Sample records for recognizing conserved regions

  1. Human monoclonal antibodies that recognize conserved epitopes in the core-lipid A region of lipopolysaccharides.

    PubMed Central

    Pollack, M; Raubitschek, A A; Larrick, J W


    Epstein-Barr virus (EBV)-transformed human B lymphocytes were fused with a murine-human heteromyeloma to produce stable hybrid cell lines that secreted human monoclonal antibodies (mAbs) of the IgM class that recognized conserved epitopes in the core-lipid A region of lipopolysaccharides (LPS). Three of the mAbs reacted with epitopes on the lipid A moiety, while a fourth recognized a determinant in the core oligosaccharide. The lipid A-specific mAbs cross-reacted with heterologous rough LPS and with lipid As released by acid hydrolysis of different intact (smooth) LPS. Carbohydrate groups in the O-side chain and core oligosaccharide of isolated, smooth LPS restricted antibody access to antigenic sites on lipid A. Yet, one lipid A-reactive mAb recognized its epitope on the surfaces of a variety of intact bacteria. These findings confirm the presence of highly conserved epitopes in the core-lipid A complex and prove the existence of human B cell clones with the potential for secreting high avidity IgM antibodies that react with these widely shared determinants. Such human mAbs might provide protective activity against disease caused by diverse gram-negative bacteria. Images PMID:2437155

  2. Cytolytic T lymphocytes (CTLs) from HIV-1 subtype C-infected Indian patients recognize CTL epitopes from a conserved immunodominant region of HIV-1 Gag and Nef.


    Thakar, Madhuri R; Bhonge, Leena S; Lakhashe, Samir K; Shankarkumar, U; Sane, Suvarna S; Kulkarni, Smita S; Mahajan, Bharati A; Paranjape, Ramesh S


    Analysis of the human immunodeficiency virus type 1 (HIV-1) cytolytic T lymphocyte (CTL) epitopes recognized by the targeted population is critical for HIV-1 vaccine design. Peripheral blood mononuclear cells from 47 Indian subjects at different stages of HIV-1 infection were tested for HIV-1 Gag-, Nef-, and Env-specific T cell responses by interferon (IFN)- gamma enzyme-linked immunospot (ELISPOT) assay, using pools of overlapping peptides. The Gag and Nef antigens were targeted by 83% and 36% of responders. Five immunodominant regions, 4 in Gag and 1 in Nef, were identified in the study; these regions are conserved across clades, including the African subtype C clade. Three antigenic regions were also found to be recognized by CTLs of the study participants. These regions were not identified as immunodominant regions in studies performed in Africa, which highlights the importance of differential clustering of responses within HIV-1 subtype C. Twenty-six putative epitopes--15 Gag (10 in p24 and 5 in p17), 10 Nef, and 1 Env (gp 41)--were predicted using a combination of peptide matrix ELISPOT assay and CTL epitope-prediction software. Ninety percent of the predicted epitopes were clustered in the conserved immunodominant regions of the Gag and Nef antigens. Of 26 predicted epitopes, 8 were promiscuous, 3 of which were highly conserved across clades. Three Gag and 4 Nef epitopes were novel. The identification of conserved epitopes will be important in the planning of an HIV-1 vaccine strategy for subtype C-affected regions.

  3. Inability to induce consistent T-cell responses recognizing conserved regions within HIIV-1 antigens: a potential mechanism for lack of vaccine efficacy in the step study

    SciTech Connect

    Korber, Bette; Szinger, James


    T cell based vaccines are based upon the induction of CD8+ T cell memory responses that would be effective in inhibiting infection and subsequent replication of an infecting HIV-1 strain, a process that requires a high probability of matching the epitope induced by vaccination with the infecting viral strain. We compared the frequency and specificity of the CTL epitopes elicited by the replication defective AdS gag/pol/nef vaccine used in the STEP trial with the likelihood of encountering those epitopes among recently sequenced Clade B isolates of HIV-1. On average vaccination elicited only one epitope per gene. Importantly, the highly conserved epitopes in gag, pol, and nef (> 80% of strains in the current collection of the Los Alamos database []) were rarely elicited by vaccination. Moreover there was a statistically significant skewing of the T cell response to relative variable epitopes of each gene; only 20% of persons possessed > 3 T cell responses to epitopes likely to be found in circulating strains in the CladeB populations in which the Step trial was conducted. This inability to elicit T cell responses likely to be found in circulating viral strains is a likely factor in the lack of efficacy of the vaccine utilized in the STEP trial. Modeling of the epitope specific responses elicited by vaccination, we project that a median of 8-10 CD8+ T cell epitopes are required to provide >80% likelihood of eliciting at least 3 CD8+ T cell epitopes that would be found on a circulating population of viruses. Development of vaccine regimens which elicit either a greater breadth of responses or elicit responses to conserved regions of the HIV-1 genome are needed to fully evaluate the concept of whether induction of T cell immunity can alter HIV-1 in vivo.

  4. Kininogen domain 3 contains regions recognized by antiphosphatidylethanolamine antibodies.


    Katsunuma, J; Sugi, T; Inomo, A; Matsubayashi, H; Izumi, S-I; Makino, T


    Antiphosphatidylethanolamine antibodies (APE) have been described in patients with thrombotic diseases and recurrent pregnancy loss (RPL). It has been reported that certain APE are not specific for phosphatidylethanolamine (PE) per se, but are directed to PE-binding plasma proteins, called kininogens. Our recent in vitro data suggest that APE may recognize the domain 3 (D3) region of kininogens. In this study, we have used synthetic peptides that span the D3 of kininogens in inhibition and direct binding studies to identify epitopes that are sites for binding APE. Our present data demonstrate that among 24 RPL patients who were positive for kininogen-dependent immunoglobulin (IgG) APE, 17 patients (70.8%) recognized the LDC27 peptide. We mapped the APE-binding region on D3 using plasma from a RPL patient (X) who had a high titer of IgG APE that recognized LDC27. APE of patient X recognized a 13-residue segment in LDC27, named CNA13. Leu331-Met357 (LDC27) and Cys333-Lys345 (CNA13) are located on the carboxyl-terminal portion of kininogen D3, which is known as the major kininogen heavy chain cell attachment site where it overlaps its cysteine protease inhibitory region. Because APE interferes with the balance of hemostasis in vitro, APE may therefore induce a similar condition in patients thereby causing thrombosis and RPL.

  5. Conserved patterns hidden within group A Streptococcus M protein hypervariability recognize human C4b-binding protein

    SciTech Connect

    Buffalo, Cosmo Z.; Bahn-Suh, Adrian J.; Hirakis, Sophia P.; Biswas, Tapan; Amaro, Rommie E.; Nizet, Victor; Ghosh, Partho


    No vaccine exists against group A Streptococcus (GAS), a leading cause of worldwide morbidity and mortality. A severe hurdle is the hypervariability of its major antigen, the M protein, with >200 different M types known. Neutralizing antibodies typically recognize M protein hypervariable regions (HVRs) and confer narrow protection. In stark contrast, human C4b-binding protein (C4BP), which is recruited to the GAS surface to block phagocytic killing, interacts with a remarkably large number of M protein HVRs (apparently ~90%). Such broad recognition is rare, and we discovered a unique mechanism for this through the structure determination of four sequence-diverse M proteins in complexes with C4BP. The structures revealed a uniform and tolerant ‘reading head’ in C4BP, which detected conserved sequence patterns hidden within hypervariability. Our results open up possibilities for rational therapies that target the M–C4BP interaction, and also inform a path towards vaccine design.

  6. Plant conservation priorities of Xinjiang region, China

    NASA Astrophysics Data System (ADS)

    Li, L. P.; Cui, W. H.; Wang, T.; Tian, S.; Xing, W. J.; Yin, L. K.; Abdusalih, N.; Jiang, Y. M.


    As an important region in the Silk Road, Xinjiang is getting a good chance of developing economy. However at the same time, its natural environment is facing a big challenge. To better protect the plant diversity, it is urgent to make a thorough conservation plan. With a full database of vascular and medicinal plant distributions and nature reserve plant lists and boundaries in Xinjiang of China, we analysed the plant diversity hotspots, protection gaps and proposed the plant conservation priorities of this region. Differed from the widely accepted viewpoints that lots of plants were not included in nature reserves, we found that most of the plants ( > 90%) were actually included in the current nature reserves. We believe that compared with establishing more nature reserves, improving the management of the existing ones is also important. Furthermore, the very few unprotected plants ( < 10%) were distributed mostly in the regions of Aletai, Tacheng, Zhaosu, Manasi, Qitai and Hetian which could be the future conservation priorities.

  7. 76 FR 28954 - International Conservation and Management Measures Recognized by the United States

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Conservation of Migratory Species of Wild Animals. The international conservation and management measures... Agreement between the Government of the Kingdom of Norway and the Government of the USSR...

  8. Conserved Region of Mammalian Retrovirus RNA

    PubMed Central

    Kominami, R.; Hatanaka, M.


    The viral RNAs of various mammalian retroviruses contain highly conserved sequences close to their 3′ ends. This was demonstrated by interviral molecular hybridization between fractionated viral complementary DNA (cDNA) and RNA. cDNA near the 3′ end (cDNA3′) from a rat virus (RPL strain) was fractionated by size and mixed with mouse virus RNA (Rauscher leukemia virus). No hybridization occurred with total cDNA (cDNAtotal), in agreement with previous results, but a cross-reacting sequence was found with the fractionated cDNA3′. The sequences between 50 to 400 nucleotides from the 3′ terminus of heteropolymeric RNA were most hybridizable. The rat viral cDNA3′ hybridized with mouse virus RNA more extensively than with RNA of remotely related retroviruses. The related viral sequence of the rodent viruses (mouse and rat) showed as much divergence in heteroduplex thermal denaturation profiles as did the unique sequence DNA of these two rodents. This suggests that over a period of time, rodent viruses have preserved a sequence with changes correlated to phylogenetic distance of hosts. The cross-reacting sequence of replication-competent retroviruses was conserved even in the genome of the replication-defective sarcoma virus and was also located in these genomes near the 3′ end of 30S RNA. A fraction of RD114 cDNA3′, corresponding to the conserved region, cross-hybridized extensively with RNA of a baboon endogenous virus (M7). Fractions of similar size prepared from cDNA3′ of MPMV, a primate type D virus, hybridized with M7 RNA to a lesser extent. Hybridization was not observed between Mason-Pfizer monkey virus and M7 if total cDNA's were incubated with viral RNAs. The degree of cross-reaction of the shared sequence appeared to be influenced by viral ancestral relatedness and host cell phylogenetic relationships. Thus, the strikingly high extent of cross-reaction at the conserved region between rodent viruses and simian sarcoma virus and between baboon

  9. 76 FR 28060 - Regional Habitat Conservation Plan, Hays County, TX

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Fish and Wildlife Service Regional Habitat Conservation Plan, Hays County, TX AGENCY: Fish and Wildlife... statement, final Hays County regional habitat conservation plan, and draft record of decision. SUMMARY: We... (EIS), the final Hays County regional habitat conservation plan (RHCP) under the National...

  10. Regional Urban Planning for Energy Conservation: Alternative Approaches.

    ERIC Educational Resources Information Center

    Manohar, Shri


    Discusses the role of urban and regional planners in redesigning land use patterns which reinforce energy conservation while preserving satisfying living conditions. A model for evaluating energy conservation planning alternatives for Perth, Australia is described. (AM)

  11. How conserved are the conserved 16S-rRNA regions?

    PubMed Central

    Ortiz Suarez, Luis Enrique


    The 16S rRNA gene has been used as master key for studying prokaryotic diversity in almost every environment. Despite the claim of several researchers to have the best universal primers, the reality is that no primer has been demonstrated to be truly universal. This suggests that conserved regions of the gene may not be as conserved as expected. The aim of this study was to evaluate the conservation degree of the so-called conserved regions flanking the hypervariable regions of the 16S rRNA gene. Data contained in SILVA database (release 123) were used for the study. Primers reported as matches of each conserved region were assembled to form contigs; sequences sizing 12 nucleotides (12-mers) were extracted from these contigs and searched into the entire set of SILVA sequences. Frequency analysis shown that extreme regions, 1 and 10, registered the lowest frequencies. 12-mer frequencies revealed segments of contigs that were not as conserved as expected (≤90%). Fragments corresponding to the primer contigs 3, 4, 5b and 6a were recovered from all sequences in SILVA database. Nucleotide frequency analysis in each consensus demonstrated that only a small fraction of these so-called conserved regions is truly conserved in non-redundant sequences. It could be concluded that conserved regions of the 16S rRNA gene exhibit considerable variation that has to be considered when using this gene as biomarker. PMID:28265511

  12. The Anaplasma marginale msp5 gene encodes a 19-kilodalton protein conserved in all recognized Anaplasma species.

    PubMed Central

    Visser, E S; McGuire, T C; Palmer, G H; Davis, W C; Shkap, V; Pipano, E; Knowles, D P


    Immunization with Anaplasma marginale outer membranes induced immunity against clinical disease which correlated with antibody titer to outer membrane proteins, including a 19-kDa protein (N. Tebele, T. C. McGuire, and G. H. Palmer, Infect. Immun. 59:3199-3204, 1991). This 19-kDa protein, designated major surface protein 5 (MSP-5), was encoded by a single-copy 633-bp gene. The molecular mass of MSP-5, defined in immunoblots by binding to monoclonal antibody ANAF16C1, was conserved among all recognized species of Anaplasma: A. marginale, A. centrale, and A. ovis. Recombinant MSP-5, which absorbed the antibody reactivity of bovine immune serum to native MSP-5, was recognized by anti-A. marginale and anti-A. centrale immune sera in a competitive inhibition assay with monoclonal antibody ANAF16C1. The presence of antibody to the epitope defined by monoclonal antibody ANAF16C1 in all postinfection sera tested indicates that this epitope is a potential diagnostic antigen for use in identifying persistently infected cattle. Images PMID:1280624

  13. Maximizing species conservation in continental Ecuador: a case of systematic conservation planning for biodiverse regions

    PubMed Central

    Lessmann, Janeth; Muñoz, Jesús; Bonaccorso, Elisa


    Ecuador has the largest number of species by area worldwide, but also a low representation of species within its protected areas. Here, we applied systematic conservation planning to identify potential areas for conservation in continental Ecuador, with the aim of increasing the representation of terrestrial species diversity in the protected area network. We selected 809 terrestrial species (amphibians, birds, mammals, and plants), for which distributions were estimated via species distribution models (SDMs), using Maxent. For each species we established conservation goals based on conservation priorities, and estimated new potential protected areas using Marxan conservation planning software. For each selected area, we determined their conservation priority and feasibility of establishment, two important aspects in the decision-making processes. We found that according to our conservation goals, the current protected area network contains large conservation gaps. Potential areas for conservation almost double the surface area of currently protected areas. Most of the newly proposed areas are located in the Coast, a region with large conservation gaps and irreversible changes in land use. The most feasible areas for conservation were found in the Amazon and Andes regions, which encompass more undisturbed habitats, and already harbor most of the current reserves. Our study allows defining a viable strategy for preserving Ecuador's biodiversity, by combining SDMs, GIS-based decision-support software, and priority and feasibility assessments of the selected areas. This approach is useful for complementing protected area networks in countries with great biodiversity, insufficient biological information, and limited resources for conservation. PMID:25360277

  14. Maximizing species conservation in continental Ecuador: a case of systematic conservation planning for biodiverse regions.


    Lessmann, Janeth; Muñoz, Jesús; Bonaccorso, Elisa


    Ecuador has the largest number of species by area worldwide, but also a low representation of species within its protected areas. Here, we applied systematic conservation planning to identify potential areas for conservation in continental Ecuador, with the aim of increasing the representation of terrestrial species diversity in the protected area network. We selected 809 terrestrial species (amphibians, birds, mammals, and plants), for which distributions were estimated via species distribution models (SDMs), using Maxent. For each species we established conservation goals based on conservation priorities, and estimated new potential protected areas using Marxan conservation planning software. For each selected area, we determined their conservation priority and feasibility of establishment, two important aspects in the decision-making processes. We found that according to our conservation goals, the current protected area network contains large conservation gaps. Potential areas for conservation almost double the surface area of currently protected areas. Most of the newly proposed areas are located in the Coast, a region with large conservation gaps and irreversible changes in land use. The most feasible areas for conservation were found in the Amazon and Andes regions, which encompass more undisturbed habitats, and already harbor most of the current reserves. Our study allows defining a viable strategy for preserving Ecuador's biodiversity, by combining SDMs, GIS-based decision-support software, and priority and feasibility assessments of the selected areas. This approach is useful for complementing protected area networks in countries with great biodiversity, insufficient biological information, and limited resources for conservation.

  15. Setting Priorities for Regional Conservation Planning in the Mediterranean Sea

    PubMed Central

    Micheli, Fiorenza; Levin, Noam; Giakoumi, Sylvaine; Katsanevakis, Stelios; Abdulla, Ameer; Coll, Marta; Fraschetti, Simonetta; Kark, Salit; Koutsoubas, Drosos; Mackelworth, Peter; Maiorano, Luigi; Possingham, Hugh P.


    Spatial prioritization in conservation is required to direct limited resources to where actions are most urgently needed and most likely to produce effective conservation outcomes. In an effort to advance the protection of a highly threatened hotspot of marine biodiversity, the Mediterranean Sea, multiple spatial conservation plans have been developed in recent years. Here, we review and integrate these different plans with the goal of identifying priority conservation areas that represent the current consensus among the different initiatives. A review of six existing and twelve proposed conservation initiatives highlights gaps in conservation and management planning, particularly within the southern and eastern regions of the Mediterranean and for offshore and deep sea habitats. The eighteen initiatives vary substantially in their extent (covering 0.1–58.5% of the Mediterranean Sea) and in the location of additional proposed conservation and management areas. Differences in the criteria, approaches and data used explain such variation. Despite the diversity among proposals, our analyses identified ten areas, encompassing 10% of the Mediterranean Sea, that are consistently identified among the existing proposals, with an additional 10% selected by at least five proposals. These areas represent top priorities for immediate conservation action. Despite the plethora of initiatives, major challenges face Mediterranean biodiversity and conservation. These include the need for spatial prioritization within a comprehensive framework for regional conservation planning, the acquisition of additional information from data-poor areas, species or habitats, and addressing the challenges of establishing transboundary governance and collaboration in socially, culturally and politically complex conditions. Collective prioritised action, not new conservation plans, is needed for the north, western, and high seas of the Mediterranean, while developing initial information

  16. Setting priorities for regional conservation planning in the Mediterranean Sea.


    Micheli, Fiorenza; Levin, Noam; Giakoumi, Sylvaine; Katsanevakis, Stelios; Abdulla, Ameer; Coll, Marta; Fraschetti, Simonetta; Kark, Salit; Koutsoubas, Drosos; Mackelworth, Peter; Maiorano, Luigi; Possingham, Hugh P


    Spatial prioritization in conservation is required to direct limited resources to where actions are most urgently needed and most likely to produce effective conservation outcomes. In an effort to advance the protection of a highly threatened hotspot of marine biodiversity, the Mediterranean Sea, multiple spatial conservation plans have been developed in recent years. Here, we review and integrate these different plans with the goal of identifying priority conservation areas that represent the current consensus among the different initiatives. A review of six existing and twelve proposed conservation initiatives highlights gaps in conservation and management planning, particularly within the southern and eastern regions of the Mediterranean and for offshore and deep sea habitats. The eighteen initiatives vary substantially in their extent (covering 0.1-58.5% of the Mediterranean Sea) and in the location of additional proposed conservation and management areas. Differences in the criteria, approaches and data used explain such variation. Despite the diversity among proposals, our analyses identified ten areas, encompassing 10% of the Mediterranean Sea, that are consistently identified among the existing proposals, with an additional 10% selected by at least five proposals. These areas represent top priorities for immediate conservation action. Despite the plethora of initiatives, major challenges face Mediterranean biodiversity and conservation. These include the need for spatial prioritization within a comprehensive framework for regional conservation planning, the acquisition of additional information from data-poor areas, species or habitats, and addressing the challenges of establishing transboundary governance and collaboration in socially, culturally and politically complex conditions. Collective prioritised action, not new conservation plans, is needed for the north, western, and high seas of the Mediterranean, while developing initial information-based plans

  17. Conservation voltage reduction: Estimating methodology for a large regional application

    SciTech Connect

    De Steese, J.G. ); Kennedy, B.W. ); Merrick, S.B. )


    Conservation Voltage Reduction (CVR) is an established and cost-effective practice that has motivated many utilities to investigate its application on individual systems. This paper describes a supply-curve methodology that can determine the conservation value of CVR applied to many distribution systems in a region. In the area served by Bonneville Power Administration involving approximately 150 utilities, the systematic implementations of CVR could conserve between 170 and 268 Average Megawatts at a cost of 5 cents/kWh. This was shown to be a larger resource than might be achievable by applying more conventional efficiency improvements to transmission and distribution (T D) systems in the region.

  18. Conservation voltage reduction: Estimating methodology for a large regional application

    SciTech Connect

    De Steese, J.G.; Kennedy, B.W.; Merrick, S.B.


    Conservation Voltage Reduction (CVR) is an established and cost-effective practice that has motivated many utilities to investigate its application on individual systems. This paper describes a supply-curve methodology that can determine the conservation value of CVR applied to many distribution systems in a region. In the area served by Bonneville Power Administration involving approximately 150 utilities, the systematic implementations of CVR could conserve between 170 and 268 Average Megawatts at a cost of 5 cents/kWh. This was shown to be a larger resource than might be achievable by applying more conventional efficiency improvements to transmission and distribution (T&D) systems in the region.

  19. EPA Recognizes Efforts of More Than 400 Federal Facilities for Green Leadership: Reducing Pollution, Conserving Energy and Saving Money

    EPA Pesticide Factsheets

    WASHINGTON - Today the U.S. Environmental Protection Agency (EPA) recognizes the efforts of more than 400 federal facilities that took steps to reduce pollution, support renewable energy, and operate more efficiently in 2014 as part of the Federal G

  20. An epitope in hepatitis C virus core region recognized by cytotoxic T cells in mice and humans.

    PubMed Central

    Shirai, M; Okada, H; Nishioka, M; Akatsuka, T; Wychowski, C; Houghten, R; Pendleton, C D; Feinstone, S M; Berzofsky, J A


    Several cytotoxic T-lymphocyte (CTL) epitopes have been defined in hepatitis C virus (HCV) proteins. CTL may play an important role in the control of infection by HCV. Here, we identify a highly conserved antigenic site in the HCV core recognized by both murine and human CTL. Spleen cells from mice immunized with a recombinant vaccinia virus expressing the HCV core gene were restimulated in vitro with 11 peptides from the core protein. CTL from H-2d mice responded to a single 16-residue synthetic peptide (HCV 129-144). This conserved epitope was presented by a murine class I major histocompatibility molecule (H-2Dd) to conventional CD4- CD8+ CTL mapped by using transfectants expressing Dd, Ld, or Kd, but was not seen by CTL restricted by H-2b. The murine epitope was mapped to the decapeptide LMGYIPLVGA. The same 16-residue peptide was recognized by CTL from two HCV-seropositive patients but not by CTL from any seronegative donors. CTL from two HLA-A2-positive patients with acute and chronic hepatitides C recognized a 9-residue fragment (DLMGYIPLV) of the peptide presented by HLA-A2 and containing an HLA-A2-binding motif, extending only 1 residue beyond the murine epitope. Therefore, this conserved peptide, seen with murine CTL and human CTL with a very prevalent HLA class I molecule, may be a valuable component of an HCV vaccine against a broad range of HCV isolates. This study demonstrates that the screening for CTL epitopes in mice prior to human study may be useful. PMID:7512163

  1. Exclusion of two major areas on thyroid peroxidase from the immunodominant region containing the conformational epitopes recognized by human autoantibodies.


    Nishikawa, T; Rapoport, B; McLachlan, S M


    We have used a chimeric molecule between thyroid peroxidase (TPO) and myeloperoxidase (MPO) as well as new information on the three-dimensional structure of MPO to refine further our understanding of the location of the TPO-immunodominant region recognized by TPO autoantibodies in patients' sera. In TPO-MPO chimera A, the amino-terminal 146 amino acids of MPO substitute for the amino-terminal 121 amino acids of TPO. We performed fluorescence-activated cell sorter analysis of Chinese hamster ovary cells expressing TPO-MPO-A on their surface using four monoclonal human autoantibody F(ab) (WR1.7, TR1.8, TR1.9, and SP1.4) that define the immunodominant region. All four F(ab) recognized the TPO-MPO-A chimeric molecule to the same extent. In a second approach to refine the location on the TPO-immunodominant region, we compared the ability of the TPO autoantibody F(ab) to inhibit the binding of serum autoantibodies to the monomeric and dimeric forms of human TPO. The F(ab) inhibited equally (approximately 80%) the binding to the TPO monomer and dimer by autoantibodies in the sera of six individual patients. The present observations exclude two major regions of TPO from the autoantibody-immunodominant region, namely the amino-terminal 121 amino acids of the TPO extracellular domain and the contact region between the two TPO monomers. These findings together with previous data on the Mab47/C21 region of TPO and the recently elucidated 3-dimensional structure of highly homologous MPO, narrow, by a process of exclusion, the site on TPO comprising the immunodominant region. The data provide further support for the thesis, still controversial, that the majority of TPO autoantibodies recognize the native molecule.

  2. The relevance of the Mediterranean Region to colonial waterbird conservation

    USGS Publications Warehouse

    Erwin, R.M.; Crivelli, Alain J.; Hafner, Heinz; Fasola, Mauro; Erwin, R. Michael; McCrimmon, Donald A.=


    The Mediterranean Sea is the largest partially enclosed sea in the world and provides habitat to more than 100 species of waterbirds from the Palearctic-North African-Middle Eastern regions. Even though the Mediterranean suffers from pollution, has little tidal influence, and is oligotrophic, more than half of the western Palearctic populations of numerous waterfowl species winter in the region. Thirty-three species of colonial waterbirds breed along the 46,000 km Mediterranean coastline with nine species considered threatened or endangered, mostly because of wetland loss and degradation. The long history of human activity and scientific investigations in the region has taught some valuable lessons. In the area of colonial waterbird biology and conservation, we have learned important lessons about the value of long-term monitoring and research on selected populations. From marking studies of Greater Flamingos (Phoenicopterus ruber roseus) and Little Egrets (Egretta garzetta) results have been used to derive useful information about metapopulation dynamics. Involvement of both African and European biologists allowed year-round Studies of these species that yielded valuable spin-offs for training in avian and wetland conservation. We have also learned the value of man-made wetlands as feeding and nesting sites for some colonial waterbirds. Careful evaluations of the habitat quality of different types of wetlands are required, as in contaminant levels such as lead shot and pesticides. Wetland conservationists have also learned from some instructive mistakes. Dam construction and agricultural incentive programs sponsored by the European Community, the World Bank, and others from the past have largely ignored impacts on wetlands and wildlife. In some areas, economic ventures such as aquaculture operations and salt mining have not involved waterbird habitat needs in their planning. Research and conservation needs include: (1) establishing regional monitoring programs and

  3. Integrating regional conservation priorities for multiple objectives into national policy

    PubMed Central

    Beger, Maria; McGowan, Jennifer; Treml, Eric A.; Green, Alison L.; White, Alan T.; Wolff, Nicholas H.; Klein, Carissa J.; Mumby, Peter J.; Possingham, Hugh P.


    Multinational conservation initiatives that prioritize investment across a region invariably navigate trade-offs among multiple objectives. It seems logical to focus where several objectives can be achieved efficiently, but such multi-objective hotspots may be ecologically inappropriate, or politically inequitable. Here we devise a framework to facilitate a regionally cohesive set of marine-protected areas driven by national preferences and supported by quantitative conservation prioritization analyses, and illustrate it using the Coral Triangle Initiative. We identify areas important for achieving six objectives to address ecosystem representation, threatened fauna, connectivity and climate change. We expose trade-offs between areas that contribute substantially to several objectives and those meeting one or two objectives extremely well. Hence there are two strategies to guide countries choosing to implement regional goals nationally: multi-objective hotspots and complementary sets of single-objective priorities. This novel framework is applicable to any multilateral or global initiative seeking to apply quantitative information in decision making. PMID:26364769

  4. Definition of epitopes and antigens recognized by vaccinia specific immune responses: their conservation in variola virus sequences, and use as a model system to study complex pathogens.


    Sette, Alessandro; Grey, Howard; Oseroff, Carla; Peters, Bjoern; Moutaftsi, Magdalini; Crotty, Shane; Assarsson, Erika; Greenbaum, Jay; Kim, Yohan; Kolla, Ravi; Tscharke, David; Koelle, David; Johnson, R Paul; Blum, Janice; Head, Steven; Sidney, John


    In the last few years, a wealth of information has become available relating to the targets of vaccinia virus (VACV)-specific CD4(+) T cell, CD8(+) T cell and antibody responses. Due to the large size of its genome, encoding more than 200 different proteins, VACV represents a useful model system to study immunity to complex pathogens. Our data demonstrate that both cellular and humoral responses target a large number of antigens and epitopes. This broad spectrum of targets is detected in both mice and humans. CD4(+) T cell responses target late and structural antigens, while CD8(+) T cells preferentially recognize early antigens. While both CD4(+) and CD8(+) T cell responses target different types of antigens, the antigens recognized by T(H) cells are highly correlated with those recognized by antibody responses. We further show that protein abundance and antibody recognition can be used to predict antigens recognized by CD4(+) T cell responses, while early expression at the mRNA level predicts antigens targeted by CD8(+) T cells. Finally, we find that the vast majority of VACV epitopes are conserved in variola virus (VARV), thus suggesting that the epitopes defined herein also have relevance for the efficacy of VACV as a smallpox vaccine.

  5. SWR-C and INO80 chromatin remodelers recognize nucleosome-free regions near +1 nucleosomes.


    Yen, Kuangyu; Vinayachandran, Vinesh; Pugh, B Franklin


    SWR-C/SWR1 and INO80 are multisubunit complexes that catalyze the deposition and removal, respectively, of histone variant H2A.Z from the first nucleosome at the start of genes. How they target and engage these +1 nucleosomes is unclear. Using ChIP-exo, we identified the subnucleosomal placement of 20 of their subunits across the yeast genome. The Swc2 subunit of SWR-C bound a narrowly defined region in the adjacent nucleosome-free region (NFR), where it positioned the Swr1 subunit over one of two sites of H2A.Z deposition at +1. The genomic binding maps suggest that many subunits have a rather plastic organization that allows subunits to exchange between the two complexes. One outcome of promoting H2A/H2A.Z exchange was an enhanced turnover of entire nucleosomes, thereby creating dynamic chromatin at the start of genes. Our findings provide unifying concepts on how these two opposing chromatin remodeling complexes function selectively at the +1 nucleosome of nearly all genes.

  6. cDNA cloning and sequencing of human fibrillarin, a conserved nucleolar protein recognized by autoimmune antisera

    SciTech Connect

    Aris, J.P.; Blobel, G. )


    The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is {approximately}1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain {approximately}75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis.

  7. Molecular cloning of Xenopus fibrillarin, a conserved U3 small nuclear ribonucleoprotein recognized by antisera from humans with autoimmune disease.

    PubMed Central

    Lapeyre, B; Mariottini, P; Mathieu, C; Ferrer, P; Amaldi, F; Amalric, F; Caizergues-Ferrer, M


    Autoantibodies against U3 small nuclear ribonucleoprotein are associated with scleroderma autoimmune disease. They were shown to react with fibrillarin, a 34- to 36-kilodalton protein that has been detected in all eukaryotes tested from humans to yeasts. We isolated a 1.6-kilobase cDNA encoding fibrillarin from a Xenopus laevis cDNA library. The protein contains a 79-residue-long Gly-Arg-rich domain in its N-terminal region and a putative RNA-binding domain with ribonucleoprotein consensus sequence in its central portion. This is the first report of cloning of fibrillarin, and the deduced protein sequence is in agreement with the involvement of the protein in a ribonucleoprotein particle. Images PMID:2136767

  8. A Syntenic Region Conserved from Fish to Mammalian X Chromosome

    PubMed Central

    Guan, Guijun; Yi, Meisheng; Kobayashi, Tohru; Hong, Yunhan; Nagahama, Yoshitaka


    Sex chromosomes bearing the sex-determining gene initiate development along the male or female pathway, no matter which sex is determined by XY male or ZW female heterogamety. Sex chromosomes originate from ancient autosomes but evolved rapidly after the acquisition of sex-determining factors which are highly divergent between species. In the heterogametic male system (XY system), the X chromosome is relatively evolutionary silent and maintains most of its ancestral genes, in contrast to its Y counterpart that has evolved rapidly and degenerated. Sex in a teleost fish, the Nile tilapia (Oreochromis niloticus), is determined genetically via an XY system, in which an unpaired region is present in the largest chromosome pair. We defined the differences in DNA contents present in this chromosome with a two-color comparative genomic hybridization (CGH) and the random amplified polymorphic DNA (RAPD) approach in XY males. We further identified a syntenic segment within this region that is well conserved in several teleosts. Through comparative genome analysis, this syntenic segment was also shown to be present in mammalian X chromosomes, suggesting a common ancestral origin of vertebrate sex chromosomes. PMID:25506037

  9. Identification and characterization of four novel peptide motifs that recognize distinct regions of the transcription factor CP2.


    Kang, Ho Chul; Chung, Bo Mee; Chae, Ji Hyung; Yang, Sung-Il; Kim, Chan Gil; Kim, Chul Geun


    Although ubiquitously expressed, the transcriptional factor CP2 also exhibits some tissue- or stage-specific activation toward certain genes such as globin in red blood cells and interleukin-4 in T helper cells. Because this specificity may be achieved by interaction with other proteins, we screened a peptide display library and identified four consensus motifs in numerous CP2-binding peptides: HXPR, PHL, ASR and PXHXH. Protein-database searching revealed that RE-1 silencing factor (REST), Yin-Yang1 (YY1) and five other proteins have one or two of these CP2-binding motifs. Glutathione S-transferase pull-down and coimmunoprecipitation assays showed that two HXPR motif-containing proteins REST and YY1 indeed were able to bind CP2. Importantly, this binding to CP2 was almost abolished when a double amino acid substitution was made on the HXPR sequence of REST and YY1 proteins. The suppressing effect of YY1 on CP2's transcriptional activity was lost by this point mutation on the HXPR sequence of YY1 and reduced by an HXPR-containing peptide, further supporting the interaction between CP2 and YY1 via the HXPR sequence. Mapping the sites on CP2 for interaction with the four distinct CP2-binding motifs revealed at least three different regions on CP2. This suggests that CP2 recognizes several distinct binding motifs by virtue of employing different regions, thus being able to interact with and regulate many cellular partners.

  10. 75 FR 31463 - Comal County Regional Habitat Conservation Plan, Comal County, TX

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Fish and Wildlife Service Comal County Regional Habitat Conservation Plan, Comal County, TX AGENCY... statement, draft habitat conservation plan, and permit application; announcement of a public hearing... County has completed a draft Habitat Conservation Plan (dHCP) as part of the application package. We...

  11. MHC-I-restricted epitopes conserved among variola and other related orthopoxviruses are recognized by T cells 30 years after vaccination.


    Tang, S T; Wang, M; Lamberth, K; Harndahl, M; Dziegiel, M H; Claesson, M H; Buus, S; Lund, O


    It is many years since the general population has been vaccinated against smallpox virus. Here, we report that human leukocyte antigen (HLA) class I restricted T cell epitopes can be recognized more than 30 years after vaccination. Using bioinformatic methods, we predicted 177 potential cytotoxic T lymphocyte epitopes. Eight epitopes were confirmed to stimulate IFN-gamma release by T cells in smallpox-vaccinated subjects. The epitopes were restricted by five supertypes (HLA-A1, -A2, -A24 -A26 and -B44). Significant T cell responses were detected against 8 of 45 peptides with an HLA class I affinity of K(D) less than or equal to 5 nM, whereas no T cell responses were detected against 60 peptides with an HLA affinity of K(D) more than 5 nM. All epitopes were fully conserved in seven variola, vaccinia and cowpox strains. Knowledge of the long-term response to smallpox vaccination may lead to a better understanding of poxvirus immunity and may aid in the development of new improved vaccines and diagnostic tools.

  12. Restricted immunoglobulin variable region gene usage by normal Ly-1 (CD5+) B cells that recognize phosphatidyl choline

    PubMed Central


    5-15% of lymphocytes in the peritoneums of normal adult B10.H-2aH- 4bp/Wts (2a4b) mice are CD5+ (Ly-1) B cells that recognize phosphatidyl choline (PtC), a phospholipid component of all mammalian cells. We produced a set of IgM-secreting hybridomas from the peritoneal cells of normal, adult 2a4b mice. We found that this set of hybridomas shows a similarly high frequency of antibodies specific for PtC (21 of 86) that also react with bromelain-treated mouse erythrocytes. Restriction fragment analysis of Ig gene rearrangements and analysis of expressed Ig idiotypes reveal that these cells use a restricted set of variable region genes to generate the PtC-specific antibodies. The Ig genes used by the PtC-specific hybridomas appear to be the same as those found in the PtC-specific Ly-1 B cell lymphomas, CH27 and CH34. PMID:2499651

  13. Definition of the region on NS3 which contains multiple epitopes recognized by dengue virus serotype-cross-reactive and flavivirus-cross-reactive, HLA-DPw2-restricted CD4+ T cell clones.


    Okamoto, Y; Kurane, I; Leporati, A M; Ennis, F A


    The epitopes recognized by six CD4+ CD8- cytotoxic T lymphocyte (CTL) clones established from a dengue-3 virus-immune donor were defined. (i) Three CTL clones, JK10, JK34 and JK39, were cross-reactive for dengue virus types 1-4. (ii) One clone, JK28, was cross-reactive for dengue virus types 1-4 and West Nile virus. (iii) Two clones, JK26 and JK49, were cross-reactive for dengue virus types 1-4, West Nile virus and yellow fever virus. The clones, except for JK49, recognized the same epitope on NS3 in an HLA-DPw2-restricted fashion. The smallest synthetic peptide recognized by the five CTL clones was a 10 aa peptide which comprises aa 255-264 on dengue virus NS3. JK49 recognized the overlapping epitope which comprises aa 257-266 in an HLA-DPw2-restricted fashion. Analysis of T cell receptor (TCR) usage by these T cell clones revealed that (i) JK10 and JK34 use V alpha11, and JK34 and JK28 use V beta23, and (ii) the amino acid sequences of the V(D)J junctional region of the TCR were different among these five CTL clones. There were, however, single amino acid conservations among TCRs of some of these T cell clones. These results indicate that the region on NS3 which comprises aa 255-266 contains multiple epitopes recognized by dengue serotype-cross-reactive and flavivirus-cross-reactive CD4+ CTL in an HLA-DPw2-restricted fashion and that a single epitope can be recognized by T cells which have heterogeneous virus specificities.

  14. Identification of the Single Immunodominant Region of the Native Human CC Chemokine Receptor 6 Recognized by Mouse Monoclonal Antibodies.


    Dorgham, Karim; Dejou, Cécile; Piesse, Christophe; Gorochov, Guy; Pène, Jérôme; Yssel, Hans


    Chemokines and their receptors play an important role in cell trafficking and recruitment. The CCR6 chemokine receptor, selectively expressed on leukocyte populations, has been shown to play a deleterious role in the pathogenesis of various chronic inflammatory diseases and, as such, may constitute a prime target in the development of immunotherapeutic treatment. However, to date no neutralizing mouse monoclonal antibodies (mAbs) specific for this chemokine receptor have been reported, whereas information on small molecules capable of interfering with the interaction of CCR6 and its ligands is scant. Here, we report the failure to generate neutralizing mouse mAbs specific for human (hu)CCR6. Immunization of mice with peptides mimicking extracellular domains, potentially involved in CCR6 function, failed to induce Abs reactive with the native receptor. Although the use of NIH-3T3 cells expressing huCCR6 resulted in the isolation of mAbs specific for this receptor, they were not able to block the interaction between huCCR6 and huCCL20. Investigation of the anti-huCCR6 mAbs generated in the present study, as well as those commercially available, show that all mAbs invariably recognize a unique, non-neutralizing, immunodominant region in the first part of its N-terminal domain. Together, these results indicate that the generation of potential neutralizing anti-huCCR6 mAbs in the mouse is unlikely to succeed and that alternative techniques, such as the use of other animal species for immunization, might constitute a better approach to generate such a potentially therapeutic tool for the treatment of inflammatory disease.

  15. Exclusion of polymeric immunoglobulins and selective immunoglobulin Y transport that recognizes its Fc region in avian ovarian follicles.


    Kitaguchi, Kohji; Osada, Kenichi; Horio, Fumihiko; Murai, Atsushi


    In avian species, blood immunoglobulin (Ig) Y, the equivalent to mammalian IgG, is selectively incorporated into ovarian follicles, but other classes, IgA and IgM, are much less abundant in the follicles. Several mammalian Igs, including IgG and IgA, are also incorporated into ovarian follicles when administered to birds. To clarify the Ig structure required for incorporation into ovarian follicles, Ig uptakes were determined after the intravenous injection of chicken and human Igs. Three chicken Igs (cIgY, cIgA and cIgM) and two human IgAs (monomeric hIgA and polymeric hIgA) were labeled with digoxigenin, and their uptakes into quail (Coturnix japonica) egg yolks were determined by ELISA and SDS-PAGE. The uptake of cIgY was the highest among the three cIgs (22% of injected cIgY was recovered from egg yolks). Chicken IgA was efficiently incorporated into egg yolk when it formed a monomeric state. Pentameric IgM was untransportable into egg yolk. We also found that the uptake of monomeric hIgA was much more efficient than that of polymeric hIgA. These results suggest that the retention of the monomeric form contributes to the efficient transport of Igs into ovarian follicles. On the other hand, Ig uptakes among monomeric Igs nevertheless differed; for example, a time-course analysis showed that the rate of monomeric cIgY uptake was approximately eight times faster than that of monomeric hIgA. The injection of cIgY fragments Fc, Fab and F(ab')(2) resulted in the largest uptake of Fc fragment, with the same level as that of cIgY. These results suggest the presence of a selective IgY transport system that recognizes its Fc region in avian ovarian follicles.

  16. Identification of the Single Immunodominant Region of the Native Human CC Chemokine Receptor 6 Recognized by Mouse Monoclonal Antibodies

    PubMed Central

    Dorgham, Karim; Dejou, Cécile; Piesse, Christophe; Gorochov, Guy; Pène, Jérôme


    Chemokines and their receptors play an important role in cell trafficking and recruitment. The CCR6 chemokine receptor, selectively expressed on leukocyte populations, has been shown to play a deleterious role in the pathogenesis of various chronic inflammatory diseases and, as such, may constitute a prime target in the development of immunotherapeutic treatment. However, to date no neutralizing mouse monoclonal antibodies (mAbs) specific for this chemokine receptor have been reported, whereas information on small molecules capable of interfering with the interaction of CCR6 and its ligands is scant. Here, we report the failure to generate neutralizing mouse mAbs specific for human (hu)CCR6. Immunization of mice with peptides mimicking extracellular domains, potentially involved in CCR6 function, failed to induce Abs reactive with the native receptor. Although the use of NIH-3T3 cells expressing huCCR6 resulted in the isolation of mAbs specific for this receptor, they were not able to block the interaction between huCCR6 and huCCL20. Investigation of the anti-huCCR6 mAbs generated in the present study, as well as those commercially available, show that all mAbs invariably recognize a unique, non-neutralizing, immunodominant region in the first part of its N-terminal domain. Together, these results indicate that the generation of potential neutralizing anti-huCCR6 mAbs in the mouse is unlikely to succeed and that alternative techniques, such as the use of other animal species for immunization, might constitute a better approach to generate such a potentially therapeutic tool for the treatment of inflammatory disease. PMID:27336468

  17. Conservation of Babesia bovis small heat shock protein (Hsp20) among strains and definition of T helper cell epitopes recognized by cattle with diverse major histocompatibility complex class II haplotypes.


    Norimine, Junzo; Mosqueda, Juan; Palmer, Guy H; Lewin, Harris A; Brown, Wendy C


    Babesia bovis small heat shock protein (Hsp20) is recognized by CD4+ T lymphocytes from cattle that have recovered from infection and are immune to challenge. This candidate vaccine antigen is related to a protective antigen of Toxoplasma gondii, Hsp30/bag1, and both are members of the alpha-crystallin family of proteins that can serve as molecular chaperones. In the present study, immunofluorescence microscopy determined that Hsp20 is expressed intracellularly in all merozoites. Importantly, Hsp20 is also expressed by tick larval stages, including sporozoites, so that natural tick-transmitted infection could boost a vaccine-induced response. The predicted amino acid sequence of Hsp20 from merozoites is completely conserved among different B. bovis strains. To define the location of CD4+ T-cell epitopes for inclusion in a multiepitope peptide or minigene vaccine construct, truncated recombinant Hsp20 proteins and overlapping peptides were tested for their ability to stimulate T cells from immune cattle. Both amino-terminal (amino acids [aa] 1 to 105) and carboxy-terminal (aa 48 to 177) regions were immunogenic for the majority of cattle in the study, stimulating strong proliferation and IFN-gamma production. T-cell lines from all individuals with distinct DRB3 haplotypes responded to aa 11 to 62 of Hsp20, which contained one or more immunodominant epitopes for each animal. One epitope, DEQTGLPIKS (aa 17 to 26), was identified by T-cell clones. The presence of strain-conserved T helper cell epitopes in aa 11 to 62 of the ubiquitously expressed Hsp20 that are presented by major histocompatibility complex class II molecules represented broadly in the Holstein breed supports the inclusion of this region in vaccine constructs to be tested in cattle.

  18. Autoantibodies from patients with primary biliary cirrhosis recognize a region within the nucleoplasmic domain of inner nuclear membrane protein LBR.


    Lin, F; Noyer, C M; Ye, Q; Courvalin, J C; Worman, H J


    Autoantibodies from rare patients with primary biliary cirrhosis (PBC) recognize LBR, or lamin B receptor, an integral membrane protein of the inner nuclear membrane. Human LBR has a nucleoplasmic, amino-terminal domain of 208 amino acids followed by a carboxyl-terminal domain with eight putative transmembrane segments. Autoantibodies against LBR from four patients with PBC recognized the nucleoplasmic, amino-terminal domain but not the carboxyl-terminal domain. Immunoblotting of smaller fusion proteins demonstrated that these autoantibodies recognized a conformational epitope(s) contained within the stretch of amino acids from 1 to 60. These results, combined with those of previous studies, show that autoepitopes of nuclear membrane proteins are located within their nucleocytoplasmic domains and that autoantibodies from patients with PBC predominantly react with one domain of a protein antigen. This work also provides further characterization of anti-LBR antibodies that have found utility as reagents in cell biology research.

  19. Regional Geograhpic Network Partnerships Supporting Sustainable Landscapes - An Example: The North Atlantic Landscape Conservation Cooperative

    EPA Science Inventory

    Natural resource management agencies, conservation organizations and other stakeholders are facing increasingly complex environmental challenges that require coordinated management actions at regional and landscape levels. To address these challenges, integrated multi-disciplina...

  20. Conservation.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  1. Regional Effects of Agricultural Conservation Practices on Nutrient Transport in the Upper Mississippi River Basin.


    García, Ana María; Alexander, Richard B; Arnold, Jeffrey G; Norfleet, Lee; White, Michael J; Robertson, Dale M; Schwarz, Gregory


    Despite progress in the implementation of conservation practices, related improvements in water quality have been challenging to measure in larger river systems. In this paper we quantify these downstream effects by applying the empirical U.S. Geological Survey water-quality model SPARROW to investigate whether spatial differences in conservation intensity were statistically correlated with variations in nutrient loads. In contrast to other forms of water quality data analysis, the application of SPARROW controls for confounding factors such as hydrologic variability, multiple sources and environmental processes. A measure of conservation intensity was derived from the USDA-CEAP regional assessment of the Upper Mississippi River and used as an explanatory variable in a model of the Upper Midwest. The spatial pattern of conservation intensity was negatively correlated (p = 0.003) with the total nitrogen loads in streams in the basin. Total phosphorus loads were weakly negatively correlated with conservation (p = 0.25). Regional nitrogen reductions were estimated to range from 5 to 34% and phosphorus reductions from 1 to 10% in major river basins of the Upper Mississippi region. The statistical associations between conservation and nutrient loads are consistent with hydrological and biogeochemical processes such as denitrification. The results provide empirical evidence at the regional scale that conservation practices have had a larger statistically detectable effect on nitrogen than on phosphorus loadings in streams and rivers of the Upper Mississippi Basin.

  2. Regional effects of agricultural conservation practices on nutrient transport in the Upper Mississippi River Basin

    USGS Publications Warehouse

    Garcia, Ana Maria.; Alexander, Richard B.; Arnold, Jeffrey G.; Norfleet, Lee; White, Michael J.; Robertson, Dale; Schwarz, Gregory


    Despite progress in the implementation of conservation practices, related improvements in water quality have been challenging to measure in larger river systems. In this paper we quantify these downstream effects by applying the empirical U.S. Geological Survey water-quality model SPARROW to investigate whether spatial differences in conservation intensity were statistically correlated with variations in nutrient loads. In contrast to other forms of water quality data analysis, the application of SPARROW controls for confounding factors such as hydrologic variability, multiple sources and environmental processes. A measure of conservation intensity was derived from the USDA-CEAP regional assessment of the Upper Mississippi River and used as an explanatory variable in a model of the Upper Midwest. The spatial pattern of conservation intensity was negatively correlated (p = 0.003) with the total nitrogen loads in streams in the basin. Total phosphorus loads were weakly negatively correlated with conservation (p = 0.25). Regional nitrogen reductions were estimated to range from 5 to 34% and phosphorus reductions from 1 to 10% in major river basins of the Upper Mississippi region. The statistical associations between conservation and nutrient loads are consistent with hydrological and biogeochemical processes such as denitrification. The results provide empirical evidence at the regional scale that conservation practices have had a larger statistically detectable effect on nitrogen than on phosphorus loadings in streams and rivers of the Upper Mississippi Basin.

  3. Recognizing abuse.


    Davidhizar, R; Newman-Giger, J


    After years as a taboo topic, abuse has come "out of the closet" and is being talked about openly in society. Yet, while abuse in the workplace is being confronted, abuse within families still often goes unrecognized by outsiders, including by nurses. Failure of nurses to recognize abuse is unfortunate since frequently they are the first point of contact with the victim of abuse in the emergency room, clinic and home. Understanding and insight into the problem of family violence by nurses is critical in addressing this problem. Knowledge is crucial in planning strategies that will have the long-lasting effect of decreasing the cycle of abuse in families.

  4. 5 CFR 5501.103 - Gifts from federally recognized Indian tribes or Alaska Native villages or regional or village...

    Code of Federal Regulations, 2010 CFR


    ... tribes or Alaska Native villages or regional or village corporations. 5501.103 Section 5501.103... tribes or Alaska Native villages or regional or village corporations. (a) Tribal or Alaska Native gifts... Indian tribes or Alaska Native villages or regional or village corporations, provided that the...

  5. 5 CFR 5501.103 - Gifts from federally recognized Indian tribes or Alaska Native villages or regional or village...

    Code of Federal Regulations, 2011 CFR


    ... tribes or Alaska Native villages or regional or village corporations. 5501.103 Section 5501.103... tribes or Alaska Native villages or regional or village corporations. (a) Tribal or Alaska Native gifts... Indian tribes or Alaska Native villages or regional or village corporations, provided that the...

  6. 5 CFR 5501.103 - Gifts from federally recognized Indian tribes or Alaska Native villages or regional or village...

    Code of Federal Regulations, 2014 CFR


    ... tribes or Alaska Native villages or regional or village corporations. 5501.103 Section 5501.103... tribes or Alaska Native villages or regional or village corporations. (a) Tribal or Alaska Native gifts... Indian tribes or Alaska Native villages or regional or village corporations, provided that the...

  7. 5 CFR 5501.103 - Gifts from federally recognized Indian tribes or Alaska Native villages or regional or village...

    Code of Federal Regulations, 2013 CFR


    ... tribes or Alaska Native villages or regional or village corporations. 5501.103 Section 5501.103... tribes or Alaska Native villages or regional or village corporations. (a) Tribal or Alaska Native gifts... Indian tribes or Alaska Native villages or regional or village corporations, provided that the...

  8. 5 CFR 5501.103 - Gifts from federally recognized Indian tribes or Alaska Native villages or regional or village...

    Code of Federal Regulations, 2012 CFR


    ... tribes or Alaska Native villages or regional or village corporations. 5501.103 Section 5501.103... tribes or Alaska Native villages or regional or village corporations. (a) Tribal or Alaska Native gifts... Indian tribes or Alaska Native villages or regional or village corporations, provided that the...

  9. The status of chondrichthyan conservation in the Indo-Australasian region.


    White, W T; Kyne, P M


    The status of chondrichthyan (sharks, batoids and chimaeras) conservation in the Indo-Australasian region is examined, and issues relevant to the conservation of this fauna at the subregional level [Australia, Indonesia (excluding West Papua), New Guinea (West Papua and Papua New Guinea), New Caledonia and New Zealand] are discussed. According to the 2009 IUCN Red List of Threatened Species, c. 21% of Indo-Australasian chondrichthyans are classified as threatened (critically endangered, endangered and vulnerable) and c. 40% are of conservation concern (threatened and near threatened). The proportion of threatened species is highest in New Guinea (c. 39%) and Indonesia (c. 35%) and least in New Zealand (c. 11%). In New Guinea, three quarters of the species are of conservation concern; in Indonesia, nearly two thirds are of conservation concern. Within the region, the proportion of threatened batoids (c. 29%) is higher than threatened sharks (c. 17%), while there are no threatened chimaeras. Conservation status is discussed at the order (for sharks), suborder (for batoids) and family level. Issues relating to the conservation status of chondrichthyans vary greatly between each subregion, but they mostly relate to targeted or incidental capture in fisheries. A handful of sharks and batoids are protected within Australian waters, while one species is protected in New Zealand. Both Australia and New Zealand have developed National Plans of Action for the Conservation and Management of Sharks (NPOA-Sharks), but these are lacking elsewhere. Development and implementation of NPOA-Sharks are a priority in order to drive the conservation of the regional fauna. Sustainable fisheries management (including by-catch), confronting the challenge of illegal, unreported and unregulated fishing, species protection where appropriate and marine protected areas (MPA) are all likely to prove vital in ensuring the long-term conservation of Indo-Australasian sharks, batoids and chimaeras.

  10. Conservation of Regional Variation in Sex-Specific Sex Chromosome Regulation

    PubMed Central

    Wright, Alison E.; Zimmer, Fabian; Harrison, Peter W.; Mank, Judith E.


    Regional variation in sex-specific gene regulation has been observed across sex chromosomes in a range of animals and is often a function of sex chromosome age. The avian Z chromosome exhibits substantial regional variation in sex-specific regulation, where older regions show elevated levels of male-biased expression. Distinct sex-specific regulation also has been observed across the male hypermethylated (MHM) region, which has been suggested to be a region of nascent dosage compensation. Intriguingly, MHM region regulatory features have not been observed in distantly related avian species despite the hypothesis that it is situated within the oldest region of the avian Z chromosome and is therefore orthologous across most birds. This situation contrasts with the conservation of other aspects of regional variation in gene expression observed on the avian sex chromosomes but could be the result of sampling bias. We sampled taxa across the Galloanserae, an avian clade spanning 90 million years, to test whether regional variation in sex-specific gene regulation across the Z chromosome is conserved. We show that the MHM region is conserved across a large portion of the avian phylogeny, together with other sex-specific regulatory features of the avian Z chromosome. Our results from multiple lines of evidence suggest that the sex-specific expression pattern of the MHM region is not consistent with nascent dosage compensation. PMID:26245831

  11. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    DOE Data Explorer

    Loots, Gabriela G. [LLNL; Ovcharenko, I. [LLNL

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. This database of evolutionary conserved regions (ECRs) in vertebrate genomes features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a comprehensive collection of promoters in all vertebrate genomes generated using multiple sources of gene annotation. The database also contains a collection of annotated transcription factor binding sites (TFBSs) in evolutionary conserved and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and fugu genomes. (taken from paper in Journal: Bioinformatics, November 7, 2006, pp. 122-124

  12. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    PubMed Central

    Pavesi, Giulio; Zambelli, Federico; Pesole, Graziano


    Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes. PMID:17286865

  13. Influence of conservation programs on amphibians using seasonal wetlands in the Prairie Pothole Region

    USGS Publications Warehouse

    Balas, Caleb J.; Euliss, Ned H.; Mushnet, David M.


    Extensive modification of upland habitats surrounding wetlands to facilitate agricultural production has negatively impacted amphibian communities in the Prairie Pothole Region of North America. In attempts to mitigate ecosystem damage associated with extensive landscape alteration, vast tracks of upland croplands have been returned to perennial vegetative cover (i.e., conservation grasslands) under a variety of U.S. Department of Agriculture programs. We evaluated the influence of these conservation grasslands on amphibian occupancy of seasonal wetlands in the Prairie Pothole Region. Using automated call surveys, aquatic funnel traps, and visual encounter surveys, we detected eight amphibian species using wetlands within three land-use categories (farmed, conservation grasslands, and native prairie grasslands) during the summers of 2005 and 2006. Seasonal wetlands within farmlands were used less frequently by amphibians than those within conservation and native prairie grasslands, and wetlands within conservation grasslands were used less frequently than those within native prairie grasslands by all species and life-stages we successfully modeled. Our results suggest that, while not occupied as frequently as wetlands within native prairie, wetlands within conservation grasslands provide important habitat for maintaining amphibian biodiversity in the Prairie Pothole Region

  14. Optimal portfolio design to reduce climate-related conservation uncertainty in the Prairie Pothole Region.


    Ando, Amy W; Mallory, Mindy L


    Climate change is likely to alter the spatial distributions of species and habitat types but the nature of such change is uncertain. Thus, climate change makes it difficult to implement standard conservation planning paradigms. Previous work has suggested some approaches to cope with such uncertainty but has not harnessed all of the benefits of risk diversification. We adapt Modern Portfolio Theory (MPT) to optimal spatial targeting of conservation activity, using wetland habitat conservation in the Prairie Pothole Region (PPR) as an example. This approach finds the allocations of conservation activity among subregions of the planning area that maximize the expected conservation returns for a given level of uncertainty or minimize uncertainty for a given expected level of returns. We find that using MPT instead of simple diversification in the PPR can achieve a value of the conservation objective per dollar spent that is 15% higher for the same level of risk. MPT-based portfolios can also have 21% less uncertainty over benefits or 6% greater expected benefits than the current portfolio of PPR conservation. Total benefits from conservation investment are higher if returns are defined in terms of benefit-cost ratios rather than benefits alone. MPT-guided diversification can work to reduce the climate-change-induced uncertainty of future ecosystem-service benefits from many land policy and investment initiatives, especially when outcomes are negatively correlated between subregions of a planning area.

  15. Both conserved and non-conserved regions of Spo11 are essential for meiotic recombination initiation in yeast.


    Nag, Dilip K; Pata, Janice D; Sironi, Manuela; Flood, David R; Hart, Ashley M


    DNA double-strand breaks (DSBs) are the initiators of most meiotic recombination events. In Saccharomyces cerevisiae, at least ten genes are necessary for meiotic DSB formation. However, the molecular roles of these proteins are not clearly understood. The meiosis-specific Spo11 protein, which shows sequence similarity with a subunit of an archaeal topoisomerase, is believed to catalyze the meiotic DSB formation. Spo11 is also required for induction of meiotic DSBs at long inverted repeats and at large trinucleotide repeat tracts. Here we report the isolation and characterization of temperature-sensitive spo11-mutant alleles to better understand how Spo11 functions, and how meiotic DSBs are generated at various recombination hotspots. Analysis of mutation sites of isolated spo11-mutant alleles indicated that both N-terminal and C-terminal non-conserved residues of Spo11 are essential for the protein's function, possibly for interaction with other meiotic DSB enzymes. Several of the mutation sites within the conserved region are predicted to lie on the surface of the protein, suggesting that this region is required for activation of the meiotic initiation complex via protein-protein interaction. In addition to the conditional mutants, we isolated partially recombination-defective mutants; analysis of one of these mutants indicated that Ski8, as observed previously, interacts with Spo11 via the latter's C-terminal residues.

  16. Evaluation of Apis mellifera syriaca Levant region honeybee conservation using comparative genome hybridization.


    Haddad, Nizar Jamal; Batainh, Ahmed; Saini, Deepti; Migdadi, Osama; Aiyaz, Mohamed; Manchiganti, Rushiraj; Krishnamurthy, Venkatesh; Al-Shagour, Banan; Brake, Mohammad; Bourgeois, Lelania; De Guzman, Lilia; Rinderer, Thomas; Hamouri, Zayed Mahoud


    Apis mellifera syriaca is the native honeybee subspecies of Jordan and much of the Levant region. It expresses behavioral adaptations to a regional climate with very high temperatures, nectar dearth in summer, attacks of the Oriental wasp and is resistant to Varroa mites. The A. m. syriaca control reference sample (CRS) in this study was originally collected and stored since 2001 from "Wadi Ben Hammad", a remote valley in the southern region of Jordan. Morphometric and mitochondrial DNA markers of these honeybees had shown highest similarity to reference A. m. syriaca samples collected in 1952 by Brother Adam of samples collected from the Middle East. Samples 1-5 were collected from the National Center for Agricultural Research and Extension breeding apiary which was established for the conservation of A. m. syriaca. Our objective was to determine the success of an A. m. syriaca honey bee conservation program using genomic information from an array-based comparative genomic hybridization platform to evaluate genetic similarities to a historic reference collection (CRS). Our results had shown insignificant genomic differences between the current population in the conservation program and the CRS indicated that program is successfully conserving A. m. syriaca. Functional genomic variations were identified which are useful for conservation monitoring and may be useful for breeding programs designed to improve locally adapted strains of A. m. syriaca.

  17. T cells specific for alpha-beta interface regions of hemoglobin recognize the isolated subunit but not the tetramer and indicate presentation without processing.

    PubMed Central

    Atassi, M Z; Yoshioka, M; Bixler, G S


    Processing of a protein antigen into fragments is believed to be a prerequisite for its presentation by the antigen-presenting cell to the T cell. This model would predict that, in oligomeric proteins, T cells prepared with specificity for regions that are buried within subunit association surfaces should recognize the respective regions in vitro equally well on the isolated subunit or on the oligomer. Three hemoglobin (Hb) alpha-chain synthetic peptides, corresponding to areas that are situated either completely [alpha-(31-45)] or partially [alpha-(41-45) and alpha-(81-95)] within the interface between the alpha and beta subunits of Hb, and a fourth peptide representing a completely exposed area in tetrameric Hb were used as immunogens in SJL/J (H-2s) mice. Peptide-primed T cells were passaged in vitro with the respective peptide to obtain peptide-specific T-lymphocyte lines. T-cell clones were isolated from these lines by limiting dilution. T-cell lines and clones that were specific for buried regions in the subunit association surfaces recognized the free peptide and the isolated subunit but not the Hb tetramer. On the other hand, T cells with specificity against regions that are not involved in subunit interaction and are completely exposed in the tetramer recognized the peptide, the isolated subunit, and the oligomeric protein equally well. The responses of the T-cell lines and clones were major histocompatibility complex-restricted. Since the same x-irradiated antigen-presenting cells were employed, the results could not be attributed to differences or defects in Hb processing. The findings indicate that in vitro the native (unprocessed and undissociated) oligomeric protein was the trigger of major histocompatibility complex-restricted T-cell responses. PMID:2788890

  18. Regulated expression of nuclear protein(s) in myogenic cells that binds to a conserved 3' untranslated region in pro alpha 1 (I) collagen cDNA.

    PubMed Central

    Herget, T; Burba, M; Schmoll, M; Zimmermann, K; Starzinski-Powitz, A


    We describe the identification and DNA-binding properties of nuclear proteins from rat L6 myoblasts which recognize an interspecies conserved 3' untranslated segment of pro alpha 1 (I) collagen cDNA. Levels of the two pro alpha 1 (I) collagen RNAs, present in L6 myoblasts, decreased drastically between 54 and 75 h after induction of myotube formation in serum-free medium. Both mRNAs contained a conserved sequence segment of 135 nucleotides (termed tame sequence) in the 3' untranslated region that had 96% homology to the human and murine pro alpha 1 (I) collagen genes. The cDNA of this tame sequence was specifically recognized by nuclear protein(s) from L6 myoblasts, as judged by gel retardation assays and DNase I footprints. The tame-binding protein(s) was able to recognize its target sequence on double-stranded DNA but bound also to the appropriate single-stranded oligonucleotide. Protein that bound to the tame sequence was undetectable in nuclear extracts of L6 myotubes that did not accumulate the two collagen mRNAs. Therefore, the activity of this nuclear protein seems to be linked to accumulation of the sequences that it recognizes in vitro. The collagen RNAs and the nuclear tame-binding proteins reappeared after a change of medium, which further suggests that the RNAs and the protein(s) are coordinately regulated. Images PMID:2779548

  19. Designing monitoring programs in an adaptive management context for regional multiple species conservation plans

    USGS Publications Warehouse

    Atkinson, A.J.; Trenham, P.C.; Fisher, R.N.; Hathaway, S.A.; Johnson, B.S.; Torres, S.G.; Moore, Y.C.


    critical management uncertainties; and 3) implementing long-term monitoring and adaptive management. Ultimately, the success of regional conservation planning depends on the ability of monitoring programs to confront the challenges of adaptively managing and monitoring complex ecosystems and diverse arrays of sensitive species.

  20. Mapping spatial pattern in biodiversity for regional conservation planning: where to from here?


    Ferrier, Simon


    Vast gaps in available information on the spatial distribution of biodiversity pose a major challenge for regional conservation planning in many parts of the world. This problem is often addressed by basing such planning on various biodiversity surrogates. In some situations, distributional data for selected taxa may be used as surrogates for biodiversity as a whole. However, this approach is less effective in data-poor regions, where there may be little choice but to base conservation planning on some form of remote environmental mapping, derived, for example, from interpretation of satellite imagery or from numerical classification of abiotic environmental layers. Although this alternative approach confers obvious benefits in terms of cost-effectiveness and rapidity of application, problems may arise if congruence is poor between mapped land-classes and actual biological distributions. I propose three strategies for making more effective use of available biological data and knowledge to alleviate such problems by (1) more closely integrating biological and environmental data through predictive modeling, with increased emphasis on modeling collective properties of biodiversity rather than individual entities; (2) making more rigorous use of remotely mapped surrogates in conservation planning by incorporating knowledge of heterogeneity within land-classes, and of varying levels of distinctiveness between classes, into measures of conservation priority and achievement; and (3) using relatively data-rich regions as test-beds for evaluating the performance of surrogates that can be readily applied across data-poor regions.

  1. A trans-national monarch butterfly population model and implications for regional conservation priorities

    USGS Publications Warehouse

    Oberhauser, Karen; Wiederholt, Ruscena; Diffendorfer, James E.; Semmens, Darius J.; Ries, Leslie; Thogmartin, Wayne E.; Lopez-Hoffman, Laura; Semmens, Brice


    1. The monarch has undergone considerable population declines over the past decade, and the governments of Mexico, Canada, and the United States have agreed to work together to conserve the species.2. Given limited resources, understanding where to focus conservation action is key for widespread species like monarchs. To support planning for continental-scale monarch habitat restoration, we address the question of where restoration efforts are likely to have the largest impacts on monarch butterfly (Danaus plexippus Linn.) population growth rates.3. We present a spatially explicit demographic model simulating the multi-generational annual cycle of the eastern monarch population, and use the model to examine management scenarios, some of which focus on particular regions of North America.4. Improving the monarch habitat in the north central or southern parts of the monarch range yields a slightly greater increase in the population growth rate than restoration in other regions. However, combining restoration efforts across multiple regions yields population growth rates above 1 with smaller simulated improvements in habitat per region than single-region strategies.5. Synthesis and applications: These findings suggest that conservation investment in projects across the full monarch range will be more effective than focusing on one or a few regions, and will require international cooperation across many land use categories.

  2. Regional Genetic Structure and Environmental Variables Influence our Conservation Approach for Feather Heads (Ptilotus macrocephalus).


    Ahrens, Collin W; James, Elizabeth A


    Continued alterations to the Australian environment compromise the long-term viability of many plant species. We investigate the population genetics of Ptilotus macrocephalus, a perennial herb that occurs in 2 nationally endangered communities on the Victorian Volcanic Plain Bioregion (VVP), Australia, to answer key questions regarding regional differentiation and to guide conservation strategies. We evaluate genetic structure and diversity within and among 17 P. macrocephalus populations from 3 regions of southeastern Australia using 17 microsatellite markers developed de novo. Genetic structure was present in P. macrocephalus between the 3 regions but not at the population level. Environmental factors, namely temperature and precipitation, significantly explained differentiation between the North region and the other 2 regions indicating isolation by environment. Within regions, genetic structure currently shows a high level of gene flow and genetic variation. Our results suggest that within-region gene flow does not reflect current habitat fragmentation in southeastern Australia whereas temperature and precipitation are likely to be responsible for the differentiation detected among regions. Climate change may severely impact P. macrocephalus on the VVP and test its evolutionary resilience. We suggest taking a proactive conservation approach to improve long-term viability by sourcing material for restoration to assist gene flow to the VVP region to promote an increased adaptive capacity.

  3. Characterization of Two Monoclonal Antibodies That Recognize Linker Region and Carboxyl Terminal Domain of Coronavirus Nucleocapsid Protein

    PubMed Central

    Zhu, Yunnuan; Shi, Hongyan; Chen, Jianfei; Shi, Da; Feng, Li


    The transmissible gastroenteritis virus (TGEV) nucleocapsid (N) protein plays important roles in the replication and translation of viral RNA. The present study provides the first description of two monoclonal antibodies (mAbs) (5E8 and 3D7) directed against the TGEV N protein linker region (LKR) and carboxyl terminal domain (CTD). The mAbs 5E8 and 3D7 reacted with native N protein in western blotting and immunofluorescence assay (IFA). Two linear epitopes, 189SVEQAVLAALKKLG202 and 246VTRFYGARSSSA257, located in the LKR and CTD of TGEV N protein, respectively, were identified after truncating the protein and applying a peptide scanning technique. Using mAb 5E8, we observed that the N protein was expressed in the cytoplasm during TGEV replication and that the protein could be immunoprecipitated from TGEV-infected PK-15 cells. The mAb 5E8 can be applied for different approaches to diagnosis of TGEV infection. In addition, the antibodies represent useful tools for investigating the antigenic properties of the N protein. PMID:27689694

  4. Rapid profiling of the antigen regions recognized by serum antibodies using massively parallel sequencing of antigen-specific libraries.


    Domina, Maria; Lanza Cariccio, Veronica; Benfatto, Salvatore; D'Aliberti, Deborah; Venza, Mario; Borgogni, Erica; Castellino, Flora; Biondo, Carmelo; D'Andrea, Daniel; Grassi, Luigi; Tramontano, Anna; Teti, Giuseppe; Felici, Franco; Beninati, Concetta


    There is a need for techniques capable of identifying the antigenic epitopes targeted by polyclonal antibody responses during deliberate or natural immunization. Although successful, traditional phage library screening is laborious and can map only some of the epitopes. To accelerate and improve epitope identification, we have employed massive sequencing of phage-displayed antigen-specific libraries using the Illumina MiSeq platform. This enabled us to precisely identify the regions of a model antigen, the meningococcal NadA virulence factor, targeted by serum antibodies in vaccinated individuals and to rank hundreds of antigenic fragments according to their immunoreactivity. We found that next generation sequencing can significantly empower the analysis of antigen-specific libraries by allowing simultaneous processing of dozens of library/serum combinations in less than two days, including the time required for antibody-mediated library selection. Moreover, compared with traditional plaque picking, the new technology (named Phage-based Representation OF Immuno-Ligand Epitope Repertoire or PROFILER) provides superior resolution in epitope identification. PROFILER seems ideally suited to streamline and guide rational antigen design, adjuvant selection, and quality control of newly produced vaccines. Furthermore, this method is also susceptible to find important applications in other fields covered by traditional quantitative serology.

  5. A regional perspective on the diversity and conservation of tropical Andean fishes.


    Anderson, Elizabeth P; Maldonado-Ocampo, Javier A


    The tropical Andes harbor an extraordinarily varied concentration of species in a landscape under increasing pressure from human activities. Conservation of the region's native plants and animals has received considerable international attention, but the focus has been on terrestrial biota. The conservation of freshwater fauna, particularly the conservation of fishes, has not been emphasized. Tropical Andean fishes are among the most understudied vertebrates in the world. We estimate that between 400 and 600 fish species inhabit the diverse aquatic environments in the region. Nearly 40% of these species are endemic. Tropical Andean fishes are vulnerable to ongoing environmental changes related to deforestation, water withdrawals, water pollution, species introductions, and hydropower development. Additionally, their distributions and population dynamics may be affected by hydrologic alterations and warmer water temperatures associated with projected climate change. Presently, at least three species are considered extinct, some populations are endangered, and some species are likely to decline or disappear. The long-term persistence of tropical Andean fishes will depend on greater consideration of freshwater systems in regional conservation initiatives.

  6. An amphiphilic region in the cytoplasmic domain of KdpD is recognized by the signal recognition particle and targeted to the Escherichia coli membrane

    PubMed Central

    Maier, Katja S; Hubich, Stefanie; Liebhart, Helga; Krauss, Susanne; Kuhn, Andreas; Facey, Sandra J


    The sensor protein KdpD of Escherichia coli is composed of a large N-terminal hydrophilic region (aa 1–400), four transmembrane regions (aa 401–498) and a large hydrophilic region (aa 499–894) at the C-terminus. KdpD requires the signal recognition particle (SRP) for its targeting to the membrane. Deletions within KdpD show that the first 50 residues are required for SRP-driven membrane insertion. A fusion protein of the green fluorescent protein (GFP) with KdpD is found localized at the membrane only when SRP is present. The membrane targeting of GFP was not observed when the first 50 KdpD residues were deleted. A truncated mutant of KdpD containing only the first 25 amino acids fused to GFP lost its ability to specifically interact with SRP, whereas a specific interaction between SRP and the first 48 amino acids of KdpD fused to GFP was confirmed by pull-down experiments. Conclusively, a small amphiphilic region of 27 residues within the amino-terminal domain of KdpD (aa 22–48) is recognized by SRP and targets the protein to the membrane. This shows that membrane proteins with a large N-terminal region in the cytoplasm can be membrane-targeted early on to allow co-translational membrane insertion of their distant transmembrane regions. PMID:18433452

  7. A Forty-Year Retrospective 1950-1990: The Metropolitan Toronto and Region Conservation Authority's Conservation Education Programmes.

    ERIC Educational Resources Information Center

    Carr, Allen Terry


    Recounts the growth of Conservation Authorities in Ontario from the first partnerships between schools and conservation in the 1950s, to the opening of a pioneer village, flood control dam, nature trails, and residential conservation education centers through the 1960s and 1970s. Increased public environmental concern sparked more growth in the…

  8. Molecular sensing of bacteria in plants. The highly conserved RNA-binding motif RNP-1 of bacterial cold shock proteins is recognized as an elicitor signal in tobacco.


    Felix, Georg; Boller, Thomas


    To detect microbial infection multicellular organisms have evolved sensing systems for pathogen-associated molecular patterns (PAMPs). Here, we identify bacterial cold shock protein (CSP) as a new such PAMP that acts as a highly active elicitor of defense responses in tobacco. Tobacco cells perceive a conserved domain of CSP and synthetic peptides representing 15 amino acids of this domain-induced responses at subnanomolar concentrations. Central to the elicitor-active domain is the RNP-1 motif KGFGFITP, a motif conserved also in many RNA- and DNA-binding proteins of eukaryotes. Csp15-Nsyl, a peptide representing the domain with highest homology to csp15 in a protein of Nicotiana sylvestris exhibited only weak activity in tobacco cells. Crystallographic and genetic data from the literature show that the RNP-1 domain of bacterial CSPs resides on a protruding loop and exposes a series of aromatic and basic side chains to the surface that are essential for the nucleotide-binding activity of CSPs. Similarly, these side chains were also essential for elicitor activity and replacement of single residues in csp15 with Ala strongly reduced or abolished activity. Most strikingly, csp15-Ala10, a peptide with the RNP-1 motif modified to KGAGFITP, lacked elicitor activity but acted as a competitive antagonist for CSP-related elicitors. Bacteria commonly have a small family of CSP-like proteins including both cold-inducible and noninducible members, and Csp-related elicitor activity was detected in extracts from all bacteria tested. Thus, the CSP domain containing the RNP-1 motif provides a structure characteristic for bacteria in general, and tobacco plants have evolved a highly sensitive chemoperception system to detect this bacterial PAMP.

  9. Extreme evolutionary conservation of functionally important regions in H1N1 influenza proteome.


    Warren, Samantha; Wan, Xiu-Feng; Conant, Gavin; Korkin, Dmitry


    The H1N1 subtype of influenza A virus has caused two of the four documented pandemics and is responsible for seasonal epidemic outbreaks, presenting a continuous threat to public health. Co-circulating antigenically divergent influenza strains significantly complicates vaccine development and use. Here, by combining evolutionary, structural, functional, and population information about the H1N1 proteome, we seek to answer two questions: (1) do residues on the protein surfaces evolve faster than the protein core residues consistently across all proteins that constitute the influenza proteome? and (2) in spite of the rapid evolution of surface residues in influenza proteins, are there any protein regions on the protein surface that do not evolve? To answer these questions, we first built phylogenetically-aware models of the patterns of surface and interior substitutions. Employing these models, we found a single coherent pattern of faster evolution on the protein surfaces that characterizes all influenza proteins. The pattern is consistent with the events of inter-species reassortment, the worldwide introduction of the flu vaccine in the early 80's, as well as the differences caused by the geographic origins of the virus. Next, we developed an automated computational pipeline to comprehensively detect regions of the protein surface residues that were 100% conserved over multiple years and in multiple host species. We identified conserved regions on the surface of 10 influenza proteins spread across all avian, swine, and human strains; with the exception of a small group of isolated strains that affected the conservation of three proteins. Surprisingly, these regions were also unaffected by genetic variation in the pandemic 2009 H1N1 viral population data obtained from deep sequencing experiments. Finally, the conserved regions were intrinsically related to the intra-viral macromolecular interaction interfaces. Our study may provide further insights towards the

  10. Interview-based sighting histories can inform regional conservation prioritization for highly threatened cryptic species

    PubMed Central

    Turvey, Samuel T; Trung, Cao Tien; Quyet, Vo Dai; Nhu, Hoang Van; Thoai, Do Van; Tuan, Vo Cong Anh; Hoa, Dang Thi; Kacha, Kouvang; Sysomphone, Thongsay; Wallate, Sousakhone; Hai, Chau Thi Thanh; Thanh, Nguyen Van; Wilkinson, Nicholas M


    The use of robust ecological data to make evidence-based management decisions is frequently prevented by limited data quantity or quality, and local ecological knowledge (LEK) is increasingly seen as an important source of information for conservation. However, there has been little assessment of LEK's usefulness for informing prioritization and management of landscapes for threatened species, or assessing comparative species status across landscapes. A large-scale interview survey in the Annamite Mountains (Vietnam and Lao PDR) compiled the first systematic LEK data set for saola Pseudoryx nghetinhensis, one of the world's rarest mammals, and eight other ungulates. Saola conservation is hindered by uncertainty over continued presence across much of its proposed distribution. We analysed comparative LEK-based last-sighting data across three landscapes to determine whether regional sighting histories support previous suggestions of landscape importance for saola conservation (Hue-Quang Nam: top-priority Vietnamese landscape; Pu Mat: lower priority Vietnamese landscape; Viengthong: high-priority Lao landscape) and whether they constitute an effective spatial prioritization tool for cryptic species management. Wild pig and red muntjac may be the only Annamite ungulates with stable populations; the regional status of all other species appears to be worse. Saola have declined more severely and/or are significantly rarer than most other ungulates and have been seen by relatively few respondents. Saola were also frequently considered locally rarest or declining, and never as species that had not declined. In contrast to other species, there are no regional differences in saola sighting histories, with continued persistence in all landscapes challenging suggestions that regional status differs greatly. Remnant populations persist in Vietnam despite heavy hunting, but even remote landscapes in Lao may be under intense pressure. Synthesis and applications. Our local

  11. Effects of Conservation Policies on Forest Cover Change in Giant Panda Habitat Regions, China

    PubMed Central

    Li, Yu; Viña, Andrés; Yang, Wu; Chen, Xiaodong; Zhang, Jindong; Ouyang, Zhiyun; Liang, Zai; Liu, Jianguo


    After long periods of deforestation, forest transition has occurred globally, but the causes of forest transition in different countries are highly variable. Conservation policies may play important roles in facilitating forest transition around the world, including China. To restore forests and protect the remaining natural forests, the Chinese government initiated two nationwide conservation policies in the late 1990s -- the Natural Forest Conservation Program (NFCP) and the Grain-To-Green Program (GTGP). While some studies have discussed the environmental and socioeconomic effects of each of these policies independently and others have attributed forest recovery to both policies without rigorous and quantitative analysis, it is necessary to rigorously quantify the outcomes of these two conservation policies simultaneously because the two policies have been implemented at the same time. To fill the knowledge gap, this study quantitatively evaluated the effects of the two conservation policies on forest cover change between 2001 and 2008 in 108 townships located in two important giant panda habitat regions -- the Qinling Mountains region in Shaanxi Province and the Sichuan Giant Panda Sanctuary in Sichuan Province. Forest cover change was evaluated using a land-cover product (MCD12Q1) derived from the Moderate Resolution Imaging Spectroradiometer (MODIS). This product proved to be highly accurate in the study region (overall accuracy was ca. 87%, using 425 ground truth points collected in the field), thus suitable for the forest change analysis performed. Results showed that within the timeframe evaluated, most townships in both regions exhibited either increases or no changes in forest cover. After accounting for a variety of socioeconomic and biophysical attributes, an Ordinary Least Square (OLS) regression model suggests that the two policies had statistically significant positive effects on forest cover change after seven years of implementation, while

  12. Effects of Conservation Policies on Forest Cover Change in Giant Panda Habitat Regions, China.


    Li, Yu; Viña, Andrés; Yang, Wu; Chen, Xiaodong; Zhang, Jindong; Ouyang, Zhiyun; Liang, Zai; Liu, Jianguo


    After long periods of deforestation, forest transition has occurred globally, but the causes of forest transition in different countries are highly variable. Conservation policies may play important roles in facilitating forest transition around the world, including China. To restore forests and protect the remaining natural forests, the Chinese government initiated two nationwide conservation policies in the late 1990s -- the Natural Forest Conservation Program (NFCP) and the Grain-To-Green Program (GTGP). While some studies have discussed the environmental and socioeconomic effects of each of these policies independently and others have attributed forest recovery to both policies without rigorous and quantitative analysis, it is necessary to rigorously quantify the outcomes of these two conservation policies simultaneously because the two policies have been implemented at the same time. To fill the knowledge gap, this study quantitatively evaluated the effects of the two conservation policies on forest cover change between 2001 and 2008 in 108 townships located in two important giant panda habitat regions -- the Qinling Mountains region in Shaanxi Province and the Sichuan Giant Panda Sanctuary in Sichuan Province. Forest cover change was evaluated using a land-cover product (MCD12Q1) derived from the Moderate Resolution Imaging Spectroradiometer (MODIS). This product proved to be highly accurate in the study region (overall accuracy was ca. 87%, using 425 ground truth points collected in the field), thus suitable for the forest change analysis performed. Results showed that within the timeframe evaluated, most townships in both regions exhibited either increases or no changes in forest cover. After accounting for a variety of socioeconomic and biophysical attributes, an Ordinary Least Square (OLS) regression model suggests that the two policies had statistically significant positive effects on forest cover change after seven years of implementation, while

  13. Ecosystem service benefits of contrasting conservation strategies in a human-dominated region.


    Eigenbrod, Felix; Anderson, Barbara J; Armsworth, Paul R; Heinemeyer, Andreas; Jackson, Sarah F; Parnell, Mark; Thomas, Chris D; Gaston, Kevin J


    The hope among policy-makers and scientists alike is that conservation strategies designed to protect biodiversity also provide direct benefits to people by protecting other vital ecosystem services. The few studies that have examined the delivery of ecosystem services by existing conservation efforts have concentrated on large, 'wilderness'-style biodiversity reserves. However, such reserves are not realistic options for densely populated regions. Here, we provide the first analyses that compare representation of biodiversity and three other ecosystem services across several contrasting conservation strategies in a human-dominated landscape (England). We show that small protected areas and protected landscapes (restrictive zoning) deliver high carbon storage and biodiversity, while existing incentive payment (agri-environment) schemes target areas that offer little advantage over other parts of England in terms of biodiversity, carbon storage and agricultural production. A fourth ecosystem service-recreation-is under-represented by all three strategies. Our findings are encouraging as they illustrate that restrictive zoning can play a major role in protecting natural capital assets in densely populated regions. However, trade-offs exist even among the four ecosystem services we considered, suggesting that a portfolio of conservation and sustainability investments will be needed to deliver both biodiversity and the other ecosystem services demanded by society.

  14. Exploring spatial patterns of vulnerability for diverse biodiversity descriptors in regional conservation planning.


    Vimal, Ruppert; Pluvinet, Pascal; Sacca, Céline; Mazagol, Pierre-Olivier; Etlicher, Bernard; Thompson, John D


    In this study, we developed a multi-criteria assessment of spatial variability of the vulnerability of three different biodiversity descriptors: sites of high conservation interest by virtue of the presence of rare or remarkable species, extensive areas of high ecological integrity, and landscape diversity in grid cells across an entire region. We assessed vulnerability in relation to (a) direct threats in and around sites to a distance of 2 km associated with intensive agriculture, building and road infrastructure and (b) indirect effects of human population density on a wider scale (50 km). The different combinations of biodiversity and threat indicators allowed us to set differential priorities for biodiversity conservation and assess their spatial variation. For example, with this method we identified sites and grid cells which combined high biodiversity with either high threat values or low threat values for the three different biodiversity indicators. In these two classes the priorities for conservation planning will be different, reduce threat values in the former and restrain any increase in the latter. We also identified low priority sites (low biodiversity with either high or low threats). This procedure thus allows for the integration of a spatial ranking of vulnerability into priority setting for regional conservation planning.

  15. RapA2 Is a Calcium-binding Lectin Composed of Two Highly Conserved Cadherin-like Domains That Specifically Recognize Rhizobium leguminosarum Acidic Exopolysaccharides*

    PubMed Central

    Abdian, Patricia L.; Caramelo, Julio J.; Ausmees, Nora; Zorreguieta, Angeles


    In silico analyses have revealed a conserved protein domain (CHDL) widely present in bacteria that has significant structural similarity to eukaryotic cadherins. A CHDL domain was shown to be present in RapA, a protein that is involved in autoaggregation of Rhizobium cells, biofilm formation, and adhesion to plant roots as shown by us and others. Structural similarity to cadherins suggested calcium-dependent oligomerization of CHDL domains as a mechanistic basis for RapA action. Here we show by circular dichroism spectroscopy, light scattering, isothermal titration calorimetry, and other methods that RapA2 from Rhizobium leguminosarum indeed exhibits a cadherin-like β-sheet conformation and that its proper folding and stability are dependent on the binding of one calcium ion per protein molecule. By further in silico analysis we also reveal that RapA2 consists of two CHDL domains and expand the range of CHDL-containing proteins in bacteria and archaea. However, light scattering assays at various concentrations of added calcium revealed that RapA2 formed neither homo-oligomers nor hetero-oligomers with RapB (a distinct CHDL protein), indicating that RapA2 does not mediate cellular interactions through a cadherin-like mechanism. Instead, we demonstrate that RapA2 interacts specifically with the acidic exopolysaccharides (EPSs) produced by R. leguminosarum in a calcium-dependent manner, sustaining a role of these proteins in the development of the biofilm matrix made of EPS. Because EPS binding by RapA2 can only be attributed to its two CHDL domains, we propose that RapA2 is a calcium-dependent lectin and that CHDL domains in various bacterial and archaeal proteins confer carbohydrate binding activity to these proteins. PMID:23235153

  16. Perfect Conserved Linkage Across the Entire Mouse Chromosome 10 Region Homologous to Human Chromosome 21

    PubMed Central

    Wiltshire, Tim; Pletcher, Mathew; Cole, Susan E.; Villanueva, Melissa; Birren, Bruce; Lehoczky, Jessica; Dewar, Ken; Reeves, Roger H.


    The distal end of human Chromosome (HSA) 21 from PDXK to the telomere shows perfect conserved linkage with mouse Chromosome (MMU) 10. This region is bounded on the proximal side by a segment of homology to HSA22q11.2, and on the distal side by a region of homology with HSA19p13.1. A high-resolution PAC-based physical map is described that spans 2.8 Mb, including the entire 2.1 Mb from Pdxk to Prmt2 corresponding to HSA21. Thirty-four expressed sequences are mapped, three of which were not mapped previously in any species and nine more that are mapped in mouse for the first time. These genes confirm and extend the conserved linkage between MMU10 and HSA21. The ordered PACs and dense STS map provide a clone resource for biological experiments, for rapid and accurate mapping, and for genomic sequencing. The new genes identified here may be involved in Down syndrome (DS) or in several genetic diseases that map to this conserved region of HSA21. PMID:10613844

  17. Rewilding the tropics, and other conservation translocations strategies in the tropical Asia-Pacific region

    PubMed Central

    Louys, Julien; Corlett, Richard T; Price, Gilbert J; Hawkins, Stuart; Piper, Philip J


    Alarm over the prospects for survival of species in a rapidly changing world has encouraged discussion of translocation conservation strategies that move beyond the focus of ‘at-risk’ species. These approaches consider larger spatial and temporal scales than customary, with the aim of recreating functioning ecosystems through a combination of large-scale ecological restoration and species introductions. The term ‘rewilding’ has come to apply to this large-scale ecosystem restoration program. While reintroductions of species within their historical ranges have become standard conservation tools, introductions within known paleontological ranges—but outside historical ranges—are more controversial, as is the use of taxon substitutions for extinct species. Here, we consider possible conservation translocations for nine large-bodied taxa in tropical Asia-Pacific. We consider the entire spectrum of conservation translocation strategies as defined by the IUCN in addition to rewilding. The taxa considered are spread across diverse taxonomic and ecological spectra and all are listed as ‘endangered’ or ‘critically endangered’ by the IUCN in our region of study. They all have a written and fossil record that is sufficient to assess past changes in range, as well as ecological and environmental preferences, and the reasons for their decline, and they have all suffered massive range restrictions since the late Pleistocene. General principles, problems, and benefits of translocation strategies are reviewed as case studies. These allowed us to develop a conservation translocation matrix, with taxa scored for risk, benefit, and feasibility. Comparisons between taxa across this matrix indicated that orangutans, tapirs, Tasmanian devils, and perhaps tortoises are the most viable taxa for translocations. However, overall the case studies revealed a need for more data and research for all taxa, and their ecological and environmental needs. Rewilding the Asian

  18. Conservation in metropolitan regions: assessing trends and threats of urban development and climate change

    NASA Astrophysics Data System (ADS)

    Thorne, J. H.; Santos, M. J.; Bjorkman, J.


    Two global challenges to successful conservation are urban expansion and climate change. Rapid urban growth threatens biodiversity and associated ecosystem services, while climate change may make currently protected areas unsuitable for species that exist within them. We examined three measures of landscape change for 8800 km2 of the San Francisco Bay metropolitan region over 80 years past and future: urban growth, protected area establishment, and natural vegetation type extents. The Bay Area is a good test bed for conservation assessment of the impacts of temporal and spatial of urban growth and land cover change. The region is geographically rather small, with over 40% of its lands already dedicated to protected park and open space lands, they are well-documented, and, the area has had extensive population growth in the past and is projected to continue to grow. The ten-county region within which our study area is a subset has grown from 1.78 million people in 1930, to 6.97 million in 2000 and is estimated to grow to 10.94 million by 2050. With such an influx of people into a small geographic area, it is imperative to both examine the past urban expansion and estimate how the future population will be accommodated into the landscape. We quantify these trends to assess conservation 'success' through time. We used historical and current landcover maps to assess trend, and a GIS-based urban modeling (UPlan) to assess future urban growth impacts in the region, under three policy scenarios- business as usual, smart growth, and urban redevelopment. Impacts are measured by the amount of open space targeted by conservation planners in the region that will be urbanized under each urban growth policy. Impacts are also measured by estimates of the energy consumption projected for each of the scenarios on household and business unit level. The 'business as usual' and 'smart growth' scenarios differed little in their impacts to targeted conservation lands, because so little

  19. Evolutionarily conserved regions of the human c-myc protein can be uncoupled from transforming activity

    SciTech Connect

    Sarid, J.; Halazonetis, T.D.; Murphy, W.; Leder, P.


    The myc family of oncogenes contains coding sequences that have been preserved in different species for over 400 million years. This conservation (which implies functional selection) is broadly represented throughout the C-terminal portion of the human c-myc protein but is largely restricted to three cluster of amino acid sequences in the N-terminal region. The authors have examined the role that the latter three regions of the c-myc protein might play in the transforming function of the c-myc gene. Several mutations, deletions and frameshifts, were introduced into the c-myc gene, and these mutant genes were tested for their ability to collaborate with the EJ-ras oncogene to transform rat embryo fibroblasts. Complete elimination of the first two N-terminal conserved segments abolished transforming activity. In contrast, genes altered in a portion of the second or the entire third conserved segment retained their transforming activity. Thus, the latter two segments are not required for the transformation process, suggesting that they serve another function related only to the normal expression of the c-myc gene.

  20. Plant diversity and conservation status of Himalayan Region Poonch Valley Azad Kashmir (Pakistan).


    Khan, Muhammad Azam; Khan, Mir Ajab; Hussain, Mazhar; Mujtaba, Ghulam


    The plant diversity of Himalayan region has been reduced to greater extent due to environmental degradation and human exploitation. Anthropogenic disturbance was the major factor responsible for fragmentation of forest vegetation into small patches. Little research has been conducted in the Himalayan region of Poonch Valley of North eastern Pakistan with reference to plants biodiversity and its conservation. The present research was carried out to provide a checklist of vegetation for biodiversity conservation. A total of 430 vascular and 5 nonvascular plant species with 5 species of Bryophytes (5 families), 13 species of Pteridophytes (6 families), 4 species of Gymnosperms (1 family) and 413 species of angiosperms (95 families) were enumerated from the Poonch valley Azad Kashmir. The genera were classified into three categories according to the number of species. 25 plant communities with phytosociological parameters and diversity indices were reported. Present study revealed that there were 145 threatened, 30 endangered, 68 vulnerable and 47 rare species. It is recorded that extensive grazing, uprooting of plants and soil slope erosion intensify the environmental problems. Since there is maximum exploitation of vegetation, the valley showed a decline in plant diversity. The study was also indicated that the main threats to the biodiversity are expansion of settlement and army installations in the forest area of the valley. For sustainable use In-situ and Ex-situ conservation, controlled harvesting and afforestation may be the solution. Moreover, forest area should be declared prohibited for settlements and army installations.

  1. [Optimization of conservation network system for inter-basin wetland ecosystem in Huang-Huai-Hai Region].


    Song, Xiao-Long; Li, Xiao-Wen; Zhang, Ming-Xiang; Yang, Dian-Lin; Zhang, Li-Na; Zhang, Gui-Long


    By using systematic conservation planning (SCP) method, and taking catchment as planning unit, an optimization of conservation network system for the inter-basin wetland ecosystem in Huang-Huai-Hai Region was conducted, with a comprehensive consideration of 3-dimensional (lateral, longitudinal and vertical) connectivity and Inter-basin Water Transfer Project and by the methods of irreplaceability analysis and gap identification. The efficacy of the optimized conservation network system was evaluated, as compared with the existing conservation network system. According to the principles of irreplaceability and connectivity, the wetland conservation gaps could be divided into two types, i.e. , be conserved in priority and in general. After the optimization, the conservation status of the inter-basin wetland ecosystem in Huang-Huai-Hai Region had an overall improvement. The conserved percentage of the wetland types was from about 20% up to 46.8%, and, for each wetland type, its conserved level increased to some extent, almost above 40%. Both in the near future and in the long term, more attention should be paid to the conservation of lake wetland. In addition, the integration of ecosystem service function and biodiversity and the combination of protection with restoration would be the main task for the wetland ecosystem conservation planning in the future.

  2. Building on IUCN regional red lists to produce lists of species of conservation priority: a model with Irish bees.


    Fitzpatrick, Una; Murray, Tomás E; Paxton, Robert J; Brown, Mark J F


    A World Conservation Union (IUCN) regional red list is an objective assessment of regional extinction risk and is not the same as a list of conservation priority species. Recent research reveals the widespread, but incorrect, assumption that IUCN Red List categories represent a hierarchical list of priorities for conservation action. We developed a simple eight-step priority-setting process and applied it to the conservation of bees in Ireland. Our model is based on the national red list but also considers the global significance of the national population; the conservation status at global, continental, and regional levels; key biological, economic, and societal factors; and is compatible with existing conservation agreements and legislation. Throughout Ireland, almost one-third of the bee fauna is threatened (30 of 100 species), but our methodology resulted in a reduced list of only 17 priority species. We did not use the priority species list to broadly categorize species to the conservation action required; instead, we indicated the individual action required for all threatened, near-threatened, and data-deficient species on the national red list based on the IUCN's conservation-actions template file. Priority species lists will strongly influence prioritization of conservation actions at national levels, but action should not be exclusive to listed species. In addition, all species on this list will not necessarily require immediate action. Our method is transparent, reproducible, and readily applicable to other taxa and regions.

  3. Conserved regions of ribonucleoprotein ribonuclease MRP are involved in interactions with its substrate.


    Esakova, Olga; Perederina, Anna; Berezin, Igor; Krasilnikov, Andrey S


    Ribonuclease (RNase) MRP is a ubiquitous and essential site-specific eukaryotic endoribonuclease involved in the metabolism of a wide range of RNA molecules. RNase MRP is a ribonucleoprotein with a large catalytic RNA moiety that is closely related to the RNA component of RNase P, and multiple proteins, most of which are shared with RNase P. Here, we report the results of an ultraviolet-cross-linking analysis of interactions between a photoreactive RNase MRP substrate and the Saccharomyces cerevisiae RNase MRP holoenzyme. The results show that the substrate interacts with phylogenetically conserved RNA elements universally found in all enzymes of the RNase P/MRP family, as well as with a phylogenetically conserved RNA region that is unique to RNase MRP, and demonstrate that four RNase MRP protein components, all shared with RNase P, interact with the substrate. Implications for the structural organization of RNase MRP and the roles of its components are discussed.

  4. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    SciTech Connect

    Loots, G; Ovcharenko, I


    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. We have created a database of evolutionary conserved regions (ECRs) in vertebrate genomes entitled ECRbase that is constructed from a collection of pairwise vertebrate genome alignments produced by the ECR Browser database. ECRbase features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a collection of promoters in all vertebrate genomes presented in the database. The database also contains a collection of annotated transcription factor binding sites (TFBS) in all ECRs and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and two pufferfish genomes. It is freely accessible at

  5. Understanding Drought and Regional Conservation Efforts on Urban Ecohydrology in Southern California

    NASA Astrophysics Data System (ADS)

    Hogue, T. S.


    Cities in the western U.S. are under increasing pressure to reduce the demand of imported water through increasing conservation efforts, altering non-native landscapes, and enhancing local water supplies. The State of California adopted emergency regulations implementing a mandatory 25% statewide reduction in potable urban water use and agricultural restrictions have also been enacted. The complexities in urban water flows and lack of granular data make understanding the impact of conservation and demand change on regional ecohydrology difficult. This presentation highlights ongoing work to better understand the coupling between humans, water and ecosystems in semi-arid urban cities, using metropolitan southern California as a case study. We evaluate historical and contemporary ecohydrologic behavior and human impacts through intensive data collection, remote sensing and high resolution modeling. The change in outdoor irrigation rates due to recent conservation measures (2008-2010) has resulted in overall decreased greenness and reduced dry season streamflow; however significant variability in conservation response is observed. Groundwater recharge, artificially supported by landscape irrigation, is also being impacted. In general, anthropogenic water fluxes (irrigation, pipe leakage, spreading grounds) are not parameterized in hydrologic and land surface models applied over urban areas. Inclusion of landscape irrigation significantly improves neighborhood scale simulations of evaporative fluxes and land surface temperatures and results in shifts in the energy partitioning. The cooling effects of irrigation on daily air temperatures has the largest influence over low intensity residential areas, with an average 2°C decrease observed in coupled model simulations (WRF-Noah-UCM). Ultimately, we strive to improve predictions of human-water interactions in semi-arid cities to better understand the effectiveness and impacts of ongoing drought and conservation efforts

  6. Hot Spots and Hot Times: Wildlife Road Mortality in a Regional Conservation Corridor.


    Garrah, Evelyn; Danby, Ryan K; Eberhardt, Ewen; Cunnington, Glenn M; Mitchell, Scott


    Strategies to reduce wildlife road mortality have become a significant component of many conservation efforts. However, their success depends on knowledge of the temporal and spatial patterns of mortality. We studied these patterns along the 1000 Islands Parkway in Ontario, Canada, a 37 km road that runs adjacent to the St. Lawrence River and bisects the Algonquin-to-Adirondacks international conservation corridor. Characteristics of all vertebrate road kill were recorded during 209 bicycle surveys conducted from 2008 to 2011. We estimate that over 16,700 vertebrates are killed on the road from April to October each year; most are amphibians, but high numbers of birds, mammals, and reptiles were also found, including six reptiles considered at-risk in Canada. Regression tree analysis was used to assess the importance of seasonality, weather, and traffic on road kill magnitude. All taxa except mammals exhibited distinct temporal peaks corresponding to phases in annual life cycles. Variations in weather and traffic were only important outside these peak times. Getis-Ord analysis was used to identify spatial clusters of mortality. Hot spots were found in all years for all taxa, but locations varied annually. A significant spatial association was found between multiyear hot spots and wetlands. The results underscore the notion that multi-species conservation efforts must account for differences in the seasonality of road mortality among species and that multiple years of data are necessary to identify locations where the greatest conservation good can be achieved. This information can be used to inform mitigation strategies with implications for conservation at regional scales.

  7. Hot Spots and Hot Times: Wildlife Road Mortality in a Regional Conservation Corridor

    NASA Astrophysics Data System (ADS)

    Garrah, Evelyn; Danby, Ryan K.; Eberhardt, Ewen; Cunnington, Glenn M.; Mitchell, Scott


    Strategies to reduce wildlife road mortality have become a significant component of many conservation efforts. However, their success depends on knowledge of the temporal and spatial patterns of mortality. We studied these patterns along the 1000 Islands Parkway in Ontario, Canada, a 37 km road that runs adjacent to the St. Lawrence River and bisects the Algonquin-to-Adirondacks international conservation corridor. Characteristics of all vertebrate road kill were recorded during 209 bicycle surveys conducted from 2008 to 2011. We estimate that over 16,700 vertebrates are killed on the road from April to October each year; most are amphibians, but high numbers of birds, mammals, and reptiles were also found, including six reptiles considered at-risk in Canada. Regression tree analysis was used to assess the importance of seasonality, weather, and traffic on road kill magnitude. All taxa except mammals exhibited distinct temporal peaks corresponding to phases in annual life cycles. Variations in weather and traffic were only important outside these peak times. Getis-Ord analysis was used to identify spatial clusters of mortality. Hot spots were found in all years for all taxa, but locations varied annually. A significant spatial association was found between multiyear hot spots and wetlands. The results underscore the notion that multi-species conservation efforts must account for differences in the seasonality of road mortality among species and that multiple years of data are necessary to identify locations where the greatest conservation good can be achieved. This information can be used to inform mitigation strategies with implications for conservation at regional scales.

  8. Conserved region 3 of the adenovirus type 5 DNA-binding protein is important for interaction with single-stranded DNA.

    PubMed Central

    Neale, G A; Kitchingman, G R


    The adenovirus-encoded single-stranded DNA-binding protein (DBP) functions in viral DNA replication and several aspects of RNA metabolism. Previous studies (G. A. M. Neale and G. R. Kitchingman, J. Biol. Chem. 264:3153-3159, 1989) have defined three highly conserved regions in the carboxy-terminal domain of the protein (amino acids 178 to 186, 322 to 330, and 464 to 475) that may be involved in the binding of the protein to single-stranded DNA. We examined the role of conserved region 3 (464 to 475) by constructing nine classes of point mutants with from one to four amino acid changes. The point mutants were tested for their ability to assist adeno-associated virus DNA replication. All nine differed from wild-type DBP; seven were essentially nonfunctional, whereas two had 55 and 145%, respectively, of the wild-type DBP helper activity. Three of the mutants were found to be temperature sensitive, with significantly greater helper activity at 33 degrees C than at 37 degrees C. All nine mutants produced essentially wild-type levels of protein. One monoclonal antibody against the DBP, termed 2/4, did not immunoprecipitate the mutant DBPs as well as wild-type DBP, indicating either that the antibody recognized sequences around CR3 or that the conformation of the protein around the epitope recognized by 2/4 had changed. Two of the three temperature-sensitive DBP mutants bound to single-stranded DNA-cellulose with the same affinity as wild-type DBP at 4 degrees C; the remaining mutants all showed reduced affinity. These results demonstrated that many of the residues within conserved region 3 of the DBP are important for interaction of the protein with nucleic acid. Images PMID:2296078

  9. Criteria for protected areas and other conservation measures in the Antarctic region

    SciTech Connect

    Angel, M.V.


    The Antarctic region is threatened by three major anthropogenic influences: climatic change brought about by increases in atmospheric carbon dioxide, the effects of persistent pollutants carried into the region via atmosphere and ocean, and the increase in Man's activities. These include radioactive wastes, organochlorides, freons, PCBs and heavy metals. Vulnerable ecosystems can be considered as those which are under direct pressure from Man's activities, whereas fragile ecosystems are the more likely to suffer irreversible change when perturbed, but are not necessarily threatened at present. Three of the main habitat types, terrestrial, inland waters, and islands, are likely to be fragile. However, all these can be conserved reasonably adequately with a system of protected and managed areas, so long as the area covered is adequate and representative. The fourth habitat type, the oceanic ecosystem, contains few fragile elements because it is dominated by the highly dynamic physical oceanic processes. Elements of the ecosystem are vulnerable to further exploitation, and although only the whales and some of the fish stocks can be regarded as fragile, there is considerably uncertainty as what synergistic effect exploitation of apparently key elements of the ecosystem, such as the krill, will have on other important components of the communities. The highly dynamic structure of oceanic environments renders the concept of conservation based on limited protected areas developed for terrestrial environments ineffective in the majority of marine environments. Instead the whole marine environment of the Antarctic region must be considered to be a single entity and managed as such.

  10. Water Use Conservation Scenarios for the Mississippi Delta Using an Existing Regional Groundwater Flow Model

    NASA Astrophysics Data System (ADS)

    Barlow, J. R.; Clark, B. R.


    The alluvial plain in northwestern Mississippi, locally referred to as the Delta, is a major agricultural area, which contributes significantly to the economy of Mississippi. Land use in this area can be greater than 90 percent agriculture, primarily for growing catfish, corn, cotton, rice, and soybean. Irrigation is needed to smooth out the vagaries of climate and is necessary for the cultivation of rice and for the optimization of corn and soybean. The Mississippi River Valley alluvial (MRVA) aquifer, which underlies the Delta, is the sole source of water for irrigation, and over use of the aquifer has led to water-level declines, particularly in the central region. The Yazoo-Mississippi-Delta Joint Water Management District (YMD), which is responsible for water issues in the 17-county area that makes up the Delta, is directing resources to reduce the use of water through conservation efforts. The U.S. Geological Survey (USGS) recently completed a regional groundwater flow model of the entire Mississippi embayment, including the Mississippi Delta region, to further our understanding of water availability within the embayment system. This model is being used by the USGS to assist YMD in optimizing their conservation efforts by applying various water-use reduction scenarios, either uniformly throughout the Delta, or in focused areas where there have been large groundwater declines in the MRVA aquifer.

  11. Conservation phylogeography: does historical diversity contribute to regional vulnerability in European tree frogs (Hyla arborea)?


    Dufresnes, Christophe; Wassef, Jérôme; Ghali, Karim; Brelsford, Alan; Stöck, Matthias; Lymberakis, Petros; Crnobrnja-Isailovic, Jelka; Perrin, Nicolas


    Documenting and preserving the genetic diversity of populations, which conditions their long-term survival, have become a major issue in conservation biology. The loss of diversity often documented in declining populations is usually assumed to result from human disturbances; however, historical biogeographic events, otherwise known to strongly impact diversity, are rarely considered in this context. We apply a multilocus phylogeographic study to investigate the late-Quaternary history of a tree frog (Hyla arborea) with declining populations in the northern and western part of its distribution range. Mitochondrial and nuclear polymorphisms reveal high genetic diversity in the Balkan Peninsula, with a spatial structure moulded by the last glaciations. While two of the main refugial lineages remained limited to the Balkans (Adriatic coast, southern Balkans), a third one expanded to recolonize Northern and Western Europe, loosing much of its diversity in the process. Our findings show that mobile and a priori homogeneous taxa may also display substructure within glacial refugia ('refugia within refugia') and emphasize the importance of the Balkans as a major European biodiversity centre. Moreover, the distribution of diversity roughly coincides with regional conservation situations, consistent with the idea that historically impoverished genetic diversity may interact with anthropogenic disturbances, and increase the vulnerability of populations. Phylogeographic models seem important to fully appreciate the risks of local declines and inform conservation strategies.

  12. Conserved 33-kb haplotype in the MHC class III region regulates chronic arthritis

    PubMed Central

    Yau, Anthony C. Y.; Tuncel, Jonatan; Norin, Ulrika; Houtman, Miranda; Padyukov, Leonid; Holmdahl, Rikard


    Genome-wide association studies have revealed many genetic loci associated with complex autoimmune diseases. In rheumatoid arthritis (RA), the MHC gene HLA-DRB1 is the strongest candidate predicting disease development. It has been suggested that other immune-regulating genes in the MHC contribute to the disease risk, but this contribution has been difficult to show because of the strong linkage disequilibrium within the MHC. We isolated genomic regions in the form of congenic fragments in rats to test whether there are additional susceptibility loci in the MHC. By both congenic mapping in inbred strains and SNP typing in wild rats, we identified a conserved, 33-kb large haplotype Ltab-Ncr3 in the MHC-III region, which regulates the onset, severity, and chronicity of arthritis. The Ltab-Ncr3 haplotype consists of five polymorphic immunoregulatory genes: Lta (lymphotoxin-α), Tnf, Ltb (lymphotoxin-β), Lst1 (leukocyte-specific transcript 1), and Ncr3 (natural cytotoxicity-triggering receptor 3). Significant correlation in the expression of the Ltab-Ncr3 genes suggests that interaction of these genes may be important in keeping these genes clustered together as a conserved haplotype. We studied the arthritis association and the spliceo-transcriptome of four different Ltab-Ncr3 haplotypes and showed that higher Ltb and Ncr3 expression, lower Lst1 expression, and the expression of a shorter splice variant of Lst1 correlate with reduced arthritis severity in rats. Interestingly, patients with mild RA also showed higher NCR3 expression and lower LST1 expression than patients with severe RA. These data demonstrate the importance of a conserved haplotype in the regulation of complex diseases such as arthritis. PMID:27303036

  13. The Association Between Biological Subtype and Isolated Regional Nodal Failure After Breast-Conserving Therapy

    SciTech Connect

    Wo, Jennifer Y.; Taghian, Alphonse G.; Nguyen, Paul L.; Raad, Rita Abi; Sreedhara, Meera B.A.; Bellon, Jennifer R.; Wong, Julia S.; Gadd, Michele A.; Smith, Barbara L.; Harris, Jay R.


    Purpose: To evaluate the risk of isolated regional nodal failure (RNF) among women with invasive breast cancer treated with breast-conserving surgery (BCS) and radiation therapy (RT) and to determine factors, including biological subtype, associated with RNF. Methods and Materials: We retrospectively studied 1,000 consecutive women with invasive breast cancer who received breast-conserving surgery and RT from 1997 through 2002. Ninety percent of patients received adjuvant systemic therapy; none received trastuzumab. Sentinel lymph node biopsy was done in 617 patients (62%). Of patients with one to three positive nodes, 34% received regional nodal irradiation (RNI). Biological subtype classification into luminal A, luminal B, HER-2, and basal subtypes was based on estrogen receptor status-, progesterone receptor status-, and HER-2-status of the primary tumor. Results: Median follow-up was 77 months. Isolated RNF occurred in 6 patients (0.6%). On univariate analysis, biological subtype (p = 0.0002), lymph node involvement (p = 0.008), lymphovascular invasion (p = 0.02), and Grade 3 histology (p = 0.01) were associated with significantly higher RNF rates. Compared with luminal A, the HER-2 (p = 0.01) and basal (p = 0.08) subtypes were associated with higher RNF rates. The 5-year RNF rate among patients with one to three positive nodes treated with tangents alone was 2.4%; we could not identify a subset of these patients with a substantial risk of RNF. Conclusions: Isolated RNF is a rare occurrence after breast-conserving therapy. Patients with the HER-2 (not treated with trastuzumab) and basal subtypes appear to be at higher risk of developing RNF although this risk is not high enough to justify the addition of RNI. Low rates of RNF in patients with one to three positive nodes suggest that tangential RT without RNI is reasonable in most patients.

  14. Land Conservation Plan from the New Hampshire’s Coastal Watersheds (Piscataqua Region Estuaries Partnership)

    EPA Pesticide Factsheets

    The overarching goal of this land conservation plan is to focus conservation on those lands and waters that are most important for conserving living resources - native plants, animals and natural communities - and water quality in the coastal watersheds.

  15. Ranking European regions as providers of structural riparian corridors for conservation and management purposes

    NASA Astrophysics Data System (ADS)

    Clerici, Nicola; Vogt, Peter


    Riparian zones are of utmost importance in providing a wide range of ecological and societal services. Among these, their role in maintaining landscape connectivity through ecological corridors for animals and plants is of major interest from a conservation and management perspective. This paper describes a methodology to identify European regions as providers of structural riparian corridors, and to rank them with reference to conservation priority. Physical riparian connectors among core habitat patches are identified through a recent segmentation technique, the Morphological Spatial Pattern Analysis. A multi-scale approach is followed by considering different edge distances to identify core and peripheral habitats for a range of hypothetical species. The ranking is performed using a simple set of indices that take into account the degree of environmental pressure and the presence of land protection schemes. An example for environmental reporting is carried out using European administrative regions and major rivers to summarize indices value. The approach is based on freely available software and simple metrics which can be easily reproduced in a GIS environment.

  16. Conservation status and regional habitat priorities for the Orinoco crocodile: Past, present, and future

    PubMed Central

    Espinosa-Blanco, Ariel S.; Morales-Betancourt, Mónica A.; Seijas, Andrés E.; Lasso, Carlos A.; Antelo, Rafael; Densmore, Llewellyn D.


    Conservation of large predator species has historically been a challenge because they often overlap in resource utilization with humans; furthermore, there is a general lack of in-depth knowledge of their ecology and natural history. We assessed the conservation status of the Orinoco crocodile (Crocodylus intermedius), defining regional habitat priorities/crocodile conservation units (RHP/CCU) and regional research priorities (RRP) for this species. We also estimated a species distribution model (SDM) to define current suitable areas where the species might inhabit and/or that might be successfully colonized. The SDM area obtained with a suitable habitat probability ≥ 0.5 was 23,621 km2. Out of 2,562 km2 are included within protected areas in both Colombia (1,643 km2) and Venezuela (919 km2), which represents only 10.8% of C. intermedius’ potential range. Areas such as Laguna de Chigüichigüe (flood plain lagoon) exhibited an increase in population abundance. In contrast, localities such as the Cojedes and Manapire Rivers reported a significant reduction in relative abundance values. In Colombia, disparity in previous survey methods prevented accurate estimation of population trends. Only one study in this country described an increase over a 13 years span in the Ele, Lipa, and Cravo Norte River populations based on nest surveys. We defined 34 critical areas (16 in Colombia, 17 in Venezuela, and one covering both countries) where we need to preserve/research/monitor and/or generate management actions, 10 RHP/CCU (six from Venezuela and four from Colombia) and 24 RRP (11 from Venezuela, 12 from Colombia, and one in both countries). Caño Guaritico (Creek) and the Capanaparo River in Venezuela and the Ele, Lipa, Cravo Norte River System and the Guayabero River in Colombia were defined as areas with the most optimal conditions for long-term preservation and maintenance of C. intermedius populations. We conclude that the conservation status of this species is

  17. Conservation status and regional habitat priorities for the Orinoco crocodile: Past, present, and future.


    Balaguera-Reina, Sergio A; Espinosa-Blanco, Ariel S; Morales-Betancourt, Mónica A; Seijas, Andrés E; Lasso, Carlos A; Antelo, Rafael; Densmore, Llewellyn D


    Conservation of large predator species has historically been a challenge because they often overlap in resource utilization with humans; furthermore, there is a general lack of in-depth knowledge of their ecology and natural history. We assessed the conservation status of the Orinoco crocodile (Crocodylus intermedius), defining regional habitat priorities/crocodile conservation units (RHP/CCU) and regional research priorities (RRP) for this species. We also estimated a species distribution model (SDM) to define current suitable areas where the species might inhabit and/or that might be successfully colonized. The SDM area obtained with a suitable habitat probability ≥ 0.5 was 23,621 km2. Out of 2,562 km2 are included within protected areas in both Colombia (1,643 km2) and Venezuela (919 km2), which represents only 10.8% of C. intermedius' potential range. Areas such as Laguna de Chigüichigüe (flood plain lagoon) exhibited an increase in population abundance. In contrast, localities such as the Cojedes and Manapire Rivers reported a significant reduction in relative abundance values. In Colombia, disparity in previous survey methods prevented accurate estimation of population trends. Only one study in this country described an increase over a 13 years span in the Ele, Lipa, and Cravo Norte River populations based on nest surveys. We defined 34 critical areas (16 in Colombia, 17 in Venezuela, and one covering both countries) where we need to preserve/research/monitor and/or generate management actions, 10 RHP/CCU (six from Venezuela and four from Colombia) and 24 RRP (11 from Venezuela, 12 from Colombia, and one in both countries). Caño Guaritico (Creek) and the Capanaparo River in Venezuela and the Ele, Lipa, Cravo Norte River System and the Guayabero River in Colombia were defined as areas with the most optimal conditions for long-term preservation and maintenance of C. intermedius populations. We conclude that the conservation status of this species is still

  18. Spatial genetic structure and regional demography in the southern torrent salamander: Implications for conservation and management

    USGS Publications Warehouse

    Miller, Mark P.; Haig, Susan M.; Wagner, R.S.


    The Southern torrent salamander (Rhyacotriton variegatus) was recently found not warranted for listing under the US Endangered Species Act due to lack of information regarding population fragmentation and gene flow. Found in small-order streams associated with late-successional coniferous forests of the US Pacific Northwest, threats to their persistence include disturbance related to timber harvest activities. We conducted a study of genetic diversity throughout this species' range to 1) identify major phylogenetic lineages and phylogeographic barriers and 2) elucidate regional patterns of population genetic and spatial phylogeographic structure. Cytochrome b sequence variation was examined for 189 individuals from 72 localities. We identified 3 major lineages corresponding to nonoverlapping geographic regions: a northern California clade, a central Oregon clade, and a northern Oregon clade. The Yaquina River may be a phylogeographic barrier between the northern Oregon and central Oregon clades, whereas the Smith River in northern California appears to correspond to the discontinuity between the central Oregon and northern California clades. Spatial analyses of genetic variation within regions encompassing major clades indicated that the extent of genetic structure is comparable among regions. We discuss our results in the context of conservation efforts for Southern torrent salamanders.

  19. Molecular genetic aetiology of general cognitive function is enriched in evolutionarily conserved regions

    PubMed Central

    Hill, W D; Davies, G; Harris, S E; Hagenaars, S P; Davies, Gail; Deary, Ian J; Debette, Stephanie; Verbaas, Carla I; Bressler, Jan; Schuur, Maaike; Smith, Albert V; Bis, Joshua C; Bennett, David A; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosley Jr, Thomas H; Liewald, D C; Penke, L; Gale, C R; Deary, I J


    Differences in general cognitive function have been shown to be partly heritable and to show genetic correlations with several psychiatric and physical disease states. However, to date, few single-nucleotide polymorphisms (SNPs) have demonstrated genome-wide significance, hampering efforts aimed at determining which genetic variants are most important for cognitive function and which regions drive the genetic associations between cognitive function and disease states. Here, we combine multiple large genome-wide association study (GWAS) data sets, from the CHARGE cognitive consortium (n=53 949) and UK Biobank (n=36 035), to partition the genome into 52 functional annotations and an additional 10 annotations describing tissue-specific histone marks. Using stratified linkage disequilibrium score regression we show that, in two measures of cognitive function, SNPs associated with cognitive function cluster in regions of the genome that are under evolutionary negative selective pressure. These conserved regions contained ~2.6% of the SNPs from each GWAS but accounted for ~40% of the SNP-based heritability. The results suggest that the search for causal variants associated with cognitive function, and those variants that exert a pleiotropic effect between cognitive function and health, will be facilitated by examining these enriched regions. PMID:27959336

  20. Northwest Climate Science Center: Integrating Regional Research, Conservation and Natural Resource Management

    NASA Astrophysics Data System (ADS)

    Mote, P.; Bisbal, G.


    The Northwest Climate Science Center (NW CSC) was established in 2010, among the first three of eight regional Climate Science Centers created by the Department of the Interior (DOI). The NW CSC is supported by an academic consortium (Oregon State University, University of Idaho, and the University of Washington), which has the capacity to generate and coordinate decision-relevant science related to climate, thus serving stakeholders across the Pacific Northwest region. The NW CSC has overlapping boundaries with three Landscape Conservation Cooperatives (LCCs): the Great Northern, the Great Basin, and the North Pacific. Collaboration between the NW CSC and these three LCCs addresses the highest priority regional climate science needs of Northwest natural and cultural resource managers. Early in 2012, the NW CSC released its first Strategic Plan for the period 2012-2015. The plan offers a practical blueprint for operation and describes five core services that the NW CSC provides to the Northwest community. These core services emphasize (a) bringing together the regional resource management and science communities to calibrate priorities and ensure efficient integration of climate science resources and tools when addressing practical issues of regional significance; (b) developing and implementing a stakeholder-driven science agenda which highlights the NW CSC's regional leadership in generating scenarios of the future environment of the NW; (c) supporting and training graduate students at the three consortium universities, including through an annual 'Climate science boot camp'; (d) providing a platform for effective climate-change-related communication among scientists, resource managers, and the general public; and (e) national leadership in data management and climate scenario development.

  1. Conserving Prairie Pothole Region wetlands and surrounding grasslands: evaluating effects on amphibians

    USGS Publications Warehouse

    Mushet, David M.; Neau, Jordan L.


    The maintenance of viable and genetically diverse populations of amphibians in the Prairie Pothole Region of the United States depends on upland as well as wetland over-wintering and landscape level habitat features. Prairie pothole wetlands provide important amphibian breeding habitat while grasslands surrounding these wetlands provide foraging habitat for adults, overwintering habitat for some species, and important connectivity among breeding wetlands. Grasslands surrounding wetlands were found to be especially important for wood frogs and northern leopard frogs, while croplands dominated habitat utilized by Great Plains toads and Woodhouse’s toads. Habitat suitability mapping highlighted (1) the influence of deep-water overwintering wetlands on suitable habitat for four of five anuran species encountered; (2) the lack of overlap between areas of core habitat for both the northern leopard frog and wood frog compared to the core habitat for both toad species; and (3) the importance of conservation programs in providing grassland components of northern leopard frog and wood frog habitat. Currently, there are approximately 7.2 million acres (2.9 million hectares, ha) of habitat in the PPR identified as suitable for amphibians. WRP and CRP wetland and grassland habitats accounted for approximately 1.9 million acres (0.75 million ha) or 26 percent of this total area. Continued loss of amphibian habitat resulting from an ongoing trend of returning PPR conservation lands to crop production, will likely have significant negative effects on the region’s ability to maintain amphibian biodiversity. Conversely, increases in conservation wetlands and surrounding grasslands on the PPR landscape have great potential to positively influence the region’s amphibian populations.

  2. Diversity and distribution of aquatic insects in Southern Brazil wetlands: implications for biodiversity conservation in a Neotropical region.


    Maltchik, Leonardo; Dalzochio, Marina Schmidt; Stenert, Cristina; Rolon, Ana Silvia


    The selection of priority areas is an enormous challenge for biodiversity conservation. Some biogeographic methods have been used to identify the priority areas to conservation, and panbiogeography is one of them. This study aimed at the utilization of panbiogeographic tools, to identify the distribution patterns of aquatic insect genera, in wetland systems of an extensive area in the Neotropical region (approximately 280 000km2), and to compare the distribution of the biogeographic units identified by the aquatic insects, with the conservation units of Southern Brazil. We analyzed the distribution pattern of 82 genera distributed in four orders of aquatic insects (Diptera, Odonata, Ephemeroptera and Trichoptera) in Southern Brazil wetlands. Therefore, 32 biogeographic nodes corresponded to the priority areas for conservation of the aquatic insect diversity. Among this total, 13 were located in the Atlantic Rainforest, 16 in the Pampa and three amongst both biomes. The distribution of nodes showed that only 15% of the dispersion centers of insects were inserted in conservation units. The four priority areas pointed by node cluster criterion must be considered in further inclusions of areas for biodiversity conservation in Southern Brazil wetlands, since such areas present species from different ancestral biota. The inclusion of such areas into the conservation units would be a strong way to conserve the aquatic biodiversity in this region.

  3. The lncRNA SLNCR1 mediates melanoma invasion through a conserved SRA1-like region

    PubMed Central

    Schmidt, Karyn; Joyce, Cailin E.; Buquicchio, Frank; Brown, Adam; Ritz, Justin; Distel, Robert J.; Yoon, Charles H.; Novina, Carl D.


    SUMMARY Long non-coding RNAs (lncRNAs) have been implicated in numerous physiological processes and diseases, most notably cancers. However, little is known about the mechanism of many functional lncRNAs. We identified an abundantly-expressed lncRNA associated with decreased melanoma patient survival. Increased expression of this lncRNA, SLNCR1, mediates melanoma invasion through a highly-conserved sequence similar to the lncRNA SRA1. Using a sensitive technique we term RATA (RNA-associated transcription factor array), we show that the brain-specific homeobox protein 3a (Brn3a) and the androgen receptor (AR) bind within and adjacent to SLNCR1’s conserved region, respectively. SLNCR1, AR, and Brn3a are specifically required for transcriptional activation of matrix metalloproteinase 9 (MMP9) and increased melanoma invasion. Our observations directly link AR to melanoma invasion, possibly explaining why males experience more melanoma metastases and have an overall lower survival as compared to females. PMID:27210747

  4. Genetic interactions of conserved regions in the DEAD-box protein Prp28p.

    PubMed Central

    Chang, T H; Latus, L J; Liu, Z; Abbott, J M


    The yeast PRP28 g ene has been implicated in nuclear precursor messenger RNA (pre-mRNA) splicing, a two-step reaction involved in a multitude of RNA structural alterations. Prp28p, the gene product of PRP28 , is a member of the evolutionarily conserved DEAD-box proteins (DBPs). Members of DBPs are involved in a variety of RNA-related biochemical processes, presumably by their putative RNA helicase activities. Prp28p has been speculated to play a role in melting the duplex between U4 and U6 small nuclear RNAs (snRNAs), leading to the formation of an active spliceosome. To study the function of Prp28p and its interactions with other components of the splicing machinery, we have isolated and characterized a large number of prp28 conditional mutants. Strikingly, many of these prp28 mutations are localized in the highly conserved motifs found in all the DBPs. Intragenic reversion analysis suggests that regions of motifs II, III and V, as well as of motifs I and IV, in Prp28p are likely to be in close proximity to each other. Our results thus provide the first hint of the local structural arrangement for Prp28p, and perhaps for other DBPs as well. PMID:9396812

  5. How to maximally support local and regional biodiversity in applied conservation? Insights from pond management.


    Lemmens, Pieter; Mergeay, Joachim; De Bie, Tom; Van Wichelen, Jeroen; De Meester, Luc; Declerck, Steven A J


    Biodiversity and nature values in anthropogenic landscapes often depend on land use practices and management. Evaluations of the association between management and biodiversity remain, however, comparatively scarce, especially in aquatic systems. Furthermore, studies also tend to focus on a limited set of organism groups at the local scale, whereas a multi-group approach at the landscape scale is to be preferred. This study aims to investigate the effect of pond management on the diversity of multiple aquatic organism groups (e.g. phytoplankton, zooplankton, several groups of macro-invertebrates, submerged and emergent macrophytes) at local and regional spatial scales. For this purpose, we performed a field study of 39 shallow man-made ponds representing five different management types. Our results indicate that fish stock management and periodic pond drainage are crucial drivers of pond biodiversity. Furthermore, this study provides insight in how the management of eutrophied ponds can contribute to aquatic biodiversity. A combination of regular draining of ponds with efforts to keep ponds free of fish seems to be highly beneficial for the biodiversity of many groups of aquatic organisms at local and regional scales. Regular draining combined with a stocking of fish at low biomass is also preferable to infrequent draining and lack of fish stock control. These insights are essential for the development of conservation programs that aim long-term maintenance of regional biodiversity in pond areas across Europe.

  6. Identification and characterization of conserved and variable regions of lime witches' broom phytoplasma genome.


    Siampour, Majid; Izadpanah, Keramatollah; Marzachi, Cristina; Salehi Abarkoohi, Mohammad


    Several segments (∼20  kbp) of the lime witches' broom (LWB) phytoplasma genome (16SrII group) were sequenced and analysed. A 5.7  kbp segment (LWB-C) included conserved genes whose phylogenetic tree was consistent with that generated using 16S rRNA genes. Another 6.4  kbp LWB phytoplasma genome segment (LWB-NC) was structurally similar to the putative mobile unit or sequence variable mosaic genomic region of phytoplasmas, although it represented a new arrangement of genes or pseudogenes such as phage-related protein genes and tra5 insertion sequences. Sequence- and phylogenetic-based evidence suggested that LWB-NC is a genomic region which includes horizontally transferred genes and could be regarded as a hot region to incorporate more foreign genes into the genome of LWB phytoplasma. The presence of phylogenetically related fragments of retroelements was also verified in the LWB phytoplasma genome. Putative intragenomic retrotransposition or retrohoming of these elements might have been determinant in shaping and manipulating the LWB phytoplasma genome. Altogether, the results of this study suggested that the genome of LWB phytoplasma is colonized by a variety of genes that have been acquired through horizontal gene transfer events, which may have further affected the genome through intragenomic mobility and insertion at cognate or incognate sites. Some of these genes are expected to have been involved in the development of features specific to LWB phytoplasma.

  7. Illicit crops and armed conflict as constraints on biodiversity conservation in the Andes region.


    Fjeldså, Jon; Alvarez, María D; Lazcano, Juan Mario; León, Blanca


    Coca, once grown for local consumption in the Andes, is now produced for external markets, often in areas with armed conflict. Internationally financed eradication campaigns force traffickers and growers to constantly relocate, making drug-related activities a principal cause of forest loss. The impact on biodiversity is known only in general terms, and this article presents the first regional analysis to identify areas of special concern, using bird data as proxy. The aim of conserving all species may be significantly constrained in the Santa Marta and Perijá mountains, Darién, some parts of the Central Andes in Colombia, and between the middle Marañón and middle Huallaga valleys in Peru. Solutions to the problem must address the root causes: international drug markets, long-lasting armed conflict, and lack of alternative income for the rural poor.

  8. A new region of conservation is defined between human and mouse X chromosomes

    SciTech Connect

    Dinulos, M.B.; Disteche, C.M.; Bassi, M.T.


    Comparative mapping of the X chromosome in eutherian mammals have revealed distinct regions of conservation as well as evolutionary rearrangements between human and mouse. Recently, we and others mapped the murine homologue of CLCN4 (Chloride channel 4) to band F4 of the X chromosome in Mus spretus but to chromosome 7 in laboratory strains. We now report the mapping of the murine homologues of APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), two genes that are located on the human X chromosome at band p22.3 and in close proximity to CLCN4. Interestingly, Oa1 and Apxl map to bands F2-F3 in both M. spretus and the laboratory strain C57BL/6J, defining a new rearrangement between human and mouse X chromosomes. 17 refs., 2 figs., 1 tab.

  9. Importance of regional variation in conservation planning: A rangewide example of the Greater Sage-Grouse

    USGS Publications Warehouse

    Doherty, Kevin E; Evans, Jeffrey S.; Coates, Peter S.; Juliusson, Lara; Fedy, Bradley C.


    We developed rangewide population and habitat models for Greater Sage-Grouse (Centrocercus urophasianus) that account for regional variation in habitat selection and relative densities of birds for use in conservation planning and risk assessments. We developed a probabilistic model of occupied breeding habitat by statistically linking habitat characteristics within 4 miles of an occupied lek using a nonlinear machine learning technique (Random Forests). Habitat characteristics used were quantified in GIS and represent standard abiotic and biotic variables related to sage-grouse biology. Statistical model fit was high (mean correctly classified = 82.0%, range = 75.4–88.0%) as were cross-validation statistics (mean = 80.9%, range = 75.1–85.8%). We also developed a spatially explicit model to quantify the relative density of breeding birds across each Greater Sage-Grouse management zone. The models demonstrate distinct clustering of relative abundance of sage-grouse populations across all management zones. On average, approximately half of the breeding population is predicted to be within 10% of the occupied range. We also found that 80% of sage-grouse populations were contained in 25–34% of the occupied range within each management zone. Our rangewide population and habitat models account for regional variation in habitat selection and the relative densities of birds, and thus, they can serve as a consistent and common currency to assess how sage-grouse habitat and populations overlap with conservation actions or threats over the entire sage-grouse range. We also quantified differences in functional habitat responses and disturbance thresholds across the Western Association of Fish and Wildlife Agencies (WAFWA) management zones using statistical relationships identified during habitat modeling. Even for a species as specialized as Greater Sage-Grouse, our results show that ecological context matters in both the strength of habitat selection (i

  10. Economic efficiency and cost implications of habitat conservation: An example in the context of the Edwards Aquifer region

    NASA Astrophysics Data System (ADS)

    Gillig, Dhazn; McCarl, Bruce A.; Jones, Lonnie L.; Boadu, Frederick


    Groundwater management in the Edwards Aquifer in Texas is in the process of moving away from a traditional right of capture economic regime toward a more environmentally sensitive scheme designed to preserve endangered species habitats. This study explores economic and environmental implications of proposed groundwater management and water development strategies under a proposed regional Habitat Conservation Plan. Results show that enhancing the habitat by augmenting water flow costs $109-1427 per acre-foot and that regional water development would be accelerated by the more extreme possibilities under the Habitat Conservation Plan. The findings also indicate that a water market would improve regional welfare and lower water development but worsen environmental attributes.

  11. A conserved region in the prM protein is a critical determinant in the assembly of flavivirus particles.


    Yoshii, Kentaro; Igarashi, Manabu; Ichii, Osamu; Yokozawa, Kana; Ito, Kimihito; Kariwa, Hiroaki; Takashima, Ikuo


    Flaviviruses are assembled to bud into the lumen of the endoplasmic reticulum (ER) and are secreted through the vesicle transport pathway, but the details of the molecular mechanism of virion assembly remain largely unknown. In this study, a highly conserved region in the prM protein was identified among flaviviruses. In the subviral particle (SP) system of tick-borne encephalitis virus (TBEV) and Japanese encephalitis virus, secretion of SPs was impaired by a mutation in the conserved region in the prM protein. Viral proteins were sparse in the Golgi complex and accumulated in the ER. Ultrastructural analysis revealed that long filamentous structures, rather than spherical SPs, were observed in the lumen of the ER as a result of the mutation. The production of infectious virions derived from infectious cDNA of TBEV was also reduced by mutations in the conserved region. Molecular modelling analysis suggested that the conserved region is important for the association of prM-envelope protein heterodimers in the formation of a spike of immature virion. These results are the first demonstration that the conserved region in the prM protein is a molecular determinant for the flavivirus assembly process.

  12. Mechanisms of aquatic species invasions across the South Atlantic Landscape Conservation Cooperative region

    USGS Publications Warehouse

    Benson, Amy J.; Stith, Bradley M.; Engel, Victor C.


    Invasive species are a global issue, and the southeastern United States is not immune to the problems they present. Therefore, various analyses using modeling and exploratory statistics were performed on the U.S. Geological Survey Nonindigenous Aquatic Species (NAS) Database with the primary objective of determining the most appropriate use of presence-only data as related to invasive species in the South Atlantic Landscape Conservation Cooperative (SALCC) region. A hierarchical model approach showed that a relatively small amount of high-quality data from planned surveys can be used to leverage the information in presence-only observations, having a broad spatial coverage and high biases of observer detection and in site selection. Because a variety of sampling protocols can be used in planned surveys, this approach to the analysis of presence-only data is widely applicable. An important part of the management of natural landscapes is the preservation of designated protected areas. When the hydrologic connection was considered in this analysis, the number of potential invaders that could spread to each protected area within the SALCC region was greatly increased, with a mean exceeding 30 species and the maximum reaching 57 species. Nearly all protected areas are hydrologically connected to at least 20 nonindigenous aquatic species. To examine possible factors which may contribute to nonindigenous aquatic species richness in the SALCC region, a set of exploratory statistics was employed. The best statistical model that included a combination of three anthropogenic variables (densities of housing, roads, and reservoirs) and two environmental variables (elevation range and longitude) explained approximately 62 percent of the variation in introduced species richness. Highest nonindigenous aquatic species richness occurred in the more upland, mountainous regions, where elevation range favored reservoirs and attracted urban centers. Lastly, patterns seen in a diffusion

  13. Conserving the Greater Sage-grouse: A social-ecological systems case study from the California-Nevada region

    USGS Publications Warehouse

    Duvall, Alison L; Metcalf, Alexander L.; Coates, Peter S.


    The Endangered Species Act (ESA) continues to serve as one of the most powerful and contested federal legislative mandates for conservation. In the midst of heated debates, researchers, policy makers, and conservation practitioners champion the importance of cooperative conservation and social-ecological systems approaches, which forge partnerships at multiple levels and scales to address complex ecosystem challenges. However, few real-world examples exist to demonstrate how multifaceted collaborations among stakeholders who share a common goal of conserving at-risk species may be nested within a systems framework to achieve social and ecological goals. Here, we present a case study of Greater Sage-grouse (Centrocercus urophasianus) conservation efforts in the “Bi-State” region of California and Nevada, United States. Using key-informant interviews, we explored dimensions and drivers of this landscape-scale conservation effort. Three themes emerged from the interviews, including 1) ESA action was transformed into opportunity for system-wide conservation; 2) a diverse, locally based partnership anchored collaboration and engagement across multiple levels and scales; and 3) best-available science combined with local knowledge led to “certainty of effectiveness and implementation”—the criteria used by the US Fish and Wildlife Service to evaluate conservation efforts when making listing decisions. Ultimately, collaborative conservation through multistakeholder engagement at various levels and scales led to proactive planning and implementation of conservation measures and precluded the need for an ESA listing of the Bi-State population of Greater Sage-grouse. This article presents a potent example of how a systems approach integrating policy, management, and learning can be used to successfully overcome the conflict-laden and “wicked” challenges that surround at-risk species conservation.

  14. Biodiversity conservation in local planning.


    Miller, James R; Groom, Martha; Hess, George R; Steelman, Toddi; Stokes, David L; Thompson, Jan; Bowman, Troy; Fricke, Laura; King, Brandon; Marquardt, Ryan


    Local land-use policy is increasingly being recognized as fundamental to biodiversity conservation in the United States. Many planners and conservation scientists have called for broader use of planning and regulatory tools to support the conservation of biodiversity at local scales. Yet little is known about the pervasiveness of these practices. We conducted an on-line survey of county, municipal, and tribal planning directors (n =116) in 3 geographic regions of the United States: metropolitan Seattle, Washington; metropolitan Des Moines, Iowa; and the Research Triangle, North Carolina. Our objectives were to gauge the extent to which local planning departments address biodiversity conservation and to identify factors that facilitate or hinder conservation actions in local planning. We found that biodiversity conservation was seldom a major consideration in these departments. Staff time was mainly devoted to development mandates and little time was spent on biodiversity conservation. Regulations requiring conservation actions that might benefit biodiversity were uncommon, with the exception of rules governing water quality in all 3 regions and the protection of threatened and endangered species in the Seattle region. Planning tools that could enhance habitat conservation were used infrequently. Collaboration across jurisdictions was widespread, but rarely focused on conservation. Departments with a conservation specialist on staff tended to be associated with higher levels of conservation actions. Jurisdictions in the Seattle region also reported higher levels of conservation action, largely driven by state and federal mandates. Increased funding was most frequently cited as a factor that would facilitate greater consideration of biodiversity in local planning. There are numerous opportunities for conservation biologists to play a role in improving conservation planning at local scales.

  15. Conservation value of a native forest fragment in a region of extensive agriculture.




    A survey of mammals and birds was carried out in a semi-deciduous forest fragment of 150 ha located in a zone of intensive agriculture in Ribeirão Preto, State of São Paulo, south-eastern Brazil. Line transect sampling was used to census mammals and birds during six days, totalling 27.8 km of trails and 27.8 hours of observation. Twenty mammal species were confirmed in the area (except bats and small mammals), including rare or endangered species, such as the mountain lion (Puma concolor), the maned wolf (Chrysocyon brachyurus), and the ocelot (Leopardus pardalis). The brown capuchin monkey (Cebus apella) and the black-tufted-ear marmoset (Callithrix penicillata) were found frequently, suggesting high population density in the fragment. Regarding the avifauna, 49 bird species were recorded, most of them typical of open areas or forest edges. Some confirmed species, however, are becoming increasingly rare in the region, as for example the muscovy duck (Cairina moschata) and the toco toucan (Ramphastos toco). The results demonstrate that forest fragment of this size are refuges for native fauna in a region dominated almost exclusively by sugar-cane plantations. Besides faunal aspects, the conservation of these fragments is of great importance for the establishment of studies related to species preservation in the long term, including reintroduction and translocation projects, as well as studies related to genetic health of isolated populations.

  16. Conserved DNA motifs in the type II-A CRISPR leader region

    PubMed Central

    Babu, Kesavan; Najar, Fares Z.


    The Clustered Regularly Interspaced Short Palindromic Repeats associated (CRISPR-Cas) systems consist of RNA-protein complexes that provide bacteria and archaea with sequence-specific immunity against bacteriophages, plasmids, and other mobile genetic elements. Bacteria and archaea become immune to phage or plasmid infections by inserting short pieces of the intruder DNA (spacer) site-specifically into the leader-repeat junction in a process called adaptation. Previous studies have shown that parts of the leader region, especially the 3′ end of the leader, are indispensable for adaptation. However, a comprehensive analysis of leader ends remains absent. Here, we have analyzed the leader, repeat, and Cas proteins from 167 type II-A CRISPR loci. Our results indicate two distinct conserved DNA motifs at the 3′ leader end: ATTTGAG (noted previously in the CRISPR1 locus of Streptococcus thermophilus DGCC7710) and a newly defined CTRCGAG, associated with the CRISPR3 locus of S. thermophilus DGCC7710. A third group with a very short CG DNA conservation at the 3′ leader end is observed mostly in lactobacilli. Analysis of the repeats and Cas proteins revealed clustering of these CRISPR components that mirrors the leader motif clustering, in agreement with the coevolution of CRISPR-Cas components. Based on our analysis of the type II-A CRISPR loci, we implicate leader end sequences that could confer site-specificity for the adaptation-machinery in the different subsets of type II-A CRISPR loci. PMID:28392985

  17. Neutralizing activities of caprine antibodies towards conserved regions of the HCV envelope glycoprotein E2

    PubMed Central


    Anti HCV vaccine is not currently available and the present antiviral therapies fail to cure approximately half of the treated HCV patients. This study was designed to assess the immunogenic properties of genetically conserved peptides derived from the C-terminal region of HVR-1 and test their neutralizing activities in a step towards developing therapeutic and/or prophylactic immunogens against HCV infection. Antibodies were generated by vaccination of goats with synthetic peptides derived from HCV E2. Viral neutralizing capacity of the generated anti E2 antibodies was tested using in vitro assays. Goats immunized with E2 synthetic peptides termed p412 [a.a 412-419], p430 [a.a 430-447] and p517 [a.a 517-531] generated high titers of antibody responses 2 to 4.5 fold higher than comparable titers of antibodies to the same epitopes in chronic HCV patients. In post infection experiments of native HCV into cultured Huh7.5 cells anti p412 and anti p 517 were proven to be neutralizing to HCV genotype 4a from patients' sera (87.5% and 75% respectively). On the contrary anti p430 exhibited weak viral neutralization capacity on the same samples (31.25%). Furthermore Ab mixes containing anti p430 exhibited reduced viral neutralization properties. From these experiments one could predict that neutralization by Abs towards different E2-epitopes varies considerably and success in the enrichment of neutralization epitope-specific antibodies may be accompanied by favorable results in combating HCV infection. Also, E2 conserved peptides p517 and p412 represent potential components of a candidate peptide vaccine against HCV infection. PMID:21819575

  18. Waterfowl Conservation in the US Prairie Pothole Region: Confronting the Complexities of Climate Change

    PubMed Central

    Niemuth, Neal D.; Fleming, Kathleen K.; Reynolds, Ronald E.


    The Prairie Pothole Region (PPR) is the most important waterfowl production area in North America. However, waterfowl populations there are predicted to decline because of climate-related drying of wetlands. Consequently, changes in the geographic focus of PPR waterfowl conservation have been recommended, which could have long-lasting and costly impacts. We used a 40-year dataset of pond counts collected in the PPR to test hypotheses about climate-related drying. We assessed May (1974–2013) and July (1974–2003) pond numbers in 20 waterfowl survey strata to determine if trends in pond numbers were consistent with predictions of drying. We also assessed trends in precipitation and temperature for the 20 strata and developed models describing May pond numbers from 1974 through 2010 as a function of precipitation, temperature, the previous year’s pond numbers, and location. None of the 20 strata showed significant declines in May pond numbers, although seven strata showed increases over time. July pond numbers declined significantly in one stratum, and increased in seven strata. An index to hydroperiod showed significant increasing trends in three strata, and no strata had decreasing trends. Precipitation increased significantly in two strata and decreased in two from 1974 to 2010; no strata showed significant changes in temperature. The best linear model described pond numbers within all strata as a function of precipitation, temperature, the previous year’s pond numbers, and the latitude and longitude of the stratum, and explained 62% of annual variation in pond numbers. We hypothesize that direct effects of climate change on prairie pothole wetlands and waterfowl may be overshadowed by indirect effects such as intensified land use and increased pressure to drain wetlands. We recommend that an adaptive, data-driven approach be used to resolve uncertainties regarding direct and indirect effects of climate change on prairie wetlands and waterfowl, and guide

  19. [Geographic distribution of birds in the Sierra Madre Oriental of San Luis Potosi, Mexico: a regional analysis of conservation status].


    Sahagún Sánchez, Francisco Javier; Navarro, Jaime Castro; Reyes Hernández, Humberto


    The Sierra Madre Oriental region in the mexican state of San Luis Potosi is a relevant place for bird conservation at a country level. Therefore the main goal of this study was to analyze the geographic patterns of distribution and the conservation current state of the birds, to support the needs to expand the conservation areas in the future. Data was collected from various databases of zoological museums and collections, and field sampling methods conducted from January 2009 to May 2011. Potential distributions were modeled for 284 species using GARP software and then a map was developed to determine areas with favorable environmental characteristics for the distribution of species richness. Finally, the importance of conservation areas for the potential distribution of birds in the region was evaluated. A total of 359 species were recorded of which 71.4% are permanent residents, 19% are winter migrants and 4% are summer residents. From this total, 41 species were endemic, 47 were species at risk and 149 were neotropical migrants. The largest species richness correspond to oak forests, cloud forests, and tropical moist forests located at altitudes from 100m to 1 500m. Their potential distribution was concentrated towards the center and Southeast of the study area. Only 10% of areas with a high potential conservation was included in areas of priority for bird conservation (AICA) and just 3% of all potential areas were under some governmental category of protection. However, no conservation area has a management plan currently applied and monitored. The information generated is important for the development of management proposals for birds conservation in the region.

  20. ATR-FT-IR spectral collection of conservation materials in the extended region of 4000-80 cm⁻¹.


    Vahur, Signe; Teearu, Anu; Peets, Pilleriin; Joosu, Lauri; Leito, Ivo


    In this paper, a spectral collection of over 150 ATR-FT-IR spectra of materials related to cultural heritage and conservation science has been presented that have been measured in the extended region of 4000-80 cm(-1) (mid-IR and far-IR region). The applicability of the spectra and, in particular, the extended spectral range, for investigation of art-related materials is demonstrated on a case study. This collection of ATRFT-IR reference spectra is freely available online ( and is meant to be a useful tool for researchers in the field of conservation and materials science.

  1. Genome-wide analyses in bacteria show small-RNA enrichment for long and conserved intergenic regions.


    Tsai, Chen-Hsun; Liao, Rick; Chou, Brendan; Palumbo, Michael; Contreras, Lydia M


    Interest in finding small RNAs (sRNAs) in bacteria has significantly increased in recent years due to their regulatory functions. Development of high-throughput methods and more sophisticated computational algorithms has allowed rapid identification of sRNA candidates in different species. However, given their various sizes (50 to 500 nucleotides [nt]) and their potential genomic locations in the 5' and 3' untranslated regions as well as in intergenic regions, identification and validation of true sRNAs have been challenging. In addition, the evolution of bacterial sRNAs across different species continues to be puzzling, given that they can exert similar functions with various sequences and structures. In this study, we analyzed the enrichment patterns of sRNAs in 13 well-annotated bacterial species using existing transcriptome and experimental data. All intergenic regions were analyzed by WU-BLAST to examine conservation levels relative to species within or outside their genus. In total, more than 900 validated bacterial sRNAs and 23,000 intergenic regions were analyzed. The results indicate that sRNAs are enriched in intergenic regions, which are longer and more conserved than the average intergenic regions in the corresponding bacterial genome. We also found that sRNA-coding regions have different conservation levels relative to their flanking regions. This work provides a way to analyze how noncoding RNAs are distributed in bacterial genomes and also shows conserved features of intergenic regions that encode sRNAs. These results also provide insight into the functions of regions surrounding sRNAs and into optimization of RNA search algorithms.

  2. Genome-Wide Analyses in Bacteria Show Small-RNA Enrichment for Long and Conserved Intergenic Regions

    PubMed Central

    Tsai, Chen-Hsun; Liao, Rick; Chou, Brendan; Palumbo, Michael


    Interest in finding small RNAs (sRNAs) in bacteria has significantly increased in recent years due to their regulatory functions. Development of high-throughput methods and more sophisticated computational algorithms has allowed rapid identification of sRNA candidates in different species. However, given their various sizes (50 to 500 nucleotides [nt]) and their potential genomic locations in the 5′ and 3′ untranslated regions as well as in intergenic regions, identification and validation of true sRNAs have been challenging. In addition, the evolution of bacterial sRNAs across different species continues to be puzzling, given that they can exert similar functions with various sequences and structures. In this study, we analyzed the enrichment patterns of sRNAs in 13 well-annotated bacterial species using existing transcriptome and experimental data. All intergenic regions were analyzed by WU-BLAST to examine conservation levels relative to species within or outside their genus. In total, more than 900 validated bacterial sRNAs and 23,000 intergenic regions were analyzed. The results indicate that sRNAs are enriched in intergenic regions, which are longer and more conserved than the average intergenic regions in the corresponding bacterial genome. We also found that sRNA-coding regions have different conservation levels relative to their flanking regions. This work provides a way to analyze how noncoding RNAs are distributed in bacterial genomes and also shows conserved features of intergenic regions that encode sRNAs. These results also provide insight into the functions of regions surrounding sRNAs and into optimization of RNA search algorithms. PMID:25313390

  3. Automatic identification of highly conserved family regions and relationships in genome wide datasets including remote protein sequences.


    Doğan, Tunca; Karaçalı, Bilge


    Identifying shared sequence segments along amino acid sequences generally requires a collection of closely related proteins, most often curated manually from the sequence datasets to suit the purpose at hand. Currently developed statistical methods are strained, however, when the collection contains remote sequences with poor alignment to the rest, or sequences containing multiple domains. In this paper, we propose a completely unsupervised and automated method to identify the shared sequence segments observed in a diverse collection of protein sequences including those present in a smaller fraction of the sequences in the collection, using a combination of sequence alignment, residue conservation scoring and graph-theoretical approaches. Since shared sequence fragments often imply conserved functional or structural attributes, the method produces a table of associations between the sequences and the identified conserved regions that can reveal previously unknown protein families as well as new members to existing ones. We evaluated the biological relevance of the method by clustering the proteins in gold standard datasets and assessing the clustering performance in comparison with previous methods from the literature. We have then applied the proposed method to a genome wide dataset of 17793 human proteins and generated a global association map to each of the 4753 identified conserved regions. Investigations on the major conserved regions revealed that they corresponded strongly to annotated structural domains. This suggests that the method can be useful in predicting novel domains on protein sequences.

  4. The proximal region of the 3'-untranslated region of cyclooxygenase-2 is recognized by a multimeric protein complex containing HuR, TIA-1, TIAR, and the heterogeneous nuclear ribonucleoprotein U.


    Cok, Steven J; Acton, Stephen J; Morrison, Aubrey R


    Cyclooxygenase-2 (COX-2) is an early response gene induced in renal mesangial cells by interleukin-1beta (IL-1beta). The 3'-untranslated region (3'-UTR) of COX-2 mRNA plays an important role in IL-1beta induction by regulating message stability and translational efficiency. The first 60 nucleotides of the 3'-UTR of COX-2 are highly conserved and contain multiple copies of the regulatory sequence AUUUA. Introduction of the 60-nucleotide sequence into the 3'-UTR of a heterologous reporter gene resulted in a 70% decrease in reporter gene expression. Electrophoretic mobility shift assays (EMSAs) demonstrated that mesangial cell nuclear fractions contain a multimeric protein complex that bound this region of COX-2 mRNA in a sequence-specific manner. We identified four members of the protein-RNA complex as HuR, TIA-1, TIAR, and the heterogeneous nuclear ribonucleoprotein U (hnRNP U). Treatment of mesangial cells with IL-1beta caused an increase in cytosolic HuR, which was accompanied by an increase in COX-2 mRNA that co-immunoprecipitated with cytosolic HuR. Therefore, we propose that HuR binds to the proximal region of the 3'-UTR of COX-2 following stimulation by IL-1beta and increases the expression of COX-2 mRNA by facilitating its transport out of the nucleus.

  5. Fire mosaics and reptile conservation in a fire-prone region.


    Nimmo, D G; Kelly, L T; Spence-Bailey, L M; Watson, S J; Taylor, R S; Clarke, M F; Bennett, A F


    Fire influences the distribution of fauna in terrestrial biomes throughout the world. Use of fire to achieve a mosaic of vegetation in different stages of succession after burning (i.e., patch-mosaic burning) is a dominant conservation practice in many regions. Despite this, knowledge of how the spatial attributes of vegetation mosaics created by fire affect fauna is extremely scarce, and it is unclear what kind of mosaic land managers should aim to achieve. We selected 28 landscapes (each 12.6 km(2) ) that varied in the spatial extent and diversity of vegetation succession after fire in a 104,000 km(2) area in the semiarid region of southeastern Australia. We surveyed for reptiles at 280 sites nested within the 28 landscapes. The landscape-level occurrence of 9 of the 22 species modeled was associated with the spatial extent of vegetation age classes created by fire. Biogeographic context and the extent of a vegetation type influenced 7 and 4 species, respectively. No species were associated with the diversity of vegetation ages within a landscape. Negative relations between reptile occurrence and both extent of recently burned vegetation (≤10 years postfire, n = 6) and long unburned vegetation (>35 years postfire, n = 4) suggested that a coarse-grained mosaic of areas (e.g. >1000 ha) of midsuccessional vegetation (11-35 years postfire) may support the fire-sensitive reptile species we modeled. This age class coincides with a peak in spinifex cover, a keystone structure for reptiles in semiarid and arid Australia. Maintaining over the long term a coarse-grained mosaic of large areas of midsuccessional vegetation in mallee ecosystems will need to be balanced against the short-term negative effects of large fires on many reptile species and a documented preference by species from other taxonomic groups, particularly birds, for older vegetation.

  6. Prey preferences of the snow leopard (Panthera uncia): regional diet specificity holds global significance for conservation.


    Lyngdoh, Salvador; Shrotriya, Shivam; Goyal, Surendra P; Clements, Hayley; Hayward, Matthew W; Habib, Bilal


    The endangered snow leopard is a large felid that is distributed over 1.83 million km(2) globally. Throughout its range it relies on a limited number of prey species in some of the most inhospitable landscapes on the planet where high rates of human persecution exist for both predator and prey. We reviewed 14 published and 11 unpublished studies pertaining to snow leopard diet throughout its range. We calculated prey consumption in terms of frequency of occurrence and biomass consumed based on 1696 analysed scats from throughout the snow leopard's range. Prey biomass consumed was calculated based on the Ackerman's linear correction factor. We identified four distinct physiographic and snow leopard prey type zones, using cluster analysis that had unique prey assemblages and had key prey characteristics which supported snow leopard occurrence there. Levin's index showed the snow leopard had a specialized dietary niche breadth. The main prey of the snow leopard were Siberian ibex (Capra sibrica), blue sheep (Pseudois nayaur), Himalayan tahr (Hemitragus jemlahicus), argali (Ovis ammon) and marmots (Marmota spp). The significantly preferred prey species of snow leopard weighed 55±5 kg, while the preferred prey weight range of snow leopard was 36-76 kg with a significant preference for Siberian ibex and blue sheep. Our meta-analysis identified critical dietary resources for snow leopards throughout their distribution and illustrates the importance of understanding regional variation in species ecology; particularly prey species that have global implications for conservation.

  7. Prey Preferences of the Snow Leopard (Panthera uncia): Regional Diet Specificity Holds Global Significance for Conservation

    PubMed Central

    Lyngdoh, Salvador; Shrotriya, Shivam; Goyal, Surendra P.; Clements, Hayley; Hayward, Matthew W.; Habib, Bilal


    The endangered snow leopard is a large felid that is distributed over 1.83 million km2 globally. Throughout its range it relies on a limited number of prey species in some of the most inhospitable landscapes on the planet where high rates of human persecution exist for both predator and prey. We reviewed 14 published and 11 unpublished studies pertaining to snow leopard diet throughout its range. We calculated prey consumption in terms of frequency of occurrence and biomass consumed based on 1696 analysed scats from throughout the snow leopard's range. Prey biomass consumed was calculated based on the Ackerman's linear correction factor. We identified four distinct physiographic and snow leopard prey type zones, using cluster analysis that had unique prey assemblages and had key prey characteristics which supported snow leopard occurrence there. Levin's index showed the snow leopard had a specialized dietary niche breadth. The main prey of the snow leopard were Siberian ibex (Capra sibrica), blue sheep (Pseudois nayaur), Himalayan tahr (Hemitragus jemlahicus), argali (Ovis ammon) and marmots (Marmota spp). The significantly preferred prey species of snow leopard weighed 55±5 kg, while the preferred prey weight range of snow leopard was 36–76 kg with a significant preference for Siberian ibex and blue sheep. Our meta-analysis identified critical dietary resources for snow leopards throughout their distribution and illustrates the importance of understanding regional variation in species ecology; particularly prey species that have global implications for conservation. PMID:24533080

  8. Anti-tumor activities of peptides corresponding to conserved complementary determining regions from different immunoglobulins.


    Figueiredo, Carlos R; Matsuo, Alisson L; Massaoka, Mariana H; Polonelli, Luciano; Travassos, Luiz R


    Short synthetic peptides corresponding to sequences of complementarity-determining regions (CDRs) from different immunoglobulin families have been shown to induce antimicrobial, antiviral and antitumor activities regardless of the specificity of the original monoclonal antibody (mAb). Presently, we studied the in vitro and in vivo antitumor activity of synthetic peptides derived from conserved CDR sequences of different immunoglobulins against human tumor cell lines and murine B16F10-Nex2 melanoma aiming at the discovery of candidate molecules for cancer therapy. Four light- and heavy-chain CDR peptide sequences from different antibodies (C36-L1, HA9-H2, 1-H2 and Mg16-H2) showed cytotoxic activity against murine melanoma and a panel of human tumor cell lineages in vitro. Importantly, they also exerted anti-metastatic activity using a syngeneic melanoma model in mice. Other peptides (D07-H3, MN20v1, MS2-H3) were also protective against metastatic melanoma, without showing significant cytotoxicity against tumor cells in vitro. In this case, we suggest that these peptides may act as immune adjuvants in vivo. As observed, peptides induced nitric oxide production in bone-marrow macrophages showing that innate immune cells can also be modulated by these CDR peptides. The present screening supports the search in immunoglobulins of rather frequent CDR sequences that are endowed with specific antitumor properties and may be candidates to be developed as anti-cancer drugs.

  9. A water quality model for regional stream assessment and conservation strategy development.


    Meixler, Marcia S; Bain, Mark B


    Non-point-source (NPS) pollution remains the primary source of stream impairment in the United States. Many problems such as eutrophication, sedimentation, and hypoxia are linked with NPS pollution which reduces the water quality for aquatic and terrestrial organisms. Increasingly, NPS pollution models have been used for landscape-scale pollution assessment and conservation strategy development. Our modeling approach functions at a scale between simple landscape-level assessments and complex, data-intensive modeling by providing a rapid, landscape-scale geographic information system (GIS) model with minimal data requirements and widespread applicability. Our model relies on curve numbers, literature-derived pollution concentrations, and land status to evaluate total phosphorus (TP), total nitrogen (TN), and suspended solids (SS) at the reach scale. Model testing in the Chesapeake Bay watershed indicated that predicted distributions of water quality classes were realistic at the reach scale, but precise estimates of pollution concentrations at the local scale can have errors. Application of our model in the tributary watersheds along Lake Ontario suggested that it is useful to managers in watershed planning by rapidly providing important information about NPS pollution conditions in areas where large data gaps exist, comparisons among stream reaches across numerous watersheds are required, or regional assessments are sought.

  10. Novel and promiscuous CTL epitopes in conserved regions of Gag targeted by individuals with early subtype C HIV type 1 infection from southern Africa.


    Masemola, Agatha M; Mashishi, Tumelo N; Khoury, Greg; Bredell, Helba; Paximadis, Maria; Mathebula, Tiyani; Barkhan, Debra; Puren, Adrian; Vardas, Efthyia; Colvin, Mark; Zijenah, Lynn; Katzenstein, David; Musonda, Rosemary; Allen, Susan; Kumwenda, Newton; Taha, Taha; Gray, Glenda; McIntyre, James; Karim, Salim Abdool; Sheppard, Haynes W; Gray, Clive M


    Characterization of optimal CTL epitopes in Gag can provide crucial information for evaluation of candidate vaccines in populations at the epicenter of the HIV-1 epidemic. We screened 38 individuals with recent subtype C HIV-1 infection using overlapping consensus C Gag peptides and hypothesized that unique HLA-restricting alleles in the southern African population would determine novel epitope identity. Seventy-four percent of individuals recognized at least one Gag peptide pool. Ten epitopic regions were identified across p17, p24, and p2p7p1p6, and greater than two-thirds of targeted regions were directed at: TGTEELRSLYNTVATLY (p17, 35%); GPKEPFRDYVDRFFKTLRAEQATQDV (p24, 19%); and RGGKLDKWEKIRLRPGGKKHYMLKHL (p17, 15%). After alignment of these epitopic regions with consensus M and a consensus subtype C sequence from the cohort, it was evident that the regions targeted were highly conserved. Fine epitope mapping revealed that five of nine identified optimal Gag epitopes were novel: HLVWASREL, LVWASRELERF, LYNTVATLY, PFRDYVDRFF, and TLRAEQATQD, and were restricted by unique HLA-Cw*08, HLA-A*30/B*57, HLA-A*29/B*44, and HLA-Cw*03 alleles, respectively. Notably, three of the mapped epitopes were restricted by more than one HLA allele. Although these epitopes were novel and restricted by unique HLA, they overlapped or were embedded within previously described CTL epitopes from subtype B HIV-1 infection. These data emphasize the promiscuous nature of epitope binding and support our hypothesis that HLA diversity between populations can shape fine epitope identity, but may not represent a constraint for universal recognition of Gag in highly conserved domains.

  11. Simulation of water-use conservation scenarios for the Mississippi Delta using an existing regional groundwater flow model

    USGS Publications Warehouse

    Barlow, Jeannie R.B.; Clark, Brian R.


    The Mississippi River alluvial plain in northwestern Mississippi (referred to as the Delta), once a floodplain to the Mississippi River covered with hardwoods and marshland, is now a highly productive agricultural region of large economic importance to Mississippi. Water for irrigation is supplied primarily by the Mississippi River Valley alluvial aquifer, and although the alluvial aquifer has a large reserve, there is evidence that the current rate of water use from the alluvial aquifer is not sustainable. Using an existing regional groundwater flow model, conservation scenarios were developed for the alluvial aquifer underlying the Delta region in northwestern Mississippi to assess where the implementation of water-use conservation efforts would have the greatest effect on future water availability-either uniformly throughout the Delta, or focused on a cone of depression in the alluvial aquifer underlying the central part of the Delta. Five scenarios were simulated with the Mississippi Embayment Regional Aquifer Study groundwater flow model: (1) a base scenario in which water use remained constant at 2007 rates throughout the entire simulation; (2) a 5-percent 'Delta-wide' conservation scenario in which water use across the Delta was decreased by 5 percent; (3) a 5-percent 'cone-equivalent' conservation scenario in which water use within the area of the cone of depression was decreased by 11 percent (a volume equivalent to the 5-percent Delta-wide conservation scenario); (4) a 25-percent Delta-wide conservation scenario in which water use across the Delta was decreased by 25 percent; and (5) a 25-percent cone-equivalent conservation scenario in which water use within the area of the cone of depression was decreased by 55 percent (a volume equivalent to the 25-percent Delta-wide conservation scenario). The Delta-wide scenarios result in greater average water-level improvements (relative to the base scenario) for the entire Delta area than the cone

  12. Performance of 12 DIR algorithms in low-contrast regions for mass and density conserving deformation

    SciTech Connect

    Yeo, U. J.; Supple, J. R.; Franich, R. D.; Taylor, M. L.; Smith, R.; Kron, T.


    Purpose: Deformable image registration (DIR) has become a key tool for adaptive radiotherapy to account for inter- and intrafraction organ deformation. Of contemporary interest, the application to deformable dose accumulation requires accurate deformation even in low contrast regions where dose gradients may exist within near-uniform tissues. One expects high-contrast features to generally be deformed more accurately by DIR algorithms. The authors systematically assess the accuracy of 12 DIR algorithms and quantitatively examine, in particular, low-contrast regions, where accuracy has not previously been established.Methods: This work investigates DIR algorithms in three dimensions using deformable gel (DEFGEL) [U. J. Yeo, M. L. Taylor, L. Dunn, R. L. Smith, T. Kron, and R. D. Franich, “A novel methodology for 3D deformable dosimetry,” Med. Phys. 39, 2203–2213 (2012)], for application to mass- and density-conserving deformations. CT images of DEFGEL phantoms with 16 fiducial markers (FMs) implanted were acquired in deformed and undeformed states for three different representative deformation geometries. Nonrigid image registration was performed using 12 common algorithms in the public domain. The optimum parameter setup was identified for each algorithm and each was tested for deformation accuracy in three scenarios: (I) original images of the DEFGEL with 16 FMs; (II) images with eight of the FMs mathematically erased; and (III) images with all FMs mathematically erased. The deformation vector fields obtained for scenarios II and III were then applied to the original images containing all 16 FMs. The locations of the FMs estimated by the algorithms were compared to actual locations determined by CT imaging. The accuracy of the algorithms was assessed by evaluation of three-dimensional vectors between true marker locations and predicted marker locations.Results: The mean magnitude of 16 error vectors per sample ranged from 0.3 to 3.7, 1.0 to 6.3, and 1.3 to 7

  13. Conserved pattern of antisense overlapping transcription in the homologous human ERCC-1 and yeast RAD10 DNA repair gene regions.

    PubMed Central

    van Duin, M; van Den Tol, J; Hoeijmakers, J H; Bootsma, D; Rupp, I P; Reynolds, P; Prakash, L; Prakash, S


    We report that the genes for the homologous Saccharomyces cerevisiae RAD10 and human ERCC-1 DNA excision repair proteins harbor overlapping antisense transcription units in their 3' regions. Since naturally occurring antisense transcription is rare in S. cerevisiae and humans (this is the first example in human cells), our findings indicate that antisense transcription in the ERCC-1-RAD10 gene regions represents an evolutionarily conserved feature. Images PMID:2471070

  14. Conservation program and practice effects on ecosystem services in the mid atlantic region of the U.S

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The U.S. Department of Agriculture (USDA) Mid-Atlantic Regional (MIAR) Wetland Conservation Effects Assessment Project (CEAP-Wetland) study area covers approximately ~58,000 km2 in the eastern United States, including areas of within five states (North Carolina, Virginia, Maryland, Delaware, and New...

  15. Soil bacterial and fungal community responses across a conservation reserve program chronosequence in Texas high plains region

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We investigated changes in soil bacterial and fungal communities with increasing restoration time across a Conservation Reserve Program chronosequence (CRP) on fine sandy loam soils in the Texas high plains region. Soil samples (0-10cm) were collected in 2012 and 2014 from seven dryland croplands (0...

  16. Vaccination With Heterologous HIV-1 Envelope Sequences and Heterologous Adenovirus Vectors Increases T-Cell Responses to Conserved Regions: HVTN 083

    PubMed Central

    Walsh, Stephen R.; Moodie, Zoe; Fiore-Gartland, Andrew J.; Morgan, Cecilia; Wilck, Marissa B.; Hammer, Scott M.; Buchbinder, Susan P.; Kalams, Spyros A.; Goepfert, Paul A.; Mulligan, Mark J.; Keefer, Michael C.; Baden, Lindsey R.; Swann, Edith M.; Grant, Shannon; Ahmed, Hasan; Li, Fusheng; Hertz, Tomer; Self, Steven G.; Friedrich, David; Frahm, Nicole; Liao, Hua-Xin; Montefiori, David C.; Tomaras, Georgia D.; McElrath, M. Juliana; Hural, John; Graham, Barney S.; Jin, Xia


    Background. Increasing the breadth of human immunodeficiency virus type 1 (HIV-1) vaccine-elicited immune responses or targeting conserved regions may improve coverage of circulating strains. HIV Vaccine Trials Network 083 tested whether cellular immune responses with these features are induced by prime-boost strategies, using heterologous vectors, heterologous inserts, or a combination of both. Methods. A total of 180 participants were randomly assigned to receive combinations of adenovirus vectors (Ad5 or Ad35) and HIV-1 envelope (Env) gene inserts (clade A or B) in a prime-boost regimen. Results. T-cell responses to heterologous and homologous insert regimens targeted a similar number of epitopes (ratio of means, 1.0; 95% confidence interval [CI], .6–1.6; P = .91), but heterologous insert regimens induced significantly more epitopes that were shared between EnvA and EnvB than homologous insert regimens (ratio of means, 2.7; 95% CI, 1.2–5.7; P = .01). Participants in the heterologous versus homologous insert groups had T-cell responses that targeted epitopes with greater evolutionary conservation (mean entropy [±SD], 0.32 ± 0.1 bits; P = .003), and epitopes recognized by responders provided higher coverage (49%; P = .035). Heterologous vector regimens had higher numbers of total, EnvA, and EnvB epitopes than homologous vector regimens (P = .02, .044, and .045, respectively). Conclusions. These data demonstrate that vaccination with heterologous insert prime boosting increased T-cell responses to shared epitopes, while heterologous vector prime boosting increased the number of T-cell epitopes recognized. Clinical Trials Registration. NCT01095224. PMID:26475930

  17. Land-use change, climate and conservation of peatlands: lessons from the high-resolution palaeoecology peat archives of the southern Baltic region

    NASA Astrophysics Data System (ADS)

    Lamentowicz, M.; Gałka, M.; Tobolski, K.; Górska, A.


    Conservation of peatlands and other issues connected with carbon sequestration and the global change have been increasingly challenging during the last decade. However, the reliable conservation can only be based on the interdisciplinary approach to the peatland ecosystem functioning. Good understanding of a present state is impossible without looking into the past conditions using various palaeoecological methods (e.g. analyses of: plant macrofossils, testate amoebae, pollen and spores and non-pollen palynomorphs). Natural developmental trends can only be recognized, having a long-term perspective (decadal, centennial or millennial scale). This perspective can be used to identify the past human impact. Many peatlands possess the state that is apparently pristine, but when we look into their past it is often obvious that their state was disturbed long time ago. Consequently, geological and palaeoecological study is prerequisite to begin a neo-ecological study. Furthermore, the past perspective is useful to start measurements of the modern processes e.g. hydrological monitoring or carbon exchange. We present high-resolution multi-proxy data from three raised bogs located in southern Baltic region. The quantitative reconstructions show the gradual disturbance connected with increasing human impact (deforestation and local peat cutting). We also show the extent of peatlands' degradation and difficulty of the recovery after stress. Differences of preservation on the example of three different bogs with the different Holocene histories will be presented. We paid an exceptional attention to the last thousand years as and the transition to the anthropocene.

  18. A Novel Universal Neutralizing Monoclonal Antibody against Enterovirus 71 That Targets the Highly Conserved “Knob” Region of VP3 Protein

    PubMed Central

    Meng, Tao; Chow, Vincent Tak Kwong; Kwang, Jimmy


    Hand, foot and mouth disease caused by enterovirus 71(EV71) leads to the majority of neurological complications and death in young children. While putative inactivated vaccines are only now undergoing clinical trials, no specific treatment options exist yet. Ideally, EV71 specific intravenous immunoglobulins could be developed for targeted treatment of severe cases. To date, only a single universally neutralizing monoclonal antibody against a conserved linear epitope of VP1 has been identified. Other enteroviruses have been shown to possess major conformational neutralizing epitopes on both the VP2 and VP3 capsid proteins. Hence, we attempted to isolate such neutralizing antibodies against conformational epitopes for their potential in the treatment of infection as well as differential diagnosis and vaccine optimization. Here we describe a universal neutralizing monoclonal antibody that recognizes a conserved conformational epitope of EV71 which was mapped using escape mutants. Eight escape mutants from different subgenogroups (A, B2, B4, C2, C4) were rescued; they harbored three essential mutations either at amino acid positions 59, 62 or 67 of the VP3 protein which are all situated in the “knob” region. The escape mutant phenotype could be mimicked by incorporating these mutations into reverse genetically engineered viruses showing that P59L, A62D, A62P and E67D abolish both monoclonal antibody binding and neutralization activity. This is the first conformational neutralization epitope mapped on VP3 for EV71. PMID:24875055

  19. Designing conservation strategies to preserve the genetic diversity of Astragalus edulis Bunge, an endangered species from western Mediterranean region.


    Peñas, Julio; Barrios, Sara; Bobo-Pinilla, Javier; Lorite, Juan; Martínez-Ortega, M Montserrat


    Astragalus edulis (Fabaceae) is an endangered annual species from the western Mediterranean region that colonized the SE Iberian Peninsula, NE and SW Morocco, and the easternmost Macaronesian islands (Lanzarote and Fuerteventura). Although in Spain some conservation measures have been adopted, it is still necessary to develop an appropriate management plan to preserve genetic diversity across the entire distribution area of the species. Our main objective was to use population genetics as well as ecological and phylogeographic data to select Relevant Genetic Units for Conservation (RGUCs) as the first step in designing conservation plans for A. edulis. We identified six RGUCs for in situ conservation, based on estimations of population genetic structure and probabilities of loss of rare alleles. Additionally, further population parameters, i.e. occupation area, population size, vulnerability, legal status of the population areas, and the historical haplotype distribution, were considered in order to establish which populations deserve conservation priority. Three populations from the Iberian Peninsula, two from Morocco, and one from the Canary Islands represent the total genetic diversity of the species and the rarest allelic variation. Ex situ conservation is recommended to complement the preservation of A. edulis, given that effective in situ population protection is not feasible in all cases. The consideration of complementary phylogeographic and ecological data is useful for management efforts to preserve the evolutionary potential of the species.

  20. Designing conservation strategies to preserve the genetic diversity of Astragalus edulis Bunge, an endangered species from western Mediterranean region

    PubMed Central

    Barrios, Sara; Bobo-Pinilla, Javier; Lorite, Juan; Martínez-Ortega, M. Montserrat


    Astragalus edulis (Fabaceae) is an endangered annual species from the western Mediterranean region that colonized the SE Iberian Peninsula, NE and SW Morocco, and the easternmost Macaronesian islands (Lanzarote and Fuerteventura). Although in Spain some conservation measures have been adopted, it is still necessary to develop an appropriate management plan to preserve genetic diversity across the entire distribution area of the species. Our main objective was to use population genetics as well as ecological and phylogeographic data to select Relevant Genetic Units for Conservation (RGUCs) as the first step in designing conservation plans for A. edulis. We identified six RGUCs for in situ conservation, based on estimations of population genetic structure and probabilities of loss of rare alleles. Additionally, further population parameters, i.e. occupation area, population size, vulnerability, legal status of the population areas, and the historical haplotype distribution, were considered in order to establish which populations deserve conservation priority. Three populations from the Iberian Peninsula, two from Morocco, and one from the Canary Islands represent the total genetic diversity of the species and the rarest allelic variation. Ex situ conservation is recommended to complement the preservation of A. edulis, given that effective in situ population protection is not feasible in all cases. The consideration of complementary phylogeographic and ecological data is useful for management efforts to preserve the evolutionary potential of the species. PMID:26844014

  1. Protein engineering of selected residues from conserved sequence regions of a novel Anoxybacillus α-amylase

    PubMed Central

    Ranjani, Velayudhan; Janeček, Štefan; Chai, Kian Piaw; Shahir, Shafinaz; Rahman, Raja Noor Zaliha Raja Abdul; Chan, Kok-Gan; Goh, Kian Mau


    The α-amylases from Anoxybacillus species (ASKA and ADTA), Bacillus aquimaris (BaqA) and Geobacillus thermoleovorans (GTA, Pizzo and GtamyII) were proposed as a novel group of the α-amylase family GH13. An ASKA yielding a high percentage of maltose upon its reaction on starch was chosen as a model to study the residues responsible for the biochemical properties. Four residues from conserved sequence regions (CSRs) were thus selected, and the mutants F113V (CSR-I), Y187F and L189I (CSR-II) and A161D (CSR-V) were characterised. Few changes in the optimum reaction temperature and pH were observed for all mutants. Whereas the Y187F (t1/2 43 h) and L189I (t1/2 36 h) mutants had a lower thermostability at 65°C than the native ASKA (t1/2 48 h), the mutants F113V and A161D exhibited an improved t1/2 of 51 h and 53 h, respectively. Among the mutants, only the A161D had a specific activity, kcat and kcat/Km higher (1.23-, 1.17- and 2.88-times, respectively) than the values determined for the ASKA. The replacement of the Ala-161 in the CSR-V with an aspartic acid also caused a significant reduction in the ratio of maltose formed. This finding suggests the Ala-161 may contribute to the high maltose production of the ASKA. PMID:25069018

  2. Conserved archetypal configuration of the transcriptional control region during the course of BK polyomavirus evolution.


    Yogo, Yoshiaki; Zhong, Shan; Xu, Yawei; Zhu, Mengyun; Chao, Yuegen; Sugimoto, Chie; Ikegaya, Hiroshi; Shibuya, Ayako; Kitamura, Tadaichi


    BK polyomavirus (BKV) is widespread among humans, asymptomatically infecting children and then persisting in renal tissue. The transcriptional control region (TCR) of the BKV genome is variable among clinical isolates. Thus, archetypal TCRs with a common basic configuration generally occur in BKV isolates from the urine of immunocompromised patients, but rearranged TCRs that possibly arise from the archetypal configuration have also been detected in clinical specimens. To examine the hypothesis that archetypal strains represent wild-type strains circulating in the human population (the archetype hypothesis), we analysed 145 complete viral genomes amplified directly from the urine of non-immunocompromised individuals worldwide. These genomes included 82, three, two and 58 sequences classified as belonging to subtypes I, II, III and IV, respectively. Rearranged TCRs with long duplications or deletions were detected from two subtype I and two subtype IV genomes, but not from the other 141 genomes (thus, the TCRs of these genomes were judged to be archetypal). The variations in the archetypal TCRs were nucleotide substitutions and single-nucleotide deletions, most of which were unique to particular subtypes or subgroups. We confirmed that the four complete BKV genomes with rearranged TCRs did not form a unique lineage on a phylogenetic tree. Collectively, the findings demonstrate that the archetypal TCR configuration has been conserved during the evolution of BKV, providing support for the archetype hypothesis. Additionally, we suggest that 'archetype' should be used as a conceptual term that denotes a prototypical structure that can generate various rearranged TCRs during viral growth in vivo and in vitro.

  3. Campylobacter fetus uses multiple loci for DNA inversion within the 5' conserved regions of sap homologs.


    Tu, Z C; Ray, K C; Thompson, S A; Blaser, M J


    Campylobacter fetus cells possess multiple promoterless sap homologs, each capable of expressing a surface layer protein (SLP) by utilizing a unique promoter present on a 6.2-kb invertible element. Each sap homolog includes a 626-bp 5' conserved region (FCR) with 74 bp upstream and 552 bp within the open reading frame. After DNA inversion, the splice is seamless because the FCRs are identical. In mutant strain 23D:ACA2K101, in which sapA and sapA2 flanking the invertible element in opposite orientations were disrupted by promoterless chloramphenicol resistance (Cm(r)) and kanamycin resistance (Km(r)) cassettes, respectively, the frequency of DNA inversion is 100-fold lower than that of wild-type strain 23D. To define the roles of a 15-bp inverted repeat (IR) and a Chi-like site (CLS) in the FCR, we mutagenized each upstream of sapA2 in 23D:ACA2K101 by introducing NotI and KpnI sites to create strains 23D:ACA2K101N and 23D:ACA2K101K, respectively. Alternatively selecting colonies for Cm(r) or Km(r) showed that mutagenizing the IR or CLS had no apparent effect on the frequency of the DNA inversion. However, mapping the unique NotI or KpnI site in relation to the Cm(r) or Km(r) cassette in the cells that changed phenotype showed that splices occurred both upstream and downstream of the mutated sites. PCR and sequence analyses also showed that the splice could occur in the 425-bp portion of the FCR downstream of the cassettes. In total, these data indicate that C. fetus can use multiple sites within the FCR for its sap-related DNA inversion.

  4. Management of the Regional Lymph Nodes Following Breast-Conservation Therapy for Early-Stage Breast Cancer: An Evolving Paradigm

    SciTech Connect

    Warren, Laura E.G.; Punglia, Rinaa S.; Wong, Julia S.; Bellon, Jennifer R.


    Radiation therapy to the breast following breast conservation surgery has been the standard of care since randomized trials demonstrated equivalent survival compared to mastectomy and improved local control and survival compared to breast conservation surgery alone. Recent controversies regarding adjuvant radiation therapy have included the potential role of additional radiation to the regional lymph nodes. This review summarizes the evolution of regional nodal management focusing on 2 topics: first, the changing paradigm with regard to surgical evaluation of the axilla; second, the role for regional lymph node irradiation and optimal design of treatment fields. Contemporary data reaffirm prior studies showing that complete axillary dissection may not provide additional benefit relative to sentinel lymph node biopsy in select patient populations. Preliminary data also suggest that directed nodal radiation therapy to the supraclavicular and internal mammary lymph nodes may prove beneficial; publication of several studies are awaited to confirm these results and to help define subgroups with the greatest likelihood of benefit.

  5. A conservative type-dependent full potential method for the treatment of supersonic flows with embedded subsonic regions

    NASA Technical Reports Server (NTRS)

    Shankar, V.; Szema, K.-Y.; Osher, S.


    A nonlinear method based on the full potential equation in conservation form, cast in an arbitrary coordinate system, has been developed to treat predominantly supersonic flows with embedded subsonic regions. This type of flow field occurs frequently near the fuselage-canopy junction area and wing leading edge regions for a moderately swept fighter configuration. The method uses the theory of characteristics to accurately monitor the type-dependent flow field. A conservative switching scheme is developed to transition from the supersonic marching algorithm to a subsonic relaxation procedure, and vice versa. An implicit approximate factorization scheme is employed to solve the finite-differenced equation. Results are shown for a few configurations, including a wing-body-wake realistic fighter model having embedded subsonic regions.


    EPA Science Inventory

    Current reserve selection algorithms have difficulty evaluating connectivity and other factors
    necessary to conserve wide-ranging species in developing landscapes. Conversely, population viability analyses may incorporate detailed demographic data but often lack sufficient spa...

  7. DisoMCS: Accurately Predicting Protein Intrinsically Disordered Regions Using a Multi-Class Conservative Score Approach

    PubMed Central

    Wang, Zhiheng; Yang, Qianqian; Li, Tonghua; Cong, Peisheng


    The precise prediction of protein intrinsically disordered regions, which play a crucial role in biological procedures, is a necessary prerequisite to further the understanding of the principles and mechanisms of protein function. Here, we propose a novel predictor, DisoMCS, which is a more accurate predictor of protein intrinsically disordered regions. The DisoMCS bases on an original multi-class conservative score (MCS) obtained by sequence-order/disorder alignment. Initially, near-disorder regions are defined on fragments located at both the terminus of an ordered region connecting a disordered region. Then the multi-class conservative score is generated by sequence alignment against a known structure database and represented as order, near-disorder and disorder conservative scores. The MCS of each amino acid has three elements: order, near-disorder and disorder profiles. Finally, the MCS is exploited as features to identify disordered regions in sequences. DisoMCS utilizes a non-redundant data set as the training set, MCS and predicted secondary structure as features, and a conditional random field as the classification algorithm. In predicted near-disorder regions a residue is determined as an order or a disorder according to the optimized decision threshold. DisoMCS was evaluated by cross-validation, large-scale prediction, independent tests and CASP (Critical Assessment of Techniques for Protein Structure Prediction) tests. All results confirmed that DisoMCS was very competitive in terms of accuracy of prediction when compared with well-established publicly available disordered region predictors. It also indicated our approach was more accurate when a query has higher homologous with the knowledge database. Availability The DisoMCS is available at PMID:26090958

  8. Income level and regional policies, underlying factors associated with unwarranted variations in conservative breast cancer surgery in Spain

    PubMed Central


    Background Geographical variations in medical practice are expected to be small when the evidence about the effectiveness and safety of a particular technology is abundant. This would be the case of the prescription of conservative surgery in breast cancer patients. In these cases, when variation is larger than expected by need, socioeconomic factors have been argued as an explanation. Objectives: Using an ecologic design, our study aims at describing the variability in the use of surgical conservative versus non-conservative treatment. Additionally, it seeks to establish whether the socioeconomic status of the healthcare area influences the use of one or the other technique. Methods 81,868 mastectomies performed between 2002 and 2006 in 180 healthcare areas were studied. Standardized utilization rates of breast cancer conservative (CS) and non-conservative (NCS) procedures were estimated as well as the variation among areas, using small area statistics. Concentration curves and dominance tests were estimated to determine the impact of income and instruction levels in the healthcare area on surgery rates. Multilevel analyses were performed to determine the influence of regional policies. Results Variation in the use of CS was massive (4-fold factor between the highest and the lowest rate) and larger than in the case of NCS (2-fold), whichever the age group. Healthcare areas with higher economic and instruction levels showed highest rates of CS, regardless of the age group, while areas with lower economic and educational levels yielded higher rates of NCS interventions. Living in a particular Autonomous Community (AC), explained a substantial part of the CS residual variance (up to a 60.5% in women 50 to 70). Conclusion The place where a woman lives -income level and regional policies- explain the unexpectedly high variation found in utilization rates of conservative breast cancer surgery. PMID:21504577

  9. Conservation and diversity in the ultralong third heavy-chain complementarity-determining region of bovine antibodies

    PubMed Central

    Stanfield, Robyn L.; Wilson, Ian A.; Smider, Vaughn V.


    A subset of bovine antibodies have an exceptionally long third heavy-chain complementarity determining region (CDR H3) that is highly variable in sequence and includes multiple cysteines. These long CDR H3s (up to 69 residues) fold into a long stalk atop which sits a knob domain that is located far from the antibody surface. Three new bovine Fab crystal structures have been determined to decipher the conserved and variable features of ultralong CDR H3s that lead to diversity in antigen recognition. Despite high sequence variability, the stalks adopt a conserved β-ribbon structure, while the knob regions share a conserved β-sheet that serves as a scaffold for two connecting loops of variable length and conformation, as well as one conserved disulfide. Variation in patterns and connectivity of the remaining disulfides contribute to the knob structural diversity. The unusual architecture of these ultralong bovine CDR H3s for generating diversity is unique in adaptive immune systems. PMID:27574710

  10. Improving spatial prioritisation for remote marine regions: optimising biodiversity conservation and sustainable development trade-offs.


    Moore, Cordelia H; Radford, Ben T; Possingham, Hugh P; Heyward, Andrew J; Stewart, Romola R; Watts, Matthew E; Prescott, Jim; Newman, Stephen J; Harvey, Euan S; Fisher, Rebecca; Bryce, Clay W; Lowe, Ryan J; Berry, Oliver; Espinosa-Gayosso, Alexis; Sporer, Errol; Saunders, Thor


    Creating large conservation zones in remote areas, with less intense stakeholder overlap and limited environmental information, requires periodic review to ensure zonation mitigates primary threats and fill gaps in representation, while achieving conservation targets. Follow-up reviews can utilise improved methods and data, potentially identifying new planning options yielding a desirable balance between stakeholder interests. This research explored a marine zoning system in north-west Australia-a biodiverse area with poorly documented biota. Although remote, it is economically significant (i.e. petroleum extraction and fishing). Stakeholder engagement was used to source the best available biodiversity and socio-economic data and advanced spatial analyses produced 765 high resolution data layers, including 674 species distributions representing 119 families. Gap analysis revealed the current proposed zoning system as inadequate, with 98.2% of species below the Convention on Biological Diversity 10% representation targets. A systematic conservation planning algorithm Maxan provided zoning options to meet representation targets while balancing this with industry interests. Resulting scenarios revealed that conservation targets could be met with minimal impacts on petroleum and fishing industries, with estimated losses of 4.9% and 7.2% respectively. The approach addressed important knowledge gaps and provided a powerful and transparent method to reconcile industry interests with marine conservation.

  11. Improving spatial prioritisation for remote marine regions: optimising biodiversity conservation and sustainable development trade-offs

    PubMed Central

    Moore, Cordelia H.; Radford, Ben T.; Possingham, Hugh P.; Heyward, Andrew J.; Stewart, Romola R.; Watts, Matthew E.; Prescott, Jim; Newman, Stephen J.; Harvey, Euan S.; Fisher, Rebecca; Bryce, Clay W.; Lowe, Ryan J.; Berry, Oliver; Espinosa-Gayosso, Alexis; Sporer, Errol; Saunders, Thor


    Creating large conservation zones in remote areas, with less intense stakeholder overlap and limited environmental information, requires periodic review to ensure zonation mitigates primary threats and fill gaps in representation, while achieving conservation targets. Follow-up reviews can utilise improved methods and data, potentially identifying new planning options yielding a desirable balance between stakeholder interests. This research explored a marine zoning system in north-west Australia–a biodiverse area with poorly documented biota. Although remote, it is economically significant (i.e. petroleum extraction and fishing). Stakeholder engagement was used to source the best available biodiversity and socio-economic data and advanced spatial analyses produced 765 high resolution data layers, including 674 species distributions representing 119 families. Gap analysis revealed the current proposed zoning system as inadequate, with 98.2% of species below the Convention on Biological Diversity 10% representation targets. A systematic conservation planning algorithm Maxan provided zoning options to meet representation targets while balancing this with industry interests. Resulting scenarios revealed that conservation targets could be met with minimal impacts on petroleum and fishing industries, with estimated losses of 4.9% and 7.2% respectively. The approach addressed important knowledge gaps and provided a powerful and transparent method to reconcile industry interests with marine conservation. PMID:27556689

  12. Improving spatial prioritisation for remote marine regions: optimising biodiversity conservation and sustainable development trade-offs

    NASA Astrophysics Data System (ADS)

    Moore, Cordelia H.; Radford, Ben T.; Possingham, Hugh P.; Heyward, Andrew J.; Stewart, Romola R.; Watts, Matthew E.; Prescott, Jim; Newman, Stephen J.; Harvey, Euan S.; Fisher, Rebecca; Bryce, Clay W.; Lowe, Ryan J.; Berry, Oliver; Espinosa-Gayosso, Alexis; Sporer, Errol; Saunders, Thor


    Creating large conservation zones in remote areas, with less intense stakeholder overlap and limited environmental information, requires periodic review to ensure zonation mitigates primary threats and fill gaps in representation, while achieving conservation targets. Follow-up reviews can utilise improved methods and data, potentially identifying new planning options yielding a desirable balance between stakeholder interests. This research explored a marine zoning system in north-west Australia–a biodiverse area with poorly documented biota. Although remote, it is economically significant (i.e. petroleum extraction and fishing). Stakeholder engagement was used to source the best available biodiversity and socio-economic data and advanced spatial analyses produced 765 high resolution data layers, including 674 species distributions representing 119 families. Gap analysis revealed the current proposed zoning system as inadequate, with 98.2% of species below the Convention on Biological Diversity 10% representation targets. A systematic conservation planning algorithm Maxan provided zoning options to meet representation targets while balancing this with industry interests. Resulting scenarios revealed that conservation targets could be met with minimal impacts on petroleum and fishing industries, with estimated losses of 4.9% and 7.2% respectively. The approach addressed important knowledge gaps and provided a powerful and transparent method to reconcile industry interests with marine conservation.

  13. AlignMiner: a Web-based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

    PubMed Central


    Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid) obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used to reliably detect

  14. A conservative region of the mercuric reductase gene (mera) as a molecular marker of bacterial mercury resistance

    PubMed Central

    Sotero-Martins, Adriana; de Jesus, Michele Silva; Lacerda, Michele; Moreira, Josino Costa; Filgueiras, Ana Luzia Lauria; Barrocas, Paulo Rubens Guimarães


    The most common bacterial mercury resistance mechanism is based on the reduction of Hg(II) to Hg0, which is dependent of the mercuric reductase enzyme (MerA) activity. The use of a 431 bp fragment of a conservative region of the mercuric reductase (merA) gene was applied as a molecular marker of this mechanism, allowing the identification of mercury resistant bacterial strains. PMID:24031221

  15. Nature Conservancy of Canada (NCC)--Manitoba Region's Environmental Education Program

    ERIC Educational Resources Information Center

    Shaluk, Cathy


    The Nature Conservancy of Canada (NCC) is excited and proud to offer its first ever in-class education programs on the Tall Grass Prairie Ecosystem. These curriculum-based programs are offered to students from Kindergarten through to Grade 12. This experience gives many students who may never have the opportunity to visit a real live prairie to…

  16. Conservation Tillage as a Solution to Drought in Both the Southeastern and Western Peanut Growing Regions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Conservation tillage cropping systems were introduced in the 1970s and much research has documented positive benefits such as decreased erosion, general soil improvement (carbon sequestration), and decreased labor, time, and fuel devoted to land preparation. Strip tillage, in-row subsoiling followe...

  17. Regional effects of agricultural conservation practices on nutrient transport in the Upper Mississippi River Basin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Despite progress in the implementation of conservation practices, related improvements in water quality have been challenging to measure in larger river systems. In this paper we quantify these downstream effects by applying the empirical U.S. Geological Survey water-quality model SPARROW to inves...

  18. Structure-sequence based analysis for identification of conserved regions in proteins


    Zemla, Adam T; Zhou, Carol E; Lam, Marisa W; Smith, Jason R; Pardes, Elizabeth


    Disclosed are computational methods, and associated hardware and software products for scoring conservation in a protein structure based on a computationally identified family or cluster of protein structures. A method of computationally identifying a family or cluster of protein structures in also disclosed herein.

  19. Picking up the pieces: conserving remnant natural areas in the post-industrial landscape of the Calumet Region

    USGS Publications Warehouse

    Labus, Paul; Whitman, Richard L.; Nevers, Meredith Becker


    The Calumet Region was shaped by geologic forces, succession, and interacting biomes converging on a unique natural landscape. Over the past 4500 years, a strand plain has formed to the north of a geologic area called Toleston Beach. Sequential and differential primary succession of dune and swale communities in this region allowed species from different biomes to interact freely. In the mid-nineteenth century, commerce and settlement drastically changed the area, and natural areas were fragmented, manipulated, and degraded by cultural intrusions and industrialization. Despite the near obliteration of dune and swale habitat, small fragments of natural land escaped destruction. These native fragments maintained some semblance of the landscape that once covered the region. Currently, these native fragments are threatened by the lingering intrusion of historic contamination and the continuing presence of industry and commerce. Restoration and conservation of these remnants will need to be a process of integrating biological diversity goals into the landscape of the industrialized region through planning and design. We outline here the natural history of the region, the philosophical rationale for conservation, and possible approaches for integrating and maintaining these valuable remnant resources and processes.

  20. A conserved proline-rich region of the Saccharomyces cerevisiae cyclase-associated protein binds SH3 domains and modulates cytoskeletal localization.

    PubMed Central

    Freeman, N L; Lila, T; Mintzer, K A; Chen, Z; Pahk, A J; Ren, R; Drubin, D G; Field, J


    Saccharomyces cerevisiae cyclase-associated protein (CAP or Srv2p) is multifunctional. The N-terminal third of CAP binds to adenylyl cyclase and has been implicated in adenylyl cyclase activation in vivo. The widely conserved C-terminal domain of CAP binds to monomeric actin and serves an important cytoskeletal regulatory function in vivo. In addition, all CAP homologs contain a centrally located proline-rich region which has no previously identified function. Recently, SH3 (Src homology 3) domains were shown to bind to proline-rich regions of proteins. Here we report that the proline-rich region of CAP is recognized by the SH3 domains of several proteins, including the yeast actin-associated protein Abp1p. Immunolocalization experiments demonstrate that CAP colocalizes with cortical actin-containing structures in vivo and that a region of CAP containing the SH3 domain binding site is required for this localization. We also demonstrate that the SH3 domain of yeast Abp1p and that of the yeast RAS protein guanine nucleotide exchange factor Cdc25p complex with adenylyl cyclase in vitro. Interestingly, the binding of the Cdc25p SH3 domain is not mediated by CAP and therefore may involve direct binding to adenylyl cyclase or to an unidentified protein which complexes with adenylyl cyclase. We also found that CAP homologous from Schizosaccharomyces pombe and humans bind SH3 domains. The human protein binds most strongly to the SH3 domain from the abl proto-oncogene. These observations identify CAP as an SH3 domain-binding protein and suggest that CAP mediates interactions between SH3 domain proteins and monomeric actin. PMID:8552082

  1. A conserved proline-rich region of the Saccharomyces cerevisiae cyclase-associated protein binds SH3 domains and modulates cytoskeletal localization.


    Freeman, N L; Lila, T; Mintzer, K A; Chen, Z; Pahk, A J; Ren, R; Drubin, D G; Field, J


    Saccharomyces cerevisiae cyclase-associated protein (CAP or Srv2p) is multifunctional. The N-terminal third of CAP binds to adenylyl cyclase and has been implicated in adenylyl cyclase activation in vivo. The widely conserved C-terminal domain of CAP binds to monomeric actin and serves an important cytoskeletal regulatory function in vivo. In addition, all CAP homologs contain a centrally located proline-rich region which has no previously identified function. Recently, SH3 (Src homology 3) domains were shown to bind to proline-rich regions of proteins. Here we report that the proline-rich region of CAP is recognized by the SH3 domains of several proteins, including the yeast actin-associated protein Abp1p. Immunolocalization experiments demonstrate that CAP colocalizes with cortical actin-containing structures in vivo and that a region of CAP containing the SH3 domain binding site is required for this localization. We also demonstrate that the SH3 domain of yeast Abp1p and that of the yeast RAS protein guanine nucleotide exchange factor Cdc25p complex with adenylyl cyclase in vitro. Interestingly, the binding of the Cdc25p SH3 domain is not mediated by CAP and therefore may involve direct binding to adenylyl cyclase or to an unidentified protein which complexes with adenylyl cyclase. We also found that CAP homologous from Schizosaccharomyces pombe and humans bind SH3 domains. The human protein binds most strongly to the SH3 domain from the abl proto-oncogene. These observations identify CAP as an SH3 domain-binding protein and suggest that CAP mediates interactions between SH3 domain proteins and monomeric actin.

  2. A Somali Split? Is It Time for the US to Abandon the Idea of a Unified Somalia and Recognize the Breakaway Regions of Somaliland and Puntland?

    DTIC Science & Technology


    The UN Food and Agriculture Organization (FAO) estimate that 40,000 tons per year could be harvested from Somaliland waters in a sustainable...neighbors in the region. The MOH reports that as of 2004 there were 536 hospital beds and 62 doctors. the ratio of doctor to individuals is 1...In particular the USAID Food for Roads projects has resulted in 1200km of roads and irrigation canals built in Northern Somalia74 . Such

  3. 76 FR 76328 - Energy Conservation Program: Enforcement of Regional Standards for Residential Furnaces and...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Residential Furnaces and Central Air Conditioners and Heat Pumps AGENCY: Office of Energy Efficiency and... of regional standards for residential furnaces and residential central air conditioners and heat... inform the rulemaking for enforcement of regional energy efficiency standards for residential...

  4. Potential conservation opportunities from the use of improved irrigation scheduling in the Pacific Northwest region

    SciTech Connect

    Harrer, B J; Lezberg, A J


    This report documents research to identify the potential energy savings and the costs per kWh saved from using systematic rather than traditional irrigation scheduling to reduce water usage in the irrigated agricultural sector of the Pacific Northwest. This research is part of an overall project aimed at developing a computer model and data base that will allow for estimation of the potential energy savings and cost effectiveness of a number of conservation technologies that are available for use in irrigated agriculture.

  5. Flexibility Correlation between Active Site Regions Is Conserved across Four AmpC β-Lactamase Enzymes

    PubMed Central

    Brown, Jenna R.; Livesay, Dennis R.


    β-lactamases are bacterial enzymes that confer resistance to β-lactam antibiotics, such as penicillins and cephalosporins. There are four classes of β-lactamase enzymes, each with characteristic sequence and structure properties. Enzymes from class A are the most common and have been well characterized across the family; however, less is known about how physicochemical properties vary across the C and D families. In this report, we compare the dynamical properties of four AmpC (class C) β-lactamases using our distance constraint model (DCM). The DCM reliably predicts thermodynamic and mechanical properties in an integrated way. As a consequence, quantitative stability/flexibility relationships (QSFR) can be determined and compared across the whole family. The DCM calculates a large number of QSFR metrics. Perhaps the most useful is the flexibility index (FI), which quantifies flexibility along the enzyme backbone. As typically observed in other systems, FI is well conserved across the four AmpC enzymes. Cooperativity correlation (CC), which quantifies intramolecular couplings within structure, is rarely conserved across protein families; however, it is in AmpC. In particular, the bulk of each structure is composed of a large rigid cluster, punctuated by three flexibly correlated regions located at the active site. These regions include several catalytic residues and the Ω-loop. This evolutionary conservation combined with active their site location strongly suggests that these coupled dynamical modes are important for proper functioning of the enzyme. PMID:26018804

  6. Dynamic sediment discharge in the Hekou-Longmen region of Yellow River and soil and water conservation implications.


    Gao, Peng; Deng, Jingcheng; Chai, Xueke; Mu, Xingmin; Zhao, Guangju; Shao, Hongbo; Sun, Wenyi


    The middle reaches of the Yellow River Basin transport the vast majority of sediment (>85% of the basin's total available sediment load), which has had profound effects on the characteristics of the middle and lower reaches of the Yellow River. Since the late 1950s, soil and water conservation measures have been extensively implemented in the Loess Plateau, China, especially since the 1970s. This has resulted in sediment discharge changing significantly. In this study, data from 22 catchments in the region of the Loess Plateau from Hekou to Longmen in the middle reaches of the Yellow River were analyzed to investigate the responses of the sediment regime to climate change and human activities. The non-parametric Mann-Kendall test and the Pettitt test were used to identify trends and shifts in sediment discharge. All 22 catchments had a significantly decreasing trend (P<0.01) in annual sediment discharge. Change point years were detected between 1971 and 1994, and were concentrated between 1978 and 1984 in 17 catchments. Moreover, erosive rainfall exhibited a tendency to decrease, but this was not a significant trend. Compared to rainfall, human activities, primarily soil and water conservation and environmental rehabilitation campaigns, have played a more prominent role in the changes in sediment regimes. In order to reduce soil erosion and sediment yield, more attention should be paid to proper and rational soil and water conservation and eco-restoration in this region.

  7. Identification and Potential Regulatory Properties of Evolutionary Conserved Regions (ECRs) at the Schizophrenia-Associated MIR137 Locus.


    Gianfrancesco, Olympia; Griffiths, Daniel; Myers, Paul; Collier, David A; Bubb, Vivien J; Quinn, John P


    Genome-wide association studies (GWAS) have identified a region at chromosome 1p21.3, containing the microRNA MIR137, to be among the most significant associations for schizophrenia. However, the mechanism by which genetic variation at this locus increases risk of schizophrenia is unknown. Identifying key regulatory regions around MIR137 is crucial to understanding the potential role of this gene in the aetiology of psychiatric disorders. Through alignment of vertebrate genomes, we identified seven non-coding regions at the MIR137 locus with conservation comparable to exons (>70 %). Bioinformatic analysis using the Psychiatric Genomics Consortium GWAS dataset for schizophrenia showed five of the ECRs to have genome-wide significant SNPs in or adjacent to their sequence. Analysis of available datasets on chromatin marks and histone modification data showed that three of the ECRs were predicted to be functional in the human brain, and three in development. In vitro analysis of ECR activity using reporter gene assays showed that all seven of the selected ECRs displayed transcriptional regulatory activity in the SH-SY5Y neuroblastoma cell line. This data suggests a regulatory role in the developing and adult brain for these highly conserved regions at the MIR137 schizophrenia-associated locus and further that these domains could act individually or synergistically to regulate levels of MIR137 expression.

  8. Possible conservation units of the sun bear (Helarctos malayanus) in Sarawak based on variation of mtDNA control region.


    Onuma, Manabu; Suzuki, Masatsugu; Ohtaishi, Noriyuki


    The mitochondrial DNA control region of the sun bear (Helarctos malayanus) was sequenced using 21 DNA samples collected from confiscated sun bears to identify conservation units, such as evolutionarily significant units and management units, in Sarawak, Borneo Island. A total of 10 haplotypes were observed, indicating the presence of at least two lineages in the sun bear population in Sarawak. Presumably, these two lineages could represent evolutionarily significant units. However, the geographical distributions of the two lineages remained unknown due to the lack of information regarding the exact capture locations of the confiscated sun bears. It is essential to elucidate the geographical distributions of these lineages in order to create a proper conservation plan for the sun bears in Sarawak. Therefore, further studies examining the haplotype distributions using DNA samples from known localities are essential.

  9. Integrated assessment of conservation opportunities in the irrigated agriculture sector of the Pacific Northwest Region

    SciTech Connect

    Harrer, B.J.; Lezberg, A.J.; Wilfert, G.L.


    This report documents research to identify the potential energy savings and cost per kWh saved for implementing currently available energy conservation measures in the irrigated agriculture sector of the Pacific Northwest. A computer model that simulates the energy consumption process of irrigation systems and estimates the levelized costs of undertaking conservation investments is the primary analytical tool used in this research. Using engineering and economic input parameters for the various conservation measures that could potentially be implemented in irrigated agriculture, the Irrigation Sector Energy Planning (ISEP) model generates estimates of energy savings and cost per kWh saved for the measures. All parameters input to the ISEP model are based upon empirical field data. Results provided by the ISEP model indicate tht by the year 2003 a total of approximately 158.6 average MW of energy could potentially be saved in the Pacific Northwest irrigation sector on all sprinkler-irrigated acres. Approximately 130.4 average MW can be saved on acres currently by sprinkler, while an additional 28.2 average MW could be saved on new acres that are forecast to come under irrigation in the next 20 years. The largest share of the total savings (47%) is estimated to come from the use of low-pressure irrigation. Over 60% of the total potential savings 158.6 average MW is estimated to be available for a cost per kWh saved of 20 mills or less and over 75% could be achieved for a cost of 30 mills or less. Savings from low-pressure irrigation and the redesign of fittings and mainlines will normally cost less than 20 mills per kWh saved. Almost all of the savings that are estimated to cost more than 30 mills per kWh saved to obtain are savings from improved irrigation scheduling on irrigated acres that use surface water and have low average pumping lifts.

  10. Seroepidemiology of Toxoplasma in a coastal region of Haiti: multiplex bead assay detection of immunoglobulin G antibodies that recognize the SAG2A antigen.


    Priest, J W; Moss, D M; Arnold, B F; Hamlin, K; Jones, C C; Lammie, P J


    Toxoplasma gondii is a globally distributed parasitic protozoan that infects most warm-blooded animals. We incorporated a bead coupled with recombinant SAG2A protein into our Neglected Tropical Disease (NTD) multiplex bead assay (MBA) panel and used it to determine Toxoplasma infection rates in two studies in Haiti. In a longitudinal cohort study of children aged 0-11 years, the infection rate varied with age reaching a maximum of 0·131 infections/year in children aged 3 years [95% confidence interval (CI) 0·065-0·204]. The median time to seroconversion was estimated to be 9·7 years (95% CI 7·6-∞). In a cross-sectional, community-wide survey of residents of all ages, we determined an overall seroprevalence of 28·2%. The seroprevalence age curve from the cross-sectional study also suggested that the force of infection varied with age and peaked at 0·057 infections/year (95% CI 0·033-0·080) at age 2·6 years. Integration of the Toxoplasma MBA into NTD surveys may allow for better estimates of the potential burden of congenital toxoplasmosis in underserved regions.

  11. Evaluation of Apis mellifera syriaca Levant Region honeybee conservation using Comparative Genome Hybridization

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Apis mellifera syriaca is the native honeybee subspecies of Jordan and much of the Levant Region. It expresses behavioral adaptations to a regional climate with very high temperatures, nectar dearth in summer, attacks of the Oriental wasp and is resistant to Varroa mites. The A. m. syriaca control r...

  12. Conservation of Socioculturally Important Local Crop Biodiversity in the Oromia Region of Ethiopia: A Case Study

    NASA Astrophysics Data System (ADS)

    Balemie, Kebu; Singh, Ranjay K.


    In this study, we surveyed diversity in a range of local crops in the Lume and Gimbichu districts of Ethiopia, together with the knowledge of local people regarding crop uses, socio-economic importance, conservation, management and existing threats. Data were collected using semistructured interviews and participant observation. The study identified 28 farmers' varieties of 12 crop species. Among these, wheat ( Triticum turgidum) and tef ( Eragrostis tef) have high intra-specific diversity, with 9 and 6 varieties respectively. Self-seed supply or seed saving was the main (80 %) source of seeds for replanting. Agronomic performance (yield and pest resistance), market demand, nutritional and use diversity attributes of the crop varieties were highlighted as important criteria for making decisions regarding planting and maintenance. Over 74 % of the informants grow a combination of "improved" and farmers' varieties. Of the farmers' varieties, the most obvious decline and/or loss was reported for wheat varieties. Introduction of improved wheat varieties, pest infestation, shortage of land, low yield performance and climate variability were identified as the principal factors contributing to this loss or decline. Appropriate interventions for future conservation and sustainable use of farmers' varieties were suggested.

  13. Conservation of cultural heritage in minority ethnic regions in northwestern china—an exploration at Kuqa, Xinjiang

    NASA Astrophysics Data System (ADS)

    Wu, N.; Zhang, X.


    Kuqa, Xinjiang, is located at northwestern inland china. Traditionally a bridge between eastern and western civilizations, Kuqa had a history of cultural fusion and was left with abundant cultural heritage. As population increase, economic growth and social changes occurred, spontaneous renovation of the old city was affected, in which street fabric and scenes underwent damages. The paper demonstrates attempts made in various projects to achieve conservation of cultural heritage in agreement with economic development and improvement of living condition. The lessons learnt in these projects will be of value to development of other historic cities, especially in minority ethnic regions in China.

  14. CisMols Analyzer: identification of compositionally similar cis-element clusters in ortholog conserved regions of coordinately expressed genes

    PubMed Central

    Jegga, Anil G.; Gupta, Ashima; Gowrisankar, Sivakumar; Deshmukh, Mrunal A.; Connolly, Steven; Finley, Kevin; Aronow, Bruce J.


    Combinatorial interactions of sequence-specific trans-acting factors with localized genomic cis-element clusters are the principal mechanism for regulating tissue-specific and developmental gene expression. With the emergence of expanding numbers of genome-wide expression analyses, the identification of the cis-elements responsible for specific patterns of transcriptional regulation represents a critical area of investigation. Computational methods for the identification of functional cis-regulatory modules are difficult to devise, principally because of the short length and degenerate nature of individual cis-element binding sites and the inherent complexity that is generated by combinatorial interactions within cis-clusters. Filtering candidate cis-element clusters based on phylogenetic conservation is helpful for an individual ortholog gene pair, but combining data from cis-conservation and coordinate expression across multiple genes is a more difficult problem. To approach this, we have extended an ortholog gene-pair database with additional analytical architecture to allow for the analysis and identification of maximal numbers of compositionally similar and phylogenetically conserved cis-regulatory element clusters from a list of user-selected genes. The system has been successfully tested with a series of functionally related and microarray profile-based co-expressed ortholog pairs of promoters and genes using known regulatory regions as training sets and co-expressed genes in the olfactory and immunohematologic systems as test sets. CisMols Analyzer is accessible via a Web interface at . PMID:15980500

  15. Computational Design of Proteins Targeting the Conserved Stem Region of Influenza Hemagglutinin

    SciTech Connect

    Fleishman, Sarel J.; Whitehead, Timothy A.; Ekiert, Damian C.; Dreyfus, Cyrille; Corn, Jacob E.; Strauch, Eva-Maria; Wilson, Ian A.; Baker, David


    We describe a general computational method for designing proteins that bind a surface patch of interest on a target macromolecule. Favorable interactions between disembodied amino acid residues and the target surface are identified and used to anchor de novo designed interfaces. The method was used to design proteins that bind a conserved surface patch on the stem of the influenza hemagglutinin (HA) from the 1918 H1N1 pandemic virus. After affinity maturation, two of the designed proteins, HB36 and HB80, bind H1 and H5 HAs with low nanomolar affinity. Further, HB80 inhibits the HA fusogenic conformational changes induced at low pH. The crystal structure of HB36 in complex with 1918/H1 HA revealed that the actual binding interface is nearly identical to that in the computational design model. Such designed binding proteins may be useful for both diagnostics and therapeutics.

  16. Intelligent irrigation performance: evaluation and quantifying its ability for conserving water in arid region

    NASA Astrophysics Data System (ADS)

    Al-Ghobari, Hussein M.; Mohammad, Fawzi S.


    Intelligent irrigation technologies have been developed in recent years to apply irrigation to turf and landscape plants. These technologies are an evapotranspiration (ET)-based irrigation controller, which calculates ET for local microclimate. Then, the controller creates a program for loading and communicating automatically with drip or sprinkler system controllers. The main objective of this study was to evaluate the effectiveness of the new ET sensors in ability to irrigate agricultural crops and to conserve water use for crop in arid climatic conditions. This paper presents the case for water conservation using intelligent irrigation system (IIS) application technology. The IIS for automating irrigation scheduling was implemented and tested with sprinkle and drip irrigation systems to irrigate wheat and tomato crops. Another irrigation scheduling system was also installed and operated as another treatment, which is based on weather data that retrieved from an automatic weather station. This irrigation control system was running in parallel to the former system (IIS) to be control experiments for comparison purposes. However, this article discusses the implementation of IIS, its installation, testing and calibration of various components. The experiments conducted for one growing season 2009-2010 and the results were represented and discussed herein. Data from all plots were analyzed, which were including soil water status, water consumption, and crop yield. The initial results indicate that up to 25% water saving by intelligent irrigation compared to control method, while maintaining competing yield. Results show that the crop evapotranspiration values for control experiments were higher than that of ET-System in consistent trend during whole growth season. The analysis points out that the values of the two treatments were somewhat close to each other's only in the initial development stages. Generally, the ET-System, with some modification was precise in

  17. Diversity, natural history and conservation of amphibians and reptiles from the San Vito Region, southwestern Costa Rica.


    Santos-Barrera, Georgina; Pacheco, Jesus; Mendoza-Quijano, Fernando; Bolaños, Federico; Cháves, Gerardo; Daily, Gretchen C; Ehrlich, Paul R; Ceballos, Gerardo


    We present an inventory of the amphibians and reptiles of the San Vito de Coto Brus region, including the Las Cruces Biological Station, in southern Costa Rica, which is the result of a survey of the herpetofauna occurring in mountain forest fragments, pastures, coffee plantations, and other disturbed areas. We found 67 species, included 26 species of amphibians and of 41 of reptiles. We describe the distribution patterns of the community on the basis of the life zones, elevation, fragmentation, and degree of anthropogenic impact. We also provide some nouvelle data on the systematics of some select taxa, their geographical ranges, microhabitats, activity, and other relevant ecological and natural history features. Finally, we comment on the present conservation status of the herpetofauna in the region. Previous literature and collection records indicate a higher number of species occurring in this area, which suggests that some declines have occurred, especially of amphibians, in last decades.

  18. Prevalence, conservation and functional analysis of Yersinia and Escherichia CRISPR regions in clinical Pseudomonas aeruginosa isolates.


    Cady, K C; White, A S; Hammond, J H; Abendroth, M D; Karthikeyan, R S G; Lalitha, P; Zegans, M E; O'Toole, G A


    Here, we report the characterization of 122 Pseudomonas aeruginosa clinical isolates from three distinct geographical locations: Dartmouth Hitchcock Medical Center in New Hampshire, USA, the Charles T. Campbell Eye Microbiology Lab at the University of Pittsburgh Medical Center, USA, and the Aravind Eye Hospital in Madurai, India. We identified and located clustered regularly interspaced short palindromic repeats (CRISPR) in 45/122 clinical isolates and sequenced these CRISPR, finding that Yersinia subtype CRISPR regions (33 %) were more prevalent than the Escherichia CRISPR region subtype (6 %) in these P. aeruginosa clinical isolates. Further, we observed 132 unique spacers from these 45 CRISPR that are 100 % identical to prophages or sequenced temperate bacteriophage capable of becoming prophages. Most intriguingly, all of these 132 viral spacers matched to temperate bacteriophage/prophages capable of inserting into the host chromosome, but not to extrachromosomally replicating lytic P. aeruginosa bacteriophage. We next assessed the ability of the more prevalent Yersinia subtype CRISPR regions to mediate resistance to bacteriophage infection or lysogeny by deleting the entire CRISPR region from sequenced strain UCBPP-PA14 and six clinical isolates. We found no change in CRISPR-mediated resistance to bacteriophage infection or lysogeny rate even for CRISPR with spacers 100 % identical to a region of the infecting bacteriophage. Lastly, to show these CRISPR and cas genes were expressed and functional, we demonstrated production of small CRISPR RNAs. This work provides both the first examination to our knowledge of CRISPR regions within clinical P. aeruginosa isolates and a collection of defined CRISPR-positive and -negative strains for further CRISPR and cas gene studies.

  19. A Conserved Region in the F2 Subunit of Paramyxovirus Fusion Proteins Is Involved In Fusion Regulation▿

    PubMed Central

    Gardner, Amanda E.; Dutch, Rebecca E.


    Paramyxoviruses utilize both an attachment protein and a fusion (F) protein to drive virus-cell and cell-cell fusion. F exists functionally as a trimer of two disulfide-linked subunits: F1 and F2. Alignment and analysis of a set of paramyxovirus F protein sequences identified three conserved blocks (CB): one in the fusion peptide/heptad repeat A domain, known to play important roles in fusion promotion, one in the region between the heptad repeats of F1 (CBF1) (A. E. Gardner, K. L. Martin, and R. E. Dutch, Biochemistry 46:5094-5105, 2007), and one in the F2 subunit (CBF2). To analyze the functions of CBF2, alanine substitutions at conserved positions were created in both the simian virus 5 (SV5) and Hendra virus F proteins. A number of the CBF2 mutations resulted in folding and expression defects. However, the CBF2 mutants that were properly expressed and trafficked had altered fusion promotion activity. The Hendra virus CBF2 Y79A and P89A mutants showed significantly decreased levels of fusion, whereas the SV5 CBF2 I49A mutant exhibited greatly increased cell-cell fusion relative to that for wild-type F. Additional substitutions at SV5 F I49 suggest that both side chain volume and hydrophobicity at this position are important in the folding of the metastable, prefusion state and the subsequent triggering of membrane fusion. The recently published prefusogenic structure of parainfluenza virus 5/SV5 F (H. S. Yin et al., Nature 439:38-44, 2006) places CBF2 in direct contact with heptad repeat A. Our data therefore indicate that this conserved region plays a critical role in stabilizing the prefusion state, likely through interactions with heptad repeat A, and in triggering membrane fusion. PMID:17507474

  20. Conserved peptides within the E2 region of Hepatitis C virus induce humoral and cellular responses in goats

    PubMed Central

    El-Awady, Mostafa K; Tabll, Ashraf A; El-Abd, Yasmine S; Yousif, Hassan; Hegab, Mohsen; Reda, Mohamed; El Shenawy, Reem; Moustafa, Rehab I; Degheidy, Nabila; El Din, Noha G Bader


    The reason(s) why human antibodies raised against hepatitis C virus (HCV) E2 epitopes do not offer protection against multiple viral infections may be related to either genetic variations among viral strains particularly within the hypervariable region-1 (HVR-1), low titers of anti E2 antibodies or interference of non neutralizing antibodies with the function of neutralizing antibodies. This study was designed to assess the immunogenic properties of genetically conserved peptides derived from the C-terminal region of HVR-1 as potential therapeutic and/or prophylactic vaccines against HCV infection. Goats immunized with E2-conserved synthetic peptides termed p36 (a.a 430–446), p37(a.a 517–531) and p38 (a.a 412–419) generated high titers of anti-p36, anti-p37 and anti-P38 antibody responses of which only anti- p37 and anti- p38 were neutralizing to HCV particles in sera from patients infected predominantly with genotype 4a. On the other hand anti-p36 exhibited weak viral neutralization capacity on the same samples. Animals super-immunized with single epitopes generated 2 to 4.5 fold higher titers than similar antibodies produced in chronic HCV patients. Also the studied peptides elicited approximately 3 fold increase in cell proliferation of specific antibody-secreting peripheral blood mononuclear cells (PBMC) from immunized goats. These results indicate that, besides E1 derived peptide p35 (a.a 315–323) described previously by this laboratory, E2 conserved peptides p37 and p38 represent essential components of a candidate peptide vaccine against HCV infection. PMID:19473491

  1. Phylogenetic Footprinting Reveals Evolutionarily Conserved Regions of the Gonadotropin-Releasing Hormone Gene that Enhance Cell-Specific Expression

    PubMed Central



    Reproductive function is controlled by the hypothalamic neuropeptide, GnRH, which serves as the central regulator of the hypothalamic-pituitary-gonadal axis. GnRH expression is limited to a small population of neurons in the hypothalamus. Targeting this minute population of neurons (as few as 800 in the mouse) requires regulatory elements upstream of the GnRH gene that remain to be fully characterized. Previously, we have identified an evolutionarily conserved promoter region (−173 to −1) and an enhancer (−1863 to −1571) in the rat gene that targets a subset of the GnRH neurons in vivo. In the present study, we used phylogenetic sequence comparison between human and rodents and analysis of the transcription factor clusters within conserved regions in an attempt to identify additional upstream regulatory elements. This approach led to the characterization of a new upstream enhancer that regulates expression of GnRH in a cell-specific manner. Within this upstream enhancer are nine binding sites for Octamer-binding transcription factor 1 (OCT1), known to be an important transcriptional regulator of GnRH gene expression. In addition, we have identified nuclear factor I (NF1) binding to multiple elements in the GnRH-regulatory regions, each in close proximity to OCT1. We show that OCT1 and NF1 physically and functionally interact. Moreover, the OCT1 and NF1 binding sites in the regulatory regions appear to be essential for appropriate GnRH gene expression. These findings indicate a role for this upstream enhancer and novel OCT1/NF1 complexes in neuron-restricted expression of the GnRH gene. PMID:15319450

  2. Insular ecosystems of the southeastern United States—A regional synthesis to support biodiversity conservation in a changing climate

    USGS Publications Warehouse

    Cartwright, Jennifer M.; Wolfe, William J.


    In the southeastern United States, insular ecosystems—such as rock outcrops, depression wetlands, high-elevation balds, flood-scoured riparian corridors, and insular prairies and barrens—occupy a small fraction of land area but constitute an important source of regional and global biodiversity, including concentrations of rare and endemic plant taxa. Maintenance of this biodiversity depends upon regimes of abiotic stress and disturbance, incorporating factors such as soil surface temperature, widely fluctuating hydrologic conditions, fires, flood scouring, and episodic droughts that may be subject to alteration by climate change. Over several decades, numerous localized, site-level investigations have yielded important information about the floristics, physical environments, and ecological dynamics of these insular ecosystems; however, the literature from these investigations has generally remained fragmented. This report consists of literature syntheses for eight categories of insular ecosystems of the southeastern United States, concerning (1) physical geography, (2) ecological determinants of community structures including vegetation dynamics and regimes of abiotic stress and disturbance, (3) contributions to regional and global biodiversity, (4) historical and current anthropogenic threats and conservation approaches, and (5) key knowledge gaps relevant to conservation, particularly in terms of climate-change effects on biodiversity. This regional synthesis was undertaken to discern patterns across ecosystems, identify knowledge gaps, and lay the groundwork for future analyses of climate-change vulnerability. Findings from this synthesis indicate that, despite their importance to regional and global biodiversity, insular ecosystems of the southeastern United States have been subjected to a variety of direct and indirect human alterations. In many cases, important questions remain concerning key determinants of ecosystem function. In particular, few

  3. Conserved Structural Regions Involved in the Catalytic Mechanism of Escherichia coli K-12 WaaO (RfaI)

    PubMed Central

    Shibayama, Keigo; Ohsuka, Shinji; Tanaka, Toshihiko; Arakawa, Yoshichika; Ohta, Michio


    Escherichia coli K-12 WaaO (formerly known as RfaI) is a nonprocessive α-1,3 glucosyltransferase, involved in the synthesis of the R core of lipopolysaccharide. By comparing the amino acid sequence of WaaO with those of 11 homologous α-glycosyltransferases, four strictly conserved regions, I, II, III, and IV, were identified. Since functionally related transferases are predicted to have a similar architecture in the catalytic sites, it is assumed that these four regions are directly involved in the formation of α-glycosidic linkage from α-linked nucleotide diphospho-sugar donor. Hydrophobic cluster analysis revealed a conserved domain at the N termini of these α-glycosyltransferases. This domain was similar to that previously reported for β-glycosyltransferases. Thus, this domain is likely to be involved in the formation of β-glycosidic linkage between the donor sugar and the enzyme at the first step of the reaction. Site-directed mutagenesis analysis of E. coli K-12 WaaO revealed four critical amino acid residues. PMID:9765561

  4. Conserved structural regions involved in the catalytic mechanism of Escherichia coli K-12 WaaO (RfaI).


    Shibayama, K; Ohsuka, S; Tanaka, T; Arakawa, Y; Ohta, M


    Escherichia coli K-12 WaaO (formerly known as RfaI) is a nonprocessive alpha-1,3 glucosyltransferase, involved in the synthesis of the R core of lipopolysaccharide. By comparing the amino acid sequence of WaaO with those of 11 homologous alpha-glycosyltransferases, four strictly conserved regions, I, II, III, and IV, were identified. Since functionally related transferases are predicted to have a similar architecture in the catalytic sites, it is assumed that these four regions are directly involved in the formation of alpha-glycosidic linkage from alpha-linked nucleotide diphospho-sugar donor. Hydrophobic cluster analysis revealed a conserved domain at the N termini of these alpha-glycosyltransferases. This domain was similar to that previously reported for beta-glycosyltransferases. Thus, this domain is likely to be involved in the formation of beta-glycosidic linkage between the donor sugar and the enzyme at the first step of the reaction. Site-directed mutagenesis analysis of E. coli K-12 WaaO revealed four critical amino acid residues.

  5. The complete mitochondrial genome sequence of the tubeworm Lamellibrachia satsuma and structural conservation in the mitochondrial genome control regions of Order Sabellida.


    Patra, Ajit Kumar; Kwon, Yong Min; Kang, Sung Gyun; Fujiwara, Yoshihiro; Kim, Sang-Jin


    The control region of the mitochondrial genomes shows high variation in conserved sequence organizations, which follow distinct evolutionary patterns in different species or taxa. In this study, we sequenced the complete mitochondrial genome of Lamellibrachia satsuma from the cold-seep region of Kagoshima Bay, as a part of whole genome study and extensively studied the structural features and patterns of the control region sequences. We obtained 15,037 bp of mitochondrial genome using Illumina sequencing and identified the non-coding AT-rich region or control region (354 bp, AT=83.9%) located between trnH and trnR. We found 7 conserved sequence blocks (CSB), scattered throughout the control region of L. satsuma and other taxa of Annelida. The poly-TA stretches, which commonly form the stem of multiple stem-loop structures, are most conserved in the CSB-I and CSB-II regions. The mitochondrial genome of L. satsuma encodes a unique repetitive sequence in the control region, which forms a unique secondary structure in comparison to Lamellibrachia luymesi. Phylogenetic analyses of all protein-coding genes indicate that L. satsuma forms a monophyletic clade with L. luymesi along with other tubeworms found in cold-seep regions (genera: Lamellibrachia, Escarpia, and Seepiophila). In general, the control region sequences of Annelida could be aligned with certainty within each genus, and to some extent within the family, but with a higher rate of variation in conserved regions.

  6. "Recognizing Numerical Constants"

    NASA Technical Reports Server (NTRS)

    Bailey, David H.; Craw, James M. (Technical Monitor)


    The advent of inexpensive, high performance computer and new efficient algorithms have made possible the automatic recognition of numerically computed constants. In other words, techniques now exist for determining, within certain limits, whether a computed real or complex number can be written as a simple expression involving the classical constants of mathematics. In this presentation, some of the recently discovered techniques for constant recognition, notably integer relation detection algorithms, will be presented. As an application of these methods, the author's recent work in recognizing "Euler sums" will be described in some detail.

  7. Analysing biodiversity and conservation knowledge products to support regional environmental assessments

    PubMed Central

    Brooks, Thomas M.; Akçakaya, H. Resit; Burgess, Neil D.; Butchart, Stuart H.M.; Hilton-Taylor, Craig; Hoffmann, Michael; Juffe-Bignoli, Diego; Kingston, Naomi; MacSharry, Brian; Parr, Mike; Perianin, Laurence; Regan, Eugenie C.; Rodrigues, Ana S.L.; Rondinini, Carlo; Shennan-Farpon, Yara; Young, Bruce E.


    Two processes for regional environmental assessment are currently underway: the Global Environment Outlook (GEO) and Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES). Both face constraints of data, time, capacity, and resources. To support these assessments, we disaggregate three global knowledge products according to their regions and subregions. These products are: The IUCN Red List of Threatened Species, Key Biodiversity Areas (specifically Important Bird & Biodiversity Areas [IBAs], and Alliance for Zero Extinction [AZE] sites), and Protected Planet. We present fourteen Data citations: numbers of species occurring and percentages threatened; numbers of endemics and percentages threatened; downscaled Red List Indices for mammals, birds, and amphibians; numbers, mean sizes, and percentage coverages of IBAs and AZE sites; percentage coverage of land and sea by protected areas; and trends in percentages of IBAs and AZE sites wholly covered by protected areas. These data will inform the regional/subregional assessment chapters on the status of biodiversity, drivers of its decline, and institutional responses, and greatly facilitate comparability and consistency between the different regional/subregional assessments. PMID:26881749

  8. Analysing biodiversity and conservation knowledge products to support regional environmental assessments

    NASA Astrophysics Data System (ADS)

    Brooks, Thomas M.; Akçakaya, H. Resit; Burgess, Neil D.; Butchart, Stuart H. M.; Hilton-Taylor, Craig; Hoffmann, Michael; Juffe-Bignoli, Diego; Kingston, Naomi; Macsharry, Brian; Parr, Mike; Perianin, Laurence; Regan, Eugenie C.; Rodrigues, Ana S. L.; Rondinini, Carlo; Shennan-Farpon, Yara; Young, Bruce E.


    Two processes for regional environmental assessment are currently underway: the Global Environment Outlook (GEO) and Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES). Both face constraints of data, time, capacity, and resources. To support these assessments, we disaggregate three global knowledge products according to their regions and subregions. These products are: The IUCN Red List of Threatened Species, Key Biodiversity Areas (specifically Important Bird & Biodiversity Areas [IBAs], and Alliance for Zero Extinction [AZE] sites), and Protected Planet. We present fourteen Data citations: numbers of species occurring and percentages threatened; numbers of endemics and percentages threatened; downscaled Red List Indices for mammals, birds, and amphibians; numbers, mean sizes, and percentage coverages of IBAs and AZE sites; percentage coverage of land and sea by protected areas; and trends in percentages of IBAs and AZE sites wholly covered by protected areas. These data will inform the regional/subregional assessment chapters on the status of biodiversity, drivers of its decline, and institutional responses, and greatly facilitate comparability and consistency between the different regional/subregional assessments.

  9. Analysing biodiversity and conservation knowledge products to support regional environmental assessments.


    Brooks, Thomas M; Akçakaya, H Resit; Burgess, Neil D; Butchart, Stuart H M; Hilton-Taylor, Craig; Hoffmann, Michael; Juffe-Bignoli, Diego; Kingston, Naomi; MacSharry, Brian; Parr, Mike; Perianin, Laurence; Regan, Eugenie C; Rodrigues, Ana S L; Rondinini, Carlo; Shennan-Farpon, Yara; Young, Bruce E


    Two processes for regional environmental assessment are currently underway: the Global Environment Outlook (GEO) and Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES). Both face constraints of data, time, capacity, and resources. To support these assessments, we disaggregate three global knowledge products according to their regions and subregions. These products are: The IUCN Red List of Threatened Species, Key Biodiversity Areas (specifically Important Bird &Biodiversity Areas [IBAs], and Alliance for Zero Extinction [AZE] sites), and Protected Planet. We present fourteen Data citations: numbers of species occurring and percentages threatened; numbers of endemics and percentages threatened; downscaled Red List Indices for mammals, birds, and amphibians; numbers, mean sizes, and percentage coverages of IBAs and AZE sites; percentage coverage of land and sea by protected areas; and trends in percentages of IBAs and AZE sites wholly covered by protected areas. These data will inform the regional/subregional assessment chapters on the status of biodiversity, drivers of its decline, and institutional responses, and greatly facilitate comparability and consistency between the different regional/subregional assessments.

  10. The compact Brachypodium genome conserves centromeric regions of a common ancestor with wheat and rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The evolution of five chromosomes of Brachypodium distachyon from a 12-chromosome ancestor of all grasses by dysploidy raises an interesting question about the fate of redundant centromeres. Three independent but complementary approaches were pursued to study centromeric region homologies among the ...

  11. Evolutionarily conserved amino acids in TCR V regions and MHC control their interaction

    PubMed Central

    Marrack, Philippa; Scott-Browne, James P.; Dai, Shaodong; Gapin, Laurent; Kappler, John W.


    Alpha/beta T cell receptors (TCRs) react with major histocompatibility complex proteins (MHC) plus peptides, a poorly understood phenomenon, probably because thymocytes bearing TCRs that manifest MHC-reactivity too well are lost by negative selection. Only TCRs with attenuated ability to react with MHC appear on mature T cells. Also, the interaction sites between TCRs and MHC may be inherently flexible and hence difficult to spot. Contacts between TCRs and MHC in the solved structures of their complexes were reevaluated with these points in mind. The results show that frequently used amino acids in TCR CDR1 and CDR2 regions are often used to bind MHC, in areas around small amino acids on the surfaces of MHC α helices that form a cup, allowing somewhat flexible binding of the TCRs. The TCR amino acids involved are specific to families of V regions and partially different rules govern recognition of MHC1 versus MHCII. PMID:18304006


    SciTech Connect

    Donald Johnson, Todd Schaack


    The research supported by DOE funding addressed the fundamental issues of understanding and modeling of hydrologic processes in relation to regional and global climate change. The emphasis of this research effort was on the application of isentropic modeling and analysis to advance the accuracy of the simulation of all aspects of the hydrologic cycle including clouds and thus the climate state regionally and globally. Simulation of atmospheric hydrologic processes by the UW hybrid isentropic coordinate models provided fundamental insight into global monsoonal circulations, and regional energy exchange in relation to the atmospheric hydrologic cycle. Inter-comparison of UW hybrid model simulations with those from the NCAR Community Climate Model and other climate and numerical weather prediction (NWP) models investigated the increased accuracies gained in modeling long-range transport in isentropic coordinates and isolated differences in modeling of the climate state. The inter-comparisons demonstrated advantages in the simulation of the transport of the hydrologic components of the climate system and provided insight into the more general problems of simulating hydrologic processes, aerosols and chemistry for climate. This research demonstrated the viability of the UW isentropic-eta model for long-term integration for climate and climate change studies and documented that no insurmountable barriers exist to simulation of climate utilizing hybrid isentropic coordinate models. The results provide impetus for continued development of hybrid isentropic coordinate models as a means to advance accuracies in the simulation of global and regional climate in relation to transport and the planetary distribution of heat sources and sinks.

  13. Interfacial Partitioning of a Loop Hinge Residue Contributes to Diacylglycerol Affinity of Conserved Region 1 Domains*

    PubMed Central

    Stewart, Mikaela D.; Cole, Taylor R.; Igumenova, Tatyana I.


    Conventional and novel isoenzymes of PKC are activated by the membrane-embedded second messenger diacylglycerol (DAG) through its interactions with the C1 regulatory domain. The affinity of C1 domains to DAG varies considerably among PKCs. To gain insight into the origin of differential DAG affinities, we conducted high-resolution NMR studies of C1B domain from PKCδ (C1Bδ) and its W252Y variant. The W252Y mutation was previously shown to render C1Bδ less responsive to DAG (Dries, D. R., Gallegos, L. L., and Newton, A. C. (2007) A single residue in the C1 domain sensitizes novel protein kinase C isoforms to cellular diacylglycerol production. J. Biol. Chem. 282, 826–830) and thereby emulate the behavior of C1B domains from conventional PKCs that have a conserved Tyr at the equivalent position. Our data revealed that W252Y mutation did not perturb the conformation of C1Bδ in solution but significantly reduced its propensity to partition into a membrane-mimicking environment in the absence of DAG. Using detergent micelles doped with a paramagnetic lipid, we determined that both the residue identity at position 252 and complexation with diacylglycerol influence the geometry of C1Bδ-micelle interactions. In addition, we identified the C-terminal helix α1 of C1Bδ as an interaction site with the head groups of phosphatidylserine, a known activator of PKCδ. Taken together, our studies (i) reveal the identities of C1Bδ residues involved in interactions with membrane-mimicking environment, DAG, and phosphatidylserine, as well as the affinities associated with each event and (ii) suggest that the initial ligand-independent membrane recruitment of C1B domains, which is greatly facilitated by the interfacial partitioning of Trp-252, is responsible, at least in part, for the differential DAG affinities. PMID:25124034

  14. Barcoding Chrysomelidae: a resource for taxonomy and biodiversity conservation in the Mediterranean Region

    PubMed Central

    Magoga, Giulia; Sassi, Davide; Daccordi, Mauro; Leonardi, Carlo; Mirzaei, Mostafa; Regalin, Renato; Lozzia, Giuseppe; Montagna, Matteo


    Abstract The Mediterranean Region is one of the world’s biodiversity hot-spots, which is also characterized by high level of endemism. Approximately 2100 species of leaf beetle (Coleoptera; Chrysomelidae) are known from this area, a number that increases year after year and represents 5/6% of the known species. These features, associated with the urgent need to develop a DNA-based species identification approach for a broad spectrum of leaf beetle species, prompted us to develop a database of nucleotide sequences, with a solid taxonomic background, for all the Chrysomelidae Latreille, 1802 sensu latu inhabiting the Mediterranean region. The Mediterranean Chrysomelidae Barcoding project, which has started in 2009, involves more than fifty entomologists and molecular biologists from different European countries. Numerous collecting campaigns have been organized during the first seven years of the project, which led to the collection of more than 5000 leaf beetle specimens. In addition, during these collecting campaigns two new allochthonous species for Europe, namely Ophraella communa LeSage, 1986 and Colasposoma dauricum Mannerheim, 1849, were intercepted and some species new to science were discovered (e.g., Pachybrachis sassii Montagna, 2011 and Pachybrachis holerorum Montagna et al., 2013). DNA was extracted from 1006 specimens (~13% of the species inhabiting the Mediterranean region) and a total of 910 cox1 gene sequences were obtained (PCR amplification efficiency of 93.8%). Here we report the list of the barcoded subfamilies, genera and the number of species for which cox1 gene sequences were obtained; the metadata associated with each specimen and a list of problematic species for which marker amplification failed. In addition, the nucleotide divergence within and between species and genera was estimated and values of intraspecific nucleotide divergence greater than the average have been discussed. Cryptocephalus quadripunctatus G. A. Olivier, 1808

  15. Recognizing complex patterns.


    Sinha, Pawan


    How the brain recognizes complex patterns in the environment is a central, but little understood question in neuroscience. The problem is of great significance for a host of applications such as biometric-based access control, autonomous robots and content-based information management. Although some headway in these directions has been made, the current artificial systems do not match the robustness and versatility of their biological counterparts. Here I examine recognition tasks drawn from two different sensory modalities--face recognition and speaker/speech recognition. The goal is to characterize the present state of artificial recognition technologies for these tasks, the influence of neuroscience on the design of these systems and the key challenges they face.

  16. Role of forest conservation in lessening land degradation in a temperate region: the Monarch Butterfly Biosphere Reserve, Mexico.


    Manzo-Delgado, Lilia; López-García, José; Alcántara-Ayala, Irasema


    With international concern about the rates of deforestation worldwide, particular attention has been paid to Latin America. Forest conservation programmes in Mexico include Payment for Environmental Services (PES), a scheme that has been successfully introduced in the Monarch Butterfly Biosphere Reserve. To seek further evidence of the role of PES in lessening land degradation processes in a temperate region, the conservation state of the Cerro Prieto ejido within the Reserve was assessed by an analysis of changes in vegetation cover and land-use between 1971 and 2013. There were no changes in the total forest surface area, but the relative proportions of the different classes of cover density had changed. In 1971, closed and semi-closed forest occupied 247.81 ha and 5.38 ha, 82.33% and 1.79% of the total area of the ejido, respectively. By 2013, closed forest had decreased to 230.38 ha (76.54% of the ejido), and semi-closed cover was 17.23 ha (5.72% of the ejido), suggesting that some semi-closed forest had achieved closed status. The final balance between forest losses and recovery was: 29.63 ha were lost, whereas 13.72 ha were recovered. Losses were mainly linked to a sanitation harvest programme to control the bark beetle Scolytus mundus. Ecotourism associated with forest conservation in the Cerro Prieto ejido has been considered by inhabitants as a focal alternative for economic development. Consequently, it is essential to develop a well-planned and solidly structured approach based on social cohesion to foster a community-led sustainable development at local level.

  17. Absence of mutations in the interspecies conserved regions of the CFTR promoter region in cystic fibrosis (CF) and CF related patients.

    PubMed Central

    Verlingue, C; Vuillaumier, S; Mercier, B; Le Gac, M; Elion, J; Férec, C; Denamur, E


    This study was aimed at testing if a 5.2 kb untranslated region on both sides of the first CFTR exon, shown to contain regulatory elements, could carry mutations responsible for cystic fibrosis (CF) or CF related phenotypes. Selection of the DNA segments studied within this region was based upon the identification of conserved sequences throughout evolution (phylogenetic footprints, PFs). Comparison of the CFTR sequences in eight species representing four orders of mammals (man, gibbon, rhesus monkey, squirrel, monkey, rabbit, cow, rat, and mouse) identified four clusters of PFs within the 3.9 kb of DNA sequence upstream from the initiation codon, as well as two nearby PFs at +1 kb within intron 1. Six DNA segments containing PFs were scanned for mutations by denaturing gradient gel electrophoresis (DGGE) in patients with CF (n = 29), congenital bilateral absence of the vas deferens (n = 143), or disseminated bronchiectasis (n = 33), for whom only one or no mutations had been identified despite extensive DGGE analysis of the 27 CFTR exons and exon/intron boundaries. Only one polymorphism (-966 T-->G) was identified with a frequency of 2.2% and no other sequence variations were found. This study reinforces the idea that the promoter region in the CFTR is not frequently mutated. PMID:9507393

  18. Behavior of mice with mutations in the conserved region deleted in velocardiofacial/DiGeorge syndrome.


    Long, Jeffrey M; LaPorte, Patricia; Merscher, Sandra; Funke, Birgit; Saint-Jore, Bruno; Puech, Anne; Kucherlapati, Raju; Morrow, Bernice E; Skoultchi, Arthur I; Wynshaw-Boris, Anthony


    Velocardiofacial/DiGeorge syndrome (VCFS/DGS) is a developmental disorder caused by a 1.5 to 3-Mb hemizygous 22q11.2 deletion. VCFS/DGS patients display malformations in multiple systems, as well as an increased frequency of neuropsychiatric defects including schizophrenia. Haploinsufficiency of TBX1 appears to be responsible for these physical malformations in humans and mice, but the genes responsible for the neuropsychiatric defects are unknown. In this study, two mouse models of VCFS/DGS, a deletion mouse model (Lgdel/+) and a single gene model (Tbx1 +/-), as well as a third mouse mutant (Gscl -/-) for a gene within the Lgdel deletion, were tested in a large behavioral battery designed to assess gross physical features, sensorimotor reflexes, motor activity nociception, acoustic startle, sensorimotor gating, and learning and memory. Lgdel/+ mice contain a 1.5-Mb hemizygous deletion of 27 genes in the orthologous region on MMU 16 and present with impairment in sensorimotor gating, grip strength, and nociception. Tbx1 +/- mice were impaired in grip strength similar to Lgdel/+ mice and movement initiation. Gscl -/- mice were not impaired in any of the administered tests, suggesting that redundant function of other Gsc family members may compensate for the loss of Gscl. Thus, although deletion of the genes in the Lgdel region in mice may recapitulate some of the behavioral phenotypes seen in humans with VCFS/DGS, these phenotypes are not found in mice with complete loss of Gscl or in mice with heterozygous loss of Tbx1, suggesting that the neuropsychiatric and physical malformations of VCFS/DGS may act by different genetic mechanisms.

  19. Localization of a highly immunogenic region of carboxypeptidase A recognized by three different monoclonal antibodies and their use in the detection of subtle conformational alterations in this enzyme region.


    Solomon, B; Koppel, R; Kenett, D; Fleminger, G


    Three murine monoclonal antibodies (mAb 100, 104, and 121) elicited against carboxypeptidase A (CPA) were prepared and characterized. All three mAbs recognize the same or partially overlapping sites of CPA. This is corroborated by the lack of antibody additivity in the ELISA assay carried out in the presence of pairs of mAbs, the similarity in molecular weight of the immunocomplex formed between CPA and one of the mAbs in the presence of another, and also a competition experiment in which one of the mAbs was labeled enzymatically. The three mAbs do not affect the enzymatic activity of CPA. Even at high concentrations, they do not recognize carboxypeptidase B (CPB) in spite of the similar tertiary structure and the 50% homology in amino acid sequence with CPA. This antigenic determinant is located on one of the four cyanogen bromide fragments of CPA. On the basis of the known sequences of the two enzymes, criteria which predict high antigenicity, and experimental data using synthetic peptides, such a determinant was found to be located within the amino acid sequence from residues 209 to 218 of the CPA molecule. The mAbs prepared detect conformational alterations in the above enzyme epitope when the enzyme is exposed to various conditions. The binding of the mAbs to CPA adsorbed onto a polystyrene plate is characterized by apparent binding constants higher by 1 or 2 orders of magnitude than those characterizing the interaction of the mAbs with CPA in solution. The mAbs also readily detect both conformational alterations of CPA on treatment with urea and subtle, reversible conformational alterations on removal of zinc from the active site of the enzyme.

  20. Desalination as Groundwater Conservation: The Cost of Protecting Cultural and Environmental Resources in Chile's Region II

    NASA Astrophysics Data System (ADS)

    Edwards, E. C.; Cristi, O.; Libecap, G. D.


    of the empirical work, the theoretical development provides an important perspective into groundwater management and the important role of understanding the physical system in water marketing. Worldwide, subsidized and scarce water is allocated to farmers for social and political reasons. The losses from this type of allocation are often ignored or marginalized. The Chilean case demonstrates that the losses due to economically inefficient allocation are real, because the alternative is greater consumption of other resources (fossil fuels in this case), not conservation. The Chilean case also demonstrates the difficulty of adequately defining water rights for efficient markets due to the physical properties of hydrologic systems. Because groundwater and surface water systems are linked and water is partially recycled, water markets may over allocate water to consumptive users or those with preferable extraction locations. This paper provides a theoretical exposition of how water rights that fail incorporate important properties of the physical system may lead to inefficient water markets.

  1. Immunoglobulin (Ig)G purified from human sera mirrors intravenous Ig human leucocyte antigen (HLA) reactivity and recognizes one's own HLA types, but may be masked by Fab complementarity-determining region peptide in the native sera.


    Ravindranath, M H; Terasaki, P I; Maehara, C Y; Jucaud, V; Kawakita, S; Pham, T; Yamashita, W


    Intravenous immunoglobulin (IVIg) reacted with a wide array of human leucocyte antigen (HLA) alleles, in contrast to normal sera, due possibly to the purification of IgG from the pooled plasma. The reactivity of IgG purified from normal sera was compared with that of native sera to determine whether any serum factors mask the HLA reactivity of anti-HLA IgG and whether IgG purified from sera can recognize the HLA types of the corresponding donors. The purified IgG, unlike native sera, mirrored IVIg reactivity to a wide array of HLA-I/-II alleles, indicating that anti-HLA IgG may be masked in normal sera - either by peptides derived from soluble HLA or by those from antibodies. A < 3 kDa peptide from the complementarity-determining region (CDR) of the Fab region of IgG (but not the HLA peptides) masked HLA recognition by the purified IgG. Most importantly, some of the anti-HLA IgG purified from normal sera - and serum IgG from a few donors - indeed recognized the HLA types of the corresponding donors, confirming the presence of auto-HLA antibodies. Comparison of HLA types with the profile of HLA antibodies showed auto-HLA IgG to the donors' HLA antigens in this order of frequency: DPA (80%), DQA (71%), DRB345 (67%), DQB (57%), Cw (50%), DBP (43%), DRB1 (21%), A (14%) and B (7%). The auto-HLA antibodies, when unmasked in vivo, may perform immunoregulatory functions similar to those of therapeutic preparations of IVIg.

  2. The sequence organization of Yp/proximal Xq homologous regions of the human sex chromosomes is highly conserved

    SciTech Connect

    Sargent, C.A.; Briggs, H.; Chalmers, I.J.


    Detailed deletion analysis of patients with breakpoints in Yp has allowed the definition of two distinct intervals on the Y chromosome short arm outside the pseudoautosomal region that are homologous to Xq21.3. Detailed YAC contigs have been developed over these regions on both the X and Y chromosomes, and the relative order of markers has been compared to assess whether rearrangements on either sex chromosome have occurred since the transposition events creating these patterns of homology. On the X chromosome, the region forms almost one contiguous block of homology, whereas on the Y chromosome, there has been one major rearrangement leading to the two separate Yp-Xq21 blocks of homology. The rearrangement breakpoint has been mapped. Within these separate X-Y homologous blocks on Yp, the order of loci homologous to X has been conserved to a high degree between the sex chromosomes. With the exception of the amelogenin gene (proximal Yp block), all the X-Y homologous sequences in the two Yp blocks have homologues in Xq21.3, with the former having its X counterpart in Xp22.2. This suggests an independent evolutionary event leading to the formation of the amelogenin X-Y homology. 45 refs., 4 figs., 1 tab.

  3. cDNA sequence, genomic organization, and evolutionary conservation of a novel gene from the WAGR region

    SciTech Connect

    Schwartz, F.; Eisenman, R.; Knoll, J.; Bruns, G.


    A new gene (239FB) with predominant and differential expression in fetal brain has recently been isolated from a chromosome 11p13-p14 boundary area near FSHB. The corresponding mRNA has an open reading frame of 294 amino acids, a 3` untranslated region of 1247 nucleotides, and a highly GC-rich 5` untranslated region. The coding and 3` UT sequence is specified by 6 exons within nearly 87 kb of isolated genomic locus. The 5` end region of the transcript maps adjacent to the only genomically defined CpG island in a chromosomal subregion that may be associated with part of the mental retardation of some WAGR (Wilms tumor, aniridia, genitourinary anomalies, and mental retardation) syndrome patients. In addition to nucleotide and amino acid similarity to an EST from a normalized infant brain cDNA library, the predicted protein has extensive similarity to Caenorhbditis elegans polypeptides of, as yet, unknown function. The 239FB locus is, therefore, likely part of a family of genes with two members expressed in human brain. The extensive conservation of the predicted protein suggests a fundamental function of the gene product and will enable evaluation of the role of the 239FB gene in neurogenesis in model organisms. 48 refs., 4 figs., 1 tab.

  4. Crystal structure of a conserved domain in the intermembrane space region of the plastid division protein ARC6.


    Kumar, Nitin; Radhakrishnan, Abhijith; Su, Chih-Chia; Osteryoung, Katherine W; Yu, Edward W


    The chloroplast division machinery is composed of numerous proteins that assemble as a large complex to divide double-membraned chloroplasts through binary fission. A key mediator of division-complex formation is ARC6, a chloroplast inner envelope protein and evolutionary descendant of the cyanobacterial cell division protein Ftn2. ARC6 connects stromal and cytosolic contractile rings across the two membranes through interaction with an outer envelope protein within the intermembrane space (IMS). The ARC6 IMS region bears a structurally uncharacterized domain of unknown function, DUF4101, that is highly conserved among ARC6 and Ftn2 proteins. Here we report the crystal structure of this domain from Arabidopsis thaliana ARC6. The domain forms an α/β barrel open towards the outer envelope membrane but closed towards the inner envelope membrane. These findings provide new clues into how ARC6 and its homologs contribute to chloroplast and cyanobacterial cell division.

  5. Structural and mutational analysis of a conserved gene (DGSI) from the minimal DiGeorge syndrome critical region.


    Gong, W; Emanuel, B S; Galili, N; Kim, D H; Roe, B; Driscoll, D A; Budarf, M L


    The majority of patients with DiGeorge syndrome (DGS), velocardiofacial syndrome (VCFS), conotruncal anomaly face syndrome (CTAFS) and some individuals with familial or sporadic conotruncal cardiac defects have hemizygous deletions of chromosome 22. Most patients with these disorders share a common large deletion, spanning > 1.5 Mb within 22q11.21-q11.23. Recently, the smallest region of deletion overlap has been narrowed to a 250 kb area, the minimal DGS critical region (MDGCR), which includes the locus D22S75 (N25). We have isolated and characterized a novel, highly conserved gene, DGSI, within the MDGCR. DGSI has 10 exons and nine introns encompassing 1702 bp of cDNA sequence and 11 kb of genomic DNA. The encoded protein has 476 amino acids with a predicted mol. wt of 52.6 kDa. The intron-exon boundaries have been analyzed and conform to the consensus GT/AG motif. The corresponding murine Dgsi has been isolated and localized to proximal mouse chromosome 16. The mouse gene contains the same number of exons and introns, and the predicted protein has 479 amino acids with 93.2% identity to that of the human DGSI gene. By database searching, both genes have significant homology to a Caenorhabditis elegans hypothetical protein, F42H10.7. Further, mutation analysis has been performed in 16 patients, who have no detectable 22q11.2 deletion and some of the characteristic clinical features of DGS/VCFS. We have detected eight sequence variants in DGSI. These occurred in the 5'-untranslated region, the coding region and the intronic regions adjacent to the intron-exon boundaries of the gene. Seven of the eight variants were also present in normal controls or unaffected family members, suggesting they may not be of etiologic significance.

  6. A Conserved Region between the Heptad Repeats of Paramyxovirus Fusion Proteins is Critical for Proper F Protein Folding†

    PubMed Central

    Gardner, Amanda E.; Martin, Kimberly L.; Dutch, Rebecca E.


    Paramyxoviruses are a diverse family which utilizes a fusion (F) protein to enter cells via fusion of the viral lipid bilayer with a target cell membrane. Although certain regions of F are known to play critical roles in membrane fusion, the function of much of the protein remains unclear. Sequence alignment of a set of paramyxovirus F proteins and analysis utilizing Block Maker identified a region of conserved amino acid sequence in a large domain between the heptad repeats of F1, designated CBF1. We employed site-directed mutagenesis to analyze the function of completely conserved residues of CBF1 in both the simian virus 5 (SV5) and Hendra virus F proteins. The majority of CBF1 point mutants were deficient in homotrimer formation, proteolytic processing, and transport to the cell surface. For some SV5 F mutants, proteolytic cleavage and surface expression could be restored by expression at 30°C, and varying levels of fusion promotion were observed at this temperature. In addition, the mutant SV5 F V402A displayed a hyperfusogenic phenotype at both 30°C and 37°C, indicating this mutation allows for efficient fusion with only an extremely small amount of cleaved, active protein. The recently published prefusogenic structure of PIV5/SV5 F [Yin, H.S., et al. (2006) Nature 439, 38–44] indicates that residues within and flanking CBF1 interact with the fusion peptide domain. Together, these data suggest that CBF1-fusion peptide interactions are critical for the initial folding of paramyxovirus F proteins from across this important viral family, and can also modulate subsequent membrane fusion promotion. PMID:17417875

  7. Quantifying landscape linkages among giant panda subpopulations in regional scale conservation.


    Qi, Dunwu; Hu, Yibo; Gu, Xiaodong; Yang, Xuyi; Yang, Guang; Wei, Fuwen


    Understanding habitat requirements and identifying landscape linkages are essential for the survival of isolated populations of endangered species. Currently, some of the giant panda populations are isolated, which threatens their long-term survival, particularly in the Xiaoxiangling mountains. In the present study, we quantified niche requirements and then identified potential linkages of giant panda subpopulations in the most isolated region, using ecological niche factor analysis and a least-cost path model. Giant pandas preferred habitat with conifer forest and gentle slopes (>20 to ≤30°). Based on spatial distribution of suitable habitat, linkages were identified for the Yele subpopulation to 4 other subpopulations (Liziping, Matou, Xinmin and Wanba). Their lengths ranged from 15 to 54 km. The accumulated cost ranged from 693 to 3166 and conifer forest covered over 31%. However, a variety of features (e.g. major roads, human settlements and large unforested areas) might act as barriers along the linkages for giant panda dispersal. Our analysis quantified giant panda subpopulation connectivity to ensure long-term survival.

  8. Use of a storm water retention system for conservation of regionally endangered fishes

    USGS Publications Warehouse

    Schaeffer, Jeffrey S.; Bland, James K.; Janssen, John


    Maintaining aquatic biodiversity in urban or suburban areas can be problematic because urban landscapes can be nearly devoid of aquatic habitats other than engineered basins for storm water management. These areas are usually of questionable value for fish, but we examined a case study in which five regionally imperiled fish species were reintroduced into an artificial storm water detention pond and subsequently thrived. Although not a formal experiment, postintroduction survey data suggested that three of the five species maintained high population densities for 10 years after initial stocking, and two persisted in lower numbers. Success was likely due to a combination of unique design features and prior habitat preparation that resulted in clear water conditions that supported dense vegetation. Stocked fish persisted despite occasional bouts of low dissolved oxygen and increased chloride levels resulting from road salt application within the watershed. Transplanted fish served as a source population for both research and further reintroduction experiments. We suggest that, for some fish species, habitat preservation has a middle ground between natural habitats and completely artificial environments that require constant husbandry and that storm water systems could be used to create engineered sanctuaries within the human landscape that have many potential benefits for both humans and fish.

  9. How legumes recognize rhizobia.


    Via, Virginia Dalla; Zanetti, María Eugenia; Blanco, Flavio


    Legume plants have developed the capacity to establish symbiotic interactions with soil bacteria (known as rhizobia) that can convert N2 to molecular forms that are incorporated into the plant metabolism. The first step of this relationship is the recognition of bacteria by the plant, which allows to distinguish potentially harmful species from symbiotic partners. The main molecular determinant of this symbiotic interaction is the Nod Factor, a diffusible lipochitooligosaccharide molecule produced by rhizobia and perceived by LysM receptor kinases; however, other important molecules involved in the specific recognition have emerged over the years. Secreted exopolysaccharides and the lipopolysaccharides present in the bacterial cell wall have been proposed to act as signaling molecules, triggering the expression of specific genes related to the symbiotic process. In this review we will briefly discuss how transcriptomic analysis are helping to understand how multiple signaling pathways, triggered by the perception of different molecules produced by rhizobia, control the genetic programs of root nodule organogenesis and bacterial infection. This knowledge can help to understand how legumes have evolved to recognize and establish complex ecological relationships with particular species and strains of rhizobia, adjusting gene expression in response to identity determinants of bacteria.

  10. Characterization of conservative somatic instability of the CAG repeat region in Huntington`s disease

    SciTech Connect

    Schaefer, F.V.; Calikoglu, A.S.; Whetsell, L.H.


    Instability and enlargement of a CAG repeat region at the beginning of the huntingtin gene (IT-15) has been linked with Huntington`s disease. The CAG repeat size shows a highly significant correlation with age-of-onset of clinicial features in individuals with 40 or more repeats who have Huntington disease. The clinical status of nonsymptomatic individuals with 30 to 39 CAG repeats is considered ambiguous. In order to define more carefully the nature of the HD expansion instability, we examined patients in our HD population using a discriminating fluorescence-based PCR approach. The degree of somatic mutation increases with both earlier age of onset and the size of the inherited allele. A single prominent band one repeat larger than the index peak was typical in individuals with 40-41 CAG repeats. Three to four larger bands are typically discerned in individuals with 50 or more repeats. In an extreme example, an individual with approximately 95 repeats had at least 8 prominent bands. Plotting the degree of somatic mutation relative to the size of the HD allele shows somatic mutation activity increases with size. By this approach 40-60% of the alleles in a 40-41 CAG repeat HD loci is represented in the primary allele. In contrast, the primary allele represents a relatively minor proportion of the total alleles for expansions greater than 50 CAG repeats (10-20%). The limited range of somatic mutation suggest that the instability is restricted to very early stages of embryogenesis before tissue development diverges or that persistent somatic instability occurs at a slow rate. Therefore, the properties of somatic instability in Huntington`s disease have aspects that are both in common but also different from that found in other trinucleotide repeat expanding diseases such as myotonic muscular dystrophy and fragile X syndrome.

  11. Does Lymphovascular Invasion Predict Regional Nodal Failure in Breast Cancer Patients With Zero to Three Positive Lymph Nodes Treated With Conserving Surgery and Radiotherapy? Implications for Regional Radiation

    SciTech Connect

    Boutrus, Rimoun; Abi-Raad, Rita; Niemierko, Andrzej; Brachtel, Elena F.; Rizk, Levi; Kelada, Alexandra; Taghian, Alphonse G.


    Purpose: To examine the relationship between lymphovascular invasion (LVI) and regional nodal failure (RNF) in breast cancer patients with zero to three positive nodes treated with breast-conservation therapy (BCT). Methods and Materials: The records of 1,257 breast cancer patients with zero to three positive lymph nodes were reviewed. All patients were treated with BCT at Massachusetts General Hospital from 1980 to December 2003. Lymphovascular invasion was diagnosed by hematoxylin and eosin-stained sections and in some cases supported by immunohistochemical stains. Regional nodal failure was defined as recurrence in the ipsilateral supraclavicular, axillary, or internal mammary lymph nodes. Regional nodal failure was diagnosed by clinical and/or radiologic examination. Results: The median follow-up was 8 years (range, 0.1-21 years). Lymphovascular invasion was present in 211 patients (17%). In univariate analysis, patients with LVI had a higher rate of RNF (3.32% vs. 1.15%; p = 0.02). In multivariate analysis, only tumor size, grade, and local failure were significant predictors of RNF (p = 0.049, 0.013, and 0.0001, respectively), whereas LVI did not show a significant relationship with RNF (hazard ratio = 2.07; 95% CI, 0.8-5.5; p = 0.143). The presence of LVI in the T2/3 population did not increase the risk of RNF over that for those with no LVI (p = 0.15). In addition, patients with Grade 3 tumors and positive LVI did not have a higher risk of RNF than those without LVI (p = 0.96). Conclusion: These results suggest that LVI can not be used as a sole indicator for regional nodal irradiation in breast cancer patients with zero to three positive lymph nodes treated with BCT.

  12. The conserved DNA-binding domains encoded by the herpes simplex virus type 1 ICP4, pseudorabies virus IE180, and varicella-zoster virus ORF62 genes recognize similar sites in the corresponding promoters.

    PubMed Central

    Wu, C L; Wilcox, K W


    Herpes simplex virus types 1 and 2 (HSV-1 and HSV-2), pseudorabies virus (PRV), varicella-zoster virus (VZV), and equine herpesvirus 1 (EHV-1) are all classified as Alphaherpesvirinae. Each of these five viruses encodes an essential immediate-early (IE) regulatory protein referred to as HSV-1 ICP4, HSV-2 ICP4, PRV IE180, VZV ORF62 protein, and EHV-1 IE1, respectively. These five proteins share extensive homology with each other in domains referred to as regions 2 and 4. The HSV-1 ICP4 region 2 domain contains residues that are required for the DNA-binding capability of ICP4. In this report, we describe the expression of region 2 domains from the ICP4, IE180, and ORF62 genes as fusion proteins in Escherichia coli. DNA-binding assays revealed that each of these region 2 fusion proteins binds to a sequence that overlaps the transcription start site in the promoter for the gene encoding the corresponding protein. Each of the sites with high affinity for one or more of these fusion proteins contains the sequence 5'-ATCGT-3'. This sequence spans the mRNA cap site in the HSV-2 ICP4 gene promoter and is immediately upstream from the transcription start site in the EHV-1 IE1 gene. These results suggest that formation of a specific complex between an IE protein and its own gene promoter may be a common mechanism used by Alphaherpesvirinae to autoregulate transcription of an essential IE gene. Images PMID:1847444

  13. Merging Disparate Data Sources Into a Paleoanthropological Geodatabase for Research, Education, and Conservation in the Greater Hadar Region (Afar, Ethiopia)

    NASA Astrophysics Data System (ADS)

    Campisano, C. J.; Dimaggio, E. N.; Arrowsmith, J. R.; Kimbel, W. H.; Reed, K. E.; Robinson, S. E.; Schoville, B. J.


    relative importance of internal and external ecological, climatological, and tectonic forcings on evolutionary change in the fossil record. In close association with colleagues working in neighboring project areas, this work advances multidisciplinary and collaborative research, training, and long-range antiquities conservation in the Hadar region.

  14. Identification, characterization and phylogenic analysis of conserved genes within the p74 gene region of Choristoneura fumiferana granulovirus genome.


    Rashidan, Kianoush Khajeh; Nassoury, Nasha; Giannopoulos, Paresa N; Mauffette, Yves; Guertin, Claude


    The genes located within the p74 gene region of the Choristoneura fumiferana granulovirus (ChfuGV) were identified by sequencing an 8.9 kb BamHI restriction fragment on the ChfuGV genome. The global guanine-cytosine (GC) content of this region of the genome was 33.02%. This paper presents the ORFs within the p74 gene region along with their transcriptional orientations. This region contains a total of 15 open reading frames (ORFs). Among those, 8 ORFs were found to be homologues to the baculoviral ORFs: Cf-i-p , Cf-vi, Cf-vii, Cf-viii (ubiquitin), Cf-xi (pp31), Cf-xii (lef-11), Cf-xiii (sod) and Cf-xv-p (p74). To date, no specific function has been assigned to the ORFs: Cf-i, Cf-ii, Cf-iii, Cf-iv, Cf-v, Cf-vi, Cf-vii, Cf-ix and Cf-x. The most noticeable ORFs located in this region of the ChfuGV genome were ubiquitin, lef-11, sod, fibrillin and p74. The phylogenetic trees (constructed using conceptual products of major conserved ORFs) and gene arrangement in this region were used to further examine the classification of the members of the granulovirus genus. Comparative studies demonstrated that ChfuGV along with the Cydia pomonella granulovirus (CpGV), Phthorimaea operculella granulovirus (PhopGV), Adoxophyes orana granulovirus (AoGV) and Cryptophlebia leucotreta granulovirus (ClGV) share a high degree of amino acids sequence and gene arrangement preservation within the studied region. These results support a previous report, which classified a granuloviruses into 2 distinct groups: Group I: ChfuGV, CpGV, PhopGV and AoGV and Group II: Xestia c-nigrum granulovirus (XcGV) and Plutella xylostella granulovirus (PxGV). The phylogenetic and gene arrangement studies also placed ClGV as a novel member of the Group I granuloviruses.

  15. Comparative mapping of the DiGeorge syndrome region in mouse shows inconsistent gene order and differential degree of gene conservation.


    Botta, A; Lindsay, E A; Jurecic, V; Baldini, A


    We have constructed a comparative map in mouse of the critical region of human 22q11 deleted in DiGeorge (DGS) and Velocardiofacial (VCFS) syndromes. The map includes 11 genes potentially haploinsufficient in these deletion syndromes. We have localized all the conserved genes to mouse Chromosome (Chr) 16, bands B1-B3. The determination of gene order shows the presence of two regions (distal and proximal), containing two groups of conserved genes. The gene order in the two regions is not completely conserved; only in the proximal group is the gene order identical to human. In the distal group the gene order is inverted. These two regions are separated by a DNA segment containing at least one gene which, in the human DGS region, is the most proximal of the known deleted genes. In addition, the gene order within the distal group of genes is inverted relative to the human gene order. Furthermore, a clathrin heavy chain-like gene was not found in the mouse genome by DNA hybridization, indicating that there is an inconsistent level of gene conservation in the region. These and other independent data obtained in our laboratory clearly show a complex evolutionary history of the DGS-VCFS region. Our data provide a framework for the development of a mouse model for the 22q11 deletion with chromosome engineering technologies.

  16. Identification of Common Epitopes on a Conserved Region of NSs Proteins Among Tospoviruses of Watermelon silver mottle virus Serogroup.


    Chen, Tsung-Chi; Huang, Ching-Wen; Kuo, Yan-Wen; Liu, Fang-Lin; Yuan, Chao-Hsiu Hsuan; Hsu, Hei-Ti; Yeh, Shyi-Dong


    ABSTRACT The NSs protein of Watermelon silver mottle virus (WSMoV) was expressed by a Zucchini yellow mosaic virus (ZYMV) vector in squash. The expressed NSs protein with a histidine tag and an additional NIa protease cleavage sequence was isolated by Ni(2+)-NTA resins as a free-form protein and further eluted after sodium dodecyl sulfate-polyacrylamide gel electrophoresis for production of rabbit antiserum and mouse monoclonal antibodies (MAbs). The rabbit antiserum strongly reacted with the NSs crude antigen of WSMoV and weakly reacted with that of a high-temperature-recovered gloxinia isolate (HT-1) of Capsicum chlorosis virus (CaCV), but not with that of Calla lily chlorotic spot virus (CCSV). In contrast, the MAbs reacted strongly with all crude NSs antigens of WSMoV, CaCV, and CCSV. Various deletions of the NSs open reading frame were constructed and expressed by ZYMV vector. Results indicate that all three MAbs target the 89- to 125-amino-acid (aa) region of WSMoV NSs protein. Two indispensable residues of cysteine and lysine were essential for MAbs recognition. Sequence comparison of the deduced MAbs-recognized region with the reported tospoviral NSs proteins revealed the presence of a consensus sequence VRKPGVKNTGCKFTMHNQIFNPN (denoted WNSscon), at the 98- to 120-aa position of NSs proteins, sharing 86 to 100% identities among those of WSMoV, CaCV, CCSV, and Peanut bud necrosis virus. A synthetic WNSscon peptide reacted with the MAbs and verified that the epitopes are present in the 98- to 120-aa region of WSMoV NSs protein. The WSMoV sero-group-specific NSs MAbs provide a means for reliable identification of tospoviruses in this large serogroup.

  17. How many kilowatts are in a negawatt? Verifying ex post estimates of utility conservation impacts at the regional level

    SciTech Connect

    Parfomak, P.W.; Lave, L.B.


    Restructuring of utilities raises questions about the future of conservation programs. One of the greatest obstacles has been the persistent uncertainity among utility planners regarding true resource effectiveness and cost-effectiveness of conservation relative to conventional generation. The authors use econometric techniques to examine the aggregate commercial and industrial conservation impacts reported. The paper shows that utility conservation programs have been effective in reducing electric loads and that utilities have reported accurately. 44 refs., 3 tabs.

  18. Mutations of Conserved Residues in the Major Homology Region Arrest Assembling HIV-1 Gag as a Membrane-Targeted Intermediate Containing Genomic RNA and Cellular Proteins

    PubMed Central

    Tanaka, Motoko; Robinson, Bridget A.; Chutiraka, Kasana; Geary, Clair D.; Reed, Jonathan C.


    ABSTRACT The major homology region (MHR) is a highly conserved motif that is found within the Gag protein of all orthoretroviruses and some retrotransposons. While it is widely accepted that the MHR is critical for assembly of HIV-1 and other retroviruses, how the MHR functions and why it is so highly conserved are not understood. Moreover, consensus is lacking on when HIV-1 MHR residues function during assembly. Here, we first addressed previous conflicting reports by confirming that MHR deletion, like conserved MHR residue substitution, leads to a dramatic reduction in particle production in human and nonhuman primate cells expressing HIV-1 proviruses. Next, we used biochemical analyses and immunoelectron microscopy to demonstrate that conserved residues in the MHR are required after assembling Gag has associated with genomic RNA, recruited critical host factors involved in assembly, and targeted to the plasma membrane. The exact point of inhibition at the plasma membrane differed depending on the specific mutation, with one MHR mutant arrested as a membrane-associated intermediate that is stable upon high-salt treatment and other MHR mutants arrested as labile, membrane-associated intermediates. Finally, we observed the same assembly-defective phenotypes when the MHR deletion or conserved MHR residue substitutions were engineered into Gag from a subtype B, lab-adapted provirus or Gag from a subtype C primary isolate that was codon optimized. Together, our data support a model in which MHR residues act just after membrane targeting, with some MHR residues promoting stability and another promoting multimerization of the membrane-targeted assembling Gag oligomer. IMPORTANCE The retroviral Gag protein exhibits extensive amino acid sequence variation overall; however, one region of Gag, termed the major homology region, is conserved among all retroviruses and even some yeast retrotransposons, although the reason for this conservation remains poorly understood. Highly

  19. Quantifying the effects of conservation practices on soil, water, and nutrients in the Loess Mesa Ravine Region of the Loess Plateau, China.


    Xu, Xiang-Zhou; Li, Mei-Juan; Liu, Bin; Kuang, Shang-Fu; Xu, Shi-Guo


    A large number of soil and water conservation programs have been implemented on the Loess Plateau of China since the 1950s. To comprehensively assess the merits and demerits of the conservation practices is of great importance in further supervising the conservation strategy for the Loess Plateau. This study calculates the impact factors of conservation practices on soil, water, and nutrients during the period 1954-2004 in the Nanxiaohegou Catchment, a representative catchment in the Loess Mesa Ravine Region of the Loess Plateau, China. Brief conclusions could be drawn as follows: (1) Soil erosion and nutrient loss had been greatly mitigated through various conservation practices. About half of the total transported water and 94.8 % of the total transported soil and nutrients, had been locally retained in the selected catchment. The soil retained from small watersheds do not only form large-scale fertile farmland but also safeguard the Yellow River against overflow. (2) Check dam was the most appropriate conservation practice on the Loess Plateau. In the selected catchment, more than 90 % of the retained soil and water were accomplished by the dam farmland, although the dam farmland occupied only 2.3 % of the total area of all conservation measures. Retention abilities of the characteristic conservation practices were in the following order: dam farmland > terrace farmland > forest land and grassland. (3) The conservation practices were more powerful in retaining sediment than in reducing runoff from the Loess Plateau, and the negative effects of the conservation practices on reducing water to the Yellow River were relatively slight.

  20. In Silico Design and Experimental Validation of siRNAs Targeting Conserved Regions of Multiple Hepatitis C Virus Genotypes

    PubMed Central

    ElHefnawi, Mahmoud; Kim, TaeKyu; Kamar, Mona A.; Min, Saehong; Hassan, Nafisa M.; El-Ahwany, Eman; Kim, Heeyoung; Zada, Suher; Amer, Marwa; Windisch, Marc P.


    RNA interference (RNAi) is a post-transcriptional gene silencing mechanism that mediates the sequence-specific degradation of targeted RNA and thus provides a tremendous opportunity for development of oligonucleotide-based drugs. Here, we report on the design and validation of small interfering RNAs (siRNAs) targeting highly conserved regions of the hepatitis C virus (HCV) genome. To aim for therapeutic applications by optimizing the RNAi efficacy and reducing potential side effects, we considered different factors such as target RNA variations, thermodynamics and accessibility of the siRNA and target RNA, and off-target effects. This aim was achieved using an in silico design and selection protocol complemented by an automated MysiRNA-Designer pipeline. The protocol included the design and filtration of siRNAs targeting highly conserved and accessible regions within the HCV internal ribosome entry site, and adjacent core sequences of the viral genome with high-ranking efficacy scores. Off-target analysis excluded siRNAs with potential binding to human mRNAs. Under this strict selection process, two siRNAs (HCV353 and HCV258) were selected based on their predicted high specificity and potency. These siRNAs were tested for antiviral efficacy in HCV genotype 1 and 2 replicon cell lines. Both in silico-designed siRNAs efficiently inhibited HCV RNA replication, even at low concentrations and for short exposure times (24h); they also exceeded the antiviral potencies of reference siRNAs targeting HCV. Furthermore, HCV353 and HCV258 siRNAs also inhibited replication of patient-derived HCV genotype 4 isolates in infected Huh-7 cells. Prolonged treatment of HCV replicon cells with HCV353 did not result in the appearance of escape mutant viruses. Taken together, these results reveal the accuracy and strength of our integrated siRNA design and selection protocols. These protocols could be used to design highly potent and specific RNAi-based therapeutic oligonucleotide

  1. Characterizing stopover sites of migrating passerine birds in the lower Chesapeake Bay region for conservation: an integrated radar-habitat study

    USGS Publications Warehouse

    Mabey, S.; Watts, B.; Paxton, B.; Smith, F.; Truitt, B.; Dawson, D.


    Many conservation organizations and initiatives including Partners-in-Flight and the U.S. Fish and Wildlife Service's regional Joint Ventures have identified migratory songbird stopover habitat as a priority conservation target. However, the spatial and temporal variability inherent in migration presents a number of challenges to both identifying and characterizing stopover habitat. Scarce conservation resources further demand that stopover sites be classified on a scale of priority so that conservation action can proceed according to ecological value. We are applying weather surveillance radar data collected from the National Weather Service WSR-88D at Wakefield, VA, and NASA's Doppler radar, NPOL, in Oyster, VA, to identify passerine stopover sites in the lower Chesapeake Bay region and develop spatial models to characterize these sites based on relative migrant abundance and consistency of use between and within seasons. We are using the stopover patterns to generate hypotheses regarding the habitat, geographic, and stochastic factors contributing to the distribution of migrants at a regional scale. We are testing these hypotheses with detailed habitat data and ground surveys of migrating birds with the goal of creating a generalized prioritization system for stopover site conservation.

  2. Regional Management Units for Marine Turtles: A Novel Framework for Prioritizing Conservation and Research across Multiple Scales

    PubMed Central

    Wallace, Bryan P.; DiMatteo, Andrew D.; Hurley, Brendan J.; Finkbeiner, Elena M.; Bolten, Alan B.; Chaloupka, Milani Y.; Hutchinson, Brian J.; Abreu-Grobois, F. Alberto; Amorocho, Diego; Bjorndal, Karen A.; Bourjea, Jerome; Bowen, Brian W.; Dueñas, Raquel Briseño; Casale, Paolo; Choudhury, B. C.; Costa, Alice; Dutton, Peter H.; Fallabrino, Alejandro; Girard, Alexandre; Girondot, Marc; Godfrey, Matthew H.; Hamann, Mark; López-Mendilaharsu, Milagros; Marcovaldi, Maria Angela; Mortimer, Jeanne A.; Musick, John A.; Nel, Ronel; Pilcher, Nicolas J.; Seminoff, Jeffrey A.; Troëng, Sebastian; Witherington, Blair; Mast, Roderic B.


    Background Resolving threats to widely distributed marine megafauna requires definition of the geographic distributions of both the threats as well as the population unit(s) of interest. In turn, because individual threats can operate on varying spatial scales, their impacts can affect different segments of a population of the same species. Therefore, integration of multiple tools and techniques — including site-based monitoring, genetic analyses, mark-recapture studies and telemetry — can facilitate robust definitions of population segments at multiple biological and spatial scales to address different management and research challenges. Methodology/Principal Findings To address these issues for marine turtles, we collated all available studies on marine turtle biogeography, including nesting sites, population abundances and trends, population genetics, and satellite telemetry. We georeferenced this information to generate separate layers for nesting sites, genetic stocks, and core distributions of population segments of all marine turtle species. We then spatially integrated this information from fine- to coarse-spatial scales to develop nested envelope models, or Regional Management Units (RMUs), for marine turtles globally. Conclusions/Significance The RMU framework is a solution to the challenge of how to organize marine turtles into units of protection above the level of nesting populations, but below the level of species, within regional entities that might be on independent evolutionary trajectories. Among many potential applications, RMUs provide a framework for identifying data gaps, assessing high diversity areas for multiple species and genetic stocks, and evaluating conservation status of marine turtles. Furthermore, RMUs allow for identification of geographic barriers to gene flow, and can provide valuable guidance to marine spatial planning initiatives that integrate spatial distributions of protected species and human activities. In addition

  3. Identifying and Addressing Infrastructure Vulnerabilities Under Climate Change in Data-Scarce Regions: the Role of Conservation

    NASA Astrophysics Data System (ADS)

    Shortridge, J.; Guikema, S.


    Climate change is expected to have dramatic impacts on built infrastructure, particularly in the water resources sector where infrastructure tends to have long lifespans and performance is highly sensitive to climate conditions. However, adapting to water resources infrastructure to climate change is challenging due to the considerable uncertainty surrounding projections of future hydrologic conditions. This has prompted the development of a number of approaches aimed at supporting planning under "deep-uncertainty" which cannot be represented probabilistically. One such method is robust decision making (RDM), which uses simulation models to assess how systems perform over a wide range of future scenarios and identify vulnerable scenarios where system performance is unacceptable. With the Lake Tana basin in Ethiopia as a case study, we use an RDM analysis to assess the vulnerability of planned irrigation infrastructure to climate change and environmental uncertainties related to data limitations. We find that planned infrastructure is vulnerable not only to climate change, but also to poorly characterized environmental conditions today. This suggests areas for research that could provide important insights into the long-term sustainability and effectiveness of the planned projects. Additionally, we evaluate the degree to which methods such as irrigation efficiency and upstream land conservation can improve the long-term performance of the proposed infrastructure. In doing so, we demonstrate how robust decision frameworks can provide decision support in data-scarce regions where more complex modeling and analysis may be impractical.

  4. [Topsoil phosphorus forms and availability of different soil and water conservation plantations in typical black soil region, northeast China].


    Yang, Xiao-Yan; Fan, Rui-Ying; Wang, En-Heng; Xia, Xiang-You; Chen, Xiang-Wei


    Aiming to understand soil phosphorus status of plantations in typical black soil region of Northeast China, the topsoil (0-10 cm) phosphorus fractionations and its availability were examined in four soil and water conservation plantations dominantly composed of Larix gmelini, Fraxinus mandshurica, Pinus sylvestris var. mongolica and Populus nigra var. italica x P. cathayan, respectively. The results showed that total P, Olsen-P and the concentration of different P fractionations in F. mandshurica and P. nigra var. italica x P. cathayan plantations were significantly higher than that of the other two coniferous plantations. Organic P was the major fractionation in the four plantations' topsoil, and sodium hydroxide extractable organic P (NaOH-Po ) representing moderately labile organic phosphorus was predominant, which accounted for 58.9% of total P. The contents of H2O-Pi and NaHCO3-P which were more labile to plant were lower, only accounting for 1.2% and 6.6% of total P, respectively. Except for NaHCO3-Po, all the other P fractions of four plantations correlated with each other, and they also had significant correlations with soil organic matter, total P, Olsen-P. Compared with the coniferous plantations, the broadleaf plantations presented higher availability of phosphorus.

  5. Patterns in the bony skull development of marsupials: high variation in onset of ossification and conserved regions of bone contact

    PubMed Central

    Spiekman, Stephan N. F.; Werneburg, Ingmar


    Development in marsupials is specialized towards an extremely short gestation and highly altricial newborns. As a result, marsupial neonates display morphological adaptations at birth related to functional constraints. However, little is known about the variability of marsupial skull development and its relation to morphological diversity. We studied bony skull development in five marsupial species. The relative timing of the onset of ossification was compared to literature data and the ossification sequence of the marsupial ancestor was reconstructed using squared-change parsimony. The high range of variation in the onset of ossification meant that no patterns could be observed that differentiate species. This finding challenges traditional studies concentrating on the onset of ossification as a marker for phylogeny or as a functional proxy. Our study presents observations on the developmental timing of cranial bone-to-bone contacts and their evolutionary implications. Although certain bone contacts display high levels of variation, connections of early and late development are quite conserved and informative. Bones that surround the oral cavity are generally the first to connect and the bones of the occipital region are among the last. We conclude that bone contact is preferable over onset of ossification for studying cranial bone development. PMID:28233826

  6. Conserving biological diversity: A strategy for protected areas in the Asia-Pacific region. World Bank technical paper

    SciTech Connect

    Braatz, S.; Davis, G.; Shen, S.; Rees, C.


    The paper acknowledges the importance of biodiversity conservation and suggests that policy change coupled with the establishment of protected area systems will be critical to success. A wide range of interventions will be needed to support these efforts toward conserving biodiversity-interventions involving national and local governments, national and international nongovernmental organizations and, most importantly, local people. The strategy defined in the paper is intended to complement existing national and international initiatives and to build partnerships in conservation for the 1990s.

  7. A national geographic framework for guiding conservation on a landscape scale

    USGS Publications Warehouse

    Millard, Michael J.; Czarnecki, Craig A.; Morton, John M.; Brandt, Laura A.; Briggs, Jennifer S.; Shipley, Frank S.; Sayre, Roger G.; Sponholtz, Pamela J.; Perkins, David; Simpkins, Darin G.; Taylor, Janith


    The U.S. Fish and Wildlife Service, along with the global conservation community, has recognized that the conservation challenges of the 21st century far exceed the responsibilities and footprint of any individual agency or program. The ecological effects of climate change and other anthropogenic stressors do not recognize geopolitical boundaries and, as such, demand a national geographic framework to provide structure for cross-jurisdictional and landscape-scale conservation strategies. In 2009, a new map of ecologically based conservation regions in which to organize capacity and implement strategic habitat conservation was developed using rapid prototyping and expert elicitation by an interagency team of U.S. Fish and Wildlife Service and U.S. Geological Survey scientists and conservation professionals. Incorporating Bird Conservation Regions, Freshwater Ecoregions, and U.S. Geological Survey hydrologic unit codes, the new geographic framework provides a spatial template for building conservation capacity and focusing biological planning and conservation design efforts. The Department of Interior's Landscape Conservation Cooperatives are being organized in these new conservation regions as multi-stakeholder collaborations for improved conservation science and management.

  8. Sal k 4, a new allergen of Salsola kali, is profilin: a predictive value of conserved conformational regions in cross-reactivity with other plant-derived profilins.


    Assarehzadegan, Mohammad Ali; Amini, Akram; Sankian, Mojtaba; Tehrani, Mohsen; Jabbari, Farahzad; Varasteh, Abdolreza


    The aim of this study was to investigate a new allergen of Salsola kali, Sal k 4, and to investigate the predictive value of the conserved conformational regions in cross-reactivity with other plant-derived profilins. The Sal k 4-coding sequence was cloned, expressed, and purified by one-step Ni2+ affinity chromatography to recover high-purity target protein. We assessed cross-reactivity and predicted conserved conformational regions among rSal k 4 and other plant-derived profilins. Immunodetection and inhibition assays using 30 individual sera from S. kali allergic patients indicated that purified rSal k 4 might be the same as that in the crude extract. The results of inhibition assays among rSal k 4 and other plant-derived profilins were in accordance with the homology of the predicted conserved conformational regions. Amino acid sequence homology analysis showed that a high degree of IgE cross-reactivity among plant-derived profilins might depend on the predicted conserved conformational regions.

  9. Interferon gamma rapidly induces in human monocytes a DNA-binding factor that recognizes the gamma response region within the promoter of the gene for the high-affinity Fc gamma receptor.

    PubMed Central

    Wilson, K C; Finbloom, D S


    Interferon gamma (IFN-gamma) transcriptionally activates several early-response genes in monocytes that are important for the ultimate phenotype of the activated macrophage. One of these genes is the high-affinity Fc receptor for IgG (Fc gamma RI). Recently, Pearse et al. [Pearse, R.N., Feinman, R. & Ravetch, J. V. (1991) Proc. Natl. Acad. Sci. USA 88, 11305-11309] defined within the promoter region of the Fc gamma RI gene an element, the gamma response region, which was necessary for IFN-gamma-induced enhancement of Fc gamma RI. In this report we describe the induction by IFN-gamma of a DNA-binding factor, FcRF gamma (Fc gamma RI DNA-binding factor, IFN-gamma induced), that specifically recognizes the gamma response region element. Electrophoretic mobility shift assays (EMSAs) demonstrated the presence of FcRF gamma in human monocytes within 1 min after exposure to IFN-gamma. On EMSA, FcRF gamma consisted of two complexes termed FcRF gamma 1 and FcRF gamma 2. The nuclear concentration of FcRF gamma rapidly increased, peaked at 15 min, and then fell after 1-2 hr. Dose-response studies revealed (i) as little as 0.05 ng of IFN-gamma per ml induced FcRF gamma, (ii) maximum activation occurred at 1 ng/ml, and (iii) steady-state levels of Fc gamma RI mRNA closely paralleled that of FcRF gamma. Since FcRF gamma was activated in cells normally not expressing Fc gamma RI RNA, other regulatory mechanisms must control Fc gamma RI-restricted tissue expression. Activation of FcRF gamma by IFN-gamma was inhibited by pretreatment with 500 nM staurosporin and 25 microM phenyl arsine oxide. These data suggest that a kinase and possibly a phosphatase activity are required for IFN-gamma-induced signaling of FcRF gamma in monocytes. Images PMID:1334553

  10. Prioritizing conservation effort through the use of biological soil crusts as ecosystem function indicators in an arid region

    USGS Publications Warehouse

    Bowker, M.A.; Miller, M.E.; Belnap, J.; Sisk, T.D.; Johnson, N.C.


    Conservation prioritization usually focuses on conservation of rare species or biodiversity, rather than ecological processes. This is partially due to a lack of informative indicators of ecosystem function. Biological soil crusts (BSCs) trap and retain soil and water resources in arid ecosystems and function as major carbon and nitrogen fixers; thus, they may be informative indicators of ecosystem function. We created spatial models of multiple indicators of the diversity and function of BSCs (species richness, evenness, functional diversity, functional redundancy, number of rare species, number of habitat specialists, nitrogen and carbon fixation indices, soil stabilization, and surface roughening) for the 800,000-ha Grand Staircase-Escalante National Monument (Utah, U.S.A.). We then combined the indicators into a single BSC function map and a single BSC biodiversity map (2 alternative types of conservation value) with an unweighted averaging procedure and a weighted procedure derived from validations performance. We also modeled potential degradation with data from a rangeland assessment survey. To determine which areas on the landscape were the highest conservation priorities, we overlaid the function- and diversity-based conservation-value layers on the potential degradation layer. Different methods for ascribing conservation-value and conservation-priority layers all yielded strikingly similar results (r = 0.89-0.99), which suggests that in this case biodiversity and function can be conserved simultaneously. We believe BSCs can be used as indicators of ecosystem function in concert with other indicators (such as plant-community properties) and that such information can be used to prioritize conservation effort in drylands. ?? 2008 Society for Conservation Biology.

  11. Regional Extinctions and Quaternary Shifts in the Geographic Range of Lestodelphys halli, the Southernmost Living Marsupial: Clues for Its Conservation.


    Formoso, Anahí E; Martin, Gabriel M; Teta, Pablo; Carbajo, Aníbal E; Sauthier, Daniel E Udrizar; Pardiñas, Ulyses F J


    The Patagonian opossum (Lestodelphys halli), the southernmost living marsupial, inhabits dry and open environments, mainly in the Patagonian steppe (between ~32 °S and ~49 °S). Its rich fossil record shows its occurrence further north in Central Argentina during the Quaternary. The paleoenvironmental meaning of the past distribution of L. halli has been mostly addressed in a subjective framework without an explicit connection with the climatic "space" currently occupied by this animal. Here, we assessed the potential distribution of this species and the changes occurred in its geographic range during late Pleistocene-Holocene times and linked the results obtained with conservation issues. To this end, we generated three potential distribution models with fossil records and three with current ones, using MaxEnt software. These models showed a decrease in the suitable habitat conditions for the species, highlighting a range shift from Central-Eastern to South-Western Argentina. Our results support that the presence of L. halli in the Pampean region during the Pleistocene-Holocene can be related to precipitation and temperature variables and that its current presence in Patagonia is more related to temperature and dominant soils. The models obtained suggest that the species has been experiencing a reduction in its geographic range since the middle Holocene, a process that is in accordance with a general increase in moisture and temperature in Central Argentina. Considering the findings of our work and the future scenario of global warming projected for Patagonia, we might expect a harsh impact on the distribution range of this opossum in the near future.

  12. [Analysis of soil respiration and influence factors in wheat farmland under conservation tillage in southwest hilly region].


    Zhang, Sai; Zhang, Xiao-Yu; Wang, Long-Chang; Luo, Hai-Xiu; Zhou, Hang-Fei; Ma, Zhong-Lian; Zhang, Cui-Wei


    In order to investigate the effect of conservation tillage on soil respiration in dry cropping farmland in southwest purple hilly region, the LI6400-09 respiratory chamber was adopted in the experiment conducted in the experimental field in Southwest University in Beibei, Chongqing. The respiration and the hydrothermal and biotic factors of soil were measured and analyzed during the growth period of wheat in the triple intercropping system of wheat/maize/soybean. There were four treatments including T (traditional tillage), R (ridge tillage), TS (traditional tillage + straw mulching) and RS (ridge tillage + straw mulching), which were all in triplicates. The results indicated that the soil respiration rate changed in the range of 1.100-2.508 micromol x (m2 x s)(-1) during the reproductive growth stage of wheat. There were significant differences in soil respiration rate among different treatments, which could be ranked as RS > R > TS > T. The soil temperature in the 10cm layer was ranked as T > R > TS > RS. The relationship between soil respiration and soil temperature fitted well with an exponential function, in which the Q10 values were 1.25, 1.20, 1.31 and 1.26, respectively. The soil moisture in the 5cm layer was ranked as TS > RS > T > R. The best fitting model between soil moisture and soil respiration was a parabolic curve, indicating the presence of soil moisture with the strongest soil respiration. The response threshold of wheat to soil moisture was 14.80%-17.47% during the reproductive stage. The dominant groups of soil animals were Collembola and Acarina, which were correlated with soil respiration to some extent. The correlation was high in the treatments T and R, ranged from 0.669-0.921, whereas there was no remarkable correlation in the other treatments.

  13. A functional role for the conserved protonatable hairpins in the 5' untranslated region of turnip yellow mosaic virus RNA.

    PubMed Central

    Hellendoorn, K; Verlaan, P W; Pleij, C W


    The 5' untranslated region (UTR) of the RNA of several tymoviruses contains conserved hairpins with protonatable internal loops, consisting of C-C and C-A mismatches (K. Hellendoorn, P. J. A. Michiels, R. Buitenhuis, and C. W. A. Pleij, Nucleic Acids Res. 24, 4910-4917, 1996). Here, we present a functional analysis of the 5' UTR of turnip yellow mosaic virus (TYMV) RNA, which contains two protonatable hairpins with nearly identical internal loops. Mutations were introduced in an infectious cDNA clone, and T7 RNA transcripts were used to infect Chinese cabbage plants. Different symptoms were observed for the various mutants, pointing to a functional role of the C-C and C-A mismatches in the hairpins of the 5' UTR. The replication of the virus is influenced by the mutations made, while in vitro translation studies showed that the expression of the two overlapping reading frames of TYMV is not influenced by the secondary structure of the leader. Various mutants were propagated for up to five serial passages of infection, and the sequence of the 5' UTR was determined. This resulted in virus RNA with new non-wild-type sequences that produced the wild-type phenotype in infected plants. Remarkably, in all cases C-C or C-A mismatches were introduced. The internal loop of the 5'-proximal hairpin seems to be more important for the viral life cycle than that of the second hairpin. A deletion of 75% of the leader, including the two hairpins, resulted in a virus that was deficient in viral spread. Since the ratio between filled and empty capsids was changed drastically by this mutation, a role of the 5' UTR in viral packaging is proposed. PMID:9343237

  14. Regional Extinctions and Quaternary Shifts in the Geographic Range of Lestodelphys halli, the Southernmost Living Marsupial: Clues for Its Conservation

    PubMed Central

    Formoso, Anahí E.; Martin, Gabriel M.; Teta, Pablo; Carbajo, Aníbal E.; Sauthier, Daniel E. Udrizar; Pardiñas, Ulyses F. J.


    The Patagonian opossum (Lestodelphys halli), the southernmost living marsupial, inhabits dry and open environments, mainly in the Patagonian steppe (between ~32°S and ~49°S). Its rich fossil record shows its occurrence further north in Central Argentina during the Quaternary. The paleoenvironmental meaning of the past distribution of L. halli has been mostly addressed in a subjective framework without an explicit connection with the climatic “space” currently occupied by this animal. Here, we assessed the potential distribution of this species and the changes occurred in its geographic range during late Pleistocene-Holocene times and linked the results obtained with conservation issues. To this end, we generated three potential distribution models with fossil records and three with current ones, using MaxEnt software. These models showed a decrease in the suitable habitat conditions for the species, highlighting a range shift from Central-Eastern to South-Western Argentina. Our results support that the presence of L. halli in the Pampean region during the Pleistocene-Holocene can be related to precipitation and temperature variables and that its current presence in Patagonia is more related to temperature and dominant soils. The models obtained suggest that the species has been experiencing a reduction in its geographic range since the middle Holocene, a process that is in accordance with a general increase in moisture and temperature in Central Argentina. Considering the findings of our work and the future scenario of global warming projected for Patagonia, we might expect a harsh impact on the distribution range of this opossum in the near future. PMID:26203650

  15. Autoantibody germ-line gene segment encodes V{sub H} and V{sub L} regions of a human anti-streptococcal monoclonal antibody recognizing streptococcal M protein and human cardiac myosin epitopes

    SciTech Connect

    Quinn, A.; Cunningham, M.W.; Adderson, E.E.


    Cross-reactivity of anti-streptococcal Abs with human cardiac myosin may result in sequelae following group A streptococcal infections. Molecular mimicry between group A streptococcal M protein and cardiac myosin may be the basis for the immunologic cross-reactivity. In this study, a cross-reactive human anti-streptococcal/antimyosin mAb (10.2.3) was characterized, and the myosin epitopes were recognized by the Ab identified. mAb 10.2.3 reacted with four peptides from the light meromyosin (LMM) tail fragment of human cardiac myosin, including LMM-10 (1411-1428), LMM-23 (1580-1597), LMM-27 (1632-1649), and LMM-30 (1671-1687). Only LMM-30 inhibited binding of mAb 10.2.3 to streptococcal M protein and human cardiac myosin. Human mAb 10.2.3 labeled cytoskeletal structures within rat heart cells in indirect immunofluorescence, and reacted with group A streptococci expressing various M protein serotypes, PepM5, and recombinant M protein. The nucleotide sequence of gene segments encoding the Ig heavy and light chain V region of mAb 10.2.3 was determined. The light chain V segment was encoded by a VK1 gene segment that was 98.5% identical with germ-line gene humig{sub K}Vi5. The V segment of the heavy chain was encoded by a V{sub H}3a gene segment that differed from the V{sub H}26 germ-line gene by a single base change. V{sub H}26 is expressed preferentially in early development and encodes autoantibodies with anti-DNA and rheumatoid factor specificities. Anti-streptococcal mAb 10.2.3 is an autoantibody encoded by V{sub H} and V{sub L} genes, with little or no somatic mutation. 63 refs., 11 figs.

  16. Loco-regional control after neo-adjuvant chemotherapy and conservative treatment for locally advanced breast cancer patients.


    Levy, Antonin; Borget, Isabelle; Bahri, Manel; Arnedos, Monica; Rivin, Eleonor; Vielh, Philippe; Balleyguier, Corinne; Rimareix, Françoise; Bourgier, Céline


    Breast-conserving treatment (BCT) has been validated for breast cancer patients receiving adjuvant chemotherapy. Our objective was to evaluate the difference in loco-regional recurrence (LRR) rates between BCT and mastectomy in patients receiving radiation therapy after neo-adjuvant chemotherapy (NCT). A retrospective data base was used to identify all patients with breast cancer undergoing NCT from 2002 to 2007. Patients with initial metastatic disease were excluded from this analysis. LRR was compared between those undergoing BCT and mastectomy. Individual variables associated with LRR were evaluated. Two hundred eighty-four patients were included, 111 (39%) underwent BCT and 173 (61%) mastectomy. Almost all patients (99%) in both groups received postoperative radiation. Pathologic complete response was seen in 37 patients, of which 28 underwent BCT (p < 0.001). Patients receiving mastectomy had more invasive lobular carcinoma (p = 0.007) and a higher American Joint Committee on Cancer (AJCC) stage (p < 0.001) at diagnosis than those with BCT. At a median follow-up of 6.3 years, the loco-regional control rate was 91% (95% CI: 86-94%). The 10-year LRR rate was similar in the BCT group (9.2% [95% CI: 4.9-16.7%]) and in the mastectomy group (10.7% [95% CI: 5.9-15.2%]; p = 0.8). Ten-year overall survival (OS) rates (63% [95% CI: 46-79%] in the BCT group; 60% [95% CI: 47-73%] in the mastectomy group, p = 0.8) were not statistically different between the two patient populations. Multivariate analysis showed that AJCC stage ≥ III (HR: 2.6; 95% CI: 1.2-5.8; p = 0.02), negative PR (HR: 6; 95% CI: 1.2-30.6, p = 0.03), and number of positive lymph nodes ≥3 (HR: 2.5; 95% CI: 1.1-5.9; p = 0.03) were independent predictors of LRR. Ten-year OS was similar in the BCT and in the mastectomy group (p = 0.1). The rate of LRR was low and did not significantly differ between the BCT and the mastectomy group after NCT. Randomized trials assessing whether mastectomy can be safely

  17. Impact of the Conservation Reserve Program on duck recruitment in the U.S. Prairie Pothole Region

    USGS Publications Warehouse

    Reynolds, Ronald E.; Shaffer, Terry L.; Renner, Randy W.; Newton, Wesley E.; Batt, Bruce D.J.


    The U.S. Department of Agriculture (USDA)'s Conservation Reserve Program (CRP) resulted in the conversion of about 1.9 million ha of cropland to perennial grass cover in the Prairie Pothole Region of North Dakota, South Dakota, and northeastern Montana by 1992. Many wildlife managers believed this cover would provide benefits to wildlife, including upland nesting ducks. During 1992-1995, we evaluated success of 5 duck species nesting in CRP fields and nearby Waterfowl Production Areas (WPA) throughout the region. We examined relationships between daily survival rates (DSR) of duck nests in CRP cover and landscape-level habitat and population parameters. We computed DSR of duck nests in other major cover types in our study area from data collected during 1980-1984 (pre-CRP) and 1990-1994 (CRP) periods. We then applied recruitment models to estimate duck production in our study area during peak CRP years (1992-1997) and compared these results with those that simulated the scenario in which cropland was in place of CRP cover (i.e., the CRP had not occurred). DSR were higher in all habitats combined during the CRP period compared to the pre-CRP period. Regressions of DSR in CRP cover on the percent of each study plot in perennial cover and geographic location were significant (P < 0.01) for 4 of 5 duck (Anas spp.) species. Estimated nest success and recruitment rates for the 5 species combined during 1992-1997 were 46% and 30% higher, respectively, with CRP cover on the landscape compared to a scenario where we simulated cropland in place of CRP. Our model estimated an additional 12.4 million recruits from our study area to the fall flight as a consequence of the CRP during 1992-1997. Our results document benefits to 5 duck species in the northern plains associated with a farm program that provided financial incentives to landowners for planting undisturbed grass cover as an alternative to annual crops.

  18. Alignment of U3 region sequences of mammalian type C viruses: identification of highly conserved motifs and implications for enhancer design.

    PubMed Central

    Golemis, E A; Speck, N A; Hopkins, N


    We aligned published sequences for the U3 region of 35 type C mammalian retroviruses. The alignment reveals that certain sequence motifs within the U3 region are strikingly conserved. A number of these motifs correspond to previously identified sites. In particular, we found that the enhancer region of most of the viruses examined contains a binding site for leukemia virus factor b, a viral corelike element, the consensus motif for nuclear factor 1, and the glucocorticoid response element. Most viruses containing more than one copy of enhancer sequences include these binding sites in both copies of the repeat. We consider this set of binding sites to constitute a framework for the enhancers of this set of viruses. Other highly conserved motifs in the U3 region include the retrovirus inverted repeat sequence, a negative regulatory element, and the CCAAT and TATA boxes. In addition, we identified two novel motifs in the promoter region that were exceptionally highly conserved but have not been previously described. PMID:2153223

  19. Regional estimates of ecological services derived from U.S. Department of Agriculture conservation programs in the Mississippi Alluvial Valley

    USGS Publications Warehouse

    Faulkner, Stephen P.; Baldwin, Michael J.; Barrow, Wylie C.; Waddle, Hardin; Keeland, Bobby D.; Walls, Susan C.; James, Dale; Moorman, Tom


    The degree to which these conservation practices can restore ecosystem functions and services is not well known. This project was initiated to quantify existing ecological services derived from USDA conservation practices in the MAV as part of the USDA Conservation Effects Assessment Project, Wetlands Component (CEAP-Wetlands). The U.S. Geological Survey (USGS), in collaboration with the USDA Natural Resources Conservation Service, the USDA Farm Service Agency, the U.S. Fish and Wildlife Service, and Ducks Unlimited, collected data on soils, vegetation, nitrogen cycling, migratory birds, and amphibians from 88 different sites between 2006 and 2008. Results from restored WRP sites were compared to baseline data from active agricultural cropland (AG) to evaluate changes in ecosystem services.

  20. Red states, blue states, and divorce: understanding the impact of conservative Protestantism on regional variation in divorce rates.


    Glass, Jennifer; Levchak, Philip


    Why do states with larger proportions of religious conservatives have higher divorce rates than states with lower proportions of religious conservatives? This project examines whether earlier transitions to marriage and parenthood among conservative Protestants (known risk factors for divorce) contribute to this paradox while attending to other plausible explanations. County-level demographic information from all 50 states is combined from a variety of public data sources and merged with individual records from the National Surveys of Family Growth to estimate both aggregated county and multilevel individual models of divorce. Results show that individual religious conservatism is positively related to individual divorce risk, solely through the earlier transitions to adulthood and lower incomes of conservative Protestants. However, the proportion of conservative Protestants in a county is also independently and positively associated with both the divorce rate in that county and an individual's likelihood of divorcing. The earlier family formation and lower levels of educational attainment and income in counties with a higher proportion of conservative Protestants can explain a substantial portion of this association. Little support is found for alternative explanations of the association between religious conservatism and divorce rates, including the relative popularity of marriage versus cohabitation across counties.

  1. A pilot study to investigate the role of the 26S proteasome in radiotherapy resistance and loco-regional recurrence following breast conserving therapy for early breast cancer.


    Elfadl, Dalia; Hodgkinson, Victoria C; Long, Ervine D; Scaife, Lucy; Drew, Philip J; Lind, Michael J; Cawkwell, Lynn


    Breast conserving therapy is a currently accepted method for managing patients with early stage breast cancer. However, approximately 7% of patients may develop loco-regional tumour recurrence within 5 years. We previously reported that expression of the 26S proteasome may be associated with radio-resistance. Here we aimed to analyse the 26S proteasome in a pilot series of early breast cancers and correlate the findings with loco-regional recurrence. Fourteen patients with early breast cancer who developed loco-regional recurrence within 4 years of completing breast conserving therapy were selected according to strict criteria and compared with those from 14 patients who were disease-free at 10 years. Decreased expression of the 26S proteasome was significantly associated with radio-resistance, manifested as the development of a loco-regional recurrence within 4 years of breast conserving therapy (p = 0.018). This small pilot study provides further suggestion that the 26S proteasome may be associated with response to radiotherapy.

  2. A conserved and essential basic region mediates tRNA binding to the Elp1 subunit of the Saccharomyces cerevisiae Elongator complex.


    Di Santo, Rachael; Bandau, Susanne; Stark, Michael J R


    Elongator is a conserved, multi-protein complex discovered in Saccharomyces cerevisiae, loss of which confers a range of pleiotropic phenotypes. Elongator in higher eukaryotes is required for normal growth and development and a mutation in the largest subunit of human Elongator (Elp1) causes familial dysautonomia, a severe recessive neuropathy. Elongator promotes addition of mcm(5) and ncm(5) modifications to uridine in the tRNA anticodon 'wobble' position in both yeast and higher eukaryotes. Since these modifications are required for the tRNAs to function efficiently, a translation defect caused by hypomodified tRNAs may therefore underlie the variety of phenotypes associated with Elongator dysfunction. The Elp1 carboxy-terminal domain contains a highly conserved arginine/lysine-rich region that resembles a nuclear localization sequence (NLS). Using alanine substitution mutagenesis, we show that this region is essential for Elongator's function in tRNA wobble uridine modification. However, rather than acting to determine the nucleo-cytoplasmic distribution of Elongator, we find that the basic region plays a critical role in a novel interaction between tRNA and the Elp1 carboxy-terminal domain. Thus the conserved basic region in Elp1 may be essential for tRNA wobble uridine modification by acting as tRNA binding motif.

  3. Construction of attenuated Salmonella typhimurium Strain expressing Helicobacter pylori conservative region of adhesin antigen and its immunogenicity

    PubMed Central

    Bai, Yang; Zhang, Ya-Li; Wang, Ji-De; Zhang, Zhao-Shan; Zhou, Dian-Yuan


    AIM: To construct a non-resistant and attenuated Salmonella typhimurium (S. typhimurium) strain which expresses conservative region of adhesion AB of Helicobacter pylori (H pylori) and evaluate its immunogenicity. METHODS: The AB gene amplified by PCR was inserted into the expression vector pYA248 containing asd gene and through two transformations introduced into the delta Cya, delta Crp, delta Asd attenuated Salmonella typhimurium strain, constructing balanced lethal attenuated Salmonella typhimurium strains X4072 (pYA248-AB). Bridged ELISA method was used to measure the expression of AB antigen in sonicate and culture supernatant. According to the method described by Meacock, stability of the recombinant was evaluated. Semi-lethal capacity test was used to evaluate the safety of recombinant. The immunogenicity of recombinant was evaluated with animal experiments. RESULTS: The attenuated S. typhimurium X4072 (pYA248-AB) which expresses AB was successfully constructed. Furthermore, bridged ELISA assay showed that the content of AB in recombinant X4072 (pYA248- AB) culture supernatant was higher than that was in thallus lytic liquor. And after recombinant X4072 (pYA248- AB) was cultured for 100 generations without selection pressure, the entire recombinant bacteria selected randomly could grow, and the AB antigen was defected positive by ELISA. The growth curve of the recombinant bacteria showed that the growth states of X4072 (pYA248) and X4072 (pYA248-AB) were basically consistent. The survival rate of C57BL/6 was still 100%, at 30 d after mice taking X4072 (pYA248-AB) 1.0 × 1010 cfu orally. Oral immunization of mice with X4072 (pYA248-AB) induced a specific immune response. CONCLUSION: In vitro recombinant plasmid appears to be stable and experiments on animals showed that the recombinant strains were safe and immunogenic in vitro, which providing a new live oral vaccine candidate for protection and care of H pylori infection. PMID:15300892

  4. Staphylococcus aureus protein A binding to von Willebrand factor A1 domain is mediated by conserved IgG binding regions.


    O'Seaghdha, Maghnus; van Schooten, Carina J; Kerrigan, Steven W; Emsley, Jonas; Silverman, Gregg J; Cox, Dermot; Lenting, Peter J; Foster, Timothy J


    Protein A (Spa) is a surface-associated protein of Staphylococcus aureus best known for its ability to bind to the Fc region of IgG. Spa also binds strongly to the Fab region of the immunoglobulins bearing V(H)3 heavy chains and to von Willebrand factor (vWF). Previous studies have suggested that the protein A-vWF interaction is important in S. aureus adherence to platelets under conditions of shear stress. We demonstrate that Spa expression is sufficient for adherence of bacteria to immobilized vWF under low fluid shear. The full length recombinant Ig-binding region of protein A, Spa-EDABC, fused to glutathione-S-transferase (GST), bound recombinant vWF in a dose-dependent and saturable fashion with half maximal binding of about 30 nm in immunosorbent assays. Full length-Spa did not bind recombinant vWF A3 domain but displayed binding to recombinant vWF domains A1 and D'-D3 (half maximal binding at 100 nm and 250 nm, respectively). Each recombinant protein A Ig-binding domain bound to the A1 domain in a similar manner to the full length-Spa molecule (half maximal binding 100 nm). Amino acid substitutions were introduced in the GST-SpaD protein at sites known to be involved in IgG Fc or in V(H)3 Fab binding. Mutants altered in residues that recognized IgG Fc but not those that recognized V(H)3 Fab had reduced binding to vWF A1 and D'-D3. This indicated that both vWF regions recognized a region on helices I and II that overlapped the IgG Fc binding site.

  5. The X chromosome of monotremes shares a highly conserved region with the eutherian and marsupial X chromosomes despite the absence of X chromosome inactivation

    SciTech Connect

    Watson, J.M.; Spencer, J.A.; Graves, J.A.M. ); Riggs, A.D. )


    Eight genes, located on the long arm of the human X chromosome and present on the marsupial X chromosome, were mapped by in situ hybridization to the chromosomes of the platypus Ornithorhynchus anatinus, one of the three species of monotreme mammals. All were located on the X chromosome. The authors conclude that the long arm of the human X chromosome represents a highly conserved region that formed part of the X chromosome in a mammalian ancestor at least 150 million years ago. Since three of these genes are located on the long arm of the platypus X chromosome, which is G-band homologous to the Y chromosome and apparently exempt from X chromosome inactivation, the conservation of this region has evidently not depended on isolation by X-Y chromosome differentiation and X chromosome inactivation.

  6. The highly conserved aspartic acid residue between hypervariable regions 1 and 2 of human immunodeficiency virus type 1 gp120 is important for early stages of virus replication.

    PubMed Central

    Wang, W K; Essex, M; Lee, T H


    Between hypervariable regions V1 and V2 of human immunodeficiency virus type 1 (HIV-1) gp120 lies a cluster of relatively conserved residues. The contribution of nine charged residues in this region to virus infectivity was evaluated by single-amino-acid substitutions in an infectious provirus clone. Three of the HIV-1 mutants studied had slower growth kinetics than the wild-type virus. The delay was most pronounced in a mutant with an alanine substituted for an aspartic acid residue at position 180. This aspartic acid is conserved by all HIV-1 isolates with known nucleotide sequences. Substitutions with three other residues at this position, including a negatively charged glutamic acid, all affected virus infectivity. The defect identified in these mutants suggests that this aspartic acid residue is involved in the early stages of HIV-1 replication. PMID:7983752

  7. An evolutionary conserved region (ECR) in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex

    PubMed Central


    Background Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs), in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1) supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a) a strong enhancer that functions in neurons and b) a transcription factor that may modulate the function of that enhancer. PMID:21599953

  8. Note: Utilization of polymer gel as a bolus compensator and a dosimeter in the near-surface buildup region for breast-conserving therapy

    NASA Astrophysics Data System (ADS)

    Fuse, Hiraku; Shinoda, Kazuya; Inohira, Masaya; Kawamura, Hiraku; Miyamoto, Katsumi; Sakae, Takeji; Fujisaki, Tatsuya


    Tangential beam radiotherapy is routinely used for radiation therapy after breast conserving surgery. A tissue-equivalent bolus placed on the irradiated area shifts the depth of the dose distribution; this bolus provides uniform dose distribution to the breast. The gel bolus made by the BANG-Pro® polymer gel and in an oxygen non-transmission pack was applicable as a dosimeter to measure dose distribution in near-surface buildup region. We validated the use of the gel bolus to improve in the whole-breast/chest wall, including the near-surface buildup region.

  9. Note: Utilization of polymer gel as a bolus compensator and a dosimeter in the near-surface buildup region for breast-conserving therapy

    SciTech Connect

    Fuse, Hiraku Inohira, Masaya; Kawamura, Hiraku; Fujisaki, Tatsuya; Shinoda, Kazuya; Miyamoto, Katsumi; Sakae, Takeji


    Tangential beam radiotherapy is routinely used for radiation therapy after breast conserving surgery. A tissue-equivalent bolus placed on the irradiated area shifts the depth of the dose distribution; this bolus provides uniform dose distribution to the breast. The gel bolus made by the BANG-Pro{sup ®} polymer gel and in an oxygen non-transmission pack was applicable as a dosimeter to measure dose distribution in near-surface buildup region. We validated the use of the gel bolus to improve in the whole-breast/chest wall, including the near-surface buildup region.

  10. NemaFootPrinter: a web based software for the identification of conserved non-coding genome sequence regions between C. elegans and C. briggsae

    PubMed Central

    Rambaldi, Davide; Guffanti, Alessandro; Morandi, Paolo; Cassata, Giuseppe


    Background NemaFootPrinter (Nematode Transcription Factor Scan Through Philogenetic Footprinting) is a web-based software for interactive identification of conserved, non-exonic DNA segments in the genomes of C. elegans and C. briggsae. It has been implemented according to the following project specifications: a) Automated identification of orthologous gene pairs. b) Interactive selection of the boundaries of the genes to be compared. c) Pairwise sequence comparison with a range of different methods. d) Identification of putative transcription factor binding sites on conserved, non-exonic DNA segments. Results Starting from a C. elegans or C. briggsae gene name or identifier, the software identifies the putative ortholog (if any), based on information derived from public nematode genome annotation databases. The investigator can then retrieve the genome DNA sequences of the two orthologous genes; visualize graphically the genes' intron/exon structure and the surrounding DNA regions; select, through an interactive graphical user interface, subsequences of the two gene regions. Using a bioinformatics toolbox (Blast2seq, Dotmatcher, Ssearch and connection to the rVista database) the investigator is able at the end of the procedure to identify and analyze significant sequences similarities, detecting the presence of transcription factor binding sites corresponding to the conserved segments. The software automatically masks exons. Discussion This software is intended as a practical and intuitive tool for the researchers interested in the identification of non-exonic conserved sequence segments between C. elegans and C. briggsae. These sequences may contain regulatory transcriptional elements since they are conserved between two related, but rapidly evolving genomes. This software also highlights the power of genome annotation databases when they are conceived as an open resource and the possibilities offered by seamless integration of different web services via the http

  11. [Identification of new conserved and variable regions in the 16S rRNA gene of acetic acid bacteria and acetobacteraceae family].


    Chakravorty, S; Sarkar, S; Gachhui, R


    The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well.

  12. Ecosystem Services Derived from Wetland Conservation Practices in the United States Prairie Pothole Region with an Emphasis on the U.S. Department of Agriculture Conservation Reserve and Wetlands Reserve Programs

    USGS Publications Warehouse

    Gleason, Robert A.; Laubhan, Murray K.; Euliss, Ned H.


    Implementation of the U.S. Department of Agriculture (USDA) Conservation Reserve Program (CRP) and Wetlands Reserve Program (WRP) has resulted in the restoration of approximately 2,200,000 ha (5,436,200 acres) of wetland and grassland habitats in the Prairie Pothole Region. These restored habitats are known to provide various ecosystem services; however, little work has been conducted to quantify and verify benefits on program lands (lands enrolled in the CRP and WRP) in agriculturally dominated landscapes of the Prairie Pothole Region. To address this need, the U.S. Geological Survey (USGS), in collaboration with the USDA Farm Service Agency and Natural Resources Conservation Service, initiated a study to develop and apply approaches to quantify changes in ecosystem services resulting from wetland restoration activities funded by the USDA. To accomplish this goal, the USGS conducted a comprehensive, stratified survey of 204 catchments (wetland and surrounding uplands contributing runoff to the wetland) in 1997 and 270 catchments in 2004 to gather data necessary for estimating various ecosystem services. In 1997 and 2004, the surveys included catchments with seasonal and semipermanent wetlands that were restored as part of USDA conservation programs, as well as nonprogram catchments in native prairie. Additionally, in 2004 data collection was expanded to include temporary wetlands for all treatments and nonprogram cropped catchments for all wetland classes: temporary, seasonal, and semipermanent. A key element in the sample design is that catchments span an alteration gradient ranging from highly altered, such as cropland, to minimally altered, such as native prairie. Therefore, we evaluated restoration programs by comparing changes in program (restored) catchments to nonprogram (cropland and native prairie) catchments. Information collected during both surveys included easily measured soil, vegetation, and morphological variables that were used to estimate the

  13. Utility of Clinical Breast Exams in Detecting Local-Regional Breast Events after Breast-Conservation in Women with a Personal History of High-risk Breast Cancer

    PubMed Central

    Neuman, Heather B.; Schumacher, Jessica R.; Francescatti, Amanda B.; Adesoye, Taiwo; SB, Edge; ES, Burnside; DJ, Vanness; M, Yu; Y, Si; D, McKellar; DP, Winchester; Greenberg, Caprice C.


    Introduction Although breast cancer follow-up guidelines emphasize the importance of clinical exams, prior studies suggest a small fraction of local-regional events occurring after breast conservation are detected by exam alone. Our objective was to examine how local-regional events are detected in a contemporary, national cohort of high-risk breast cancer survivors. Methods A stage-stratified sample of stage II/III breast cancer patients diagnosed in 2006-2007 (n=11,099) were identified from 1,217 facilities within the National Cancer Data Base. Additional data on local-regional and distant breast events, method of event detection, imaging received, and mortality was collected. We further limited the cohort to patients with breast conservation (n=4,854). Summary statistics describe local-regional event rates and detection method. Results Local-regional events were detected in 5.5% (n=265). 83% were ipsilateral or contralateral in-breast events, and 17% within ipsilateral lymph nodes. 48% of local-regional events were detected on asymptomatic breast imaging, 29% by patients, and 10% on clinical exam. Overall, 0.5% of the 4,854 patients had a local-regional event detected on exam. Exams detected a higher proportion of lymph node (8/45) compared to in-breast events (18/220). No factors were associated with method of event detection. Discussion Clinical exams, as an adjunct to screening mammography, have a modest effect on local-regional event detection. This contradicts current belief that exams are a critical adjunct to mammographic screening. These findings can help to streamline follow-up care, potentially improving follow-up efficiency and quality. PMID:27491784

  14. Effects of Long-term Conservation Tillage on Soil Nutrients in Sloping Fields in Regions Characterized by Water and Wind Erosion

    NASA Astrophysics Data System (ADS)

    Tan, Chunjian; Cao, Xue; Yuan, Shuai; Wang, Weiyu; Feng, Yongzhong; Qiao, Bo


    Conservation tillage is commonly used in regions affected by water and wind erosion. To understand the effects of conservation tillage on soil nutrients and yield, a long-term experiment was set up in a region affected by water and wind erosion on the Loess Plateau. The treatments used were traditional tillage (CK), no tillage (NT), straw mulching (SM), plastic-film mulching (PM), ridging and plastic-film mulching (RPM) and intercropping (In). Our results demonstrate that the available nutrients in soils subjected to non-traditional tillage treatments decreased during the first several years and then remained stable over the last several years of the experiment. The soil organic matter and total nitrogen content increased gradually over 6 years in all treatments except CK. The nutrient content of soils subjected to conservative tillage methods, such as NT and SM, were significantly higher than those in soils under the CK treatment. Straw mulching and film mulching effectively reduced an observed decrease in soybean yield. Over the final 6 years of the experiment, soybean yields followed the trend RPM > PM > SM > NT > CK > In. This trend has implications for controlling soil erosion and preventing non-point source pollution in sloping fields by sacrificing some food production.

  15. Identification of Cis-regulatory elements in the mouse Pax9/Nkx2-9 genomic region: implication for evolutionary conserved synteny.

    PubMed Central

    Santagati, Fabio; Abe, Kuniya; Schmidt, Volker; Schmitt-John, Thomas; Suzuki, Misao; Yamamura, Ken-Ichi; Imai, Kenji


    We previously reported close physical linkage between Pax9 and Nkx2-9 in the human, mouse, and pufferfish (Fugu rubripes) genomes. In this study, we analyzed cis-regulatory elements of the two genes by comparative sequencing in the three species and by transgenesis in the mouse. We identified two regions including conserved noncoding sequences that possessed specific enhancer activities for expression of Pax9 in the medial nasal process and of Nkx2-9 in the ventral neural tube. Remarkably, the latter contained the consensus Gli-binding motif. Interestingly, the identified Pax9 cis-regulatory sequences were located in an intron of the neighboring gene Slc25a21. Close examination of an extended genomic interval around Pax9 revealed the presence of strong synteny conservation in the human, mouse, and Fugu genomes. We propose such an intersecting organization of cis-regulatory sequences in multigenic regions as a possible mechanism that maintains evolutionary conserved synteny. PMID:14504231

  16. Effects of Long-term Conservation Tillage on Soil Nutrients in Sloping Fields in Regions Characterized by Water and Wind Erosion

    PubMed Central

    Tan, Chunjian; Cao, Xue; Yuan, Shuai; Wang, Weiyu; Feng, Yongzhong; Qiao, Bo


    Conservation tillage is commonly used in regions affected by water and wind erosion. To understand the effects of conservation tillage on soil nutrients and yield, a long-term experiment was set up in a region affected by water and wind erosion on the Loess Plateau. The treatments used were traditional tillage (CK), no tillage (NT), straw mulching (SM), plastic-film mulching (PM), ridging and plastic-film mulching (RPM) and intercropping (In). Our results demonstrate that the available nutrients in soils subjected to non-traditional tillage treatments decreased during the first several years and then remained stable over the last several years of the experiment. The soil organic matter and total nitrogen content increased gradually over 6 years in all treatments except CK. The nutrient content of soils subjected to conservative tillage methods, such as NT and SM, were significantly higher than those in soils under the CK treatment. Straw mulching and film mulching effectively reduced an observed decrease in soybean yield. Over the final 6 years of the experiment, soybean yields followed the trend RPM > PM > SM > NT > CK > In. This trend has implications for controlling soil erosion and preventing non-point source pollution in sloping fields by sacrificing some food production. PMID:26621049

  17. Effects of Long-term Conservation Tillage on Soil Nutrients in Sloping Fields in Regions Characterized by Water and Wind Erosion.


    Tan, Chunjian; Cao, Xue; Yuan, Shuai; Wang, Weiyu; Feng, Yongzhong; Qiao, Bo


    Conservation tillage is commonly used in regions affected by water and wind erosion. To understand the effects of conservation tillage on soil nutrients and yield, a long-term experiment was set up in a region affected by water and wind erosion on the Loess Plateau. The treatments used were traditional tillage (CK), no tillage (NT), straw mulching (SM), plastic-film mulching (PM), ridging and plastic-film mulching (RPM) and intercropping (In). Our results demonstrate that the available nutrients in soils subjected to non-traditional tillage treatments decreased during the first several years and then remained stable over the last several years of the experiment. The soil organic matter and total nitrogen content increased gradually over 6 years in all treatments except CK. The nutrient content of soils subjected to conservative tillage methods, such as NT and SM, were significantly higher than those in soils under the CK treatment. Straw mulching and film mulching effectively reduced an observed decrease in soybean yield. Over the final 6 years of the experiment, soybean yields followed the trend RPM > PM > SM > NT > CK > In. This trend has implications for controlling soil erosion and preventing non-point source pollution in sloping fields by sacrificing some food production.

  18. A conserved region in the Closterovirus 1a polyprotein drives extensive remodeling of endoplasmic reticulum membranes and induces motile globules in Nicotiana benthamiana cells.


    Gushchin, V A; Karlin, D G; Makhotenko, A V; Khromov, A V; Erokhina, T N; Solovyev, A G; Morozov, S Yu; Agranovsky, A A


    In infected plant cells, closterovirus replicative polyproteins 1a and 1ab drive membrane remodeling and formation of multivesicular replication platforms. Polyprotein 1a contains a variable Central Region (CR) between the methyltransferase and helicase domains. In a previous study, we have found that transient expression of the Beet yellows virus CR-2 segment (aa 1305-1494) in Nicotiana benthamiana induces the formation of ~1µm mobile globules originating from the ER membranes. In the present study, sequence analysis has shown that a part of the CR named the "Zemlya region" (overlapping the CR-2), is conserved in all members of the Closterovirus genus and contains a predicted amphipathic helix (aa 1368-1385). By deletion analysis, the CR-2 region responsible for the induction of 1-μm globules has been mapped to aa 1368-1432. We suggest that the conserved membrane-modifying region of the BYV 1a may be involved in the biogenesis of closterovirus replication platforms.

  19. Recognizing the adolescent drug abuser.


    MacKenzie, R G; Jacobs, E A


    Adolescents are at high risk for using and abusing illicit drugs. Guidelines for recognizing drug abusers are presented as well as a staging process for progression of drug use. The family physician is in an ideal position to identify young users/abusers and to assist them and their families in obtaining much needed assistance.

  20. Recognizing Prefixes in Scientific Quantities

    ERIC Educational Resources Information Center

    Sokolowski, Andrzej


    Although recognizing prefixes in physical quantities is inherent for practitioners, it might not be inherent for students, who do not use prefixes in their everyday life experiences. This deficiency surfaces in AP Physics exams. For example, readers of an AP Physics exam reported "a common mistake of incorrectly converting nanometers to…

  1. Threats, conservation strategies, and prognosis for suckers (Catostomidae) in North America: insights from regional case studies of a diverse family of non-game fishes

    USGS Publications Warehouse

    Cooke, Steven J.; Bunt, Christopher M.; Hamilton, Steven J.; Jennings, Cecil A.; Pearson, Micheal P.; Cooperman, Micheal S.; Markle, Douglas F.


    Catostomid fishes are a diverse family of 76+ freshwater species that are distributed across North America in many different habitats. This group of fish is facing a variety of impacts and conservation issues that are somewhat unique relative to more economically valuable and heavily managed fish species. Here, we present a brief series of case studies to highlight the threats such as migration barriers, flow regulation, environmental contamination, habitat degradation, exploitation and impacts from introduced (non-native) species that are facing catostomids in different regions. Collectively, the case studies reveal that individual species usually are not threatened by a single, isolated factor. Instead, species in general face numerous stressors that threaten multiple stages of their life history. Several factors have retarded sucker conservation including widespread inabilities of field workers to distinguish some species, lack of basic natural history and ecological knowledge of life history, and the misconception that suckers are tolerant of degraded conditions and are of little social or ecological value. Without a specific constituent group lobbying for conservation of non-game fishes, all such species, including members of the catostomid family, will continue to face serious risks because of neglect, ignorance, and misunderstanding. We suggest that conservation strategies should incorporate research and education/outreach components. Other conservation strategies that would be effective for protecting suckers include freshwater protected areas for critical habitat, restoration of degraded habitat, and design of catostomid-friendly fish bypass facilities. We believe that the plight of the catostomids is representative of the threats facing many other non-game freshwater fishes with diverse life-history strategies globally.

  2. Identification, characterization and phylogenic analysis of conserved genes within the odvp-6e/odv-e56 gene region of Choristoneura fumiferana granulovirus.


    Rashidan, Kianoush Khajeh; Nassoury, Nasha; Giannopoulos, Paresa N; Mauffette, Yves; Guertin, Claude


    The genes that are located within the odvp-6e/odv-e56 region of the Choristoneura fumiferana granulovirus (ChfuGV) were identified by sequencing the 11 kb BamHI restriction fragment on the ChfuGV genome. The global GC content that was calculated from the data obtained from this genomic region was 34.96%. The open-reading frames (ORFs), located within the odvp-6e/odv-e56 region, are presented and compared to the equivalent ORFs that are located at the same region in other GVs. This region is composed of 14 ORFs, including three ORFs that are unique to ChfuGV with no obvious homologues in other baculoviruses as well as eleven ORFs with homologues to granuloviral ORFs, such as granulin, CfORF2, pk-1, ie-1, odv-e18, p49, and odvp-6e/odv-e56. In this study, the conceptual products of seven major conserved ORFs (granulin, CfORF2, IE-1, ODV-E18, p49 and ODVP-6E/ODV-E56) were used in order to construct phylogenetic trees. Our results show that granuloviruses can be grouped in 2 distinct groups as follows: Group I; Choristoneura fumiferana granulovirus (ChfuGV), Cydia pomonella granulovirus (CpGV), Phthorimaea operculella granulovirus (PhopGV), and Adoxophyes orana granulovirus (AoGV). Group II; Xestia c-nigrum granulovirus (XcGV), Plutella xylostella granulovirus (PxGV), and Trichoplusia ni granulovirus (TnGV). The ChfuGV conserved proteins are most closely related to those of CpGV, PhopGV, and AoGV. Comparative studies, performed on gene arrangements within this region of genomes, demonstrated that three GVs from group I maintain similar gene arrangements.

  3. EPA Recognizes Comcast-Spectacor for Environmental Achievements

    EPA Pesticide Factsheets

    PHILADELPHIA (February 18, 2015) - Before the Philadelphia Flyers-Columbus Blue Jackets game Tuesday night, EPA Regional Administrator Shawn M. Garvin recognized Comcast-Spectacor, owners and operators of the Wells Fargo Center and Philadelphia Flye

  4. Recognizing Prefixes in Scientific Quantities

    NASA Astrophysics Data System (ADS)

    Sokolowski, Andrzej


    Although recognizing prefixes in physical quantities is inherent for practitioners, it might not be inherent for students, who do not use prefixes in their everyday life experiences. This deficiency surfaces in AP Physics exams. For example, readers of an AP Physics exam reported "a common mistake of incorrectly converting nanometers to meters." Similar students' mistakes were reported also by AP Chemistry readers "as in previous years, students still had difficulty converting kJ to J." While traditional teaching focuses on memorizing the symbols of prefixes, little attention is given to helping learners recognize a prefix in a given quantity. I noticed in my teaching practice that by making the processes of identifying prefixes more explicit, students make fewer mistakes on unit conversion. Thus, this paper presents an outline of a lesson that focuses on prefix recognition. It is designed for a first-year college physics class; however, its key points can be addressed to any group of physics students.

  5. Sequences of conserved region in the A subunit of DNA gyrase from nine species of the genus Mycobacterium: phylogenetic analysis and implication for intrinsic susceptibility to quinolones.


    Guillemin, I; Cambau, E; Jarlier, V


    The sequences of a conserved region in the A subunit of DNA gyrase corresponding to the quinolone resistance-determining region were determined for nine mycobacterial species and were compared. Although the nucleotide sequences were highly conserved, they clearly differentiated one species from another. The results of the phylogenetic analysis based on the sequences of the quinolone resistance-determining regions were compared with those provided by the 16S rRNA sequences. Deduced amino acid sequences were identical within the nine species except for amino acid 83, which was frequently involved in acquired resistance to quinolones in many genera, including mycobacteria. The presence at position 83 of an alanine for seven mycobacterial species (M. tuberculosis, M. bovis BCG, M. leprae, M. avium, M. kansasii, M. chelonae, and M. smegmatis) and of a serine for the two remaining mycobacterial species (M. fortuitum and M. aurum) correlated well with the MICs of ofloxacin for both groups of species, suggesting the role of this residue in intrinsic susceptibility to quinolones in mycobacteria.

  6. Movement patterns of Antillean manatees in Chetumal Bay (Mexico) and coastal Belize: A challenge for regional conservation

    USGS Publications Warehouse

    Castelblanco-Martínez, Delma Nataly; Padilla-Saldivar, J.; Hernández-Arana, Héctor Abuid; Slone, D.H.; Reid, J.P.; Morales-Vela, B.


    Information from 15 satellite-tracked Antillean manatees (Trichechus manatus manatus) was analyzed in order to assess individual movements, home ranges, and high-use areas for conservation decisions. Manatees were captured in Chetumal Bay, Mexico, and tagged with Argos-monitored satellite transmitters. Location of the manatees and physical characteristics were assessed to describe habitat properties. Most manatees traveled to freshwater sources. The Maximum Area Size (MAS) for each manatee was determined using the observation-area method. Additional kernel densities of 95% home range and 50% Center of Activity (COA) were also calculated, with manatees having 1–3 COAs. Manatees exhibited two different movement patterns: remaining in Chetumal Bay, and long-distance (up to 240 km in 89 d). The residence time in Chetumal Bay was higher for females (89.6% of time) than for males (72.0%), but the daily travel rate (0.4–0.5 km/d) was similar for both sexes. Most of the COAs fell within Natural Protected Areas (NPA). However, manatees also travel for long distances into unprotected areas, where they face uncontrolled boat traffic, fishing activities, and habitat loss. Conservation of movement corridors may promote long-distance movements and facilitate genetic exchange.

  7. Comparison of orthologous and paralogous DNA flanking the wheat high molecular weight glutenin genes: sequence conservation and divergence, transposon distribution, and matrix-attachment regions.


    Anderson, O D; Larka, L; Christoffers, M J; McCue, K F; Gustafson, J P


    Extended flanking DNA sequences were characterized for five members of the wheat high molecular weight (HMW) glutenin gene family to understand more of the structure, control, and evolution of these genes. Analysis revealed more sequence conservation among orthologous regions than between paralogous regions, with differences mainly owing to transposition events involving putative retrotransposons and several miniature inverted transposable elements (MITEs). Both gyspy-like long terminal repeat (LTR) and non-LTR retrotransposon sequences are represented in the flanking DNAs. One of the MITEs is a novel class, but another MITE is related to the maize Stowaway family and is widely represented in Triticeae express sequence tags (ESTs). Flanking DNA of the longest sequence, a 20 425-bp fragment including and surrounding the HMW-glutenin Bx7 gene, showed additional cereal gene-like sequences both immediately 5' and 3' to the HMW-glutenin coding region. The transcriptional activities of sequences related to these flanking putative genes and the retrotransposon-related regions were indicated by matches to wheat and other Triticeae ESTs. Predictive analysis of matrix-attachment regions (MARs) of the HMW glutenin and several alpha-, gamma-, and omega-gliadin flanking DNAs indicate potential MARs immediately flanking each of the genes. Matrix binding activity in the predicted regions was confirmed for two of the HMW-glutenin genes.

  8. Regional recurrence in breast cancer patients with one to three positive axillary lymph nodes treated with breast-conserving surgery and whole breast irradiation

    PubMed Central

    Hirata, Kimiko; Yoshimura, Michio; Inoue, Minoru; Yamauchi, Chikako; Ogura, Masakazu; Toi, Masakazu; Suzuki, Eiji; Takeuchi, Megumi; Takada, Masahiro; Hiraoka, Masahiro


    Radiotherapy with breast-conserving therapy plays a crucial role in the treatment of early breast cancer. However, optimal radiotherapy targets have been controversial. We therefore evaluated regional recurrence in breast cancer patients with one to three positive lymph nodes (LNs) treated with breast-conserving surgery (BCS) followed by whole-breast irradiation (WBI). From 1993 to 2010, 121 breast cancer patients with one to three positive LNs who underwent BCS followed by WBI were analyzed. All patients underwent radiotherapy with two tangential fields to the whole breast. To evaluate the radiation dose to the axillary LNs, we contoured axillary LNs area and evaluated the dose–volumetric parameters. The median follow-up time was 112.4 months (range, 15.6–248.1 months). The 5-year overall survival and disease-free survival rates were 95.6% and 86.6%, respectively. The 5-year regional recurrence–free rate (RRFR) was 97.4%. During follow-up, six patients had regional recurrence. The pathological T stage was the factor best associated with the 5-year RRFR using the log-rank test, with 100.0% in the pT1 cohort versus 94.7% in the pT2–4 cohort (P < 0.01). The radiation dose to the axillary LNs did not contribute to the RRFR. In conclusion, while the pathological T stage was the prognostic factor best associated with regional recurrence, few regional recurrences were observed in early breast cancer patients with one to three LNs treated with BCS followed by WBI. Unintentional radiation doses to the axillary LNs using standard WBI were not related to the RRFR after axillary dissection. PMID:27422931

  9. Priming of CD4+ T cells specific for conserved regions of human immunodeficiency virus glycoprotein gp120 in humans immunized with a recombinant envelope protein.

    PubMed Central

    Abrignani, S; Montagna, D; Jeannet, M; Wintsch, J; Haigwood, N L; Shuster, J R; Steimer, K S; Cruchaud, A; Staehelin, T


    A nonglycosylated denatured form of human immunodeficiency virus (HIV) 1 glycoprotein gp120 (Env 2-3), which does not bind to CD4, was used with muramyl tripeptide as adjuvant to immunize HIV-seronegative healthy volunteers. In all the volunteers, three 50-micrograms injections of Env 2-3 induced priming of CD4+ T cells specific for conserved regions of the native glycosylated gp120. Moreover, we found that several major histocompatibility complex class II (DR) alleles can function as restriction molecules for presentation of conserved epitopes of gp120 to T cells, implying that a T-cell response to these epitopes can be obtained in a large fraction of the population. The possibility to prime CD4+ T cells specific for conserved epitopes of a HIV protein is particularly important in view of the lack of such cells in HIV-infected individuals and of a possible role that CD4+ T cells may play in the development of protective immunity against AIDS. PMID:1696717

  10. 36 CFR 242.11 - Regional advisory councils.

    Code of Federal Regulations, 2010 CFR


    ... by substantial evidence, be consistent with recognized principles of fish and wildlife conservation... subsistence taking and uses of fish and wildlife resources on public lands. The Regional Councils shall... public meetings related to subsistence uses of fish and wildlife within their respective regions,...

  11. Rice pseudomolecule-anchored cross-species DNA sequence alignments indicate regional genomic variation in expressed sequence conservation

    PubMed Central

    Armstead, Ian; Huang, Lin; King, Julie; Ougham, Helen; Thomas, Howard; King, Ian


    Background Various methods have been developed to explore inter-genomic relationships among plant species. Here, we present a sequence similarity analysis based upon comparison of transcript-assembly and methylation-filtered databases from five plant species and physically anchored rice coding sequences. Results A comparison of the frequency of sequence alignments, determined by MegaBLAST, between rice coding sequences in TIGR pseudomolecules and annotations vs 4.0 and comprehensive transcript-assembly and methylation-filtered databases from Lolium perenne (ryegrass), Zea mays (maize), Hordeum vulgare (barley), Glycine max (soybean) and Arabidopsis thaliana (thale cress) was undertaken. Each rice pseudomolecule was divided into 10 segments, each containing 10% of the functionally annotated, expressed genes. This indicated a correlation between relative segment position in the rice genome and numbers of alignments with all the queried monocot and dicot plant databases. Colour-coded moving windows of 100 functionally annotated, expressed genes along each pseudomolecule were used to generate 'heat-maps'. These revealed consistent intra- and inter-pseudomolecule variation in the relative concentrations of significant alignments with the tested plant databases. Analysis of the annotations and derived putative expression patterns of rice genes from 'hot-spots' and 'cold-spots' within the heat maps indicated possible functional differences. A similar comparison relating to ancestral duplications of the rice genome indicated that duplications were often associated with 'hot-spots'. Conclusion Physical positions of expressed genes in the rice genome are correlated with the degree of conservation of similar sequences in the transcriptomes of other plant species. This relative conservation is associated with the distribution of different sized gene families and segmentally duplicated loci and may have functional and evolutionary implications. PMID:17708759

  12. Energy Conservation Simplified

    ERIC Educational Resources Information Center

    Hecht, Eugene


    The standard formulation of energy conservation involves the subsidiary ideas of kinetic energy ("KE"), work ("W"), thermal energy, internal energy, and a half-dozen different kinds of potential energy ("PE"): elastic, chemical, nuclear, gravitational, and so forth. These quantities came to be recognized during the centuries over which the…

  13. Conservation potential of agricultural water conservation subsidies

    NASA Astrophysics Data System (ADS)

    Huffaker, Ray


    A current policy subsidizes farmers to invest in improved on-farm irrigation efficiency, expecting water to be conserved off farm. Contrary to expectation, water has been increasingly depleted in some regions after such improvements. This paper investigates the policy's failure to conserve water consistently by (1) formulating an economic model of irrigated crop production to determine a profit-maximizing irrigator's range of responses to a subsidy and (2) embedding these responses into hypothetical streamflow diagrams to ascertain their potential to conserve water under various hydrologic regimes. Testable hypotheses are developed to predict the conservation potential of a subsidy in real-world application.

  14. Bacillus thuringiensis insecticidal Cry1Aa toxin binds to a highly conserved region of aminopeptidase N in the host insect leading to its evolutionary success.


    Nakanishi, K; Yaoi, K; Shimada, N; Kadotani, T; Sato, R


    Bacillus thuringiensis insecticidal protein, Cry1Aa toxin, binds to a specific receptor in insect midguts and has insecticidal activity. Therefore, the structure of the receptor molecule is probably a key factor in determining the binding affinity of the toxin and insect susceptibility. The cDNA fragment (PX frg1) encoding the Cry1Aa toxin-binding region of an aminopeptidase N (APN) or an APN family protein from diamondback moth, Plutella xylostella midgut was cloned and sequenced. A comparison between the deduced amino acid sequence of PX frg1 and other insect APN sequences shows that Cry1Aa toxin binds to a highly conserved region of APN family protein. In this paper, we propose a model to explain the mechanism that causes B. thuringiensis evolutionary success and differing insect susceptibility to Cry1Aa toxin.

  15. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.


    Pappu, H R; Druffel, K L


    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus.

  16. Conservation in the first internal transcribed spacer region (ITS1) in Hematodinium species infecting crustacean hosts found in the UK and Newfoundland.


    Small, H J; Shields, J D; Moss, J A; Reece, K S


    Parasitic dinoflagellates in the genus Hematodinium infect a number of decapod crustaceans in waters off the UK, including the Norway lobster Nephrops norvegicus and the edible crab Cancer pagurus. This study investigated sequence variability in the first internal transcribed spacer (ITS1) region of the ribosomal RNA complex of Hematodinium spp. infecting N. norvegicus, C. pagurus, and Pagurus bernhardus from 4 locations in the UK and from the Hematodinium sp. infecting Chionoecetes opilio from the province of Newfoundland and Labrador, Canada. Phylogenetic analysis of the Hematodinium ITS1 sequences from N. norvegicus, C. pagurus, P. bernhardus and C. opilio suggest that these crustaceans are infected with the same species of Hematodinium. Length variability of the ITS1 region was observed (324 to 345 bp) and attributed to 4 variable microsatellite regions (CATG)n' (GCC)nTCCGC(TG)n' (TA)n' and (GAA)n(GGA)n within the sequenced ITS1 fragment. The observed variation may be due to co-infection of the host crustacean with several different strains of Hematodinium or differences among copies of ITS1 region within the genome of a single parasite cell. The Hematodinium ITS1 sequence from N. norvegicus, C. pagurus, P. bernhardus and C. opilio isolates was sufficiently conserved in primer binding regions targeted by previous molecular diagnostic assays; therefore, we suggest that this assay could be used to screen for Hematodinium infections in these crustacean hosts.

  17. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E


    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  18. Global Conservation Priorities for Marine Turtles

    PubMed Central

    Wallace, Bryan P.; DiMatteo, Andrew D.; Bolten, Alan B.; Chaloupka, Milani Y.; Hutchinson, Brian J.; Abreu-Grobois, F. Alberto; Mortimer, Jeanne A.; Seminoff, Jeffrey A.; Amorocho, Diego; Bjorndal, Karen A.; Bourjea, Jérôme; Bowen, Brian W.; Briseño Dueñas, Raquel; Casale, Paolo; Choudhury, B. C.; Costa, Alice; Dutton, Peter H.; Fallabrino, Alejandro; Finkbeiner, Elena M.; Girard, Alexandre; Girondot, Marc; Hamann, Mark; Hurley, Brendan J.; López-Mendilaharsu, Milagros; Marcovaldi, Maria Angela; Musick, John A.; Nel, Ronel; Pilcher, Nicolas J.; Troëng, Sebastian; Witherington, Blair; Mast, Roderic B.


    Where conservation resources are limited and conservation targets are diverse, robust yet flexible priority-setting frameworks are vital. Priority-setting is especially important for geographically widespread species with distinct populations subject to multiple threats that operate on different spatial and temporal scales. Marine turtles are widely distributed and exhibit intra-specific variations in population sizes and trends, as well as reproduction and morphology. However, current global extinction risk assessment frameworks do not assess conservation status of spatially and biologically distinct marine turtle Regional Management Units (RMUs), and thus do not capture variations in population trends, impacts of threats, or necessary conservation actions across individual populations. To address this issue, we developed a new assessment framework that allowed us to evaluate, compare and organize marine turtle RMUs according to status and threats criteria. Because conservation priorities can vary widely (i.e. from avoiding imminent extinction to maintaining long-term monitoring efforts) we developed a “conservation priorities portfolio” system using categories of paired risk and threats scores for all RMUs (n = 58). We performed these assessments and rankings globally, by species, by ocean basin, and by recognized geopolitical bodies to identify patterns in risk, threats, and data gaps at different scales. This process resulted in characterization of risk and threats to all marine turtle RMUs, including identification of the world's 11 most endangered marine turtle RMUs based on highest risk and threats scores. This system also highlighted important gaps in available information that is crucial for accurate conservation assessments. Overall, this priority-setting framework can provide guidance for research and conservation priorities at multiple relevant scales, and should serve as a model for conservation status assessments and priority-setting for

  19. Sequence of a cDNA encoding the bi-specific NAD(P)H-nitrate reductase from the tree Betula pendula and identification of conserved protein regions.


    Friemann, A; Brinkmann, K; Hachtel, W


    Nitrate reductase (NR) assays revealed a bispecific NAD(P)H-NR (EC to be the only nitrate-reducing enzyme in leaves of hydroponically grown birches. To obtain the primary structure of the NAD(P)H-NR, leaf poly(A)+ mRNA was used to construct a cDNA library in the lambda gt11 phage. Recombinant clones were screened with heterologous gene probes encoding NADH-NR from tobacco and squash. A 3.0 kb cDNA was isolated which hybridized to a 3.2 kb mRNA whose level was significantly higher in plants grown on nitrate than in those grown on ammonia. The nucleotide sequence of the cDNA comprises a reading frame encoding a protein of 898 amino acids which reveals 67%-77% identity with NADH-nitrate reductase sequences from higher plants. To identify conserved and variable regions of the multicentre electron-transfer protein a graphical evaluation of identities found in NR sequence alignments was carried out. Thirteen well-conserved sections exceeding a size of 10 amino acids were found in higher plant nitrate reductases. Sequence comparisons with related redox proteins indicate that about half of the conserved NR regions are involved in cofactor binding. The most striking difference in the birch NAD(P)H-NR sequence in comparison to NADH-NR sequences was found at the putative pyridine nucleotide binding site. Southern analysis indicates that the bi-specific NR is encoded by a single copy gene in birch.

  20. A highly conserved sequence associated with the HIV gp41 loop region is an immunomodulator of antigen-specific T cells in mice.


    Ashkenazi, Avraham; Faingold, Omri; Kaushansky, Nathali; Ben-Nun, Avraham; Shai, Yechiel


    Modulation of T-cell responses by HIV occurs via distinct mechanisms, 1 of which involves inactivation of T cells already at the stage of virus-cell fusion. Hydrophobic portions of the gp41 protein of the viral envelope that contributes to membrane fusion may modulate T-cell responsiveness. Here we found a highly conserved sequence (termed "ISLAD") that is associated with the membranotropic gp41 loop region. We showed that ISLAD has the ability to bind the T-cell membrane and to interact with the T-cell receptor (TCR) complex. Furthermore, ISLAD inhibited T-cell proliferation and interferon-γ secretion that resulted from TCR engagement through antigen-presenting cells. Moreover, administering ISLAD (10 µg per mouse) to an experimental autoimmune encephalomyelitis (EAE) model of multiple sclerosis reduced the severity of the disease. This was related to the inhibition of pathogenic T-cell proliferation and to reduced pro-inflammatory cytokine secretion in the lymph nodes of ISLAD-treated EAE mice. The data suggest that T-cell inactivation by HIV during membrane fusion may lie in part in this conserved sequence associated with the gp41 loop region.

  1. Results of the global conservation assessment of the freshwater crabs (Brachyura, Pseudothelphusidae and Trichodactylidae): The Neotropical region, with an update on diversity

    PubMed Central

    Cumberlidge, Neil; Alvarez, Fernando; Villalobos, Jose-Luis


    Abstract The freshwater crabs of the Neotropics comprise 311 species in two families (Pseudothelphusidae and Trichodactylidae) and one or both of these families are found in all of the countries in the Neotropical region (except for Chile and some of the Caribbean islands). Colombia (102 species, 81% endemic) and Mexico (67 species, 95% endemic) are the biodiversity hotspots of freshwater crab species richness and country-level endemism for this region. The results of the IUCN Red List conservation assessments show that 34% of pseudothelphusids and 10% of trichodactylids have an elevated risk of extinction, 29% of pseudothelphusids and 75% of trichodactylids are not at-risk (Least Concern), and although none are actually extinct, 56% of pseudothelphusids and 17% of trichodactylids are too poorly known to assess (Data Deficient). Colombia (14 species), Venezuela (7 species), Mexico (6 species), and Ecuador (5 species) are the countries with the highest number of threatened species of Neotropical freshwater crabs. The majority of threatened species are restricted-range semiterrestrial endemics living in habitats subjected to deforestation, alteration of drainage patterns, and pollution. This underlines the need to prioritize and develop conservation measures before species decline to levels from which they cannot recover. These results represent a baseline that can be used to design strategies to save threatened Neotropical species of freshwater crabs. PMID:25561834

  2. Results of the global conservation assessment of the freshwater crabs (Brachyura, Pseudothelphusidae and Trichodactylidae): The Neotropical region, with an update on diversity.


    Cumberlidge, Neil; Alvarez, Fernando; Villalobos, Jose-Luis


    The freshwater crabs of the Neotropics comprise 311 species in two families (Pseudothelphusidae and Trichodactylidae) and one or both of these families are found in all of the countries in the Neotropical region (except for Chile and some of the Caribbean islands). Colombia (102 species, 81% endemic) and Mexico (67 species, 95% endemic) are the biodiversity hotspots of freshwater crab species richness and country-level endemism for this region. The results of the IUCN Red List conservation assessments show that 34% of pseudothelphusids and 10% of trichodactylids have an elevated risk of extinction, 29% of pseudothelphusids and 75% of trichodactylids are not at-risk (Least Concern), and although none are actually extinct, 56% of pseudothelphusids and 17% of trichodactylids are too poorly known to assess (Data Deficient). Colombia (14 species), Venezuela (7 species), Mexico (6 species), and Ecuador (5 species) are the countries with the highest number of threatened species of Neotropical freshwater crabs. The majority of threatened species are restricted-range semiterrestrial endemics living in habitats subjected to deforestation, alteration of drainage patterns, and pollution. This underlines the need to prioritize and develop conservation measures before species decline to levels from which they cannot recover. These results represent a baseline that can be used to design strategies to save threatened Neotropical species of freshwater crabs.

  3. Conservation of the Conformation and Positive Charges of Hepatitis C Virus E2 Envelope Glycoprotein Hypervariable Region 1 Points to a Role in Cell Attachment

    PubMed Central

    Penin, François; Combet, Christophe; Germanidis, Georgios; Frainais, Pierre-Olivier; Deléage, Gilbert; Pawlotsky, Jean-Michel


    Chronic hepatitis C virus (HCV) infection is a major cause of liver disease. The HCV polyprotein contains a hypervariable region (HVR1) located at the N terminus of the second envelope glycoprotein E2. The strong variability of this 27-amino-acid region is due to its apparent tolerance of amino acid substitutions together with strong selection pressures exerted by anti-HCV immune responses. No specific function has so far been attributed to HVR1. However, its presence at the surface of the viral particle suggests that it might be involved in viral entry. This would imply that HVR1 is not randomly variable. We sequenced 460 HVR1 clones isolated at various times from six HCV-infected patients receiving alpha interferon therapy (which exerts strong pressure towards quasispecies genetic evolution) and analyzed their amino acid sequences together with those of 1,382 nonredundant HVR1 sequences collected from the EMBL database. We found that (i) despite strong amino acid sequence variability related to strong pressures towards change, the chemicophysical properties and conformation of HVR1 were highly conserved, and (ii) HVR1 is a globally basic stretch, with the basic residues located at specific sequence positions. This conservation of positively charged residues indicates that HVR1 is involved in interactions with negatively charged molecules such as lipids, proteins, or glycosaminoglycans (GAGs). As with many other viruses, possible interaction with GAGs probably plays a role in host cell recognition and attachment. PMID:11356980

  4. The impact of the number of excised axillary nodes and of the percentage of involved nodes on regional nodal failure in patients treated by breast-conserving surgery with or without regional irradiation

    SciTech Connect

    Fortin, Andre . E-mail:; Dagnault, Anne; Blondeau, Lucie; Thi Trinh Thuc Vu; Larochelle, Marie


    Purpose: After breast-conserving surgery, recommendations for regional nodal radiotherapy are usually based on the number of positive nodes. This number is dependent on the number of nodes removed during the axillary dissection. This study examines whether the percentage of positive nodes may help to select patients for regional radiotherapy. Methods and Materials: A retrospective study was conducted on 1,372 T1-T2 node-positive breast cancer patients treated at L'Hotel-Dieu de Quebec Hospital between 1972 and 1997. Results: Among the patients who did not receive regional radiotherapy, the percentage of involved nodes was significantly associated with axillary failure. Ten-year axillary control rates were 97% and 91% when the percentage of involved nodes was <50% and {>=}50%, respectively (p = 0.007). In addition, regional radiotherapy is always significantly associated with a decrease in overall regional failure (axillary and/or supraclavicular), regardless of the percentage of involved nodes. However, regional radiotherapy reduced the axillary failure rate (2% vs. 9%, p = 0.007) only when more than a specific percentage of nodes was involved ({>=}40% if N1-3 and {>=}50% if N>3 nodes). Conclusions: The percentage of involved nodes should be taken into consideration in selecting patients for regional radiotherapy. Irradiation of the axilla should be reserved for patients with a specific ratio: >40% involved nodes if N1-3 and {>=}50% involved nodes if N>3 nodes.

  5. Memorandum about Regional Certifications Made During the Resource Conservation and Recovery Act (RCRA) Subtitle C State Program Revision Authorization Process

    EPA Pesticide Factsheets

    During last year’s RCRA Senior Policy Managers Meeting in Kansas City, there was a discussion regarding the certifications that are made by the Regions during the State Authorization Revision process. The result of this discussion was a general agreement.

  6. A census of glutamine/asparagine-rich regions: Implications for their conserved function and the prediction of novel prions

    PubMed Central

    Michelitsch, Melissa D.; Weissman, Jonathan S.


    Glutamine/asparagine (Q/N)-rich domains have a high propensity to form self-propagating amyloid fibrils. This phenomenon underlies both prion-based inheritance in yeast and aggregation of a number of proteins involved in human neurodegenerative diseases. To examine the prevalence of this phenomenon, complete proteomic sequences of 31 organisms and several incomplete proteomic sequences were examined for Q/N-rich regions. We found that Q/N-rich regions are essentially absent from the thermophilic bacterial and archaeal proteomes. Moreover, the average Q/N content of the proteins in these organisms is markedly lower than in mesophilic bacteria and eukaryotes. Mesophilic bacterial proteomes contain a small number (0–4) of proteins with Q/N-rich regions. Remarkably, Q/N-rich domains are found in a much larger number of eukaryotic proteins (107–472 per proteome) with diverse biochemical functions. Analyses of these regions argue they have been evolutionarily selected perhaps as modular “polar zipper” protein–protein interaction domains. These data also provide a large pool of potential novel prion-forming proteins, two of which have recently been shown to behave as prions in yeast, thus suggesting that aggregation or prion-like regulation of protein function may be a normal regulatory process for many eukaryotic proteins with a wide variety of functions. PMID:11050225

  7. Conservation in the first internal transcribed spacer (ITS1) region of Hematodinium perezi (genotype III) from Callinectes sapidus .


    Pagenkopp Lohan, Katrina M; Small, Hamish J; Shields, Jeffrey D; Place, Allen R; Reece, Kimberly S


    Hematodinium spp. infections have been reported from blue crabs Callinectes sapidus in high-salinity waters of the USA from New Jersey to Texas. Recently, H. perezi (genotype III) has been proposed as the parasite species and genotype infecting blue crabs from Virginia; however, it is unknown whether this same genotype is present in blue crabs from other locations. To address this question, we collected 317 blue crabs from Massachusetts, Virginia, Georgia, Florida, Louisiana, and Texas to test for the presence of H. perezi (III) using a specific PCR assay targeting the first internal transcribed spacer (ITS1) region of the ribosomal RNA gene complex. To examine the genetic variation within H. perezi (III), ITS1 region sequences from the parasite in blue crabs from multiple locations were compared to each other and to those of H. perezi (III) found in alternate hosts from Virginia. In total, 34 distinct ITS1 sequence variants of the parasite were identified from blue crabs alone, and 38 distinct variants were identified when alternate hosts were included. However, a single ITS1 sequence variant appeared in all geographic regions and hosts, and also in blue crabs sampled from a previous study. The high similarity among all the ITS1 region sequences examined (>98%) and the observation of a single variant found throughout a large geographic range, strongly suggests that a single species and genotype of Hematodinium, specifically H. perezi (III), infects blue crabs from Virginia to Texas and multiple alternate host species in Virginia.

  8. Recognizing new medical knowledge computationally.

    PubMed Central

    Nelson, S. J.; Cole, W. G.; Tuttle, M. S.; Olson, N. E.; Sherertz, D. D.


    Can new medical knowledge be recognized computationally? We know knowledge is changing, and our knowledge-based systems will need to accommodate that change in knowledge on a regular basis if they are to stay successful. Computational recognition of these changes seems desirable. It is unlikely that low level objects in the computational universe, bits and characters, will change much over time, higher level objects of language, where meaning begins to emerge, may show change. An analysis of ten arbitrarily selected paragraphs from the Medical Knowledge Self-Assessment Program of the American College of Physicians was used as a test bed for nominal phrase recognition. While there were words not known to Meta-1.2, only 8 of the 32 concepts new to the primary author were pointed to by new words. Use of a barrier word method was successful in identifying 23 of the 32 new concepts. Use of co-occurrence (in sentences) of putative nominal phrases may reduce the amount of human effort involved in recognizing the emergence of new relationships. PMID:8130505

  9. Recognizing and treating secondary osteoporosis.


    Walker-Bone, Karen


    Osteoporosis, through its association with fragility fracture, is a major public health problem, costing an estimated $34.8 billion worldwide per annum. With projected demographic changes, the burden looks set to grow. Therefore, the prevention of osteoporosis, as well as its identification and treatment once established, are becoming increasingly important. Osteoporosis is secondary when a drug, disease or deficiency is the underlying cause. Glucocorticoids, hypogonadism, alcohol abuse and malnutrition are among the most frequently recognized causes of secondary osteoporosis but the list of implicated diseases and drugs is growing and some of the more recently recognized associations, such as those with haematological conditions and acid-suppressing medications, are less well publicized. In some cases, advancement in treatment of the primary disease has led to people living long enough to develop secondary osteoporosis; for example, successful treatment for breast and prostate malignancies by hormonal manipulation, improved survival in HIV with the advent of anti-retroviral therapies, and improved treatment for cystic fibrosis. This Review emphasizes the importance of secondary osteoporosis, discusses familiar and less well-known causes and what is known of their mechanisms, provides guidance as to the pragmatic identification of secondary osteoporosis and summarizes treatment options, where available.

  10. Heron conservation

    USGS Publications Warehouse

    Kushlan, J.A.; Hafner, H.


    Herons are large, popular and, in many cases, spectacular birds found in wetlands world-wide, both tropical and temperate, natural and man-made. Some populations are very small and localized, some have decreased, some have expanded their ranges, and a few are pests of human activities. In the fifteen years since the publication of the latest monographic treatment of the family, The Herons Handbook, there has been a tremendous increase in our knowledge of heron status and conservation requirements, set against a backdrop of increasing concern about the future of the world?s wetland habitats. This book provides a comprehensive update following two distinct threads. The status and conservation needs of herons are first presented on a regional basis, in a series of chapters set at a continental or subcontinental scale. Over 200 biologists and heron conservationists have contributed to the data summarized here, and the very latest census and survey results provide the most up-to-date and detailed picture of heron populations currently available. Chapters discussing several critical issues in heron conservation follow, tending to focus on the international nature of the problems.

  11. Analysis of the cat eye syndrome critical region in humans and the region of conserved synteny in mice: a search for candidate genes at or near the human chromosome 22 pericentromere.


    Footz, T K; Brinkman-Mills, P; Banting, G S; Maier, S A; Riazi, M A; Bridgland, L; Hu, S; Birren, B; Minoshima, S; Shimizu, N; Pan, H; Nguyen, T; Fang, F; Fu, Y; Ray, L; Wu, H; Shaull, S; Phan, S; Yao, Z; Chen, F; Huan, A; Hu, P; Wang, Q; Loh, P; Qi, S; Roe, B A; McDermid, H E


    We have sequenced a 1.1-Mb region of human chromosome 22q containing the dosage-sensitive gene(s) responsible for cat eye syndrome (CES) as well as the 450-kb homologous region on mouse chromosome 6. Fourteen putative genes were identified within or adjacent to the human CES critical region (CESCR), including three known genes (IL-17R, ATP6E, and BID) and nine novel genes, based on EST identity. Two putative genes (CECR3 and CECR9) were identified, in the absence of EST hits, by comparing segments of human and mouse genomic sequence around two solitary amplified exons, thus showing the utility of comparative genomic sequence analysis in identifying transcripts. Of the 14 genes, 10 were confirmed to be present in the mouse genomic sequence in the same order and orientation as in human. Absent from the mouse region of conserved synteny are CECR1, a promising CES candidate gene from the center of the contig, neighboring CECR4, and CECR7 and CECR8, which are located in the gene-poor proximal 400 kb of the contig. This latter proximal region, located approximately 1 Mb from the centromere, shows abundant duplicated gene fragments typical of pericentromeric DNA. The margin of this region also delineates the boundary of conserved synteny between the CESCR and mouse chromosome 6. Because the proximal CESCR appears abundant in duplicated segments and, therefore, is likely to be gene poor, we consider the putative genes identified in the distal CESCR to represent the majority of candidate genes for involvement in CES.

  12. Conserved genetic regions across angiosperms as tools to develop single-copy nuclear markers in gymnosperms: an example using cycads.


    Salas-Leiva, Dayana E; Meerow, Alan W; Francisco-Ortega, Javier; Calonje, Michael; Griffith, M Patrick; Stevenson, Dennis W; Nakamura, Kyoko


    Several individuals of the Caribbean Zamia clade and other cycad genera were used to identify single-copy nuclear genes for phylogeographic and phylogenetic studies in Cycadales. Two strategies were employed to select target loci: (i) a tblastX search of Arabidopsis conserved ortholog sequence (COS) set and (ii) a tblastX search of Arabidopsis-Populus-Vitis-Oryza Shared Single-Copy genes (APVO SSC) against the EST Zamia databases in GenBank. From the first strategy, 30 loci were selected, and from the second, 16 loci. In both cases, the matching GenBank accessions of Zamia were used as a query for retrieving highly similar sequences from Cycas, Picea, Pinus species or Ginkgo biloba. After retrieving and aligning all the sequences in each locus, intron predictions were completed to assist in primer design. PCR was carried out in three rounds to detect paralogous loci. A total of 29 loci were successfully amplified as a single band of which 20 were likely single-copy loci. These loci showed different diversity and divergence levels. A preliminary screening allowed us to select 8 promising loci (40S, ATG2, BG, GroES, GTP, LiSH, PEX4 and TR) for the Zamia pumila complex and 4 loci (COS26, GroES, GTP and HTS) for all other cycad genera.

  13. Sequence of a cDNA encoding nitrite reductase from the tree Betula pendula and identification of conserved protein regions.


    Friemann, A; Brinkmann, K; Hachtel, W


    The sequence of an mRNA encoding nitrite reductase (NiR, EC from the tree Betula pendula was determined. A cDNA library constructed from leaf poly(A)+ mRNA was screened with an oligonucleotide probe deduced from NiR sequences from spinach and maize. A 2.5 kb cDNA was isolated that hybridized to an mRNA, the steady-state level of which increased markedly upon induction with nitrate. The nucleotide sequence of the cDNA contains a reading frame encoding a protein of 583 amino acids that reveals 79% identity with NiR from spinach. The transit peptide of the NiR precursor from birch was determined to be 22 amino acids in size by sequence comparison with NiR from spinach and maize and is the shortest transit peptide reported so far. A graphical evaluation of identities found in the NiR sequence alignment revealed nine well conserved sections each exceeding ten amino acids in size. Sequence comparisons with related redox proteins identified essential residues involved in cofactor binding. A putative binding site for ferredoxin was found in the N-terminal half of the protein.

  14. Genetic analysis of tumorigenesis: a conserved region in the human and Chinese hamster genomes contains genetically identified tumor-suppressor genes

    SciTech Connect

    Stenman, G.; Sager, R.


    Regional chromosome homologies were found in a comparison of human 11p with Chinese hamster 3p. By use of probes that recognize six genes of human 11p (INS, CAT, HBBC, CALC, PTH, and HRAS), the corresponding genes were localized by in situ hybridization on Chinese hamster chromosome 3. INS and CAT were located close to the centromere on 3p, whereas HBBC, CALC, and PTH were at 3q3-4 and HRAS at 3q4. Extensive prior data from chromosome studies of tumorigenic and tumor-derived Chinese hamster cells have suggested the presence of a tumor-suppressor gene on 3p. Two tumor-suppressor genes have been described on human 11p, one linked to CAT and one to INS. The present study raises the possibility that the Chinese hamster suppressor may be closely linked to INS or CAT.

  15. High conservation level of CD8(+) T cell immunogenic regions within an unusual H1N2 human influenza variant.


    Komadina, Naomi; Quiñones-Parra, Sergio M; Kedzierska, Katherine; McCaw, James M; Kelso, Anne; Leder, Karin; McVernon, Jodie


    Current seasonal influenza vaccines require regular updates due to antigenic drift causing loss of effectiveness and therefore providing little or no protection against novel influenza A subtypes. Next generation vaccines capable of eliciting CD8(+) T cell (CTL) mediated cross-protective immunity may offer a long-term alternative strategy. However, measuring pre- and existing levels of CTL cross-protection in humans is confounded by differences in infection histories across individuals. During 2000-2003, H1N2 viruses circulated persistently in the human population for the first time and we hypothesized that the viral nucleoprotein (NP) contained novel CTL epitopes that may have contributed to the survival of the viruses. This study describes the immunogenic NP peptides of H1N1, H2N2, and H3N2 influenza viruses isolated from humans over the past century, 1918-2003, by comparing this historical dataset to reference NP peptides from H1N2 that circulated in humans during 2000-2003. Observed peptides sequences ranged from highly conserved (15%) to highly variable (12%), with variation unrelated to reported immunodominance. No unique NP peptides which were exclusive to the H1N2 viruses were noted. However, the virus had inherited the NP from a recently emerged H3N2 variant containing novel peptides, which may have assisted its persistence. Any advantage due to this novelty was subsequently lost with emergence of a newer H3N2 variant in 2003. Our approach has potential to provide insight into the population context in which influenza viruses emerge, and may help to inform immunogenic peptide selection for CTL-inducing influenza vaccines. J. Med. Virol. 88:1725-1732, 2016. © 2016 Wiley Periodicals, Inc.

  16. Widespread Shortening of 3' Untranslated Regions and Increased Exon Inclusion Are Evolutionarily Conserved Features of Innate Immune Responses to Infection.


    Pai, Athma A; Baharian, Golshid; Pagé Sabourin, Ariane; Brinkworth, Jessica F; Nédélec, Yohann; Foley, Joseph W; Grenier, Jean-Christophe; Siddle, Katherine J; Dumaine, Anne; Yotova, Vania; Johnson, Zachary P; Lanford, Robert E; Burge, Christopher B; Barreiro, Luis B


    The contribution of pre-mRNA processing mechanisms to the regulation of immune responses remains poorly studied despite emerging examples of their role as regulators of immune defenses. We sought to investigate the role of mRNA processing in the cellular responses of human macrophages to live bacterial infections. Here, we used mRNA sequencing to quantify gene expression and isoform abundances in primary macrophages from 60 individuals, before and after infection with Listeria monocytogenes and Salmonella typhimurium. In response to both bacteria we identified thousands of genes that significantly change isoform usage in response to infection, characterized by an overall increase in isoform diversity after infection. In response to both bacteria, we found global shifts towards (i) the inclusion of cassette exons and (ii) shorter 3' UTRs, with near-universal shifts towards usage of more upstream polyadenylation sites. Using complementary data collected in non-human primates, we show that these features are evolutionarily conserved among primates. Following infection, we identify candidate RNA processing factors whose expression is associated with individual-specific variation in isoform abundance. Finally, by profiling microRNA levels, we show that 3' UTRs with reduced abundance after infection are significantly enriched for target sites for particular miRNAs. These results suggest that the pervasive usage of shorter 3' UTRs is a mechanism for particular genes to evade repression by immune-activated miRNAs. Collectively, our results suggest that dynamic changes in RNA processing may play key roles in the regulation of innate immune responses.

  17. Interactive effects of climate change with nutrients, mercury, and freshwater acidification on key taxa in the North Atlantic Landscape Conservation Cooperative region.


    Pinkney, Alfred E; Driscoll, Charles T; Evers, David C; Hooper, Michael J; Horan, Jeffrey; Jones, Jess W; Lazarus, Rebecca S; Marshall, Harold G; Milliken, Andrew; Rattner, Barnett A; Schmerfeld, John; Sparling, Donald W


    The North Atlantic Landscape Conservation Cooperative LCC (NA LCC) is a public-private partnership that provides information to support conservation decisions that may be affected by global climate change (GCC) and other threats. The NA LCC region extends from southeast Virginia to the Canadian Maritime Provinces. Within this region, the US National Climate Assessment documented increases in air temperature, total precipitation, frequency of heavy precipitation events, and rising sea level, and predicted more drastic changes. Here, we synthesize literature on the effects of GCC interacting with selected contaminant, nutrient, and environmental processes to adversely affect natural resources within this region. Using a case study approach, we focused on 3 stressors with sufficient NA LCC region-specific information for an informed discussion. We describe GCC interactions with a contaminant (Hg) and 2 complex environmental phenomena-freshwater acidification and eutrophication. We also prepared taxa case studies on GCC- and GCC-contaminant/nutrient/process effects on amphibians and freshwater mussels. Several avian species of high conservation concern have blood Hg concentrations that have been associated with reduced nesting success. Freshwater acidification has adversely affected terrestrial and aquatic ecosystems in the Adirondacks and other areas of the region that are slowly recovering due to decreased emissions of N and sulfur oxides. Eutrophication in many estuaries within the region is projected to increase from greater storm runoff and less denitrification in riparian wetlands. Estuarine hypoxia may be exacerbated by increased stratification. Elevated water temperature favors algal species that produce harmful algal blooms (HABs). In several of the region's estuaries, HABs have been associated with bird die-offs. In the NA LCC region, amphibian populations appear to be declining. Some species may be adversely affected by GCC through higher temperatures and

  18. Interactive effects of climate change with nutrients, mercury, and freshwater acidification on key taxa in the North Atlantic Landscape Conservation Cooperative region

    USGS Publications Warehouse

    Pinkney, Alfred E.; Driscoll, Charles T.; Evers, David C.; Hooper, Michael J.; Horan, Jeffrey; Jones, Jess W.; Lazarus, Rebecca; Marshall, Harold G.; Milliken, Andrew; Rattner, Barnett A.; Schmerfeld, John J.; Sparling, Donald W.


    The North Atlantic Landscape Conservation Cooperative LCC (NA LCC) is a public–private partnership that provides information to support conservation decisions that may be affected by global climate change (GCC) and other threats. The NA LCC region extends from southeast Virginia to the Canadian Maritime Provinces. Within this region, the US National Climate Assessment documented increases in air temperature, total precipitation, frequency of heavy precipitation events, and rising sea level, and predicted more drastic changes. Here, we synthesize literature on the effects of GCC interacting with selected contaminant, nutrient, and environmental processes to adversely affect natural resources within this region. Using a case study approach, we focused on 3 stressors with sufficient NA LCC region-specific information for an informed discussion. We describe GCC interactions with a contaminant (Hg) and 2 complex environmental phenomena—freshwater acidification and eutrophication. We also prepared taxa case studies on GCC- and GCC-contaminant/nutrient/process effects on amphibians and freshwater mussels. Several avian species of high conservation concern have blood Hg concentrations that have been associated with reduced nesting success. Freshwater acidification has adversely affected terrestrial and aquatic ecosystems in the Adirondacks and other areas of the region that are slowly recovering due to decreased emissions of N and sulfur oxides. Eutrophication in many estuaries within the region is projected to increase from greater storm runoff and less denitrification in riparian wetlands. Estuarine hypoxia may be exacerbated by increased stratification. Elevated water temperature favors algal species that produce harmful algal blooms (HABs). In several of the region's estuaries, HABs have been associated with bird die-offs. In the NA LCC region, amphibian populations appear to be declining. Some species may be adversely affected by GCC through higher temperatures

  19. Gene map of large yellow croaker (Larimichthys crocea) provides insights into teleost genome evolution and conserved regions associated with growth.


    Xiao, Shijun; Wang, Panpan; Zhang, Yan; Fang, Lujing; Liu, Yang; Li, Jiong-Tang; Wang, Zhi-Yong


    The genetic map of a species is essential for its whole genome assembly and can be applied to the mapping of important traits. In this study, we performed RNA-seq for a family of large yellow croakers (Larimichthys crocea) and constructed a high-density genetic map. In this map, 24 linkage groups comprised 3,448 polymorphic SNP markers. Approximately 72.4% (2,495) of the markers were located in protein-coding regions. Comparison of the croaker genome with those of five model fish species revealed that the croaker genome structure was closer to that of the medaka than to the remaining four genomes. Because the medaka genome preserves the teleost ancestral karyotype, this result indicated that the croaker genome might also maintain the teleost ancestral genome structure. The analysis also revealed different genome rearrangements across teleosts. QTL mapping and association analysis consistently identified growth-related QTL regions and associated genes. Orthologs of the associated genes in other species were demonstrated to regulate development, indicating that these genes might regulate development and growth in croaker. This gene map will enable us to construct the croaker genome for comparative studies and to provide an important resource for selective breeding of croaker.

  20. Pub1p C-terminal RRM domain interacts with Tif4631p through a conserved region neighbouring the Pab1p binding site.


    Santiveri, Clara M; Mirassou, Yasmina; Rico-Lastres, Palma; Martínez-Lumbreras, Santiago; Pérez-Cañadillas, José Manuel


    Pub1p, a highly abundant poly(A)+ mRNA binding protein in Saccharomyces cerevisiae, influences the stability and translational control of many cellular transcripts, particularly under some types of environmental stresses. We have studied the structure, RNA and protein recognition modes of different Pub1p constructs by NMR spectroscopy. The structure of the C-terminal RRM domain (RRM3) shows a non-canonical N-terminal helix that packs against the canonical RRM fold in an original fashion. This structural trait is conserved in Pub1p metazoan homologues, the TIA-1 family, defining a new class of RRM-type domains that we propose to name TRRM (TIA-1 C-terminal domain-like RRM). Pub1p TRRM and the N-terminal RRM1-RRM2 tandem bind RNA with high selectivity for U-rich sequences, with TRRM showing additional preference for UA-rich ones. RNA-mediated chemical shift changes map to β-sheet and protein loops in the three RRMs. Additionally, NMR titration and biochemical in vitro cross-linking experiments determined that Pub1p TRRM interacts specifically with the N-terminal region (1-402) of yeast eIF4G1 (Tif4631p), very likely through the conserved Box1, a short sequence motif neighbouring the Pab1p binding site in Tif4631p. The interaction involves conserved residues of Pub1p TRRM, which define a protein interface that mirrors the Pab1p-Tif4631p binding mode. Neither protein nor RNA recognition involves the novel N-terminal helix, whose functional role remains unclear. By integrating these new results with the current knowledge about Pub1p, we proposed different mechanisms of Pub1p recruitment to the mRNPs and Pub1p-mediated mRNA stabilization in which the Pub1p/Tif4631p interaction would play an important role.

  1. Leucine residues in conserved region of 33K protein of bovine adenovirus - 3 are important for binding to major late promoter and activation of late gene expression.


    Kulshreshtha, Vikas; Islam, Azharul; Ayalew, Lisanework E; Tikoo, Suresh K


    The L6 region of bovine adenovirus 3 (BAdV-3) encode 33K (spliced) and 22K (unspliced) proteins. Earlier, anti-33K serum detected five major and three minor proteins in BAdV-3 infected cells. Here, we demonstrate that anti-sera raised against L6-22K protein detected two proteins of 42 and 37 kDa in BAdV-3 infected cells and one protein of 42 kDa in transfected cells expressing splice-site variant 22K protein (pC.22K containing substituted splice acceptor/donor sequence). Unlike 22K, 33K stimulated the transcription from the major late promoter (MLP) by binding to the downstream sequence elements (DE). Analysis of the variant proteins demonstrated that amino acids 201-240 of the conserved C-terminus of 33K containing the potential leucine zipper and RS repeat are required for the activation of MLP. Furthermore, amino acid substitution analysis demonstrated that unlike arginine residues of RS repeat, the leucine residues (217, 224, 232 and 240) of the conserved leucine zipper appear required for the binding of 33K to the MLP.

  2. Assessment of Micro-Basin Tillage as a Soil and Water Conservation Practice in the Black Soil Region of Northeast China.


    Sui, Yuanyuan; Ou, Yang; Yan, Baixing; Xu, Xiaohong; Rousseau, Alain N; Zhang, Yu


    Micro-basin tillage is a soil and water conservation practice that requires building individual earth blocks along furrows. In this study, plot experiments were conducted to assess the efficiency of micro-basin tillage on sloping croplands between 2012 and 2013 (5°and 7°). The conceptual, optimal, block interval model was used to design micro-basins which are meant to capture the maximum amount of water per unit area. Results indicated that when compared to the up-down slope tillage, micro-basin tillage could increase soil water content and maize yield by about 45% and 17%, and reduce runoff, sediment and nutrients loads by about 63%, 96% and 86%, respectively. Meanwhile, micro-basin tillage could reduce the peak runoff rates and delay the initial runoff-yielding time. In addition, micro-basin tillage with the optimal block interval proved to be the best one among all treatments with different intervals. Compared with treatments of other block intervals, the optimal block interval treatments increased soil moisture by around 10% and reduced runoff rate by around 15%. In general, micro-basin tillage with optimal block interval represents an effective soil and water conservation practice for sloping farmland of the black soil region.

  3. Rice Cellulose SynthaseA8 Plant-Conserved Region Is a Coiled-Coil at the Catalytic Core Entrance1[OPEN

    PubMed Central

    Rushton, Phillip S.; Olek, Anna T.; Makowski, Lee; Badger, John


    The crystallographic structure of a rice (Oryza sativa) cellulose synthase, OsCesA8, plant-conserved region (P-CR), one of two unique domains in the catalytic domain of plant CesAs, was solved to 2.4 Å resolution. Two antiparallel α-helices form a coiled-coil domain linked by a large extended connector loop containing a conserved trio of aromatic residues. The P-CR structure was fit into a molecular envelope for the P-CR domain derived from small-angle X-ray scattering data. The P-CR structure and molecular envelope, combined with a homology-based chain trace of the CesA8 catalytic core, were modeled into a previously determined CesA8 small-angle X-ray scattering molecular envelope to produce a detailed topological model of the CesA8 catalytic domain. The predicted position for the P-CR domain from the molecular docking models places the P-CR connector loop into a hydrophobic pocket of the catalytic core, with the coiled-coil aligned near the entrance of the substrate UDP-glucose into the active site. In this configuration, the P-CR coiled-coil alone is unlikely to regulate substrate access to the active site, but it could interact with other domains of CesA, accessory proteins, or other CesA catalytic domains to control substrate delivery. PMID:27879387

  4. Evaluation of ELISA based on the conserved and functional middle region of nucleocapsid protein to detect distemper infection in dogs.


    Latha, D; Geetha, M; Ramadass, P; Narayanan, R B


    A 287bp fragment from the middle region of the nucleocapsid protein of canine distemper virus (CDV) was amplified from the conjunctival samples of distemper-infected dogs and was cloned into pRSET B vector. The recombinant protein was expressed as a 16-kDa-fusion protein with histidine tag in E. coli. Sera of distemper-infected and vaccinated dogs contained IgG antibodies against the purified recombinant protein as observed by enzyme linked immunosorbent assays (ELISA) and showed a strong correlation (r=0.882, p<0.0001 at 95% CI) and good agreement (kappa=0.718) with the conventional tissue culture viral antigen based ELISA. Further, the results of recombinant protein based ELISA and Western blotting with the sera from the infected and vaccinated dogs correlated well (kappa=0.8226). These findings recommend the use of the recombinant protein in the serodiagnosis of canine distemper virus infection in dogs.

  5. Recognizing, Determining, and Addressing Entrepreneurial Innovations by Superintendents of Emerging or Established Educational Service Agencies

    ERIC Educational Resources Information Center

    Arfstrom, Kari M.


    This dissertation describes how entrepreneurial superintendents of educational service agencies (ESAs) recognize, determine and address common and distinct innovative characteristics within emerging or established regional educational environments. Because internal and external factors assist in recognizing innovative practices, this study…

  6. The Role of DNA Barcodes in Understanding and Conservation of Mammal Diversity in Southeast Asia

    PubMed Central

    Francis, Charles M.; Borisenko, Alex V.; Ivanova, Natalia V.; Eger, Judith L.; Lim, Burton K.; Guillén-Servent, Antonio; Kruskop, Sergei V.; Mackie, Iain; Hebert, Paul D. N.


    Background Southeast Asia is recognized as a region of very high biodiversity, much of which is currently at risk due to habitat loss and other threats. However, many aspects of this diversity, even for relatively well-known groups such as mammals, are poorly known, limiting ability to develop conservation plans. This study examines the value of DNA barcodes, sequences of the mitochondrial COI gene, to enhance understanding of mammalian diversity in the region and hence to aid conservation planning. Methodology and Principal Findings DNA barcodes were obtained from nearly 1900 specimens representing 165 recognized species of bats. All morphologically or acoustically distinct species, based on classical taxonomy, could be discriminated with DNA barcodes except four closely allied species pairs. Many currently recognized species contained multiple barcode lineages, often with deep divergence suggesting unrecognized species. In addition, most widespread species showed substantial genetic differentiation across their distributions. Our results suggest that mammal species richness within the region may be underestimated by at least 50%, and there are higher levels of endemism and greater intra-specific population structure than previously recognized. Conclusions DNA barcodes can aid conservation and research by assisting field workers in identifying species, by helping taxonomists determine species groups needing more detailed analysis, and by facilitating the recognition of the appropriate units and scales for conservation planning. PMID:20838635

  7. Unique and conserved genome regions in Vibrio harveyi and related species in comparison with the shrimp pathogen Vibrio harveyi CAIM 1792.


    Espinoza-Valles, Iliana; Vora, Gary J; Lin, Baochuan; Leekitcharoenphon, Pimlapas; González-Castillo, Adrián; Ussery, Dave; Høj, Lone; Gomez-Gil, Bruno


    Vibrio harveyi CAIM 1792 is a marine bacterial strain that causes mortality in farmed shrimp in north-west Mexico, and the identification of virulence genes in this strain is important for understanding its pathogenicity. The aim of this work was to compare the V. harveyi CAIM 1792 genome with related genome sequences to determine their phylogenic relationship and explore unique regions in silico that differentiate this strain from other V. harveyi strains. Twenty-one newly sequenced genomes were compared in silico against the CAIM 1792 genome at nucleotidic and predicted proteome levels. The proteome of CAIM 1792 had higher similarity to those of other V. harveyi strains (78%) than to those of the other closely related species Vibrio owensii (67%), Vibrio rotiferianus (63%) and Vibrio campbellii (59%). Pan-genome ORFans trees showed the best fit with the accepted phylogeny based on DNA-DNA hybridization and multi-locus sequence analysis of 11 concatenated housekeeping genes. SNP analysis clustered 34/38 genomes within their accepted species. The pangenomic and SNP trees showed that V. harveyi is the most conserved of the four species studied and V. campbellii may be divided into at least three subspecies, supported by intergenomic distance analysis. blastp atlases were created to identify unique regions among the genomes most related to V. harveyi CAIM 1792; these regions included genes encoding glycosyltransferases, specific type restriction modification systems and a transcriptional regulator, LysR, reported to be involved in virulence, metabolism, quorum sensing and motility.

  8. Understanding the Distribution of Marine Megafauna in the English Channel Region: Identifying Key Habitats for Conservation within the Busiest Seaway on Earth

    PubMed Central

    McClellan, Catherine M.; Brereton, Tom; Dell'Amico, Florence; Johns, David G.; Cucknell, Anna-C.; Patrick, Samantha C.; Penrose, Rod; Ridoux, Vincent; Solandt, Jean-Luc; Stephan, Eric; Votier, Stephen C.; Williams, Ruth; Godley, Brendan J.


    The temperate waters of the North-Eastern Atlantic have a long history of maritime resource richness and, as a result, the European Union is endeavouring to maintain regional productivity and biodiversity. At the intersection of these aims lies potential conflict, signalling the need for integrated, cross-border management approaches. This paper focuses on the marine megafauna of the region. This guild of consumers was formerly abundant, but is now depleted and protected under various national and international legislative structures. We present a meta-analysis of available megafauna datasets using presence-only distribution models to characterise suitable habitat and identify spatially-important regions within the English Channel and southern bight of the North Sea. The integration of studies from dedicated and opportunistic observer programmes in the United Kingdom and France provide a valuable perspective on the spatial and seasonal distribution of various taxonomic groups, including large pelagic fishes and sharks, marine mammals, seabirds and marine turtles. The Western English Channel emerged as a hotspot of biodiversity for megafauna, while species richness was low in the Eastern English Channel. Spatial conservation planning is complicated by the highly mobile nature of marine megafauna, however they are important components of the marine environment and understanding their distribution is a first crucial step toward their inclusion into marine ecosystem management. PMID:24586985

  9. A conserved proline residue in the leucine zipper region of AtbZIP34 and AtbZIP61 in Arabidopsis thaliana interferes with the formation of homodimer

    SciTech Connect

    Shen Huaishun; Cao Kaiming; Wang Xiping


    Two putative Arabidopsis E group bZIP transcript factors, AtbZIP34 and AtbZIP61, are nuclear-localized and their transcriptional activation domain is in their N-terminal region. By searching GenBank, we found other eight plant homologues of AtbZIP34 and AtbZIP61. All of them have a proline residue in the third heptad of zipper region. Yeast two-hybrid assay and EMSA showed that AtbZIP34 and AtbZIP61 could not form homodimer while their mutant forms, AtbZIP34m and AtbZIP61m, which the proline residue was replaced by an alanine residue in the zipper region, could form homodimer and bind G-box element. These results suggest that the conserved proline residue interferes with the homodimer formation. However, both AtbZIP34 and AtbZIP61 could form heterodimers with members of I group and S group transcription factors in which some members involved in vascular development. So we speculate that AtbZIP34 and AtbZIP61 may participate in plant development via interacting with other group bZIP transcription factors.

  10. Understanding the distribution of marine megafauna in the English channel region: identifying key habitats for conservation within the busiest seaway on earth.


    McClellan, Catherine M; Brereton, Tom; Dell'Amico, Florence; Johns, David G; Cucknell, Anna-C; Patrick, Samantha C; Penrose, Rod; Ridoux, Vincent; Solandt, Jean-Luc; Stephan, Eric; Votier, Stephen C; Williams, Ruth; Godley, Brendan J


    The temperate waters of the North-Eastern Atlantic have a long history of maritime resource richness and, as a result, the European Union is endeavouring to maintain regional productivity and biodiversity. At the intersection of these aims lies potential conflict, signalling the need for integrated, cross-border management approaches. This paper focuses on the marine megafauna of the region. This guild of consumers was formerly abundant, but is now depleted and protected under various national and international legislative structures. We present a meta-analysis of available megafauna datasets using presence-only distribution models to characterise suitable habitat and identify spatially-important regions within the English Channel and southern bight of the North Sea. The integration of studies from dedicated and opportunistic observer programmes in the United Kingdom and France provide a valuable perspective on the spatial and seasonal distribution of various taxonomic groups, including large pelagic fishes and sharks, marine mammals, seabirds and marine turtles. The Western English Channel emerged as a hotspot of biodiversity for megafauna, while species richness was low in the Eastern English Channel. Spatial conservation planning is complicated by the highly mobile nature of marine megafauna, however they are important components of the marine environment and understanding their distribution is a first crucial step toward their inclusion into marine ecosystem management.

  11. FRG1, a gene in the FSH muscular dystrophy region on human chromosome 4q35, is highly conserved in vertebrates and invertebrates.


    Grewal, P K; Todd, L C; van der Maarel, S; Frants, R R; Hewitt, J E


    The human FRG1 gene maps to human chromosome 4q35 and was identified as a candidate for facioscapulohumeral muscular dystrophy. However, FRG1 is apparently not causally associated with the disease and as yet, its function remains unclear. We have cloned homologues of FRG1 from two additional vertebrates, the mouse and the Japanese puffer fish Fugu rubripes, and investigated the genomic organization of the genes in the two species. The intron/exon structure of the genes is identical throughout the protein coding region, although the Fugu gene is five times smaller than the mouse gene. We have also identified FRG1 homologues in two nematodes; Caenorhabditis elegans and Brugia malayi. The FRG1 protein is highly conserved and contains a lipocalin sequence motif, suggesting it may function as a transport protein.

  12. Recognizing characters of ancient manuscripts

    NASA Astrophysics Data System (ADS)

    Diem, Markus; Sablatnig, Robert


    Considering printed Latin text, the main issues of Optical Character Recognition (OCR) systems are solved. However, for degraded handwritten document images, basic preprocessing steps such as binarization, gain poor results with state-of-the-art methods. In this paper ancient Slavonic manuscripts from the 11th century are investigated. In order to minimize the consequences of false character segmentation, a binarization-free approach based on local descriptors is proposed. Additionally local information allows the recognition of partially visible or washed out characters. The proposed algorithm consists of two steps: character classification and character localization. Initially Scale Invariant Feature Transform (SIFT) features are extracted which are subsequently classified using Support Vector Machines (SVM). Afterwards, the interest points are clustered according to their spatial information. Thereby, characters are localized and finally recognized based on a weighted voting scheme of pre-classified local descriptors. Preliminary results show that the proposed system can handle highly degraded manuscript images with background clutter (e.g. stains, tears) and faded out characters.

  13. The C-terminal 18 Amino Acid Region of Dengue Virus NS5 Regulates its Subcellular Localization and Contains a Conserved Arginine Residue Essential for Infectious Virus Production

    PubMed Central

    Ng, Ivan H. W.; Chan, Kitti W. K.; Zhao, Yongqian; Ooi, Eng Eong; Lescar, Julien; Jans, David A.; Forwood, Jade K.


    Dengue virus NS5 is the most highly conserved amongst the viral non-structural proteins and is responsible for capping, methylation and replication of the flavivirus RNA genome. Interactions of NS5 with host proteins also modulate host immune responses. Although replication occurs in the cytoplasm, an unusual characteristic of DENV2 NS5 is that it localizes to the nucleus during infection with no clear role in replication or pathogenesis. We examined NS5 of DENV1 and 2, which exhibit the most prominent difference in nuclear localization, employing a combination of functional and structural analyses. Extensive gene swapping between DENV1 and 2 NS5 identified that the C-terminal 18 residues (Cter18) alone was sufficient to direct the protein to the cytoplasm or nucleus, respectively. The low micromolar binding affinity between NS5 Cter18 and the nuclear import receptor importin-alpha (Impα), allowed their molecular complex to be purified, crystallised and visualized at 2.2 Å resolution using x-ray crystallography. Structure-guided mutational analysis of this region in GFP-NS5 clones of DENV1 or 2 and in a DENV2 infectious clone reveal residues important for NS5 subcellular localization. Notably, the trans conformation adopted by Pro-884 allows proper presentation for binding Impα and mutating this proline to Thr, as present in DENV1 NS5, results in mislocalizaion of NS5 to the cytoplasm without compromising virus fitness. In contrast, a single mutation to alanine at NS5 position R888, a residue conserved in all flaviviruses, resulted in a completely non-viable virus, and the R888K mutation led to a severely attenuated phentoype, even though NS5 was located in the nucleus. R888 forms a hydrogen bond with Y838 that is also conserved in all flaviviruses. Our data suggests an evolutionarily conserved function for NS5 Cter18, possibly in RNA interactions that are critical for replication, that is independent of its role in subcellular localization. PMID:27622521

  14. A comparison among root soil-conservation effects for nine herbs at the cold region highway in north-eastern China

    NASA Astrophysics Data System (ADS)

    Xu, W.; Wang, X.; Zhang, Y.; Liu, Y.


    High soil-conservation herbs are very important for slope vegetation restoration of a highway in serious sandstorm regions. In this study, nine common herbs in northeast China were selected and compared to study soil-conservation effects by using an undisturbed-soil trough scouring method for soil anti-scourability enhancement and hydrostatic collapse method for soil anti-erodibility. Further, principal components analysis was used to identify significant root features that affected soil erosion resistance. Results indicated that different herbs had distinct enhancement effects on soil erosion resistance. Soil anti-scourability enhancement index decreased with increases of soil depth, slope gradient and rainfall amount. Relationship between soil anti-erodibility enhancement index ( S) and immersion time ( t) is a cubic spline in each different herb type ( R 2 ≥ 0.88). Herb root features such as micro-aggregates, organic matter, net leaf weight, thick root length, fine root length and biomass contributed a leading role in soil erosion resistance enhancement effect, and all their common factor variances were more than 0.81. Descending order of soil erosion resistance enhancement effect in soil anti-scourability for nine herbs is Poa pratensis, Medicago sativa, Viola philippica, Rudbeckia hirta, Clematis heracleifolia, Kalimeris indica, Cosmos bipinnata, Hemerocallis fulva and Sedum elatinoides, while the sequence of soil anti-erodibility is M. sativa, S. elatinoides, P. pratensis, R. hirta, H. fulva, V. philippica, C. heracleifolia, C. bipinnata and K. indica. Therefore, we concluded that P. pratensis and M. sativa were the most suitable herbs for resisting soil erosion and recommended to be widely planted for road vegetation recovery in this region.

  15. Delta-associated molluscan life and death assemblages in the northern Adriatic Sea: Implications for paleoecology, regional diversity and conservation.


    Weber, Kristina; Zuschin, Martin


    Life-death (LD) studies of shelly macrofauna are important to evaluate how well a fossil assemblage can reflect the original living community, but can also serve as a proxy for recent ecological shifts in marine habitats and in practice this has to be distinguished using taphonomic preservation pattern and estimates of time-averaging. It remains to be rigorously evaluated, however, how to distinguish between sources of LD disagreement. In addition, death assemblages (DAs) also preserve important information on regional diversity which is not available from single censuses of the life assemblages (LAs). The northern Adriatic Sea is an ecosystem under anthropogenic pressure, and we studied the distribution and abundance of living and dead bivalve and gastropod species in the physically stressful environments (tidal flat and shallow sublittoral soft bottoms) associated with the delta of the Isonzo River (Gulf of Trieste). Specifically we evaluated the fidelity of richness, evenness, abundance, habitat discrimination and beta diversity. A total of 10,740 molluscs from fifteen tidal flat and fourteen sublittoral sites were analyzed for species composition and distribution of living and dead molluscs. Of 78 recorded species, only eleven were numerically abundant. There were many more dead than living individuals and rarefied species richness in the DA was higher at all spatial scales, but the differences are lower in habitats and in the region than at individual stations. Evenness was always higher in death assemblages, and probably due to temporally more variable LAs the differences are stronger in the sublittoral habitats. Distinct assemblages characterized intertidal and sublittoral habitats, and the distribution and abundance of empty shells generally corresponded to that of the living species. Death assemblages have lower beta diversity than life assemblages, but empty shells capture compositional differences between habitats to a higher degree than living shells


    EPA Science Inventory

    One fundamental step in conservation planning involves determining where to concentrate efforts to protect conservation targets. Here we demonstrate an approach to prioritizing areas based on both species composition and potential threats facing the species. First, we determine...

  17. Direct selection of conserved cDNAs from the DiGeorge critical region: isolation of a novel CDC45-like gene.


    McKie, J M; Wadey, R B; Sutherland, H F; Taylor, C L; Scambler, P J


    We have used a modified direct selection technique to detect transcripts that are both evolutionary conserved and developmentally expressed. The enrichment for homologous mouse cDNAs by use of human genomic DNA as template is shown to be an efficient and rapid approach for generating transcript maps. Deletions of human 22q11 are associated with several clinical syndromes, with overlapping phenotypes, for example, velocardiofacial syndrome (VCFS) and DiGeorge syndrome (DGS). A large number of transcriptional units exist within the defined critical region, many of which have been identified previously by direct selection. However, no single obvious candidate gene for the VCFS/DGS phenotype has yet been found. Our technique has been applied to the DiGeorge critical region and has resulted in the isolation of a novel candidate gene, Cdc45l2, similar to yeast Cdc45p. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AJ0223728 and AF0223729.

  18. Paradigms for parasite conservation.


    Dougherty, Eric R; Carlson, Colin J; Bueno, Veronica M; Burgio, Kevin R; Cizauskas, Carrie A; Clements, Christopher F; Seidel, Dana P; Harris, Nyeema C


    Parasitic species, which depend directly on host species for their survival, represent a major regulatory force in ecosystems and a significant component of Earth's biodiversity. Yet the negative impacts of parasites observed at the host level have motivated a conservation paradigm of eradication, moving us farther from attainment of taxonomically unbiased conservation goals. Despite a growing body of literature highlighting the importance of parasite-inclusive conservation, most parasite species remain understudied, underfunded, and underappreciated. We argue the protection of parasitic biodiversity requires a paradigm shift in the perception and valuation of their role as consumer species, similar to that of apex predators in the mid-20th century. Beyond recognizing parasites as vital trophic regulators, existing tools available to conservation practitioners should explicitly account for the unique threats facing dependent species. We built upon concepts from epidemiology and economics (e.g., host-density threshold and cost-benefit analysis) to devise novel metrics of margin of error and minimum investment for parasite conservation. We define margin of error as the risk of accidental host extinction from misestimating equilibrium population sizes and predicted oscillations, while minimum investment represents the cost associated with conserving the additional hosts required to maintain viable parasite populations. This framework will aid in the identification of readily conserved parasites that present minimal health risks. To establish parasite conservation, we propose an extension of population viability analysis for host-parasite assemblages to assess extinction risk. In the direst cases, ex situ breeding programs for parasites should be evaluated to maximize success without undermining host protection. Though parasitic species pose a considerable conservation challenge, adaptations to conservation tools will help protect parasite biodiversity in the face of

  19. A Conserved Virulence Plasmidic Region Contributes to the Virulence of the Multiresistant Escherichia coli Meningitis Strain S286 Belonging to Phylogenetic Group C

    PubMed Central

    Caro, Valérie; Diancourt, Laure; Bingen, Edouard; Bidet, Philippe; Bonacorsi, Stéphane


    Recent isolation of the non-K1 Escherichia coli neonatal meningitis strain S286, belonging to phylogroup C, which is closely related to major group B1, and producing an extended-spectrum beta-lactamase, encouraged us to seek the genetic determinants responsible for its virulence. We show that S286 belongs to the sequence O type ST23O78 and harbors 4 large plasmids. The largest one, pS286colV (∼120 kb), not related to resistance, contains genes characteristic of a Conserved Virulence Plasmidic (CVP) region initially identified in B2 extra-intestinal avian pathogenic E. coli (APEC) strains and in the B2 neonatal meningitis E. coli strain S88. The sequence of this CVP region has a strong homology (98%) with that of the recently sequenced plasmid pChi7122-1 of the O78 APEC strain Chi7122. A CVP plasmid-cured variant of S286 was less virulent than the wild type strain in a neonatal rat sepsis model with a significant lower level of bacteremia at 24 h (4.1±1.41 versus 2.60±0.16 log CFU/ml, p = 0.001) and mortality. However, the mortality in the model of adult mice was comparable between wild type and variant indicating that pS286colV is not sufficient by itself to fully explain the virulence of S286. Gene expression analysis of pS286colV in iron depleted environment was very close to that of pS88, suggesting that genes of CVP region may be expressed similarly in two very different genetic backgrounds (group C versus group B2). Screening a collection of 178 human A/B1 extraintestinal pathogenic E. coli (ExPEC) strains revealed that the CVP region is highly prevalent (23%) and MLST analysis indicated that these CVP positive strains belong to several clusters and mostly to phylogroup C. The virulence of S286 is explained in part by the presence of CVP region and this region has spread in different clusters of human A/B1 ExPEC, especially in group C. PMID:24086343

  20. A conserved virulence plasmidic region contributes to the virulence of the multiresistant Escherichia coli meningitis strain S286 belonging to phylogenetic group C.


    Lemaître, Chloé; Mahjoub-Messai, Farah; Dupont, Damien; Caro, Valérie; Diancourt, Laure; Bingen, Edouard; Bidet, Philippe; Bonacorsi, Stéphane


    Recent isolation of the non-K1 Escherichia coli neonatal meningitis strain S286, belonging to phylogroup C, which is closely related to major group B1, and producing an extended-spectrum beta-lactamase, encouraged us to seek the genetic determinants responsible for its virulence. We show that S286 belongs to the sequence O type ST23O78 and harbors 4 large plasmids. The largest one, pS286colV (~120 kb), not related to resistance, contains genes characteristic of a Conserved Virulence Plasmidic (CVP) region initially identified in B2 extra-intestinal avian pathogenic E. coli (APEC) strains and in the B2 neonatal meningitis E. coli strain S88. The sequence of this CVP region has a strong homology (98%) with that of the recently sequenced plasmid pChi7122-1 of the O78 APEC strain Chi7122. A CVP plasmid-cured variant of S286 was less virulent than the wild type strain in a neonatal rat sepsis model with a significant lower level of bacteremia at 24 h (4.1 ± 1.41 versus 2.60 ± 0.16 log CFU/ml, p = 0.001) and mortality. However, the mortality in the model of adult mice was comparable between wild type and variant indicating that pS286colV is not sufficient by itself to fully explain the virulence of S286. Gene expression analysis of pS286colV in iron depleted environment was very close to that of pS88, suggesting that genes of CVP region may be expressed similarly in two very different genetic backgrounds (group C versus group B2). Screening a collection of 178 human A/B1 extraintestinal pathogenic E. coli (ExPEC) strains revealed that the CVP region is highly prevalent (23%) and MLST analysis indicated that these CVP positive strains belong to several clusters and mostly to phylogroup C. The virulence of S286 is explained in part by the presence of CVP region and this region has spread in different clusters of human A/B1 ExPEC, especially in group C.

  1. Hepatocyte nuclear factor 1 regulates the expression of the organic cation transporter 1 via binding to an evolutionary conserved region in intron 1 of the OCT1 gene.


    O'Brien, Valerie P; Bokelmann, Kristin; Ramírez, Jacqueline; Jobst, Karoline; Ratain, Mark J; Brockmöller, Jürgen; Tzvetkov, Mladen V


    The organic cation transporter 1 (OCT1), also known as solute carrier family 22 member 1, is strongly and specifically expressed in the human liver. Here we show that the hepatocyte nuclear factor 1 (HNF1) regulates OCT1 transcription and contributes to the strong, liver-specific expression of OCT1. Bioinformatic analyses revealed strong conservation of HNF1 binding motifs in an evolutionary conserved region (ECR) in intron 1 of the OCT1 gene. Electrophoretic mobility shift and chromatin immunoprecipitation assays confirmed the specific binding of HNF1 to the intron 1 ECR. In reporter gene assays performed in HepG2 cells, the intron 1 ECR increased SV40 promoter activity by 22-fold and OCT1 promoter activity by 13-fold. The increase was reversed when the HNF1 binding sites in the intron 1 ECR were mutated or the endogenous HNF1α expression was downregulated with small interfering RNA. Following HNF1α overexpression in Huh7 cells, the intron 1 ECR increased SV40 promoter activity by 11-fold and OCT1 promoter activity by 6-fold. Without HNF1α overexpression, the increases were only 3- and 2-fold, respectively. Finally, in human liver samples, high HNF1 expression was significantly correlated with high OCT1 expression (r = 0.48, P = 0.002, n = 40). In conclusion, HNF1 is a strong regulator of OCT1 expression. It remains to be determined whether genetic variants, disease conditions, or drugs that affect HNF1 activity may affect the pharmacokinetics and efficacy of OCT1-transported drugs such as morphine, tropisetron, ondansetron, tramadol, and metformin. Beyond OCT1, this study demonstrates the validity and usefulness of interspecies comparisons in the discovery of functionally relevant genomic sequences.

  2. Sensitive detection of Tomato ringspot virus by real-time TaqMan RT-PCR targeting the highly conserved 3'-UTR region.


    Tang, Joe; Khan, Subuhi; Delmiglio, Catia; Ward, Lisa I


    A real-time TaqMan RT-PCR assay was developed for the rapid and sensitive detection of Tomato ringspot virus (ToRSV), an important plant virus which infects a wide range of fruit and ornamental crops. Primers and a probe were designed based on the highly conserved 3'-untranslated region (UTR) sequences of ToRSV, to amplify a 182bp fragment of this region of RNA-1 and RNA-2. The assay was demonstrated to reliably amplify all ToRSV isolates tested. The detection limit was estimated to be about 12 copies of the ToRSV target region. No amplification was observed from the RNA of other nepoviruses or healthy host species. A comparison with a published conventional RT-PCR and a SYBR-based qRT-PCR indicated that both of the published assays lacked reliability and sensitivity, as neither were able to amplify all ToRSV isolates tested, and both were approximately 1000 times less sensitive than the novel TaqMan real-time assay. This TaqMan real-time assay was tested using four different reagent kits and was shown to be robust and stable, with no significant differences in sensitivity between kits. It is expected that the implementation of this TaqMan real-time RT-PCR assay will facilitate efficient phytosanitary certification of nursery stock requiring testing for ToRSV by regulatory agencies, and will also have wider uses for the general detection of ToRSV in a range of hosts.

  3. Taxonomy and conservation of Vietnam's primates: a review.


    Blair, Mary E; Sterling, Eleanor J; Hurley, Martha M


    Vietnam has the highest number of primate taxa overall (24-27) and the highest number of globally threatened primate taxa (minimum 20) in Mainland Southeast Asia. Conservation management of these species depends in part on resolving taxonomic uncertainties, which remain numerous among the Asian primates. Recent research on genetic, morphological, and acoustic diversity in Vietnam's primates has clarified some of these uncertainties, although a number of significant classification issues still remain. Herein, we summarize and compare the major current taxonomic classifications of Vietnam's primates, discuss recent advances in the context of these taxonomies, and suggest key areas for additional research to best inform conservation efforts in a region crucial to global primate diversity. Among the most important next steps for the conservation of Vietnam's primates is a new consensus list of Asian primates that resolves current differences between major taxonomies, incorporates recent research advances, and recognizes units of diversity at scales below the species-level, whether termed populations, morphs, or subspecies. Priority should be placed on recognizing distinct populations, regardless of the species concept in use, in order to foster the evolutionary processes necessary for primate populations to cope with inevitable environmental changes. The long-term conservation of Vietnam's primates depends not only on an accepted and accurate taxonomy but also on funding for on-the-ground conservation activities, including training, and the continued dedication and leadership of Vietnamese researchers and managers.

  4. Arabic word recognizer for mobile applications

    NASA Astrophysics Data System (ADS)

    Khanna, Nitin; Abdollahian, Golnaz; Brame, Ben; Boutin, Mireille; Delp, Edward J.


    When traveling in a region where the local language is not written using a "Roman alphabet," translating written text (e.g., documents, road signs, or placards) is a particularly difficult problem since the text cannot be easily entered into a translation device or searched using a dictionary. To address this problem, we are developing the "Rosetta Phone," a handheld device (e.g., PDA or mobile telephone) capable of acquiring an image of the text, locating the region (word) of interest within the image, and producing both an audio and a visual English interpretation of the text. This paper presents a system targeted for interpreting words written in Arabic script. The goal of this work is to develop an autonomous, segmentation-free Arabic phrase recognizer, with computational complexity low enough to deploy on a mobile device. A prototype of the proposed system has been deployed on an iPhone with a suitable user interface. The system was tested on a number of noisy images, in addition to the images acquired from the iPhone's camera. It identifies Arabic words or phrases by extracting appropriate features and assigning "codewords" to each word or phrase. On a dictionary of 5,000 words, the system uniquely mapped (word-image to codeword) 99.9% of the words. The system has a 82% recognition accuracy on images of words captured using the iPhone's built-in camera.

  5. Evidence on How a Conserved Glycine in the Hinge Region of HapR Regulates Its DNA Binding Ability: LESSONS FROM A NATURAL VARIANT.

    SciTech Connect

    M Dongre; N Singh; C Dureja; N Peddada; A Solanki; F Ashish; S Raychaudhuri


    HapR has been recognized as a quorum-sensing master regulator in Vibrio cholerae. Because it controls a plethora of disparate cellular events, the absence of a functional HapR affects the physiology of V. cholerae to a great extent. In the current study, we pursued an understanding of an observation of a natural protease-deficient non-O1, non-O139 variant V. cholerae strain V2. Intriguingly, a nonfunctional HapR (henceforth designated as HapRV2) harboring a substitution of glycine to aspartate at position 39 of the N-terminal hinge region has been identified. An in vitro gel shift assay clearly suggested the inability of HapRV2 to interact with various cognate promoters. Reinstatement of glycine at position 39 restores DNA binding ability of HapRV2 (HapRV2G), thereby rescuing the protease-negative phenotype of this strain. The elution profile of HapRV2 and HapRV2G proteins in size-exclusion chromatography and their circular dichroism spectra did not reflect any significant differences to explain the functional discrepancies between the two proteins. To gain insight into the structure-function relationship of these two proteins, we acquired small/wide angle x-ray scattering data from samples of the native and G39D mutant. Although Guinier analysis and indirect Fourier transformation of scattering indicated only a slight difference in the shape parameters, structure reconstruction using dummy amino acids concluded that although HapR adopts a 'Y' shape similar to its crystal structure, the G39D mutation in hinge drastically altered the DNA binding domains by bringing them in close proximity. This altered spatial orientation of the helix-turn-helix domains in this natural variant provides the first structural evidence on the functional role of the hinge region in quorum sensing-related DNA-binding regulatory proteins of Vibrio spp.

  6. Collections Conservation.

    ERIC Educational Resources Information Center

    DeCandido, Robert

    Collections conservation is an approach to the preservation treatment of books and book-like materials that is conceptualized and organized in terms of large groups of materials. This guide is intended to enable a library to evaluate its current collections conservation activities. The introduction describes collections conservation and gives…

  7. 50 CFR 100.11 - Regional advisory councils.

    Code of Federal Regulations, 2010 CFR


    ... consistent with recognized principles of fish and wildlife conservation, and not be detrimental to the... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false Regional advisory councils. 100.11 Section 100.11 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE...

  8. Complete mitochondrial genome of the Tristram's Bunting, Emberiza tristrami (Aves: Passeriformes): the first representative of the family Emberizidae with six boxes in the central conserved domain II of control region.


    Kan, Xianzhao; Yuan, Jian; Zhang, Liqin; Li, Xifeng; Yu, Lei; Chen, Lei; Guo, Zhichun; Yang, Jianke


    Mitochondrial genome has proven to be a powerful tool for phylogenetic inference, phylogeography, and molecular evolution. In this study, we determined the complete mitochondrial genome of Emberiza tristrami (Passeriformes: Emberizidae) for use in future phylogenetic analyses. This circular mitochondrial genome is 16,789 bp in length and composed of 13 typical protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 putative control region (CR). One extra nucleotide "C" of nad3 is not detected in the mitogenome of E. tristrami. The CR of E. tristrami can be divided into three domains: ETAS (extended termination-associated sequence) domain I (nt 1-431), central conserved domain II (nt 432-847), and CSB (conserved sequence block) domain III (nt 848-1217). Six conserved sequence boxes in the central conserved domain II were identified as boxes F, E, D, C, b, and B.

  9. Energy Conservation Simplified

    NASA Astrophysics Data System (ADS)

    Hecht, Eugene


    The standard formulation of energy conservation involves the subsidiary ideas of kinetic energy (KE), work (W), thermal energy, internal energy, and a half-dozen different kinds of potential energy (PE): elastic, chemical, nuclear, gravitational, and so forth. These quantities came to be recognized during the centuries over which the principle developed. The final conservation law, although rich in specificity, is fairly involved. More significantly, it obscures a fundamental underlying simplicity, which could only be appreciated post-relativity (1905). Energy is the scalar measure of physical change. Using the special theory it will be shown that there are only two all-encompassing classifications of energy—energy of rest and energy of motion—and that we can apply the idea of conservation of energy to all physical processes using only these two energy types as quantified by mass and KE.

  10. Structure of the mitochondrial control region of the Eurasian otter (Lutra lutra; Carnivora, Mustelidae): patterns of genetic heterogeneity and implications for conservation of the species in Italy.


    Ketmaier, V; Bernardini, C


    In this study we determined the complete sequence of the mitochondrial DNA (mtDNA) control region of the Eurasian otter (Lutra lutra). We then compared these new sequences with orthologues of nine carnivores belonging to six families (Mustelidae, Mephitidae, Canidae, Hyaenidae, Ursidae, and Felidae). The comparative analyses identified all the conserved regions previously found in mammals. The Eurasian otter and seven other species have a single location with tandem repeats in the right domain, while the spotted hyena (Hyaenidae) and the tiger (Felidae) have repeated sequences in both the right and left domains. To assess the degree of genetic heterogeneity of the Eurasian otter in Italy we sequenced two fragments of the gene and analyzed length polymorphisms of repeated sequences and heteroplasmy in 32 specimens. The study includes 23 museum specimens collected in northern, central, and southern Italy; most of these specimens are from extinct populations, while the southern Italian samples belong to the sole extant Italian population of the Eurasian otter. The study also includes all the captive-reared animals living in the colony "Centro Lontra, Caramanico Terme" (Pescara, central Italy). The colony is maintained for reintroduction of the species. We found a low level of genetic polymorphism; a single haplotype is dominant, but our data indicate the presence in central and southern Italy of two slightly divergent haplotypes. One haplotype belongs to an extinct population, the other is present in the single extant Italian population. Analyses of length polymorphisms and heteroplasmy indicate that the autochthonous Italian samples are characterized by a distinct array of repeated sequences from captive-reared animals.

  11. Immune complexes in chronic Chagas disease patients are formed by exovesicles from Trypanosoma cruzi carrying the conserved MASP N-terminal region

    PubMed Central

    Díaz Lozano, Isabel María; De Pablos, Luis Miguel; Longhi, Silvia Andrea; Zago, María Paola; Schijman, Alejandro Gabriel; Osuna, Antonio


    The exovesicles (EVs) are involved in pathologic host-parasite immune associations and have been recently used as biomarkers for diagnosis of infectious diseases. The release of EVs by Trypanosoma cruzi, the causative agent of Chagas disease, has recently been described, with different protein cargoes including the MASP multigene family of proteins MASPs are specific to this parasite and characterized by a conserved C-terminal (C-term) region and an N-terminal codifying for a signal peptide (SP). In this investigation, we identified immature MASP proteins containing the MASP SP in EVs secreted by the infective forms of the parasite. Those EVs are responsible for the formation of immune complexes (ICs) containing anti-MASP SP IgGs in patients with different (cardiac, digestive and asymptomatic) chronic Chagas disease manifestations. Moreover, purified EVs as well as the MASP SP inhibit the action of the complement system and also show a significant association with the humoral response in patients with digestive pathologies. These findings reveal a new route for the secretion of MASP proteins in T. cruzi, which uses EVs as vehicles for immature and misfolded proteins, forming circulating immune complexes. Such complexes could be used in the prognosis of digestive pathologies of clinical forms of Chagas disease. PMID:28294160

  12. Integration of land-sharing and land-sparing conservation strategies through regional networking: the Mesoamerican Biological Corridor as a lifeline for carnivores in El Salvador.


    Crespin, Silvio J; García-Villalta, Jorge E


    Nations with little remaining natural habitat and small extent are challenged when trying to achieve biodiversity targets. We show that the Central American nation of El Salvador cannot viably sustain populations of 87 % of its extant carnivores, especially in the case of large-bodied species with low population densities. Current land-sparing strategies will not suffice; therefore we propose that land-sharing strategies be implemented in tandem with protected areas to expand current conservation efforts via new regional networks. In Central America such a network can be established by linking international protected area systems in a way that implements the existing vision for the Mesoamerican Biological Corridor. Specifically, we propose a re-envisioning of the Mesoamerican Biological Corridor in which land-sharing practices are adopted throughout the agricultural matrix while ensuring formal protection of the remaining natural habitat. Such an integration of land-sparing and land-sharing could result in the creation of an effective network of protected areas, thereby increasing the probability of safeguarding species with populations that overlap national borders.

  13. Immune complexes in chronic Chagas disease patients are formed by exovesicles from Trypanosoma cruzi carrying the conserved MASP N-terminal region

    NASA Astrophysics Data System (ADS)

    Díaz Lozano, Isabel María; de Pablos, Luis Miguel; Longhi, Silvia Andrea; Zago, María Paola; Schijman, Alejandro Gabriel; Osuna, Antonio


    The exovesicles (EVs) are involved in pathologic host-parasite immune associations and have been recently used as biomarkers for diagnosis of infectious diseases. The release of EVs by Trypanosoma cruzi, the causative agent of Chagas disease, has recently been described, with different protein cargoes including the MASP multigene family of proteins MASPs are specific to this parasite and characterized by a conserved C-terminal (C-term) region and an N-terminal codifying for a signal peptide (SP). In this investigation, we identified immature MASP proteins containing the MASP SP in EVs secreted by the infective forms of the parasite. Those EVs are responsible for the formation of immune complexes (ICs) containing anti-MASP SP IgGs in patients with different (cardiac, digestive and asymptomatic) chronic Chagas disease manifestations. Moreover, purified EVs as well as the MASP SP inhibit the action of the complement system and also show a significant association with the humoral response in patients with digestive pathologies. These findings reveal a new route for the secretion of MASP proteins in T. cruzi, which uses EVs as vehicles for immature and misfolded proteins, forming circulating immune complexes. Such complexes could be used in the prognosis of digestive pathologies of clinical forms of Chagas disease.

  14. Immune complexes in chronic Chagas disease patients are formed by exovesicles from Trypanosoma cruzi carrying the conserved MASP N-terminal region.


    Díaz Lozano, Isabel María; De Pablos, Luis Miguel; Longhi, Silvia Andrea; Zago, María Paola; Schijman, Alejandro Gabriel; Osuna, Antonio


    The exovesicles (EVs) are involved in pathologic host-parasite immune associations and have been recently used as biomarkers for diagnosis of infectious diseases. The release of EVs by Trypanosoma cruzi, the causative agent of Chagas disease, has recently been described, with different protein cargoes including the MASP multigene family of proteins MASPs are specific to this parasite and characterized by a conserved C-terminal (C-term) region and an N-terminal codifying for a signal peptide (SP). In this investigation, we identified immature MASP proteins containing the MASP SP in EVs secreted by the infective forms of the parasite. Those EVs are responsible for the formation of immune complexes (ICs) containing anti-MASP SP IgGs in patients with different (cardiac, digestive and asymptomatic) chronic Chagas disease manifestations. Moreover, purified EVs as well as the MASP SP inhibit the action of the complement system and also show a significant association with the humoral response in patients with digestive pathologies. These findings reveal a new route for the secretion of MASP proteins in T. cruzi, which uses EVs as vehicles for immature and misfolded proteins, forming circulating immune complexes. Such complexes could be used in the prognosis of digestive pathologies of clinical forms of Chagas disease.

  15. Alternative splicing within the elk-1 5' untranslated region serves to modulate initiation events downstream of the highly conserved upstream open reading frame 2.


    Rahim, Gwendoline; Araud, Tanguy; Jaquier-Gubler, Pascale; Curran, Joseph


    The 5' untranslated region (UTR) plays a central role in the regulation of mammalian translation initiation. Key components include RNA structure, upstream AUGs (uAUGs), upstream open reading frames (uORFs), and internal ribosome entry site elements that can interact to modulate the readout. We previously reported the characterization of two alternatively spliced 5' UTR isoforms of the human elk-1 gene. Both contain two uAUGs and a stable RNA stem-loop, but the long form (5' UTR(L)) was more repressive than the short form (5' UTR(S)) for initiation at the ELK-1 AUG. We now demonstrate that ELK-1 expression arises by a combination of leaky scanning and reinitiation, with the latter mediated by the small uORF2 conserved in both spliced isoforms. In HEK293T cells, a considerable fraction of ribosomes scans beyond the ELK-1 AUG in a reinitiation mode. These are sequestered by a series of out-of-frame AUG codons that serve to prevent access to a second in-frame AUG start site used to express short ELK-1 (sELK-1), an N-terminally truncated form of ELK-1 that has been observed only in neuronal cells. We present evidence that all these events are fine-tuned by the nature of the 5' UTR and the activity of the α subunit of eukaryotic initiation factor 2 and provide insights into the neuronal specificity of sELK-1 expression.

  16. Biodiversity funds and conservation needs in the EU under climate change.


    Lung, Tobias; Meller, Laura; van Teeffelen, Astrid J A; Thuiller, Wilfried; Cabeza, Mar


    Despite ambitious biodiversity policy goals, less than a fifth of the European Union's (EU) legally protected species and habitats show a favorable conservation status. The recent EU biodiversity strategy recognizes that climate change adds to the challenge of halting biodiversity loss, and that an optimal distribution of financial resources is needed. Here, we analyze recent EU biodiversity funding from a climate change perspective. We compare the allocation of funds to the distribution of both current conservation priorities (within and beyond Natura 2000) and future conservation needs at the level of NUTS-2 regions, using modelled bird distributions as indicators of conservation value. We find that funding is reasonably well aligned with current conservation efforts but poorly fit with future needs under climate change, indicating obstacles for implementing adaptation measures. We suggest revising EU biodiversity funding instruments for the 2014-2020 budget period to better account for potential climate change impacts on biodiversity.

  17. Sternocostoclavicular Hyperostosis: An Ill-Recognized Disease

    PubMed Central

    Roed, Bolette; Kristensen, Tatiana; Thorsen, Søren; Poulsen Bloch, Klaus; Afzelius, Pia


    Sternocostoclavicular hyperostosis (SCCH) is an ill-recognized, rarely diagnosed disease. Today, SCCH is widely considered part of the synovitis, acne, pustulosis, hyperostosis and osteitis (SAPHO) syndrome. SCCH develops over years with intermittent attacks of pain, swelling, and reddening of the sternocostoclavicular region. The disease causes progressive hyperostosis, fusion of the sternocostoclavicular joints, and soft tissue ossification. SCCH is chronic, non-malignant, and occurs predominantly bilaterally in middle-aged women. The incidence of the disease is unknown. We present a case of isolated SCCH, where chest radiographs showed a clear development of bilateral disease over the course of more than a decade. Whole-body bone scintigraphy was performed and was suggestive of SCCH. The diagnosis was established as late as 14 years from the onset of symptoms. During this period, the patient underwent several inconclusive examinations, resulting in a delay of diagnosis and in prolonged and aggravated symptoms. With this case report, we want to draw attention to SCCH and the importance of early diagnosis of the disease. PMID:27527220

  18. Evidence on how a conserved glycine in the hinge region of HapR regulates its DNA binding ability: lessons from a natural variant.


    Dongre, Mitesh; Singh, Naorem Santa; Dureja, Chetna; Peddada, Nagesh; Solanki, Ashish K; Ashish; Raychaudhuri, Saumya


    HapR has been recognized as a quorum-sensing master regulator in Vibrio cholerae. Because it controls a plethora of disparate cellular events, the absence of a functional HapR affects the physiology of V. cholerae to a great extent. In the current study, we pursued an understanding of an observation of a natural protease-deficient non-O1, non-O139 variant V. cholerae strain V2. Intriguingly, a nonfunctional HapR (henceforth designated as HapR(V2)) harboring a substitution of glycine to aspartate at position 39 of the N-terminal hinge region has been identified. An in vitro gel shift assay clearly suggested the inability of HapR(V2) to interact with various cognate promoters. Reinstatement of glycine at position 39 restores DNA binding ability of HapR(V2) (HapR(V2G)), thereby rescuing the protease-negative phenotype of this strain. The elution profile of HapR(V2) and HapR(V2G) proteins in size-exclusion chromatography and their circular dichroism spectra did not reflect any significant differences to explain the functional discrepancies between the two proteins. To gain insight into the structure-function relationship of these two proteins, we acquired small/wide angle x-ray scattering data from samples of the native and G39D mutant. Although Guinier analysis and indirect Fourier transformation of scattering indicated only a slight difference in the shape parameters, structure reconstruction using dummy amino acids concluded that although HapR adopts a "Y" shape similar to its crystal structure, the G39D mutation in hinge drastically altered the DNA binding domains by bringing them in close proximity. This altered spatial orientation of the helix-turn-helix domains in this natural variant provides the first structural evidence on the functional role of the hinge region in quorum sensing-related DNA-binding regulatory proteins of Vibrio spp.

  19. Conservation of wading birds

    USGS Publications Warehouse

    Kushlan, J.A.


    The conservation and management of wading birds has received considerable attention over the past twenty years, through research, population monitoring, habitat protection, and through activities of specialist groups devoted to all three groups, the herons, ibises and allies, and flamingos. While populations are best known in North America, greatest advances in knowledge may have come in Australasia. The status of most species and many populations is now sufficiently known to allow assessment of risk. Conservation and management techniques allow creation of global and regional action plans for conservation of many species. Global action plans are being developed, but few regional plans have been undertaken. Management of nesting sites is now particularly well appreciated. Although known in broad stroke, much remains to be learned about managing feeding habitat. Problems related to disturbance, conflict with humans, habitat loss, contaminants and other environmental stresses remain for some species and many populations. New challenges lie in creating conservation action that account for genetic stocks.

  20. Conservation Laws

    NASA Astrophysics Data System (ADS)

    Dewitt, Bryce; Christensen, Steven M.

    In the case of the free particle, we interpreted various components of the energy-momentum-stress density as fluxes of energy and momentum. This interpretation can obviously be extended also to particle ensembles and gases. When we speak of fluxes we usually think of quantities that are conserved. In special relativity, energy and momentum are conserved. In general relativity, they are no longer generally conserved, at least if we do not include the energy and momentum of the gravitational field itself. Nevertheless, their densities and fluxes satisfy a covariant generalization of a true conservation law, which is quite easy to obtain.

  1. Higher-Order Neural Networks Recognize Patterns

    NASA Technical Reports Server (NTRS)

    Reid, Max B.; Spirkovska, Lilly; Ochoa, Ellen


    Networks of higher order have enhanced capabilities to distinguish between different two-dimensional patterns and to recognize those patterns. Also enhanced capabilities to "learn" patterns to be recognized: "trained" with far fewer examples and, therefore, in less time than necessary to train comparable first-order neural networks.

  2. Vitrification: Machines learn to recognize glasses

    NASA Astrophysics Data System (ADS)

    Ceriotti, Michele; Vitelli, Vincenzo


    The dynamics of a viscous liquid undergo a dramatic slowdown when it is cooled to form a solid glass. Recognizing the structural changes across such a transition remains a major challenge. Machine-learning methods, similar to those Facebook uses to recognize groups of friends, have now been applied to this problem.

  3. Post-transcriptional regulation of cytokine genes in fish: A role for conserved AU-rich elements located in the 3'-untranslated region of their mRNAs.


    Roca, Francisco J; Cayuela, María L; Secombes, Chris J; Meseguer, José; Mulero, Victoriano


    The overproduction of cytokines, such us interleukin-1beta (IL-1beta) and tumor necrosis factor alpha (TNFalpha), contributes to the pathological complications observed in many inflammatory diseases caused by bacterial endotoxins. The synthesis of these cytokines is tightly regulated at both transcriptional and post-transcriptional levels. Post-transcriptional regulation of gene expression depends on specific cis-acting sequences and trans-acting factors. Thus, the presence of adenylate- and uridylate-rich (AU-rich) elements (AREs) has been described in the 3'-untranslated regions (UTRs) of many unstable mammalian mRNAs. Although, it represents the most widespread, phylogenetically conserved and efficient determinant of mRNA stability among those so far characterized in mammalian cells, no studies are available on the functional relevance of this sequence in non-mammalian vertebrates. In this contribution, we study the enzymatic activity of various luciferase reporter constructs, containing or lacking the 3'UTR of IL-1beta and TNFalpha from different fish species, and report the finding that bony fish AREs are able to decrease luciferase activity but are less potent than their mammalian counterparts. Surprisingly, the 3'UTR of the IL-1beta from the cartilaginous fish small spotted catshark had the greatest ability to decrease luciferase activity. Lastly, the functional significance of the above was confirmed by measuring the half-life of IL-1beta and TNFalpha mRNAs in gilthead seabream leukocytes by blocking transcription with actinomycin D. Both cytokine mRNAs were unstable with an estimated half-life of about 45 min in control and activated cells.

  4. Roles of the highly conserved amino acids in the globular head and stalk region of the Newcastle disease virus HN protein in the membrane fusion process.


    Sun, Chengxi; Wen, Hongling; Chen, Yuzhen; Chu, Fulu; Lin, Bin; Ren, Guijie; Song, Yanyan; Wang, Zhiyu


    Newcastle disease virus (NDV), an avain paramyxovirus, has been assigned to the genus Avulavirus within the family Paramyxoviridae. It causes Newcastle disease (ND) that is a highly contagious and fatal viral disease affecting poultry and most species of birds. The hemagglutinin-neuraminidase (HN) protein of NDV has multiple functions including mediating hemadsorption (HAD), neuraminidase (NA), and fusion promotion activities affecting the process of viral attachment, entry, replication and dissemination. Fusion ability of the NDV was highly correlated to its virulence. Mutations in the HN globular head and headless HN of NDV were constructed to determinate the impact of highly conserved amino acids in the globular head of paramyxovirus HN proteins and the roles of the stalk region of HN in the fusion process. It was found that the interaction between F and HN mutants E401A, G402A, G468A, V469A, Y526A, and T527A was equal to that in F and wt HN. The mutations of G402A, G468A, V469A, and T527A had various effects on cell fusion promotion, receptor binding ability, and NA activity, but the membrane merging rate was comparable to wt HN. The elimination of hemadsorption ability and NA activity of E401A and Y526A resulted in the loss of the fusion promotion function of HN. The conclusion was that receptor binding and NA had a common active site and E401 and Y526 amino acids were essential for virus attachment, entry, and dissemination. In addition, G468A mutation made different contributions to HAD and NA, which indicated that G468 was one of the potential key amino acids in switching the two functions between receptor binding and sialic acid destruction of HN. It was also proven that the headless HN of NDV could promote the fusion event mediated by F. Thus, it revealed a novel mechanism in F activation of NDV.

  5. Sensitive and Specific Serodiagnosis of Lyme Disease by Enzyme-Linked Immunosorbent Assay with a Peptide Based on an Immunodominant Conserved Region of Borrelia burgdorferi VlsE

    PubMed Central

    Liang, Fang Ting; Steere, Allen C.; Marques, Adriana R.; Johnson, Barbara J. B.; Miller, James N.; Philipp, Mario T.


    VlsE, the variable surface antigen of Borrelia burgdorferi, contains an immunodominant conserved region named IR6. In the present study, the diagnostic performance of a peptide enzyme-linked immunosorbent assay (ELISA) based on a 26-mer synthetic peptide (C6) with the IR6 sequence was explored. Sensitivity was assessed with serum samples (n = 210) collected from patients with clinically defined Lyme disease at the acute (early localized or early disseminated disease), convalescent, or late disease phase. The sensitivities for acute-, convalescent-, and late-phase specimens were 74% (29 of 39), 85 to 90% (34 of 40 to 35 of 39), and 100% (59 of 59), respectively. Serum specimens from early neuroborreliosis patients were 95% positive (19 of 20), and those from an additional group of patients with posttreatment Lyme disease syndrome yielded a sensitivity of 62% (8 of 13). To assess the specificity of the peptide ELISA, 77 serum samples from patients with other spirochetal or chronic infections, autoimmune diseases, or neurologic diseases and 99 serum specimens from hospitalized patients in an area where Lyme disease is not endemic were examined. Only two potential false positives from the hospitalized patients were found, and the overall specificity was 99% (174 of 176). Precision, which was assessed with a panel of positive and negative serum specimens arranged in blinded duplicates, was 100%. Four serum samples with very high anti-OspA antibody titers obtained from four monkeys given the OspA vaccine did not react with the C6 peptide. This simple, sensitive, specific, and precise ELISA may contribute to alleviate some of the remaining problems in Lyme disease serodiagnosis. Because of its synthetic peptide base, it will be inexpensive to manufacture. It also will be applicable to serum specimens from OspA-vaccinated subjects. PMID:10565920

  6. Spliceosomal introns in the 5′ untranslated region of plant BTL RING-H2 ubiquitin ligases are evolutionary conserved and required for gene expression

    PubMed Central


    Background Introns located close to the 5′ end of a gene or in the 5′ untranslated region often exert positive effects on gene expression. This effect, known as intron-mediated enhancement (IME), has been observed in diverse eukaryotic organisms, including plants. The sequences involved in IME seem to be spread across the intron and function in an additive manner. The IMEter algorithm was developed to predict plant introns that may enhance gene expression. We have identified several plant members of the BTL class of E3s, which may have orthologs across eukaryotes, that contain a 5′UTR intron. The RING finger E3 ligases are key enzymes of the ubiquitination system that mediate the transfer of ubiquitin to substrates. Results In this study, we retrieved BTL sequences from several angiosperm species and found that 5′UTR introns showing a strong IMEter score were predicted, suggesting that they may be conserved by lineage. Promoter-GUS fusion lines were used to confirm the IME effect of these 5′UTR introns on gene expression. IMEter scores of BTLs were compared with the 5′UTR introns of two gene families MHX and polyubiquitin genes. Conclusions Analysis performed in two Arabidopsis BTL E3 ligases genes indicated that the 5′UTR introns were essential for gene expression in all the tissues tested. Comparison of the average 5′UTR intron size on three gene families in ten angiosperm species suggests that a prevalent size for a 5′UTR intron is in the range of 600 nucleotides, and that the overall IMEter score within a gene family is preserved across several angiosperms. Our results indicated that gene expression dependent on a 5′UTR intron is an efficient regulatory mechanism in BTL E3 ligases that has been preserved throughout plant evolution. PMID:24228887

  7. 75 FR 48723 - Meeting Announcement: Neotropical Migratory Bird Conservation Advisory Group

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Fish and Wildlife Service Meeting Announcement: Neotropical Migratory Bird Conservation Advisory Group... the Neotropical Migratory Bird Conservation Act (NMBCA) grants program (Advisory Group) will meet in.... SUPPLEMENTARY INFORMATION: Recognizing the importance of conserving migratory birds, the U.S. Congress...

  8. Conservation Tillage

    NASA Astrophysics Data System (ADS)

    Gebhardt, Maurice R.; Daniel, Tommy C.; Schweizer, Edward E.; Allmaras, Raymond R.


    Conservation production systems combine tillage and planting practices to reduce soil erosion and loss of water from farmland. Successful conservation tillage practices depend on the ability of farm managers to integrate sound crop production practices with effective pest management systems. More scientific information is needed to determine the relations between tillage practices and physical, chemical, and biological soil factors that affect plant and pest ecology. There is a need to devise improved pest management strategies for conservation tillage and to better understand the impact of conservation tillage on water quality, especially as it is related to use of agricultural chemicals. While savings in fuel, labor, and soil have induced many farmers to adopt conservation tillage, improved methods and equipment should increase adoption even more.

  9. Self-Amplified Optical Pattern Recognizer

    NASA Technical Reports Server (NTRS)

    Liu, Hua-Kuang


    Self-amplified optical pattern recognizers developed for use in recognition of patterns, in optical computing, and in optoelectronic neural networks. In recognizer, photorefractive crystal serves as medium in which one holographically records diffraction-grating filter representing pattern with which recognition sought. Apparatus "self-amplified" because signal amplified within filter to many orders of magnitude greater than in prior optical pattern recognizers. Basic principle of operation applicable to many types of correlation filters, including (but not limited to) Vander Lugt matched filters, joint-transform filters, and phase-only filters.

  10. Isolation and characterization of cDNA clones encoding the Drosophila homolog of the HMG-box SSRP family that recognizes specific DNA structures.

    PubMed Central

    Bruhn, S L; Housman, D E; Lippard, S J


    Recently an HMG-box protein denoted SSRP1, for structure-specific recognition protein 1, has been discovered which binds to specific DNA structural elements such as the bent, unwound conformations that occur upon the formation of intrastrand crosslinks by the anticancer drug cisplatin. The SSRP family includes the mouse protein T160, which recognizes recombination signal sequences. In order to delineate functional domains more clearly, a homolog of SSRP1 was cloned from Drosophila melanogaster. This homolog maps to polytene region 60A (1-4) and shares 54% identity with human SSRP1. Comparison of the predicted amino acid sequences among SSRP family members reveals 48% identity, with structural conservation in the carboxy terminus of the HMG box as well as domains of highly charged residues. Interestingly, however, the most highly conserved regions of the protein are in the less well understood amino terminus, strongly suggesting that this portion of the protein is critical for its function. Images PMID:8479916

  11. Social cognition: feeling voices to recognize emotions.


    Adolphs, Ralph


    Our understanding of how we simulate other people's actions and feelings to recognize their emotional states is extended by a new study which finds that premotor and somatosensory cortices are required to process the emotional meaning of sounds.

  12. Immune Cells in Blood Recognize Tumors

    NCI scientists have developed a novel strategy for identifying immune cells circulating in the blood that recognize specific proteins on tumor cells, a finding they believe may have potential implications for immune-based therapies.

  13. M.(phi)BssHII, a novel cytosine-C5-DNA-methyltransferase with target-recognizing domains at separated locations of the enzyme.

    PubMed Central

    Sethmann, S; Ceglowski, P; Willert, J; Iwanicka-Nowicka, R; Trautner, T A; Walter, J


    In all cytosine-C5-DNA-methyltransferases (MTases) from prokaryotes and eukaryotes, remarkably conserved amino acid sequence elements responsible for general enzymatic functions are arranged in the same canonical order. In addition, one variable region, which includes the target-recognizing domain(s) (TRDs) characteristic for each enzyme, has been localized in one region between the same blocks of these conserved elements. This conservation in the order of conserved and variable sequences suggests stringent structural constraints in the primary structure to obtain the correct folding of the enzymes. Here we report the characterization of a new type of a multispecific MTase, M.(phiphi)BssHII, which is expressed as two isoforms. Isoform I is an entirely novel type of MTase which has, in addition to the TRDs at the conventional location, one TRD located at a non-canonical position at its N-terminus. Isoform II is represented by the same MTase, but without the N-terminal TRD. The N-terminal TRD provides HaeII methylation specificity to isoform I. The TRD is fully functional when engineered into either the conventional variable region of M.(phiphi)BssHII or the related monospecific M.phi3TII MTase. The implications of this structural plasticity with respect to the evolution of MTases are discussed. PMID:10369689

  14. Energy Conservation

    ERIC Educational Resources Information Center

    Abelson, Philip H.


    Comments on The Potential for Energy Conservation,'' a study by the Office of Emergency Preparedness, emphasizing the coming dependence on foreign oil, and presses for government influence to encourage development of more efficient cars. (AL)

  15. Conservation Presentation.

    ERIC Educational Resources Information Center

    Friday, Gerald


    Introduces a project in which students teach about the importance of recycling and conservation by presenting demonstrations. Includes demonstrations on water, plastic, and other recycling products such as steel. (YDS)

  16. Conservation businesses and conservation planning in a biological diversity hotspot.


    Di Minin, Enrico; Macmillan, Douglas Craig; Goodman, Peter Styan; Escott, Boyd; Slotow, Rob; Moilanen, Atte


    The allocation of land to biological diversity conservation competes with other land uses and the needs of society for development, food, and extraction of natural resources. Trade-offs between biological diversity conservation and alternative land uses are unavoidable, given the realities of limited conservation resources and the competing demands of society. We developed a conservation-planning assessment for the South African province of KwaZulu-Natal, which forms the central component of the Maputaland-Pondoland-Albany biological diversity hotspot. Our objective was to enhance biological diversity protection while promoting sustainable development and providing spatial guidance in the resolution of potential policy conflicts over priority areas for conservation at risk of transformation. The conservation-planning assessment combined spatial-distribution models for 646 conservation features, spatial economic-return models for 28 alternative land uses, and spatial maps for 4 threats. Nature-based tourism businesses were competitive with other land uses and could provide revenues of >US$60 million/year to local stakeholders and simultaneously help meeting conservation goals for almost half the conservation features in the planning region. Accounting for opportunity costs substantially decreased conflicts between biological diversity, agricultural use, commercial forestry, and mining. Accounting for economic benefits arising from conservation and reducing potential policy conflicts with alternative plans for development can provide opportunities for successful strategies that combine conservation and sustainable development and facilitate conservation action.

  17. Conservation assessment of the terrestrial ecoregions of latin America and the Caribbean

    SciTech Connect

    Dinerstein, E.; Olson, D.M.; Graham, D.J.; Webster, A.L.; Primm, S.A.


    This priority-setting study elevates, as a first principle, maintaining the representation of all ecosystem and habitat types in regional investment portfolios. Second, it recognizes landscape-level features as an essential guide for effective conservation planning. The study`s biogeographic approach to setting conservation priorities begins by dividing LaC into 5 major ecosystem types (METs), 11 major habitat types (MHTs), and 191 ecoregions. This last number includes 13 mangrove complexes but otherwise includes marine areas and freshwater habitats (except large, geographically continguous freshwater ecosystems).

  18. Positive impacts in soil and water conservation in an Andean region of South America: Case scenarios from a USAID multidisciplinary cooperative project

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The USAID-SANREM-Virginia Polytechnic Institute project has made and continues to make an excellent impact, specifically showcasing the positive results of soil and water conservation (Barrera et al. 2010a; 2010b). This project has strong international cooperation between the USA, Ecuador and Bolivi...

  19. Recognizing the Presidents: Was Alexander Hamilton President?


    Roediger, Henry L; DeSoto, K Andrew


    Studies over the past 40 years have shown that Americans can recall about half the U.S. presidents. Do people know the presidents even though they are unable to access them for recall? We investigated this question using the powerful cues of a recognition test. Specifically, we tested the ability of 326 online subjects to recognize U.S. presidents when presented with their full names among various types of lures. The hit rate for presidential recognition was .88, well above the proportion produced in free recall but far from perfect. Presidents Franklin Pierce and Chester Arthur were recognized less than 60% of the time. Interestingly, four nonpresidents were falsely recognized at relatively high rates, and Alexander Hamilton was more frequently identified as president than were several actual presidents. Even on a recognition test, knowledge of American presidents is imperfect and prone to error. The false alarm data support the theory that false fame can arise from contextual familiarity.

  20. Regional hotspots of butterfly diversity in a protected area: Are they indicators of unique assemblages and areas with more species of conservation concern?

    NASA Astrophysics Data System (ADS)

    Gutiérrez, David; Menéndez, Rosa


    The implementation of biodiversity studies to set conservation priorities assumes that the different criteria used in prioritisation are correlated. Based on butterfly data, we examined whether high total diversity (species density and richness), unique species assemblages, and high numbers of different categories of Species of European Conservation Concern (SPEC) were co-located in the same habitats in the Picos de Europa National Park, Spain. Species density (number of species per sample) declined with elevation and was significantly higher in Genista shrublands on southern slopes (Southern Genista shrubland). We found unique species assemblages for Southern Genista shrublands, heathlands, mown meadows and subalpine meadows, whereas Genista shrubland on northern slopes (Northern Genista shrubland) and pastures were occupied by more habitat generalist species. We also found an effect of elevation on species composition. Species with global distributions concentrated in Europe (SPECs 4b) tended to be associated with Southern Genista shrubland, whereas species with global distributions restricted to Europe (SPECs 4a) were associated with higher elevations. Thus, we suggest a higher conservation value for butterfly assemblages located both on Southern Genista shrublands and at high elevations as they contain unique assemblages with a higher number of SPECs. By comparing our data with a previous study on carabid beetles, we found a low coincidence between butterflies and beetles for habitats with high species diversity and unique assemblages. Our study suggests that preserving areas in the landscape supporting higher butterfly diversity only partially preserves those species of greater conservation concern, and that butterflies cannot be used as a reliable indicator of other priority taxa for conservation, such as carabid beetles.

  1. Equipping African American Clergy to Recognize Depression.


    Anthony, Jean Spann; Morris, Edith; Collins, Charles W; Watson, Albert; Williams, Jennifer E; Ferguson, Bʼnai; Ruhlman, Deborah L


    Many African Americans (AAs) use clergy as their primary source of help for depression, with few being referred to mental health providers. This study used face-to-face workshops to train AA clergy to recognize the symptoms and levels of severity of depression. A pretest/posttest format was used to test knowledge (N = 42) about depression symptoms. Results showed that the participation improved the clergy's ability to recognize depression symptoms. Faith community nurses can develop workshops for clergy to improve recognition and treatment of depression.

  2. Recognizing and responding to hyperglycaemic emergencies.


    Kisiel, Maria; Marsons, Lorraine

    Diabetic ketoacidosis (DKA) and hyperglycaemic hyperosmolar state (HHS) are both diabetic emergencies associated with hyperglycaemia and can be fatal if healthcare professionals fail to recognize and intervene appropriately. While many students and qualified nurses may be able to recall common signs and symptoms related to DKA and HHS - for example polyuria, polydipsia and elevated blood sugars - understanding the physiological mechanisms behind abnormal observations and restoring homeostasis through appropriate management is far more complex. Health educators can play a significant role in contextualizing difficult concepts, such as DKA and HHS, so that these complex conditions can be recognized with greater confidence and competence in clinical practice.

  3. Recognizing and treating anxiety disorders in children.


    Kelly, Maria N


    Anxiety disorders are a common group of disorders that must be recognized more frequently by pediatricians. Outcomes can be very successful with prompt recognition and early treatment. For this reason, it is important that pediatricians recognize their central role in integrating sociological, psychological, and biological approaches to treatment. Pediatricians are vital for initial assessment, interventions, management of psychotherapeutic and pharmacotherapeutic treatments, and referral to psychiatrists and psychologists when necessary. An improved understanding of anxiety disorders by pediatricians will lead to improved diagnosis and improved quality of life for many undiagnosed pediatric patients suffering from anxiety.

  4. A mini-RNA containing the tetraloop, wobble-pair and loop E motifs of the central conserved region of potato spindle tuber viroid is processed into a minicircle.


    Schrader, O; Baumstark, T; Riesner, D


    A Mini-RNA from potato spindle tuber viroid (PSTVd) was constructed specifically for cleavage and ligation to circles in vitro. It contains the C-domain with the so-called central conserved region (CCR) of PSTVd with a 17 nt duplication in the upper strand and hairpin structures at the left and rights ends of the secondary structure. The CCR was previously shown to be essential for processing of in vitro transcripts. When folded under conditions which favor formation of a kinetically controlled conformation and incubated in a potato nuclear extract, the Mini-RNA is cleaved correctly at the 5'- and the 3'-end and ligated to a circle. Thus, the CCR obviously contains all structural and functional requirements for correct processing and therefore may be regarded as 'processing domain' of PSTVd. Using the Mini-RNA as a model substrate, the structural and functional relevance of its conserved non-canonical motifs GAAA tetraloop, loop E and G:U wobble base pair were studied by mutational analysis. It was found that (i) the conserved GAAA tetraloop is essential for processing by favoring the kinetically controlled conformation, (ii) a G:U wobble base pair at the 5'-cleavage site contributes to its correct recognition and (iii) an unpaired nucleotide in loop E, which is different from the corresponding nucleotide in the conserved loop E motif, is essential for ligation of the 5'- with the 3'-end. Hence all three structural motifs are functional elements for processing in a potato nuclear extract.

  5. Evaluating local benefits from conservation in Nepal's Annapurna Conservation Area.


    Spiteri, Arian; Nepal, Sanjay K


    Protected areas are integral to the global effort to conserve biodiversity, and, over the past two decades, protected area managers have begun to recognize that conservation objectives are next to impossible to achieve without considering the needs and concerns of local communities. Incentive-based programs (IBPs) have become a favored approach to protected area management, geared at fostering local stewardship by delivering benefits tied to conservation to local people. Effective IBPs require benefits to accrue to and be recognized by those experiencing the greatest consequences as a result of the protected area, and those likely to continue extractive activities if their livelihood needs are compromised. This research examines dispersal of IBP benefits, as perceived by local residents in Nepal's Annapurna Conservation Area. Results reported here are based on questionnaire interviews with 188 households conducted between September and December 2004. Results indicate that local residents primarily identify benefits from social development activities, provisions for resource extraction, and economic opportunities. Overall, benefits have been dispersed equally to households in villages on and off the main tourist route, and regardless of a household's participation in tourism. However, benefits are not effectively targeted to poorer residents, those highly dependent on natural resources, and those experiencing the most crop damage and livestock loss from protected wildlife. This article provides several suggestions for improving the delivery of conservation incentives.

  6. Great Apes' Capacities to Recognize Relational Similarity

    ERIC Educational Resources Information Center

    Haun, Daniel B. M.; Call, Josep


    Recognizing relational similarity relies on the ability to understand that defining object properties might not lie in the objects individually, but in the relations of the properties of various object to each other. This aptitude is highly relevant for many important human skills such as language, reasoning, categorization and understanding…

  7. 26 CFR 601.502 - Recognized representative.

    Code of Federal Regulations, 2010 CFR


    ... 26 Internal Revenue 20 2010-04-01 2010-04-01 false Recognized representative. 601.502 Section 601.502 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INTERNAL REVENUE... before the Internal Revenue Service and is in active status pursuant to the requirements of Circular...

  8. Can You Recognize a Heart Attack? Quiz


    ... Heart Attack? Updated:Sep 16,2016 Begin the quiz Heart Attack • Home • About Heart Attacks Acute Coronary ... in Women “Can you recognize a heart attack?” Quiz • Understand Your Risks to Prevent a Heart Attack ...

  9. How Should a Speech Recognizer Work?

    ERIC Educational Resources Information Center

    Scharenborg, Odette; Norris, Dennis; ten Bosch, Louis; McQueen, James M.


    Although researchers studying human speech recognition (HSR) and automatic speech recognition (ASR) share a common interest in how information processing systems (human or machine) recognize spoken language, there is little communication between the two disciplines. We suggest that this lack of communication follows largely from the fact that…

  10. Stent Fracture: How Frequently Is It Recognized?

    PubMed Central

    Mohsen, Mohammed Khalil; Alqahtani, Awad; Al suwaidi, Jassim


    In spite of there being several case reports, coronary stent fracture is not a well-recognized entity and incidence rates are likely to be underestimated. In this article, we review different aspects of stent fracture, including incidence, classification, predictors, outcome, diagnosis, and management. PMID:23983912

  11. Recently recognized chromosomal defects of clinical importance.

    PubMed Central

    Pembrey, M.; Baraitser, M.


    We review those conditions which have recently been recognized to be associated with small, sometimes difficult to detect, chromosomal abnormalities. These include the Prader-Willi syndrome and X-linked mental retardation. Images Figure 1 Figure 2 Figure 3 PMID:3540928

  12. Recognizing and Responding to a Suicide Crisis.

    ERIC Educational Resources Information Center

    Hendin, Herbert; Maltsberger, John T.; Lipschitz, Alan; Haas, Ann Pollinger; Kyle, Jennifer


    Data from therapists who were treating 26 patients when they committed suicide were utilized to identify warning signs. Problems in communication between patient and therapist were identified as factors interfering with crisis recognition. Evaluation of the identified affects and behaviors may help therapists recognize a suicide crisis. (BF)

  13. EPA recognizes Texas AandM Agrilife

    EPA Pesticide Factsheets

    DALLAS - (Oct. 13, 2015) The U.S. Environmental Protection Agency (EPA) recently recognized Texas A&M Agrilife Research Extension Center at Dallas during the 2015 WaterSmart Innovations Conference and Exposition in Las Vegas, Nev. The center rec

  14. 10 CFR 431.447 - Department of Energy recognition of nationally recognized certification programs.

    Code of Federal Regulations, 2013 CFR


    ... EFFICIENCY PROGRAM FOR CERTAIN COMMERCIAL AND INDUSTRIAL EQUIPMENT Small Electric Motors Energy Conservation Standards § 431.447 Department of Energy recognition of nationally recognized certification programs. (a... reference, see § 431.443) or similar procedures and methodologies for determining the energy efficiency...

  15. 10 CFR 431.447 - Department of Energy recognition of nationally recognized certification programs.

    Code of Federal Regulations, 2014 CFR


    ... EFFICIENCY PROGRAM FOR CERTAIN COMMERCIAL AND INDUSTRIAL EQUIPMENT Small Electric Motors Energy Conservation Standards § 431.447 Department of Energy recognition of nationally recognized certification programs. (a... reference, see § 431.443) or similar procedures and methodologies for determining the energy efficiency...

  16. [Conservation Units.

    ERIC Educational Resources Information Center

    Texas Education Agency, Austin.

    Each of the six instructional units deals with one aspect of conservation: forests, water, rangeland, minerals (petroleum), and soil. The area of the elementary school curriculum with which each correlates is indicated. Lists of general and specific objectives are followed by suggested teaching procedures, including ideas for introducing the…

  17. [Conservation Units.

    ERIC Educational Resources Information Center

    Texas Education Agency, Austin.

    Instructional units deal with each aspect of conservation: forests, wildlife, rangelands, water, minerals, and soil. The area of the secondary school curriculum with which each is correlated is indicated. Lists of general and specific objectives are followed by suggested teaching procedures, including ideas for introducing the topic, questions to…

  18. Marketing Conservation.

    ERIC Educational Resources Information Center

    Ellis, William B.


    In 1986, Northeast Utilities began helping shool administrators combat school building energy wastage through a program called Energy Alliance. The typical school can reduce its energy bill by 30 percent by adopting a wide range of conservation measures, including cogeneration, relamping, and energy audits. (MLH)

  19. Lighting Conservation

    ERIC Educational Resources Information Center

    Arnold, Frank D.


    With the energy crisis has come an awareness of wasteful consumption practices. One area where research is being done is in lighting conservation. Information in this article is concerned with finding more effective and efficient lighting designs which include daylight utilization, task-oriented lighting, and lighting controls. (MA)

  20. Colorful Conservation

    ERIC Educational Resources Information Center

    Skophammer, Karen


    Some people only think about conservation on Earth Day. Being in the "art business" however, this author is always conscious of the many products she thinks get wasted when they could be reused, recycled, and restored--especially in a school building and art room. In this article, she describes an art lesson that allows students to paint…

  1. Generation of robust CD8+ T cell responses against subdominant epitopes in conserved regions of HIV-1 by repertoire mining with mimotopes

    PubMed Central

    Schaubert, Keri L.; Price, David A.; Salkowitz, Janelle R.; Sewell, Andrew K.; Sidney, John; Asher, Tedi E.; Blondelle, Sylvie E.; Adams, Sharon; Marincola, Francesco M.; Joseph, Aviva; Sette, Alessandro; Douek, Daniel C.; Ayyavoo, Velpandi; Storkus, Walter; Leung, Ming-Ying; Ng, Hwee L.; Yang, Otto O.; Goldstein, Harris; Wilson, Darcy B.; Kan-Mitchell, June


    Summary HLA-A*0201-restricted virus-specific CD8+ cytotoxic T lymphocytes (CTLs) do not appear to control HIV effectively in vivo. To enhance the immunogenicity of a highly conserved subdominant epitope, TV9 (TLNAWVKVV, p24 Gag19–27), mimotopes were designed by screening a large combinatorial nonapeptide library with TV9-specific CTLs primed in vitro from healthy donors. A mimic peptide with a low binding affinity to HLA-A*0201, TV9p6 (KINAWIKVV), was studied further. Parallel cultures of in vitro-primed CTLs showed that TV9p6 consistently activated crossreactive and equally functional CTLs as measured by cytotoxicity, cytokine production and suppression of HIV replication in vitro. Comparison of TCRB gene usage between CTLs primed from the same donors with TV9 or TV9p6 revealed a degree of clonal overlap in some cases and an example of a conserved TCRB sequence encoded distinctly at the nucleotide level between individuals (a “public” TCR); however, in the main, distinct clonotypes were recruited by each peptide antigen. These findings indicate that mimotopes can mobilize functional crossreactive clonotypes that are less readily recruited from the naïve T cell pool by the corresponding wildtype epitope. Mimotope-induced repertoire diversification could potentially override subdominance under certain circumstances and enhance vaccine-induced responses to conserved but poorly immunogenic determinants within the HIV proteome. PMID:20432235

  2. Federally-Recognized Tribes of the Columbia-Snake Basin.

    SciTech Connect

    United States. Bonneville Power Administration


    This is an omnibus publication about the federally-recognized Indian tribes of the Columbia-Snake river basin, as presented by themselves. It showcases several figurative and literal snapshots of each tribe, bits and pieces of each tribe`s story. Each individual tribe or tribal confederation either submitted its own section to this publication, or developed its own section with the assistance of the writer-editor. A federally-recognized tribe is an individual Indian group, or confederation of Indian groups, officially acknowledged by the US government for purposes of legislation, consultation and benefits. This publication is designed to be used both as a resource and as an introduction to the tribes. Taken together, the sections present a rich picture of regional indian culture and history, as told by the tribes.

  3. 7 CFR 1467.20 - Market-based conservation initiatives.

    Code of Federal Regulations, 2013 CFR


    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Market-based conservation initiatives. 1467.20....20 Market-based conservation initiatives. (a) Acceptance and use of contributions. Section 1241(e) of... for Conservation Improvements. (1) USDA recognizes that environmental benefits will be achieved...

  4. 7 CFR 1467.20 - Market-based conservation initiatives.

    Code of Federal Regulations, 2012 CFR


    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Market-based conservation initiatives. 1467.20....20 Market-based conservation initiatives. (a) Acceptance and use of contributions. Section 1241(e) of... for Conservation Improvements. (1) USDA recognizes that environmental benefits will be achieved...

  5. 7 CFR 1467.20 - Market-based conservation initiatives.

    Code of Federal Regulations, 2014 CFR


    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Market-based conservation initiatives. 1467.20....20 Market-based conservation initiatives. (a) Acceptance and use of contributions. Section 1241(e) of... for Conservation Improvements. (1) USDA recognizes that environmental benefits will be achieved...

  6. Design Alternatives for Evaluating the Impact of Conservation Projects

    ERIC Educational Resources Information Center

    Margoluis, Richard; Stem, Caroline; Salafsky, Nick; Brown, Marcia


    Historically, examples of project evaluation in conservation were rare. In recent years, however, conservation professionals have begun to recognize the importance of evaluation both for accountability and for improving project interventions. Even with this growing interest in evaluation, the conservation community has paid little attention to…

  7. A neutralizing monoclonal antibody previously mapped exclusively on human immunodeficiency virus type 1 gp41 recognizes an epitope in p17 sharing the core sequence IEEE.

    PubMed Central

    Buratti, E; Tisminetzky, S G; D'Agaro, P; Baralle, F E


    We report here that a human immunodeficiency virus type 1 (HIV-1)-specific neutralizing monoclonal antibody (MAb 1575) mapped to the conserved putative intracellular region from amino acid residues 735 to 752 (735-752 region) of gp41 also recognizes a region in an extracellular portion of p17. Both epitopes have a core recognition sequence (IEEE) in a nonhomologous context. The IEEE motif found in HIV-1 p17 is located in a region known as HGP-30 (residues 86 to 115) which has been previously associated with virus neutralization, cytotoxic T lymphocyte activity, and mother-to-child transmission. An analysis of available gp41 and p17 sequences demonstrates that in these regions both IEEE sequences are highly conserved in different HIV-1 clades. The presence of the IEEE epitope in p17 allows us to explain some unexpected neutralizing characteristics of MAb 1575. In addition, the gp41 735-752 region has been previously reported both in intra- and extracellular locations. Our results suggest that the extracellular location was the result of cross-reactivity with p17. PMID:9032383

  8. How are necrotic cells recognized by their predators?

    PubMed Central

    Li, Zao; Zhou, Zheng


    Abstract Necrosis is a type of cell death often caused by cell injury and is linked to human diseases including neuron degeneration, stroke, and cancer. Cells undergoing necrosis are engulfed and degraded by engulfing cells, their predators. The mechanisms by which necrotic cells are recognized and removed remain elusive. Here we comment on our recent findings that reveal new molecular mechanisms of necrotic-cell recognition. Through studying the C. elegans touch neurons undergoing excitotoxic necrosis, we identified a receptor/ligand pair that enables engulfing cells to recognize necrotic neurons. The phagocytic receptor CED-1 is activated through interaction with its ligand phosphatidylserine (PS), exposed on the surface of necrotic cells. Furthermore, against the common belief that necrotic cells have ruptured plasma membrane, we found that necrotic C. elegans touch neurons actively present PS on their outer surfaces while maintaining plasma membrane integrity. We further identified 2 mechanisms governing the presentation of PS, one of which is shared with cells undergoing apoptosis, a “cell suicide” event, whereas the other is unique to necrotic neurons. The influx of Ca2+, a key necrosis-triggering factor, is implicated in activating a neuronal PS-scramblase for PS exposure. We propose that the mechanisms controlling PS-exposure and necrotic-cell recognition by engulfing cells are likely conserved from worms to humans. PMID:27073733

  9. EPA Recognizes Whole Foods Market in Marietta, Ga for Reducing Food Waste

    EPA Pesticide Factsheets

    ATLANTA - Today, U.S. Environmental Protection Agency (EPA) Regional Administrator Heather McTeer Toney recognized the Whole Foods Market Merchant Walk Marietta Store in Georgia for the store's achievements in EPA's Food Recovery Challenge. Whole Fo

  10. EPA Joins Philly Nonprofit in Recognizing Graduates of Environmental Jobs Training Program

    EPA Pesticide Factsheets

    (PHILADELPHIA -- May 12, 2015 ) EPA Regional Administrator Shawn M. Garvin today recognized the Energy Coordinating Agency (ECA) and graduates of ECA's jobs training program for successfully completing training for possible careers in environmental c

  11. Microsoft Corporation and King County-Cities Climate Collaboration Recognized for Climate Action Leadership

    EPA Pesticide Factsheets

    (Seattle - March 10, 2016) The U.S. Environmental Protection Agency Administrator Gina McCarthy and Regional Administrator Dennis McLerran recognized Microsoft Corporation and King County-Cities Climate Collaboration, among other organizations, with

  12. Multi-Season Regional Analysis of Multi-Species Occupancy: Implications for Bird Conservation in Agricultural Lands in East-Central Argentina

    PubMed Central

    Goijman, Andrea Paula; Conroy, Michael. J.; Bernardos, Jaime Nicolás; Zaccagnini, María Elena


    Rapid expansion and intensification of agriculture create challenges for the conservation of biodiversity and associated ecosystem services. In Argentina, the total row crop planted area has increased in recent decades with the expansion of soybean cultivation, homogenizing the landscape. In 2003 we started the first long-term, large-scale bird monitoring program in agroecosystems of central Argentina, in portions of the Pampas and Espinal ecoregions. Using data from this program, we evaluated the effect of land use and cover extent on birds between 2003-2012, accounting for imperfect detection probabilities using a Bayesian hierarchical, multi-species and multi-season occupancy model. We tested predictions that species diversity is positively related to habitat heterogeneity, which in intensified agroecosystems is thought to be mediated by food availability; thus the extent of land use and cover is predicted to affect foraging guilds differently. We also infer about ecosystem services provisioning and inform management recommendations for conservation of birds. Overall our results support the predictions. Although many species within each guild responded differently to land use and native forest cover, we identified generalities for most trophic guilds. For example, granivorous gleaners, ground insectivores and omnivores responded negatively to high proportions of soybean, while insectivore gleaners and aerial foragers seemed more tolerant. Habitat heterogeneity would likely benefit most species in an intensified agroecosystem, and can be achieved with a diversity of crops, pastures, and natural areas within the landscape. Although most studied species are insectivores, potentially beneficial for pest control, some guilds such as ground insectivores are poorly represented, suggesting that agricultural intensification reduces ecological functions, which may be recovered through management. Continuation of the bird monitoring program will allow us to continue to

  13. Multi-Season Regional Analysis of Multi-Species Occupancy: Implications for Bird Conservation in Agricultural Lands in East-Central Argentina.


    Goijman, Andrea Paula; Conroy, Michael J; Bernardos, Jaime Nicolás; Zaccagnini, María Elena


    Rapid expansion and intensification of agriculture create challenges for the conservation of biodiversity and associated ecosystem services. In Argentina, the total row crop planted area has increased in recent decades with the expansion of soybean cultivation, homogenizing the landscape. In 2003 we started the first long-term, large-scale bird monitoring program in agroecosystems of central Argentina, in portions of the Pampas and Espinal ecoregions. Using data from this program, we evaluated the effect of land use and cover extent on birds between 2003-2012, accounting for imperfect detection probabilities using a Bayesian hierarchical, multi-species and multi-season occupancy model. We tested predictions that species diversity is positively related to habitat heterogeneity, which in intensified agroecosystems is thought to be mediated by food availability; thus the extent of land use and cover is predicted to affect foraging guilds differently. We also infer about ecosystem services provisioning and inform management recommendations for conservation of birds. Overall our results support the predictions. Although many species within each guild responded differently to land use and native forest cover, we identified generalities for most trophic guilds. For example, granivorous gleaners, ground insectivores and omnivores responded negatively to high proportions of soybean, while insectivore gleaners and aerial foragers seemed more tolerant. Habitat heterogeneity would likely benefit most species in an intensified agroecosystem, and can be achieved with a diversity of crops, pastures, and natural areas within the landscape. Although most studied species are insectivores, potentially beneficial for pest control, some guilds such as ground insectivores are poorly represented, suggesting that agricultural intensification reduces ecological functions, which may be recovered through management. Continuation of the bird monitoring program will allow us to continue to

  14. Recognize sex work as legitimate work.


    Reynaga, Elena


    It is not sex work per se that makes sex workers vulnerable to HIV, but rather the policies that repress them. In this article, based on her presentation at a plenary session at the conference, Elena Reynaga, who is a sex worker, describes how these policies deprive sex workers of their rights and subject them to physical and sexual violence. The author concludes that at the heart of the problem lies the fact that sex work is not recognized as legitimate work.

  15. Recognizing and reporting adverse drug reactions.

    PubMed Central

    Lucas, L. M.; Colley, C. A.


    Although physicians in practice are most likely to see patients with adverse drug reactions, they may fail to recognize an adverse effect or to attribute it to a drug effect and, when recognized, they may fail to report serious reactions to the US Food and Drug Administration (FDA). To recognize and attribute an adverse event to a drug effect, physicians should review the patient's clinical course, looking at patient risk factors, the known adverse reactions to the suspected drug, and the likelihood of a causal relationship between the drug and the adverse event-based on the temporal relationship, response to stopping or restarting the drug, and whether other factors could explain the reaction. Once an adverse drug reaction has been identified, the patient should be informed and appropriate documentation made in the patient's medical record. Serious known reactions and all reactions to newly released drugs or those not previously known to occur (even if the certainty is low) should be reported to the FDA. PMID:1536067

  16. Recognizing specialized terminology presented through different modes.


    Commons-Miller, Lucas Alexander Hayleigh; Commons, Michael Lamport


    In the present study, the authors examined how previous experience and modes of presenting information affect the recognition of terms in new, specialized terminologies. The specialized terminology used was related to orienteering. Orienteering concepts representing features found in the woods may be communicated verbally (as definitions or words) or symbolically. There were 225 participants (101 reported no orienteering experience and 122 reported varying amounts of orienteering experience; 2 did not respond to that question) who tried to identify which of 5 entities was an orienteering definition, word, or symbol. Those with orienteering experience found that recognizing the specialized terminology was significantly easier than for those without experience. Recognizing symbols was significantly more difficult than recognizing definitions or words, particularly for non-orienteers. Performance of the orienteers was similar for the three modes. Within the orienteering group, the number of years of experience and usual course difficulty attempted were significant predictors of overall test success. Applications to training of both low-level specialized terminology (e.g., used in algebra), and higher level terminology (e.g., used in computer science) are discussed.

  17. Recognizing Materials using Perceptually Inspired Features

    PubMed Central

    Sharan, Lavanya; Liu, Ce; Rosenholtz, Ruth; Adelson, Edward H.


    Our world consists not only of objects and scenes but also of materials of various kinds. Being able to recognize the materials that surround us (e.g., plastic, glass, concrete) is important for humans as well as for computer vision systems. Unfortunately, materials have received little attention in the visual recognition literature, and very few computer vision systems have been designed specifically to recognize materials. In this paper, we present a system for recognizing material categories from single images. We propose a set of low and mid-level image features that are based on studies of human material recognition, and we combine these features using an SVM classifier. Our system outperforms a state-of-the-art system [Varma and Zisserman, 2009] on a challenging database of real-world material categories [Sharan et al., 2009]. When the performance of our system is compared directly to that of human observers, humans outperform our system quite easily. However, when we account for the local nature of our image features and the surface properties they measure (e.g., color, texture, local shape), our system rivals human performance. We suggest that future progress in material recognition will come from: (1) a deeper understanding of the role of non-local surface properties (e.g., extended highlights, object identity); and (2) efforts to model such non-local surface properties in images. PMID:23914070

  18. Large scale study on the variation of RF energy absorption in the head & brain regions of adults and children and evaluation of the SAM phantom conservativeness.


    Keshvari, J; Kivento, M; Christ, A; Bit-Babik, G


    This paper presents the results of two computational large scale studies using highly realistic exposure scenarios, MRI based human head and hand models, and two mobile phone models. The objectives are (i) to study the relevance of age when people are exposed to RF by comparing adult and child heads and (ii) to analyze and discuss the conservativeness of the SAM phantom for all age groups. Representative use conditions were simulated using detailed CAD models of two mobile phones operating between 900 MHz and 1950 MHz including configurations with the hand holding the phone, which were not considered in most previous studies. The peak spatial-average specific absorption rate (psSAR) in the head and the pinna tissues is assessed using anatomically accurate head and hand models. The first of the two mentioned studies involved nine head-, four hand- and two phone-models, the second study included six head-, four hand- and three simplified phone-models (over 400 configurations in total). In addition, both studies also evaluated the exposure using the SAM phantom. Results show no systematic differences between psSAR induced in the adult and child heads. The exposure level and its variation for different age groups may be different for particular phones, but no correlation between psSAR and model age was found. The psSAR from all exposure conditions was compared to the corresponding configurations using SAM, which was found to be conservative in the large majority of cases.

  19. Large scale study on the variation of RF energy absorption in the head & brain regions of adults and children and evaluation of the SAM phantom conservativeness

    NASA Astrophysics Data System (ADS)

    Keshvari, J.; Kivento, M.; Christ, A.; Bit-Babik, G.


    This paper presents the results of two computational large scale studies using highly realistic exposure scenarios, MRI based human head and hand models, and two mobile phone models. The objectives are (i) to study the relevance of age when people are exposed to RF by comparing adult and child heads and (ii) to analyze and discuss the conservativeness of the SAM phantom for all age groups. Representative use conditions were simulated using detailed CAD models of two mobile phones operating between 900 MHz and 1950 MHz including configurations with the hand holding the phone, which were not considered in most previous studies. The peak spatial-average specific absorption rate (psSAR) in the head and the pinna tissues is assessed using anatomically accurate head and hand models. The first of the two mentioned studies involved nine head-, four hand- and two phone-models, the second study included six head-, four hand- and three simplified phone-models (over 400 configurations in total). In addition, both studies also evaluated the exposure using the SAM phantom. Results show no systematic differences between psSAR induced in the adult and child heads. The exposure level and its variation for different age groups may be different for particular phones, but no correlation between psSAR and model age was found. The psSAR from all exposure conditions was compared to the corresponding configurations using SAM, which was found to be conservative in the large majority of cases.

  20. The conservation attitude

    USGS Publications Warehouse

    Leopold, Luna Bergere


    Forsaking his inheritance and its assurance of a comfortable existence, Guatama Buddha adopted the life of a pauper to seek the intellectual joys of pure contemplation. Under a mulberry tree, it is said, he propounded a 12-point program of ethical conduct stressing the development of a disinterested outlook in each individual. Temples, ritual, and idols he considered distractions from the basic need. He felt that there was a basic need for the development of an attitude.The Brahmins as well as the lower castes recognized the merits of the system suggested by Buddha, but they molded his teachings into an accessory to existing rituals and dogma. They soon forgot that Guatama wanted no idols and no temples. They forgot his admonition that an attitude was the thing that really counted. Despite his expressed wish, today Buddha in stone, in bronze, and in gold ponders these things in thousands of temples and hears the prayers of millions who still seek the truths of an ethical life.Today, conservation has its temples. The temples of conservation include hundreds of irrigation reservoirs; it has prayer-sticks in miles of contour plow furrows, and the Buddha of a drop-inlet structure looks down on a conservation pool in myriad detention dams.Conservation is well established today in the minds of the American public. It seems appropriate to analyze at this time just what it is that is established in the public mind. In what ways have we, too, substituted the temples, the ritual, and the idols for an attitude?

  1. Local responses to participatory conservation in Annapurna conservation area, Nepal.


    Khadka, Damodar; Nepal, Sanjay K


    Biodiversity conservation has undergone a profound change in philosophy, policies and management approaches over the last forty years. The traditional top-down approach to nature protection has been widely criticized for failing to include critical social elements in management practices, and is being gradually replaced by a slew of participatory strategies under the rubric of bottom-up conservation. The new approach recognizes local communities as key partners in wildlife management and seeks their participation in social development and biodiversity conservation. However, every social context is different in its structure and functions, and in the way social groups respond to calls for participation. In order to gain a better understanding of the approach and the barriers encountered in its implementation, a questionnaire survey of 188 households was employed in the communities of the Upper Mustang extension of Annapurna Conservation Area (ACA) in Nepal. The study provides a comparative analysis of community participation and its barriers between Non-Tourist (NT) and Tourist (TV) villages. The results revealed important differences between the two groups in terms of their participation in community programs, barriers to participation, and perception of benefits from participation. Owing to their distinct spatial, demographic and attitudinal differences, the two village groups have their own sets of needs, values and motivation factors which cannot be generalized and treated as such. The research clearly identifies the need for the conservation agency to be creative in devising strategies and initiatives appropriate to specific social groups so as to optimize their input in participatory conservation.

  2. Modeling effects of climatological variability and management practices on conservation of groundwater from the Mississippi River Valley Shallow Alluvial Aquifer in the Mississippi Delta region

    NASA Astrophysics Data System (ADS)

    Thornton, Robert Frank

    Ninety-eight percent of water taken from the Mississippi River Shallow Alluvial Aquifer, hereafter referred to as "the aquifer" or "MRVA," is used by the agricultural industry for irrigation. Mississippi Delta agriculture is increasingly using more water from the MRVA and the aquifer has been losing about 300,000 acre-feet per year. This research expands on previous work in which a model was developed that simulates the effects of climatic variability, crop acreage changes, and specific irrigation methods on consequent variations in the water volume of the MRVA. This study corrects an identified problem by replacing total growing season precipitation with an irrigation demand driver based on evaporation and crop coefficients and changing the time scale from the entire growing season to a daily resolution. The calculated irrigation demand, as a climatological driver for the model, captures effective precipitation more precisely than the initial growing season precipitation driver. Predictive equations resulting from regression analyses of measured versus calculated irrigation water use showed R2 and correlations of 0.33 and 0.57, 0.77 and 0.88, 0.71 and 0.84, and 0.68 and 0.82 for cotton, corn, soybeans and rice, respectively. Ninety-five percent of the predicted values fall within a range of + or - about 23,000 acre-feet, an error of about 10-percent. The study also adds an additional conservation strategy through the use of surface water from on-farm reservoirs in lieu of groundwater. Analyses show that climate could provide the entire water need of the plants in 70-percent of the years for corn, 65-percent of the years for soybeans and cotton, and even 5-percent of the years for rice. Storing precipitation in on-farm structures is an effective way to reduce reliance of Delta producers on groundwater. If producers adopted, at a minimum, the 97.5:2.5 ratio suggested management practice, this minimal management strategy could potentially conserve 48-percent, 35

  3. Islamic Headdress Influences How Emotion is Recognized from the Eyes

    PubMed Central

    Kret, Mariska Esther; de Gelder, Beatrice


    Previous research has shown a negative bias in the perception of whole facial expressions from out-group members. Whether or not emotion recognition from the eyes is already sensitive to contextual information is presently a matter of debate. In three experiments we tested whether emotions can be recognized when just the eyes are visible and whether this recognition is affected by context cues, such as various Islamic headdresses vs. a cap or a scarf. Our results indicate that fear is still well recognized from a briefly flashed (100 ms) image of a women wearing a burqa with less than 20% transparency of the eye region. Moreover, the type of headdress influences how emotions are recognized. In a group of participants from non-Islamic background, fear was recognized better from women wearing a niqāb than from women wearing a cap and a shawl, whereas the opposite was observed for happy and sad expressions. The response patterns showed that fearful and anger labels were more often attributed to women with a niqāb vs. a cap and a shawl and again, an opposite pattern was observed for the happy response. However, there was no general response bias: both correct and incorrect responses were influenced by the facial expression as well. Anxiety levels and/or explicit negative associations with the Islam as measured via questionnaires did not mediate the effects. Consistent with the face literature, we conclude that the recognition of emotions from the eyes is also influenced by context. PMID:22557983

  4. Cloning and comparative mapping of a gene from the commonly deleted region of DiGeorge and Velocardiofacial syndromes conserved in C. elegans.


    Rizzu, P; Lindsay, E A; Taylor, C; O'Donnell, H; Levy, A; Scambler, P; Baldini, A


    We have identified and cloned a gene, ES2, encoding a putative 476 amino acid protein with a predicted Mr of 52,568. The gene is localized within the DiGeorge/Velocardiofacial syndrome locus on 22q11.2 and is deleted in all the patients in which a deletion within 22q11 could be demonstrated, with the exception of one patient. ES2 is expressed in all the tissues studied. Sequence comparison showed identity with five ESTs and at the amino acid level the sequence was highly similar to, and collinear with, a hypothetical C. elegans protein of unknown function. Mutation analysis was performed in 16 patients without deletion, but no mutation has been found. The cDNA sequence is conserved in mouse and is localized on MMU16B1-B3, known to contain a syntenic group in common with HSA 22q11.2.

  5. Conservative estimation of whole-body-averaged SARs in infants with a homogeneous and simple-shaped phantom in the GHz region

    NASA Astrophysics Data System (ADS)

    Hirata, Akimasa; Ito, Naoki; Fujiwara, Osamu; Nagaoka, Tomoaki; Watanabe, Soichi


    We calculated the whole-body-averaged specific absorption rates (WBSARs) in a Japanese 9-month-old infant model and its corresponding homogeneous spheroidal and ellipsoidal models with 2/3 muscle tissue for 1-6 GHz far-field exposure. As a result, we found that in comparison with the WBSAR in the infant model, the ellipsoidal model with the same frontally projected area as that of the infant model provides an underestimate, whereas the ellipsoidal model with the same surface area yields an overestimate. In addition, the WBSARs in the homogenous infant models were found to be strongly affected by the electrical constant of tissue, and to be larger in the order of 2/3 muscle, skin and muscle tissues, regardless of the model shapes or polarization of incident waves. These findings suggest that the ellipsoidal model having the same surface area as that of the infant model and electrical constants of muscle tissue provides a conservative WBSAR over wide frequency bands. To confirm this idea, based on the Kaup index for Japanese 9-month-old infants, which is often used to represent the obesity of infants, we developed linearly reduced 9-month-old infant models and the corresponding muscle ellipsoidals and re-calculated their whole-body-averaged SARs with respect to body shapes. Our results reveal that the ellipsoidal model with the same surface area as that of a 9-month-old infant model gives a conservative WBSAR for different infant models, whose variability due to the model shape reaches 15%.

  6. Identification of a highly conserved, functional nuclear localization signal within the N-terminal region of herpes simplex virus type 1 VP1-2 tegument protein.


    Abaitua, F; O'Hare, P


    VP1-2 is a large structural protein assembled into the tegument compartment of the virion, conserved across the herpesviridae, and essential for virus replication. In herpes simplex virus (HSV) and pseudorabies virus, VP1-2 is tightly associated with the capsid. Studies of its assembly and function remain incomplete, although recent data indicate that in HSV, VP1-2 is recruited onto capsids in the nucleus, with this being required for subsequent recruitment of additional structural proteins. Here we have developed an antibody to characterize VP1-2 localization, observing the protein in both cytoplasmic and nuclear compartments, frequently in clusters in both locations. Within the nucleus, a subpopulation of VP1-2 colocalized with VP26 and VP5, though VP1-2-positive foci devoid of these components were observed. We note a highly conserved basic motif adjacent to the previously identified N-terminal ubiquitin hydrolase domain (DUB). The DUB domain in isolation exhibited no specific localization, but when extended to include the adjacent motif, it efficiently accumulated in the nucleus. Transfer of the isolated motif to a test protein, beta-galactosidase, conferred specific nuclear localization. Substitution of a single amino acid within the motif abolished the nuclear localization function. Deletion of the motif from intact VP1-2 abrogated its nuclear localization. Moreover, in a functional assay examining the ability of VP1-2 to complement growth of a VP1-2-ve mutant, deletion of the nuclear localization signal abolished complementation. The nuclear localization signal may be involved in transport of VP1-2 early in infection or to late assembly sites within the nucleus or, considering the potential existence of VP1-2 cleavage products, in selective localization of subdomains to different compartments.

  7. Recognizing women in the archaeological record

    SciTech Connect

    Bumsted, M.P.


    Primary sexual characteristics are usually absent in the archaeological record. The recovered secondary sex markers in bone morphology or mortuary context reflect the lifelong integrated biocultural experience of the individual man or woman. Internal patterns of variability within and between sexes can be recognized but are too frequently masked by traditional descriptive and univariate analyses. Fortunately, a more detailed picture of life experience is gained by analyzing chemical composition (isotopic and elemental) of hard tissues using an analytical anthropology approach and by examining the variation in novel ways. 7 figs.

  8. Recognizing Patterns In Log-Polar Coordinates

    NASA Technical Reports Server (NTRS)

    Weiman, Carl F. R.


    Log-Hough transform is basis of improved method for recognition of patterns - particularly, straight lines - in noisy images. Takes advantage of rotational and scale invariance of mapping from Cartesian to log-polar coordinates, and offers economy of representation and computation. Unification of iconic and Hough domains simplifies computations in recognition and eliminates erroneous quantization of slopes attributable to finite spacing of Cartesian coordinate grid of classical Hough transform. Equally efficient recognizing curves. Log-Hough transform more amenable to massively parallel computing architectures than traditional Cartesian Hough transform. "In-place" nature makes it possible to apply local pixel-neighborhood processing.

  9. Predicting the conservation status of data-deficient species.


    Bland, Lucie M; Collen, Ben; Orme, C David L; Bielby, Jon


    There is little appreciation of the level of extinction risk faced by one-sixth of the over 65,000 species assessed by the International Union for Conservation of Nature. Determining the status of these data-deficient (DD) species is essential to developing an accurate picture of global biodiversity and identifying potentially threatened DD species. To address this knowledge gap, we used predictive models incorporating species' life history, geography, and threat information to predict the conservation status of DD terrestrial mammals. We constructed the models with 7 machine learning (ML) tools trained on species of known status. The resultant models showed very high species classification accuracy (up to 92%) and ability to correctly identify centers of threatened species richness. Applying the best model to DD species, we predicted 313 of 493 DD species (64%) to be at risk of extinction, which increases the estimated proportion of threatened terrestrial mammals from 22% to 27%. Regions predicted to contain large numbers of threatened DD species are already conservation priorities, but species in these areas show considerably higher levels of risk than previously recognized. We conclude that unless directly targeted for monitoring, species classified as DD are likely to go extinct without notice. Taking into account information on DD species may therefore help alleviate data gaps in biodiversity indicators and conserve poorly known biodiversity.

  10. Optimal Conservation of Migratory Species

    PubMed Central

    Martin, Tara G.; Chadès, Iadine; Arcese, Peter; Marra, Peter P.; Possingham, Hugh P.; Norris, D. Ryan


    Background Migratory animals comprise a significant portion of biodiversity worldwide with annual investment for their conservation exceeding several billion dollars. Designing effective conservation plans presents enormous challenges. Migratory species are influenced by multiple events across land and sea–regions that are often separated by thousands of kilometres and span international borders. To date, conservation strategies for migratory species fail to take into account how migratory animals are spatially connected between different periods of the annual cycle (i.e. migratory connectivity) bringing into question the utility and efficiency of current conservation efforts. Methodology/Principal Findings Here, we report the first framework for determining an optimal conservation strategy for a migratory species. Employing a decision theoretic approach using dynamic optimization, we address the problem of how to allocate resources for habitat conservation for a Neotropical-Nearctic migratory bird, the American redstart Setophaga ruticilla, whose winter habitat is under threat. Our first conservation strategy used the acquisition of winter habitat based on land cost, relative bird density, and the rate of habitat loss to maximize the abundance of birds on the wintering grounds. Our second strategy maximized bird abundance across the entire range of the species by adding the constraint of maintaining a minimum percentage of birds within each breeding region in North America using information on migratory connectivity as estimated from stable-hydrogen isotopes in feathers. We show that failure to take into account migratory connectivity may doom some regional populations to extinction, whereas including information on migratory connectivity results in the protection of the species across its entire range. Conclusions/Significance We demonstrate that conservation strategies for migratory animals depend critically upon two factors: knowledge of migratory

  11. Energy Conservation

    SciTech Connect

    Simpson, P.


    There are two fundamental reasons or motivations for energy conservation: (1) economics; and (2) consideration of energy - its sources and availability. Economics speaks for itself and needs little explanation: a project is undertaken, the cost is recovered in a given period of time (we hope) and our company realizes cost savings thereafter. We study and propose a project; we estimate the payback. If approved, we implement the project. Then, we eagerly watch for its effectiveness - for the proposed payback. The second consideration in regard to energy conservation might - in the foreseeable future - become by far the most important - that of availability. Very knowledgeable persons have stated that this - in reality - is the most serious problem facing our nation today. Readily available, reasonably priced energy has given to the US the high form of living experienced today. An interruption in this flow could catapult our nation in an awesome catastrophe. The energy shortage of the late 70`s might be a forerunner of such an experience.

  12. Genes encoding conserved hypothetical proteins localized in the conjugative transfer region of plasmid pRet42a from Rhizobium etli CFN42 participate in modulating transfer and affect conjugation from different donors

    PubMed Central

    López-Fuentes, Eunice; Torres-Tejerizo, Gonzalo; Cervantes, Laura; Brom, Susana


    Among sequenced genomes, it is common to find a high proportion of genes encoding proteins that cannot be assigned a known function. In bacterial genomes, genes related to a similar function are often located in contiguous regions. The presence of genes encoding conserved hypothetical proteins (chp) in such a region may suggest that they are related to that particular function. Plasmid pRet42a from Rhizobium etli CFN42 is a conjugative plasmid containing a segment of approximately 30 Kb encoding genes involved in conjugative transfer. In addition to genes responsible for Dtr (DNA transfer and replication), Mpf (Mating pair formation) and regulation, it has two chp-encoding genes (RHE_PA00163 and RHE_PA00164) and a transcriptional regulator (RHE_PA00165). RHE_PA00163 encodes an uncharacterized protein conserved in bacteria that presents a COG4634 conserved domain, and RHE_PA00164 encodes an uncharacterized conserved protein with a DUF433 domain of unknown function. RHE_PA00165 presents a HTH_XRE domain, characteristic of DNA-binding proteins belonging to the xenobiotic response element family of transcriptional regulators. Interestingly, genes similar to these are also present in transfer regions of plasmids from other bacteria. To determine if these genes participate in conjugative transfer, we mutagenized them and analyzed their conjugative phenotype. A mutant in RHE_PA00163 showed a slight (10 times) but reproducible increase in transfer frequency from Rhizobium donors, while mutants in RHE_PA00164 and RHE_PA00165 lost their ability to transfer the plasmid from some Agrobacterium donors. Our results indicate that the chp-encoding genes located among conjugation genes are indeed related to this function. However, the participation of RHE_PA00164 and RHE_PA00165 is only revealed under very specific circumstances, and is not perceived when the plasmid is transferred from the original host. RHE_PA00163 seems to be a fine-tuning modulator for conjugative transfer

  13. Conservation reaches new heights.


    Pepall, J; Khanal, P


    The conservation program with the management assistance of the Woodlands Mountain Institute in 2 contiguous parks, the Mount Everest National Park in Nepal and the Qomolangma Nature Reserve in China, in 2 countries is described. The focus is on conservation of the complex ecosystem with sustainable development by showing local people how to benefit from the park without environmental damage. Cultural diversity is as important as biological diversity. The area has been designated by UNESCO as a World Heritage Site with the "last pure ecological seed" of the Himalayas. The regional geography and culture are presented. Population growth has impacted natural resources through overgrazing, cultivation of marginal land, and deforestation; future plans to build a dam and road bordering the nature reserve pose other threats. Proposed management plans for the Makalu-Barun Nature Park (established in November 1991) and Conservation Area include a division of the park into nature reserve areas free of human activity, protected areas which permit traditional land use, and special sites and trail for tourists and religious pilgrims. The conservation area will act as a buffer for the park and provide economic opportunities; further subdivisions include land use for biodiversity protection, community forest and pasture, agroforestry, and agriculture and settlement. Efforts will be made to increase the welfare of women and local people; proposed projects include the introduction of higher milk-producing animals for stall feeding. Also proposed is a cultural and natural history museum. 70% of the project's resources will be directed to local community participation in consultation and park maintenance. The project is a model of how conservation and protection of natural resources can coexist with local economic development and participation; an integration of preservation of biological diversity, mountain wisdom, and the value of local people as resources for conservation.

  14. How do infants recognize joint attention?


    Gustafsson, Erik; Brisson, Julie; Beaulieu, Christelle; Mainville, Marc; Mailloux, Dominique; Sirois, Sylvain


    The emergence of joint attention is still a matter of vigorous debate. It involves diverse hypotheses ranging from innate modules dedicated to intention reading to more neuro-constructivist approaches. The aim of this study was to assess whether 12-month-old infants are able to recognize a "joint attention" situation when observing such a social interaction. Using a violation-of-expectation paradigm, we habituated infants to a "joint attention" video and then compared their looking time durations between "divergent attention" videos and "joint attention" ones using a 2 (familiar or novel perceptual component)×2 (familiar or novel conceptual component) factorial design. These results were enriched with measures of pupil dilation, which are considered to be reliable measures of cognitive load. Infants looked longer at test events that involved novel speaker and divergent attention but no changes in infants' pupil dilation were observed in any conditions. Although looking time data suggest that infants may appreciate discrepancies from expectations related to joint attention behavior, in the absence of clear evidence from pupillometry, the results show no demonstration of understanding of joint attention, even at a tacit level. Our results suggest that infants may be sensitive to relevant perceptual variables in joint attention situations, which would help scaffold social cognitive development. This study supports a gradual, learning interpretation of how infants come to recognize, understand, and participate in joint attention.

  15. Cross-Neutralising Nanobodies Bind to a Conserved Pocket in the Hemagglutinin Stem Region Identified Using Yeast Display and Deep Mutational Scanning

    PubMed Central

    Gaiotto, Tiziano; Hufton, Simon E.


    Cross-neutralising monoclonal antibodies against influenza hemagglutinin (HA) are of considerable interest as both therapeutics and diagnostic tools. We have recently described five different single domain antibodies (nanobodies) which share this cross-neutralising activity and suggest their small size, high stability, and cleft binding properties may present distinct advantages over equivalent conventional antibodies. We have used yeast display in combination with deep mutational scanning to give residue level resolution of positions in the antibody-HA interface which are crucial for binding. In addition, we have mapped positions within HA predicted to have minimal effect on antibody binding when mutated. Our cross-neutralising nanobodies were shown to bind to a highly conserved pocket in the HA2 domain of A(H1N1)pdm09 influenza virus overlapping with the fusion peptide suggesting their mechanism of action is through the inhibition of viral membrane fusion. We also note that the epitope overlaps with that of CR6261 and F10 which are human monoclonal antibodies in clinical development as immunotherapeutics. Although all five nanobodies mapped to the same highly conserved binding pocket we observed differences in the size of the epitope footprint which has implications in comparing the relative genetic barrier each nanobody presents to a rapidly evolving influenza virus. To further refine our epitope map, we have re-created naturally occurring mutations within this HA stem epitope and tested their effect on binding using yeast display. We have shown that a D46N mutation in the HA2 stem domain uniquely interferes with binding of R2b-E8. Further testing of this substitution in the context of full length purified HA from 1918 H1N1 pandemic (Spanish flu), 2009 H1N1 pandemic (swine flu) and highly pathogenic avian influenza H5N1 demonstrated binding which correlated with D46 whereas binding to seasonal H1N1 strains carrying N46 was absent. In addition, our deep sequence

  16. Expression of Non-Conserved Regions of the S Genome Segments of Three Hantaviruses: Evaluation of the Expressed Polypeptides for Diagnosis of Haemorrhagic Fever with Renal Syndrome

    DTIC Science & Technology


    treatment with enterokinase can be used to remnove these representing the entire NP coding regions as well as the extraneous amino acids from the...1121 patients. Of the 21 rat sera examined, PRNT identified treated Nith enterokinase to rmniov the extraneous. non- tmo infections with HTN virus and

  17. Evaluation of Land Use, Land Management and Soil Conservation Strategies to Reduce Non-Point Source Pollution Loads in the Three Gorges Region, China.


    Strehmel, Alexander; Schmalz, Britta; Fohrer, Nicola


    The construction of the Three Gorges Dam in China and the subsequent impoundment of the Yangtze River have induced a major land use change in the Three Gorges Reservoir Region, which fosters increased inputs of sediment and nutrients from diffuse sources into the water bodies. Several government programs have been implemented to mitigate high sediment and nutrient loads to the reservoir. However, institutional weaknesses and a focus on economic development have so far widely counteracted the effectiveness of these programs. In this study, the eco-hydrological model soil and water assessment tool is used to assess the effects of changes in fertilizer amounts and the conditions of bench terraces in the Xiangxi catchment in the Three Gorges Reservoir Region on diffuse matter releases. With this, the study aims at identifying efficient management measures, which should have priority. The results show that a reduction of fertilizer amounts cannot reduce phosphorus loads considerably without inhibiting crop productivity. The condition of terraces in the catchment has a strong impact on soil erosion and phosphorus releases from agricultural areas. Hence, if economically feasible, programmes focusing on the construction and maintenance of terraces in the region should be implemented. Additionally, intercropping on corn fields as well as more efficient fertilization schemes for agricultural land were identified as potential instruments to reduce diffuse matter loads further. While the study was carried out in the Three Gorges Region, its findings may also beneficial for the reduction of water pollution in other mountainous areas with strong agricultural use.

  18. Evaluation of Land Use, Land Management and Soil Conservation Strategies to Reduce Non-Point Source Pollution Loads in the Three Gorges Region, China

    NASA Astrophysics Data System (ADS)

    Strehmel, Alexander; Schmalz, Britta; Fohrer, Nicola


    The construction of the Three Gorges Dam in China and the subsequent impoundment of the Yangtze River have induced a major land use change in the Three Gorges Reservoir Region, which fosters increased inputs of sediment and nutrients from diffuse sources into the water bodies. Several government programs have been implemented to mitigate high sediment and nutrient loads to the reservoir. However, institutional weaknesses and a focus on economic development have so far widely counteracted the effectiveness of these programs. In this study, the eco-hydrological model soil and water assessment tool is used to assess the effects of changes in fertilizer amounts and the conditions of bench terraces in the Xiangxi catchment in the Three Gorges Reservoir Region on diffuse matter releases. With this, the study aims at identifying efficient management measures, which should have priority. The results show that a reduction of fertilizer amounts cannot reduce phosphorus loads considerably without inhibiting crop productivity. The condition of terraces in the catchment has a strong impact on soil erosion and phosphorus releases from agricultural areas. Hence, if economically feasible, programmes focusing on the construction and maintenance of terraces in the region should be implemented. Additionally, intercropping on corn fields as well as more efficient fertilization schemes for agricultural land were identified as potential instruments to reduce diffuse matter loads further. While the study was carried out in the Three Gorges Region, its findings may also beneficial for the reduction of water pollution in other mountainous areas with strong agricultural use.

  19. Selling energy conservation.


    Hinrichsen, D


    This article concerns the Organization of the Petroleum Exporting Countries (OPEC) crisis and its impact on energy efficiency measures in the US. In 1985, when the OPEC collapsed, the US government had avoided the need to construct 350 gigawatts of new electric capacity. The most successful efficiency improvements, especially in household appliances and equipment, lighting and tightened energy efficiency standards in new buildings, resulted from the OPEC event. The real innovation of that time was the change in profit rules for utilities. This revolution and the way some US utilities view energy have not caught on elsewhere. Despite the initiative toward improving energy efficiency in homes, offices and industries, the change has been slow. Partly to blame are the big development banks, which pointed out that short-term conservation and efficiency measures could save at least 15% of the total energy demand without the need for major investment. The benefits of energy conservation was shown during the oil shock when per capita energy consumption fell by 5% in the member states of the Organization of Economic Cooperation and Development, while the per capita gross domestic product grew by a third. There has been a decrease in energy expenditure worldwide, and the scope for further energy savings is enormous, but governments need to recognize and seize the opportunity.

  20. Credibility and advocacy in conservation science.


    Horton, Cristi C; Peterson, Tarla Rai; Banerjee, Paulami; Peterson, Markus J


    Conservation policy sits at the nexus of natural science and politics. On the one hand, conservation scientists strive to maintain scientific credibility by emphasizing that their research findings are the result of disinterested observations of reality. On the other hand, conservation scientists are committed to conservation even if they do not advocate a particular policy. The professional conservation literature offers guidance on negotiating the relationship between scientific objectivity and political advocacy without damaging conservation science's credibility. The value of this guidance, however, may be restricted by limited recognition of credibility's multidimensionality and emergent nature: it emerges through perceptions of expertise, goodwill, and trustworthiness. We used content analysis of the literature to determine how credibility is framed in conservation science as it relates to apparent contradictions between science and advocacy. Credibility typically was framed as a static entity lacking dimensionality. Authors identified expertise or trustworthiness as important, but rarely mentioned goodwill. They usually did not identify expertise, goodwill, or trustworthiness as dimensions of credibility or recognize interactions among these 3 dimensions of credibility. This oversimplification may limit the ability of conservation scientists to contribute to biodiversity conservation. Accounting for the emergent quality and multidimensionality of credibility should enable conservation scientists to advance biodiversity conservation more effectively.

  1. Credibility and advocacy in conservation science

    PubMed Central

    Horton, Cristi C.; Peterson, Tarla Rai; Banerjee, Paulami


    Abstract Conservation policy sits at the nexus of natural science and politics. On the one hand, conservation scientists strive to maintain scientific credibility by emphasizing that their research findings are the result of disinterested observations of reality. On the other hand, conservation scientists are committed to conservation even if they do not advocate a particular policy. The professional conservation literature offers guidance on negotiating the relationship between scientific objectivity and political advocacy without damaging conservation science's credibility. The value of this guidance, however, may be restricted by limited recognition of credibility's multidimensionality and emergent nature: it emerges through perceptions of expertise, goodwill, and trustworthiness. We used content analysis of the literature to determine how credibility is framed in conservation science as it relates to apparent contradictions between science and advocacy. Credibility typically was framed as a static entity lacking dimensionality. Authors identified expertise or trustworthiness as important, but rarely mentioned goodwill. They usually did not identify expertise, goodwill, or trustworthiness as dimensions of credibility or recognize interactions among these 3 dimensions of credibility. This oversimplification may limit the ability of conservation scientists to contribute to biodiversity conservation. Accounting for the emergent quality and multidimensionality of credibility should enable conservation scientists to advance biodiversity conservation more effectively. PMID:26041036

  2. Predicted effect of landscape position on wildlife habitat value of Conservation Reserve Enhancement Program wetlands in a tile-drained agricultural region

    USGS Publications Warehouse

    Otis, David L.; Crumpton, William R.; Green, David; Loan-Wilsey, Anna; Cooper, Tom; Johnson, Rex R.


    Justification for investment in restored or constructed wetland projects are often based on presumed net increases in ecosystem services. However, quantitative assessment of performance metrics is often difficult and restricted to a single objective. More comprehensive performance assessments could help inform decision-makers about trade-offs in services provided by alternative restoration program design attributes. The primary goal of the Iowa Conservation Reserve Enhancement Program is to establish wetlands that efficiently remove nitrates from tile-drained agricultural landscapes. A secondary objective is provision of wildlife habitat. We used existing wildlife habitat models to compare relative net change in potential wildlife habitat value for four alternative landscape positions of wetlands within the watershed. Predicted species richness and habitat value for birds, mammals, amphibians, and reptiles generally increased as the wetland position moved lower in the watershed. However, predicted average net increase between pre- and post-project value was dependent on taxonomic group. The increased average wetland area and changes in surrounding upland habitat composition among landscape positions were responsible for these differences. Net change in predicted densities of several grassland bird species at the four landscape positions was variable and species-dependent. Predicted waterfowl breeding activity was greater for lower drainage position wetlands. Although our models are simplistic and provide only a predictive index of potential habitat value, we believe such assessment exercises can provide a tool for coarse-level comparisons of alternative proposed project attributes and a basis for constructing informed hypotheses in auxiliary empirical field studies.

  3. Identification of highly conserved regions in L-segment of Crimean–Congo hemorrhagic fever virus and immunoinformatic prediction about potential novel vaccine

    PubMed Central

    Oany, Arafat Rahman; Ahmad, Shah Adil Ishtiyaq; Hossain, Mohammad Uzzal; Jyoti, Tahmina Pervin


    Crimean–Congo hemorrhagic fever (CCHF) is a tick-borne zoonotic viral disease with a disease fatality rate between 15% and 70%. Despite the wide range of distribution, the virus (CCHFV) is basically endemic in Africa, Asia, eastern Europe, and the Middle East. Acute febrile illness associated with petechiae, disseminated intravascular coagulation, and multiple-organ failure are the main symptoms of the disease. With all these fatal effects, CCHFV is considered a huge threat as no successful therapeutic approach is currently available for the treatment of this disease. In the present study, we have used the immunoinformatics approach to design a potential epitope-based vaccine against the RNA-dependent RNA polymerase-L of CCHFV. Both the T-cell and B-cell epitopes were assessed, and the epitope “DCSSTPPDR” was found to be the most potential one, with 100% conservancy among all the strains of CCHFV. The epitope was also found to interact with both type I and II major histocompatibility complex molecules and is considered nonallergenic as well. In vivo study of our proposed peptide is advised for novel universal vaccine production, which might be an effective path to prevent CCHF disease. PMID:25609983

  4. Socioeconomic contexts of primate conservation: population, poverty, global economic demands, and sustainable land use.


    Estrada, Alejandro


    Recent assessments by the International Union for Conservation of Nature (IUCN) indicate the existence of about 612 recognized primate species and subspecies (IUCN RedList, 2012), but close to 50% of these taxa are at risk of extinction as a result of human action. In this article, I call attention to underlying regional and global socioeconomic contexts of primate conservation. Using information from FAO and UN databases and other sources, I examine, for the Neotropics, sub-Saharan Africa, and Southeast Asia, trends in forest loss and human demographics and social condition, discuss the impact of global market pressures upon primate habitats, and examine land-use patterns that may favor primate conservation. Between 1990 and 2010, an estimated 149 million ha of forest were lost in the three regions and additional losses are expected in the future. Global human population will increase from 7 billion in 2012 to 9 billion in 2050. Currently, 2 billion people live in the three primate range regions under high levels of poverty. Large-scale deforestation is related to global market demands, especially from developed and developing nations, for food (e.g., cattle), domestic animal feed (e.g., soybeans), biofuel-based crops (e.g., oil palm), and industrial round wood. The growth of protected areas in the three regions has been steady for several decades, but it is not enough to ensure long-term conservation of many primate taxa. Other conservations tools involving sustainable land use and biodiversity conservation corridors are required at the landscape level. The above assessment can easily be applied at the local level by primatologists, giving more precision to conservation initiatives.

  5. Transcription regulatory mechanism of Pitx in the papilla-forming region in the ascidian, Halocynthia roretzi, implies conserved involvement of Otx as the upstream gene in the adhesive organ development of chordates.


    Yoshida, Keita; Ueno, Motoko; Niwano, Tomoko; Saiga, Hidetoshi


    Pitx genes play important roles in a variety of developmental processes in vertebrates. In an ascidian species, Halocynthia roretzi, Hr-Pitx, the only Pitx gene of this species, has been reported to be expressed in the left epidermis at the tailbud stage. In the present study, first, we have shown that Hr-Pitx is also expressed in the papilla-forming region at the neurula to tailbud stages, and then we addressed transcription regulatory mechanisms for the expression of Hr-Pitx in the papilla-forming region. We have identified the genomic region ranging from 850 to 1211 bp upstream from the translation start site of the Hr-Pitx gene as an enhancer region that drives the transcription of Hr-Pitx in the papilla-forming region. Within the enhancer region, putative transcriptional factor binding sites for Otx as well as Fox were shown to be required for its activity. Finally, we carried out knocking down experiments of Hr-Otx function using an antisense morpholino oligonucleotide, in which the knocking down of Hr-Otx function resulted in reduction of the enhancer activity and loss of the expression of Hr-Pitx in the papilla-forming region. In Xenopus laevis, it has been reported that Pitx genes are expressed downstream of Otx function during development of the cement gland, an adhesive organ of its larva. Taken together, it is suggested that the expression regulatory mechanism of Pitx, involving Otx as the upstream gene, in the developing adhesive organ is conserved between ascidians and vertebrates.

  6. Recognizing Question Entailment for Medical Question Answering

    PubMed Central

    Abacha, Asma Ben; Dina, Demner-Fushman


    With the increasing heterogeneity and specialization of medical texts, automated question answering is becoming more and more challenging. In this context, answering a given medical question by retrieving similar questions that are already answered by human experts seems to be a promising solution. In this paper, we propose a new approach for the detection of similar questions based on Recognizing Question Entailment (RQE). In particular, we consider Frequently Asked Question (FAQs) as a valuable and widespread source of information. Our final goal is to automatically provide an existing answer if FAQ similar to a consumer health question exists. We evaluate our approach using consumer health questions received by the National Library of Medicine and FAQs collected from NIH websites. Our first results are promising and suggest the feasibility of our approach as a valuable complement to classic question answering approaches. PMID:28269825

  7. Obstacle detection by recognizing binary expansion patterns

    NASA Technical Reports Server (NTRS)

    Baram, Yoram; Barniv, Yair


    This paper describes a technique for obstacle detection, based on the expansion of the image-plane projection of a textured object, as its distance from the sensor decreases. Information is conveyed by vectors whose components represent first-order temporal and spatial derivatives of the image intensity, which are related to the time to collision through the local divergence. Such vectors may be characterized as patterns corresponding to 'safe' or 'dangerous' situations. We show that essential information is conveyed by single-bit vector components, representing the signs of the relevant derivatives. We use two recently developed, high capacity classifiers, employing neural learning techniques, to recognize the imminence of collision from such patterns.

  8. Shuttle inspection team recognized for 'eagle eyes.'

    NASA Technical Reports Server (NTRS)


    NASA Administrator Daniel Goldin (left) applauds the Space Shuttle ice and debris inspection team who were recognized for their keen safety observations prior to the launch of Space Shuttle Discovery. Standing next to Goldin are (left to right) D. Scott Otto, with Lockheed Martin Space Services Company; John B. Blue, Thomas F. Ford and Michael Barber, with United Space Alliance; Gregory N. Katnik and Jorge E. Rivera, with NASA. Katnick and Rivera received the agency's Exceptional Achievement Medal; Barber, Blue, Ford and Otto received the NASA Public Service Medal. While scanning the launch pad before launch, the team found a stray 4-inch pin near the Shuttle's external fuel tank that could have caused damage during launch. Discovery was safely launched the next day, on Oct. 11.

  9. Position, rotation, and intensity invariant recognizing method


    Ochoa, Ellen; Schils, George F.; Sweeney, Donald W.


    A method for recognizing the presence of a particular target in a field of view which is target position, rotation, and intensity invariant includes the preparing of a target-specific invariant filter from a combination of all eigen-modes of a pattern of the particular target. Coherent radiation from the field of view is then imaged into an optical correlator in which the invariant filter is located. The invariant filter is rotated in the frequency plane of the optical correlator in order to produce a constant-amplitude rotational response in a correlation output plane when the particular target is present in the field of view. Any constant response is thus detected in the output The U.S. Government has rights in this invention pursuant to Contract No. DE-AC04-76DP00789 between the U.S. Department of Energy and AT&T Technologies, Inc.

  10. Octopuses (Enteroctopus dofleini) recognize individual humans.


    Anderson, Roland C; Mather, Jennifer A; Monette, Mathieu Q; Zimsen, Stephanie R M


    This study exposed 8 Enteroctopus dofleini separately to 2 unfamiliar individual humans over a 2-week period under differing circumstances. One person consistently fed the octopuses and the other touched them with a bristly stick. Each human recorded octopus body patterns, behaviors, and respiration rates directly after each treatment. At the end of 2 weeks, a body pattern (a dark Eyebar) and 2 behaviors (reaching arms toward or away from the tester and funnel direction) were significantly different in response to the 2 humans. The respiration rate of the 4 larger octopuses changed significantly in response to the 2 treatments; however, there was no significant difference in the 4 smaller octopuses' respiration. Octopuses' ability to recognize humans enlarges our knowledge of the perceptual ability of this nonhuman animal, which depends heavily on learning in response to visual information. Any training paradigm should take such individual recognition into consideration as it could significantly alter the octopuses' responses.

  11. Recognizing asthma mimics and asthma complications.


    Amundson, Dennis; Seda, Gilbert; Daheshia, Massoud


    Asthma is a chronic inflammatory disorder of the airways characterized by airflow obstruction, bronchial hyperreactivity, and underlying inflammation. Two common reasons asthmatics fail standard therapy are incorrect diagnosis and failure to recognize underlying contributing factors. A correct diagnosis of asthma is of great importance to military practitioners since misdiagnosis or uncontrolled asthma affects an individual's operational readiness or determines whether one can receive a medical waiver to enlist in military service. This article presents four cases of patients with dyspnea that have conditions which mimic asthma or complicate asthma management: vocal cord dysfunction misdiagnosed as asthma, respiratory bronchiolitis interstitial lung disease mistaken as asthma, difficult-to-control asthma because of bronchiectasis and allergic bronchopulmonary aspergillosis, and difficult and fatal asthma. Asthma is contrasted to other respiratory disorders, and an outlined approach to asthma diagnosis and management is presented using the Global Initiative for Asthma guidelines.

  12. How can we recognize continuous quality improvement?

    PubMed Central

    Rubenstein, Lisa; Khodyakov, Dmitry; Hempel, Susanne; Danz, Margie; Salem-Schatz, Susanne; Foy, Robbie; O'Neill, Sean; Dalal, Siddhartha; Shekelle, Paul


    Objective Continuous quality improvement (CQI) methods are foundational approaches to improving healthcare delivery. Publications using the term CQI, however, are methodologically heterogeneous, and labels other than CQI are used to signify relevant approaches. Standards for identifying the use of CQI based on its key methodological features could enable more effective learning across quality improvement (QI) efforts. The objective was to identify essential methodological features for recognizing CQI. Design Previous work with a 12-member international expert panel identified reliably abstracted CQI methodological features. We tested which features met rigorous a priori standards as essential features of CQI using a three-phase online modified-Delphi process. Setting Primarily United States and Canada. Participants 119 QI experts randomly assigned into four on-line panels. Intervention(s) Participants rated CQI features and discussed their answers using online, anonymous and asynchronous discussion boards. We analyzed ratings quantitatively and discussion threads qualitatively. Main outcome measure(s) Panel consensus on definitional CQI features. Results Seventy-nine (66%) panelists completed the process. Thirty-three completers self-identified as QI researchers, 18 as QI practitioners and 28 as both equally. The features ‘systematic data guided activities,’ ‘designing with local conditions in mind’ and ‘iterative development and testing’ met a priori standards as essential CQI features. Qualitative analyses showed cross-cutting themes focused on differences between QI and CQI. Conclusions We found consensus among a broad group of CQI researchers and practitioners on three features as essential for identifying QI work more specifically as ‘CQI.’ All three features are needed as a minimum standard for recognizing CQI methods. PMID:24311732

  13. The nitrogen-fixation island insertion site is conserved in diazotrophic Pseudomonas stutzeri and Pseudomonas sp. isolated from distal and close geographical regions.


    Venieraki, Anastasia; Dimou, Maria; Vezyri, Eleni; Vamvakas, Alexandros; Katinaki, Pagona-Artemis; Chatzipavlidis, Iordanis; Tampakaki, Anastasia; Katinakis, Panagiotis


    The presence of nitrogen fixers within the genus Pseudomonas has been established and so far most isolated strains are phylogenetically affiliated to Pseudomonas stutzeri. A gene ortholog neighborhood analysis of the nitrogen fixation island (NFI) in four diazotrophic P. stutzeri strains and Pseudomonas azotifigens revealed that all are flanked by genes coding for cobalamin synthase (cobS) and glutathione peroxidise (gshP). The putative NFIs lack all the features characterizing a mobilizable genomic island. Nevertheless, bioinformatic analysis P. stutzeri DSM 4166 NFI demonstrated the presence of short inverted and/or direct repeats within both flanking regions. The other P. stutzeri strains carry only one set of repeats. The genetic diversity of eleven diazotrophic Pseudomonas isolates was also investigated. Multilocus sequence typing grouped nine isolates along with P. stutzeri and two isolates are grouped in a separate clade. A Rep-PCR fingerprinting analysis grouped the eleven isolates into four distinct genotypes. We also provided evidence that the putative NFI in our diazotrophic Pseudomonas isolates is flanked by cobS and gshP genes. Furthermore, we demonstrated that the putative NFI of Pseudomonas sp. Gr65 is flanked by inverted repeats identical to those found in P. stutzeri DSM 4166 and while the other P. stutzeri isolates harbor the repeats located in the intergenic region between cobS and glutaredoxin genes as in the case of P. stutzeri A1501. Taken together these data suggest that all putative NFIs of diazotrophic Pseudomonas isolates are anchored in an intergenic region between cobS and gshP genes and their flanking regions are designated by distinct repeats patterns. Moreover, the presence of almost identical NFIs in diazotrophic Pseudomonas strains isolated from distal geographical locations around the world suggested that this horizontal gene transfer event may have taken place early in the evolution.

  14. 46 CFR 162.039-5 - Recognized laboratory.

    Code of Federal Regulations, 2011 CFR


    ... 46 Shipping 6 2011-10-01 2011-10-01 false Recognized laboratory. 162.039-5 Section 162.039-5... Recognized laboratory. (a) A recognized laboratory is one which is regularly engaged in the examination... motorboats. The following laboratories are recognized, and the semiportable fire extinguishers bearing...

  15. 46 CFR 160.048-8 - Recognized laboratory.

    Code of Federal Regulations, 2010 CFR


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Recognized laboratory. 160.048-8 Section 160.048-8... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  16. 46 CFR 160.076-19 - Recognized laboratories.

    Code of Federal Regulations, 2012 CFR


    ... 46 Shipping 6 2012-10-01 2012-10-01 false Recognized laboratories. 160.076-19 Section 160.076-19... Recognized laboratories. The approval and production oversight functions that this subpart requires to be conducted by a recognized laboratory must be conducted by an independent laboratory recognized by the...

  17. 46 CFR 160.077-9 - Recognized laboratory.

    Code of Federal Regulations, 2013 CFR


    ... 46 Shipping 6 2013-10-01 2013-10-01 false Recognized laboratory. 160.077-9 Section 160.077-9... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  18. 46 CFR 160.048-8 - Recognized laboratory.

    Code of Federal Regulations, 2011 CFR


    ... 46 Shipping 6 2011-10-01 2011-10-01 false Recognized laboratory. 160.048-8 Section 160.048-8... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  19. 46 CFR 160.048-8 - Recognized laboratory.

    Code of Federal Regulations, 2013 CFR


    ... 46 Shipping 6 2013-10-01 2013-10-01 false Recognized laboratory. 160.048-8 Section 160.048-8... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  20. 46 CFR 162.039-5 - Recognized laboratory.

    Code of Federal Regulations, 2014 CFR


    ... 46 Shipping 6 2014-10-01 2014-10-01 false Recognized laboratory. 162.039-5 Section 162.039-5... Recognized laboratory. (a) A recognized laboratory is one which is regularly engaged in the examination... motorboats. The following laboratories are recognized, and the semiportable fire extinguishers bearing...

  1. 46 CFR 160.048-8 - Recognized laboratory.

    Code of Federal Regulations, 2012 CFR


    ... 46 Shipping 6 2012-10-01 2012-10-01 false Recognized laboratory. 160.048-8 Section 160.048-8... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  2. 46 CFR 160.077-9 - Recognized laboratory.

    Code of Federal Regulations, 2012 CFR


    ... 46 Shipping 6 2012-10-01 2012-10-01 false Recognized laboratory. 160.077-9 Section 160.077-9... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  3. 46 CFR 160.076-19 - Recognized laboratories.

    Code of Federal Regulations, 2013 CFR


    ... 46 Shipping 6 2013-10-01 2013-10-01 false Recognized laboratories. 160.076-19 Section 160.076-19... Recognized laboratories. The approval and production oversight functions that this subpart requires to be conducted by a recognized laboratory must be conducted by an independent laboratory recognized by the...

  4. 46 CFR 160.049-8 - Recognized laboratory.

    Code of Federal Regulations, 2011 CFR


    ... 46 Shipping 6 2011-10-01 2011-10-01 false Recognized laboratory. 160.049-8 Section 160.049-8... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  5. 46 CFR 160.049-8 - Recognized laboratory.

    Code of Federal Regulations, 2012 CFR


    ... 46 Shipping 6 2012-10-01 2012-10-01 false Recognized laboratory. 160.049-8 Section 160.049-8... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  6. 46 CFR 160.077-9 - Recognized laboratory.

    Code of Federal Regulations, 2011 CFR


    ... 46 Shipping 6 2011-10-01 2011-10-01 false Recognized laboratory. 160.077-9 Section 160.077-9... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  7. 46 CFR 160.049-8 - Recognized laboratory.

    Code of Federal Regulations, 2013 CFR


    ... 46 Shipping 6 2013-10-01 2013-10-01 false Recognized laboratory. 160.049-8 Section 160.049-8... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  8. 46 CFR 160.048-8 - Recognized laboratory.

    Code of Federal Regulations, 2014 CFR


    ... 46 Shipping 6 2014-10-01 2014-10-01 false Recognized laboratory. 160.048-8 Section 160.048-8... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  9. 46 CFR 162.039-5 - Recognized laboratory.

    Code of Federal Regulations, 2013 CFR


    ... 46 Shipping 6 2013-10-01 2013-10-01 false Recognized laboratory. 162.039-5 Section 162.039-5... Recognized laboratory. (a) A recognized laboratory is one which is regularly engaged in the examination... motorboats. The following laboratories are recognized, and the semiportable fire extinguishers bearing...

  10. 46 CFR 160.077-9 - Recognized laboratory.

    Code of Federal Regulations, 2014 CFR


    ... 46 Shipping 6 2014-10-01 2014-10-01 false Recognized laboratory. 160.077-9 Section 160.077-9... Recognized laboratory. (a) A manufacturer seeking Coast Guard approval of a product under this subpart shall... to a recognized independent laboratory. The following laboratories are recognized under §...

  11. 46 CFR 162.039-5 - Recognized laboratory.

    Code of Federal Regulations, 2010 CFR


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Recognized laboratory. 162.039-5 Section 162.039-5... Recognized laboratory. (a) A recognized laboratory is one which is regularly engaged in the examination... motorboats. The following laboratories are recognized, and the semiportable fire extinguishers bearing...

  12. 46 CFR 162.039-5 - Recognized laboratory.

    Code of Federal Regulations, 2012 CFR


    ... 46 Shipping 6 2012-10-01 2012-10-01 false Recognized laboratory. 162.039-5 Section 162.039-5... Recognized laboratory. (a) A recognized laboratory is one which is regularly engaged in the examination... motorboats. The following laboratories are recognized, and the semiportable fire extinguishers bearing...

  13. 46 CFR 160.076-19 - Recognized laboratories.

    Code of Federal Regulations, 2014 CFR


    ... 46 Shipping 6 2014-10-01 2014-10-01 false Recognized laboratories. 160.076-19 Section 160.076-19... Recognized laboratories. The approval and production oversight functions that this subpart requires to be conducted by a recognized laboratory must be conducted by an independent laboratory recognized by the...

  14. Widespread Shortening of 3’ Untranslated Regions and Increased Exon Inclusion Are Evolutionarily Conserved Features of Innate Immune Responses to Infection

    PubMed Central

    Pagé Sabourin, Ariane; Nédélec, Yohann; Dumaine, Anne; Yotova, Vania; Johnson, Zachary P.; Lanford, Robert E.; Burge, Christopher B.


    The contribution of pre-mRNA processing mechanisms to the regulation of immune responses remains poorly studied despite emerging examples of their role as regulators of immune defenses. We sought to investigate the role of mRNA processing in the cellular responses of human macrophages to live bacterial infections. Here, we used mRNA sequencing to quantify gene expression and isoform abundances in primary macrophages from 60 individuals, before and after infection with Listeria monocytogenes and Salmonella typhimurium. In response to both bacteria we identified thousands of genes that significantly change isoform usage in response to infection, characterized by an overall increase in isoform diversity after infection. In response to both bacteria, we found global shifts towards (i) the inclusion of cassette exons and (ii) shorter 3’ UTRs, with near-universal shifts towards usage of more upstream polyadenylation sites. Using complementary data collected in non-human primates, we show that these features are evolutionarily conserved among primates. Following infection, we identify candidate RNA processing factors whose expression is associated with individual-specific variation in isoform abundance. Finally, by profiling microRNA levels, we show that 3’ UTRs with reduced abundance after infection are significantly enriched for target sites for particular miRNAs. These results suggest that the pervasive usage of shorter 3’ UTRs is a mechanism for particular genes to evade repression by immune-activated miRNAs. Collectively, our results suggest that dynamic changes in RNA processing may play key roles in the regulation of innate immune responses. PMID:27690314

  15. The Human Arp2/3 Complex Is Composed of Evolutionarily Conserved Subunits and Is Localized to Cellular Regions of Dynamic Actin Filament Assembly

    PubMed Central

    Welch, Matthew D.; DePace, Angela H.; Verma, Suzie; Iwamatsu, Akihiro; Mitchison, Timothy J.


    The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells. The human complex consists of seven subunits which include the actin related proteins Arp2 and Arp3, and five others referred to as p41-Arc, p34-Arc, p21-Arc, p20-Arc, and p16-Arc (Arp complex). We have determined the predicted amino acid sequence of all seven subunits. Each has homologues in diverse eukaryotes, implying that the structure and function of the complex has been conserved through evolution. Human Arp2 and Arp3 are very similar to family members from other species. p41-Arc is a new member of the Sop2 family of WD (tryptophan and aspartate) repeat–containing proteins and may be posttranslationally modified, suggesting that it may be involved in regulating the activity and/or localization of the complex. p34-Arc, p21-Arc, p20-Arc, and p16-Arc define novel protein families. We sought to evaluate the function of the Arp2/3 complex in cells by determining its intracellular distribution. Arp3, p34-Arc, and p21-Arc were localized to the lamellipodia of stationary and locomoting fibroblasts, as well to Listeria monocytogenes assembled actin tails. They were not detected in cellular bundles of actin filaments. Taken together with the ability of the Arp2/3 complex to induce actin polymerization, these observations suggest that the complex promotes actin assembly in lamellipodia and may participate in lamellipodial protrusion. PMID:9230079

  16. The human Arp2/3 complex is composed of evolutionarily conserved subunits and is localized to cellular regions of dynamic actin filament assembly.


    Welch, M D; DePace, A H; Verma, S; Iwamatsu, A; Mitchison, T J


    The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells. The human complex consists of seven subunits which include the actin related proteins Arp2 and Arp3, and five others referred to as p41-Arc, p34-Arc, p21-Arc, p20-Arc, and p16-Arc (p omplex). We have determined the predicted amino acid sequence of all seven subunits. Each has homologues in diverse eukaryotes, implying that the structure and function of the complex has been conserved through evolution. Human Arp2 and Arp3 are very similar to family members from other species. p41-Arc is a new member of the Sop2 family of WD (tryptophan and aspartate) repeat-containing proteins and may be posttranslationally modified, suggesting that it may be involved in regulating the activity and/or localization of the complex. p34-Arc, p21-Arc, p20-Arc, and p16-Arc define novel protein families. We sought to evaluate the function of the Arp2/3 complex in cells by determining its intracellular distribution. Arp3, p34-Arc, and p21-Arc were localized to the lamellipodia of stationary and locomoting fibroblasts, as well to Listeria monocytogenes assembled actin tails. They were not detected in cellular bundles of actin filaments. Taken together with the ability of the Arp2/3 complex to induce actin polymerization, these observations suggest that the complex promotes actin assembly in lamellipodia and may participate in lamellipodial protrusion.

  17. Characterization and Placement of Wetlands for Integrated Conservation Practice Planning

    EPA Science Inventory

    Constructed wetlands have been recognized as an efficient and cost-effective conservation practice to protect water quality through reducing the transport of sediments and nutrients from upstream croplands to downstream water bodies. The challenge resides in targeting the strateg...

  18. Conservation genetics of North American freshwater mussels Amblema and Megalonaias

    USGS Publications Warehouse

    Mulvey, M.; Lydeard, C.; Pyer, D.L.; Hicks, K.M.; Brim-Box, J.; Williams, J.D.; Butler, R.S.


    Freshwater bivalves are among the most endangered groups of organisms in North America. Efforts to protect the declining mussel fauna are confounded by ambiguities associated with recognition of distinct evolutionary entities or species. This, in part, is due to the paucity of reliable morphological characters for differentiating taxa. We have employed allozymes and DNA sequence data to search for diagnosably distinct evolutionary entities within two problematic genera of unionid mussels, Amblema and Megalonaias. Within the genus Amblema three species are recognized based on our DNA sequence data for the mitochondrial 16S rRNA and allozyme data (Amblema neislerii, A. plicata, and A. elliotti). Only one taxonomically distinct entity is recognized within the genus Megalonaias—M. nervosa. Megalonaias boykiniana of the Apalachicolan Region is not diagnosable and does not warrant specific taxonomic status. Interestingly, Megalonaias from west of the Mississippi River, including the Mississippi, exhibited an allozyme and mtDNA haplotype frequency shift suggestive of an east-west dichotomy. The results of this study eliminate one subspecies of Amblema and increase the range of A. plicata. This should not affect the conservation status of “currently stable” assigned to A. plicata by Williams et al. (1993). The conservation status of A. elliotti needs to be reexamined because its distribution appears to be limited to the Coosa River System in Alabama and Georgia.

  19. Opaque-2 is a transcriptional activator that recognizes a specific target site in 22-kD zein genes.


    Schmidt, R J; Ketudat, M; Aukerman, M J; Hoschek, G


    opaque-2 (o2) is a regulatory locus in maize that plays an essential role in controlling the expression of genes encoding the 22-kD zein proteins. Through DNase I footprinting and DNA binding analyses, we have identified the binding site for the O2 protein (O2) in the promoter of 22-kD zein genes. The sequence in the 22-kD zein gene promoter that is recognized by O2 is similar to the target site recognized by other "basic/leucine zipper" (bZIP) proteins in that it contains an ACGT core that is necessary for DNA binding. The site is located in the -300 region relative to the translation start and lies about 20 bp downstream of the highly conserved zein gene sequence motif known as the "prolamin box." Employing gel mobility shift assays, we used O2 antibodies and nuclear extracts from an o2 null mutant to demonstrate that the O2 protein in maize endosperm nuclei recognizes the target site in the zein gene promoter. Mobility shift assays using nuclear proteins from an o2 null mutant indicated that other endosperm proteins in addition to O2 can bind the O2 target site and that O2 may be associated with one of these proteins. We also demonstrated that in yeast cells the O2 protein can activate expression of a lacZ gene containing a multimer of the O2 target sequence as part of its promoter, thus confirming its role as a transcriptional activator. A computer-assisted search indicated that the O2 target site is not present in the promoters of zein genes other than those of the 22-kD class. These data suggest a likely explanation at the molecular level for the differential effect of o2 mutations on expression of certain members of the zein gene family.

  20. Animal conservation, carbon and sustainability.


    Leader-Williams, N


    International conventions to reduce carbon dioxide levels focus on ecosystems and do not specifically recognize the need to conserve species. However, species are the building blocks of ecosystems, they are more widely understood among the public, and they provide means of capturing market values from ecosystems. Achieving successful conservation globally will require ensuring that the systems under which species and ecosystems are conserved are more inclusive than statutory protected areas. Equal emphasis needs to be placed on including effective regimes that also encompass private and communal ownership through incentive-based approaches. Nevertheless, if globalized industries such as nature-based tourism or consumptive use are to provide meaningful incentives locally, a key requirement is to reduce leakage of revenue that is earned as a result of conserving species, such that local development concerns are addressed. However, current biodiversity conventions that address these needs are largely aspirational, while globalized industries such as tourism mainly promote their green credentials only through voluntary codes of conduct. Greatly improved linkages are needed between international conservation concerns and ensuring effective solutions to sustainability, which inevitably rest at national and sub-national levels, through systems of rights, tenure, benefits and incentives.

  1. Attenuated Salmonella choleraesuis-mediated RNAi targeted to conserved regions against foot-and-mouth disease virus in guinea pigs and swine.


    Cong, Wei; Jin, Hong; Jiang, Chengda; Yan, Weiyao; Liu, Mingqiu; Chen, Jiulian; Zuo, Xiaoping; Zheng, Zhaoxin


    In this study, specific sequences within three genes (3D, VP4 and 2B) of the foot-and-mouth disease virus (FMDV) genome were determined to be effective RNAi targets. These sequences are highly conserved among different serotype viruses based on sequence analysis. Small interfering RNA (siRNA)-expressing plasmids (p3D-NT19, p3D-NT56, pVP4-NT19, pVP4-NT65 and p2B-NT25) were constructed to express siRNA targeting 3D, VP4 and 2B, respectively. The antiviral potential of these siRNA for various FMDV isolates was investigated in baby hamster kidney (BHK-21) cells and suckling mice. The results show that these siRNA inhibited virus yield 10- to 300-fold for different FMDV isolates of serotype O and serotype Asia I at 48 h post infection in BHK-21 cells compared to control cells. In suckling mice, p3D-NT56 and p2B-NT25 delayed the death of mice. Twenty percent to 40% of the animals that received a single siRNA dose survived 5 days post infection with serotype O or serotype Asia I. We used an attenuated Salmonella choleraesuis (C500) vaccine strain, to carry the plasmid that expresses siRNA directed against the polymerase gene 3D (p3D-NT56) of FMDV. We used guinea pigs to evaluate the inhibitory effects of recombinant S. cho (p3D-NT56/S. cho) on FMDV infection. The results show that 80% of guinea pigs inoculated with 10(9) CFU of p3D-NT56/S. cho and challenged 36 h later with 50 ID(50) of homologous FMDV were protected. We also measured the antiviral activity of p3D-NT56/S. cho in swine. The results indicate that 100% of the animals treated with 5 x 10(9) CFU of p3D-NT56/S. cho were protected in 9 days.

  2. Conservation agriculture among small scale farmers in semi-arid region of Kenya does improve soil biological quality and soil organic carbon

    NASA Astrophysics Data System (ADS)

    Waweru, Geofrey; Okoba, Barrack; Cornelis, Wim


    The low food production in Sub-Saharan Africa (SSA) has been attributed to declining soil quality. This is due to soil degradation and fertility depletion resulting from unsustainable conventional farming practices such as continuous tillage, crop residue burning and mono cropping. To overcome these challenges, conservation agriculture (CA) is actively promoted. However, little has been done in evaluating the effect of each of the three principles of CA namely: minimum soil disturbance, maximum surface cover and diversified/crop rotation on soil quality in SSA. A study was conducted for three years from 2012 to 2015 in Laikipia East sub county in Kenya to evaluate the effect of tillage, surface cover and intercropping on a wide variety of physical, chemical and biological soil quality indicators, crop parameters and the field-water balance. This abstract reports on soil microbial biomass carbon (SMBC) and soil organic carbon (SOC). The experimental set up was a split plot design with tillage as main treatment (conventional till (CT), no-till (NT) and no-till with herbicide (NTH)), and intercropping and surface cover as sub treatment (intercropping maize with: beans, MB; beans and leucaena, MBL; beans and maize residues at 1.5 Mg ha-1 MBMu, and dolichos, MD). NT had significantly higher SMBC by 66 and 31% compared with CT and NTH respectively. SOC was significantly higher in NTH than CT and NT by 15 and 4%, respectively. Intercropping and mulching had significant effect on SMBC and SOC. MBMu resulted in higher SMBC by 31, 38 and 43%, and SOC by 9, 20 and 22% as compared with MBL, MD and MB, respectively. SMBC and SOC were significantly affected by the interaction between tillage, intercropping and soil cover with NTMBMu and NTHMBMu having the highest SMBC and SOC, respectively. We conclude that indeed tillage, intercropping and mulching substantially affect SMBC and SOC. On the individual components of CA, tillage and surface cover had the highest effect on SMBC and

  3. Attenuated Salmonella choleraesuis-mediated RNAi targeted to conserved regions against foot-and-mouth disease virus in guinea pigs and swine

    PubMed Central

    Cong, Wei; Jin, Hong; Jiang, Chengda; Yan, Weiyao; Liu, Mingqiu; Chen, Jiulian; Zuo, Xiaoping; Zheng, Zhaoxin


    In this study, specific sequences within three genes (3D, VP4 and 2B) of the foot-and-mouth disease virus (FMDV) genome were determined to be effective RNAi targets. These sequences are highly conserved among different serotype viruses based on sequence analysis. Small interfering RNA (siRNA)-expressing plasmids (p3D-NT19, p3D-NT56, pVP4-NT19, pVP4-NT65 and p2B-NT25) were constructed to express siRNA targeting 3D, VP4 and 2B, respectively. The antiviral potential of these siRNA for various FMDV isolates was investigated in baby hamster kidney (BHK-21) cells and suckling mice. The results show that these siRNA inhibited virus yield 10- to 300-fold for different FMDV isolates of serotype O and serotype Asia I at 48 h post infection in BHK-21 cells compared to control cells. In suckling mice, p3D-NT56 and p2B-NT25 delayed the death of mice. Twenty percent to 40% of the animals that received a single siRNA dose survived 5 days post infection with serotype O or serotype Asia I. We used an attenuated Salmonella choleraesuis (C500) vaccine strain, to carry the plasmid that expresses siRNA directed against the polymerase gene 3D (p3D-NT56) of FMDV. We used guinea pigs to evaluate the inhibitory effects of recombinant S. cho (p3D-NT56/S. cho) on FMDV infection. The results show that 80% of guinea pigs inoculated with 109 CFU of p3D-NT56/S. cho and challenged 36 h later with 50 ID50 of homologous FMDV were protected. We also measured the antiviral activity of p3D-NT56/S. cho in swine. The results indicate that 100% of the animals treated with 5 × 109 CFU of p3D-NT56/S. cho were protected in 9 days. PMID:20167192

  4. Two separate modules of the conserved regulatory RNA AbcR1 address multiple target mRNAs in and outside of the translation initiation region

    PubMed Central

    Overlöper, Aaron; Kraus, Alexander; Gurski, Rosemarie; Wright, Patrick R; Georg, Jens; Hess, Wolfgang R; Narberhaus, Franz


    The small RNA AbcR1 regulates the expression of ABC transporters in the plant pathogen Agrobacterium tumefaciens, the plant symbiont Sinorhizobium meliloti, and the human pathogen Brucella abortus. A combination of proteomic and bioinformatic approaches suggested dozens of AbcR1 targets in A. tumefaciens. Several of these newly discovered targets are involved in the uptake of amino acids, their derivatives, and sugars. Among the latter is the periplasmic sugar-binding protein ChvE, a component of the virulence signal transduction system. We examined 16 targets and their interaction with AbcR1 in close detail. In addition to the previously described mRNA interaction site of AbcR1 (M1), the CopraRNA program predicted a second functional module (M2) as target-binding site. Both M1 and M2 contain single-stranded anti-SD motifs. Using mutated AbcR1 variants, we systematically tested by band shift experiments, which sRNA region is responsible for mRNA binding and gene regulation. On the target site, we find that AbcR1 interacts with some mRNAs in the translation initiation region and with others far into their coding sequence. Our data show that AbcR1 is a versatile master regulator of nutrient uptake systems in A. tumefaciens and related bacteria. PMID:24921646

  5. Landscapes, tourism, and conservation




    One key aspect of global change is a decrease in ecological integrity as more and more landscapes are developed, leaving a mosaic of intact refuges and degraded patches that may not be sufficient for conserving biodiversity. While increases in human population and shifts in the distribution of people affect land use, the temporary movement of people can have major implications for conservation and biodiversity. Three examples are presented where recreation/tourism can enhance the conservation of land on a landscape scale, leading to habitat protection and biodiversity preservation: (1) Shorebirds often require a matrix of different habitat types during migratory stopovers, and ecotourism can serve as a catalyst for landscape scale protection of habitat. (2) Riparian habitats can serve as corridors to link diverse habitat patches, as well as serving as biodiversity hotspots. (3) Remediation and rehabilitation of contaminated lands, such as those of the US Department of Energy, aimed at developing recreational activities on the uncontaminated portions, can be the most economical form of re-development with no increase in human or ecological risk. Since large areas on many DOE sites have been undisturbed since the Second World War, when they were acquired, they contain unique or valuable ecosystems that serve an important role within their regional landscapes. In all three cases the judicious development of recreational/tourist interests can encourage both the conservation of habitats and the wise management of habitats on a landscape scale. While some species or habitats are too fragile for sustained tourism, many can be managed so that species, ecosystems and ecotourists flourish. By contributing to the economic base of regions, ecotourists/recreationists can influence the protection of land and biodiversity on a landscape scale, contributing to ecosystem management. The human dimensions of land preservation and biodiversity protection are key to long

  6. Genomics and the future of conservation genetics.


    Allendorf, Fred W; Hohenlohe, Paul A; Luikart, Gordon


    We will soon have complete genome sequences from thousands of species, as well as from many individuals within species. This coming explosion of information will transform our understanding of the amount, distribution and functional significance of genetic variation in natural populations. Now is a crucial time to explore the potential implications of this information revolution for conservation genetics and to recognize limitations in applying genomic tools to conservation issues. We identify and discuss those problems for which genomics will be most valuable for curbing the accelerating worldwide loss of biodiversity. We also provide guidance on which genomics tools and approaches will be most appropriate to use for different aspects of conservation.



    Hough, P.V.C.


    This patent relates to a method and means for recognizing a complex pattern in a picture. The picture is divided into framelets, each framelet being sized so that any segment of the complex pattern therewithin is essentially a straight line. Each framelet is scanned to produce an electrical pulse for each point scanned on the segment therewithin. Each of the electrical pulses of each segment is then transformed into a separate strnight line to form a plane transform in a pictorial display. Each line in the plane transform of a segment is positioned laterally so that a point on the line midway between the top and the bottom of the pictorial display occurs at a distance from the left edge of the pictorial display equal to the distance of the generating point in the segment from the left edge of the framelet. Each line in the plane transform of a segment is inclined in the pictorial display at an angle to the vertical whose tangent is proportional to the vertical displacement of the generating point in the segment from the center of the framelet. The coordinate position of the point of intersection of the lines in the pictorial display for each segment is determined and recorded. The sum total of said recorded coordinate positions being representative of the complex pattern. (AEC)

  8. Position, rotation, and intensity invariant recognizing method


    Ochoa, E.; Schils, G.F.; Sweeney, D.W.


    A method for recognizing the presence of a particular target in a field of view which is target position, rotation, and intensity invariant includes the preparing of a target-specific invariant filter from a combination of all eigen-modes of a pattern of the particular target. Coherent radiation from the field of view is then imaged into an optical correlator in which the invariant filter is located. The invariant filter is rotated in the frequency plane of the optical correlator in order to produce a constant-amplitude rotational response in a correlation output plane when the particular target is present in the field of view. Any constant response is thus detected in the output plane to determine whether a particular target is present in the field of view. Preferably, a temporal pattern is imaged in the output plane with a optical detector having a plurality of pixels and a correlation coefficient for each pixel is determined by accumulating the intensity and intensity-square of each pixel. The orbiting of the constant response caused by the filter rotation is also preferably eliminated either by the use of two orthogonal mirrors pivoted correspondingly to the rotation of the filter or the attaching of a refracting wedge to the filter to remove the offset angle. Detection is preferably performed of the temporal pattern in the output plane at a plurality of different angles with angular separation sufficient to decorrelate successive frames. 1 fig.

  9. Perspective: Recognizing and rewarding clinical scholarship.


    Grigsby, R Kevin; Thorndyke, Luanne


    Faculty members in medical schools and academic medical centers are in a constant process of generating new knowledge. The cornerstone of academia--and academic medicine--is scholarship. Traditionally, tenure and/or academic promotion in the professorial ranks is awarded to those who meet institutional criteria in the missions of research, teaching, and service, including patient care. In the academic review process, priority is often placed on a record of demonstrated, consistent success in traditional laboratory research, also known as the scholarship of discovery. More recently, there has been greater recognition of other forms of scholarship: education, application, and integration. These forms of scholarship, although less recognized, also result in the generation of new knowledge. In an attempt to understand the breadth and scope of clinical scholarship, the authors searched the extant literature in academic medicine for a definition of clinical scholarship and expanded the search to disciplines outside of medicine. They found that succinct, discrete definitions of clinical scholarship have been published in other disciplines, but not in academic medicine. After reviewing definitions of clinical scholarship from other disciplines, adapting definitions of educational scholarship in academic medicine, and including qualities unique to clinical scholarship, the authors developed a framework for understanding clinical scholarship in academic medicine as a means for opening a dialogue within the academic medical community. This dialogue hopefully will lead to formulating a succinct, discrete definition of clinical scholarship that will allow greater recognition and reward for clinical scholars in the promotion and tenure process.

  10. Overview: recognizing the problem of magnesium deficiency

    SciTech Connect

    Seelig, M.S.


    The magnesium content of the usual American diet is less than the recommended dietary allowance. Excesses of some macro- and micro-nutrients interact with Mg, increasing its requirements. Marginal deficiency of Mg is not associated with hypomagnesemia, is not characterized by typical manifestations, as is thus difficult to diagnose. Serum or plasma Mg levels are held within narrow limits unless tissue levels are very low, or renal function is poor. Vulnerability to Mg deficiency increases during growth and development, pregnancy, when under physical or psychological stress, and during illness or its treatment that interferes with absorption or causes loss of Mg. Evidence of biochemical changes of early Mg deficiency is rarely sought, although the roles of Mg in many enzyme systems are recognized. The effects of Mg deficiency on metabolism, even in disorders caused by vitamin dependencies in which Mg is a co-factor, are largely unexplored. Deficiency of Mg is diagnosed confidently when the laboratory reports hypomagnesemia in patients with convulsions or arrhythmias. Without these signs, Mg levels are not often ordered, even in the presence of neuromuscular irritability such as respond to Mg repletion. Because Mg supplementation or Mg-sparing drugs protect against premature or ectopic heart beats and sudden death, to which diuretic-treated hypertensive patients are at risk, it is increasingly being advised that their Mg status be determined.

  11. RECOGNIZING AND IDENTIFYING PEOPLE: A neuropsychological review

    PubMed Central

    Barton, Jason J S; Corrow, Sherryse L


    Recognizing people is a classic example of a cognitive function that involves multiple processing stages and parallel routes of information. Neuropsychological data have provided important evidence for models of this process, particularly from case reports; however, the quality and extent of the data varies widely between studies. In this review we first discuss the requirements and logical basis of the types of neuropsychological evidence to support conclusions about the modules in this process. We then survey the adequacy of the current body of reports to address two key issues. First is the question of which cognitive operation generates a sense of familiarity: the current debate revolves around whether familiarity arises in modality-specific recognition units or later amodal processes. Key evidence on this point comes from the search for dissociations between familiarity for faces, voices and names. The second question is whether lesions can differentially affect the abilities to link diverse sources of person information (e.g. face, voice, name, biographic data). Dissociations of these linkages may favour a distributed-only model of the organization of semantic knowledge, whereas a ‘person-hub’ model would predict uniform impairments of all linkages. While we conclude that there is reasonable evidence for dissociations in name, voice and face familiarity in regards to the first question, the evidence for or against dissociated linkages between information stores in regards to the second is tenuous at best. We identify deficiencies in the current literature that should motivate and inform the design of future studies. PMID:26773237

  12. Artificial Immune System for Recognizing Patterns

    NASA Technical Reports Server (NTRS)

    Huntsberger, Terrance


    A method of recognizing or classifying patterns is based on an artificial immune system (AIS), which includes an algorithm and a computational model of nonlinear dynamics inspired by the behavior of a biological immune system. The method has been proposed as the theoretical basis of the computational portion of a star-tracking system aboard a spacecraft. In that system, a newly acquired star image would be treated as an antigen that would be matched by an appropriate antibody (an entry in a star catalog). The method would enable rapid convergence, would afford robustness in the face of noise in the star sensors, would enable recognition of star images acquired in any sensor or spacecraft orientation, and would not make an excessive demand on the computational resources of a typical spacecraft. Going beyond the star-tracking application, the AIS-based pattern-recognition method is potentially applicable to pattern- recognition and -classification processes for diverse purposes -- for example, reconnaissance, detecting intruders, and mining data.

  13. Dogs recognize dog and human emotions.


    Albuquerque, Natalia; Guo, Kun; Wilkinson, Anna; Savalli, Carine; Otta, Emma; Mills, Daniel


    The perception of emotional expressions allows animals to evaluate the social intentions and motivations of each other. This usually takes place within species; however, in the case of domestic dogs, it might be advantageous to recognize the emotions of humans as well as other dogs. In this sense, the combination of visual and auditory cues to categorize others' emotions facilitates the information processing and indicates high-level cognitive representations. Using a cross-modal preferential looking paradigm, we presented dogs with either human or dog faces with different emotional valences (happy/playful versus angry/aggressive) paired with a single vocalization from the same individual with either a positive or negative valence or Brownian noise. Dogs looked significantly longer at the face whose expression was congruent to the valence of vocalization, for both conspecifics and heterospecifics, an ability previously known only in humans. These results demonstrate that dogs can extract and integrate bimodal sensory emotional information, and discriminate between positive and negative emotions from both humans and dogs.

  14. Recognizing hesitation phenomena in continuous, spontaneous speech

    NASA Astrophysics Data System (ADS)

    Oshaughnessy, Douglas

    Spontaneous speech differs from read speech in speaking rate and hesitation. In natural, spontaneous speech, people often start talking and then think along the way; at times, this causes the speech to have hesitation pauses (both filled and unfilled) and restarts. Results are reported on all types of pauses in a widely-used speech database, for both hesitation pauses and semi-intentional pauses. A distinction is made between grammatical pauses (at major syntactic boundaries) and ungrammatical ones. Different types of unfilled pauses cannot be reliably separated based on silence duration, although grammatical pauses tend to be longer. In the prepausal word before ungrammatical pauses, there were few continuation rises in pitch, whereas 80 percent of the grammatical pauses were accompanied by a prior fundamental frequency rise of 10-40 kHz. Identifying the syntactic function of such hesitation phenomena can improve recognition performance by eliminating from consideration some of the hypotheses proposed by an acoustic recognizer. Results presented allow simple identification of filled pauses (such as uhh, umm) and their syntactic function.

  15. Development of NATO's recognized environmental picture

    NASA Astrophysics Data System (ADS)

    Teufert, John F.; Trabelsi, Mourad


    An important element for the fielding of a viable, effective NATO Response Force (NRF) is access to meteorological, oceanographic, geospatial data (GEOMETOC) and imagery. Currently, the available GEOMETOC information suffers from being very fragmented. NATO defines the Recognised Environmental Picture as controlled information base for GEOMETOC data. The NATO REP proposes an architecture that is both flexible and open. The focus lies on enabling a network-centric approach. The key into achieving this is relying on using open, well recognized standards that apply to both the data exchange protocols and the data formats. Communication and information exchange based on open standards enables system interoperability. Diverse systems, each with unique, specialized contributions to an increased understanding of the battlespace, can now cooperate to a manageable information sphere. By clearly defining responsibilities in the generation of information, a reduction in data transfer overhead is achieved . REP identifies three main stages in the dissemination of GEOMETOC data. These are Collection, Fusion (and Analysis) and Publication. A REP architecture has been successfully deployed during the NATO Coalition Warrior Interoperability Demonstration (CWID) in Lillehammer, Norway during June 2005. CWID is an annual event to validate and improve the interoperability of NATO and national Consultation and command, control, communications, computers, intelligence, surveillance, and reconnaissance (C4ISR) systems. With a test case success rate of 84%, it was able to provide relevant GEOMETOC support to the main NRF component headquarters. In 2006, the REP architecture will be deployed and validated during the NATO NRF Steadfast live exercises.

  16. Sequence conservation in the C-terminal region of spider silk proteins (Spidroin) from Nephila clavipes (Tetragnathidae) and Araneus bicentenarius (Araneidae).


    Beckwitt, R; Arcidiacono, S


    The polymerase chain reaction (PCR) has been used to amplify the portion of the Spidroin 1 gene that codes for the C-terminal part of the silk protein of the spider Nephila clavipes. Along with some substitution mutations of minor consequence, the PCR-derived sequence reveals an additional base missing from the previously published Nephila Spidroin 1 sequence. Comparison of the PCR-derived sequence with the equivalent region of Spidroin 2 indicates that the insertion of this single base results in greatly increased similarity in the resulting amino acid sequences of Spidroin 1 and Spidroin 2 (75% over 97 amino acids). The same PCR primers also amplified a fragment of the same length from Araneus bicentenarius. This sequence is also very similar to Spidroin 1 of Nephila (71% over 238 bases excluding the PCR primers, which translates into 76% over 79 amino acids).

  17. Linkage mapping in sheep and deer identifies a conserved pecora ruminant linkage group orthologous to two regions of HSA16 and a portion of HSA7Q

    SciTech Connect

    Broom, J.E.; Tate, M.L.; Dodds, K.G.


    Two orthologous linkage groups have been mapped in sheep and deer. Seven loci have been mapped in deer, and 12 in sheep. The sheep linkage group is assigned of ovine chromosome 24. The linkage groups consist of loci from the short arm of human chromosome 16, spanning the region containing the human Batten disease locus, and from human chromosome 7. One locus from the long arm of human chromosome 16 is also present, demonstrating a previously unknown rearrangement between human and ruminant chromosomes. There is no significant difference in marker order and distances between the two linkage groups, implying that this linkage pattern was present in the genome of the common ancestor of the pecora ruminants. 35 refs., 1 fig., 2 tabs.

  18. System recognizing Bahamian license plate with touching characters

    NASA Astrophysics Data System (ADS)

    Dun, Jingyu; Zhang, Sanyuan; Ye, Xiuzi; Zhang, Yin


    Various methods are proposed for license plate recognition, but none of them are universal. Some common methods for license plate localization, character extraction, and recognition are analyzed. Then a system is proposed to recognize the Bahamian license plate with touching characters. A vertical edge-based method with a modified sliding window technique is used to locate the license plate, and a machine learning process is used to trim the region. The located license plate is rectified by using the minimum enclosing box and the stroke width value. Then the vertical projection and pairs of extreme points are combined to segment the characters. Finally, a deep learning method is used to recognize the characters. 2996 images are experimented on and the total recognition accuracy achieves 83.29%. Typical methods of each stage are implemented to compare with the proposed methods. In addition, the proposed system is experimented on a public dataset to show the generalization ability of the system. The experimental results show that the proposed system performs better than the other methods and is able to be used in a real-time application.

  19. Using polygons to recognize and locate partially occluded objects.


    Koch, M W; Kashyap, R L


    We present computer vision algorithms that recognize and locate partially occluded objects. The scene may contain unknown objects that may touch or overlap giving rise to partial occlusion. The algorithms revolve around a generate-test paradigm. The paradigm iteratively generates and tests hypotheses for compatibility with the scene until it identifies all the scene objects. Polygon representations of the object's boundary guide the hypothesis generation scheme. Choosing the polygon representation turns out to have powerful consequences in all phases of hypothesis generation and verification. Special vertices of the polygon called ``corners'' help detect and locate the model in the scene. Polygon moment calculations lead to estimates of the dissimilarity between scene and model corners, and determine the model corner location in the scene. An association graph represents the matches and compatibility constraints. Extraction of the largest set of mutually compatible matches from the association graph forms a model hypothesis. Using a coordinate transform that maps the model onto the scene, the hypothesis gives the proposed model's location and orientation. Hypothesis verification requires checking for region consistency. The union of two polygons and other polygon operations combine to measure the consistency of the hypothesis with the scene. Experimental results give examples of all phases of recognizing and locating the objects.

  20. Water Conservation and Water Storage

    NASA Astrophysics Data System (ADS)

    Narayanan, M.


    Water storage can be a viable part of the solution to water conservation. This means that we should include reservoirs. Regardless, one should evaluate all aspects of water conservation principles. Recent drought in California indicates that there is an urgent need to re-visit the techniques used to maintain the water supply-chain mechanism in the entire state. We all recognize the fact that fish and wildlife depend on the streams, rivers and wetlands for survival. It is a well-known fact that there is an immediate need to provide solid protection to all these resources. Laws and regulations should help meet the needs of natural systems. Farmers may be forced to drilling wells deeper than ever. But, they will be eventually depleting groundwater reserves. Needless to say that birds, fish and wildlife cannot access these groundwater table. California is talking a lot about conservation. Unfortunately, the conservation efforts have not established a strong visible hold. The Environmental Protection Agency has a plan called E2PLAN (Narayanan, 2012). It is EPA's plan for achieving energy and environmental performance, leadership, accountability, and carbon neutrality. In June 2011, the EPA published a comprehensive, multi-year planning document called Strategic Sustainability Performance Plan. The author has previously reported these in detail at the 2012 AGU fall meeting. References: Ziegler, Jay (15 JUNE 2014). The Conversation: Water conservation efforts aren't taking hold, but there are encouraging signs. THE SACRAMENTO BEE. California. Narayanan, Mysore. (2012). The Importance of Water Conservation in the 21st Century. 72nd AGU International Conference. Eos Transactions: American Geophysical Union, Vol. 92, No. 56, Fall Meeting Supplement, 2012. H31I - 1255.

  1. Facial Expressions and Ability to Recognize Emotions From Eyes or Mouth in Children

    PubMed Central

    Guarnera, Maria; Hichy, Zira; Cascio, Maura I.; Carrubba, Stefano


    This research aims to contribute to the literature on the ability to recognize anger, happiness, fear, surprise, sadness, disgust and neutral emotions from facial information. By investigating children’s performance in detecting these emotions from a specific face region, we were interested to know whether children would show differences in recognizing these expressions from the upper or lower face, and if any difference between specific facial regions depended on the emotion in question. For this purpose, a group of 6-7 year-old children was selected. Participants were asked to recognize emotions by using a labeling task with three stimulus types (region of the eyes, of the mouth, and full face). The findings seem to indicate that children correctly recognize basic facial expressions when pictures represent the whole face, except for a neutral expression, which was recognized from the mouth, and sadness, which was recognized from the eyes. Children are also able to identify anger from the eyes as well as from the whole face. With respect to gender differences, there is no female advantage in emotional recognition. The results indicate a significant interaction ‘gender x face region’ only for anger and neutral emotions. PMID:27247651

  2. Building Collections: Recognizing and Appreciating Differences

    ERIC Educational Resources Information Center

    Krapp, Joanna Vergona


    A huge world exists outside the family. When youngsters enter school, they meet children from diverse and unfamiliar backgrounds--regional, ethnic, religious, and racial. Often there is confusion, mistrust, and apprehension. In the eyes of a child, being different is not always a good thing. Parents and teachers bear the burden of discussing…