brian K.; Skiniotis, Georgios; Lefkowitz, Robert J.
2014-01-01
G Protein Coupled Receptors (GPCRs) are critically regulated by β-arrestins (βarrs), which not only desensitize G protein signaling but also initiate a G protein independent wave of signaling1-5. A recent surge of structural data on a number of GPCRs, including the β2 adrenergic receptor (β2AR)-G protein complex, has provided novel insights into the structural basis of receptor activation6-11. Lacking however has been complementary information on recruitment of βarrs to activated GPCRs primarily due to challenges in obtaining stable receptor-βarr complexes for structural studies. Here, we devised a strategy for forming and purifying a functional β2AR-βarr1 complex that allowed us to visualize its architecture by single particle negative stain electron microscopy (EM) and to characterize the interactions between β2AR and βarr1 using hydrogen-deuterium exchange mass spectrometry (HDXMS) and chemical cross-linking. EM 2D averages and 3D reconstructions reveal bimodal binding of βarr1 to the β2AR, involving two separate sets of interactions, one with the phosphorylated carboxy-terminus of the receptor and the other with its seven-transmembrane core. Areas of reduced HDX together with identification of cross-linked residues suggest engagement of the finger loop of βarr1 with the seven-transmembrane core of the receptor. In contrast, focal areas of increased HDX indicate regions of increased dynamics in both N and C domains of βarr1 when coupled to the β2AR. A molecular model of the β2AR-βarr signaling complex was made by docking activated βarr1 and β2AR crystal structures into the EM map densities with constraints provided by HDXMS and cross-linking, allowing us to obtain valuable insights into the overall architecture of a receptor-arrestin complex. The dynamic and structural information presented herein provides a framework for better understanding the basis of GPCR regulation by arrestins. PMID:25043026
Identification and mechanism of ABA receptor antagonism
DOE Office of Scientific and Technical Information (OSTI.GOV)
Melcher, Karsten; Xu, Yong; Ng, Ley-Moy
2010-11-11
The phytohormone abscisic acid (ABA) functions through a family of fourteen PYR/PYL receptors, which were identified by resistance to pyrabactin, a synthetic inhibitor of seed germination. ABA activates these receptors to inhibit type 2C protein phosphatases, such as ABI1, yet it remains unclear whether these receptors can be antagonized. Here we demonstrate that pyrabactin is an agonist of PYR1 and PYL1 but is unexpectedly an antagonist of PYL2. Crystal structures of the PYL2-pyrabactin and PYL1-pyrabactin-ABI1 complexes reveal the mechanism responsible for receptor-selective activation and inhibition, which enables us to design mutations that convert PYL1 to a pyrabactin-inhibited receptor and PYL2more » to a pyrabactin-activated receptor and to identify new pyrabactin-based ABA receptor agonists. Together, our results establish a new concept of ABA receptor antagonism, illustrate its underlying mechanisms and provide a rational framework for discovering novel ABA receptor ligands.« less
An XA21-Associated Kinase (OsSERK2) Regulates Immunity Mediated by the XA21 and XA3 Immune Receptors
Chen, Xuewei; Zuo, Shimin; Schwessinger, Benjamin; Chern, Mawsheng; Canlas, Patrick E.; Ruan, Deling; Zhou, Xiaogang; Wang, Jing; Daudi, Arsalan; Petzold, Christopher J.; Heazlewood, Joshua L.; Ronald, Pamela C.
2014-01-01
The rice XA21 immune receptor kinase and the structurally related XA3 receptor confer immunity to Xanthomonas oryzae pv. oryzae (Xoo), the causal agent of bacterial leaf blight. Here we report the isolation of OsSERK2 (rice somatic embryogenesis receptor kinase 2) and demonstrate that OsSERK2 positively regulates immunity mediated by XA21 and XA3 as well as the rice immune receptor FLS2 (OsFLS2). Rice plants silenced for OsSerk2 display altered morphology and reduced sensitivity to the hormone brassinolide. OsSERK2 interacts with the intracellular domains of each immune receptor in the yeast two-hybrid system in a kinase activity-dependent manner. OsSERK2 undergoes bidirectional transphosphorylation with XA21 in vitro and forms a constitutive complex with XA21 in vivo. These results demonstrate an essential role for OsSERK2 in the function of three rice immune receptors and suggest that direct interaction with the rice immune receptors is critical for their function. Taken together, our findings suggest that the mechanism of OsSERK2-meditated regulation of rice XA21, XA3, and FLS2 differs from that of AtSERK3/BAK1-mediated regulation of Arabidopsis FLS2 and EFR. PMID:24482436
Pereira, Naveen L; Redfield, Margaret M; Scott, Christopher; Tosakulwong, Nirubol; Olson, Timothy M; Bailey, Kent R; Rodeheffer, Richard J; Burnett, John C
2014-01-01
To evaluate the impact of a functional genetic variant in the natriuretic peptide clearance receptor, NPR3, on circulating natriuretic peptides (NPs) and myocardial structure and function in the general community. NPR3 plays an important role in the clearance of NPs and through direct signaling mechanisms modulates smooth muscle cell function and cardiac fibroblast proliferation. A NPR3 nonsynonymous single nucleotide polymorphism (SNP) rs2270915, resulting in a N521D substitution in the intracellular catalytic domain that interacts with Gi could affect receptor function. Whether this SNP is associated with alterations in NPs levels and altered cardiac structure and function is unknown. DNA samples of 1931 randomly selected residents of Olmsted County, Minnesota were genotyped. Plasma NT-proANP1-98, ANP1-28, proBNP1-108, NT-proBNP1-76, BNP1-32 and BNP3-32 levels were measured. All subjects underwent comprehensive echocardiography. Genotype frequencies for rs2270915 were as follows: (A/A 60%, A/G 36%, G/G 4%). All analyses performed were for homozygotes G/G versus wild type A/A plus the heterozygotes A/G. Diastolic dysfunction was significantly more common (p = 0.007) in the homozygotes G/G (43%) than the A/A+A/G (28%) group. Multivariate regression adjusted for age, sex, body mass index and hypertension demonstrated rs2270915 to be independently associated with diastolic dysfunction (odds ratio 1.94, p = 0.03). There was no significant difference in NPs levels between the 2 groups suggesting that the clearance function of the receptor was not affected. A nonsynonymous NPR3 SNP is independently associated with diastolic dysfunction and this association does not appear to be related to alterations in circulating levels of natriuretic peptides.
Structure of Gremlin-2 in Complex with GDF5 Gives Insight into DAN-Family-Mediated BMP Antagonism.
Nolan, Kristof; Kattamuri, Chandramohan; Rankin, Scott A; Read, Randy J; Zorn, Aaron M; Thompson, Thomas B
2016-08-23
The DAN family, including Gremlin-1 and Gremlin-2 (Grem1 and Grem2), represents a large family of secreted BMP (bone morphogenetic protein) antagonists. However, how DAN proteins specifically inhibit BMP signaling has remained elusive. Here, we report the structure of Grem2 bound to GDF5 at 2.9-Å resolution. The structure reveals two Grem2 dimers binding perpendicularly to each GDF5 monomer, resembling an H-like structure. Comparison to the unbound Grem2 structure reveals a dynamic N terminus that undergoes significant transition upon complex formation, leading to simultaneous interaction with the type I and type II receptor motifs on GDF5. Binding studies show that DAN-family members can interact with BMP-type I receptor complexes, whereas Noggin outcompetes the type I receptor for ligand binding. Interestingly, Grem2-GDF5 forms a stable aggregate-like structure in vitro that is not clearly observed for other antagonists, including Noggin and Follistatin. These findings exemplify the structural and functional diversity across the various BMP antagonist families. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kirschner, Austin N.; Sorem, Jessica; Longnecker, Richard
Epstein-Barr virus requires glycoproteins gH/gL, gB, and gp42 to fuse its lipid envelope with B cells. Gp42 is a type II membrane protein consisting of a flexible N-terminal region, which binds gH/gL, and a C-terminal lectin-like domain that binds to the B-cell entry receptor human leukocyte antigen (HLA) class II. Gp42 triggers membrane fusion after HLA binding, a process that requires simultaneous binding to gH/gL and a functional hydrophobic pocket in the lectin domain adjacent to the HLA binding site. Here we present the structure of gp42 in its unbound form. Comparisons to the previously determined structure of a gp42:HLAmore » complex reveals additional N-terminal residues forming part of the gH/gL binding site and structural changes in the receptor binding domain. Although the core of the lectin domain remains similar, significant shifts in two loops and an {alpha} helix bordering the essential hydrophobic pocket suggest a structural mechanism for triggering fusion.« less
Schneider, Sebastian; Provasi, Davide; Filizola, Marta
2015-01-01
Major advances in G Protein-Coupled Receptor (GPCR) structural biology over the past few years have yielded a significant number of high-resolution crystal structures for several different receptor subtypes. This dramatic increase in GPCR structural information has underscored the use of automated docking algorithms for the discovery of novel ligands that can eventually be developed into improved therapeutics. However, these algorithms are often unable to discriminate between different, yet energetically similar, poses because of their relatively simple scoring functions. Here, we describe a metadynamics-based approach to study the dynamic process of ligand binding to/unbinding from GPCRs with a higher level of accuracy and yet satisfying efficiency. PMID:26260607
The β-Arrestins: Multifunctional Regulators of G Protein-coupled Receptors.
Smith, Jeffrey S; Rajagopal, Sudarshan
2016-04-22
The β-arrestins (βarrs) are versatile, multifunctional adapter proteins that are best known for their ability to desensitize G protein-coupled receptors (GPCRs), but also regulate a diverse array of cellular functions. To signal in such a complex fashion, βarrs adopt multiple conformations and are regulated at multiple levels to differentially activate downstream pathways. Recent structural studies have demonstrated that βarrs have a conserved structure and activation mechanism, with plasticity of their structural fold, allowing them to adopt a wide array of conformations. Novel roles for βarrs continue to be identified, demonstrating the importance of these dynamic regulators of cellular signaling. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Karnik, Sadashiva S; Unal, Hamiyet; Kemp, Jacqueline R; Tirupula, Kalyan C; Eguchi, Satoru; Vanderheyden, Patrick M L; Thomas, Walter G
2015-10-01
The renin angiotensin system (RAS) produced hormone peptides regulate many vital body functions. Dysfunctional signaling by receptors for RAS peptides leads to pathologic states. Nearly half of humanity today would likely benefit from modern drugs targeting these receptors. The receptors for RAS peptides consist of three G-protein-coupled receptors—the angiotensin II type 1 receptor (AT1 receptor), the angiotensin II type 2 receptor (AT2 receptor), the MAS receptor—and a type II trans-membrane zinc protein—the candidate angiotensin IV receptor (AngIV binding site). The prorenin receptor is a relatively new contender for consideration, but is not included here because the role of prorenin receptor as an independent endocrine mediator is presently unclear. The full spectrum of biologic characteristics of these receptors is still evolving, but there is evidence establishing unique roles of each receptor in cardiovascular, hemodynamic, neurologic, renal, and endothelial functions, as well as in cell proliferation, survival, matrix-cell interaction, and inflammation. Therapeutic agents targeted to these receptors are either in active use in clinical intervention of major common diseases or under evaluation for repurposing in many other disorders. Broad-spectrum influence these receptors produce in complex pathophysiological context in our body highlights their role as precise interpreters of distinctive angiotensinergic peptide cues. This review article summarizes findings published in the last 15 years on the structure, pharmacology, signaling, physiology, and disease states related to angiotensin receptors. We also discuss the challenges the pharmacologist presently faces in formally accepting newer members as established angiotensin receptors and emphasize necessary future developments. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.
Bower, Rebekah L
2016-01-01
Amylin is an important, but poorly understood, 37 amino acid glucoregulatory hormone with great potential to target metabolic diseases. A working example that the amylin system is one worth developing is the FDA‐approved drug used in insulin‐requiring diabetic patients, pramlintide. However, certain characteristics of pramlintide pharmacokinetics and formulation leave considerable room for further development of amylin‐mimetic compounds. Given that amylin‐mimetic drug design and development is an active area of research, surprisingly little is known about the structure/function relationships of amylin. This is largely due to the unfavourable aggregative and solubility properties of the native peptide sequence, which are further complicated by the composition of amylin receptors. These are complexes of the calcitonin receptor with receptor activity‐modifying proteins. This review explores what is known of the structure–function relationships of amylin and provides insights that can be drawn from the closely related peptide, CGRP. We also describe how this information is aiding the development of more potent and stable amylin mimetics, including peptide hybrids. PMID:27061187
Garay, Camilo; Judge, Gurjeet; Lucarelli, Stefanie; Bautista, Stephen; Pandey, Rohan; Singh, Tanveer; Antonescu, Costin N.
2015-01-01
Epidermal growth factor (EGF) binding to its receptor (EGFR) activates several signaling intermediates, including Akt, leading to control of cell survival and metabolism. Concomitantly, ligand-bound EGFR is incorporated into clathrin-coated pits—membrane structures containing clathrin and other proteins—eventually leading to receptor internalization. Whether clathrin might regulate EGFR signaling at the plasma membrane before vesicle scission is poorly understood. We compared the effect of clathrin perturbation (preventing formation of, or receptor recruitment to, clathrin structures) to that of dynamin2 (allowing formation of clathrin structures but preventing EGFR internalization) under conditions in which EGFR endocytosis is clathrin dependent. Clathrin perturbation by siRNA gene silencing, with the clathrin inhibitor pitstop2, or knocksideways silencing inhibited EGF-simulated Gab1 and Akt phosphorylation in ARPE-19 cells. In contrast, perturbation of dynamin2 with inhibitors or by siRNA gene silencing did not affect EGF-stimulated Gab1 or Akt phosphorylation. EGF stimulation enriched Gab1 and phospho-Gab1 within clathrin structures. ARPE-19 cells have low ErbB2 expression, and overexpression and knockdown experiments revealed that robust ErbB2 expression bypassed the requirement for clathrin for EGF-stimulated Akt phosphorylation. Thus clathrin scaffolds may represent unique plasma membrane signaling microdomains required for signaling by certain receptors, a function that can be separated from vesicle formation. PMID:26246598
Lychakov, D V; Pashchinin, A N; Boiadzhieva-Mikhaĭlova, A; Khristov, I
1989-01-01
The receptor organs of the vestibular apparatus of rats flown for 7 days on Cosmos-1667 were examined. Serial sections were examined by light microscopy, some utriculus sections by electron microscopy, and otolith membranes by scanning electron microscopy. The fixation method used revealed a distinct structural heterogeneity of the receptor epithelium. In the striola area of the utriculus and sacculus as well as in the central apical area of cristae there are receptor cells surrounded by enlarged cup-like nerve endings. The nerve endings occupy over 70% of the cup-receptor cell complex. The area incorporating the enlarged nerve endings differs in size from animal to animal and from left to right ear in the same animal. The flown rat that was the first to be killed after recovery showed a very well pronounced asymmetry: in the right ear enlarged cups were seen all over the epithelium while in the left ear they were located in distinct spots. Since such changes were not identified in the remaining flown and control rats, it is concluded that they were produced by space flight effects but remained reversible and disappeared after recovery. This paper describes the causes responsible of the changes and their structural and functional relevances as well as other structural modifications that should be considered during vestibular studies.
1989-09-30
polyethylenimine . The filters were washed with 3x4 ml of the same buffer and bound radioactivity was determined by scintillation counting. Nonspecific binding was...then autoradiographed for 6 hours on preflashed8 Kodak XAR film . Samples in 5..pl aliquots were applied to freshly glow- discharged carbon support...quench buffer containing 0.5% Triton X-100. The membrane was washed with buffer and autoradiographed orn preflashed Kodak XAR5 film . Geysen Epitope
MET Receptor Tyrosine Kinase as an Autism Genetic Risk Factor
Peng, Yun; Huentelman, Matthew; Smith, Christopher; Qiu, Shenfeng
2014-01-01
In this chapter, we will briefly discuss recent literature on the role of MET receptor tyrosine kinase (RTK) in brain development and how perturbation of MET signaling may alter normal neurodevelopmental outcomes. Recent human genetic studies have established MET as a risk factor for autism, and the molecular and cellular underpinnings of this genetic risk are only beginning to emerge from obscurity. Unlike many autism risk genes that encode synaptic proteins, the spatial and temporal expression pattern of MET RTK indicates this signaling system is ideally situated to regulate neuronal growth, functional maturation, and establishment of functional brain circuits, particularly in those brain structures involved in higher levels of cognition, social skills, and executive functions. PMID:24290385
Won, Jonghun; Lee, Gyu Rie; Park, Hahnbeom; Seok, Chaok
2018-06-07
The second extracellular loops (ECL2s) of G-protein-coupled receptors (GPCRs) are often involved in GPCR functions, and their structures have important implications in drug discovery. However, structure prediction of ECL2 is difficult because of its long length and the structural diversity among different GPCRs. In this study, a new ECL2 conformational sampling method involving both template-based and ab initio sampling was developed. Inspired by the observation of similar ECL2 structures of closely related GPCRs, a template-based sampling method employing loop structure templates selected from the structure database was developed. A new metric for evaluating similarity of the target loop to templates was introduced for template selection. An ab initio loop sampling method was also developed to treat cases without highly similar templates. The ab initio method is based on the previously developed fragment assembly and loop closure method. A new sampling component that takes advantage of secondary structure prediction was added. In addition, a conserved disulfide bridge restraining ECL2 conformation was predicted and analytically incorporated into sampling, reducing the effective dimension of the conformational search space. The sampling method was combined with an existing energy function for comparison with previously reported loop structure prediction methods, and the benchmark test demonstrated outstanding performance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Jinghua; Marnell, Lorraine L.; Marjon, Kristopher D.
Pentraxins are a family of ancient innate immune mediators conserved throughout evolution. The classical pentraxins include serum amyloid P component (SAP) and C-reactive protein, which are two of the acute-phase proteins synthesized in response to infection. Both recognize microbial pathogens and activate the classical complement pathway through C1q. More recently, members of the pentraxin family were found to interact with cell-surface Fc{gamma} receptors (Fc{gamma}R) and activate leukocyte-mediated phagocytosis. Here we describe the structural mechanism for pentraxin's binding to Fc{gamma}R and its functional activation of Fc{gamma}R-mediated phagocytosis and cytokine secretion. The complex structure between human SAP and Fc{gamma}RIIa reveals a diagonallymore » bound receptor on each SAP pentamer with both D1 and D2 domains of the receptor contacting the ridge helices from two SAP subunits. The 1:1 stoichiometry between SAP and Fc{gamma}RIIa infers the requirement for multivalent pathogen binding for receptor aggregation. Mutational and binding studies show that pentraxins are diverse in their binding specificity for Fc{gamma}R isoforms but conserved in their recognition structure. The shared binding site for SAP and IgG results in competition for Fc{gamma}R binding and the inhibition of immune-complex-mediated phagocytosis by soluble pentraxins. These results establish antibody-like functions for pentraxins in the Fc{gamma}R pathway, suggest an evolutionary overlap between the innate and adaptive immune systems, and have new therapeutic implications for autoimmune diseases.« less
Żmudzki, Paweł; Satała, Grzegorz; Chłoń-Rzepa, Grażyna; Bojarski, Andrzej J; Kazek, Grzegorz; Siwek, Agata; Gryboś, Anna; Głuch-Lutwin, Monika; Wesołowska, Anna; Pawłowski, Maciej
2016-10-01
In our previous papers, we have reported that some 8-amino-1,3-dimethyl-1H-purine-2,6(3H,7H)-dione derivatives possessed high affinity and displayed agonistic, partial agonistic, or antagonistic activity for serotonin 5-HT 1A and dopamine D 2 receptors. In order to examine further the influence of the substituent in the position 8 of the purine moiety and the influence of the xanthine core on the affinity for serotonin 5-HT 1A , 5-HT 2A , 5-HT 6 , 5-HT 7 , and dopamine D 2 receptors, two series of 1-arylpiperazynylalkyl derivatives of 8-amino-3,7-dimethyl-1H-purine-2,6(3H,7H)-dione were synthesized. All the final compounds were investigated in in vitro competition binding experiments for the serotonin 5-HT 1A , 5-HT 2A , 5-HT 6 , 5-HT 7 , and dopamine D 2 receptors. The structure-affinity relationships for this group of compounds were discussed. For selected compounds, the functional assays for the 5-HT 1A and D 2 receptors were carried out. The results of the assays indicated that these groups of derivatives possessed antagonistic activity for 5-HT 1A receptors and agonistic, partial agonistic, or antagonistic activity for D 2 receptors. In total, 26 new compounds were synthesized, 20 of which were tested in in vitro binding experiments and 5 were tested in in vitro functional assays. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Koizumi, Taichi; Terada, Tohru; Nakajima, Ken-ichiro; Kojima, Masaki; Koshiba, Seizo; Matsumura, Yoshitaka; Kaneda, Kohei; Asakura, Tomiko; Shimizu-Ibuka, Akiko; Abe, Keiko; Misaka, Takumi
2015-01-01
Neoculin (NCL) is a heterodimeric protein isolated from the edible fruit of Curculigo latifolia. It exerts a taste-modifying activity by converting sourness to sweetness. We previously demonstrated that NCL changes its action on the human sweet receptor hT1R2-hT1R3 from antagonism to agonism as the pH changes from neutral to acidic values, and that the histidine residues of NCL molecule play critical roles in this pH-dependent functional change. Here, we comprehensively screened key amino acid residues of NCL using nuclear magnetic resonance (NMR) spectroscopy and alanine scanning mutagenesis. We found that the mutations of Arg48, Tyr65, Val72 and Phe94 of NCL basic subunit increased or decreased both the antagonist and agonist activities. The mutations had only a slight effect on the pH-dependent functional change. These residues should determine the affinity of NCL for the receptor regardless of pH. Their locations were separated from the histidine residues responsible for the pH-dependent functional change in the tertiary structure. From these results, we concluded that NCL interacts with hT1R2-hT1R3 through a pH-independent affinity interface including the four residues and a pH-dependent activation interface including the histidine residues. Thus, the receptor activation is induced by local structural changes in the pH-dependent interface. PMID:26263392
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yong; Kovach, Amanda; Suino-Powell, Kelly
2008-07-23
The functional interaction between the peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) and its coactivator PGC-1{alpha} is crucial for the normal physiology of PPAR{gamma} and its pharmacological response to antidiabetic treatment with rosiglitazone. Here we report the crystal structure of the PPAR{gamma} ligand-binding domain bound to rosiglitazone and to a large PGC-1{alpha} fragment that contains two LXXLL-related motifs. The structure reveals critical contacts mediated through the first LXXLL motif of PGC-1{alpha} and the PPAR{gamma} coactivator binding site. Through a combination of biochemical and structural studies, we demonstrate that the first LXXLL motif is the most potent among all nuclear receptor coactivator motifsmore » tested, and only this motif of the two LXXLL-related motifs in PGC-1{alpha} is capable of binding to PPAR{gamma}. Our studies reveal that the strong interaction of PGC-1{alpha} and PPAR{gamma} is mediated through both hydrophobic and specific polar interactions. Mutations within the context of the full-length PGC-1{alpha} indicate that the first PGC-1{alpha} motif is necessary and sufficient for PGC-1{alpha} to coactivate PPAR{gamma} in the presence or absence of rosiglitazone. These results provide a molecular basis for specific recruitment and functional interplay between PPAR{gamma} and PGC-1{alpha} in glucose homeostasis and adipocyte differentiation.« less
Wolf, Lisa; Herr, Christian; Niederstraßer, Julia; Beisswenger, Christoph; Bals, Robert
2017-01-01
The receptor for advanced glycation endproducts (RAGE) is highly expressed in the lung but its physiological functions in this organ is still not completely understood. To determine the contribution of RAGE to physiological functions of the lung, we analyzed pulmonary mechanics and structure of wildtype and RAGE deficient (RAGE-/-) mice. RAGE deficiency spontaneously resulted in a loss of lung structure shown by an increased mean chord length, increased respiratory system compliance, decreased respiratory system elastance and increased concentrations of serum protein albumin in bronchoalveolar lavage fluids. Pulmonary expression of RAGE was mainly localized on alveolar epithelial cells and alveolar macrophages. Primary murine alveolar epithelial cells isolated from RAGE-/- mice revealed an altered differentiation and defective barrier formation under in vitro conditions. Stimulation of interferone-y (IFNy)-activated alveolar macrophages deficient for RAGE with Toll-like receptor (TLR) ligands resulted in significantly decreased release of proinflammatory cytokines and chemokines. Exposure to chronic cigarette smoke did not affect emphysema-like changes in lung parenchyma in RAGE-/- mice. Acute cigarette smoke exposure revealed a modified inflammatory response in RAGE-/- mice that was characterized by an influx of macrophages and a decreased keratinocyte-derived chemokine (KC) release. Our data suggest that RAGE regulates the differentiation of alveolar epithelial cells and impacts on the development and maintenance of pulmonary structure. In cigarette smoke-induced lung pathology, RAGE mediates inflammation that contributes to lung damage.
Stahlschmidt, Wiebke; Robertson, Mark J.; Robinson, Phillip J.; McCluskey, Adam; Haucke, Volker
2014-01-01
Clathrin plays important roles in intracellular membrane traffic including endocytosis of plasma membrane proteins and receptors and protein sorting between the trans-Golgi network (TGN) and endosomes. Whether clathrin serves additional roles in receptor recycling, degradative sorting, or constitutive secretion has remained somewhat controversial. Here we have used acute pharmacological perturbation of clathrin terminal domain (TD) function to dissect the role of clathrin in intracellular membrane traffic. We report that internalization of major histocompatibility complex I (MHCI) is inhibited in cells depleted of clathrin or its major clathrin adaptor complex 2 (AP-2), a phenotype mimicked by application of Pitstop® inhibitors of clathrin TD function. Hence, MHCI endocytosis occurs via a clathrin/AP-2-dependent pathway. Acute perturbation of clathrin also impairs the dynamics of intracellular clathrin/adaptor complex 1 (AP-1)- or GGA (Golgi-localized, γ-ear-containing, Arf-binding protein)-coated structures at the TGN/endosomal interface, resulting in the peripheral dispersion of mannose 6-phosphate receptors. By contrast, secretory traffic of vesicular stomatitis virus G protein, recycling of internalized transferrin from endosomes, or degradation of EGF receptor proceeds unperturbed in cells with impaired clathrin TD function. These data indicate that clathrin is required for the function of AP-1- and GGA-coated carriers at the TGN but may be dispensable for outward traffic en route to the plasma membrane. PMID:24407285
Crystal structure of the human OX2 orexin receptor bound to the insomnia drug suvorexant
NASA Astrophysics Data System (ADS)
Yin, Jie; Mobarec, Juan Carlos; Kolb, Peter; Rosenbaum, Daniel M.
2015-03-01
The orexin (also known as hypocretin) G protein-coupled receptors (GPCRs) respond to orexin neuropeptides in the central nervous system to regulate sleep and other behavioural functions in humans. Defects in orexin signalling are responsible for the human diseases of narcolepsy and cataplexy; inhibition of orexin receptors is an effective therapy for insomnia. The human OX2 receptor (OX2R) belongs to the β branch of the rhodopsin family of GPCRs, and can bind to diverse compounds including the native agonist peptides orexin-A and orexin-B and the potent therapeutic inhibitor suvorexant. Here, using lipid-mediated crystallization and protein engineering with a novel fusion chimaera, we solved the structure of the human OX2R bound to suvorexant at 2.5 Å resolution. The structure reveals how suvorexant adopts a π-stacked horseshoe-like conformation and binds to the receptor deep in the orthosteric pocket, stabilizing a network of extracellular salt bridges and blocking transmembrane helix motions necessary for activation. Computational docking suggests how other classes of synthetic antagonists may interact with the receptor at a similar position in an analogous π-stacked fashion. Elucidation of the molecular architecture of the human OX2R expands our understanding of peptidergic GPCR ligand recognition and will aid further efforts to modulate orexin signalling for therapeutic ends.
Functional Human α7 Nicotinic Acetylcholine Receptor (nAChR) Generated from Escherichia coli.
Tillman, Tommy S; Alvarez, Frances J D; Reinert, Nathan J; Liu, Chuang; Wang, Dawei; Xu, Yan; Xiao, Kunhong; Zhang, Peijun; Tang, Pei
2016-08-26
Human Cys-loop receptors are important therapeutic targets. High-resolution structures are essential for rational drug design, but only a few are available due to difficulties in obtaining sufficient quantities of protein suitable for structural studies. Although expression of proteins in E. coli offers advantages of high yield, low cost, and fast turnover, this approach has not been thoroughly explored for full-length human Cys-loop receptors because of the conventional wisdom that E. coli lacks the specific chaperones and post-translational modifications potentially required for expression of human Cys-loop receptors. Here we report the successful production of full-length wild type human α7nAChR from E. coli Chemically induced chaperones promote high expression levels of well-folded proteins. The choice of detergents, lipids, and ligands during purification determines the final protein quality. The purified α7nAChR not only forms pentamers as imaged by negative-stain electron microscopy, but also retains pharmacological characteristics of native α7nAChR, including binding to bungarotoxin and positive allosteric modulators specific to α7nAChR. Moreover, the purified α7nAChR injected into Xenopus oocytes can be activated by acetylcholine, choline, and nicotine, inhibited by the channel blockers QX-222 and phencyclidine, and potentiated by the α7nAChR specific modulators PNU-120596 and TQS. The successful generation of functional human α7nAChR from E. coli opens a new avenue for producing mammalian Cys-loop receptors to facilitate structure-based rational drug design. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Molecular determinants of orexin receptor-arrestin-ubiquitin complex formation.
Jaeger, Werner C; Seeber, Ruth M; Eidne, Karin A; Pfleger, Kevin D G
2014-01-01
The orexin system regulates a multitude of key physiological processes, particularly involving maintenance of metabolic homeostasis. Consequently, there is considerable potential for pharmaceutical development for the treatment of disorders from narcolepsy to metabolic syndrome. It acts through the hormonal activity of two endogenous peptides, orexin A binding to orexin receptors 1 and 2 (OX₁ and OX₂) with similar affinity, and orexin B binding to OX₂ with higher affinity than OX₁ receptors. We have previously revealed data differentiating orexin receptor subtypes with respect to their relative stability in forming orexin receptor-arrestin-ubiquitin complexes measured by BRET. Recycling and cellular signalling distinctions were also observed. Here, we have investigated, using BRET, the molecular determinants involved in providing OX₂ receptors with greater β-arrestin-ubiquitin complex stability. The contribution of the C-terminal tail of the OX receptors was investigated by bulk substitution and site-specific mutagenesis using BRET and inositol phosphate assays. Replacement of the OX₁ receptor C-terminus with that of the OX₂ receptor did not result in the expected gain of function, indicating a role for intracellular domain configuration in addition to primary structure. Furthermore, two out of the three putative serine/threonine clusters in the C-terminus were found to be involved in OX₂ receptor-β-arrestin-ubiquitin complex formation. This study provides fundamental insights into the molecular elements that influence receptor-arrestin-ubiquitin complex formation. Understanding how and why the orexin receptors can be functionally differentiated brings us closer to exploiting these receptors as drug targets. © 2013 The Authors. British Journal of Pharmacology published by John Wiley &. Sons Ltd on behalf of The British Pharmacological Society.
Synthetic alleles at position 121 define a functional domain of human interleukin-1 beta.
Ambrosetti, D C; Palla, E; Mirtella, A; Galeotti, C; Solito, E; Navarra, P; Parente, L; Melli, M
1996-06-01
The non-conservative substitution of the tyrosine residue at position 121 of human interleukin-1 beta (IL-1 beta) generates protein mutants showing strong reduction of the capacity to induce (a) prostaglandin E2 (PGE2) release from fibroblasts and smooth muscle cells, (b) murine T-cells proliferation and (c) activation of interleukin-6 (IL-6) gene expression. It is generally accepted that these functions are mediated by the type-I interleukin-1 receptor (IL-1RI). However, the mutant proteins maintain the binding affinity to the types-I and II IL-1 receptors, which is the same as the control IL-1 beta, suggesting that this amino acid substitution does not alter the structure of the molecule, except locally. Thus we have identified a new functional site of IL-1 beta different from the known receptor binding region, responsible for fundamental IL-1 beta functions. Moreover, we show that the same mutants maintain at least two hypothalamic functions, that is, the in vitro short-term PGE2 release from rat hypothalamus and the induction of fever in rabbits. This result suggests that there is yet another site of the molecule responsible for the hypothalamic functions, implying that multiple active sites on the IL-1 beta molecule, possibly binding to more than one receptor chain, trigger different signals.
Understanding the broad influence of sex hormones and sex differences in the brain.
McEwen, Bruce S; Milner, Teresa A
2017-01-02
Sex hormones act throughout the entire brain of both males and females via both genomic and nongenomic receptors. Sex hormones can act through many cellular and molecular processes that alter structure and function of neural systems and influence behavior as well as providing neuroprotection. Within neurons, sex hormone receptors are found in nuclei and are also located near membranes, where they are associated with presynaptic terminals, mitochondria, spine apparatus, and postsynaptic densities. Sex hormone receptors also are found in glial cells. Hormonal regulation of a variety of signaling pathways as well as direct and indirect effects on gene expression induce spine synapses, up- or downregulate and alter the distribution of neurotransmitter receptors, and regulate neuropeptide expression and cholinergic and GABAergic activity as well as calcium sequestration and oxidative stress. Many neural and behavioral functions are affected, including mood, cognitive function, blood pressure regulation, motor coordination, pain, and opioid sensitivity. Subtle sex differences exist for many of these functions that are developmentally programmed by hormones and by not yet precisely defined genetic factors, including the mitochondrial genome. These sex differences and responses to sex hormones in brain regions, which influence functions not previously regarded as subject to such differences, indicate that we are entering a new era of our ability to understand and appreciate the diversity of gender-related behaviors and brain functions. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Understanding the Broad Influence of Sex Hormones and Sex Differences in the Brain
McEwen, Bruce S.; Milner, Teresa A.
2016-01-01
Sex hormones act throughout the entire brain of both males and females via both genomic and non-genomic receptors. Sex hormones can act through many cellular and molecular processes that alter structure and function of neural systems and influence behavior as well as providing neuroprotection. Within neurons, sex hormone receptors are found in nuclei and are also located near membranes where they are associated with presynaptic terminals, mitochondria, spine apparatus, post-synaptic densities. Sex hormone receptors also are found in glial cells. Hormonal regulation of a variety of signaling pathways as well as direct and indirect effects upon gene expression induce spine synapses, up- or down-regulate and alter the distribution of neurotransmitter receptors, regulate neuropeptide expression and cholinergic and GABAergic activity as well as calcium sequestration and oxidative stress. Many neural and behavioral functions are affected, including mood, cognitive function, blood pressure regulation, motor coordination, pain and opioid sensitivity. Subtle sex differences exist for many of these functions that are developmentally programmed by hormones and by not-yet-precisely-defined genetic factors including the mitochondrial genome. These sex differences and responses to sex hormones in brain regions, and upon functions not previously regarded as subject to such differences, indicates that we are entering a new era of our ability to understand and appreciate the diversity of gender-related behaviors and brain functions. PMID:27870427
Bridgham, Jamie T.; Keay, June; Ortlund, Eric A.; Thornton, Joseph W.
2014-01-01
An important goal in molecular evolution is to understand the genetic and physical mechanisms by which protein functions evolve and, in turn, to characterize how a protein's physical architecture influences its evolution. Here we dissect the mechanisms for an evolutionary shift in function in the mollusk ortholog of the steroid hormone receptors (SRs), a family of biologically essential transcription factors. In vertebrates, the activity of SRs allosterically depends on binding a hormonal ligand; in mollusks, however, the SR ortholog (called ER, because of high sequence similarity to vertebrate estrogen receptors) activates transcription in the absence of ligand and does not respond to steroid hormones. To understand how this shift in regulation evolved, we combined evolutionary, structural, and functional analyses. We first determined the X-ray crystal structure of the ER of the Pacific oyster Crassostrea gigas (CgER), and found that its ligand pocket is filled with bulky residues that prevent ligand occupancy. To understand the genetic basis for the evolution of mollusk ERs' unique functions, we resurrected an ancient SR progenitor and characterized the effect of historical amino acid replacements on its functions. We found that reintroducing just two ancient replacements from the lineage leading to mollusk ERs recapitulates the evolution of full constitutive activity and the loss of ligand activation. These substitutions stabilize interactions among key helices, causing the allosteric switch to become “stuck” in the active conformation and making activation independent of ligand binding. Subsequent changes filled the ligand pocket without further affecting activity; by degrading the allosteric switch, these substitutions vestigialized elements of the protein's architecture required for ligand regulation and made reversal to the ancestral function more complex. These findings show how the physical architecture of allostery enabled a few large-effect mutations to trigger a profound evolutionary change in the protein's function and shaped the genetics of evolutionary reversibility. PMID:24415950
Computational approaches for drug discovery.
Hung, Che-Lun; Chen, Chi-Chun
2014-09-01
Cellular proteins are the mediators of multiple organism functions being involved in physiological mechanisms and disease. By discovering lead compounds that affect the function of target proteins, the target diseases or physiological mechanisms can be modulated. Based on knowledge of the ligand-receptor interaction, the chemical structures of leads can be modified to improve efficacy, selectivity and reduce side effects. One rational drug design technology, which enables drug discovery based on knowledge of target structures, functional properties and mechanisms, is computer-aided drug design (CADD). The application of CADD can be cost-effective using experiments to compare predicted and actual drug activity, the results from which can used iteratively to improve compound properties. The two major CADD-based approaches are structure-based drug design, where protein structures are required, and ligand-based drug design, where ligand and ligand activities can be used to design compounds interacting with the protein structure. Approaches in structure-based drug design include docking, de novo design, fragment-based drug discovery and structure-based pharmacophore modeling. Approaches in ligand-based drug design include quantitative structure-affinity relationship and pharmacophore modeling based on ligand properties. Based on whether the structure of the receptor and its interaction with the ligand are known, different design strategies can be seed. After lead compounds are generated, the rule of five can be used to assess whether these have drug-like properties. Several quality validation methods, such as cost function analysis, Fisher's cross-validation analysis and goodness of hit test, can be used to estimate the metrics of different drug design strategies. To further improve CADD performance, multi-computers and graphics processing units may be applied to reduce costs. © 2014 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Taguchi, Takahiro; Testa, J.R.; Mitcham, J.L.
This report describes the localization of the the TIL gene to human chromosome 4p14 using fluorescence in situ hybridization. This gene encodes a protein which is related to the Drosophila transmembrane receptor Toll and the mammalian interleukin-1 receptor, which share similarities in structure and function. The Drosophila gene is also important during embryonic development, which makes TIL a candidate locus for human congenital malformations that are genetically linked to human chromosome 4. 17 refs., 1 fig.
Borthakur, Susmita; Lee, HyeongJu; Kim, SoonJeung; Wang, Bing-Cheng; Buck, Matthias
2014-01-01
The sterile α motif (SAM) domain of the ephrin receptor tyrosine kinase, EphA2, undergoes tyrosine phosphorylation, but the effect of phosphorylation on the structure and interactions of the receptor is unknown. Studies to address these questions have been hindered by the difficulty of obtaining site-specifically phosphorylated proteins in adequate amounts. Here, we describe the use of chemically synthesized and specifically modified domain-length peptides to study the behavior of phosphorylated EphA2 SAM domains. We show that tyrosine phosphorylation of any of the three tyrosines, Tyr921, Tyr930, and Tyr960, has a surprisingly small effect on the EphA2 SAM structure and stability. However, phosphorylation at Tyr921 and Tyr930 enables differential binding to the Src homology 2 domain of the adaptor protein Grb7, which we propose will lead to distinct functional outcomes. Setting up different signaling platforms defined by selective interactions with adaptor proteins thus adds another level of regulation to EphA2 signaling. PMID:24825902
Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
Reuten, Raphael; Patel, Trushar R.; McDougall, Matthew; Rama, Nicolas; Nikodemus, Denise; Gibert, Benjamin; Delcros, Jean-Guy; Prein, Carina; Meier, Markus; Metzger, Stéphanie; Zhou, Zhigang; Kaltenberg, Jennifer; McKee, Karen K.; Bald, Tobias; Tüting, Thomas; Zigrino, Paola; Djonov, Valentin; Bloch, Wilhelm; Clausen-Schaumann, Hauke; Poschl, Ernst; Yurchenco, Peter D.; Ehrbar, Martin; Mehlen, Patrick; Stetefeld, Jörg; Koch, Manuel
2016-01-01
Netrins, a family of laminin-related molecules, have been proposed to act as guidance cues either during nervous system development or the establishment of the vascular system. This was clearly demonstrated for netrin-1 via its interaction with the receptors DCC and UNC5s. However, mainly based on shared homologies with netrin-1, netrin-4 was also proposed to play a role in neuronal outgrowth and developmental/pathological angiogenesis via interactions with netrin-1 receptors. Here, we present the high-resolution structure of netrin-4, which shows unique features in comparison with netrin-1, and show that it does not bind directly to any of the known netrin-1 receptors. We show that netrin-4 disrupts laminin networks and basement membranes (BMs) through high-affinity binding to the laminin γ1 chain. We hypothesize that this laminin-related function is essential for the previously described effects on axon growth promotion and angiogenesis. Our study unveils netrin-4 as a non-enzymatic extracellular matrix protein actively disrupting pre-existing BMs. PMID:27901020
A Promising Therapeutic Target for Metabolic Diseases: Neuropeptide Y Receptors in Humans.
Yi, Min; Li, Hekai; Wu, Zhiye; Yan, Jianyun; Liu, Qicai; Ou, Caiwen; Chen, Minsheng
2018-01-01
Human neuropeptide Y (hNPY) is one of the most widely expressed neurotransmitters in the human central and peripheral nervous systems. It consists of 36 highly conserved amino acid residues, and was first isolated from the porcine hypothalamus in 1982. While it is the most recently discovered member of the pancreatic polypeptide family (which includes neuropeptide Y, gut-derived hormone peptide YY, and pancreatic polypeptide), NPY is the most abundant peptide found in the mammalian brain. In order to exert particular functions, NPY needs to bind to the NPY receptor to activate specific signaling pathways. NPY receptors belong to the class A or rhodopsin-like G-protein coupled receptor (GPCR) family and signal via cell-surface receptors. By binding to GPCRs, NPY plays a crucial role in various biological processes, including cortical excitability, stress response, food intake, circadian rhythms, and cardiovascular function. Abnormal regulation of NPY is involved in the development of a wide range of diseases, including obesity, hypertension, atherosclerosis, epilepsy, metabolic disorders, and many cancers. Thus far, five receptors have been cloned from mammals (Y1, Y2, Y4, Y5, and y6), but only four of these (hY1, hY2, hY4, and hY5) are functional in humans. In this review, we summarize the structural characteristics of human NPY receptors and their role in metabolic diseases. © 2018 The Author(s). Published by S. Karger AG, Basel.
Bruno, Agostino; Beato, Claudia; Costantino, Gabriele
2011-04-01
G-protein coupled receptors may exist as functional homodimers, heterodimers and even as higher aggregates. In this work, we investigate the 5-HT(2A) receptor, which is a known target for antipsychotic drugs. Recently, 5-HT(2A) has been shown to form functional homodimers and heterodimers with the mGluR2 receptor. The objective of this study is to build up 3D models of the 5-HT(2A)/mGluR2 heterodimer and of the 5-HT(2A)-5-HT(2A) homodimer, and to evaluate the impact of the dimerization interface on the shape of the 5-HT(2A) binding pocket by using molecular dynamics simulations and docking studies. The heterodimer, homodimer and monomeric 5-HT(2A) receptors were simulated by molecular dynamics for 40 ns each. The trajectories were clustered and representative structures of six clusters for each system were generated. Inspection of the these representative structures clearly indicate an effect of the dimerization interface on the topology of the binding pocket. Docking studies allowed to generate receiver operating characteristic curves for a set of 5-HT(2A) ligands, indicating that different complexes prefer different classes of 5-HT(2A) ligands. This study clearly indicates that the presence of a dimerization interface must explicitly be considered when studying G-protein coupled receptors known to exist as dimers. Molecular dynamics simulation and cluster analysis are appropriate tools to study the phenomenon.