Rare TREM2 variants associated with Alzheimer's disease display reduced cell surface expression.
Sirkis, Daniel W; Bonham, Luke W; Aparicio, Renan E; Geier, Ethan G; Ramos, Eliana Marisa; Wang, Qing; Karydas, Anna; Miller, Zachary A; Miller, Bruce L; Coppola, Giovanni; Yokoyama, Jennifer S
2016-09-02
Rare variation in TREM2 has been associated with greater risk for Alzheimer's disease (AD). TREM2 encodes a cell surface receptor expressed on microglia and related cells, and the R47H variant associated with AD appears to affect the ability of TREM2 to bind extracellular ligands. In addition, other rare TREM2 mutations causing early-onset neurodegeneration are thought to impair cell surface expression. Using a sequence kernel association (SKAT) analysis in two independent AD cohorts, we found significant enrichment of rare TREM2 variants not previously characterized at the protein level. Heterologous expression of the identified variants showed that novel variants S31F and R47C displayed significantly reduced cell surface expression. In addition, we identified rare variant R136Q in a patient with language-predominant AD that also showed impaired surface expression. The results suggest rare TREM2 variants enriched in AD may be associated with altered TREM2 function and that AD risk may be conferred, in part, from altered TREM2 surface expression.
ERAP1 reduces accumulation of aberrant and disulfide-linked forms of HLA-B27 on the cell surface.
Tran, Tri M; Hong, Sohee; Edwan, Jehad H; Colbert, Robert A
2016-06-01
Endoplasmic reticulum (ER) aminopeptidase 1 (ERAP1) variants contribute to the risk of ankylosing spondylitis in HLA-B27 positive individuals, implying a disease-related interaction between these gene products. The aim of this study was to determine whether reduced ERAP1 expression would alter the cell surface expression of HLA-B27 and the formation of aberrant disulfide-linked forms that have been implicated in the pathogenesis of spondyloarthritis. ERAP1 expression was knocked down in monocytic U937 cells expressing HLA-B27 and endogenous HLA class I. The effect of ERAP1 knockdown on the accumulation HLA-B alleles (B18, B51, and B27) was assessed using immunoprecipitation, isoelectric focusing, and immunoblotting, as well as flow cytometry with antibodies specific for different forms of HLA-B27. Cell surface expression of aberrant disulfide-linked HLA-B27 dimers was assessed by immunoprecipitation and electrophoresis on non-reducing polyacrylamide gels. ERAP1 knockdown increased the accumulation of HLA-B27 on the cell surface including disulfide-linked dimers, but had no effect on levels of HLA-B18 or -B51. Antibodies with unique specificity for HLA-B27 confirmed increased cell surface expression of complexes shown previously to contain long peptides. IFN-γ treatment resulted in striking increases in the expression of disulfide-linked HLA-B27 heavy chains, even in cells with normal ERAP1 expression. Our results suggest that normal levels of ERAP1 reduce the accumulation of aberrant and disulfide-linked forms of HLA-B27 in monocytes, and thus help to maintain the integrity of cell surface HLA-B27 complexes. Published by Elsevier Ltd.
ERAP1 Reduces Accumulation of Aberrant and Disulfide-Linked Forms of HLA-B27 on the Cell Surface
Tran, Tri; Hong, Sohee; Edwan, Jehad; Colbert, Robert A.
2016-01-01
Objective Endoplasmic reticulum (ER) aminopeptidase 1 (ERAP1) variants contribute to the risk of ankylosing spondylitis in HLA-B27 positive individuals, implying a disease-related interaction between these gene products. The aim of this study was to determine whether reduced ERAP1 expression would alter the cell surface expression of HLA-B27 and the formation of aberrant disulfide-linked forms that have been implicated in the pathogenesis of spondyloarthritis. Methods ERAP1 expression was knocked down in monocytic U937 cells expressing HLA-B27 and endogenous HLA class I. The effect of ERAP1 knockdown on the accumulation HLA-B alleles (B18, B51, and B27) was assessed using immunoprecipitation, isoelectric focusing, and immunoblotting, as well as flow cytometry with antibodies specific for different forms of HLA-B27. Cell surface expression of aberrant disulfide-linked HLA-B27 dimers was assessed by immunoprecipitation and electrophoresis on non-reducing polyacrylamide gels. Results ERAP1 knockdown increased the accumulation of HLA-B27 on the cell surface including disulfide-linked dimers, but had no effect on levels of HLA-B18 or -B51. Antibodies with unique specificity for HLA-B27 confirmed increased cell surface expression of complexes shown previously to contain long peptides. IFN-γ treatment resulted in striking increases in the expression of disulfide-linked HLA-B27 heavy chains, even in cells with normal ERAP1 expression. Conclusions Our results suggest that normal levels of ERAP1 reduce the accumulation of aberrant and disulfide-linked forms of HLA-B27 in monocytes, and thus help to maintain the integrity of cell surface HLA-B27 complexes. PMID:27107845
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choi, Ju Yeon; Park, Seonghee, E-mail: sp@ewha.ac.kr
The intermediate conductance calcium-activated potassium channel (KCa3.1) mediates proliferation of many cell types including fibroblasts, and is a molecular target for intervention in various cell proliferative diseases. Our previous study showed that reduction of KCa3.1 channel expression by lyso-globotriaosylceramide (lyso-Gb3) inhibits differentiation into myofibroblasts and collagen synthesis, which might lead to development of ascending thoracic aortic aneurysm secondary to Fabry disease. However, how lyso-Gb3 downregulates KCa3.1 channel expression is unknown. Therefore, we aimed to investigate the underlying mechanisms of lyso-Gb3-mediated KCa3.1 channel downregulation, focusing on the cAMP signaling pathway. We found that lyso-Gb3 increased the intracellular cAMP concentration by upregulationmore » of adenylyl cyclase 6 and inhibited ERK 1/2 phosphorylation through the protein kinase A (PKA) pathway, leading to the inhibition of KCa3.1 channel synthesis, not the exchange protein directly activated by cAMP (Epac) pathway. Moreover, lyso-Gb3 suppressed expression of class II phosphatidylinositol 3-kinase C2β (PI3KC2β) by PKA activation, which reduces the production of phosphatidylinositol 3-phosphate [PI(3)P], and the reduced membrane surface expression of KCa3.1 channel was recovered by increasing the intracellular levels of PI(3)P. Consequently, our findings that lyso-Gb3 inhibited both KCa3.1 channel synthesis and surface expression by increasing intracellular cAMP, and controlled surface expression through changes in PI3KC2β-mediated PI(3)P production, suggest that modulation of PKA and PI3KC2β activity to control of KCa3.1 channel expression can be an alternative important target to attenuate ascending thoracic aortic aneurysms in Fabry disease. - Highlights: • Lyso-Gb3 causes elevation of intracellular cAMP. • Lyso-Gb3 inhibits the ERK 1/2 phosphorylation through PKA, thereby reducing KCa3.1 channel synthesis. • Lyso-Gb3 reduces PI3KC2β-mediated intracellular PI(3)P production. • Lyso-Gb3 reduces both surface and total expression of the KCa3.1 channel. • Increasing intracellular levels of PI(3)P only recovers the reduced surface expression.« less
NHE8 plays important roles in gastric mucosal protection
Xu, Hua; Li, Jing; Chen, Huacong; Wang, Chunhui
2013-01-01
Sodium/hydrogen exchanger (NHE) 8 is an apically expressed membrane protein in the intestinal epithelial cells. It plays important roles in sodium absorption and bicarbonate secretion in the intestine. Although NHE8 mRNA has been detected in the stomach, the precise location and physiological role of NHE8 in the gastric glands remain unclear. In the current study, we successfully detected the expression of NHE8 in the glandular region of the stomach by Western blotting and located NHE8 protein at the apical membrane in the surface mucous cells by a confocal microscopic method. We also identified the expression of downregulated-in-adenoma (DRA) in the surface mucous cells in the stomach. Using NHE8−/− mice, we found that NHE8 plays little or no role in basal gastric acid production, yet NHE8−/− mice have reduced gastric mucosal surface pH and higher incidence of developing gastric ulcer. DRA expression was reduced significantly in the stomach in NHE8−/− mice. The propensity for gastric ulcer, reduced mucosal surface pH, and low DRA expression suggest that NHE8 is indirectly involved in gastric bicarbonate secretion and gastric mucosal protection. PMID:23220221
Chen, Liye; Ridley, Anna; Hammitzsch, Ariane; Al-Mossawi, Mohammad Hussein; Bunting, Helen; Georgiadis, Dimitris; Chan, Antoni; Kollnberger, Simon; Bowness, Paul
2016-01-01
Objective Human leucocyte antigen (HLA)-B27 and endoplasmic reticulum aminopeptidase 1 (ERAP1) are strongly associated with ankylosing spondylitis (AS). ERAP1 is a key aminopeptidase in HLA class I presentation and can potentially alter surface expression of HLA-B27 free heavy chains (FHCs). We studied the effects of ERAP1 silencing/inhibition/variations on HLA-B27 FHC expression and Th17 responses in AS. Methods Flow cytometry was used to measure surface expression of HLA class I in peripheral blood mononuclear cells (PBMCs) from patients with AS carrying different ERAP1 genotypes (rs2287987, rs30187 and rs27044) and in ERAP1-silenced/inhibited/mutated HLA-B27-expressing antigen presenting cells (APCs). ERAP1-silenced/inhibited APCs were cocultured with KIR3DL2CD3ε-reporter cells or AS CD4+ T cells. Th17 responses of AS CD4+ T cells were measured by interleukin (IL)-17A ELISA and Th17 intracellular cytokine staining. FHC cell surface expression and Th17 responses were also measured in AS PBMCs following ERAP1 inhibition. Results The AS-protective ERAP1 variants, K528R and Q730E, were associated with reduced surface FHC expression by monocytes from patients with AS and HLA-B27-expressing APCs. ERAP1 silencing or inhibition in APCs downregulated HLA-B27 FHC surface expression, reduced IL-2 production by KIR3DL2CD3ε-reporter cells and suppressed the Th17 expansion and IL-17A secretion by AS CD4+ T cells. ERAP1 inhibition of AS PBMCs reduced HLA class I FHC surface expression by monocytes and B cells, and suppressed Th17 expansion. Conclusions ERAP1 activity determines surface expression of HLA-B27 FHCs and potentially promotes Th17 responses in AS through binding of HLA-B27 FHCs to KIR3DL2. Our data suggest that ERAP1 inhibition has potential for AS treatment. PMID:26130142
Yang, H; Jiang, W; Furth, E E; Wen, X; Katz, J P; Sellon, R K; Silberg, D G; Antalis, T M; Schweinfest, C W; Wu, G D
1998-12-01
The pathogenesis of diarrhea in intestinal inflammatory states is a multifactorial process involving the effects of inflammatory mediators on epithelial transport function. The effect of colonic inflammation on the gene expression of DRA (downregulated in adenoma), a chloride-sulfate anion transporter that is mutated in patients with congenital chloridorrhea, was examined in vivo as well as in an intestinal epithelial cell line. DRA mRNA expression was diminished five- to sevenfold in the HLA-B27/beta2m transgenic rat compared with control. In situ hybridization showed that DRA, which is normally expressed in the upper crypt and surface epithelium of the colon, was dramatically reduced in the surface epithelium of the HLA-B27/beta2m transgenic rat, the interleukin-10 (IL-10) knockout mouse with spontaneous colitis, and in patients with ulcerative colitis. Immunohistochemistry demonstrated that mRNA expression of DRA reflected that of protein expression in vivo. IL-1beta reduced DRA mRNA expression in vitro by inhibiting gene transcription. The loss of transport function in the surface epithelium of the colon by attenuation of transporter gene expression, perhaps inhibited at the level of gene transcription by proinflammatory cytokines, may play a role in the pathogenesis of diarrhea in colitis.
Platelet dysfunction associated with the novel Trp29Cys thromboxane A₂ receptor variant.
Mumford, A D; Nisar, S; Darnige, L; Jones, M L; Bachelot-Loza, C; Gandrille, S; Zinzindohoue, F; Fischer, A-M; Mundell, S J; Gaussem, P
2013-03-01
Genetic variations that affect the structure of the thromboxane A2 receptor (TP receptor) provide insights into the function of this key platelet and vascular receptor, but are very rare in unselected populations. To determine the functional consequences of the TP receptor Trp29Cys (W29C) substitution. We performed a detailed phenotypic analysis of an index case (P1) with reduced platelet aggregation and secretion responses to TP receptor pathway activators, and a heterozygous TP receptor W29C substitution. An analysis of the variant W29C TP receptor expressed in heterologous cells was performed. Total TP receptor expression in platelets from P1 was similar to that of controls, but there was reduced maximum binding and reduced affinity of binding to the TP receptor antagonist [(3) H]SQ29548. HEK293 cells transfected with W29C TP receptor cDNA showed similar total TP receptor expression to wild-type (WT) controls. However, the TP receptor agonist U46619 was less potent at inducing rises in cytosolic free Ca(2+) in HEK293 cells expressing the W29C TP receptor than in WT controls, indicating reduced receptor function. Immunofluorescence microscopy and cell surface ELISA showed intracellular retention and reduced cell surface expression of the W29C TP receptor in HEK293 cells. Consistent with the platelet phenotype, both maximum binding and the affinity of binding of [(3) H]SQ29548 to the W29C TP receptor were reduced compared to WT controls. These findings extend the phenotypic description of the very rare disorder TP receptor deficiency, and show that the W29C substitution reduces TP receptor function by reducing surface receptor expression and by disrupting ligand binding. © 2012 International Society on Thrombosis and Haemostasis.
Zhou, Angela X; Kozhaya, Lina; Fujii, Hodaka; Unutmaz, Derya
2013-05-15
The role of surface-bound TGF-β on regulatory T cells (Tregs) and the mechanisms that mediate its functions are not well defined. We recently identified a cell-surface molecule called Glycoprotein A Repetitions Predominant (GARP), which is expressed specifically on activated Tregs and was found to bind latent TGF-β and mediate a portion of Treg suppressive activity in vitro. In this article, we address the role of GARP in regulating Treg and conventional T cell development and immune suppression in vivo using a transgenic mouse expressing GARP on all T cells. We found that, despite forced expression of GARP on all T cells, stimulation through the TCR was required for efficient localization of GARP to the cell surface. In addition, IL-2 signals enhanced GARP cell surface expression specifically on Tregs. GARP-transgenic CD4(+) T cells and Tregs, especially those expressing higher levels of GARP, were significantly reduced in the periphery. Mature Tregs, but not conventional CD4(+) T cells, were also reduced in the thymus. CD4(+) T cell reduction was more pronounced within the effector/memory subset, especially as the mouse aged. In addition, GARP-overexpressing CD4(+) T cells stimulated through the TCR displayed reduced proliferative capacity, which was restored by inhibiting TGF-β signaling. Furthermore, inhibiting TGF-β signals greatly enhanced surface expression of GARP on Tregs and blocked the induction of Foxp3 in activated CD4(+) T cells overexpressing GARP. These findings suggest a role for GARP in natural and induced Treg development through activation of bound latent TGF-β and signaling, which negatively regulates GARP expression on Tregs.
Chu, Eugene M; Tai, Daven C; Beer, Jennifer L; Hill, John S
2013-02-01
Macrophages are centrally involved during atherosclerosis development and are the predominant cell type that accumulates cholesterol in the plaque. Macrophages however, are heterogeneous in nature reflecting a variety of microenvironments and different phenotypes may be more prone to contribute towards atherosclerosis progression. Using primary human monocyte-derived macrophages, we sought to evaluate one aspect of atherogenic potential of different macrophage phenotypes by determining their propensity to associate with and accumulate oxidized low density lipoprotein (oxLDL). Classically-activated macrophages treated simultaneously with interferon γ (IFNγ) and tumor necrosis factor α (TNFα) associated with less oxLDL and accumulated less cholesterol compared to untreated controls. The combined treatment of IFNγ and TNFα reduced the mRNA expression of CD36 and the expression of both cell surface CD36 and macrophage scavenger receptor 1 (MSR1) protein. Under oxLDL loaded conditions, IFNγ and TNFα did not reduce macrophage protein expression of the transcription factor peroxisome proliferator-actived receptor γ (PPARγ) which is known to positively regulate CD36 expression. However, macrophages treated with IFNγ attenuated the ability of the PPARγ-specific agonist rosiglitazone from upregulating cell surface CD36 protein expression. Our results demonstrate that the observed reduction of cholesterol accumulation in macrophages treated with IFNγ and TNFα following oxLDL treatment was due at least in part to reduced cell surface CD36 and MSR1 protein expression. Copyright © 2012 Elsevier B.V. All rights reserved.
Wang, Rui; Wan, Qi; Kozhaya, Lina; Fujii, Hodaka; Unutmaz, Derya
2008-07-16
Regulatory T (T(reg)) cells control immune activation and maintain tolerance. How T(regs) mediate their suppressive function is unclear. Here we identified a cell surface molecule, called GARP, (or LRRC32), which within T cells is specifically expressed in T(regs) activated through the T cell receptor (TCR). Ectopic expression of GARP in human naïve T (T(N)) cells inhibited their proliferation and cytokine secretion upon TCR activation. Remarkably, GARP over-expression in T(N) cells induced expression of T(reg) master transcription factor Foxp3 and endowed them with a partial suppressive function. The extracellular but not the cytoplasmic region of GARP, was necessary for these functions. Silencing Foxp3 in human T(reg) cells reduced expression of GARP and attenuated their suppressive function. However, GARP function was not affected when Foxp3 was downregulated in GARP-overexpressing cells, while silencing GARP in Foxp3-overexpressing cells reduced their suppressive activity. These findings reveal a novel cell surface molecule-mediated regulatory mechanism, with implications for modulating aberrant immune responses.
Synaptopodin Limits TRPC6 Podocyte Surface Expression and Attenuates Proteinuria.
Yu, Hao; Kistler, Andreas; Faridi, Mohd Hafeez; Meyer, James Otto; Tryniszewska, Beata; Mehta, Dolly; Yue, Lixia; Dryer, Stuart; Reiser, Jochen
2016-11-01
Gain-of-function mutations of classic transient receptor potential channel 6 (TRPC6) were identified in familial FSGS, and increased expression of wild-type TRPC6 in glomeruli is observed in several human acquired proteinuric diseases. Synaptopodin, an actin binding protein that is important in maintaining podocyte function, is downregulated in various glomerular diseases. Here, we investigated whether synaptopodin maintains podocyte function by regulating podocyte surface expression and activity of TRPC6. We show indirect interaction and nonrandom association of synaptopodin and TRPC6 in podocytes. Knockdown of synaptopodin in cultured mouse podocytes increased the expression of TRPC6 at the plasma membrane, whereas overexpression of synaptopodin decreased it. Mechanistically, synaptopodin-dependent TRPC6 surface expression required functional actin and microtubule cytoskeletons. Overexpression of wild-type or FSGS-inducing mutant TRPC6 in synaptopodin-depleted podocytes enhanced TRPC6-mediated calcium influx and induced apoptosis. In vivo, knockdown of synaptopodin also caused increased podocyte surface expression of TRPC6. Administration of cyclosporin A, which stabilizes synaptopodin, reduced LPS-induced proteinuria significantly in wild-type mice but to a lesser extent in TRPC6 knockout mice. Furthermore, administration of cyclosporin A reversed the LPS-induced increase in podocyte surface expression of TRPC6 in wild-type mice. Our findings suggest that alteration in synaptopodin levels under disease conditions may modify intracellular TRPC6 channel localization and activity, which further contribute to podocyte dysfunction. Reducing TRPC6 surface levels may be a new approach to restoring podocyte function. Copyright © 2016 by the American Society of Nephrology.
Mori, Yasunori; Fukuda, Mitsunori; Henley, Jeremy M.
2014-01-01
Glutamate receptors are fundamental for control synaptic transmission, synaptic plasticity, and neuronal excitability. However, many of the molecular mechanisms underlying their trafficking remain elusive. We previously demonstrated that the small GTPase Rab17 regulates dendritic trafficking in hippocampal neurons. Here, we investigated the role(s) of Rab17 in AMPA receptor (AMPAR) and kainate receptor (KAR) trafficking. Although Rab17 knockdown did not affect surface expression of the AMPAR subunit GluA1 under basal or chemically induced long term potentiation conditions, it significantly reduced surface expression of the KAR subunit GluK2. Rab17 co-localizes with Syntaxin-4 in the soma, dendritic shaft, the tips of developing hippocampal neurons, and in spines. Rab17 knockdown caused Syntaxin-4 redistribution away from dendrites and into axons in developing hippocampal neurons. Syntaxin-4 knockdown reduced GluK2 but had no effect on GluA1 surface expression. Moreover, overexpression of constitutively active Rab17 promoted dendritic surface expression of GluK2 by enhancing Syntaxin-4 translocation to dendrites. These data suggest that Rab17 mediates the dendritic trafficking of Syntaxin-4 to selectively regulate dendritic surface insertion of GluK2-containing KARs in rat hippocampal neurons. PMID:24895134
Reciprocal and activity-dependent regulation of surface AMPA and NMDA receptors in cultured neurons
Li, Guo Hua; Jackson, Michael F; Orser, Beverley A; MacDonald, John F
2010-01-01
Activation of NMDA receptors (NMDARs) can modulate excitatory synaptic transmission in the central nervous system by dynamically altering the number of synaptic AMPA receptors (AMPARs). The surface expression of NMDARs themselves is also subject to modulation in an activity-dependent manner. In addition to NMDAR-induced changes in AMPAR expression, AMPARs have also been found to regulate their own surface expression, independently of NMDARs. However, whether or not AMPARs and NMDARs might reciprocally regulate their surface expression has not previously been systematically explored. We utilized surface biotinylation assays and stimulation protocols intended to selectively stimulate various glutamate receptor subpopulations (e.g. AMPARs vs NMDARs; synaptic vs extrasynaptic). We reveal that activation of synaptic NMDARs increases the surface expression of both NMDAR and AMPAR subunits, while activation of extrasynaptic NMDAR produces the opposite effect. Surprisingly, we find that selective activation of AMPARs reduces the surface expression of not only AMPARs but also of NMDARs. These results suggest that both AMPARs and NMDARs at synaptic sites are subject to modulation by multiple signalling pathways in an activity-dependent way. PMID:21383896
Norman, Jane E; Cunningham, Margaret R; Jones, Matthew L; Walker, Mary E; Westbury, Sarah K; Sessions, Richard B; Mundell, Stuart J; Mumford, Andrew D
2016-05-01
Protease-activated receptor 4 (PAR4) is a key regulator of platelet reactivity and is encoded by F2RL3, which has abundant rare missense variants. We aimed to provide proof of principle that rare F2LR3 variants potentially affect platelet reactivity and responsiveness to PAR1 antagonist drugs and to explore underlying molecular mechanisms. We identified 6 rare F2RL3 missense variants in 236 cardiac patients, of which the variant causing a tyrosine 157 to cysteine substitution (Y157C) was predicted computationally to have the greatest effect on PAR4 structure. Y157C platelets from 3 cases showed reduced responses to PAR4-activating peptide and to α-thrombin compared with controls, but no reduction in responses to PAR1-activating peptide. Pretreatment with the PAR1 antagonist vorapaxar caused lower residual α-thrombin responses in Y157C platelets than in controls, indicating greater platelet inhibition. HEK293 cells transfected with a PAR4 Y157C expression construct had reduced PAR4 functional responses, unchanged total PAR4 expression but reduced surface expression. PAR4 Y157C was partially retained in the endoplasmic reticulum and displayed an expression pattern consistent with defective N-glycosylation. Mutagenesis of Y322, which is the putative hydrogen bond partner of Y157, also reduced PAR4 surface expression in HEK293 cells. Reduced PAR4 responses associated with Y157C result from aberrant anterograde surface receptor trafficking, in part, because of disrupted intramolecular hydrogen bonding. Characterization of PAR4 Y157C establishes that rare F2RL3 variants have the potential to markedly alter platelet PAR4 reactivity particularly after exposure to therapeutic PAR1 antagonists. © 2016 American Heart Association, Inc.
Bodhinathan, Karthik; Taura, Jaume J.; Taylor, Natalie M.; Nettleton, Margaret Y.; Ciruela, Francisco; Slesinger, Paul A.
2013-01-01
G protein-gated inwardly rectifying potassium (GIRK) channels play an important role in regulating neuronal excitability. Sorting nexin 27b (SNX27b), which reduces surface expression of GIRK channels through a PDZ domain interaction, contains a putative Ras-association (RA) domain with unknown function. Deleting the RA domain in SNX27b (SNX27b-ΔRA) prevents the down-regulation of GIRK2c/GIRK3 channels. Similarly, a point mutation (K305A) in the RA domain disrupts regulation of GIRK2c/GIRK3 channels and reduces H-Ras binding in vitro. Finally, the dominant-negative H-Ras (S17N) occludes the SNX27b-dependent decrease in surface expression of GIRK2c/GIRK3 channels. Thus, the presence of a functional RA domain and the interaction with Ras-like G proteins comprise a novel mechanism for modulating SNX27b control of GIRK channel surface expression and cellular excitability. PMID:23536889
Estimating surface temperature in forced convection nucleate boiling - A simplified method
NASA Technical Reports Server (NTRS)
Hendricks, R. C.; Papell, S. S.
1977-01-01
A simplified expression to estimate surface temperatures in forced convection boiling was developed using a liquid nitrogen data base. Using the principal of corresponding states and the Kutateladze relation for maximum pool boiling heat flux, the expression was normalized for use with other fluids. The expression was applied also to neon and water. For the neon data base, the agreement was acceptable with the exclusion of one set suspected to be in the transition boiling regime. For the water data base at reduced pressure greater than 0.05 the agreement is generally good. At lower reduced pressures, the water data scatter and the calculated temperature becomes a function of flow rate.
Tsuji, Kunikazu; Ojima, Miyoko; Otabe, Koji; Horie, Masafumi; Koga, Hideyuki; Sekiya, Ichiro; Muneta, Takeshi
2017-06-09
Flow cytometric analysis of cell surface antigens is a powerful tool for the isolation and characterization of stem cells residing in adult tissues. In contrast to the collection of hematopoietic stem cells, the process of enzymatic digestion is usually necessary to prepare mesenchymal stem cells (MSCs) suspensions, which can influence the expression of cell surface markers. In this study, we examined the effects of various cell-detaching reagents and digestion times on the expression of stem cell-related surface antigens and MSC functions. Human MSCs were detached from dishes using four different reagents: trypsin, TrypLE, collagenase, and a nonenzymatic cell dissociation reagent (C5789; Sigma-Aldrich). Following dissociation reagent incubations ranging from 5 to 120 min, cell surface markers were analyzed by flow cytometry. Trypsin and TrypLE quickly dissociated the cells within 5 min, while collagenase and C5789 required 60 min to obtain maximum cell yields. C5789 significantly decreased cell viability at 120 min. Trypsin treatment significantly reduced CD44+, CD55+, CD73+, CD105+, CD140a+, CD140b+, and CD201+ cell numbers within 30 min. Collagenase treatment reduced CD140a expression by 30 min. In contrast, TrypLE treatment did not affect the expression of any cell surface antigens tested by 30 min. Despite the significant loss of surface antigen expression after 60 min of treatment with trypsin, adverse effects of enzymatic digestion on multipotency of MSCs were limited. Overall, our data indicated that TrypLE is advantageous over other cell dissociation reagents tested for the rapid preparation of viable MSC suspensions.
Suzuki, Takashi; Nakamura, Kazuyoshi; Mayanagi, Taira; Sobue, Kenji; Kubokawa, Manabu
2017-07-22
The ROMK1 K + channel, a member of the ROMK channel family, is the major candidate for the K + secretion pathway in the renal cortical collecting duct (CCD). ROMK1 possesses a PDZ domain-binding motif at its C-terminus that is considered a modulator of ROMK1 expression via interaction with Na + /H + exchange regulatory factor (NHERF) 1 and NHERF2 scaffold protein. Although NHERF1 is a potential binding partner of the ROMK1 K + channel, the interaction between NHERF1 and K + channel activity remains unclear. Therefore, in this study, we knocked down NHERF1 in cultured M-1 cells derived from mouse CCD and investigated the surface expression and K + channel current in these cells after exogenous transfection with EGFP-ROMK1. NHERF1 knockdown resulted in reduced surface expression of ROMK1 as indicated by a cell biotinylation assay. Using the patch-clamp technique, we further found that the number of active channels per patched membrane and the Ba 2+ -sensitive whole-cell K + current were decreased in the knockdown cells, suggesting that reduced K + current was accompanied by decreased surface expression of ROMK1 in the NHERF1 knockdown cells. Our results provide evidence that NHERF1 mediates K + current activity through acceleration of the surface expression of ROMK1 K + channels in M-1 cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Reduced opsin gene expression in a cave-dwelling fish
Tobler, Michael; Coleman, Seth W.; Perkins, Brian D.; Rosenthal, Gil G.
2010-01-01
Regressive evolution of structures associated with vision in cave-dwelling organisms is the focus of intense research. Most work has focused on differences between extreme visual phenotypes: sighted, surface animals and their completely blind, cave-dwelling counterparts. We suggest that troglodytic systems, comprising multiple populations that vary along a gradient of visual function, may prove critical in understanding the mechanisms underlying initial regression in visual pathways. Gene expression assays of natural and laboratory-reared populations of the Atlantic molly (Poecilia mexicana) revealed reduced opsin expression in cave-dwelling populations compared with surface-dwelling conspecifics. Our results suggest that the reduction in opsin expression in cave-dwelling populations is not phenotypically plastic but reflects a hardwired system not rescued by exposure to light during retinal ontogeny. Changes in opsin gene expression may consequently represent a first evolutionary step in the regression of eyes in cave organisms. PMID:19740890
Cai, Ruopeng; Jiang, Yanlong; Yang, Wei; Yang, Wentao; Shi, Shaohua; Shi, Chunwei; Hu, Jingtao; Gu, Wei; Ye, Liping; Zhou, Fangyu; Gong, Qinglong; Han, Wenyu; Yang, Guilian; Wang, Chunfeng
2016-02-01
Recently, poly-γ-glutamic acid synthetase A (pgsA) has been applied to display exogenous proteins on the surface of Lactobacillus casei or Lactococcus lactis, which results in a surfacedisplayed component of bacteria. However, the ability of carrying genes encoded by plasmids and the expression efficiency of recombinant bacteria can be somewhat affected by the longer gene length of pgsA (1,143 bp); therefore, a truncated gene, pgsA, was generated based on the characteristics of pgsA by computational analysis. Using murine IL-10 as an exogenous gene, recombinant Lactobacillus plantarum was constructed and the capacity of the surface-displayed protein and functional differences between exogenous proteins expressed by these strains were evaluated. Surface expression of IL-10 on both recombinant bacteria with anchorins and the higher expression levels in L. plantarum-pgsA'-IL-10 were confirmed by western blot assay. Most importantly, up-regulation of IL-1β, IL-6, TNF-α, IFN-γ, and the nuclear transcription factor NF-κB p65 in RAW264.7 cells after stimulation with Poly(I:C) or LPS was exacerbated after co-culture with L. plantarum-pgsA. By contrast, IL-10 expressed by these recombinant strains could reduce these factors, and the expression of these factors was associated with recombinant strains that expressed anchorin (especially in L. plantarum-pgsA'-IL-10) and was significantly lower compared with the anchorin-free strains. These findings indicated that exogenous proteins could be successfully displayed on the surface of L. plantarum by pgsA or pgsA', and the expression of recombinant bacteria with pgsA' was superior compared with bacteria with pgsA.
Hayashi, Hisamitsu; Mizuno, Tadahaya; Horikawa, Reiko; Nagasaka, Hironori; Yabuki, Takashi; Takikawa, Hajime; Sugiyama, Yuichi
2012-05-01
Multidrug resistance-associated protein 2 (in humans, MRP2; in rodents, Mrp2) mediates biliary excretion of bilirubin glucuronides. Therefore, upregulation of MRP2/Mrp2 expression may improve hyperbilirubinemia. We investigated the effects of 4-phenylbutyrate (4PBA), a drug used to treat ornithine transcarbamylase deficiency (OTCD), on the cell surface expression and transport function of MRP2/Mrp2 and serum T-Bil concentration. MRP2-expressing MDCKII (MRP2-MDCKII) cells and rats were studied to explore the change induced by 4PBA treatment in the cell surface expression and transport function of MRP2/Mrp2 and its underlying mechanism. Serum and liver specimens from OTCD patients were analyzed to examine the effect of 4PBA on hepatic MRP2 expression and serum T-Bil concentration in humans. In MRP2-MDCKII cells and the rat liver, 4PBA increased the cell surface expression and transport function of MRP2/Mrp2. In patients with OTCD, hepatic MRP2 expression increased and serum T-Bil concentration decreased significantly after 4PBA treatment. In vitro studies designed to explore the mechanism underlying this drug action suggested that cell surface-resident MRP2/Mrp2 is degraded via ubiquitination-mediated targeting to the endosomal/lysosomal degradation pathway and that 4PBA inhibits the degradation of cell surface-resident MRP2/Mrp2 by reducing its susceptibility to ubiquitination. 4PBA activates MRP2/Mrp2 function through increased expression of MRP2/Mrp2 at the hepatocanalicular membrane by modulating its ubiquitination, and thereby decreases serum T-Bil concentration. 4PBA has thus therapeutic potential for improving hyperbilirubinemia. Copyright © 2012 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
SRC Inhibition Reduces NR2B Surface Expression and Synaptic Plasticity in the Amygdala
ERIC Educational Resources Information Center
Sinai, Laleh; Duffy, Steven; Roder, John C.
2010-01-01
The Src protein tyrosine kinase plays a central role in the regulation of N-methyl-d-aspartate receptor (NMDAR) activity by regulating NMDAR subunit 2B (NR2B) surface expression. In the amygdala, NMDA-dependent synaptic plasticity resulting from convergent somatosensory and auditory inputs contributes to emotional memory; however, the role of Src…
VandenBussche, C J; Mulrooney, T J; Frazier, W R; Dakshanamurthy, S; Hurley, C K
2009-03-01
Using flow cytometry, fluorescent microscopy and examination of receptor glycosylation status, we demonstrate that an entire killer cell immunoglobulin-like receptor (KIR) locus (KIR2DS3)--assumed earlier to be surface expressed--appears to have little appreciable surface expression in transfected cells. This phenotype was noted for receptors encoded by three allelic variants including the common KIR2DS3*001 allele. Comparing the surface expression of KIR2DS3 with that of the better-studied KIR2DS1 molecule in two different cell lines, mutational analysis identified multiple polymorphic amino-acid residues that significantly alter the proportion of molecules present on the cell surface. A simultaneous substitution of five residues localized to the leader peptide (residues -18 and -7), second domain (residues 123 and 150) and transmembrane region (residue 234) was required to restore KIR2DS3 to the expression level of KIR2DS1. Corresponding simultaneous substitutions of KIR2DS1 to the KIR2DS3 residues resulted in a dramatically decreased surface expression. Molecular modeling was used to predict how these substitutions contribute to this phenotype. Alterations in receptor surface expression are likely to affect the balance of immune cell signaling impacting the characteristics of the response to pathogens or malignancy.
Amyloid Precursor-like Protein 2 Association with HLA Class I Molecules
Tuli, Amit; Sharma, Mahak; Wang, Xiaojian; Simone, Laura C.; Capek, Haley L.; Cate, Steven; Hildebrand, William H.; Naslavsky, Naava; Caplan, Steve; Solheim, Joyce C.
2009-01-01
Amyloid precursor-like protein 2 (APLP2) is a ubiquitously expressed protein. The previously demonstrated functions for APLP2 include binding to the mouse major histocompatibility complex (MHC) class I molecule H-2Kd and down regulating its cell surface expression. In this study, we have investigated the interaction of APLP2 with the human leukocyte antigen (HLA) class I molecule in human tumor cell lines. APLP2 was readily detected in pancreatic, breast, and prostate tumor lines, although it was found only in very low amounts in lymphoma cell lines. In a pancreatic tumor cell line, HLA class I was extensively co-localized with APLP2 in vesicular compartments following endocytosis of HLA class I molecules. In pancreatic, breast, and prostate tumor lines, APLP2 was bound to the HLA class I molecule. APLP2 was found to bind to HLA-A24, and more strongly to HLA-A2. Increased expression of APLP2 resulted in reduced surface expression of HLA-A2 and HLA-A24. Overall, these studies demonstrate that APLP2 binds to the HLA class I molecule, co-localizes with it in intracellular vesicles, and reduces the level of HLA class I molecule cell surface expression. PMID:19184004
Chen, Lie; Bi, Danlei; Tian, Lijun; McClafferty, Heather; Steeb, Franziska; Ruth, Peter; Knaus, Hans Guenther; Shipston, Michael J.
2013-01-01
Regulatory β-subunits of large conductance calcium- and voltage-activated potassium (BK) channels play an important role in generating functional diversity and control of cell surface expression of the pore forming α-subunits. However, in contrast to α-subunits, the role of reversible post-translational modification of intracellular residues on β-subunit function is largely unknown. Here we demonstrate that the human β4-subunit is S-acylated (palmitoylated) on a juxtamembrane cysteine residue (Cys-193) in the intracellular C terminus of the regulatory β-subunit. β4-Subunit palmitoylation is important for cell surface expression and endoplasmic reticulum (ER) exit of the β4-subunit alone. Importantly, palmitoylated β4-subunits promote the ER exit and surface expression of the pore-forming α-subunit, whereas β4-subunits that cannot be palmitoylated do not increase ER exit or surface expression of α-subunits. Strikingly, however, this palmitoylation- and β4-dependent enhancement of α-subunit surface expression was only observed in α-subunits that contain a putative trafficking motif (… REVEDEC) at the very C terminus of the α-subunit. Engineering this trafficking motif to other C-terminal α-subunit splice variants results in α-subunits with reduced surface expression that can be rescued by palmitoylated, but not depalmitoylated, β4-subunits. Our data reveal a novel mechanism by which palmitoylated β4-subunit controls surface expression of BK channels through masking of a trafficking motif in the C terminus of the α-subunit. As palmitoylation is dynamic, this mechanism would allow precise control of specific splice variants to the cell surface. Our data provide new insights into how complex interplay between the repertoire of post-transcriptional and post-translational mechanisms controls cell surface expression of BK channels. PMID:23504458
DOE Office of Scientific and Technical Information (OSTI.GOV)
Petit, Chad M.; Department of Pathobiological Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803; Chouljenko, Vladimir N.
The SARS-coronavirus (SARS-CoV) is the etiological agent of the severe acute respiratory syndrome (SARS). The SARS-CoV spike (S) glycoprotein mediates membrane fusion events during virus entry and virus-induced cell-to-cell fusion. The cytoplasmic portion of the S glycoprotein contains four cysteine-rich amino acid clusters. Individual cysteine clusters were altered via cysteine-to-alanine amino acid replacement and the modified S glycoproteins were tested for their transport to cell-surfaces and ability to cause cell fusion in transient transfection assays. Mutagenesis of the cysteine cluster I, located immediately proximal to the predicted transmembrane, domain did not appreciably reduce cell-surface expression, although S-mediated cell fusion wasmore » reduced by more than 50% in comparison to the wild-type S. Similarly, mutagenesis of the cysteine cluster II located adjacent to cluster I reduced S-mediated cell fusion by more than 60% compared to the wild-type S, while cell-surface expression was reduced by less than 20%. Mutagenesis of cysteine clusters III and IV did not appreciably affect S cell-surface expression or S-mediated cell fusion. The wild-type S was palmitoylated as evidenced by the efficient incorporation of {sup 3}H-palmitic acid in wild-type S molecules. S glycoprotein palmitoylation was significantly reduced for mutant glycoproteins having cluster I and II cysteine changes, but was largely unaffected for cysteine cluster III and IV mutants. These results show that the S cytoplasmic domain is palmitoylated and that palmitoylation of the membrane proximal cysteine clusters I and II may be important for S-mediated cell fusion.« less
Zhang, Nianhui; Peng, Zechun; Tong, Xiaoping; Lindemeyer, A Kerstin; Cetina, Yliana; Huang, Christine S; Olsen, Richard W; Otis, Thomas S; Houser, Carolyn R
2017-11-01
While numerous changes in the GABA system have been identified in models of Fragile X Syndrome (FXS), alterations in subunits of the GABA A receptors (GABA A Rs) that mediate tonic inhibition are particularly intriguing. Considering the key role of tonic inhibition in controlling neuronal excitability, reduced tonic inhibition could contribute to FXS-associated disorders such as hyperactivity, hypersensitivity, and increased seizure susceptibility. The current study has focused on the expression and function of the δ subunit of the GABA A R, a major subunit involved in tonic inhibition, in granule cells of the dentate gyrus in the Fmr1 knockout (KO) mouse model of FXS. Electrophysiological studies of dentate granule cells revealed a marked, nearly four-fold, decrease in tonic inhibition in the Fmr1 KO mice, as well as reduced effects of two δ subunit-preferring pharmacological agents, THIP and DS2, supporting the suggestion that δ subunit-containing GABA A Rs are compromised in the Fmr1 KO mice. Immunohistochemistry demonstrated a small but statistically significant decrease in δ subunit labeling in the molecular layer of the dentate gyrus in Fmr1 KO mice compared to wildtype (WT) littermates. The discrepancy between the large deficits in GABA-mediated tonic inhibition in granule cells in the Fmr1 KO mice and only modest reductions in immunolabeling of the δ subunit led to studies of surface expression of the δ subunit. Cross-linking experiments followed by Western blot analysis demonstrated a small, non-significant decrease in total δ subunit protein in the hippocampus of Fmr1 KO mice, but a four-fold decrease in surface expression of the δ subunit in these mice. No significant changes were observed in total or surface expression of the α4 subunit protein, a major partner of the δ subunit in the forebrain. Postembedding immunogold labeling for the δ subunit demonstrated a large, three-fold, decrease in the number of symmetric synapses with immunolabeling at perisynaptic locations in Fmr1 KO mice. While α4 immunogold particles were also reduced at perisynaptic locations in the Fmr1 KO mice, the labeling was increased at synaptic sites. Together these findings suggest that, in the dentate gyrus, altered surface expression of the δ subunit, rather than a decrease in δ subunit expression alone, could be limiting δ subunit-mediated tonic inhibition in this model of FXS. Finding ways to increase surface expression of the δ subunit of the GABA A R could be a novel approach to treatment of hyperexcitability-related alterations in FXS. Copyright © 2017 Elsevier Inc. All rights reserved.
Hayashi, Hisamitsu; Sugiyama, Yuichi
2007-06-01
Progressive familial intrahepatic cholestasis type 2 (PFIC2) is caused by a mutation in the bile salt export pump (BSEP/ABCB11) gene. We previously reported that E297G and D482G BSEP, which are frequently found mutations in European patients, result in impaired membrane trafficking, whereas both mutants retain their transport function. The dysfunctional localization is probably attributable to the retention of BSEP in endoplasmic reticulum (ER) followed by proteasomal degradation. Because sodium 4-phenylbutyrate (4PBA) has been shown to restore the reduced cell surface expression of mutated plasma membrane proteins, in the current study, we investigated the effect of 4PBA treatment on E297G and D482G BSEP. Transcellular transport and cell surface biotinylation studies using Madin-Darby canine kidney (MDCK) II cells demonstrated that 4PBA treatment increased functional cell surface expression of wild-type (WT), E297G, and D482G BSEP. The prolonged half-life of cell surface-resident BSEP with 4PBA treatment was responsible for this result. Moreover, treatment of Sprague-Dawley rats with 4PBA resulted in an increase in BSEP expression at the canalicular membrane, which was accompanied by an increase in the biliary excretion of [(3)H]taurocholic acid (TC). 4PBA treatment with a clinically achievable concentration enhances the cell surface expression and the transport capacity of WT, E297G, and D482G BSEP in MDCK II cells, and also induces functional BSEP expression at the canalicular membrane and bile acid transport via canalicular membrane in vivo. 4PBA is a potential pharmacological agent for treating not only PFIC2 patients with E297G and D482G mutations but also other cholestatic patients, in whom the BSEP expression at the canalicular membrane is reduced.
Active RNA replication of hepatitis C virus downregulates CD81 expression.
Ke, Po-Yuan; Chen, Steve S-L
2013-01-01
So far how hepatitis C virus (HCV) replication modulates subsequent virus growth and propagation still remains largely unknown. Here we determine the impact of HCV replication status on the consequential virus growth by comparing normal and high levels of HCV RNA expression. We first engineered a full-length, HCV genotype 2a JFH1 genome containing a blasticidin-resistant cassette inserted at amino acid residue of 420 in nonstructural (NS) protein 5A, which allowed selection of human hepatoma Huh7 cells stably-expressing HCV. Short-term establishment of HCV stable cells attained a highly-replicating status, judged by higher expressions of viral RNA and protein as well as higher titer of viral infectivity as opposed to cells harboring the same genome without selection. Interestingly, maintenance of highly-replicating HCV stable cells led to decreased susceptibility to HCV pseudotyped particle (HCVpp) infection and downregulated cell surface level of CD81, a critical HCV entry (co)receptor. The decreased CD81 cell surface expression occurred through reduced total expression and cytoplasmic retention of CD81 within an endoplasmic reticulum -associated compartment. Moreover, productive viral RNA replication in cells harboring a JFH1 subgenomic replicon containing a similar blasticidin resistance gene cassette in NS5A and in cells robustly replicating full-length infectious genome also reduced permissiveness to HCVpp infection through decreasing the surface expression of CD81. The downregulation of CD81 surface level in HCV RNA highly-replicating cells thus interfered with reinfection and led to attenuated viral amplification. These findings together indicate that the HCV RNA replication status plays a crucial determinant in HCV growth by modulating the expression and intracellular localization of CD81.
Active RNA Replication of Hepatitis C Virus Downregulates CD81 Expression
Ke, Po-Yuan; Chen, Steve S.-L.
2013-01-01
So far how hepatitis C virus (HCV) replication modulates subsequent virus growth and propagation still remains largely unknown. Here we determine the impact of HCV replication status on the consequential virus growth by comparing normal and high levels of HCV RNA expression. We first engineered a full-length, HCV genotype 2a JFH1 genome containing a blasticidin-resistant cassette inserted at amino acid residue of 420 in nonstructural (NS) protein 5A, which allowed selection of human hepatoma Huh7 cells stably-expressing HCV. Short-term establishment of HCV stable cells attained a highly-replicating status, judged by higher expressions of viral RNA and protein as well as higher titer of viral infectivity as opposed to cells harboring the same genome without selection. Interestingly, maintenance of highly-replicating HCV stable cells led to decreased susceptibility to HCV pseudotyped particle (HCVpp) infection and downregulated cell surface level of CD81, a critical HCV entry (co)receptor. The decreased CD81 cell surface expression occurred through reduced total expression and cytoplasmic retention of CD81 within an endoplasmic reticulum -associated compartment. Moreover, productive viral RNA replication in cells harboring a JFH1 subgenomic replicon containing a similar blasticidin resistance gene cassette in NS5A and in cells robustly replicating full-length infectious genome also reduced permissiveness to HCVpp infection through decreasing the surface expression of CD81. The downregulation of CD81 surface level in HCV RNA highly-replicating cells thus interfered with reinfection and led to attenuated viral amplification. These findings together indicate that the HCV RNA replication status plays a crucial determinant in HCV growth by modulating the expression and intracellular localization of CD81. PMID:23349980
Role of Bruton’s tyrosine kinase in myeloma cell migration and induction of bone disease
Bam, Rakesh; Ling, Wen; Khan, Sharmin; Pennisi, Angela; Venkateshaiah, Sathisha Upparahalli; Li, Xin; van Rhee, Frits; Usmani, Saad; Barlogie, Bart; Shaughnessy, John; Epstein, Joshua; Yaccoby, Shmuel
2014-01-01
Myeloma cells typically grow in bone, recruit osteoclast precursors and induce their differentiation and activity in areas adjacent to tumor foci. Bruton’s tyrosine kinase (BTK), of the TEC family, is expressed in hematopoietic cells and is particularly involved in B-lymphocyte function and osteoclastogenesis. We demonstrated BTK expression in clinical myeloma plasma cells, interleukin (IL) –6– or stroma–dependent cell lines and osteoclasts. SDF-1 induced BTK activation in myeloma cells and BTK inhibition by small hairpin RNA or the small molecule inhibitor, LFM-A13, reduced their migration toward stromal cell-derived factor-1 (SDF-1). Pretreatment with LFM-A13 also reduced in vivo homing of myeloma cells to bone using bioluminescence imaging in the SCID-rab model. Enforced expression of BTK in myeloma cell line enhanced cell migration toward SDF-1 but had no effect on short-term growth. BTK expression was correlated with cell-surface CXCR4 expression in myeloma cells (n = 33, r = 0.81, P < 0.0001), and BTK gene and protein expression was more profound in cell-surface CXCR4-expressing myeloma cells. BTK was not upregulated by IL-6 while its inhibition had no effect on IL-6 signaling in myeloma cells. Human osteoclast precursors also expressed BTK and cell-surface CXCR4 and migrated toward SDF-1. LFM-A13 suppressed migration and differentiation of osteoclast precursors as well as bone-resorbing activity of mature osteoclasts. In primary myeloma-bearing SCID-rab mice, LFM-A13 inhibited osteoclast activity, prevented myeloma-induced bone resorption and moderately suppressed myeloma growth. These data demonstrate BTK and cell-surface CXCR4 association in myeloma cells and that BTK plays a role in myeloma cell homing to bone and myeloma-induced bone disease. PMID:23456977
Coherent scattering of a spherical wave from an irregular surface. [antenna pattern effects
NASA Technical Reports Server (NTRS)
Fung, A. K.
1983-01-01
The scattering of a spherical wave from a rough surface using the Kirchhoff approximation is considered. An expression representing the measured coherent scattering coefficient is derived. It is shown that the sphericity of the wavefront and the antenna pattern can become an important factor in the interpretation of ground-based measurements. The condition under which the coherent scattering-coefficient expression reduces to that corresponding to a plane wave incidence is given. The condition under which the result reduces to the standard image solution is also derived. In general, the consideration of antenna pattern and sphericity is unimportant unless the surface-height standard deviation is small, i.e., unless the coherent scattering component is significant. An application of the derived coherent backscattering coefficient together with the existing incoherent scattering coefficient to interpret measurements from concrete and asphalt surfaces is shown.
Mendes, Ana Isabel; Matos, Paulo; Moniz, Sónia; Luz, Simão; Amaral, Margarida D.; Farinha, Carlos M.; Jordan, Peter
2011-01-01
Members of the WNK (with-no-lysine [K]) subfamily of protein kinases regulate various ion channels involved in sodium, potassium, and chloride homeostasis by either inducing their phosphorylation or regulating the number of channel proteins expressed at the cell surface. Here, we describe findings demonstrating that the cell surface expression of the cystic fibrosis transmembrane conductance regulator (CFTR) is also regulated by WNK4 in mammalian cells. This effect of WNK4 is independent of the presence of kinase and involves interaction with and inhibition of spleen tyrosine kinase (Syk), which phosphorylates Tyr512 in the first nucleotide-binding domain 1 (NBD1) of CFTR. Transfection of catalytically active Syk into CFTR-expressing baby hamster kidney cells reduces the cell surface expression of CFTR, whereas that of WNK4 promotes it. This is shown by biotinylation of cell surface proteins, immunofluorescence microscopy, and functional efflux assays. Mutation of Tyr512 to either glutamic acid or phenylalanine is sufficient to alter CFTR surface levels. In human airway epithelial cells, downregulation of endogenous Syk and WNK4 confirms their roles as physiologic regulators of CFTR surface expression. Together, our results show that Tyr512 phosphorylation is a novel signal regulating the prevalence of CFTR at the cell surface and that WNK4 and Syk perform an antagonistic role in this process. PMID:21807898
A novel phenoxazine derivative suppresses surface IgM expression in DT40 B cell line
Gao, Sanyang; Takano, Tomoko; Sada, Kiyonao; He, Jinsong; Noda, Chiseko; Hori-Tamura, Naoko; Tomoda, Akio; Yamamura, Hirohei
2002-01-01
2-amino-4, 4α-dihydro-4α, 7-dimethyl-3H-phenoxazine-3-one (Phx) has been demonstrated to be an actinomycin D-like phenoxazine, and to display anti-tumour activity. In this study, we report on the effect of Phx on B cell antigen receptor (BCR) and receptor-mediated signalling in DT40 B cells. Treatment of B cells with Phx for 12 h inhibited BCR-stimulated tyrosine phosphorylation of cellular proteins. B cells exposed to Phx exhibited down-regulation of surface IgM which is part of BCR. In contracts with actinomycin D, Phx rapidly reduced the expression of IgM without decreasing the expression of other signalling molecules. Analysis with confocal microscopy demonstrated that Phx treatment reduced IgM expression both at the cell surface and inside the cell. Treatment of B cells with Phx resulted in the reduction of IgM secretion. Since MG-132, a proteasomal inhibitor, restored IgM contents to the control levels, Phx has the specific effect of accelerating IgM degradation. These results suggest that Phx down-regulates the expression of IgM and inhibits BCR-mediated signalling and IgM secretion. Phx may be useful as an immunosuppressive agent for therapeutic purposes. PMID:12411404
BIN1 is reduced and Cav1.2 trafficking is impaired in human failing cardiomyocytes.
Hong, Ting-Ting; Smyth, James W; Chu, Kevin Y; Vogan, Jacob M; Fong, Tina S; Jensen, Brian C; Fang, Kun; Halushka, Marc K; Russell, Stuart D; Colecraft, Henry; Hoopes, Charles W; Ocorr, Karen; Chi, Neil C; Shaw, Robin M
2012-05-01
Heart failure is a growing epidemic, and a typical aspect of heart failure pathophysiology is altered calcium transients. Normal cardiac calcium transients are initiated by Cav1.2 channels at cardiac T tubules. Bridging integrator 1 (BIN1) is a membrane scaffolding protein that causes Cav1.2 to traffic to T tubules in healthy hearts. The mechanisms of Cav1.2 trafficking in heart failure are not known. To study BIN1 expression and its effect on Cav1.2 trafficking in failing hearts. Intact myocardium and freshly isolated cardiomyocytes from nonfailing and end-stage failing human hearts were used to study BIN1 expression and Cav1.2 localization. To confirm Cav1.2 surface expression dependence on BIN1, patch-clamp recordings were performed of Cav1.2 current in cell lines with and without trafficking-competent BIN1. Also, in adult mouse cardiomyocytes, surface Cav1.2 and calcium transients were studied after small hairpin RNA-mediated knockdown of BIN1. For a functional readout in intact heart, calcium transients and cardiac contractility were analyzed in a zebrafish model with morpholino-mediated knockdown of BIN1. BIN1 expression is significantly decreased in failing cardiomyocytes at both mRNA (30% down) and protein (36% down) levels. Peripheral Cav1.2 is reduced to 42% by imaging, and a biochemical T-tubule fraction of Cav1.2 is reduced to 68%. The total calcium current is reduced to 41% in a cell line expressing a nontrafficking BIN1 mutant. In mouse cardiomyocytes, BIN1 knockdown decreases surface Cav1.2 and impairs calcium transients. In zebrafish hearts, BIN1 knockdown causes a 75% reduction in calcium transients and severe ventricular contractile dysfunction. The data indicate that BIN1 is significantly reduced in human heart failure, and this reduction impairs Cav1.2 trafficking, calcium transients, and contractility. Copyright © 2012 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.
BIN1 is Reduced and Cav1.2 Trafficking is Impaired in Human Failing Cardiomyocytes
Hong, Ting-Ting; Smyth, James W.; Chu, Kevin Y.; Vogan, Jacob M.; Fong, Tina S.; Jensen, Brian C.; Fang, Kun; Halushka, Marc K.; Russell, Stuart D.; Colecraft, Henry; Hoopes, Charles W.; Ocorr, Karen; Chi, Neil C.; Shaw, Robin M.
2011-01-01
Background Heart failure is a growing epidemic and a typical aspect of heart failure pathophysiology is altered calcium transients. Normal cardiac calcium transients are initiated by Cav1.2 channels at cardiac T-tubules. BIN1 is a membrane scaffolding protein that causes Cav1.2 to traffic to T-tubules in healthy hearts. The mechanisms of Cav1.2 trafficking in heart failure are not known. Objective To study BIN1 expression and its effect on Cav1.2 trafficking in failing hearts. Methods Intact myocardium and freshly isolated cardiomyocytes from non-failing and end-stage failing human hearts were used to study BIN1 expression and Cav1.2 localization. To confirm Cav1.2 surface expression dependence on BIN1, patch clamp recordings were performed of Cav1.2 current in cell lines with and without trafficking competent BIN1. Also, in adult mouse cardiomyocytes, surface Cav1.2 and calcium transients were studied after shRNA mediated knockdown of BIN1. For a functional readout in intact heart, calcium transients and cardiac contractility were analyzed in a zebrafish model with morpholino mediated knockdown of BIN1. Results BIN1 expression is significantly decreased in failing cardiomyocytes at both mRNA (30% down) and protein (36% down) levels. Peripheral Cav1.2 is reduced 42% by imaging and biochemical T-tubule fraction of Cav1.2 is reduced 68%. Total calcium current is reduced 41% in a cell line expressing non-trafficking BIN1 mutant. In mouse cardiomyocytes, BIN1 knockdown decreases surface Cav1.2 and impairs calcium transients. In zebrafish hearts, BIN1 knockdown causes a 75% reduction in calcium transients and severe ventricular contractile dysfunction. Conclusions The data indicate that BIN1 is significantly reduced in human heart failure, and this reduction impairs Cav1.2 trafficking, calcium transients, and contractility. PMID:22138472
Mulrooney, Tiernan J.; Posch, Phillip E.; Hurley, Carolyn Katovich
2013-01-01
KIR aid in the regulation of NK cell activity. In this study, the effect of the interaction between the KIR2DS and their adapter, DAP12, was investigated beyond the previously defined signaling function. Flow cytometry analysis showed enhanced KIR2DS surface expression on NKL cells when cotransfected with DAP12. Conversely, KIR2DS4 surface expression on primary cells was decreased when the cells were treated with DAP12-specific siRNA. Treatment of the KIR2DS and DAP12-transfected cells with CHX or BFA repressed KIR2DS surface expression, revealing a role for DAP12 in trafficking newly synthesized KIR to the cell surface. Immunoprecipitation of DAP12 revealed an interaction of DAP12 with an immature isoform of KIR2DS, indicating that the interaction likely initiates within the ER. An internalization assay demonstrated a significant impact of DAP12 on KIR2DS surface stability. Confocal microscopy showed that internalized KIR2DS molecules are recruited to lysosomal compartments independent of DAP12 expression. Our results suggest that in vivo conditions that adversely affect DAP12 expression will indirectly reduce surface expression and stability of KIR2DS. These effects could significantly impact ligand recognition and strength of signaling through KIR2DS molecules. PMID:23715743
Heredia, A.; Amoroso, A.; Davis, C.; Le, N.; Reardon, E.; Dominique, J. K.; Klingebiel, E.; Gallo, R. C.; Redfield, R. R.
2003-01-01
Propagation of R5 strains of HIV-1 on CD4 lymphocytes and macrophages requires expression of the CCR5 coreceptor on the cell surface. Individuals lacking CCR5 (CCR5Δ32 homozygous genotype) are phenotypically normal and resistant to infection with HIV-1. CCR5 expression on lymphocytes depends on signaling through the IL-2 receptor. By FACS analysis we demonstrate that rapamycin (RAPA), a drug that disrupts IL-2 receptor signaling, reduces CCR5 surface expression on T cells at concentrations as low as 1 nM. In addition, lower concentrations of RAPA (0.01 nM) were sufficient to reduce CCR5 surface expression on maturing monocytes. PCR analysis on peripheral blood mononuclear cells (PBMCs) showed that RAPA interfered with CCR5 expression at the transcriptional level. Reduced expression of CCR5 on PBMCs cultured in the presence of RAPA was associated with increased extracellular levels of macrophage inflammatory protein (MIP)-1α and MIP-1β. In infectivity assays, RAPA suppressed the replication of R5 strains of HIV-1 both in PBMC and macrophage cultures. In total PBMC cultures, RAPA-mediated inhibition of CCR5-using strains of HIV-1 occurred at 0.01 nM, a concentration of drug that is ∼103 times lower than therapeutic through levels of drug in renal transplant recipients. In addition, RAPA enhanced the antiviral activity of the CCR5 antagonist TAK-779. These results suggest that low concentrations of RAPA may have a role in both the treatment and prevention of HIV-1 infection. PMID:12915736
McLeod, Ian X.; Zhou, Xiang; Li, Qi-Jing; Wang, Fan; He, You-Wen
2011-01-01
IL-7Rα mediated signals are essential for naive T lymphocyte survival. Recent studies show that IL-7Rα is internalized and either recycled to cell surface or degraded. However, how the intracellular process of IL-7Rα trafficking is regulated is unclear. Here we show that Vps34, the class III phosphatidylinositol 3-kinase, plays a critical role in proper IL-7Rα intracellular trafficking. Mice lacking Vps34 in T lymphocytes had a severely reduced T lymphocyte compartment. Vps34-deficient T lymphocytes exhibit increased death and reduced IL-7Rα surface expression, though three major forms of autophagy remain intact. Intracellular IL-7Rα in normal T lymphocytes at steady-state is trafficked through either early endosome/multivesicular bodies (MVB) to the late endosome-Golgi for surface expression or to the lysosome for degradation. However, Vps34-deficient T cells have mislocalized intracellular Eea1, HRS, and Vps36 protein levels, the combined consequence of which is the inability to mobilize internalized IL-7Rα into the retromer pathway for surface display. Our studies reveal that Vps34, though dispensible for autophagy induction, is a critical regulator of naïve T cell homeostasis, modulating IL-7Rα trafficking, signaling, and recycling. PMID:22021616
Moffat, Laura L.; Robinson, Ryan E.; Bakoulis, Anastasia; Clark, Scott G.
2014-01-01
Wnts control a wide range of essential developmental processes, including cell fate specification, axon guidance and anteroposterior neuronal polarization. We identified a conserved transmembrane RING finger protein, PLR-1, that governs the response to Wnts by lowering cell-surface levels of the Frizzled family of Wnt receptors in Caenorhabditis elegans. Loss of PLR-1 activity in the neuron AVG causes its anteroposterior polarity to be symmetric or reversed because signaling by the Wnts CWN-1 and CWN-2 are inappropriately activated, whereas ectopic PLR-1 expression blocks Wnt signaling and target gene expression. Frizzleds are enriched at the cell surface; however, when PLR-1 and Frizzled are co-expressed, Frizzled is not detected at the surface but instead is colocalized with PLR-1 in endosomes. The Frizzled cysteine-rich domain (CRD) and invariant second intracellular loop lysine are crucial for PLR-1 downregulation. The PLR-1 RING finger and protease-associated (PA) domain are essential for activity. In a Frizzled-dependent manner, PLR-1 reduces surface levels of the Wnt receptors CAM-1/Ror and LIN-18/Ryk. PLR-1 is a homolog of the mammalian transmembrane E3 ubiquitin ligases RNF43 and ZNRF3, which control Frizzled surface levels in an R-spondin-sensitive manner. We propose that PLR-1 downregulates Wnt receptor surface levels via lysine ubiquitylation of Frizzled to coordinate spatial and temporal responses to Wnts during neuronal development. PMID:24401370
Tassone, Evelyne; Valacca, Cristina; Mignatti, Paolo
2014-01-01
Membrane-type 1 matrix metalloproteinase (MT1-MMP, MMP-14), a transmembrane proteinase with an extracellular catalytic domain and a short cytoplasmic tail, degrades extracellular matrix components and controls diverse cell functions through proteolytic and non-proteolytic interactions with extracellular, intracellular and transmembrane proteins. Here we show that in tumor cells MT1-MMP downregulates fibroblast growth factor-2 (FGF-2) signaling by reducing the amount of FGF-2 bound to the cell surface with high and low affinity. FGF-2 induces weaker activation of ERK1/2 MAP kinase in MT1-MMP expressing cells than in cells devoid of MT1-MMP. This effect is abolished in cells that express proteolytically inactive MT1-MMP but persists in cells expressing MT1-MMP mutants devoid of hemopexin-like or cytoplasmic domain, showing that FGF-2 signaling is downregulated by MT1-MMP proteolytic activity. MT1-MMP expression results in downregulation of FGFR-1 and -4, and in decreased amount of cell surface-associated FGF-2. In addition, MT1-MMP strongly reduces the amount of FGF-2 bound to the cell surface with low affinity. Because FGF-2 association with low-affinity binding sites is a prerequisite for binding to its high-affinity receptors, downregulation of low-affinity binding to the cell surface results in decreased FGF-2 signaling. Consistent with this conclusion, FGF-2 induction of tumor cell migration and invasion in vitro is stronger in cells devoid of MT1-MMP than in MT1-MMP expressing cells. Thus, MT1-MMP controls FGF-2 signaling by a proteolytic mechanism that decreases the cell’s biological response to FGF-2. PMID:24986796
Disturbed vesicular trafficking of membrane proteins in prion disease.
Uchiyama, Keiji; Miyata, Hironori; Sakaguchi, Suehiro
2013-01-01
The pathogenic mechanism of prion diseases remains unknown. We recently reported that prion infection disturbs post-Golgi trafficking of certain types of membrane proteins to the cell surface, resulting in reduced surface expression of membrane proteins and abrogating the signal from the proteins. The surface expression of the membrane proteins was reduced in the brains of mice inoculated with prions, well before abnormal symptoms became evident. Prions or pathogenic prion proteins were mainly detected in endosomal compartments, being particularly abundant in recycling endosomes. Some newly synthesized membrane proteins are delivered to the surface from the Golgi apparatus through recycling endosomes, and some endocytosed membrane proteins are delivered back to the surface through recycling endosomes. These results suggest that prions might cause neuronal dysfunctions and cell loss by disturbing post-Golgi trafficking of membrane proteins via accumulation in recycling endosomes. Interestingly, it was recently shown that delivery of a calcium channel protein to the cell surface was impaired and its function was abrogated in a mouse model of hereditary prion disease. Taken together, these results suggest that impaired delivery of membrane proteins to the cell surface is a common pathogenic event in acquired and hereditary prion diseases.
Chiu, Yu-Hsin; Alvarez-Baron, Claudia; Kim, Eun Young
2010-01-01
Large-conductance Ca2+-activated K+ (BKCa) channels regulate the physiology of many cell types. A single vertebrate gene variously known as Slo1, KCa1.1, or KCNMA1 encodes the pore-forming subunits of BKCa channel but is expressed in a potentially very large number of alternative splice variants. Two splice variants of Slo1, Slo1VEDEC and Slo1QEERL, which differ at the extreme COOH terminus, show markedly different steady-state expression levels on the cell surface. Here we show that Slo1VEDEC and Slo1QEERL can reciprocally coimmunoprecipitate, indicating that they form heteromeric complexes. Moreover, coexpression of even small amounts of Slo1VEDEC markedly reduces surface expression of Slo1QEERL and total Slo1 as indicated by cell-surface biotinylation assays. The effects of Slo1VEDEC on steady-state surface expression can be attributed primarily to the last five residues of the protein based on surface expression of motif-swapped constructs of Slo1 in human embryonic kidney (HEK) 293T cells. In addition, the presence of the VEDEC motif at the COOH terminus of Slo1 channels is sufficient to confer a dominant-negative effect on cell surface expression of itself or other types of Slo1 subunits. Treating cells with short peptides containing the VEDEC motif increased surface expression of Slo1VEDEC channels transiently expressed in HEK293T cells and increased current through endogenous BKCa channels in mouse podocytes. Slo1VEDEC and Slo1QEERL channels are removed from the HEK293T cell surface with similar kinetics and to a similar extent, which suggests that the inhibitory effect of the VEDEC motif is exerted primarily on forward trafficking into the plasma membrane. PMID:20051533
Bassoy, Esen Yonca; Kasahara, Atsuko; Chiusolo, Valentina; Jacquemin, Guillaume; Boydell, Emma; Zamorano, Sebastian; Riccadonna, Cristina; Pellegatta, Serena; Hulo, Nicolas; Dutoit, Valérie; Derouazi, Madiha; Dietrich, Pierre Yves; Walker, Paul R; Martinvalet, Denis
2017-06-01
Glioblastoma is a highly heterogeneous aggressive primary brain tumor, with the glioma stem-like cells (GSC) being more sensitive to cytotoxic lymphocyte-mediated killing than glioma differentiated cells (GDC). However, the mechanism behind this higher sensitivity is unclear. Here, we found that the mitochondrial morphology of GSCs modulates the ER-mitochondria contacts that regulate the surface expression of sialylated glycans and their recognition by cytotoxic T lymphocytes and natural killer cells. GSCs displayed diminished ER-mitochondria contacts compared to GDCs. Forced ER-mitochondria contacts in GSCs increased their cell surface expression of sialylated glycans and reduced their susceptibility to cytotoxic lymphocytes. Therefore, mitochondrial morphology and dynamism dictate the ER-mitochondria contacts in order to regulate the surface expression of certain glycans and thus play a role in GSC recognition and elimination by immune effector cells. Targeting the mitochondrial morphology, dynamism, and contacts with the ER could be an innovative strategy to deplete the cancer stem cell compartment to successfully treat glioblastoma. © 2017 The Authors.
Effect of flagella expression on adhesion of Achromobacter piechaudii to chalk surfaces.
Nejidat, A; Saadi, I; Ronen, Z
2008-12-01
To examine flagella role and cell motility in adhesion of Achromobacter piechaudii to chalk. Transmission electron microscopy revealed that stationary cells have thicker and longer flagella than logarithmic cells. SDS-PAGE analysis showed that flagellin was more abundant in stationary cells than logarithmic ones. Sonication or inhibition of flagellin synthesis caused a 30% reduction in adhesion to chalk. Preincubation of chalk with flagella extracts reduced adhesion, by 50%. Three motility mutants were isolated. Mutants 94 and 153 were nonmotile, expressed normal levels of flagellin, have regular flagella and exhibited reduced adhesion. Mutant 208 expressed low levels of flagellin, no flagella and a spherical cell shape but with normal adhesion capacity. Multiple cell surface factors affect the adhesion efficiency to chalk. Flagella per se through physical interaction and through cell motility contribute to the adhesion process. The adhesion behaviour of mutant 208 suggests that cell shape can compensate for flagellar removal and motility. Physiological status affects bacterial cell surface properties and hence adhesion efficiency to chalk. This interaction is essential to sustain biodegradation activities and thus, remediation of contaminated chalk aquifers.
Sajeevan, R. S.; Nataraja, Karaba N.; Shivashankara, K. S.; Pallavi, N.; Gurumurthy, D. S.; Shivanna, M. B.
2017-01-01
Mulberry (Morus species) leaf is the sole food for monophagous silkworms, Bombyx mori L. Abiotic stresses such as drought, salinity, and high temperature, significantly decrease mulberry productivity and post-harvest water loss from leaves influence silkworm growth and cocoon yield. Leaf surface properties regulate direct water loss through the cuticular layer. Leaf surface waxes, contribute for cuticular resistance and protect mesophyll cells from desiccation. In this study we attempted to overexpress AtSHN1, a transcription factor associated with epicuticular wax biosynthesis to increase leaf surface wax load in mulberry. Agrobacterium mediated in vitro transformation was carried out using hypocotyl and cotyledonary explants of Indian mulberry (cv. M5). Mulberry transgenic plants expressing AtSHN1 displayed dark green shiny appearance with increased leaf surface wax content. Scanning electron microscopy (SEM) and gas chromatograph–mass spectrometry (GC-MS) analysis showed change in pattern of surface wax deposition and significant change in wax composition in AtSHN1 overexpressors. Increased wax content altered leaf surface properties as there was significant difference in water droplet contact angle and diameter between transgenic and wild type plants. The transgenic plants showed significant improvement in leaf moisture retention capacity even 5 h after harvest and there was slow degradation of total buffer soluble protein in detached leaves compared to wild type. Silkworm bioassay did not indicate any undesirable effects on larval growth and cocoon yield. This study demonstrated that expression of AtSHN1, can increase surface wax load and reduce the post-harvest water loss in mulberry. PMID:28421085
HFE interacts with the BMP type I receptor ALK3 to regulate hepcidin expression
Wu, Xing-gang; Wang, Yang; Wu, Qian; Cheng, Wai-Hang; Liu, Wenjing; Zhao, Yueshui; Mayeur, Claire; Schmidt, Paul J.; Yu, Paul B.; Wang, Fudi
2014-01-01
Mutations in HFE are the most common cause of hereditary hemochromatosis (HH). HFE mutations result in reduced expression of hepcidin, a hepatic hormone, which negatively regulates iron absorption from the duodenum and iron release from macrophages. However, the mechanism by which HFE regulates hepcidin expression in hepatocytes is not well understood. It is known that the bone morphogenetic protein (BMP) pathway plays a central role in controlling hepcidin expression in the liver. Here we show that HFE overexpression increased Smad1/5/8 phosphorylation and hepcidin expression, whereas inhibition of BMP signaling abolished HFE-induced hepcidin expression in Hep3B cells. HFE was found to associate with ALK3, inhibiting ALK3 ubiquitination and proteasomal degradation and increasing ALK3 protein expression and accumulation on the cell surface. The 2 HFE mutants associated with HH, HFE C282Y and HFE H63D, regulated ALK3 protein ubiquitination and trafficking differently, but both failed to increase ALK3 cell-surface expression. Deletion of Hfe in mice resulted in a decrease in hepatic ALK3 protein expression. Our results provide evidence that HFE induces hepcidin expression via the BMP pathway: HFE interacts with ALK3 to stabilize ALK3 protein and increase ALK3 expression at the cell surface. PMID:24904118
Prediction of surface tension of HFD-like fluids using the Fowler’s approximation
NASA Astrophysics Data System (ADS)
Goharshadi, Elaheh K.; Abbaspour, Mohsen
2006-09-01
The Fowler's expression for calculation of the reduced surface tension has been used for simple fluids using the Hartree-Fock Dispersion (HFD)-like potential (HFD-like fluids) obtained from the inversion of the viscosity collision integrals at zero pressure. In order to obtain the RDFs values needed for calculation of the surface tension, we have performed the MD simulation at different temperatures and densities and then fitted with an expression and compared the resulting RDFs with the experiment. Our results are in excellent accordance with experimental values when the vapor density has been considered, especially at high temperatures. We have also calculated the surface tension using a RDF's expression based on the Lennard-Jones (LJ) potential which was in good agreement with the molecular dynamics simulations. In this work, we have shown that our results based on HFD-like potential can describe the temperature dependence of the surface tension superior than that of LJ potential.
Hayashi, Hisamitsu; Sugiyama, Yuichi
2009-01-01
The reduced expression of the bile salt export pump (BSEP/ABCB11) at the canalicular membrane is associated with cholestasis-induced hepatotoxicity due to the accumulation of bile acids in hepatocytes. We demonstrated previously that 4-phenylbutyrate (4PBA) treatment, a U.S. Food and Drug Administration-approved drug for the treatment of urea cycle disorders, induces the cell-surface expression of BSEP by prolonging the degradation rate of cell-surface-resident BSEP. On the other hand, BSEP mutations, E297G and D482G, found in progressive familial intrahepatic cholestasis type 2 (PFIC2), reduced it by shortening the degradation rate of cell-surface-resident BSEP. Therefore, to help the development of the medical treatment of cholestasis, we investigated the underlying mechanism by which 4PBA and PFIC2-type mutations affect the BSEP degradation from cell surface, focusing on short-chain ubiquitination. In Madin-Darby canine kidney II (MDCK II) cells expressing BSEP and rat canalicular membrane vesicles, the molecular mass of the mature form of BSEP/Bsep shifted from 170 to 190 kDa after ubiquitin modification (molecular mass, 8 kDa). Ubiquitination susceptibility of BSEP/Bsep was reduced in vitro and in vivo by 4PBA treatment and, conversely, was enhanced by BSEP mutations E297G and D482G. Moreover, biotin-labeling studies using MDCK II cells demonstrated that the degradation of cell-surface-resident chimeric protein fusing ubiquitin to BSEP was faster than that of BSEP itself. In conclusion, BSEP/Bsep is modified with two to three ubiquitins, and its ubiquitination is modulated by 4PBA treatment and PFIC2-type mutations. Modulation of short-chain ubiquitination can regulate the change in the degradation rate of cell-surface-resident BSEP by 4PBA treatment and PFIC2-type mutations.
Reduction of CD147 surface expression on primary T cells leads to enhanced cell proliferation.
Biegler, Brian; Kasinrerk, Watchara
2012-12-01
CD147 is a ubiquitously expressed membrane glycoprotein that has numerous functional associations in health and disease. However, the molecular mechanisms by which CD147 participates in these processes are unclear. Establishing physiologically relevant silencing of CD147 in primary T cells could provide clues essential for elucidating some aspects of CD147 biology. To date, achieving the knockdown of CD147 in primary T cells has remained elusive. Utilizing RNA interference and the Nucleofector transfection system, we were able to reduce the expression of CD147 in primary T cells. Comparison of basic functions, such as proliferation and CD25 expression, were then made between control populations and populations with reduced expression. Up-regulation of CD147 was found upon T-cell activation, indicating a role in T-cell responses. To better understand the possible importance of this up-regulation, we knocked down the expression of CD147 using RNA interference. When compared to control populations the CD147 knockdown populations exhibited increased proliferation. This alteration of cell proliferation, however, was not linked to a change in CD25 expression. We achieved reduction of CD147 surface expression in primary T cells by siRNA-mediated gene silencing. Our results point to CD147 having a possible negative regulatory role in T cell-mediated immune responses.
The melanocortin receptor agonist NDP-MSH impairs the allostimulatory function of dendritic cells.
Rennalls, La'Verne P; Seidl, Thomas; Larkin, James M G; Wellbrock, Claudia; Gore, Martin E; Eisen, Tim; Bruno, Ludovica
2010-04-01
As alpha-melanocyte-stimulating hormone (alpha-MSH) is released by immunocompetent cells and has potent immunosuppressive properties, it was determined whether human dendritic cells (DCs) express the receptor for this hormone. Reverse transcription-polymerase chain reaction detected messenger RNA specific for all of the known melanocortin receptors in DCs. Mixed lymphocyte reactions also revealed that treatment with [Nle(4), DPhe(7)]-alpha-MSH (NDP-MSH), a potent alpha-MSH analogue, significantly reduced the ability of DCs to stimulate allogeneic T cells. The expression of various cell surface adhesion, maturation and costimulatory molecules on DCs was also investigated. Although treatment with NDP-MSH did not alter the expression of CD83 and major histocompatibility complex class I and II, the surface expression of CD86 (B7.2), intercellular adhesion molecule (ICAM-1/CD54) and CD1a was reduced. In summary, our data indicate that NDP-MSH inhibits the functional activity of DCs, possibly by down-regulating antigen-presenting and adhesion molecules and that these events may be mediated via the extracellular signal-regulated kinase 1 and 2 pathway.
Hypoxia-inducible factor regulates alphavbeta3 integrin cell surface expression.
Cowden Dahl, Karen D; Robertson, Sarah E; Weaver, Valerie M; Simon, M Celeste
2005-04-01
Hypoxia-inducible factor (HIF)-deficient placentas exhibit a number of defects, including changes in cell fate adoption, lack of fetal angiogenesis, hypocellularity, and poor invasion into maternal tissue. HIF is a heterodimeric transcription factor consisting of alpha and beta aryl hydrocarbon receptor nuclear translocator or ARNT) subunits. We used undifferentiated trophoblast stem (TS) cells to characterize HIF-dependent adhesion, migration, and invasion. Arnt(-/-) and Hifalpha(-/-) TS cells exhibit reduced adhesion and migration toward vitronectin compared with wild-type cells. Furthermore, this defect is associated with decreased cell surface expression of integrin alphavbeta3 and significantly decreased expression of this integrin in focal adhesions. Because of the importance of adhesion and migration in tumor progression (in addition to placental development), we examined the affect of culturing B16F0 melanoma cells in 1.5% oxygen (O(2)). Culturing B16F0 melanoma cells at 1.5% O(2) resulted in increased alphavbeta3 integrin surface expression and increased adhesion to and migration toward vitronectin. Together, these data suggest that HIF and O(2) tension influence placental invasion and tumor migration by increasing cell surface expression of alphavbeta3 integrin.
Hypoxia-inducible Factor Regulates αvβ3 Integrin Cell Surface Expression
Cowden Dahl, Karen D.; Robertson, Sarah E.; Weaver, Valerie M.; Simon, M. Celeste
2005-01-01
Hypoxia-inducible factor (HIF)-deficient placentas exhibit a number of defects, including changes in cell fate adoption, lack of fetal angiogenesis, hypocellularity, and poor invasion into maternal tissue. HIF is a heterodimeric transcription factor consisting of α and β aryl hydrocarbon receptor nuclear translocator or ARNT) subunits. We used undifferentiated trophoblast stem (TS) cells to characterize HIF-dependent adhesion, migration, and invasion. Arnt-/- and Hifα-/- TS cells exhibit reduced adhesion and migration toward vitronectin compared with wild-type cells. Furthermore, this defect is associated with decreased cell surface expression of integrin αvβ3 and significantly decreased expression of this integrin in focal adhesions. Because of the importance of adhesion and migration in tumor progression (in addition to placental development), we examined the affect of culturing B16F0 melanoma cells in 1.5% oxygen (O2). Culturing B16F0 melanoma cells at 1.5% O2 resulted in increased αvβ3 integrin surface expression and increased adhesion to and migration toward vitronectin. Together, these data suggest that HIF and O2 tension influence placental invasion and tumor migration by increasing cell surface expression of αvβ3 integrin. PMID:15689487
Jones, David K; Johnson, Ashley C; Roti Roti, Elon C; Liu, Fang; Uelmen, Rebecca; Ayers, Rebecca A; Baczko, Istvan; Tester, David J; Ackerman, Michael J; Trudeau, Matthew C; Robertson, Gail A
2018-03-22
Reduced levels of the cardiac human (h)ERG ion channel protein and the corresponding repolarizing current I Kr can cause arrhythmia and sudden cardiac death, but the underlying cellular mechanisms controlling hERG surface expression are not well understood. Here, we identified TRIOBP-1, an F-actin-binding protein previously associated with actin polymerization, as a putative hERG-interacting protein in a yeast-two hybrid screen of a cardiac library. We corroborated this interaction by performing Förster resonance energy transfer (FRET) in HEK293 cells and co-immunoprecipitation in HEK293 cells and native cardiac tissue. TRIOBP-1 overexpression reduced hERG surface expression and current density, whereas reducing TRIOBP-1 expression via shRNA knockdown resulted in increased hERG protein levels. Immunolabeling in rat cardiomyocytes showed that native TRIOBP-1 colocalized predominantly with myosin-binding protein C and secondarily with rat ERG. In human stem cell-derived cardiomyocytes, TRIOBP-1 overexpression caused intracellular co-sequestration of hERG signal, reduced native I Kr and disrupted action potential repolarization. Ca 2+ currents were also somewhat reduced and cell capacitance was increased. These findings establish that TRIOBP-1 interacts directly with hERG and can affect protein levels, I Kr magnitude and cardiac membrane excitability. © 2018. Published by The Company of Biologists Ltd.
Dudimah, Fred D.; Abraha, Abraham; Wang, Xiaofei; Whalen, Margaret M.
2010-01-01
Tributyltin (TBT) activates the mitogen activated protein kinase (MAPK), p44/42 in human natural killer (NK) cells. TBT also reduces NK cytotoxic function and decreases the expression of several NK-cell proteins. To understand the role that p44/42 activation plays in TBT-induced loss of NK cell function, we have investigated how selective activation of p44/42 by phorbol 12-myristate 13-acetate (PMA) affects NK cells. Previously we showed that PMA caused losses of lytic function similar to those seen with TBT exposures. Here we examined activation of p44/42 in the regulation of NK-cell protein expression and how this regulation may explain the protein expression changes seen with TBT exposures. NK cells exposed to PMA were examined for levels of cell-surface proteins, granzyme mRNA, and perforin mRNA expression. The expression of CD11a, CD16, CD18, and CD56 were reduced, perforin mRNA levels were unchanged and granzyme mRNA levels were increased. To verify that activation of p44/42 was responsible for the alterations seen in CD11a, CD16, CD18, and CD56 with PMA, NK cells were treated with the p44/42 pathway inhibitor (PD98059) prior to PMA exposures. In the presence of PD98059, PMA caused no decreases in the expression of the cell-surface proteins. Results of these studies indicate that the activation of p44/42 may lead to the loss of NK cell cytotoxic function by decreasing the expression of CD11a, CD16, CD18, and CD56. Further, activation of p44/42 appears to be at least in part responsible for the TBT-induced decreases in expression of CD16, CD18, and CD56. PMID:20883105
Nisar, Shaista P; Lordkipanidzé, Marie; Jones, Matthew L; Dawood, Ban; Murden, Sherina; Cunningham, Margaret R; Mumford, Andrew D; Wilde, Jonathan T; Watson, Steve P; Mundell, Stuart J; Lowe, Gillian C
2014-05-05
A small number of thromboxane receptor variants have been described in patients with a bleeding history that result in platelet dysfunction. We have identified a patient with a history of significant bleeding, who expresses a novel heterozygous thromboxane receptor variant that predicts an asparagine to serine substitution (N42S). This asparagine is conserved across all class A GPCRs, suggesting a vital role for receptor structure and function.We investigated the functional consequences of the TP receptor heterozygous N42S substitution by performing platelet function studies on platelet-rich plasma taken from the patient and healthy controls. We investigated the N42S mutation by expressing the wild-type (WT) and mutant receptor in human embryonic kidney (HEK) cells. Aggregation studies showed an ablation of arachidonic acid responses in the patient, whilst there was right-ward shift of the U46619 concentration response curve (CRC). Thromboxane generation was unaffected. Calcium mobilisation studies in cells lines showed a rightward shift of the U46619 CRC in N42S-expressing cells compared to WT. Radioligand binding studies revealed a reduction in BMax in platelets taken from the patient and in N42S-expressing cells, whilst cell studies confirmed poor surface expression. We have identified a novel thromboxane receptor variant, N42S, which results in platelet dysfunction due to reduced surface expression. It is associated with a significant bleeding history in the patient in whom it was identified. This is the first description of a naturally occurring variant that results in the substitution of this highly conserved residue and confirms the importance of this residue for correct GPCR function.
Gautam, A; Dubey, J P; Saville, W J; Howe, D K
2011-12-29
Sarcocystis neurona is a two-host coccidian parasite whose complex life cycle progresses through multiple developmental stages differing at morphological and molecular levels. The S. neurona merozoite surface is covered by multiple, related glycosylphosphatidylinositol-linked proteins, which are orthologous to the surface antigen (SAG)/SAG1-related sequence (SRS) gene family of Toxoplasma gondii. Expression of the SAG/SRS proteins in T. gondii and another related parasite Neospora caninum is life-cycle stage specific and seems necessary for parasite transmission and persistence of infection. In the present study, the expression of S. neurona merozoite surface antigens (SnSAGs) was evaluated in the sporozoite and bradyzoite stages. Western blot analysis was used to compare SnSAG expression in merozoites versus sporozoites, while immunocytochemistry was performed to examine expression of the SnSAGs in merozoites versus bradyzoites. These analyses revealed that SnSAG2, SnSAG3 and SnSAG4 are expressed in sporozoites, while SnSAG5 was appeared to be downregulated in this life cycle stage. In S. neurona bradyzoites, it was found that SnSAG2, SnSAG3, SnSAG4 and SnSAG5 were either absent or expression was greatly reduced. As shown for T. gondii, stage-specific expression of the SnSAGs may be important for the parasite to progress through its developmental stages and complete its life cycle successfully. Thus, it is possible that the SAG switching mechanism by these parasites could be exploited as a point of intervention. As well, the alterations in surface antigen expression during different life cycle stages may need to be considered when designing prospective approaches for protective vaccination. Copyright © 2011 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tyler, Andreas, E-mail: andreas.tyler@medbio.umu.se; Johansson, Anders; Karlsson, Terese
Background: Acquired resistance to cisplatin treatment is a caveat when treating patients with non-small cell lung cancer (NSCLC) and malignant pleural mesothelioma (MPM). Ceramide increases in response to chemotherapy, leading to proliferation arrest and apoptosis. However, a tumour stress activation of glucosylceramide synthase (GCS) follows to eliminate ceramide by formation of glycosphingolipids (GSLs) such as globotriaosylceramide (Gb3), the functional receptor of verotoxin-1. Ceramide elimination enhances cell proliferation and apoptosis blockade, thus stimulating tumor progression. GSLs transactivate multidrug resistance 1/P-glycoprotein (MDR1) and multidrug resistance-associated protein 1 (MRP1) expression which further prevents ceramide accumulation and stimulates drug efflux. We investigated the expressionmore » of Gb3, MDR1 and MRP1 in NSCLC and MPM cells with acquired cisplatin resistance, and if GCS activity or MDR1 pump inhibitors would reduce their expression and reverse cisplatin-resistance. Methods: Cell surface expression of Gb3, MDR1 and MRP1 and intracellular expression of MDR1 and MRP1 was analyzed by flow cytometry and confocal microscopy on P31 MPM and H1299 NSCLC cells and subline cells with acquired cisplatin resistance. The effect of GCS inhibitor PPMP and MDR1 pump inhibitor cyclosporin A for 72 h on expression and cisplatin cytotoxicity was tested. Results: The cisplatin-resistant cells expressed increased cell surface Gb3. Cell surface Gb3 expression of resistant cells was annihilated by PPMP whereas cyclosporin A decreased Gb3 and MDR1 expression in H1299 cells. No decrease of MDR1 by PPMP was noted in using flow cytometry, whereas a decrease of MDR1 in H1299 and H1299res was indicated with confocal microscopy. No certain co-localization of Gb3 and MDR1 was noted. PPMP, but not cyclosporin A, potentiated cisplatin cytotoxicity in all cells. Conclusions: Cell surface Gb3 expression is a likely tumour biomarker for acquired cisplatin resistance of NSCLC and MPM cells. Tumour cell resistance to MDR1 inhibitors of cell surface MDR1 and Gb3 could explain the aggressiveness of NSCLC and MPM. Therapy with GCS activity inhibitors or toxin targeting of the Gb3 receptor may substantially reduce acquired cisplatin drug resistance of NSCLC and MPM cells. - Highlights: • The cisplatin-resistant cells had increased cell surface Gb3 and MDR1. • PPMP decreased extracellular Gb3 in the resistant cell lines. • Cyclosporin A decreased extracellular Gb3 and MDR1 in H1299 cells. • PPMP, but not cyclosporin A, potentiated cisplatin cytotoxicity in all cells. • Resistance to inhibitors of MDR1 and Gb3 could explain aggressiveness of NSCLC and MPM.« less
Guernsey, Michael W.; Ritscher, Lars; Miller, Matthew A.; Smith, Daniel A.; Schöneberg, Torsten; Shapiro, Michael D.
2013-01-01
Variation in the melanocortin-1 receptor (Mc1r) is associated with pigmentation diversity in wild and domesticated populations of vertebrates, including several species of birds. Among domestic bird species, pigmentation variation in the rock pigeon ( Columba livia ) is particularly diverse. To determine the potential contribution of Mc1r variants to pigment diversity in pigeons, we sequenced Mc1r in a wide range of pigeon breeds and identified several single nucleotide polymorphisms, including a variant that codes for an amino acid substitution (Val85Met). In contrast to the association between Val85Met and eumelanism in other avian species, this change was associated with pheomelanism in pigeons. In vitro cAMP accumulation and protein expression assays revealed that Val85Met leads to decreased receptor function and reduced cell surface expression of the mutant protein. The reduced in vitro function is consistent with the observed association with reduced eumelanic pigmentation. Comparative genetic and cellular studies provide important insights about the range of mechanisms underlying diversity among vertebrates, including different phenotypic associations with similar mutations in different species. PMID:23977400
Betsunoh, Hironori; Mukai, Shoichiro; Akiyama, Yutaka; Fukushima, Tsuyoshi; Minamiguchi, Naoki; Hasui, Yoshihiro; Osada, Yukio; Kataoka, Hiroaki
2007-04-01
Cell surface proteolysis is important for the generation of bioactive proteins mediating tumor progression. Recent studies suggest that the membrane-anchored cell surface proteinases matriptase and hepsin have significant roles in tumors. We analyzed the expression and clinical relevance of matriptase and hepsin, and their inhibitors hepatocyte growth factor activator inhibitor type 1 (HAI-1) and type 2 (HAI-2) in 66 cases of conventional renal cell carcinomas (RCC). The mRNA level was evaluated in paired samples from tumor and non-tumorous renal tissues by real-time reverse transcription-polymerase chain reaction. As matriptase and hepsin potently activate the proform of hepatocyte growth factor (HGF), the expression of HGF and its receptor, c-Met, was also analyzed. Although upregulation of matriptase was observed occasionally in RCC, the expression level was not associated with prognostic parameters. Hepsin was downregulated in RCC, particularly in early stage disease, but upregulated in advanced stages. There was a trend of higher hepsin expression in RCC with distant metastasis, and Kaplan-Meier survival curves showed that high hepsin expression was associated with reduced overall survival (P<0.01, log-rank test). Moreover, multivariate analysis indicated that hepsin was an independent prognostic factor. Overexpression of HGF or c-Met also showed reduced overall survival. We also observed a tendency of low HAI-2 expression with reduced overall survival and a statistical association between high hepsin and low HAI-2 level. No associations were observed between matriptase and HAI-1 and HAI-2. Our findings suggest that the balance between hepsin and its inhibitor, HAI-2, may have prognostic value in RCC.
The Cell Surface Markers Expression in Postmenopausal Women and Relation to Obesity and Bone Status.
Horváthová, Mira; Ilavská, Silvia; Štefíková, Kornélia; Szabová, Michaela; Krivošíková, Zora; Jahnová, Eva; Tulinská, Jana; Spustová, Viera; Gajdoš, Martin
2017-07-11
The age-related changes and hormonal deprivation in postmenopausal women are associated with the immune response alteration. The excessive fat accumulation, local and systemic inflammation may lead to dysregulation in immune function and relevant health problems, including obesity and osteoporosis. We analyzed the expression of cell surface markers in the venous blood specimens, stained with fluorophores-conjugated monoclonal antibodies and analysed by multicolour flow cytometry. The significant changes of cytotoxic, naive, and memory T-lymphocytes, plasmacytoid dendritic cells (DCs) were in postmenopausal women versus fertile women. Body mass index (BMI) affected markedly the cell surface expression of CD265/RANK. Osteoporosis is linked to reduced percentage of plasmacytoid DCs, and elevated natural Treg cells ( p < 0.05). The confounding factors such as women age, BMI, bone mineral density (BMD), waist size and tissue fat affect the expression of RANK on myeloid DCs and CD40L on T-lymphocytes that might be the immunophenotypic modulators after menopause.
The Cell Surface Markers Expression in Postmenopausal Women and Relation to Obesity and Bone Status
Horváthová, Mira; Ilavská, Silvia; Štefíková, Kornélia; Szabová, Michaela; Krivošíková, Zora; Jahnová, Eva; Tulinská, Jana; Spustová, Viera; Gajdoš, Martin
2017-01-01
The age-related changes and hormonal deprivation in postmenopausal women are associated with the immune response alteration. The excessive fat accumulation, local and systemic inflammation may lead to dysregulation in immune function and relevant health problems, including obesity and osteoporosis. We analyzed the expression of cell surface markers in the venous blood specimens, stained with fluorophores-conjugated monoclonal antibodies and analysed by multicolour flow cytometry. The significant changes of cytotoxic, naive, and memory T-lymphocytes, plasmacytoid dendritic cells (DCs) were in postmenopausal women versus fertile women. Body mass index (BMI) affected markedly the cell surface expression of CD265/RANK. Osteoporosis is linked to reduced percentage of plasmacytoid DCs, and elevated natural Treg cells (p < 0.05). The confounding factors such as women age, BMI, bone mineral density (BMD), waist size and tissue fat affect the expression of RANK on myeloid DCs and CD40L on T-lymphocytes that might be the immunophenotypic modulators after menopause. PMID:28696349
Andrini, Olga; Keck, Mathilde; L'Hoste, Sébastien; Briones, Rodolfo; Mansour-Hendili, Lamisse; Grand, Teddy; Sepúlveda, Francisco V; Blanchard, Anne; Lourdel, Stéphane; Vargas-Poussou, Rosa; Teulon, Jacques
2014-09-01
ClC-Kb, a member of the ClC family of Cl(-) channels/transporters, plays a major role in the absorption of NaCl in the distal nephron. CLCNKB mutations cause Bartter syndrome type 3, a hereditary renal salt-wasting tubulopathy. Here, we investigate the functional consequences of a Val to Met substitution at position 170 (V170M, α helix F), which was detected in eight patients displaying a mild phenotype. Conductance and surface expression were reduced by ~40-50 %. The regulation of channel activity by external H(+) and Ca(2+) is a characteristic property of ClC-Kb. Inhibition by external H(+) was dramatically altered, with pKH shifting from 7.6 to 6.0. Stimulation by external Ca(2+) on the other hand was no longer detectable at pH 7.4, but was still present at acidic pH values. Functionally, these regulatory modifications partly counterbalance the reduced surface expression by rendering V170M hyperactive. Pathogenic Met170 seems to interact with another methionine on α helix H (Met227) since diverse mutations at this site partly removed pH sensitivity alterations of V170M ClC-Kb. Exploring other disease-associated mutations, we found that a Pro to Leu substitution at position 124 (α helix D, Simon et al., Nat Genet 1997, 17:171-178) had functional consequences similar to those of V170M. In conclusion, we report here for the first time that ClC-Kb disease-causing mutations located around the selectivity filter can result in both reduced surface expression and hyperactivity in heterologous expression systems. This interplay must be considered when analyzing the mild phenotype of patients with type 3 Bartter syndrome.
Analytical Expressions for Thermo-Osmotic Permeability of Clays
NASA Astrophysics Data System (ADS)
Gonçalvès, J.; Ji Yu, C.; Matray, J.-M.; Tremosa, J.
2018-01-01
In this study, a new formulation for the thermo-osmotic permeability of natural pore solutions containing monovalent and divalent cations is proposed. The mathematical formulation proposed here is based on the theoretical framework supporting thermo-osmosis which relies on water structure alteration in the pore space of surface-charged materials caused by solid-fluid electrochemical interactions. The ionic content balancing the surface charge of clay minerals causes a disruption in the hydrogen bond network when more structured water is present at the clay surface. Analytical expressions based on our heuristic model are proposed and compared to the available data for NaCl solutions. It is shown that the introduction of divalent cations reduces the thermo-osmotic permeability by one third compared to the monovalent case. The analytical expressions provided here can be used to advantage for safety calculations in deep underground nuclear waste repositories.
Functional Characterization of CaVα2δ Mutations Associated with Sudden Cardiac Death*
Bourdin, Benoîte; Shakeri, Behzad; Tétreault, Marie-Philippe; Sauvé, Rémy; Lesage, Sylvie; Parent, Lucie
2015-01-01
L-type Ca2+ channels play a critical role in cardiac rhythmicity. These ion channels are oligomeric complexes formed by the pore-forming CaVα1 with the auxiliary CaVβ and CaVα2δ subunits. CaVα2δ increases the peak current density and improves the voltage-dependent activation gating of CaV1.2 channels without increasing the surface expression of the CaVα1 subunit. The functional impact of genetic variants of CACNA2D1 (the gene encoding for CaVα2δ), associated with shorter repolarization QT intervals (the time interval between the Q and the T waves on the cardiac electrocardiogram), was investigated after recombinant expression of the full complement of L-type CaV1.2 subunits in human embryonic kidney 293 cells. By performing side-by-side high resolution flow cytometry assays and whole-cell patch clamp recordings, we revealed that the surface density of the CaVα2δ wild-type protein correlates with the peak current density. Furthermore, the cell surface density of CaVα2δ mutants S755T, Q917H, and S956T was not significantly different from the cell surface density of the CaVα2δ wild-type protein expressed under the same conditions. In contrast, the cell surface expression of CaVα2δ D550Y, CaVα2δ S709N, and the double mutant D550Y/Q917H was reduced, respectively, by ≈30–33% for the single mutants and by 60% for the latter. The cell surface density of D550Y/Q917H was more significantly impaired than protein stability, suggesting that surface trafficking of CaVα2δ was disrupted by the double mutation. Co-expression with D550Y/Q917H significantly decreased CaV1.2 currents as compared with results obtained with CaVα2δ wild type. It is concluded that D550Y/Q917H reduced inward Ca2+ currents through a defect in the cell surface trafficking of CaVα2δ. Altogether, our results provide novel insight in the molecular mechanism underlying the modulation of CaV1.2 currents by CaVα2δ. PMID:25527503
Sakugawa, Chihiro; Haruyama, Yukihiro; Tanaka, Hiroyuki; Fukushima, Tsuyoshi; Kawaguchi, Makiko; Kataoka, Hiroaki
2017-12-04
Hepatocyte growth factor activator inhibitor type 1 (HAI-1) is a membrane-bound serine protease inhibitor that is expressed on the surface of epithelial cells. Evidence has suggested that decreased cell surface HAI-1 in carcinoma cells results in enhanced invasiveness. However, little is known regarding the expression of HAI-1 in pancreatic ductal adenocarcinoma (PDAC). This study aimed to analyze HAI-1 expression in PDAC and its impact on patient prognosis. HAI-1 immunohistochemistry was performed on samples from 67 PDAC cases. HAI-1 expression was increased in intraepithelial neoplasia compared to the adjacent non-neoplastic ductal epithelium. Of the 67 samples tested, 58% (39/67) of PDAC cases showed diffuse (> 75%) immunoreactivity in PDAC cells. The remaining cases showed reduced HAI-1 immunoreactivity in a substantial number of cancer cells. Although there was no correlation between HAI-1 status and tumor size, histologic grade or lymph node metastasis, diffuse HAI-1 positive cases showed longer disease-free survival (DFS; p = 0.006, log-rank test). In conclusion, HAI-1 is upregulated in pancreatic intraepithelial neoplasia and broadly expressed in PDAC cells. However, PDAC cases having areas of reduced HAI-1 immunoreactivity may show shorter DFS.
Sayegh, Camil E.; Demaries, Sandra L.; Iacampo, Sandra; Ratcliffe, Michael J. H.
1999-01-01
Immunoglobulin gene rearrangement in avian B cell precursors generates surface Ig receptors of limited diversity. It has been proposed that specificities encoded by these receptors play a critical role in B lineage development by recognizing endogenous ligands within the bursa of Fabricius. To address this issue directly we have introduced a truncated surface IgM, lacking variable region domains, into developing B precursors by retroviral gene transfer in vivo. Cells expressing this truncated receptor lack endogenous surface IgM, and the low level of endogenous Ig rearrangements that have occurred within this population of cells has not been selected for having a productive reading frame. Such cells proliferate rapidly within bursal epithelial buds of normal morphology. In addition, despite reduced levels of endogenous light chain rearrangement, those light chain rearrangements that have occurred have undergone variable region diversification by gene conversion. Therefore, although surface expression of an Ig receptor is required for bursal colonization and the induction of gene conversion, the specificity encoded by the prediversified receptor is irrelevant and, consequently, there is no obligate ligand for V(D)J-encoded determinants of prediversified avian cell surface IgM receptor. PMID:10485907
Timóteo, Rodolfo Pessato; Micheli, Douglas Cobo; Teodoro, Reginaldo Botelho; Freire, Marlene; Bertoncello, Dernival; Murta, Eddie Fernando Candido; Tavares-Murta, Beatriz Martins
To characterize the inflammatory profiles of patients with systemic lupus erythematosus receiving standard treatment compared to healthy controls. Peripheral venous blood was collected from systemic lupus erythematosus patients (n=14) and controls (n=18) at enrollment. Blood samples were used for quantification, by flow cytometry, of CD11b (integrin) and Chemokine receptor CXCR2 expression surface antigen in neutrophils and lymphocytes, while cytokines were assayed in serum samples. Purified neutrophils were assayed by their ability to phagocytize human plasma-opsonized zymosan. Patients had a median (interquartile range) disease activity index of 1.0 (0-2.0) characteristic of patients in remission. Interleukin-6 and interleukin-10 serum concentrations were significantly higher in the patient group compared to controls and the phagocytic index of circulating neutrophils was significantly reduced in patients compared to controls. The levels of interleukin-2, interleukin-5, interleukin-8 and tumor necrosis factor alpha did not significantly differ between patients and controls. Flow cytometric analysis revealed that the integrin expression levels were reduced in lymphocytes (but not in neutrophils) obtained from systemic lupus erythematosus patients, while surface expression of the chemokine receptor 2 was similar in both neutrophils and lymphocytes. Systemic lupus erythematosus patients receiving standard treatment presented with elevated systemic levels of interleukin-6 and interleukin-10, reduced neutrophil phagocytic capacity, and reduced lymphocyte expression of integrin even when symptoms were in remission. These alterations to innate immune components may put these individuals at a greater risk for acquiring infections. Copyright © 2016 Elsevier Editora Ltda. All rights reserved.
Rotmann, Alexander; Vékony, Nicole; Gassner, Davina; Niegisch, Günter; Strand, Dennis; Martiné, Ursula; Closs, Ellen I
2006-04-01
We have previously shown that activation of PKC (protein kinase C) results in internalization of hCAT-1 [human CAT-1 (cationic amino acid transporter 1)] and a decrease in arginine transport [Rotmann, Strand, Martiné and Closs (2004) J. Biol. Chem. 279, 54185-54192]. However, others found increased transport rates for arginine in response to PKC activation, suggesting a differential effect of PKC on different CAT isoforms. Therefore we investigated the effect of PKC on hCAT-3, an isoform expressed in thymus, brain, ovary, uterus and mammary gland. In Xenopus laevis oocytes and human U373MG glioblastoma cells, hCAT-3-mediated L-arginine transport was significantly reduced upon treatment with compounds that activate classical PKC. In contrast, inactive phorbol esters and an activator of novel PKC isoforms had no effect. PKC inhibitors (including the PKCalpha-preferring Ro 31-8280) reduced the inhibitory effect of the PKC-activating compounds. Microscopic analyses revealed a PMA-induced reduction in the cell-surface expression of fusion proteins between hCAT-3 and enhanced green fluorescent protein expressed in X. laevis oocytes and glioblastoma cells. Western-blot analysis of biotinylated surface proteins demonstrated a PMA-induced decrease in hCAT-3 in the plasma membrane, but not in total protein lysates. Pretreatment with a PKC inhibitor also reduced this PMA effect. It is concluded that similar to hCAT-1, hCAT-3 activity is decreased by PKC via reduction of transporter molecules in the plasma membrane. Classical PKC isoforms seem to be responsible for this effect.
Ma, Qun; Wood, Thomas K
2009-10-01
Previously we discovered that OmpA of Escherichia coli increases biofilm formation on polystyrene surfaces (González Barrios et al., Biotechnol Bioeng, 93:188-200, 2006a). Here we show OmpA influences biofilm formation differently on hydrophobic and hydrophilic surfaces since it represses cellulose production which is hydrophilic. OmpA increased biofilm formation on polystyrene, polypropylene, and polyvinyl surfaces while it decreased biofilm formation on glass surfaces. Sand column assays corroborated that OmpA decreases attachment to hydrophilic surfaces. The ompA mutant formed sticky colonies, and the extracellular polysaccharide that caused stickiness was identified as cellulose. A whole-transcriptome study revealed that OmpA induces the CpxRA two-component signal transduction pathway that responds to membrane stress. CpxA phosphorylates CpxR and results in reduced csgD expression. Reduced CsgD production represses adrA expression and results in reduced cellulose production since CsgD and AdrA are responsible for 3,5-cyclic diguanylic acid and cellulose synthesis. Real-time polymerase chain reaction confirmed csgD and adrA are repressed by OmpA. Biofilm and cellulose assays with double deletion mutants adrA ompA, csgB ompA, and cpxR ompA confirmed OmpA decreased cellulose production and increased biofilm formation on polystyrene surfaces through CpxR and AdrA. Further evidence of the link between OmpA and the CpxRA system was that overproduction of OmpA disrupted the membrane and led to cell lysis. Therefore, OmpA inhibits cellulose production through the CpxRA stress response system, and this reduction in cellulose increases biofilm formation on hydrophobic surfaces.
The hematopoietic cell-specific transcription factor PU.1 is critical for expression of CD11c.
Yashiro, Takuya; Kasakura, Kazumi; Oda, Yoshihito; Kitamura, Nao; Inoue, Akihito; Nakamura, Shusuke; Yokoyama, Hokuto; Fukuyama, Kanako; Hara, Mutsuko; Ogawa, Hideoki; Okumura, Ko; Nishiyama, Makoto; Nishiyama, Chiharu
2017-02-01
PU.1 is a hematopoietic cell-specific transcription factor belonging to the Ets family, which plays an important role in the development of dendritic cells (DCs). CD11c (encoded by Itgax) is well established as a characteristic marker of hematopoietic lineages including DCs. In the present study, we analyzed the role of PU.1 (encoded by Spi-1) in the expression of CD11c. When small interfering RNA (siRNA) for Spi-1 was introduced into bone marrow-derived DCs (BMDCs), the mRNA level and cell surface expression of CD11c were dramatically reduced. Using reporter assays, the TTCC sequence at -56/-53 was identified to be critical for PU.1-mediated activation of the promoter. An EMSA showed that PU.1 directly bound to this region. ChIP assays demonstrated that a significant amount of PU.1 bound to this region on chromosomal DNA in BMDCs, which was decreased in LPS-stimulated BMDCs in accordance with the reduced levels of mRNAs of Itgax and Spi-1, and the histone acetylation degree. Enforced expression of exogenous PU.1 induced the expression of the CD11c protein on the cell surface of mast cells, whereas control transfectants rarely expressed CD11c. Quantitative RT-PCR also showed that the expression of a transcription factor Irf4, which is a partner molecule of PU.1, was reduced in PU.1-knocked down BMDCs. IRF4 transactivated the Itgax gene in a synergistic manner with PU.1. Taken together, these results indicate that PU.1 functions as a positive regulator of CD11c gene expression by directly binding to the Itgax promoter and through transactivation of the Irf4 gene. © The Japanese Society for Immunology. 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Promoting Thiol Expression Increases The Durability of Antitumor T cell Functions
Scurti, Gina; Thyagarajan, Krishnamurthy; Kaur, Navtej; Husain, Shahid; Fang, Quan; Naga, Osama S.; Simms, Patricia; Beeson, Gyda; Voelkel-Johnson, Christina; Garrett-Mayer, Elizabeth; Beeson, Craig C.; Nishimura, Michael I.; Mehrotra, Shikhar
2014-01-01
Ex vivo-expanded CD8+ T cells used for adoptive immunotherapy generally acquire an effector memory-like phenotype (TEM cells). With regard to therapeutic applications, two undesired features of this phenotype in vivo are limited persistence and reduced anti-tumor efficacy, relative to CD8+ T cells with a central memory-like phenotype (TCM cells). Further, there is incomplete knowledge about all the differences between TEM and TCM cells that may influence tumor treatment outcomes. Given that TCM cells survive relatively longer in oxidative tumor microenvironments, we investigated the hypothesis that TCM possess relatively greater anti-oxidative capacity than TEM cells. Here we report that TCM cells exhibit a relative increase compared to TEM cells in expression of cell surface thiols, a key target of cellular redox controls, along with other antioxidant molecules. Increased expression of redox regulators in TCM cells inversely correlated with the generation of reactive oxygen and nitrogen species, proliferative capacity and glycolytic enzyme levels. Notably, TCR-transduced T cells pretreated with thiol donors, such as N-acetyl cysteine or rapamycin, up-regulated thiol levels and antioxidant genes. A comparison of anti-tumor CD8+ T cell populations on the basis of surface thiol expression showed that thiol-high cells persisted longer in vivo and exerted superior tumor control. Our results suggest that higher levels of reduced cell surface thiols are a key characteristic of T cells that can control tumor growth, and that profiling this biomarker may have benefits to T cell adoptive immunotherapy protocols. PMID:25164014
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stiernholm, N.B.J.; Verkoczy, L.K.; Berinstein, N.L.
1995-05-01
The constant region of the human Ig{lambda} locus consists of seven tandemly organized J-C gene segments. Although it has been established that the J-C{lambda}1, J-C{lambda}2, J-C{lambda}3, and J-C{lambda}7 gene segments are functional, and code for the four distinct Ig{lambda} isotypes found in human serum, the J-C{lambda}4, J-C{lambda}5, and J-C{lambda}6 gene segments are generally considered to be pseudogenes. Although one example of a functional J-C{lambda}6 gene segment has been documented, in the majority of cases, J-C{lambda}6 is rendered nonfunctional by virtue of a single duplication of four nucleotides, creating a premature translational arrest. We show here that rearrangements to the J-C{lambda}6more » gene segment do occur, and that such a rearrangement encodes an Ig{lambda} protein that lacks the terminal end of the constant region. We also show that this truncated protein is expressed on the surface with the IgH chain, creating an unusual surface Ig (sIg) receptor (sIg{triangle}CL). Cells that express this receptor on the surface do so at significantly reduced levels compared with clonally related variants, which express sIg receptors with conventional Ig{lambda} L chains. However, the effects of sIg cross-linking on tyrosine phosphorylation and surface expression of the CD25 and CD71 Ags are similar in cells that express conventional sIg receptors and in those that express sIg{triangle}CL receptors, suggesting that the latter could possibly function as an Ag receptor. 35 refs., 7 figs.« less
Bachert, Beth A; Choi, Soo J; LaSala, Paul R; Harper, Tiffany I; McNitt, Dudley H; Boehm, Dylan T; Caswell, Clayton C; Ciborowski, Pawel; Keene, Douglas R; Flores, Anthony R; Musser, James M; Squeglia, Flavia; Marasco, Daniela; Berisio, Rita; Lukomski, Slawomir
2016-01-01
The streptococcal collagen-like proteins 1 and 2 (Scl1 and Scl2) are major surface adhesins that are ubiquitous among group A Streptococcus (GAS). Invasive M3-type strains, however, have evolved two unique conserved features in the scl1 locus: (i) an IS1548 element insertion in the scl1 promoter region and (ii) a nonsense mutation within the scl1 coding sequence. The scl1 transcript is drastically reduced in M3-type GAS, contrasting with a high transcription level of scl1 allele in invasive M1-type GAS. This leads to a lack of Scl1 expression in M3 strains. In contrast, while scl2 transcription and Scl2 production are elevated in M3 strains, M1 GAS lack Scl2 surface expression. M3-type strains were shown to have reduced biofilm formation on inanimate surfaces coated with cellular fibronectin and laminin, and in human skin equivalents. Repair of the nonsense mutation and restoration of Scl1 expression on M3-GAS cells, restores biofilm formation on cellular fibronectin and laminin coatings. Inactivation of scl1 in biofilm-capable M28 and M41 strains results in larger skin lesions in a mouse model, indicating that lack of Scl1 adhesin promotes bacterial spread over localized infection. These studies suggest the uniquely evolved scl1 locus in the M3-type strains, which prevents surface expression of the major Scl1 adhesin, contributed to the emergence of the invasive M3-type strains. Furthermore these studies provide insight into the molecular mechanisms mediating colonization, biofilm formation, and pathogenesis of group A streptococci.
Placental alterations in structure and function in intra-uterine growth-retarded horses.
Robles, M; Peugnet, P M; Valentino, S A; Dubois, C; Dahirel, M; Aubrière, M-C; Reigner, F; Serteyn, D; Wimel, L; Couturier-Tarrade, A; Chavatte-Palmer, P
2018-05-01
Following embryo transfer (ET), the size and breed of the recipient mare can affect fetal development and subsequent post natal growth rate and insulin sensitivity in foals. To investigate placental adaptation in pregnancies where increased or restricted fetal growth was induced through ET between Pony, Saddlebred and Draught horses. In vivo experiment. Control Pony (P, n = 21) and Saddlebred (S, n = 28) pregnancies were obtained by artificial insemination. Increased pregnancies were obtained by transferring Pony (P-D, n = 6) and Saddlebred (S-D, n = 8) embryos into Draught mares. Restricted pregnancies were obtained by transferring Saddlebred embryos into Pony mares (S-P, n = 6). Placental weight and surface were recorded and samples collected for stereology and analysis of expression of genes involved in placental growth, vascularisation and nutrient transport. Data were analysed by linear model. S-P foals were growth retarded when compared with controls despite increased gestational length. Placental weight was reduced but placental surface density and volume fraction were increased. Placental expression of genes involved in growth and development and nutrient transfer was strongly reduced. In contrast, placental size and weight were increased in enhanced growth P-D and S-D foals. The trophoblastic surface density and the allantoic vessels surface density were decreased in P-D and S-D, respectively, both with very few modifications in gene expression. Control embryos were produced by artificial insemination whereas experimental embryos were produced by ET. Placental structure and gene expression are modified after ET into a smaller or larger breed than that of the embryo. These adaptations contribute to the observed phenotype of foal growth restriction or enhanced growth at birth. © 2017 EVJ Ltd.
Myosin Vb mediates Cu+ export in polarized hepatocytes
Gupta, Arnab; Schell, Michael J.; Bhattacharjee, Ashima; Lutsenko, Svetlana; Hubbard, Ann L.
2016-01-01
ABSTRACT The cellular machinery responsible for Cu+-stimulated delivery of the Wilson-disease-associated protein ATP7B to the apical domain of hepatocytes is poorly understood. We demonstrate that myosin Vb regulates the Cu+-stimulated delivery of ATP7B to the apical domain of polarized hepatic cells, and that disruption of the ATP7B-myosin Vb interaction reduces the apical surface expression of ATP7B. Overexpression of the myosin Vb tail, which competes for binding of subapical cargos to myosin Vb bound to subapical actin, disrupted the surface expression of ATP7B, leading to reduced cellular Cu+ export. The myosin-Vb-dependent targeting step occurred in parallel with hepatocyte-like polarity. If the myosin Vb tail was expressed acutely in cells just prior to the establishment of polarity, it appeared as part of an intracellular apical compartment, centered on γ-tubulin. ATP7B became selectively arrested in this compartment at high [Cu+] in the presence of myosin Vb tail, suggesting that these compartments are precursors of donor–acceptor transfer stations for apically targeted cargos of myosin Vb. Our data suggest that reduced hepatic Cu+ clearance in idiopathic non-Wilsonian types of disease might be associated with the loss of function of myosin Vb. PMID:26823605
Tseng, Pang-Yen; Henderson, Peter B; Hergarden, Anne C; Patriarchi, Tommaso; Coleman, Andrea M; Lillya, Mark W; Montagut-Bordas, Carlota; Lee, Boram; Hell, Johannes W; Horne, Mary C
2017-07-18
The voltage-gated L-type Ca 2+ channel Ca V 1.2 is crucial for initiating heartbeat and control of a number of neuronal functions such as neuronal excitability and long-term potentiation. Mutations of Ca V 1.2 subunits result in serious health problems, including arrhythmia, autism spectrum disorders, immunodeficiency, and hypoglycemia. Thus, precise control of Ca V 1.2 surface expression and localization is essential. We previously reported that α-actinin associates and colocalizes with neuronal Ca V 1.2 channels and that shRNA-mediated depletion of α-actinin significantly reduces localization of endogenous Ca V 1.2 in dendritic spines in hippocampal neurons. Here we investigated the hypothesis that direct binding of α-actinin to Ca V 1.2 supports its surface expression. Using two-hybrid screens and pull-down assays, we identified three point mutations (K1647A, Y1649A, and I1654A) in the central, pore-forming α 1 1.2 subunit of Ca V 1.2 that individually impaired α-actinin binding. Surface biotinylation and flow cytometry assays revealed that Ca V 1.2 channels composed of the corresponding α-actinin-binding-deficient mutants result in a 35-40% reduction in surface expression compared to that of wild-type channels. Moreover, the mutant Ca V 1.2 channels expressed in HEK293 cells exhibit a 60-75% decrease in current density. The larger decrease in current density as compared to surface expression imparted by these α 1 1.2 subunit mutations hints at the possibility that α-actinin not only stabilizes surface localization of Ca V 1.2 but also augments its ion conducting activity.
Kidd, Michael W; Bulley, Simon; Jaggar, Jonathan H
2017-03-01
Several different voltage-dependent K + (K V ) channel isoforms are expressed in arterial smooth muscle cells (myocytes). Vasoconstrictors inhibit K V currents, but the isoform selectivity and mechanisms involved are unclear. We show that angiotensin II (Ang II), a vasoconstrictor, stimulates degradation of K V 1.5, but not K V 2.1, channels through a protein kinase C- and lysosome-dependent mechanism, reducing abundance at the surface of mesenteric artery myocytes. The Ang II-induced decrease in cell surface K V 1.5 channels reduces whole-cell K V 1.5 currents and attenuates K V 1.5 function in pressurized arteries. We describe a mechanism by which Ang II stimulates protein kinase C-dependent K V 1.5 channel degradation, reducing the abundance of functional channels at the myocyte surface. Smooth muscle cells (myocytes) of resistance-size arteries express several different voltage-dependent K + (K V ) channels, including K V 1.5 and K V 2.1, which regulate contractility. Myocyte K V currents are inhibited by vasoconstrictors, including angiotensin II (Ang II), but the mechanisms involved are unclear. Here, we tested the hypothesis that Ang II inhibits K V currents by reducing the plasma membrane abundance of K V channels in myocytes. Angiotensin II (applied for 2 h) reduced surface and total K V 1.5 protein in rat mesenteric arteries. In contrast, Ang II did not alter total or surface K V 2.1, or K V 1.5 or K V 2.1 cellular distribution, measured as the percentage of total protein at the surface. Bisindolylmaleimide (BIM; a protein kinase C blocker), a protein kinase C inhibitory peptide or bafilomycin A (a lysosomal degradation inhibitor) each blocked the Ang II-induced decrease in total and surface K V 1.5. Immunofluorescence also suggested that Ang II reduced surface K V 1.5 protein in isolated myocytes; an effect inhibited by BIM. Arteries were exposed to Ang II or Ang II plus BIM (for 2 h), after which these agents were removed and contractility measurements performed or myocytes isolated for patch-clamp electrophysiology. Angiotensin II reduced both whole-cell K V currents and currents inhibited by Psora-4, a K V 1.5 channel blocker. Angiotensin II also reduced vasoconstriction stimulated by Psora-4 or 4-aminopyridine, another K V channel inhibitor. These data indicate that Ang II activates protein kinase C, which stimulates K V 1.5 channel degradation, leading to a decrease in surface K V 1.5, a reduction in whole-cell K V 1.5 currents and a loss of functional K V 1.5 channels in myocytes of pressurized arteries. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.
CD10/NEP in non-small cell lung carcinomas. Relationship to cellular proliferation.
Ganju, R K; Sunday, M; Tsarwhas, D G; Card, A; Shipp, M A
1994-01-01
The cell surface metalloproteinase CD10/neutral endopeptidase 24.11 (NEP) hydrolyzes a variety of peptide substrates and reduces cellular responses to specific peptide hormones. Because CD10/NEP modulates peptide-mediated proliferation of small cell carcinomas of the lung (SCLC) and normal fetal bronchial epithelium, we evaluated the enzyme's expression in non-small cell lung carcinomas (NSCLC). Bronchoalveolar and large cell carcinoma cell lines had low levels of CD10/NEP expression whereas squamous, adenosquamous, and adenocarcinoma cell lines had higher and more variable levels of the cell surface enzyme. Regional variations in CD10/NEP immunostaining in primary NSCLC specimens prompted us to correlate CD10/NEP expression with cell growth. In primary carcinomas of the lung, clonal NSCLC cell lines and SV40-transformed fetal airway epithelium, subsets of cells expressed primarily CD10/NEP or the proliferating cell nuclear antigen (PCNA). Cultured airway epithelial cells had the lowest levels of CD10/NEP expression when the highest percentage of cells were actively dividing; in addition, these cells grew more rapidly when cell surface CD10/NEP was inhibited. NSCLC cell lines had receptors for a variety of mitogenic peptides known to be CD10/NEP substrates, underscoring the functional significance of growth-related variability in CD10/NEP expression. Images PMID:7962523
Haining, Elizabeth J.; Yang, Jing; Bailey, Rebecca L.; Khan, Kabir; Collier, Richard; Tsai, Schickwann; Watson, Steve P.; Frampton, Jon; Garcia, Paloma; Tomlinson, Michael G.
2012-01-01
A disintegrin and metalloprotease 10 (ADAM10) is a ubiquitous transmembrane metalloprotease that cleaves the extracellular regions from over 40 different transmembrane target proteins, including Notch and amyloid precursor protein. ADAM10 is essential for embryonic development and is also important in inflammation, cancer, and Alzheimer disease. However, ADAM10 regulation remains poorly understood. ADAM10 is compartmentalized into membrane microdomains formed by tetraspanins, which are a superfamily of 33 transmembrane proteins in humans that regulate clustering and trafficking of certain other transmembrane “partner” proteins. This is achieved by specific tetraspanin-partner interactions, but it is not clear which tetraspanins specifically interact with ADAM10. The aims of this study were to identify which tetraspanins interact with ADAM10 and how they regulate this metalloprotease. Co-immunoprecipitation identified specific ADAM10 interactions with Tspan5, Tspan10, Tspan14, Tspan15, Tspan17, and Tspan33/Penumbra. These are members of the largely unstudied TspanC8 subgroup of tetraspanins, all six of which promoted ADAM10 maturation. Different cell types express distinct repertoires of TspanC8 tetraspanins. Human umbilical vein endothelial cells express relatively high levels of Tspan14, the knockdown of which reduced ADAM10 surface expression and activity. Mouse erythrocytes express predominantly Tspan33, and ADAM10 expression was substantially reduced in the absence of this tetraspanin. In contrast, ADAM10 expression was normal on Tspan33-deficient mouse platelets in which Tspan14 is the major TspanC8 tetraspanin. These results define TspanC8 tetraspanins as essential regulators of ADAM10 maturation and trafficking to the cell surface. This finding has therapeutic implications because focusing on specific TspanC8-ADAM10 complexes may allow cell type- and/or substrate-specific ADAM10 targeting. PMID:23035126
Djurisic, S; Teiblum, S; Tolstrup, C K; Christiansen, O B; Hviid, T V F
2015-03-01
The HLA-G molecule is expressed on trophoblast cells at the feto-maternal interface, where it interacts with local immune cells, and upholds tolerance against the semi-allogeneic fetus. Aberrant HLA-G expression in the placenta and reduced soluble HLA-G levels are observed in pregnancy complications, partly explained by HLA-G polymorphisms which are associated with differences in the alternative splicing pattern and of the stability of HLA-G mRNA. Of special importance is a 14 bp insertion/deletion polymorphism located in the 3'-untranslated region of the HLA-G gene. In the current study, we present novel evidence for allelic imbalance of the 14 bp insertion/deletion polymorphism, using a very accurate and sensitive Digital droplet PCR technique. Allelic imbalance in heterozygous samples was observed as differential expression levels of 14 bp insertion/deletion allele-specific mRNA transcripts, which was further associated with low levels of HLA-G surface expression on primary trophoblast cells. Full gene sequencing of HLA-G allowed us to study correlations between HLA-G extended haplotypes and single-nucleotide polymorphisms and HLA-G surface expression. We found that a 1:1 expression (allelic balance) of the 14 bp insertion/deletion mRNA alleles was associated with high surface expression of HLA-G and with a specific HLA-G extended haplotype. The 14 bp del/del genotype was associated with a significantly lower abundance of the G1 mRNA isoform, and a higher abundance of the G3 mRNA isoform. Overall, the present study provides original evidence for allelic imbalance of the 14 bp insertion/deletion polymorphism, which influences HLA-G surface expression on primary trophoblast cells, considered to be important in the pathogenesis of pre-eclampsia and other pregnancy complications. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Valkova, Christina; Albrizio, Marina; Röder, Ira V; Schwake, Michael; Betto, Romeo; Rudolf, Rüdiger; Kaether, Christoph
2011-01-11
The nicotinic acetylcholine receptor of skeletal muscle is composed of five subunits that are assembled in a stepwise manner. Quality control mechanisms ensure that only fully assembled receptors reach the cell surface. Here, we show that Rer1, a putative Golgi-ER retrieval receptor, is involved in the biogenesis of acetylcholine receptors. Rer1 is expressed in the early secretory pathway in the myoblast line C2C12 and in mouse skeletal muscle, and up-regulated during myogenesis. Upon down-regulation of Rer1 in C2C12 cells, unassembled acetylcholine receptor α-subunits escape from the ER and are transported to the plasma membrane and lysosomes, where they are degraded. As a result, the amount of fully assembled receptor at the cell surface is reduced. In vivo Rer1 knockdown and genetic inactivation of one Rer1 allele lead to significantly smaller neuromuscular junctions in mice. Our data show that Rer1 is a functionally important unique factor that controls surface expression of muscle acetylcholine receptors by localizing unassembled α-subunits to the early secretory pathway.
Defective CXCR4 expression in aged bone marrow cells impairs vascular regeneration
Shao, Hongwei; Xu, Qiyuan; Wu, Qiuling; Ma, Qi; Salgueiro, Luis; Wang, Jian’An; Eton, Darwin; Webster, Keith A; Yu, Hong
2011-01-01
The chemokine stromal cell-derived factor-1 (SDF-1) plays a critical role in mobilizing precursor cells in the bone marrow and is essential for efficient vascular regeneration and repair. We recently reported that calcium augments the expression of chemokine receptor CXCR4 and enhances the angiogenic potential of bone marrow derived cells (BMCs). Neovascularization is impaired by aging therefore we suggested that aging may cause defects of CXCR4 expression and cellular responses to calcium. Indeed we found that both the basal and calcium-induced surface expression of CXCR4 on BMCs was significantly reduced in 25-month-old mice compared with 2-month-old mice. Reduced Ca-induced CXCR4 expression in BMC from aged mice was associated with defective calcium influx. Diminished CXCR4 surface expression in BMC from aged mice correlated with diminished neovascularization in an ischemic hindlimb model with less accumulation of CD34+ progenitor cells in the ischemic muscle with or without local overexpression of SDF-1. Intravenous injection of BMCs from old mice homed less efficiently to ischemic muscle and stimulated significantly less neovascularization compared with the BMCs from young mice. Transplantation of old BMCs into young mice did not reconstitute CXCR4 functions suggesting that the defects were not reversible by changing the environment. We conclude that defects of basal and calcium-regulated functions of the CXCR4/SDF-1 axis in BMCs contribute significantly to the age-related loss of vasculogenic responses. PMID:21143386
Becky L. Estes; Eric E. Knapp; Carl N. Skinner; Fabian C. C. Uzoh
2012-01-01
Reducing stand density is often used as a tool for mitigating the risk of high-intensity crown fires. However, concern has been expressed that opening stands might lead to greater drying of surface fuels, contributing to increased fire risk. The objective of this study was to determine whether woody fuel moisture differed between unthinned and thinned mixed-conifer...
Rotmann, Alexander; Vékony, Nicole; Gassner, Davina; Niegisch, Günter; Strand, Dennis; Martiné, Ursula; Closs, Ellen I.
2005-01-01
We have previously shown that activation of PKC (protein kinase C) results in internalization of hCAT-1 [human CAT-1 (cationic amino acid transporter 1)] and a decrease in arginine transport [Rotmann, Strand, Martiné and Closs (2004) J. Biol. Chem. 279, 54185–54192]. However, others found increased transport rates for arginine in response to PKC activation, suggesting a differential effect of PKC on different CAT isoforms. Therefore we investigated the effect of PKC on hCAT-3, an isoform expressed in thymus, brain, ovary, uterus and mammary gland. In Xenopus laevis oocytes and human U373MG glioblastoma cells, hCAT-3-mediated L-arginine transport was significantly reduced upon treatment with compounds that activate classical PKC. In contrast, inactive phorbol esters and an activator of novel PKC isoforms had no effect. PKC inhibitors (including the PKCα-preferring Ro 31-8280) reduced the inhibitory effect of the PKC-activating compounds. Microscopic analyses revealed a PMA-induced reduction in the cell-surface expression of fusion proteins between hCAT-3 and enhanced green fluorescent protein expressed in X. laevis oocytes and glioblastoma cells. Western-blot analysis of biotinylated surface proteins demonstrated a PMA-induced decrease in hCAT-3 in the plasma membrane, but not in total protein lysates. Pretreatment with a PKC inhibitor also reduced this PMA effect. It is concluded that similar to hCAT-1, hCAT-3 activity is decreased by PKC via reduction of transporter molecules in the plasma membrane. Classical PKC isoforms seem to be responsible for this effect. PMID:16332251
Flow cytometric single cell analysis reveals heterogeneity between adipose depots
Boumelhem, Badwi B.; Assinder, Stephen J.; Bell-Anderson, Kim S.; Fraser, Stuart T.
2017-01-01
ABSTRACT Understanding adipose tissue heterogeneity is hindered by the paucity of methods to analyze mature adipocytes at the single cell level. Here, we report a system for analyzing live adipocytes from different adipose depots in the adult mouse. Single cell suspensions of buoyant adipocytes were separated from the stromal vascular fraction and analyzed by flow cytometry. Compared to other lipophilic dyes, Nile Red uptake effectively distinguished adipocyte populations. Nile Red fluorescence increased with adipocyte size and granularity and could be combined with MitoTracker® Deep Red or fluorescent antibody labeling to further dissect adipose populations. Epicardial adipocytes exhibited the least mitochondrial membrane depolarization and highest fatty-acid translocase CD36 surface expression. In contrast, brown adipocytes showed low surface CD36 expression. Pregnancy resulted in reduced mitochondrial membrane depolarisation and increased CD36 surface expression in brown and epicardial adipocyte populations respectively. Our protocol revealed unreported heterogeneity between adipose depots and highlights the utility of flow cytometry for screening adipocytes at the single cell level. PMID:28453382
Chu, Khim Hoong
2017-11-09
Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6 cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.
Effect of sialic acid loss on dendritic cell maturation
Crespo, Hélio J; Guadalupe Cabral, M; Teixeira, Alexandra V; Lau, Joseph T Y; Trindade, Hélder; Videira, Paula A
2009-01-01
Sialic acids are key structural determinants and contribute to the functionality of a number of immune cell receptors. Previously, we demonstrated that differentiation of human dendritic cells (DCs) is accompanied by an increased expression of sialylated cell surface structures, putatively through the activity of the ST3Gal.I and ST6Gal.I sialyltransferases. Furthermore, DC endocytosis was reduced upon removal of the cell surface sialic acid residues by neuraminidase. In the present work, we evaluate the contribution of the sialic acid modifications in DC maturation. We demonstrate that neuraminidase-treated human DCs have increased expression of major histocompatibility complex (MHC) and costimulatory molecules, increased gene expression of specific cytokines and induce a higher proliferative response of T lymphocytes. Together, the data suggest that clearance of cell surface sialic acids contributes to the development of a T helper type 1 proinflammatory response. This postulate is supported by mouse models, where elevated MHC class II and increased maturation of specific DC subsets were observed in DCs harvested from ST3Gal.I−/− and ST6Gal.I−/− mice. Moreover, important qualitative differences, particularly in the extent of reduced endocytosis and in the peripheral distribution of DC subsets, existed between the ST3Gal.I−/− and ST6Gal.I−/− strains. Together, the data strongly suggest not only a role of cell surface sialic acid modifications in maturation and functionality of DCs, but also that the sialic acid linkages created by different sialyltransferases are functionally distinct. Consequently, with particular relevance to DC-based therapies, cell surface sialylation, mediated by individual sialyltransferases, can influence the immunogenicity of DCs upon antigen loading. PMID:19740323
Clift, Ian C.; Bamidele, Adebowale O.; Rodriguez-Ramirez, Christie; Kremer, Kimberly N.
2014-01-01
CXC chemokine receptor 4 (CXCR4) is a G protein–coupled receptor (GPCR) located on the cell surface that signals upon binding the chemokine stromal derived factor-1 (SDF-1; also called CXCL 12). CXCR4 promotes neuroblastoma proliferation and chemotaxis. CXCR4 expression negatively correlates with prognosis and drives neuroblastoma growth and metastasis in mouse models. All functions of CXCR4 require its expression on the cell surface, yet the molecular mechanisms that regulate CXCR4 cell-surface levels in neuroblastoma are poorly understood. We characterized CXCR4 cell-surface regulation in the related SH-SY5Y and SK-N-SH human neuroblastoma cell lines. SDF-1 treatment caused rapid down-modulation of CXCR4 in SH-SY5Y cells. Pharmacologic activation of protein kinase C similarly reduced CXCR4, but via a distinct mechanism. Analysis of CXCR4 mutants delineated two CXCR4 regions required for SDF-1 treatment to decrease cell-surface CXCR4 in neuroblastoma cells: the isoleucine-leucine motif at residues 328 and 329 and residues 343–352. In contrast, and unlike CXCR4 regulation in other cell types, serines 324, 325, 338, and 339 were not required. Arrestin proteins can bind and regulate GPCR cell-surface expression, often functioning together with kinases such as G protein–coupled receptor kinase 2 (GRK2). Using SK-N-SH cells which are naturally deficient in β-arrestin1, we showed that β-arrestin1 is required for the CXCR4 343–352 region to modulate CXCR4 cell-surface expression following treatment with SDF-1. Moreover, GRK2 overexpression enhanced CXCR4 internalization, via a mechanism requiring both β-arrestin1 expression and the 343–352 region. Together, these results characterize CXCR4 structural domains and β-arrestin1 as critical regulators of CXCR4 cell-surface expression in neuroblastoma. β-Arrestin1 levels may therefore influence the CXCR4-driven metastasis of neuroblastoma as well as prognosis. PMID:24452472
Wilcz-Villega, E; McClean, S; O'Sullivan, M
2014-03-01
Increased intestinal permeability and altered expression of tight junction (TJ) proteins may be implicated in the pathogenesis of irritable bowel syndrome (IBS). This study aimed to investigate the expression of adherens junction (AJ) protein E-cadherin and TJ proteins zonula occludens (ZO)-1 and claudin (CLD)-1 and associations with IBS symptoms. Junctional proteins were immunostained in cecal biopsy tissue of Rome II IBS patients (n = 34) comprising both alternating (IBS-A) and diarrhea predominant (IBS-D) subtypes, and controls (n = 12). IBS symptom duration, abdominal pain severity and stool frequency were assessed for IBS patients. Protein expression was determined by immunofluorescence. E-cadherin and ZO-1 protein expression was significantly lower (p = 0.03 and p = 0.016, respectively) in the cecal surface epithelium of the IBS group comprising both IBS-A and IBS-D subtypes. CLD-1 expression was not significantly altered compared with controls. On subtype analysis, ZO-1 expression was significantly reduced in both IBS-A and IBS-D compared with controls, whereas E-cadherin was reduced only in IBS-A. Lower E-cadherin expression was associated with longer symptoms duration specifically in IBS-A patients (rs = -0.76, p = 0.004). Reduced E-cadherin associated with abdominal pain severity in the overall IBS group (rs = -0.36, p = 0.041), but this association was unrelated to IBS subtype. E-cadherin protein expression in the cecum was significantly lower in IBS-A compared with controls and associated with longstanding symptoms. E-cadherin was further associated with abdominal pain severity in the IBS group overall, but unrelated to IBS subtype. Altered E-cadherin expression may provide novel insights into mechanisms underlying intestinal barrier dysfunction in IBS. © 2013 John Wiley & Sons Ltd.
Oliveira, Simone Santiago Carvalho de; Gonçalves, Diego de Souza; Garcia-Gomes, Aline Dos Santos; Gonçalves, Inês Correa; Seabra, Sergio Henrique; Menna-Barreto, Rubem Figueiredo; Lopes, Angela Hampshire de Carvalho Santos; D'Avila-Levy, Claudia Masini; Santos, André Luis Souza Dos; Branquinha, Marta Helena
2017-01-01
A pleiotropic response to the calpain inhibitor MDL28170 was detected in the tomato parasite Phytomonas serpens. Ultrastructural studies revealed that MDL28170 caused mitochondrial swelling, shortening of flagellum and disruption of trans Golgi network. This effect was correlated to the inhibition in processing of cruzipain-like molecules, which presented an increase in expression paralleled by decreased proteolytic activity. Concomitantly, a calcium-dependent cysteine peptidase was detected in the parasite extract, the activity of which was repressed by pre-incubation of parasites with MDL28170. Flow cytometry and Western blotting analyses revealed the differential expression of calpain-like proteins (CALPs) in response to the pre-incubation of parasites with the MDL28170, and confocal fluorescence microscopy confirmed their surface location. The interaction of promastigotes with explanted salivary glands of the insect Oncopeltus fasciatus was reduced when parasites were pre-treated with MDL28170, which was correlated to reduced levels of surface cruzipain-like and gp63-like molecules. Treatment of parasites with anti-Drosophila melanogaster (Dm) calpain antibody also decreased the adhesion process. Additionally, parasites recovered from the interaction process presented higher levels of surface cruzipain-like and gp63-like molecules, with similar levels of CALPs cross-reactive to anti-Dm-calpain antibody. The results confirm the importance of exploring the use of calpain inhibitors in studying parasites' physiology.
de Oliveira, Simone Santiago Carvalho; Gonçalves, Diego de Souza; Garcia-Gomes, Aline dos Santos; Gonçalves, Inês Correa; Seabra, Sergio Henrique; Menna-Barreto, Rubem Figueiredo; Lopes, Angela Hampshire de Carvalho Santos; D’Avila-Levy, Claudia Masini; dos Santos, André Luis Souza; Branquinha, Marta Helena
2016-01-01
A pleiotropic response to the calpain inhibitor MDL28170 was detected in the tomato parasite Phytomonas serpens. Ultrastructural studies revealed that MDL28170 caused mitochondrial swelling, shortening of flagellum and disruption of trans Golgi network. This effect was correlated to the inhibition in processing of cruzipain-like molecules, which presented an increase in expression paralleled by decreased proteolytic activity. Concomitantly, a calcium-dependent cysteine peptidase was detected in the parasite extract, the activity of which was repressed by pre-incubation of parasites with MDL28170. Flow cytometry and Western blotting analyses revealed the differential expression of calpain-like proteins (CALPs) in response to the pre-incubation of parasites with the MDL28170, and confocal fluorescence microscopy confirmed their surface location. The interaction of promastigotes with explanted salivary glands of the insect Oncopeltus fasciatus was reduced when parasites were pre-treated with MDL28170, which was correlated to reduced levels of surface cruzipain-like and gp63-like molecules. Treatment of parasites with anti-Drosophila melanogaster (Dm) calpain antibody also decreased the adhesion process. Additionally, parasites recovered from the interaction process presented higher levels of surface cruzipain-like and gp63-like molecules, with similar levels of CALPs cross-reactive to anti-Dm-calpain antibody. The results confirm the importance of exploring the use of calpain inhibitors in studying parasites’ physiology. PMID:27925020
Annamalai, Balasubramaniam; Mannangatti, Padmanabhan; Arapulisamy, Obulakshmi; Shippenberg, Toni S.; Jayanthi, Lankupalle D.
2012-01-01
The serotonin (5-HT) transporter (SERT) regulates serotoninergic neurotransmission by clearing 5-HT released into the synaptic space. Phosphorylation of SERT on serine and threonine mediates SERT regulation. Whether tyrosine phosphorylation regulates SERT is unknown. Here, we tested the hypothesis that tyrosine-phosphorylation of SERT regulates 5-HT transport. In support of this, alkali-resistant 32P-labeled SERT was found in rat platelets, and Src-tyrosine kinase inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo [3,4,d]pyrimidine (PP2) decreased platelet SERT function and expression. In human placental trophoblast cells expressing SERT, PP2 reduced transporter function, expression, and stability. Although siRNA silencing of Src expression decreased SERT function and expression, coexpression of Src resulted in PP2-sensitive increases in SERT function and expression. PP2 treatment markedly decreased SERT protein stability. Compared with WT-SERT, SERT tyrosine mutants Y47F and Y142F exhibited reduced 5-HT transport despite their higher total and cell surface expression levels. Moreover, Src-coexpression increased total and cell surface expression of Y47F and Y142F SERT mutants without affecting their 5-HT transport capacity. It is noteworthy that Y47F and Y142F mutants exhibited higher protein stability compared with WT-SERT. However, similar to WT-SERT, PP2 treatment decreased the stability of Y47F and Y142F mutants. Furthermore, compared with WT-SERT, Y47F and Y142F mutants exhibited lower basal tyrosine phosphorylation and no further enhancement of tyrosine phosphorylation in response to Src coexpression. These results provide the first evidence that SERT tyrosine phosphorylation supports transporter protein stability and 5HT transport. PMID:21992875
Xiao, Yan; Chen, Xianzhong; Shen, Wei; Yang, Haiquan; Fan, You
2015-12-01
Production of bioethanol using starch as raw material has become a very prominent technology. However, phytate in the raw material not only decreases ethanol production efficiency, but also increases phosphorus discharge. In this study, to decrease phytate content in an ethanol fermentationprocess, Saccharomyces cerevisiae was engineered forheterologous expression of phytase on the cell surface. The phy gene encoding phytase gene was fused with the C-terminal-half region of α-agglutinin and then inserted downstream of the secretion signal gene, to produce a yeast surface-display expression vector pMGK-AG-phy, which was then transformed into S. cerevisiae. The recombinant yeast strain, PHY, successfully displayed phytase on the surface of cells producing 6.4 U/g wet cells and its properties were further characterized. The growthrate and ethanol production of the PHY strain were faster than the parent S. cerevisiae strain in the fermentation medium by simultaneous saccharification and fermentation. Moreover, the phytate concentration decreased by 91% in dry vinasse compared to the control. In summary, we constructed recombinant S. cerevisiae strain displaying phytase on the cell surface, which could effectively reduce the content of phytate, improve the utilization value of vinasse and reduce the discharge of phosphorus. The strain reported here represents a useful novel engineering platform for developing an environment-friendly system for bioethanol production from a corn substrate.
Zara, Giacomo; Budroni, Marilena; Mannazzu, Ilaria; Zara, Severino
2011-12-01
Air-liquid biofilm formation appears to be an adaptive mechanism that promotes foraging of Saccharomyces cerevisiae flor strains in response to nutrient starvation. The FLO11 gene plays a central role in this phenotype as its expression allows yeast cells to rise to the liquid surface. Here, we investigated the role of ammonium depletion in air-liquid biofilm formation and FLO11 expression in a S. cerevisiae flor strain. The data obtained show that increasing ammonium concentrations from 0 to 450 m m reduce air-liquid biofilm in terms of biomass and velum formation and correlate with a reduction of FLO11 expression. Rapamycin inhibition of the TOR pathway and deletion of RAS2 gene significantly reduced biofilm formation and FLO11 expression. Taken together, these data suggest that ammonium depletion is a key factor in the induction of air-liquid biofilm formation and FLO11 expression in S. cerevisiae flor strains. Copyright © 2011 John Wiley & Sons, Ltd.
NASA Astrophysics Data System (ADS)
Li, Kai; Hu, Dandan; Xie, Youtao; Huang, Liping; Zheng, Xuebin
2018-02-01
Biomedical coatings for orthopedic implants should facilitate osseointegration and mitigate implant-induced inflammatory reactions. In our study, Ca-Si coatings with Sr-containing nanowire-like structures (NW-Sr-CS) were achieved via hydrothermal treatment. In order to identify the effect of nanowire-like topography and Sr dopant on the biological properties of Ca-Si-based coatings, the original Ca-Si coating, Ca-Si coatings modified with nanoplate (NP-CS) and similar nanowire-like structure (NW-CS) were fabricated as the control. Surface morphology, phase composition, surface area, zeta potential and ion release of these coatings were characterized. The in vitro osteogenic activities and immunomodulatory properties were evaluated with bone marrow stromal cells (BMSCs) and RAW 264.7 cells, a mouse macrophage cell line. Compared with the CS and NP-CS coatings, the NW-CS coating possessed a larger surface area and pore volume, beneficial protein adsorption, up-regulated the expression levels of integrin β1, Vinculin and focal adhesion kinase and promoted cell spreading. Furthermore, the NW-CS coating significantly enhanced the osteogenic differentiation and mineralization as indicated by the up-regulation of ALP activity, mineralized nodule formation and osteoblastogenesis-related gene expression. With the introduction of Sr, the NW-Sr-CS coatings exerted a greater effect on the BMSC proliferation rate, calcium sensitive receptor gene expression as well as PKC and ERK1/2 phosphorylation. In addition, the Sr-doped coatings significantly up-regulated the ratio of OPG/RANKL in the BMSCs. The NW-Sr-CS coatings could modulate the polarization of macrophages towards the wound-healing M2 phenotype, reduce the mRNA expression levels of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) and enhance anti-inflammatory cytokines (IL-1ra, IL-10). The Sr-doped nanowire modification may be a valuable approach to enhance osteogenic activities and reduce inflammatory reactions.
Expression of the degree of polarization based on the geometrical optics pBRDF model.
Wang, Kai; Zhu, Jingping; Liu, Hong; Du, Bingzheng
2017-02-01
An expression of the degree of polarization (DOP) based on the geometrical optics polarimetric bidirectional reflectance distribution function model is presented. In this expression, the DOP is related to the surface roughness and decreases at different reflection angles because diffuse reflection is taken into consideration. A shadowing/masking function introduced into the specular reflection expression makes the DOP values decrease as the angle of incidence or observation approaches grazing. Different kinds of materials were measured to validate the accuracy of this DOP expression. The measured results suggest that the errors of the DOP are reduced significantly, and the polarized reflection characteristics can be described more reasonably and accurately.
Tonkin-Hill, Gerry Q.; Trianty, Leily; Noviyanti, Rintis; Nguyen, Hanh H. T.; Sebayang, Boni F.; Lampah, Daniel A.; Marfurt, Jutta; Cobbold, Simon A.; Rambhatla, Janavi S.; McConville, Malcolm J.; Rogerson, Stephen J.; Brown, Graham V.; Day, Karen P.; Price, Ric N.; Anstey, Nicholas M.
2018-01-01
Within the human host, the malaria parasite Plasmodium falciparum is exposed to multiple selection pressures. The host environment changes dramatically in severe malaria, but the extent to which the parasite responds to—or is selected by—this environment remains unclear. From previous studies, the parasites that cause severe malaria appear to increase expression of a restricted but poorly defined subset of the PfEMP1 variant, surface antigens. PfEMP1s are major targets of protective immunity. Here, we used RNA sequencing (RNAseq) to analyse gene expression in 44 parasite isolates that caused severe and uncomplicated malaria in Papuan patients. The transcriptomes of 19 parasite isolates associated with severe malaria indicated that these parasites had decreased glycolysis without activation of compensatory pathways; altered chromatin structure and probably transcriptional regulation through decreased histone methylation; reduced surface expression of PfEMP1; and down-regulated expression of multiple chaperone proteins. Our RNAseq also identified novel associations between disease severity and PfEMP1 transcripts, domains, and smaller sequence segments and also confirmed all previously reported associations between expressed PfEMP1 sequences and severe disease. These findings will inform efforts to identify vaccine targets for severe malaria and also indicate how parasites adapt to—or are selected by—the host environment in severe malaria. PMID:29529020
Tang, Fen; Jiang, Zhentao; Tan, Wenting; Long, Junrong; Liu, Shengquan; Chu, Chun
2017-08-28
To observe the effects of Shexiang Baoxin Pill (SBP) on isoprenaline (Iso)-induced changes in myocardial cell volume, shape, and connexin 43 (Cx43) expression. Methods: H9C2 myocardial cells were randomly divided into a control group, a Iso group and a Iso+SBP group. After 72 h of culture, the average surface area of H9C2 cells was measured under phase contrast microscope. Bicinchoninic acid (BCA) protein assay was carried out to determine the concentration of proteins. The survival rate of myocardial cells was measured by methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay, and the Cx43 expression was detected by Western blot. Results: The mean surface area and Cx43 concentration in Iso-treated myocardial cells were increased under the phase contrast microscope (P<0.05). Compared with the Iso group, the mean surface area was decreased, and the Cx43 concentration was reduced in the Iso+SBP group (both P<0.05). Compared with the control group, the Cx43 expression was obviously down-regulated in the H9C2 cells of the Iso group (P<0.05); while compared with the Iso group, the Cx43 expression was obviously up-regulated in the Iso+SBP group (P<0.05). Conclusion: Shexiang Baoxin Pills can prevent Iso-induced myocardial hypertrophy and down-regulate Cx43 expression.
Kochi, Shinsuke; Yamashiro, Keisuke; Hongo, Shoichi; Yamamoto, Tadashi; Ugawa, Yuki; Shimoe, Masayuki; Kawamura, Mari; Hirata-Yoshihara, Chiaki; Ideguchi, Hidetaka; Maeda, Hiroshi; Takashiba, Shogo
2017-12-01
Gingival epithelial cells form a physiological barrier against bacterial invasion. Excessive bacterial invasion destroys the attachment between the tooth surface and the epithelium, resulting in periodontitis. Integrins play a significant role in cell attachment; therefore, we hypothesized that bacterial infection might decrease the expressions of these integrins in gingival epithelial cells, resulting in reduced cell adhesion. Immortalized human gingival epithelial cells were co-cultured with Aggregatibacter actinomycetemcomitans Y4 (Aa Y4), and the gene expression levels of IL-8, proliferating cell nuclear antigen (PCNA), and integrins (α2, α3, α5, β4, and β6) were measured using quantitative reverse transcription polymerase chain reaction. Expression of PCNA and integrins, except integrin α5, was significantly downregulated, while expression of IL-8 and integrin α5 was significantly upregulated in the cells co-cultured with Aa Y4. The number of adherent cells significantly decreased when co-cultured with Aa Y4, as determined using cell adhesion assays. In the cells co-cultured with Aa Y4 and an integrin α5 neutralizing antibody, there was no effect on the expression of IL-8 and PCNA, while the expressions of integrins α2, α3, β4, and β6, and the number of adherent cells did not decrease. The number of invading bacteria in the cells was reduced in the presence of the antibody and increased in the presence of TLR2/4 inhibitor. Therefore, integrin α5 might be involved in Aa Y4 invasion into gingival epithelial cells, and the resulting signal transduction cascade reduces cell adhesion by decreasing the expression of integrins, while the TLR2/4 signaling cascade regulates IL-8 expression.
WAIF1 Is a Cell-Surface CTHRC1 Binding Protein Coupling Bone Resorption and Formation.
Matsuoka, Kazuhiko; Kohara, Yukihiro; Naoe, Yoshinori; Watanabe, Atsushi; Ito, Masako; Ikeda, Kyoji; Takeshita, Sunao
2018-04-06
The osteoclast-derived collagen triple helix repeat containing 1 (CTHRC1) protein stimulates osteoblast differentiation, but the underlying mechanism remains unclear. Here, we identified Wnt-activated inhibitory factor 1 (WAIF1)/5T4 as a cell-surface protein binding CTHRC1. The WAIF1-encoding Trophoblast glycoprotein (Tpbg) gene, which is abundantly expressed in the brain and bone but not in other tissues, showed the same expression pattern as Cthrc1. Tpbg downregulation in marrow stromal cells reduced CTHRC1 binding and CTHRC1-stimulated alkaline phosphatase activity through PKCδ activation of MEK/ERK, suggesting a novel WAIF1/PKCδ/ERK pathway triggered by CTHRC1. Unexpectedly, osteoblast lineage-specific deletion of Tpbg downregulated Rankl expression in mouse bones and reduced both bone formation and resorption; importantly, it impaired bone mass recovery following RANKL-induced resorption, reproducing the phenotype of osteoclast-specific Cthrc1 deficiency. Thus, the binding of osteoclast-derived CTHRC1 to WAIF1 in stromal cells activates PKCδ-ERK osteoblastogenic signaling and serves as a key molecular link between bone resorption and formation during bone remodeling. © 2018 American Society for Bone and Mineral Research. © 2018 American Society for Bone and Mineral Research.
Epithelial heparan sulfate regulates Sonic Hedgehog signaling in lung development.
He, Hua; Huang, Meina; Sun, Shenfei; Wu, Yihui; Lin, Xinhua
2017-08-01
The tree-like structure of the mammalian lung is generated from branching morphogenesis, a reiterative process that is precisely regulated by numerous factors. How the cell surface and extra cellular matrix (ECM) molecules regulate this process is still poorly understood. Herein, we show that epithelial deletion of Heparan Sulfate (HS) synthetase Ext1 resulted in expanded branching tips and reduced branching number, associated with several mesenchymal developmental defects. We further demonstrate an expanded Fgf10 expression and increased FGF signaling activity in Ext1 mutant lungs, suggesting a cell non-autonomous mechanism. Consistent with this, we observed reduced levels of SHH signaling which is responsible for suppressing Fgf10 expression. Moreover, reactivating SHH signaling in mutant lungs rescued the tip dilation phenotype and attenuated FGF signaling. Importantly, the reduced SHH signaling activity did not appear to be caused by decreased Shh expression or protein stability; instead, biologically active form of SHH proteins were reduced in both the Ext1 mutant epithelium and surrounding wild type mesenchymal cells. Together, our study highlights the epithelial HS as a key player for dictating SHH signaling critical for lung morphogenesis.
2015-01-01
The regulation of surface levels of protein is critical for proper cell function and influences properties including cell adhesion, ion channel contributions to current flux, and the sensitivity of surface receptors to ligands. Here we demonstrate a two-color labeling system in live cells using a single fluorogen activating peptide (FAP) based fusion tag, which enables the rapid and simultaneous quantification of surface and internal proteins. In the nervous system, BK channels can regulate neural excitability and neurotransmitter release, and the surface trafficking of BK channels can be modulated by signaling cascades and assembly with accessory proteins. Using this labeling approach, we examine the dynamics of BK channel surface expression in HEK293 cells. Surface pools of the pore-forming BKα subunit were stable, exhibiting a plasma membrane half-life of >10 h. Long-term activation of adenylyl cyclase by forskolin reduced BKα surface levels by 30%, an effect that could not be attributed to increased bulk endocytosis of plasma membrane proteins. This labeling approach is compatible with microscopic imaging and flow cytometry, providing a solid platform for examining protein trafficking in living cells. PMID:26301573
Li, Fang; Weir, Michael D.; Chen, Jihua; Xu, Hockin H. K.
2013-01-01
Objective Antibacterial primer and adhesive are promising to help combat biofilms and recurrent caries. The objectives of this study were to compare novel bonding agent containing quaternary ammonium dimethacrylate (QADM) with bonding agent containing nanoparticles of silver (NAg) in antibacterial activity, contact-inhibition vs. long-distance inhibition, glucosyltransferases (gtf) gene expressions, and cytotoxicity for the first time. Methods QADM and NAg were incorporated into Scotchbond Multi-Purpose adhesive and primer. Microtensile dentin bond strength was measured. Streptococcus mutans (S. mutans) biofilm on resin surface (contact-inhibition) as well as S. mutans in culture medium away from the resin surface (long-distance inhibition) were tested for metabolic activity, colony-forming units (CFU), lactic acid production, and gtf gene expressions. Eluents from cured primer/adhesive samples were used to examine cytotoxicity against human gingival fibroblasts. Results Bonding agent with QADM greatly reduced CFU and lactic acid of biofilms on the resin surface (p < 0.05), while having no effect on S. mutans in culture medium away from the resin surface. In contrast, bonding agent with NAg inhibited not only S. mutans on the resin surface, but also S. mutans in culture medium away from the resin surface. Bonding agent with QADM suppressed gtfB, gtfC and gtfD gene expressions of S. mutans on its surface, but not away from its surface. Bonding agent with NAg suppressed S. mutans gene expressions both on its surface and away from its surface. Bonding agents with QADM and NAg did not adversely affect microtensile bond strength or fibroblast cytotoxicity, compared to control (p > 0.1). Significance QADM-containing adhesive had contact-inhibition and inhibited bacteria on its surface, but not away from its surface. NAg-containing adhesive had long-distance killing capability and inhibited bacteria on its surface and away from its surface. The novel antibacterial adhesives are promising for caries-inhibition restorations, and QADM and NAg could be complimentary agents in inhibiting bacteria on resin surface as well as away from resin surface. PMID:23428077
Xu, Qiyuan; Wang, Jian’An; He, Jinlin; Zhou, Mingsheng; Adi, Jennipher; Webster, Keith A; Yu, Hong
2011-01-01
Objectives Reduced numbers and activity of circulating progenitor cells are associated with aging and have been linked with coronary artery disease. To determine the impact of aging and atherosclerotic disease on the chemotaxic activity of bone marrow derived cells (BMCs), we examined CXCR4 surface expression on BMCs from aged and atherosclerotic mice. Methods CXCR4 expression and cellular mobility were compared between BMCs of young (6-week old) ApoE null mice (ApoE−/−) and aged ApoE−/− mice that had been fed with a high-fat, high-cholesterol diet for 6-months. Results Age and atherosclerosis correlated with significantly lower surface expression of CXCR4 that was less inducible by calcium. The impaired calcium response was associated with defective calcium influx and was partially recovered by treatment with the calcium ionophore ionomycin. ApoE−/− mice fed high fat diet for 6-months had defective CXCR4 expression and SDF-1 regulation that is equivalent to that of 24-month old wild type mice. BMCs from aged, atherogenic ApoE−/− mice also displayed defective homing to SDF-1, and the animals had lower serum and bone marrow levels of SDF-1. Conclusion Evolution of atherosclerosis in ApoE−/− mice is paralleled by progressive loss of mobility of BMCs with reductions of CXCR4 expression, and reduced levels of SDF-1 in both serum and bone marrow. These changes mute the homing capability of BMCs and may contribute to the progression of atherosclerosis in this model. PMID:21855069
Goel, C; Kalra, N; Dwarakanath, B S; Gaur, S N; Arora, N
2015-05-01
Serine protease activity of Per a 10 from Periplaneta americana modulates dendritic cell (DC) functions by a mechanism(s) that remains unclear. In the present study, Per a 10 protease activity on CD40 expression and downstream signalling was evaluated in DCs. Monocyte-derived DCs from cockroach-allergic patients were treated with proteolytically active/heat-inactivated Per a 10. Stimulation with active Per a 10 demonstrated low CD40 expression on DCs surface (P < 0·05), while enhanced soluble CD40 level in the culture supernatant (P < 0·05) compared to the heat-inactivated Per a 10, suggesting cleavage of CD40. Per a 10 activity reduced the interleukin (IL)-12 and interferon (IFN)-γ secretion by DCs (P < 0·05) compared to heat-inactivated Per a 10, indicating that low CD40 expression is associated with low levels of IL-12 secretion. Active Per a 10 stimulation caused low nuclear factor-kappa B (NF-κB) activation in DCs compared to heat-inactivated Per a 10. Inhibition of the NF-κB pathway suppressed the CD40 expression and IL-12 secretion by DCs, further indicating that NF-κB is required for CD40 up-regulation. CD40 expression activated the tumour necrosis factor (TNF) receptor-associated factor 6 (TRAF6), thereby suggesting its involvement in NF-κB activation. Protease activity of Per a 10 induced p38 mitogen-activated protein kinase (MAPK) activation that showed no significant effect on CD40 expression by DCs. However, inhibiting p38 MAPK or NF-κB suppressed the secretion of IL-12, IFN-γ, IL-6 and TNF-α by DCs. Such DCs further reduced the secretion of IL-4, IL-6, IL-12 and TNF-α by CD4(+) T cells. In conclusion, protease activity of Per a 10 reduces CD40 expression on DCs. CD40 down-regulation leads to low NF-κB levels, thereby modulating DC-mediated immune responses. © 2014 British Society for Immunology.
Goel, C; Kalra, N; Dwarakanath, B S; Gaur, S N; Arora, N
2015-01-01
Serine protease activity of Per a 10 from Periplaneta americana modulates dendritic cell (DC) functions by a mechanism(s) that remains unclear. In the present study, Per a 10 protease activity on CD40 expression and downstream signalling was evaluated in DCs. Monocyte-derived DCs from cockroach-allergic patients were treated with proteolytically active/heat-inactivated Per a 10. Stimulation with active Per a 10 demonstrated low CD40 expression on DCs surface (P < 0·05), while enhanced soluble CD40 level in the culture supernatant (P < 0·05) compared to the heat-inactivated Per a 10, suggesting cleavage of CD40. Per a 10 activity reduced the interleukin (IL)-12 and interferon (IFN)-γ secretion by DCs (P < 0·05) compared to heat-inactivated Per a 10, indicating that low CD40 expression is associated with low levels of IL-12 secretion. Active Per a 10 stimulation caused low nuclear factor-kappa B (NF-κB) activation in DCs compared to heat-inactivated Per a 10. Inhibition of the NF-κB pathway suppressed the CD40 expression and IL-12 secretion by DCs, further indicating that NF-κB is required for CD40 up-regulation. CD40 expression activated the tumour necrosis factor (TNF) receptor-associated factor 6 (TRAF6), thereby suggesting its involvement in NF-κB activation. Protease activity of Per a 10 induced p38 mitogen-activated protein kinase (MAPK) activation that showed no significant effect on CD40 expression by DCs. However, inhibiting p38 MAPK or NF-κB suppressed the secretion of IL-12, IFN-γ, IL-6 and TNF-α by DCs. Such DCs further reduced the secretion of IL-4, IL-6, IL-12 and TNF-α by CD4+ T cells. In conclusion, protease activity of Per a 10 reduces CD40 expression on DCs. CD40 down-regulation leads to low NF-κB levels, thereby modulating DC-mediated immune responses. PMID:25492061
Futrega, Kathryn; Yu, Jianshi; Jones, Jace W; Kane, Maureen A; Lott, William B; Atkinson, Kerry; Doran, Michael R
2016-04-21
Polydimethylsiloxane (PDMS) is the most commonly used material in the manufacture of customized cell culture devices. While there is concern that uncured PDMS oligomers may leach into culture medium and/or hydrophobic molecules may be absorbed into PDMS structures, there is no consensus on how or if PDMS influences cell behaviour. We observed that human umbilical cord blood (CB)-derived CD34(+) cells expanded in standard culture medium on PDMS exhibit reduced CD38 surface expression, relative to cells cultured on tissue culture polystyrene (TCP). All-trans retinoic acid (ATRA) induces CD38 expression, and we reasoned that this hydrophobic molecule might be absorbed by PDMS. Through a series of experiments we demonstrated that ATRA-mediated CD38 expression was attenuated when cultures were maintained on PDMS. Medium pre-incubated on PDMS for extended durations resulted in a time-dependant reduction of ATRA in the medium and increasingly attenuated CD38 expression. This indicated a time-dependent absorption of ATRA into the PDMS. To better understand how PDMS might generally influence cell behaviour, Ingenuity Pathway Analysis (IPA) was used to identify potential upstream regulators. This analysis was performed for differentially expressed genes in primary cells including CD34(+) haematopoietic progenitor cells, mesenchymal stromal cells (MSC), and keratinocytes, and cell lines including prostate cancer epithelial cells (LNCaP), breast cancer epithelial cells (MCF-7), and myeloid leukaemia cells (KG1a). IPA predicted that the most likely common upstream regulator of perturbed pathways was ATRA. We demonstrate here that ATRA is absorbed by PDMS in a time-dependent manner and results in the concomitant reduced expression of CD38 on the cell surface of CB-derived CD34(+) cells.
Simion, Viorel; Constantinescu, Cristina Ana; Stan, Daniela; Deleanu, Mariana; Tucureanu, Monica Madalina; Butoi, Elena; Manduteanu, Ileana; Simionescu, Maya
2016-01-01
Inflammation is a common process associated with numerous vascular pathologies. We hypothesized that targeting the inflamed endothelium by coupling a peptide with high affinity for P-selectin to the surface of dexamethasone-loaded lipid nanoemulsions will highly increase their specific binding to activated endothelial cells (EC) and reduce the cell activation. We developed and characterized dexamethasone-loaded lipid nanoemulsions directed towards P-selectin (PLN-Dex) and monitored their anti-inflammatory effects in vitro using cultured EC (EA.hy926 cells) and in vivo using a mouse model of acute inflammation [lipopolysaccharides (LPS) intravenously administered in C57BL/6 mice]. We found that PLN-Dex bound specifically to the surface of activated EC are efficiently internalized by EC and reduced the expression of proinflammatory genes, thus preventing the monocyte adhesion and transmigration to/through activated EC. Given intravenously in mice with acute inflammation, PLN-Dex accumulated at a significant high level in the lungs (compared to nontargeted nanoemulsions) and significantly reduced mRNA expression level of key proinflammatory cytokines such as IL-1β, IL-6, and MCP-1. In conclusion, the newly developed nanoformulation, PLN-Dex, is functional in vitro and in vivo, reducing selectively the endothelium activation and the consequent monocyte infiltration and diminishing significantly the lungs' inflammation, in a mouse model of acute inflammation. PMID:27703301
Geng, Jing; Beloin, Christophe; Ghigo, Jean-Marc; Henry, Nelly
2014-01-01
Bacteria are ubiquitously distributed throughout our planet, mainly in the form of adherent communities in which cells exhibit specific traits. The mechanisms underpinning the physiological shift in surface-attached bacteria are complex, multifactorial and still partially unclear. Here we address the question of the existence of early surface sensing through implementation of a functional response to initial surface contact. For this purpose, we developed a new experimental approach enabling simultaneous monitoring of free-floating, aggregated and adherent cells via the use of dispersed surfaces as adhesive substrates and flow cytometry analysis. With this system, we analyzed, in parallel, the constitutively expressed GFP content of the cells and production of a respiration probe—a fluorescent reduced tetrazolium ion. In an Escherichia coli strain constitutively expressing curli, a major E. coli adhesin, we found that single cell surface contact induced a decrease in the cell respiration level compared to free-floating single cells present in the same sample. Moreover, we show here that cell surface contact with an artificial surface and with another cell caused reduction in respiration. We confirm the existence of a bacterial cell “sense of touch” ensuring early signalling of surface contact formation through respiration down modulation. PMID:25054429
Saghiri, Mohammad Ali; Asatourian, Armen; Gurel, Zafer; Sorenson, Christine M; Sheibani, Nader
2017-09-15
Apoptosis plays a fundamental role in appropriate tissue development and function. Although expression of Bcl-2 has been reported during tooth and submandibular gland (SMG) development, the physiological role Bcl-2 plays during these processes has not been addressed. This study was performed to evaluate the impact of Bcl-2 expression on the formation and properties of tooth hard tissue, and saliva production. Twenty-four mice (12 males and 12 females) were divided into three groups of eight (n=8): group A (Bcl-2 +/+), group B (Bcl-2 +/-), and group C (Bcl-2 -/-) and subjected to micro-CT analyses. The mineral content of first molars was analyzed by X-Ray diffraction (XRD) and scanning electron microscopy (SEM) color dot map. The surface microhardness was determined by Vickers test on labial surfaces of incisors. Saliva was collected from different groups of mice after subcutaneous injection of pilocarpine. Samples from Bcl-2 -/- mice showed significantly smaller micro-CT values, lower and poor crystallinity of hydroxyapatite (HA), and lowest surface micro hardness. SMG from Bcl-2 -/- mice showed remarkable reduction in size, consistent with reduced saliva accumulation. The absence of Bcl-2 expression in SMG did not affect the expression of other Bcl-2 family members. Thus, Bcl-2 expression influence on the formation and properties of tooth hard tissue, and saliva accumulation. Bcl-2 expression has a significant impact on the mineralogical content of enamel crystals of tooth structure. Lack of Bcl-2 expression led to impaired production of enamel ACP crystals. Copyright © 2017 Elsevier Inc. All rights reserved.
Wang, Juexin; Shen, Dingding; Xia, Geqing; Shen, Wangzhen; Macdonald, Robert L.; Xu, Dong; Kang, Jing-Qiong
2016-01-01
Mutations in GABAA receptor subunit genes are frequently associated with epilepsy, and nonsense mutations in GABRG2 are associated with several epilepsy syndromes including childhood absence epilepsy, generalized tonic clonic seizures and the epileptic encephalopathy, Dravet syndrome. The molecular basis for the phenotypic heterogeneity of mutations is unclear. Here we focused on three nonsense mutations in GABRG2 (GABRG2(R136*), GABRG2(Q390*) and GABRG2(W429*)) associated with epilepsies of different severities. Structural modeling and structure-based analysis indicated that the surface of the wild-type γ2 subunit was naturally hydrophobic, which is suitable to be buried in the cell membrane. Different mutant γ2 subunits had different stabilities and different interactions with their wild-type subunit binding partners because they adopted different conformations and had different surface hydrophobicities and different tendency to dimerize. We utilized flow cytometry and biochemical approaches in combination with lifted whole cell patch-clamp recordings. We demonstrated that the truncated subunits had no to minimal surface expression and unchanged or reduced surface expression of wild-type partnering subunits. The amplitudes of GABA-evoked currents from the mutant α1β2γ2(R136*), α1β2γ2(Q390*) and α1β2γ2(W429*) receptors were reduced compared to the currents from α1β2γ2 receptors but with differentially reduced levels. This thus suggests differential protein structure disturbances are correlated with disease severity. PMID:27762395
Elias, Camila G R; Chagas, Michel G; Souza-Gonçalves, Ana Luiza; Pascarelli, Bernardo M O; d'Avila-Levy, Claudia M; Branquinha, Marta H; Santos, André L S
2012-01-01
Phytomonas serpens synthesizes metallo- and cysteine-proteases that are related to gp63 and cruzipain, respectively, two virulence factors produced by pathogenic trypanosomatids. Here, we described the cellular distribution of gp63- and cruzipain-like molecules in P. serpens through immunocytochemistry and confocal fluorescence microscopy. Both proteases were detected in distinct cellular compartments, presenting co-localization in membrane domains and intracellular regions. Subsequently, we showed that exogenous proteins modulated the production of both protease classes, but in different ways. Regarding the metalloprotease, only fetal bovine serum (FBS) influenced the gp63 expression, reducing its surface exposition (≈30%). Conversely, the cruzipain-like molecule was differentially modulated according to the proteins: human and bovine albumins reduced its expression around 50% and 35%, respectively; mucin and FBS did not alter its production, while IgG and hemoglobin drastically enhanced its surface exposition around 7- and 11-fold, respectively. Additionally, hemoglobin induced an augmentation in the cell-associated cruzipain-like activity in a dose-dependent manner. A twofold increase of the secreted cruzipain-like protein was detected after parasite incubation with 1% hemoglobin compared to the parasites incubated in PBS-glucose. The results showed the ability of P. serpens in modulating the expression and the activity of proteolytic enzymes after exposition to exogenous proteins, with emphasis in its cruzipain-like molecules. Copyright © 2011 Elsevier Inc. All rights reserved.
Rooj, Arun K.; Liu, Zhiyong; McNicholas, Carmel M.
2015-01-01
Major plasma membrane components of the tumor cell, ion channels, and integrins play crucial roles in metastasis. Glioma cells express an amiloride-sensitive nonselective cation channel composed of acid-sensing ion channel (ASIC)-1 and epithelial Na+ channel (ENaC) α- and γ-subunits. Inhibition of this channel is associated with reduced cell migration and proliferation. Using the ASIC-1 subunit as a reporter for the channel complex, we found a physical and functional interaction between this channel and integrin-β1. Short hairpin RNA knockdown of integrin-β1 attenuated the amiloride-sensitive current, which was due to loss of surface expression of ASIC-1. In contrast, upregulation of membrane expression of integrin-β1 increased the surface expression of ASIC-1. The link between the amiloride-sensitive channel and integrin-β1 was mediated by α-actinin. Downregulation of α-actinin-1 or -4 attenuated the amiloride-sensitive current. Mutation of the putative binding site for α-actinin on the COOH terminus of ASIC-1 reduced the membrane localization of ASIC-1 and also resulted in attenuation of the amiloride-sensitive current. Our data suggest a novel interaction between the amiloride-sensitive glioma cation channel and integrin-β1, mediated by α-actinin. This interaction may form a mechanism by which channel activity can regulate glioma cell proliferation and migration. PMID:26108662
[Crisis in the valuation, emotional labor and occupational burnout among teachers of religion].
Lachowska, Bogusława; Starczewski, Karol
2015-01-01
This article presents an analysis of the relationship between the crisis of values and in the valuation, the strategy of emotional labor, and occupational burnout in the group of lay teachers of religion. In addition, the role of emotional labor as a mediator of the relationship between the crisis of values and burnout was analyzed. Three strategies of emotional labor were considered in the study: surface acting, deep acting, and expression of naturally felt emotions. The study was conducted in a group of 169 lay teachers of religion (males - 24%, females - 76%), using the Questionnaire for Investigating Crisis in Valuation developed by Oleś, the Maslach Burnout Inventory, and the Emotional Labour Scale developed by Diefendorff, Croyle and Gosserand. The crisis of values and in the valuation is an important factor responsible for occupational burnout in the group of lay teachers of religion. Surface acting and expression of naturally felt emotions mediate the relationship between crisis in the valuation and emotional exhaustion, depersonalization and lack of personal accomplishment. Surface acting increases, while the expression of naturally felt emotions decreases occupational burnout. Deep acting is not related with occupational burnout. It is justified to seek factors favoring the expression of naturally felt emotions, and also those reducing surface acting. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.
Comparison of the GHSSmooth and the Rayleigh-Rice surface scatter theories
NASA Astrophysics Data System (ADS)
Harvey, James E.; Pfisterer, Richard N.
2016-09-01
The scalar-based GHSSmooth surface scatter theory results in an expression for the BRDF in terms of the surface PSD that is very similar to that provided by the rigorous Rayleigh-Rice (RR) vector perturbation theory. However it contains correction factors for two extreme situations not shared by the RR theory: (i) large incident or scattered angles that result in some portion of the scattered radiance distribution falling outside of the unit circle in direction cosine space, and (ii) the situation where the relevant rms surface roughness, σrel, is less than the total intrinsic rms roughness of the scattering surface. Also, the RR obliquity factor has been discovered to be an approximation of the more general GHSSmooth obliquity factor due to a little-known (or long-forgotten) implicit assumption in the RR theory that the surface autocovariance length is longer than the wavelength of the scattered radiation. This assumption allowed retaining only quadratic terms and lower in the series expansion for the cosine function, and results in reducing the validity of RR predictions for scattering angles greater than 60°. This inaccurate obliquity factor in the RR theory is also the cause of a complementary unrealistic "hook" at the high spatial frequency end of the predicted surface PSD when performing the inverse scattering problem. Furthermore, if we empirically substitute the polarization reflectance, Q, from the RR expression for the scalar reflectance, R, in the GHSSmooth expression, it inherits all of the polarization capabilities of the rigorous RR vector perturbation theory.
Roles of Heparan Sulfate Sulfation in Dentinogenesis*
Hayano, Satoru; Kurosaka, Hiroshi; Yanagita, Takeshi; Kalus, Ina; Milz, Fabian; Ishihara, Yoshihito; Islam, Md. Nurul; Kawanabe, Noriaki; Saito, Masahiro; Kamioka, Hiroshi; Adachi, Taiji; Dierks, Thomas; Yamashiro, Takashi
2012-01-01
Cell surface heparan sulfate (HS) is an essential regulator of cell signaling and development. HS traps signaling molecules, like Wnt in the glycosaminoglycan side chains of HS proteoglycans (HSPGs), and regulates their functions. Endosulfatases Sulf1 and Sulf2 are secreted at the cell surface to selectively remove 6-O-sulfate groups from HSPGs, thereby modifying the affinity of cell surface HSPGs for its ligands. This study provides molecular evidence for the functional roles of HSPG sulfation and desulfation in dentinogenesis. We show that odontogenic cells are highly sulfated on the cell surface and become desulfated during their differentiation to odontoblasts, which produce tooth dentin. Sulf1/Sulf2 double null mutant mice exhibit a thin dentin matrix and short roots combined with reduced expression of dentin sialophosphoprotein (Dspp) mRNA, encoding a dentin-specific extracellular matrix precursor protein, whereas single Sulf mutants do not show such defective phenotypes. In odontoblast cell lines, Dspp mRNA expression is potentiated by the activation of the Wnt canonical signaling pathway. In addition, pharmacological interference with HS sulfation promotes Dspp mRNA expression through activation of Wnt signaling. On the contrary, the silencing of Sulf suppresses the Wnt signaling pathway and subsequently Dspp mRNA expression. We also show that Wnt10a protein binds to cell surface HSPGs in odontoblasts, and interference with HS sulfation decreases the binding affinity of Wnt10a for HSPGs, which facilitates the binding of Wnt10a to its receptor and potentiates the Wnt signaling pathway, thereby up-regulating Dspp mRNA expression. These results demonstrate that Sulf-mediated desulfation of cellular HSPGs is an important modification that is critical for the activation of the Wnt signaling in odontoblasts and for production of the dentin matrix. PMID:22351753
Wang, Yanyan; Xu, Han; Zheng, Xiaodong; Wei, Haiming; Sun, Rui; Tian, Zhigang
2007-10-01
Human umbilical cord blood (CB) has recently been used as a source of stem cells in transplantation. NK cells derived from CB are the key effector cells involved in graft-versus-host disease (GVHD) and graft-versus-leukemia (GVL). It was reported that the activity of CB NK cells was lower than that of adult peripheral blood (PB) NK cells. In this study, we analyzed the expression of some NK cell receptors and cytotoxicity-related molecules in CB and PB NK cells. The expressions of activating NK receptors, CD16, NKG2D and NKp46, did not show significant difference between CB and PB NK cells. But the expression of inhibitory receptor NKG2A/CD94 was significantly higher on CB NK cells. As to the effector function molecules, granzyme B was expressed significantly lower in CB NK cells, but the expressions of intracellular perforin, IFN-gamma, TNF-alpha and cell surface FasL and TRAIL did not show difference between CB and PB NK cells. The results indicated that the high expression of NKG2A/CD94 and low expression of granzyme B may be related with the reduced activity of CB NK cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tiwari, Vaibhav; Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, IL 60612; Department of Basic Medical Sciences, College of Osteopathic Medicine of the Pacific and College of Optometry, Western University of Health Sciences, Pomona, CA 91766
2009-12-18
Human herpesvirus-8 (HHV-8) is known to interact with cell surface heparan sulfate (HS) for entry into a target cell. Here we investigated the role of HS during HHV-8 glycoproteins-induced cell fusion. Interestingly, the observed fusion demonstrated an unusual dependence on HS as evident from following lines of evidence: (1) a significant reduction in cell-to-cell fusion occurred when target cells were treated with heparinase; (2) in a competition assay, when the effector cells expressing HHV-8 glycoproteins were challenged with soluble HS, cell-to-cell fusion was reduced; and, (3) co-expression of HHV-8 glycoproteins gH-gL on target cells resulted in inhibition of cell surfacemore » HS expression. Taken together, our results indicate that cell surface HS can play an additional role during HHV-8 pathogenesis.« less
Involvement of neutral endopeptidase in neoplastic progression.
Sumitomo, Makoto; Shen, Ruoqian; Nanus, David M
2005-08-01
Neutral endopeptidase 24.11 (NEP) is a 90-110 kDa cell surface cell surface peptidase that is normally expressed by numerous tissues, including prostate, kidney, intestine, endometrium, adrenal glands and lung. This enzyme cleaves peptide bonds on the amino side of hydrophobic amino acids and inactivates a variety of physiologically active peptides, including atrial natriuretic factor, substance P, bradykinin, oxytocin, Leu- and Met-enkephalins, neurotensin, bombesin, endothelin-1, and bombesin-like peptides. NEP reduces the local concentration of peptide available for receptor binding and signal transduction. Loss or decreases in NEP expression have been reported in a variety of malignancies. Reduced NEP may promote peptide-mediated proliferation by allowing accumulation of higher peptide concentrations at the cell surface, and facilitate the development or progression of neoplasia. We have used prostate cancer as model in which to study the involvement of NEP in malignancy. Using a variety of experimental approaches, including recombinant NEP, cell lines expressing wild-type and mutant NEP protein, and cell lines expressing NEP protein with a mutated cytoplasmic domain, we have examined the effects of NEP on cell migration and cell survival. We have shown that the effects of NEP are mediated by its ability to catalytically inactivate substrates such as bombesin and endothelin-1, but also through direct protein-protein interaction with other protein such as Lyn kinase [which associates with the p85 subunit of phosphatidylinositol 3-kinase (PI3-K) resulting in NEP-Lyn-PI3-K protein complex], ezrin/radixin/moesin (ERM) proteins, and the PTEN tumor suppressor protein. We review the mechanisms of NEP's tumor suppressive action and how NEP loss contributes to tumor progression.
Characterization of the Eimeria maxima sporozoite surface protein IMP1.
Jenkins, M C; Fetterer, R; Miska, K; Tuo, W; Kwok, O; Dubey, J P
2015-07-30
The purpose of this study was to characterize Eimeria maxima immune-mapped protein 1 (IMP1) that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transcription levels at 6-12h of sporulation with a considerable downregulation thereafter. Alignment of IMP1 coding sequence from Houghton, Weybridge, and APU-1 strains of E. maxima revealed single nucleotide polymorphisms that in some instances led to amino acid changes in the encoded protein sequence. The E. maxima (APU-1) IMP1 cDNA sequence was cloned and expressed in 2 different polyHis Escherichia coli expression vectors. Regardless of expression vector, recombinant E. maxima IMP1 (rEmaxIMP1) was fairly unstable in non-denaturing buffer, which is consistent with stability analysis of the primary amino acid sequence. Antisera specific for rEmaxIMP1 identified a single 72 kDa protein or a 61 kDa protein by non-reducing or reducing SDS-PAGE/immunoblotting. Immunofluorescence staining with anti-rEmaxIMP1, revealed intense surface staining of E. maxima sporozoites, with negligible staining of merozoite stages. Immuno-histochemical staining of E. maxima-infected chicken intestinal tissue revealed staining of E. maxima developmental stages in the lamnia propia and crypts at both 24 and 48 h post-infection, and negligible staining thereafter. The expression of IMP1 during early stages of in vivo development and its location on the sporozoite surface may explain in part the immunoprotective effect of this protein against E. maxima infection. Published by Elsevier B.V.
ADAM17 limits the expression of CSF1R on murine hematopoietic progenitors
Becker, Amy M.; Walcheck, Bruce; Bhattacharya, Deepta
2014-01-01
All-lymphoid progenitors (ALPs) yield few myeloid cells in vivo, but readily generate such cells in vitro. The basis for this difference remains unknown. We hypothesized that ALPs limit responsiveness to in vivo concentrations of myeloid-promoting cytokines by reducing expression of the corresponding receptors, potentially through post-transcriptional mechanisms. Consistent with such a mechanism, ALPs express higher levels of Csf1r transcripts than their upstream precursors, yet show limited cell surface protein expression of CSF1R. ALPs and other hematopoietic progenitors deficient in ADAM17, a metalloprotease that can cleave CSF1R, display elevated cell surface CSF1R expression. Adam17−/− ALPs, however, fail to yield myeloid cells upon transplantation into irradiated recipients. Moreover, Adam17−/− ALPs yield fewer macrophages in vitro than control ALPs at high concentrations of M-CSF. Mice with hematopoietic-specific deletion of Adam17 have grossly normal numbers of myeloid and lymphoid progenitors and mature cells in vivo. These data demonstrate that ADAM17 limits CSF1R protein expression on hematopoietic progenitors, but that compensatory mechanisms prevent elevated CSF1R levels from altering lymphoid progenitor potential. PMID:25308957
PSD-95 stabilizes NMDA receptors by inducing the degradation of STEP61.
Won, Sehoon; Incontro, Salvatore; Nicoll, Roger A; Roche, Katherine W
2016-08-09
Phosphorylation regulates surface and synaptic expression of NMDA receptors (NMDARs). Both the tyrosine kinase Fyn and the tyrosine phosphatase striatal-enriched protein tyrosine phosphatase (STEP) are known to target the NMDA receptor subunit GluN2B on tyrosine 1472, which is a critical residue that mediates NMDAR endocytosis. STEP reduces the surface expression of NMDARs by promoting dephosphorylation of GluN2B Y1472, whereas the synaptic scaffolding protein postsynaptic density protein 95 (PSD-95) stabilizes the surface expression of NMDARs. However, nothing is known about a potential functional interaction between STEP and PSD-95. We now report that STEP61 binds to PSD-95 but not to other PSD-95 family members. We find that PSD-95 expression destabilizes STEP61 via ubiquitination and degradation by the proteasome. Using subcellular fractionation, we detect low amounts of STEP61 in the PSD fraction. However, STEP61 expression in the PSD is increased upon knockdown of PSD-95 or in vivo as detected in PSD-95-KO mice, demonstrating that PSD-95 excludes STEP61 from the PSD. Importantly, only extrasynaptic NMDAR expression and currents were increased upon STEP knockdown, as is consistent with low STEP61 localization in the PSD. Our findings support a dual role for PSD-95 in stabilizing synaptic NMDARs by binding directly to GluN2B but also by promoting synaptic exclusion and degradation of the negative regulator STEP61.
PSD-95 stabilizes NMDA receptors by inducing the degradation of STEP61
Won, Sehoon; Incontro, Salvatore; Nicoll, Roger A.; Roche, Katherine W.
2016-01-01
Phosphorylation regulates surface and synaptic expression of NMDA receptors (NMDARs). Both the tyrosine kinase Fyn and the tyrosine phosphatase striatal-enriched protein tyrosine phosphatase (STEP) are known to target the NMDA receptor subunit GluN2B on tyrosine 1472, which is a critical residue that mediates NMDAR endocytosis. STEP reduces the surface expression of NMDARs by promoting dephosphorylation of GluN2B Y1472, whereas the synaptic scaffolding protein postsynaptic density protein 95 (PSD-95) stabilizes the surface expression of NMDARs. However, nothing is known about a potential functional interaction between STEP and PSD-95. We now report that STEP61 binds to PSD-95 but not to other PSD-95 family members. We find that PSD-95 expression destabilizes STEP61 via ubiquitination and degradation by the proteasome. Using subcellular fractionation, we detect low amounts of STEP61 in the PSD fraction. However, STEP61 expression in the PSD is increased upon knockdown of PSD-95 or in vivo as detected in PSD-95–KO mice, demonstrating that PSD-95 excludes STEP61 from the PSD. Importantly, only extrasynaptic NMDAR expression and currents were increased upon STEP knockdown, as is consistent with low STEP61 localization in the PSD. Our findings support a dual role for PSD-95 in stabilizing synaptic NMDARs by binding directly to GluN2B but also by promoting synaptic exclusion and degradation of the negative regulator STEP61. PMID:27457929
MicroRNA miR-328 Regulates Zonation Morphogenesis by Targeting CD44 Expression
Wang, Chia-Hui; Lee, Daniel Y.; Deng, Zhaoqun; Jeyapalan, Zina; Lee, Shao-Chen; Kahai, Shireen; Lu, Wei-Yang; Zhang, Yaou; Yang, Burton B.
2008-01-01
Morphogenesis is crucial to initiate physiological development and tumor invasion. Here we show that a microRNA controls zonation morphogenesis by targeting hyaluronan receptor CD44. We have developed a novel system to study microRNA functions by generating constructs expressing pre-miRNAs and mature miRNAs. Using this system, we have demonstrated that expression of miR-328 reduced cell adhesion, aggregation, and migration, and regulated formation of capillary structure. Protein analysis indicated that miR-328 repressed CD44 expression. Activities of luciferase constructs harboring the target site in CD44, but not the one containing mutation, were repressed by miR-328. Zonation morphogenesis appeared in cells transfected by miR-328: miR-328-transfected cells were present on the surface of zonating structures while the control cells stayed in the middle. MiR-328-mediated CD44 actions was validated by anti-CD44 antibody, hyaluronidase, CD44 siRNA, and CD44 expression constructs. In vivo experiments showed that CD44-silencing cells appeared as layers on the surfaces of nodules or zonating structures. Immuno-histochemistry also exhibited CD44-negative cells on the surface layers of normal rat livers and the internal zones of Portal veins. Our results demonstrate that miR-328 targets CD44, which is essential in regulating zonation morphogenesis: silencing of CD44 expression is essential in sealing the zonation structures to facilitate their extension and to inhibit complex expansion. PMID:18560585
MicroRNA miR-328 regulates zonation morphogenesis by targeting CD44 expression.
Wang, Chia-Hui; Lee, Daniel Y; Deng, Zhaoqun; Jeyapalan, Zina; Lee, Shao-Chen; Kahai, Shireen; Lu, Wei-Yang; Zhang, Yaou; Yang, Burton B
2008-06-18
Morphogenesis is crucial to initiate physiological development and tumor invasion. Here we show that a microRNA controls zonation morphogenesis by targeting hyaluronan receptor CD44. We have developed a novel system to study microRNA functions by generating constructs expressing pre-miRNAs and mature miRNAs. Using this system, we have demonstrated that expression of miR-328 reduced cell adhesion, aggregation, and migration, and regulated formation of capillary structure. Protein analysis indicated that miR-328 repressed CD44 expression. Activities of luciferase constructs harboring the target site in CD44, but not the one containing mutation, were repressed by miR-328. Zonation morphogenesis appeared in cells transfected by miR-328: miR-328-transfected cells were present on the surface of zonating structures while the control cells stayed in the middle. MiR-328-mediated CD44 actions was validated by anti-CD44 antibody, hyaluronidase, CD44 siRNA, and CD44 expression constructs. In vivo experiments showed that CD44-silencing cells appeared as layers on the surfaces of nodules or zonating structures. Immuno-histochemistry also exhibited CD44-negative cells on the surface layers of normal rat livers and the internal zones of Portal veins. Our results demonstrate that miR-328 targets CD44, which is essential in regulating zonation morphogenesis: silencing of CD44 expression is essential in sealing the zonation structures to facilitate their extension and to inhibit complex expansion.
Immunoglobulin light chain allelic inclusion in systemic lupus erythematosus
Fraser, Louise D.; Zhao, Yuan; Lutalo, Pamela M. K.; D'Cruz, David P.; Cason, John; Silva, Joselli S.; Dunn‐Walters, Deborah K.; Nayar, Saba; Cope, Andrew P.
2015-01-01
The principles of allelic exclusion state that each B cell expresses a single light and heavy chain pair. Here, we show that B cells with both kappa and lambda light chains (Igκ and Igλ) are enriched in some patients with the systemic autoimmune disease systemic lupus erythematosus (SLE), but not in the systemic autoimmune disease control granulomatosis with polyangiitis. Detection of dual Igκ and Igλ expression by flow cytometry could not be abolished by acid washing or by DNAse treatment to remove any bound polyclonal antibody or complexes, and was retained after two days in culture. Both surface and intracytoplasmic dual light chain expression was evident by flow cytometry and confocal microscopy. We observed reduced frequency of rearrangements of the kappa‐deleting element (KDE) in SLE and an inverse correlation between the frequency of KDE rearrangement and the frequency of dual light chain expressing B cells. We propose that dual expression of Igκ and Igλ by a single B cell may occur in some patients with SLE when this may be a consequence of reduced activity of the KDE. PMID:26036683
Albert, Markus; Belastegui-Macadam, Xana; Kaldenhoff, Ralf
2006-11-01
Dodder or Cuscutaceae are holoparasitic plants subsisting on other dicotyledonous plants. The infection process is initiated by adherence of Cuscuta prehaustoria to the host surface, followed by penetration attempts by hyphae. In the case of a successful infection, these organs connect the parasite's vascular tissue to that of the host. Here we show that contact of Cuscuta reflexa prehaustoria to tomato induces the expression of a new arabinogalactan protein (AGP), attAGP, in the tomato precisely at the site of dodder attack. We show that attAGP is a plasma membrane-bound cell wall-localized protein. Using the RNAi technique and attAGP-targeted virus-induced gene silencing, we observed a correlation between attAGP expression level and force of attachment of the parasite to host tomatoes. If the expression level of attAGP was reduced, the C. reflexa attachment capability was significantly reduced, too. We conclude that C. reflexa infection induced a signal in the host leading to expression of tomato attAGP, which promotes the parasite's adherence.
USDA-ARS?s Scientific Manuscript database
We studied disease progression of, and host responses to, four species in the M. anisopliae complex expressing green fluorescent protein (GFP). We compared development and determined their relative levels of virulence against two susceptible arthropods, the cattle tick Rhipicephalus annulatus and th...
NASA Astrophysics Data System (ADS)
Ditmar, Pavel
2018-02-01
Time-varying Stokes coefficients estimated from GRACE satellite data are routinely converted into mass anomalies at the Earth's surface with the expression proposed for that purpose by Wahr et al. (J Geophys Res 103(B12):30,205-30,229, 1998). However, the results obtained with it represent mass transport at the spherical surface of 6378 km radius. We show that the accuracy of such conversion may be insufficient, especially if the target area is located in a polar region and the signal-to-noise ratio is high. For instance, the peak values of mean linear trends in 2003-2015 estimated over Greenland and Amundsen Sea embayment of West Antarctica may be underestimated in this way by about 15%. As a solution, we propose an updated expression for the conversion of Stokes coefficients into mass anomalies. This expression is based on the assumptions that: (i) mass transport takes place at the reference ellipsoid and (ii) at each point of interest, the ellipsoidal surface is approximated by the sphere with a radius equal to the current radial distance from the Earth's center ("locally spherical approximation"). The updated expression is nearly as simple as the traditionally used one but reduces the inaccuracies of the conversion procedure by an order of magnitude. In addition, we remind the reader that the conversion expressions are defined in spherical (geocentric) coordinates. We demonstrate that the difference between mass anomalies computed in spherical and ellipsoidal (geodetic) coordinates may not be negligible, so that a conversion of geodetic colatitudes into geocentric ones should not be omitted.
Salazar-Peláez, Lina M.; Abraham, Thomas; Herrera, Ana M.; Correa, Mario A.; Ortega, Jorge E.; Paré, Peter D.; Seow, Chun Y.
2015-01-01
Vitronectin, a multifunctional glycoprotein, is involved in coagulation, inhibition of the formation of the membrane attack complex (MAC), cell adhesion and migration, wound healing, and tissue remodeling. The primary cellular source of vitronectin is hepatocytes; it is not known whether resident cells of airways produce vitronectin, even though the glycoprotein has been found in exhaled breath condensate and bronchoalveolar lavage from healthy subjects and patients with interstitial lung disease. It is also not known whether vitronectin expression is altered in subjects with asthma and COPD. In this study, bronchial tissue from 7 asthmatic, 10 COPD and 14 control subjects was obtained at autopsy and analyzed by immunohistochemistry to determine the percent area of submucosal glands occupied by vitronectin. In a separate set of experiments, quantitative colocalization analysis was performed on tracheobronchial tissue sections obtained from donor lungs (6 asthmatics, 4 COPD and 7 controls). Vitronectin RNA and protein expressions in bronchial surface epithelium were examined in 12 subjects who undertook diagnostic bronchoscopy. Vitronectin was found in the tracheobronchial epithelium from asthmatic, COPD, and control subjects, although its expression was significantly lower in the asthmatic group. Colocalization analysis of 3D confocal images indicates that vitronectin is expressed in the glandular serous epithelial cells and in respiratory surface epithelial cells other than goblet cells. Expression of the 65-kDa vitronectin isoform was lower in bronchial surface epithelium from the diseased subjects. The cause for the decreased vitronectin expression in asthma is not clear, however, the reduced concentration of vitronectin in the epithelial/submucosal layer of airways may be linked to airway remodeling. PMID:25768308
Prichard, David O; Byrne, Anne Marie; Murphy, James O; Reynolds, John V; O'Sullivan, Jacintha; Feighery, Ronan; Doyle, Brendan; Eldin, Osama Sharaf; Finn, Stephen P; Maguire, Aoife; Duff, Deirdre; Kelleher, Dermot P; Long, Aideen
2017-12-01
The fundamental mechanisms underlying erosive oesophagitis and subsequent development of Barrett's oesophagus (BO) are poorly understood. Here, we investigated the contribution of specific components of the gastric refluxate on adhesion molecules involved in epithelial barrier maintenance. Cell line models of squamous epithelium (HET-1A) and BO (QH) were used to examine the effects of bile acids on cell adhesion to extracellular matrix proteins (Collagen, laminin, vitronectin, fibronectin) and expression of integrin ligands (α 3 , α 4, α 5 , α 6 and α ν ). Experimental findings were validated in human explant oesophageal biopsies, a rat model of gastroesophageal reflux disease (GORD) and in patient tissue microarrays. The bile acid deoxycholic acid (DCA) specifically reduced adhesion of HET-1A cells to vitronectin and reduced cell-surface expression of integrin-α ν via effects on endocytic recycling processes. Increased expression of integrin-α v was observed in ulcerated tissue in a rat model of GORD and in oesophagitis and Barrett's intestinal metaplasia patient tissue compared to normal squamous epithelium. Increased expression of integrin-α ν was observed in QH BO cells compared to HET-1A cells. QH cells were resistant to DCA-mediated loss of adhesion and reduction in cell-surface expression of integrin-α ν . We demonstrated that a specific component of the gastric refluxate, DCA, affects the epithelial barrier through modulation of integrin α ν expression, providing a novel mechanism for bile acid-mediated erosion of oesophageal squamous epithelium and promotion of BO. Strategies aimed at preventing bile acid-mediated erosion should be considered in the clinical management of patients with GORD. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Price-Schiavi, Shari A; Jepson, Scott; Li, Peter; Arango, Maria; Rudland, Philip S; Yee, Lisa; Carraway, Kermit L
2002-06-20
Muc4 (also called sialomucin complex), the rat homolog of human MUC4, is a heterodimeric glycoprotein complex that consists of a peripheral O-glycosylated mucin subunit, ASGP-1, tightly but noncovalently linked to a N-glycosylated transmembrane subunit, ASGP-2. The complex is expressed in a number of normal, vulnerable epithelial tissues, including mammary gland, uterus, colon, cornea and trachea. Muc4/SMC is also overexpressed or aberrantly expressed on a number of human tumors including breast tumors. Overexpression of Muc4/SMC has been shown to block cell-cell and cell-matrix interactions, protect tumor cells from immune surveillance and promote metastasis. In addition, as a ligand for ErbB2, Muc4/SMC can potentiate phosphorylation of ErbB2 and potentially alter signals generated from this receptor. Using A375 human melanoma cells and MCF7 human breast adenocarcinoma cells stably transfected with tetracycline regulatable Muc4, we have investigated whether overexpression of Muc4/SMC can repress antibody binding to cell surface-expressed ErbB2. Overexpression of Muc4/SMC does not affect the level of ErbB2 expression in either cell line, but it does reduce binding of a number of anti-ErbB2 antibodies, including Herceptin. Interestingly, overexpression of ErbB2 does not block binding of other unrelated antibodies of the same isotype, suggesting that the reduction in ErbB2 antibody binding is due to complex formation of Muc4/SMC and ErbB2. Furthermore, capping of Muc4/SMC with anti-Muc4/SMC antibodies reduces antibody binding to ErbB2 instead of increasing binding, again suggesting that reduced antibody binding to ErbB2 is due to steric hindrance from complex formation of Muc4/SMC and ErbB2. Thus, overexpression of Muc4/SMC on tumor cells may have both prognostic and therapeutic relevance. Copyright 2002 Wiley-Liss, Inc.
On the theory of oscillating airfoils of finite span in subsonic compressible flow
NASA Technical Reports Server (NTRS)
Reissner, Eric
1950-01-01
The problem of oscillating lifting surface of finite span in subsonic compressible flow is reduced to an integral equation. The kernel of the integral equation is approximated by a simpler expression, on the basis of the assumption of sufficiently large aspect ratio. With this approximation the double integral occurring in the formulation of the problem is reduced to two single integrals, one of which is taken over the chord and the other over the span of the lifting surface. On the basis of this reduction the three-dimensional problem appears separated into two two-dimensional problems, one of them being effectively the problem of two-dimensional flow and the other being the problem of spanwise circulation distribution. Earlier results concerning the oscillating lifting surface of finite span in incompressible flow are contained in the present more general results.
St-Pierre, Gabrielle; Pal, Sudip; Østergaard, Michael E; Zhou, Tianyuan; Yu, Jinghua; Tanowitz, Michael; Seth, Punit P; Hanessian, Stephen
2016-06-01
Antisense oligonucleotides (ASOs) modified with ligands which target cell surface receptors have the potential to significantly improve potency in the target tissue. This has recently been demonstrated using triantennary N-acetyl d-galactosamine conjugated ASOs. CD22 is a cell surface receptor expressed exclusively on B cells thus presenting an attractive target for B cell specific delivery of drugs. Herein, we reported the synthesis of monovalent and trivalent ASO conjugates with biphenylcarbonyl (BPC) modified sialic acids and their study as ASO delivery agents into B cells. CD22 positive cells exhibited reduced potency when treated with ligand modified ASOs and mechanistic examination suggested reduced uptake into cells potentially as a result of sequestration of ASO by other cell-surface proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.
Inhibition of WISE preserves renal allograft function.
Qian, Xueming; Yuan, Xiaodong; Vonderfecht, Steven; Ge, Xupeng; Lee, Jae; Jurisch, Anke; Zhang, Li; You, Andrew; Fitzpatrick, Vincent D; Williams, Alexia; Valente, Eliane G; Pretorius, Jim; Stevens, Jennitte L; Tipton, Barbara; Winters, Aaron G; Graham, Kevin; Harriss, Lindsey; Baker, Daniel M; Damore, Michael; Salimi-Moosavi, Hossein; Gao, Yongming; Elkhal, Abdallah; Paszty, Chris; Simonet, W Scott; Richards, William G; Tullius, Stefan G
2013-01-01
Wnt-modulator in surface ectoderm (WISE) is a secreted modulator of Wnt signaling expressed in the adult kidney. Activation of Wnt signaling has been observed in renal transplants developing interstitial fibrosis and tubular atrophy; however, whether WISE contributes to chronic changes is not well understood. Here, we found moderate to high expression of WISE mRNA in a rat model of renal transplantation and in kidneys from normal rats. Treatment with a neutralizing antibody against WISE improved proteinuria and graft function, which correlated with higher levels of β-catenin protein in kidney allografts. In addition, treatment with the anti-WISE antibody reduced infiltration of CD68(+) macrophages and CD8(+) T cells, attenuated glomerular and interstitial injury, and decreased biomarkers of renal injury. This treatment reduced expression of genes involved in immune responses and in fibrogenic pathways. In summary, WISE contributes to renal dysfunction by promoting tubular atrophy and interstitial fibrosis.
Wang, Jiang; Luo, Dongjiao; Sun, Aihua; Yan, Jie
2008-07-01
Lipoproteins LipL32 and LipL21 and transmembrane protein OMPL1 have been confirmed as the superficial genus-specific antigens of Leptospira interrogans, which can be used as antigens for developing a universal genetic engineering vaccine. In order to obtain high expression of an artificial fusion gene lipL32/1-lipL21-ompL1/2, we optimized prokaryotic expression conditions. We used surface response analysis based on the central composite design to optimize culture conditions of a new antigen protein by recombinant Escherichia coli DE3.The culture conditions included initial pH, induction start time, post-induction time, Isopropyl beta-D-thiogalactopyranoside (IPTG) concentration, and temperature. The maximal production of antigen protein was 37.78 mg/l. The optimal culture conditions for high recombinant fusion protein was determined: initial pH 7.9, induction start time 2.5 h, a post-induction time of 5.38 h, 0.20 mM IPTG, and a post-induction temperature of 31 degrees C. Surface response analysis based on CCD increased the target production. This statistical method reduced the number of experiments required for optimization and enabled rapid identification and integration of the key culture condition parameters for optimizing recombinant protein expression.
Carrillo-Galvez, Ana Belén; Cobo, Marién; Cuevas-Ocaña, Sara; Gutiérrez-Guerrero, Alejandra; Sánchez-Gilabert, Almudena; Bongarzone, Pierpaolo; García-Pérez, Angélica; Muñoz, Pilar; Benabdellah, Karim; Toscano, Miguel G; Martín, Francisco; Anderson, Per
2015-01-01
Mesenchymal stromal cells (MSCs) represent a promising tool for therapy in regenerative medicine, transplantation, and autoimmune disease due to their trophic and immunomodulatory activities. However, we are still far from understanding the mechanisms of action of MSCs in these processes. Transforming growth factor (TGF)-β1 is a pleiotropic cytokine involved in MSC migration, differentiation, and immunomodulation. Recently, glycoprotein A repetitions predominant (GARP) was shown to bind latency-associated peptide (LAP)/TGF-β1 to the cell surface of activated Foxp3(+) regulatory T cells (Tregs) and megakaryocytes/platelets. In this manuscript, we show that human and mouse MSCs express GARP which presents LAP/TGF-β1 on their cell surface. Silencing GARP expression in MSCs increased their secretion and activation of TGF-β1 and reduced their proliferative capacity in a TGF-β1-independent manner. Importantly, we showed that GARP expression on MSCs contributed to their ability to inhibit T-cell responses in vitro. In summary, we have found that GARP is an essential molecule for MSC biology, regulating their immunomodulatory and proliferative activities. We envision GARP as a new target for improving the therapeutic efficacy of MSCs and also as a novel MSC marker. © 2014 AlphaMed Press.
Carrillo-Galvez, Ana Belén; Cobo, Marién; Cuevas-Ocaña, Sara; Gutiérrez-Guerrero, Alejandra; Sánchez-Gilabert, Almudena; Bongarzone, Pierpaolo; García-Pérez, Angélica; Muñoz, Pilar; Benabdellah, Karim; Toscano, Miguel G; Martín, Francisco; Anderson, Per
2015-01-01
Mesenchymal stromal cells (MSCs) represent a promising tool for therapy in regenerative medicine, transplantation, and autoimmune disease due to their trophic and immunomodulatory activities. However, we are still far from understanding the mechanisms of action of MSCs in these processes. Transforming growth factor (TGF)-β1 is a pleiotropic cytokine involved in MSC migration, differentiation, and immunomodulation. Recently, glycoprotein A repetitions predominant (GARP) was shown to bind latency-associated peptide (LAP)/TGF-β1 to the cell surface of activated Foxp3+ regulatory T cells (Tregs) and megakaryocytes/platelets. In this manuscript, we show that human and mouse MSCs express GARP which presents LAP/TGF-β1 on their cell surface. Silencing GARP expression in MSCs increased their secretion and activation of TGF-β1 and reduced their proliferative capacity in a TGF-β1-independent manner. Importantly, we showed that GARP expression on MSCs contributed to their ability to inhibit T-cell responses in vitro. In summary, we have found that GARP is an essential molecule for MSC biology, regulating their immunomodulatory and proliferative activities. We envision GARP as a new target for improving the therapeutic efficacy of MSCs and also as a novel MSC marker. Stem Cells 2015;33:183–195 PMID:25182959
Liu, Mingfu; Lin, Lin; Gebremariam, Teclegiorgis; Luo, Guanpingsheng; Skory, Christopher D.; French, Samuel W.; Chou, Tsui-Fen; Edwards, John E.; Ibrahim, Ashraf S.
2015-01-01
Dialysis patients with chronic renal failure receiving deferoxamine for treating iron overload are uniquely predisposed for mucormycosis, which is most often caused by Rhizopus oryzae. Although the deferoxamine siderophore is not secreted by Mucorales, previous studies established that Rhizopus species utilize iron from ferrioxamine (iron-rich form of deferoxamine). Here we determined that the CBS domain proteins of Fob1 and Fob2 act as receptors on the cell surface of R. oryzae during iron uptake from ferrioxamine. Fob1 and Fob2 cell surface expression was induced in the presence of ferrioxamine and bound radiolabeled ferrioxamine. A R. oryzae strain with targeted reduced Fob1/Fob2 expression was impaired for iron uptake, germinating, and growing on medium with ferrioxamine as the sole source of iron. This strain also exhibited reduced virulence in a deferoxamine-treated, but not the diabetic ketoacidotic (DKA), mouse model of mucormycosis. The mechanism by which R. oryzae obtains iron from ferrioxamine involves the reductase/permease uptake system since the growth on ferrioxamine supplemented medium is associated with elevated reductase activity and the use of the ferrous chelator bathophenanthroline disulfonate abrogates iron uptake and growth on medium supplemented with ferrioxamine as a sole source of iron. Finally, R. oryzae mutants with reduced copies of the high affinity iron permease (FTR1) or with decreased FTR1 expression had an impaired iron uptake from ferrioxamine in vitro and reduced virulence in the deferoxamine-treated mouse model of mucormycosis. These two receptors appear to be conserved in Mucorales, and can be the subject of future novel therapy to maintain the use of deferoxamine for treating iron-overload. PMID:25974051
Raju, S Vamsee; Lin, Vivian Y; Liu, Limbo; McNicholas, Carmel M; Karki, Suman; Sloane, Peter A; Tang, Liping; Jackson, Patricia L; Wang, Wei; Wilson, Landon; Macon, Kevin J; Mazur, Marina; Kappes, John C; DeLucas, Lawrence J; Barnes, Stephen; Kirk, Kevin; Tearney, Guillermo J; Rowe, Steven M
2017-01-01
Acquired cystic fibrosis transmembrane conductance regulator (CFTR) dysfunction may contribute to chronic obstructive pulmonary disease pathogenesis and is a potential therapeutic target. We sought to determine the acute effects of cigarette smoke on ion transport and the mucociliary transport apparatus, their mechanistic basis, and whether deleterious effects could be reversed with the CFTR potentiator ivacaftor (VX-770). Primary human bronchial epithelial (HBE) cells and human bronchi were exposed to cigarette smoke extract (CSE) and/or ivacaftor. CFTR function and expression were measured in Ussing chambers and by surface biotinylation. CSE-derived acrolein modifications on CFTR were determined by mass spectroscopic analysis of purified protein, and the functional microanatomy of the airway epithelia was measured by 1-μm resolution optical coherence tomography. CSE reduced CFTR-dependent current in HBE cells (P < 0.05) and human bronchi (P < 0.05) within minutes of exposure. The mechanism involved CSE-induced reduction of CFTR gating, decreasing CFTR open-channel probability by approximately 75% immediately after exposure (P < 0.05), whereas surface CFTR expression was partially reduced with chronic exposure, but was stable acutely. CSE treatment of purified CFTR resulted in acrolein modifications on lysine and cysteine residues that likely disrupt CFTR gating. In primary HBE cells, CSE reduced airway surface liquid depth (P < 0.05) and ciliary beat frequency (P < 0.05) within 60 minutes that was restored by coadministration with ivacaftor (P < 0.005). Cigarette smoking transmits acute reductions in CFTR activity, adversely affecting the airway surface. These effects are reversible by a CFTR potentiator in vitro, representing a potential therapeutic strategy in patients with chronic obstructive pulmonary disease with chronic bronchitis.
Human Plasmacytoid Dendritic Cells Display and Shed B Cell Maturation Antigen upon TLR Engagement.
Schuh, Elisabeth; Musumeci, Andrea; Thaler, Franziska S; Laurent, Sarah; Ellwart, Joachim W; Hohlfeld, Reinhard; Krug, Anne; Meinl, Edgar
2017-04-15
The BAFF-APRIL system is best known for its control of B cell homeostasis, and it is a target of therapeutic intervention in autoimmune diseases and lymphoma. By analyzing the expression of the three receptors of this system, B cell maturation Ag (BCMA), transmembrane activator and CAML interactor, and BAFF receptor, in sorted human immune cell subsets, we found that BCMA was transcribed in plasmacytoid dendritic cells (pDCs) in both blood and lymphoid tissue. Circulating human pDCs contained BCMA protein without displaying it on the cell surface. After engagement of TLR7/8 or TLR9, BCMA was detected also on the cell surface of pDCs. The display of BCMA on the surface of human pDCs was accompanied by release of soluble BCMA (sBCMA); inhibition of γ-secretase enhanced surface expression of BCMA and reduced the release of sBCMA by pDCs. In contrast with human pDCs, murine pDCs did not express BCMA, not even after TLR9 activation. In this study, we extend the spectrum of BCMA expression to human pDCs. sBCMA derived from pDCs might determine local availability of its high-affinity ligand APRIL, because sBCMA has been shown to function as an APRIL-specific decoy. Further, therapeutic trials targeting BCMA in patients with multiple myeloma should consider possible effects on pDCs. Copyright © 2017 by The American Association of Immunologists, Inc.
Lawrence, Alexandra; Xu, Xin; Bible, Melissa D.; Calve, Sarah; Neu, Corey P.; Panitch, Alyssa
2015-01-01
The lubricating proteoglycan, lubricin, facilitates the remarkable low friction and wear properties of articular cartilage in the synovial joints of the body. Lubricin lines the joint surfaces and plays a protective role as a boundary lubricant in sliding contact; decreased expression of lubricin is associated with cartilage degradation and the pathogenesis of osteoarthritis. An unmet need for early osteoarthritis treatment is the development of therapeutic molecules that mimic lubricin function and yet are also resistant to enzymatic degradation common in the damaged joint. Here, we engineered a lubricin mimic (mLub) that is less susceptible to enzymatic degradation and binds to the articular surface to reduce friction. mLub was synthesized using a chondroitin sulfate backbone with type II collagen and hyaluronic acid (HA) binding peptides to promote interaction with the articular surface and synovial fluid constituents. In vitro and in vivo characterization confirmed the binding ability of mLub to isolated type II collagen and HA, and to the cartilage surface. Following trypsin treatment to the cartilage surface, application of mLub, in combination with purified or commercially available hyaluronan, reduced the coefficient of friction, and adhesion, to control levels as assessed over macro- to micro-scales by rheometry and atomic force microscopy. In vivo studies demonstrate an mLub residency time of less than 1 week. Enhanced lubrication by mLub reduces surface friction and adhesion, which may suppress the progression of degradation and cartilage loss in the joint. mLub therefore shows potential for treatment in early osteoarthritis following injury. PMID:26398308
hERG K+ channel-associated cardiac effects of the antidepressant drug desipramine.
Staudacher, Ingo; Wang, Lu; Wan, Xiaoping; Obers, Sabrina; Wenzel, Wolfgang; Tristram, Frank; Koschny, Ronald; Staudacher, Kathrin; Kisselbach, Jana; Koelsch, Patrick; Schweizer, Patrick A; Katus, Hugo A; Ficker, Eckhard; Thomas, Dierk
2011-02-01
Cardiac side effects of antidepressant drugs are well recognized. Adverse effects precipitated by the tricyclic drug desipramine include prolonged QT intervals, torsade de pointes tachycardia, heart failure, and sudden cardiac death. QT prolongation has been primarily attributed to acute blockade of hERG/I(Kr) currents. This study was designed to provide a more complete picture of cellular effects associated with desipramine. hERG channels were expressed in Xenopus laevis oocytes and human embryonic kidney (HEK 293) cells, and potassium currents were recorded using patch clamp and two-electrode voltage clamp electrophysiology. Ventricular action potentials were recorded from guinea pig cardiomyocytes. Protein trafficking and cell viability were evaluated in HEK 293 cells and in HL-1 mouse cardiomyocytes by immunocytochemistry, Western blot analysis, or colorimetric MTT assay, respectively. We found that desipramine reduced hERG currents by binding to a receptor site inside the channel pore. hERG protein surface expression was reduced after short-term treatment, revealing a previously unrecognized mechanism. When long-term effects were studied, forward trafficking was impaired and hERG currents were decreased. Action potential duration was prolonged upon acute and chronic desipramine exposure. Finally, desipramine triggered apoptosis in cells expressing hERG channels. Desipramine exerts at least four different cellular effects: (1) direct hERG channel block, (2) acute reduction of hERG surface expression, (3) chronic disruption of hERG trafficking, and (4) induction of apoptosis. These data highlight the complexity of hERG-associated drug effects.
Benzoxazole derivatives suppress lipopolysaccharide-induced mast cell activation.
Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Choo, Hea-Young Park; Lee, Kyung Ho
2018-05-01
Mast cells are central regulators of allergic inflammation that function by releasing various proallergic inflammatory mediators, including histamine, eicosanoids and proinflammatory cytokines. Occasionally, bacterial infections may initiate or worsen allergic inflammation. A number of studies have indicated that activation of lipoxygenase in mast cells positive regulates allergic inflammatory responses by generating leukotrienes and proinflammatory cytokines. In the present study, the effects of benzoxazole derivatives on the lipopolysaccharide (LPS)‑induced expression of proinflammatory cytokines, production of histamine and surface expression of co‑stimulatory molecules on bone marrow-derived mast cells (BMMCs) were studied. The benzoxazole derivatives significantly reduced the expression of interleukin (IL)‑1β, IL‑6, IL‑13, tumor necrosis factor‑α, perilipin (PLIN) 2, and PLIN3 in BMMCs treated with LPS. Furthermore, histamine production was suppressed in BMMCs treated with LPS, or treated with phorbol-12-myristate-13-acetate/ionomycin. Benzoxazole derivatives marginally affected the surface expression of cluster of differentiation (CD)80 and CD86 on BMMCs in the presence of LPS, although LPS alone did not increase the expression of those proteins. Therefore, benzoxazole derivatives inhibited the secretion of proinflammatory cytokines in mast cells and may be potential candidate anti‑allergic agents to suppress mast cell activation.
Unloading-induced bone loss was suppressed in gold-thioglucose treated mice.
Hino, K; Nifuji, A; Morinobu, M; Tsuji, K; Ezura, Y; Nakashima, K; Yamamoto, H; Noda, M
2006-10-15
Loss of mechanical stress causes bone loss. However, the mechanisms underlying the unloading-induced bone loss are largely unknown. Here, we examined the effects of gold-thioglucose (GTG) treatment, which destroys ventromedial hypothalamus (VMH), on unloading-induced bone loss. Unloading reduced bone volume in control (saline-treated) mice. Treatment with GTG-reduced bone mass and in these GTG-treated mice, unloading-induced reduction in bone mass levels was not observed. Unloading reduced the levels of bone formation rate (BFR) and mineral apposition rate (MAR). GTG treatment also reduced these parameters and under this condition, unloading did not further reduce the levels of BFR and MAR. Unloading increased the levels of osteoclast number (Oc.N/BS) and osteoclast surface (Oc.S/BS). GTG treatment did not alter the basal levels of these bone resorption parameters. In contrast to control, GTG treatment suppressed unloading-induced increase in the levels of Oc.N/BS and Oc.S/BS. Unloading reduced the levels of mRNA expression of the genes encoding osteocalcin, type I collagen and Cbfa1 in bone. In contrast, GTG treatment suppressed such unloading-induced reduction of mRNA expression. Unloading also enhanced the levels of fat mass in bone marrow and mRNA expression of the genes encoding PPARgamma2, C/EBPalpha, and C/EBPbeta in bone. In GTG-treated mice, unloading did not increase fat mass and the levels of fat-related mRNA expression. These results indicated that GTG treatment suppressed unloading-induced alteration in bone loss. 2006 Wiley-Liss, Inc.
Zunino, Susan J; Hwang, Daniel H; Huang, Shurong; Storms, David H
2018-02-01
THP-1 monocytes were used to evaluate the effects of physiological levels of resveratrol aglycone, resveratrol-3-O-glucuronide, resveratrol-4'-O-glucuronide, and resveratrol-3-O-sulfate on phagocytosis, IL-1β, IL-1α, and IL-18 production, viability, and TLR2 and TLR4 expression. THP-1 cells were treated with 1, 5, 10, and 15μM resveratrol or metabolites. Resveratrol-3-O-glucuronide, resveratrol-4'-O-glucuronide, and resveratrol-3-O-sulfate had no effect on the functional parameters tested. Resveratrol aglycone increased phagocytosis at concentrations of 5, 10, and 15μM and LPS-induced IL-1β production at concentrations of 10 and 15μM. Expression of TLR4 increased slightly after resveratrol treatment, but surface expression of TLR2 was reduced as resveratrol concentrations increased. Our data suggest that resveratrol may be effective in modulating monocyte function in an environment where there is direct exposure to the aglycone, such as at the gut epithelium. Published by Elsevier Ltd.
Zhang, Shailin; Sun, Junying; Xu, Ying; Qian, Shi; Wang, Bing; Liu, Fei; Liu, Xuanyong
2013-01-01
Zirconia films were prepared on titanium by cathodic arc deposition technique. The surface topography and element composition of the films were characterized by scanning electron microscopy and X-ray photoelectron spectroscopy, respectively. Osteoblast-like MG63 cells were cultured on the surface of the zirconia films in vitro, and cell behaviour was investigated, with titanium as control. The results obtained from scanning electron microscopy and immunofluorescence studies showed that the MG63 cells on ZrO2 films spread better than those on Ti. The CCK8 assay indicated that the zirconia films promoted the proliferation of MG63 cells. The results of alkaline phosphatase (ALP) activity test and the expression of osteogenic marker genes, such as ALP, collagen I and osteocalcin, demonstrated that the differentiation of MG63 cells might be enhanced by zirconia films. In addition, the zirconia films possibly regulated osteoclastogenic gene expression by stimulating the expression of osteoprotegerin and reducing the expression of receptor activator of nuclear factor-kappaB ligand. The present work suggests that the ZrO2 film is worth further consideration for orthopedic implant applications.
Lundberg, A H; Fukatsu, K; Gaber, L; Callicutt, S; Kotb, M; Wilcox, H; Kudsk, K; Gaber, A O
2001-02-01
To determine whether blocking the cell surface expression of intracellular adhesion molecules (ICAM-1) in established severe acute pancreatitis (AP) would ameliorate pulmonary injury. Lung injury in AP is in part mediated by infiltrating leukocytes, which are directed to lung tissue by ICAM-l. The authors' laboratory has previously demonstrated that AP results in overproduction of inflammatory cytokines, upregulation of pulmonary ICAM-1 expression, and a concomitant infiltration of neutrophils, which results in lung injury. Young female mice were fed a choline-deficient/ethionine-supplemented diet to induce AP and were treated with a blocking dose of monoclonal antibody specific to the ICAM-1 receptor. Antibody treatment was administered at 72, 96, and 120 hours after beginning the diet, and all animals were killed at 144 hours. The degree of pancreatitis was evaluated by serum biochemical and tumor necrosis factor alpha levels as well as histology. The dual radiolabeled monoclonal antibody method was used to quantitate ICAM-1 cell surface expression in pulmonary tissue. Lung injury was assessed histologically and by determining lung microvascular permeability by measuring accumulated 125I-radiolabeled albumin. Pulmonary neutrophil sequestration was determined by the myeloperoxidase assay. All mice developed severe AP, and pancreatic injury was equally severe in both treated and untreated groups. Pulmonary ICAM-1 expression was significantly upregulated in animals with AP compared with controls. Treatment with a blocking dose of anti-ICAM-1 antibody after the induction of AP resulted in inhibited ICAM-1 cell surface expression to near control levels. Compared to untreated animals with AP, mice treated with anti-ICAM-1 mice had significantly reduced histologic lung injury and neutrophil sequestration, and a decreased microvascular permeability by more than twofold. These results demonstrate for the first time that treatment targeting the cell surface expression of ICAM-1 after the induction of AP ameliorates pulmonary injury, even in the face of severe pancreatic disease.
Transcription factor Mohawk and the pathogenesis of human anterior cruciate ligament degradation
Nakahara, Hiroyuki; Hasegawa, Akihiko; Otabe, Koji; Ayabe, Fumiaki; Matsukawa, Tetsuya; Onizuka, Naoko; Ito, Yoshiaki; Ozaki, Toshifumi; Lotz, Martin K.; Asahara, Hiroshi
2013-01-01
Objective To investigate the expression and function of Mohawk (MKX) in human adult anterior cruciate ligament (ACL) tissues and ligament cells from normal and osteoarthritis-affected knees. Methods Knee joints were obtained at autopsy within 24-48 hours postmortem from 13 normal donors (age 36.9±11.0 years), 16 OA donors (age 79.7±11.4 years) and 8 old donors without OA (age 76.9±12.9 years). All cartilage surfaces were graded macroscopically. MKX expression was analyzed by immunohistochemistry and quantitative PCR. ACL-derived cells were used to study regulation of MKX expression by IL-1β. MKX was knocked down by siRNA to analyze function of MKX in extracellular matrix (ECM) production and differentiation in ACL-derived cells. Results The expression of MKX was significantly decreased in ACL-derived cells from OA knees compared with normal knees. Consistent with this finding, immunohistochemistry showed that MKX positive cells were significantly reduced in ACL tissues from OA donors in particular in cells located in disorientated fibers. In ACL-derived cells, IL-1β strongly suppressed MKX gene expression and reduced ligament ECM genes, COL1A1 and TNXB. On the other hand, SOX9, chondrocyte master transcription factor, was up regulated by IL-1β treatment. Importantly, knock down of MKX expression by siRNA upregulated SOX9 expression in ACL-derived cells, whereas the expression of COL1A1 and TNXB were decreased. Conclusion Reduced expression of MKX is a feature of degenerated ACL in OA-affected joints and this may be in part mediated by IL-1β. MKX appears necessary to maintain the tissue specific cellular differentiation status and ECM production in adult human tendons and ligaments. PMID:23686683
The sensor kinase PhoQ mediates virulence in Pseudomonas aeruginosa.
Gooderham, W James; Gellatly, Shaan L; Sanschagrin, François; McPhee, Joseph B; Bains, Manjeet; Cosseau, Celine; Levesque, Roger C; Hancock, Robert E W
2009-03-01
Pseudomonas aeruginosa is a ubiquitous environmental Gram-negative bacterium that is also a major opportunistic human pathogen in nosocomial infections and cystic fibrosis chronic lung infections. PhoP-PhoQ is a two-component regulatory system that has been identified as essential for virulence and cationic antimicrobial peptide resistance in several other Gram-negative bacteria. This study demonstrated that mutation of phoQ caused reduced twitching motility, biofilm formation and rapid attachment to surfaces, 2.2-fold reduced cytotoxicity to human lung epithelial cells, substantially reduced lettuce leaf virulence, and a major, 10 000-fold reduction in competitiveness in chronic rat lung infections. Microarray analysis revealed that PhoQ controlled the expression of many genes consistent with these phenotypes and with its known role in polymyxin B resistance. It was also demonstrated that PhoQ controls the expression of many genes outside the known PhoP regulon.
Gründel, Anne; Pfeiffer, Melanie; Jacobs, Enno
2015-01-01
In different bacteria, primarily cytosolic and metabolic proteins are characterized as surface localized and interacting with different host factors. These moonlighting proteins include glycolytic enzymes, and it has been hypothesized that they influence the virulence of pathogenic species. The presence of surface-displayed glycolytic enzymes and their interaction with human plasminogen as an important host factor were investigated in the genome-reduced and cell wall-less microorganism Mycoplasma pneumoniae, a common agent of respiratory tract infections of humans. After successful expression of 19 glycolytic enzymes and production of polyclonal antisera, the localization of proteins in the mycoplasma cell was characterized using fractionation of total proteins, colony blot, mild proteolysis and immunofluorescence of M. pneumoniae cells. Eight glycolytic enzymes, pyruvate dehydrogenases A to C (PdhA-C), glyceraldehyde-3-phosphate dehydrogenase (GapA), lactate dehydrogenase (Ldh), phosphoglycerate mutase (Pgm), pyruvate kinase (Pyk), and transketolase (Tkt), were confirmed as surface expressed and all are able to interact with plasminogen. Plasminogen bound to recombinant proteins PdhB, GapA, and Pyk was converted to plasmin in the presence of urokinase plasminogen activator and plasmin-specific substrate d-valyl-leucyl-lysine-p-nitroanilide dihydrochloride. Furthermore, human fibrinogen was degraded by the complex of plasminogen and recombinant protein PdhB or Pgm. In addition, surface-displayed proteins (except PdhC) bind to human lung epithelial cells, and the interaction was reduced significantly by preincubation of cells with antiplasminogen. Our results suggest that plasminogen binding and activation by different surface-localized glycolytic enzymes of M. pneumoniae may play a role in successful and long-term colonization of the human respiratory tract. PMID:26667841
Anastasia, Luigi; Holguera, Javier; Bianchi, Anna; D'Avila, Francesca; Papini, Nadia; Tringali, Cristina; Monti, Eugenio; Villar, Enrique; Venerando, Bruno; Muñoz-Barroso, Isabel; Tettamanti, Guido
2008-03-01
The paramyxovirus Newcastle Disease Virus (NDV) binds to sialic acid-containing glycoconjugates, sialoglycoproteins and sialoglycolipids (gangliosides) of host cell plasma membrane through its hemagglutinin-neuraminidase (sialidase) HN glycoprotein. We hypothesized that the modifications of the cell surface ganglioside pattern determined by over-expression of the mammalian plasma-membrane associated, ganglioside specific, sialidase NEU3 would affect the virus-host cell interactions. Using COS7 cells as a model system, we observed that over-expression of the murine MmNEU3 did not affect NDV binding but caused a marked reduction in NDV infection and virus propagation through cell-cell fusion. Moreover, since GD1a was greatly reduced in COS7 cells following NEU3-over-expression, we added [(3)H]-labelled GD1a to COS7 cells under conditions that block intralysosomal metabolic processing, and we observed a marked increase of GD1a cleavage to GM1 during NDV infection, indicating a direct involvement of the virus sialidase and host cell GD1a in NDV infectivity. Therefore, the decrease of GD1a in COS7 cell membrane upon MmNEU3 over-expression is likely to be instrumental to NDV reduced infection. Evidence was also provided for the preferential association of NDV-HN at 4 degrees C to detergent resistant microdomains (DRMs) of COS7 cells plasma membranes.
Niki, Toshiro; Kadowaki, Takeshi; Ueno, Masaki; Nishi, Nozomu; Yamauchi, Akira; Hattori, Toshio; Masaki, Tsutomu; Hirashima, Mitsuomi
2012-01-01
Galectin-9 (Gal-9), a β-galactoside binding mammalian lectin, regulates immune responses by reducing pro-inflammatory IL-17-producing Th cells (Th17) and increasing anti-inflammatory Foxp3+ regulatory T cells (Treg) in vitro and in vivo. These functions of Gal-9 are thought to be exerted by binding to receptor molecules on the cell surface. However, Gal-9 lacks a signal peptide for secretion and is predominantly located in the cytoplasm, which raises questions regarding how and which cells secrete Gal-9 in vivo. Since Gal-9 expression does not necessarily correlate with its secretion, Gal-9-secreting cells in vivo have been elusive. We report here that CD4 T cells expressing Gal-9 on the cell surface (Gal-9+ Th cells) secrete Gal-9 upon T cell receptor (TCR) stimulation, but other CD4 T cells do not, although they express an equivalent amount of intracellular Gal-9. Gal-9+ Th cells expressed interleukin (IL)-10 and transforming growth factor (TGF)-β but did not express Foxp3. In a co-culture experiment, Gal-9+ Th cells regulated Th17/Treg development in a manner similar to that by exogenous Gal-9, during which the regulation by Gal-9+ Th cells was shown to be sensitive to a Gal-9 antagonist but insensitive to IL-10 and TGF-β blockades. Further elucidation of Gal-9+ Th cells in humans indicates a conserved role of these cells through evolution and implies the possible utility of these cells for diagnosis or treatment of immunological diseases. PMID:23144904
1994-01-01
The expression of class I major histocompatibility complex antigens on the surface of cells transformed by adenovirus 12 (Ad12) is generally very low, and correlates with the high oncogenicity of this virus. In primary embryonal fibroblasts from transgenic mice that express both endogenous H-2 genes and a miniature swine class I gene (PD1), Ad12- mediated transformation results in suppression of cell surface expression of all class I antigens. Although class I mRNA levels of PD1 and H-2Db are similar to those in nonvirally transformed cells, recognition of newly synthesized class I molecules by a panel of monoclonal antibodies is impaired, presumably as a result of inefficient assembly and transport of the class I molecules. Class I expression can be partially induced by culturing cells at 26 degrees C, or by coculture of cells with class I binding peptides at 37 degrees C. Analysis of steady state mRNA levels of the TAP1 and TAP2 transporter genes for Ad12-transformed cell lines revealed that they both are significantly reduced, TAP2 by about 100-fold and TAP1 by 5-10-fold. Reconstitution of PD1 and H-2Db, but not H-2Kb, expression is achieved in an Ad12-transformed cell line by stable transfection with a TAP2, but not a TAP1, expression construct. From these data it may be concluded that suppressed expression of peptide transporter genes, especially TAP2, in Ad12-transformed cells inhibits cell surface expression of class I molecules. The failure to fully reconstitute H- 2Db and H-2Kb expression indicates that additional factors are involved in controlling class I gene expression in Ad12-transformed cells. Nevertheless, these results suggest that suppression of peptide transporter genes might be an important mechanism whereby virus- transformed cells escape immune recognition in vivo. PMID:7519239
Surface Functionalization of Orthopedic Titanium Implants with Bone Sialoprotein
Ritz, Ulrike; Ackermann, Angelika; Anthonissen, Joris; Kaufmann, Kerstin B.; Brendel, Christian; Götz, Hermann; Rommens, Pol M.; Hofmann, Alexander
2016-01-01
Orthopedic implant failure due to aseptic loosening and mechanical instability remains a major problem in total joint replacement. Improving osseointegration at the bone-implant interface may reduce micromotion and loosening. Bone sialoprotein (BSP) has been shown to enhance bone formation when coated onto titanium femoral implants and in rat calvarial defect models. However, the most appropriate method of BSP coating, the necessary level of BSP coating, and the effect of BSP coating on cell behavior remain largely unknown. In this study, BSP was covalently coupled to titanium surfaces via an aminosilane linker (APTES), and its properties were compared to BSP applied to titanium via physisorption and untreated titanium. Cell functions were examined using primary human osteoblasts (hOBs) and L929 mouse fibroblasts. Gene expression of specific bone turnover markers at the RNA level was detected at different intervals. Cell adhesion to titanium surfaces treated with BSP via physisorption was not significantly different from that of untreated titanium at any time point, whereas BSP application via covalent coupling caused reduced cell adhesion during the first few hours in culture. Cell migration was increased on titanium disks that were treated with higher concentrations of BSP solution, independent of the coating method. During the early phases of hOB proliferation, a suppressive effect of BSP was observed independent of its concentration, particularly when BSP was applied to the titanium surface via physisorption. Although alkaline phosphatase activity was reduced in the BSP-coated titanium groups after 4 days in culture, increased calcium deposition was observed after 21 days. In particular, the gene expression level of RUNX2 was upregulated by BSP. The increase in calcium deposition and the stimulation of cell differentiation induced by BSP highlight its potential as a surface modifier that could enhance the osseointegration of orthopedic implants. Both physisorption and covalent coupling of BSP are similarly effective, feasible methods, although a higher BSP concentration is recommended. PMID:27111551
Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A
2017-07-01
Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.
Mendes, Ana Isabel; Matos, Paulo; Moniz, Sónia; Jordan, Peter
2010-01-01
One mechanism by which mammalian cells regulate the uptake of glucose is the number of glucose transporter proteins (GLUT) present at the plasma membrane. In insulin-responsive cells types, GLUT4 is released from intracellular stores through inactivation of the Rab GTPase activating protein Tre-2/USP6-BUB2-Cdc16 domain family member 4 (TBC1D4) (also known as AS160). Here we describe that TBC1D4 forms a protein complex with protein kinase WNK1 in human embryonic kidney (HEK293) cells. We show that WNK1 phosphorylates TBC1D4 in vitro and that the expression levels of WNK1 in these cells regulate surface expression of the constitutive glucose transporter GLUT1. WNK1 was found to increase the binding of TBC1D4 to regulatory 14-3-3 proteins while reducing its interaction with the exocytic small GTPase Rab8A. These effects were dependent on the catalytic activity because expression of a kinase-dead WNK1 mutant had no effect on binding of 14-3-3 and Rab8A, or on surface GLUT1 levels. Together, the data describe a pathway regulating constitutive glucose uptake via GLUT1, the expression level of which is related to several human diseases. PMID:20937822
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Ying; Department of Clinical Laboratory, Second Affiliated Hospital of Dalian Medical University, Dalian 116023; Huang, Xiaohua
2013-10-25
Highlights: •Down-regulating FUT9 and ST3Gal4 expression blocks L1-induced neuronal differentiation of ESCs. •Up-regulating FUT9 and ST3Gal4 expression in L1-ESCs depends on the activation of PLCγ. •L1 promotes ESCs to differentiate into neuron through regulating cell surface glycosylation. -- Abstract: Cell recognition molecule L1 (CD171) plays an important role in neuronal survival, migration, differentiation, neurite outgrowth, myelination, synaptic plasticity and regeneration after injury. Our previous study has demonstrated that overexpressing L1 enhances cell survival and proliferation of mouse embryonic stem cells (ESCs) through promoting the expression of FUT9 and ST3Gal4, which upregulates cell surface sialylation and fucosylation. In the present study,more » we examined whether sialylation and fucosylation are involved in ESC differentiation through L1 signaling. RNA interference analysis showed that L1 enhanced differentiation of ESCs into neurons through the upregulation of FUT9 and ST3Gal4. Furthermore, blocking the phospholipase Cγ (PLCγ) signaling pathway with either a specific PLCγ inhibitor or knockdown PLCγ reduced the expression levels of both FUT9 and ST3Gal4 mRNAs and inhibited L1-mediated neuronal differentiation. These results demonstrate that L1 promotes neuronal differentiation from ESCs through the L1-mediated enhancement of FUT9 and ST3Gal4 expression.« less
Effect of PGE2 on the cell surface molecule expression in PMA treated thymocytes.
Daculsi, R; Vaillier, D; Carron, J C; Gualde, N
1998-02-01
PGE2 is produced by cells of the thymic microenvironment. The effects of PGE2 are mediated by cAMP through binding to its intracellular receptor protein kinase A (PKA). Phorbol 12-myristate 13-acetate (PMA) is known to modulate CD molecule expression on thymocytes, probably through activation of protein kinase C (PKC). We have hypothesized that cross-talk between these two signalling pathways may affect modulation of the CD molecules on the cell surface of thymocytes. For this purpose, we compare the effects of PMA alone or combined with PGE2 on CD3, CD4 and CD8 expression on mouse thymocytes by flow-cytometric analysis. PMA treatment almost completely abolished CD4 expression and slightly decreased CD3 and CD8 expression. PGE2 alone did not change the CD3, CD4 and CD8 molecule expression. Combined with PMA, PGE2 can overcome the decrease induced by PMA of the CD3 expression and partially reduced the disappearance of the CD4 molecule. On the other hand PGE2 accelerated the loss of CD8 molecule expression. These events occurred only in CD4+ CD8+ immature thymocytes. An analogue of cAMP (dibutyryl cAMP) mimics the effect of PGE2, but not Br-cGMP. This differential regulation by PGE2 of the CD molecule expression on immature thymocytes may provide additional evidence on the role of PGE2 during the process of thymic differentiation.
BIGH3 modulates adhesion and migration of hematopoietic stem and progenitor cells
Klamer, Sofieke E; Kuijk, Carlijn GM; Hordijk, Peter L; van der Schoot, C Ellen; von Lindern, Marieke; van Hennik, Paula B; Voermans, Carlijn
2013-01-01
Cell adhesion and migration are important determinants of homing and development of hematopoietic stem and progenitor cells (HSPCs) in bone marrow (BM) niches. The extracellular matrix protein transforming growth factor-β (TGF-β) inducible gene H3 (BIGH3) is involved in adhesion and migration, although the effect of BIGH3 is highly cell type-dependent. BIGH3 is abundantly expressed by mesenchymal stromal cells, while its expression in HSPCs is relatively low unless induced by certain BM stressors. Here, we set out to determine how BIGH3 modulates HSPC adhesion and migration. We show that primary HSPCs adhere to BIGH3-coated substrates, which is, in part, integrin-dependent. Overexpression of BIGH3 in HSPCs and HL60 cells reduced the adhesion to the substrate fibronectin in adhesion assays, which was even more profound in electrical cell-substrate impedance sensing (ECIS) assays. Accordingly, the CXCL12 induced migration over fibronectin-coated surface was reduced in BIGH3-expressing HSPCs. The integrin expression profile of HSPCs was not altered upon BIGH3 expression. Although expression of BIGH3 did not alter actin polymerization in response to CXCL12, it inhibited the PMA-induced activation of the small GTPase RAC1 as well as the phosphorylation and activation of extracellular-regulated kinases (ERKs). Reduced activation of ERK and RAC1 may be responsible for the inhibition of cell adhesion and migration by BIGH3 in HSPCs. Induced BIGH3 expression upon BM stress may contribute to the regulation of BM homeostasis. PMID:24152593
Dua, Harminder S.; Otri, Ahmad Muneer; Hopkinson, Andrew; Mohammed, Imran
2014-01-01
Purpose: Human β-defensins (HBDs) are an important part of the innate immune host defense at the ocular surface. Unlike other defensins, expression of HBD9 at the ocular surface is reduced during microbial infection, but activation of toll-like receptor 2 (TLR2) in corneal epithelial cells has been shown to up-regulate HBD9. Our purpose was to test the hypothesis that TLR2 has a key role in the signalling pathway(s) involved in the overexpression or underexpression of HBD9, and accordingly, different pathogens would induce a different expression pattern of HBD9. Methods: The in vitro RNAi silencing method and response to dexamethasone were used to determine key molecules involved in signalling pathways of HBD9 in immortalized human corneal epithelial cells. The techniques included cell culture with exposure to specific transcription factor inhibitors and bacteria, RNA extraction and cDNA synthesis, quantitative real-time polymerase chain reaction, and immunohistology. Results: This study demonstrates that TLR2 induces HBD9 mRNA and protein expression in a time- and dose-dependent manner. Transforming growth factor-β–activated kinase 1 (TAK1) plays a central role in HBD9 induction by TLR2, and transcription factors c-JUN and activating transcription factor 2 are also involved. Dexamethasone reduces TLR2-mediated up-regulation of HBD9 mRNA and protein levels in mitogen-activated protein kinase phosphatase 1 (MKP1)-dependent and c-JUN-independent manner. HBD9 expression differs with gram-negative and gram-positive bacteria. Conclusions: TLR2-mediated MKPs and nuclear factor-κB signalling pathways are involved in HBD9 expression. TAK-1 is a key molecule. These molecules can be potentially targeted to modulate HBD9 expression. Differential expression of HBD9 with different bacteria could be related to differences in pathogen-associated molecular patterns of these organisms. PMID:25646028
An MHC class I immune evasion gene of Marek׳s disease virus.
Hearn, Cari; Preeyanon, Likit; Hunt, Henry D; York, Ian A
2015-01-15
Marek׳s disease virus (MDV) is a widespread α-herpesvirus of chickens that causes T cell tumors. Acute, but not latent, MDV infection has previously been shown to lead to downregulation of cell-surface MHC class I (Virology 282:198-205 (2001)), but the gene(s) involved have not been identified. Here we demonstrate that an MDV gene, MDV012, is capable of reducing surface expression of MHC class I on chicken cells. Co-expression of an MHC class I-binding peptide targeted to the endoplasmic reticulum (bypassing the requirement for the TAP peptide transporter) partially rescued MHC class I expression in the presence of MDV012, suggesting that MDV012 is a TAP-blocking MHC class I immune evasion protein. This is the first unique non-mammalian MHC class I immune evasion gene identified, and suggests that α-herpesviruses have conserved this function for at least 100 million years. Copyright © 2014 Elsevier Inc. All rights reserved.
Qin, Nan; Tan, Xiaojuan; Jiao, Yinming; Liu, Lin; Zhao, Wangsheng; Yang, Shuang; Jia, Aiqun
2014-01-01
Bacterial biofilms are particularly problematic since they become resistant to most available antibiotics. Hence, novel potential antagonists to inhibit biofilm formation are urgent. Here the influences of two natural products, ursolic acid and resveratrol, on biofilm of the clinical methicillin-resistant Staphylococcus aureus (MRSA) isolate were investigated using RNA-seq, and the differentially expressed genes were analyzed using Cuffdiff. The results showed that ursolic acid inhibition of biofilm formation may reduce amino acids metabolism and adhesins expression and resveratrol may disturb quorum sensing (QS) and the synthesis of surface proteins and capsular polysaccharides. In addition, the transcriptome analysis of resveratrol and the combination of resveratrol with vancomycin inhibition of established biofilm revealed that resveratrol would disturb the expression of genes related to QS, surface and secreted proteins, and capsular polysaccharides. These findings suggest that ursolic acid and resveratrol could be useful to be adjunct therapies for the treatment of MRSA biofilm-involved infections. PMID:24970710
Pressey, Jessica C; Mahadevan, Vivek; Khademullah, C Sahara; Dargaei, Zahra; Chevrier, Jonah; Ye, Wenqing; Huang, Michelle; Chauhan, Alamjeet K; Meas, Steven J; Uvarov, Pavel; Airaksinen, Matti S; Woodin, Melanie A
2017-04-14
Synaptic inhibition depends on a transmembrane gradient of chloride, which is set by the neuron-specific K + -Cl - co-transporter KCC2. Reduced KCC2 levels in the neuronal membrane contribute to the generation of epilepsy, neuropathic pain, and autism spectrum disorders; thus, it is important to characterize the mechanisms regulating KCC2 expression. In the present study, we determined the role of KCC2-protein interactions in regulating total and surface membrane KCC2 expression. Using quantitative immunofluorescence in cultured mouse hippocampal neurons, we discovered that the kainate receptor subunit GluK2 and the auxiliary subunit Neto2 significantly increase the total KCC2 abundance in neurons but that GluK2 exclusively increases the abundance of KCC2 in the surface membrane. Using a live cell imaging assay, we further determined that KCC2 recycling primarily occurs within 1-2 h and that GluK2 produces an ∼40% increase in the amount of KCC2 recycled to the membrane during this time period. This GluK2-mediated increase in surface recycling translated to a significant increase in KCC2 expression in the surface membrane. Moreover, we found that KCC2 recycling is enhanced by protein kinase C-mediated phosphorylation of the GluK2 C-terminal residues Ser-846 and Ser-868. Lastly, using gramicidin-perforated patch clamp recordings, we found that the GluK2-mediated increase in KCC2 recycling to the surface membrane translates to a hyperpolarization of the reversal potential for GABA (E GABA ). In conclusion, our results have revealed a mechanism by which kainate receptors regulate KCC2 expression in the hippocampus. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
2012-01-01
Background 10-Hydroxy-2-decenoic acid, an unsaturated fatty acid is the most active and unique component to the royal jelly that has antimicrobial properties. Streptococcus mutans is associated with pathogenesis of oral cavity, gingivoperiodontal diseases and bacteremia following dental manipulations. In the oral cavity, S. mutans colonize the soft tissues including tongue, palate, and buccal mucosa. When considering the role of supragingival dental plaque in caries, the proportion of acid producing bacteria (particularly S. mutans), has direct relevance to the pathogenicity of the plaque. The genes that encode glucosyltransferases (gtfs) especially gtfB and gtfC are important in S. mutans colonization and pathogenesis. This study investigated the hydroxy-decenoic acid (HDA) effects on gtfB and gtfC expression and S. mutans adherence to cells surfaces. Methods Streptococcus mutans was treated by different concentrations of HPLC purified HDA supplied by Iran Beekeeping and Veterinary Association. Real time RT-PCR and western blot assays were conducted to evaluate gtfB and gtfC genes transcription and translation before and after HDA treatment. The bacterial attachment to the cell surfaces was evaluated microscopically. Results 500 μg ml-1 of HDA inhibited gtfB and gtfC mRNA transcription and its expression. The same concentration of HDA decreased 60% the adherence of S. mutans to the surface of P19 cells. Conclusion Hydroxy-decenoic acid prevents gtfB and gtfC expression efficiently in the bactericide sub-concentrations and it could effectively reduce S. mutans adherence to the cell surfaces. In the future, therapeutic approaches to affecting S. mutans could be selective and it’s not necessary to put down the oral flora completely. PMID:22839724
Yousefi, Behnam; Ghaderi, Shahrooz; Rezapoor-Lactooyi, Alireza; Amiri, Niusha; Verdi, Javad; Shoae-Hassani, Alireza
2012-07-28
10-Hydroxy-2-decenoic acid, an unsaturated fatty acid is the most active and unique component to the royal jelly that has antimicrobial properties. Streptococcus mutans is associated with pathogenesis of oral cavity, gingivoperiodontal diseases and bacteremia following dental manipulations. In the oral cavity, S. mutans colonize the soft tissues including tongue, palate, and buccal mucosa. When considering the role of supragingival dental plaque in caries, the proportion of acid producing bacteria (particularly S. mutans), has direct relevance to the pathogenicity of the plaque. The genes that encode glucosyltransferases (gtfs) especially gtfB and gtfC are important in S. mutans colonization and pathogenesis. This study investigated the hydroxy-decenoic acid (HDA) effects on gtfB and gtfC expression and S. mutans adherence to cells surfaces. Streptococcus mutans was treated by different concentrations of HPLC purified HDA supplied by Iran Beekeeping and Veterinary Association. Real time RT-PCR and western blot assays were conducted to evaluate gtfB and gtfC genes transcription and translation before and after HDA treatment. The bacterial attachment to the cell surfaces was evaluated microscopically. 500 μg ml-1 of HDA inhibited gtfB and gtfC mRNA transcription and its expression. The same concentration of HDA decreased 60% the adherence of S. mutans to the surface of P19 cells. Hydroxy-decenoic acid prevents gtfB and gtfC expression efficiently in the bactericide sub-concentrations and it could effectively reduce S. mutans adherence to the cell surfaces. In the future, therapeutic approaches to affecting S. mutans could be selective and it's not necessary to put down the oral flora completely.
Timed Knickkopf function is essential for wing cuticle formation in Drosophila melanogaster.
Li, Kaixia; Zhang, Xubo; Zuo, Ying; Liu, Weimin; Zhang, Jianzhen; Moussian, Bernard
2017-10-01
The insect cuticle is an extracellular matrix that consists of the polysaccharide chitin, proteins, lipids and organic molecules that are arranged in distinct horizontal layers. In Drosophila melanogaster, these layers are not formed sequentially, but, at least partially, at the same time. Timing of the underlying molecular mechanisms is conceivably crucial for cuticle formation. To study this issue, we determined the time period during which the function of Knickkopf (Knk), a key factor of chitin organization, is required for wing cuticle differentiation in D. melanogaster. Although knk is expressed throughout metamorphosis, we demonstrate that its expression 30 h prior and 48 h after pupariation is essential for correct wing cuticle formation. In other words, expression beyond this period is futile. Importantly, manipulation of Knk expression during this time causes wing bending suggesting an effect of Knk amounts on the physical properties of the wing cuticle. Manipulation of Knk expression also interferes with the structure and function of the cuticle surface. First, we show that the shape of surface nano-structures depends on the expression levels of knk. Second, we find that cuticle impermeability is compromised in wings with reduced knk expression. In summary, despite the extended supply of Knk during metamorphosis, controlled amounts of Knk are important for correct wing cuticle differentiation and function in a concise period of time. Copyright © 2017 Elsevier Ltd. All rights reserved.
Immunoglobulin light chain allelic inclusion in systemic lupus erythematosus.
Fraser, Louise D; Zhao, Yuan; Lutalo, Pamela M K; D'Cruz, David P; Cason, John; Silva, Joselli S; Dunn-Walters, Deborah K; Nayar, Saba; Cope, Andrew P; Spencer, Jo
2015-08-01
The principles of allelic exclusion state that each B cell expresses a single light and heavy chain pair. Here, we show that B cells with both kappa and lambda light chains (Igκ and Igλ) are enriched in some patients with the systemic autoimmune disease systemic lupus erythematosus (SLE), but not in the systemic autoimmune disease control granulomatosis with polyangiitis. Detection of dual Igκ and Igλ expression by flow cytometry could not be abolished by acid washing or by DNAse treatment to remove any bound polyclonal antibody or complexes, and was retained after two days in culture. Both surface and intracytoplasmic dual light chain expression was evident by flow cytometry and confocal microscopy. We observed reduced frequency of rearrangements of the kappa-deleting element (KDE) in SLE and an inverse correlation between the frequency of KDE rearrangement and the frequency of dual light chain expressing B cells. We propose that dual expression of Igκ and Igλ by a single B cell may occur in some patients with SLE when this may be a consequence of reduced activity of the KDE. © 2015 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
de Barros, Patrícia Pimentel; Freire, Fernanda; Rossoni, Rodnei Dennis; Junqueira, Juliana Campos; Jorge, Antonio Olavo Cardoso
2017-07-01
Pathogenicity of Candida albicans is associated with its capacity switch from yeast-like to hyphal growth. The hyphal form is capable to penetrate the epithelial surfaces and to damage the host tissues. Therefore, many investigations have focused on mechanisms that control the morphological transitions of C. albicans. Recently, certain studies have showed that non-albicans Candida species can reduce the capacity of C. albicans to form biofilms and to develop candidiasis in animal models. Then, the objective of this study was to evaluate the effects of Candida krusei and Candida glabrata on the morphogenesis of C. albicans. Firstly, the capacity of reference and clinical strains of C. albicans in forming hyphae was tested in vitro. After that, the expression of HWP1 (hyphal wall protein 1) gene was determined by quantitative real-time PCR (polymerase chain reaction) assay. For both reference and clinical strains, a significant inhibition of the hyphae formation was observed when C. albicans was incubated in the presence of C. krusei or C. glabrata compared to the control group composed only by C. albicans. In addition, the culture mixed of C. albicans-C. krusei or C. albicans-C. glabrata reduced significantly the expression of HWP1 gene of C. albicans in relation to single cultures of this specie. In both filamentation and gene expression assays, C. krusei showed the higher inhibitory activity on the morphogenesis of C. albicans compared to C. glabrata. C. krusei and C. glabrata are capable to reduce the filamentation of C. albicans and consequently decrease the expression of the HWP1 gene.
[Long-term expansion of multipotent mesenchymal stromal cells under reduced oxygen tension].
Rylova, Iu V; Buravkova, L B
2013-01-01
We have shown that the decrease in oxygen tension in the culture medium of multipotent mesenchymal stromal cells (MMSCs) results in a short-term reduction in the proportion of CD73(+)-cells in the population, without effecting the number of cells expressing other constitutive surface markers (CD90 and CD105). In this case, the heterogeneity of the cell population declined: large spread cells disappeared. The proliferative activity of MMSCs significantly increased and remained stable in conditions in which the oxygen content was close to the tissue oxygen levels (5% O2). At lower oxygen concentration, proliferative activity of the cells gradually reduced from passages 3-4. The increase in proliferative activity was not accompanied by increased expression of telomerase gene indicateding the alsance of cell transformation. However, genome-wide analysis of MMSC gene expression level revealed changes in expression of cyclins (CCND2 and PCNA), regulatory subunit cyclin-dependent kinase (CKS2) and an inhibitor of cyclin-dependent kinase (CDKN2C), regulating the cell cycle, which is obviously facilitated the increase in the proliferative capacity of cells at lower oxygen tension.
Contributions of feature shapes and surface cues to the recognition of facial expressions.
Sormaz, Mladen; Young, Andrew W; Andrews, Timothy J
2016-10-01
Theoretical accounts of face processing often emphasise feature shapes as the primary visual cue to the recognition of facial expressions. However, changes in facial expression also affect the surface properties of the face. In this study, we investigated whether this surface information can also be used in the recognition of facial expression. First, participants identified facial expressions (fear, anger, disgust, sadness, happiness) from images that were manipulated such that they varied mainly in shape or mainly in surface properties. We found that the categorization of facial expression is possible in either type of image, but that different expressions are relatively dependent on surface or shape properties. Next, we investigated the relative contributions of shape and surface information to the categorization of facial expressions. This employed a complementary method that involved combining the surface properties of one expression with the shape properties from a different expression. Our results showed that the categorization of facial expressions in these hybrid images was equally dependent on the surface and shape properties of the image. Together, these findings provide a direct demonstration that both feature shape and surface information make significant contributions to the recognition of facial expressions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Zhang, Songmei; Qiu, Jing; Ren, Yanfang; Yu, Weiqiang; Zhang, Fuqiang; Liu, Xiuxin
2016-04-01
Corrosion of dental alloys is a major concern in dental restorations. Streptococcus mutans reduces the pH in oral cavity and induces demineralization of the enamel as well as corrosion of restorative dental materials. The rough surfaces of dental alloys induced by corrosion enhance the subsequent accumulation of plaque. In this study, the corrosion process of nickel-chromium (Ni-Cr) and cobalt-chromium (Co-Cr) alloys in a nutrient-rich medium containing S. mutans was studied using inductively coupled plasma atomic emission spectrometry (ICP-AES), X-ray photoelectron spectroscopy (XPS) and electrochemical corrosion test. Our results showed that the release of Ni and Co ions increased, particularly after incubation for 3 days. The electrochemical corrosion results showed a significant decrease in the corrosion resistance (Rp) value after the alloys were immersed in the media containing S. mutans for 3 days. Correspondingly, XPS revealed a reduction in the relative dominance of Ni, Co, and Cr in the surface oxides after the alloys were immersed in the S. mutans culture. After removal of the biofilm, the pre-corroded alloys were re-incubated in S. mutans medium, and the expressions of genes associated with the adhesion and acidogenesis of S. mutans, including gtfBCD, gbpB, fif and ldh, were evaluated by detecting the mRNA levels using real-time reverse transcription polymerase chain reaction (RT-PCR). We found that the gtfBCD, gbpB, ftf and Idh expression of S. mutans were noticeably increased after incubation with pre-corroded alloys for 24 h. This study demonstrated that S. mutans enhanced the corrosion behavior of the dental alloys, on the other hand, the presence of corroded alloy surfaces up-regulated the virulent gene expression in S. mutans. Compared with smooth surfaces, the rough corroded surfaces of dental alloys accelerated the bacteria-adhesion and corrosion process by changing the virulence gene expression of S. mutans.
Kato, Takuya; Hayashi, Hisamitsu; Sugiyama, Yuichi
2010-09-01
The reduced expression of the bile salt export pump (BSEP/ABCB11) at the canalicular membrane is associated with cholestasis-induced hepatotoxicity due to the accumulation of bile acids in hepatocytes. We previously reported that 4-phenylbutyrate (4PBA), an approved drug for urea cycle disorders, is a promising agent for intrahepatic cholestasis because it increases both the cell surface expression and the transport capacity of BSEP. In the present study, we searched for effective compounds other than 4PBA by focusing on short- and medium-chain fatty acids, which have similar characteristics to 4PBA such as their low-molecular-weight and a carboxyl group. In transcellular transport studies using Madin-Darby canine kidney (MDCK) II cells, all short- and medium-chain fatty acids tested except for formate, acetate, and hexanoic acid showed more potent effects on wild type (WT) BSEP-mediated [3H]taurocholate transport than did 4PBA. The increase in WT BSEP transport with butyrate and octanoic acid treatment correlated with an increase in its expression at the cell surface. Two PFIC2-type variants, E297G and D482G BSEP, were similarly affected with both compounds treatment. The prolonged half-life of cell surface-resident WT BSEP was responsible for this increased octanoic acid-stimulated transport, but not for that of butyrate. In conclusion, short- and medium-chain fatty acids have potent effects on the increase in WT and PFIC2-type BSEP-mediated transport in MDCK II cells. Although both short- and medium-chain fatty acids enhance the transport capacity of WT and PFIC2-type BSEP by inducing those expressions at the cell surface, the underlying mechanism seems to differ between fatty acids. 2010 Elsevier B.V. All rights reserved.
Acoustic field of a wedge-shaped section of a spherical cap transducer
NASA Astrophysics Data System (ADS)
Ketterling, Jeffrey A.
2003-12-01
The acoustic pressure field at an arbitrary point in space is derived for a wedge-shaped section of a spherical cap transducer using the spatial impulse response (SIR) method. For a spherical surface centered at the origin, a wedge shape is created by taking cuts in the X-Y and X-Z planes and removing the smallest surface component. Analytic expressions are derived for the SIR based on spatial location. The expressions utilize the SIR solutions for a spherical cap transducer [Arditi et al., Ultrason. Imaging 3, 37-61 (1981)] with additional terms added to account for the reduced surface area of the wedge. Results from the numerical model are compared to experimental measurements from a wedge transducer with an 8-cm outer diameter and 9-cm geometric focus. The experimental and theoretical -3-dB beamwidths agreed to within 10%+/-5%. The SIR model for a wedge-shaped transducer is easily extended to other spherically curved transducer geometries that consist of combinations of wedge sections and spherical caps.
Acoustic field of a wedge-shaped section of a spherical cap transducer.
Ketterling, Jeffrey A
2003-12-01
The acoustic pressure field at an arbitrary point in space is derived for a wedge-shaped section of a spherical cap transducer using the spatial impulse response (SIR) method. For a spherical surface centered at the origin, a wedge shape is created by taking cuts in the X-Y and X-Z planes and removing the smallest surface component. Analytic expressions are derived for the SIR based on spatial location. The expressions utilize the SIR solutions for a spherical cap transducer [Arditi et al., Ultrason. Imaging 3, 37-61 (1981)] with additional terms added to account for the reduced surface area of the wedge. Results from the numerical model are compared to experimental measurements from a wedge transducer with an 8-cm outer diameter and 9-cm geometric focus. The experimental and theoretical -3-dB beamwidths agreed to within 10% +/- 5%. The SIR model for a wedge-shaped transducer is easily extended to other spherically curved transducer geometries that consist of combinations of wedge sections and spherical caps.
Novel antioxidant capability of titanium induced by UV light treatment.
Ueno, Takeshi; Ikeda, Takayuki; Tsukimura, Naoki; Ishijima, Manabu; Minamikawa, Hajime; Sugita, Yoshihiko; Yamada, Masahiro; Wakabayashi, Noriyuki; Ogawa, Takahiro
2016-11-01
The intracellular production of reactive oxygen species (ROS) is a representative form of cellular oxidative stress and plays an important role in triggering adverse cellular events, such as the inflammatory reaction and delayed or compromised differentiation. Osteoblastic reaction to titanium with particular focus on ROS production remains unknown. Ultraviolet (UV) light treatment improves the physicochemical properties of titanium, specifically the induction of super hydrophilicity and removal of hydrocarbon, and eventually enhances its osteoconductivity. We hypothesized that there is a favorable regulatory change of ROS production within osteoblasts in contact with UV-treated titanium. Osteoblasts were cultured on titanium disks with or without UV-pretreatment. The intracellular production of ROS was higher on acid-etch-created rough titanium surfaces than on machine-prepared smooth ones. The ROS production was reduced by 40-50% by UV pretreatment of titanium regardless of the surface roughness. Oxidative DNA damage, as detected by 8-OHdG expression, was alleviated by 50% on UV-treated titanium surfaces. The expression of inflammatory cytokines was consistently lower in osteoblasts cultured on UV-treated titanium. ROS scavenger, glutathione, remained more without being depleted in osteoblasts on UV-treated titanium. Bio-burden test further showed that culturing osteoblasts on UV-treated titanium can significantly reduce the ROS production even with the presence of hydrogen peroxide, an oxidative stress inducer. These data suggest that the intracellular production of ROS and relevant inflammatory reaction, which unavoidably occurs in osteoblasts in contact with titanium, can be significantly reduced by UV pretreatment of titanium, implying a novel antioxidant capability of the particular titanium. Copyright © 2016 Elsevier Ltd. All rights reserved.
Tan, King L; Jankova, Lucy; Chan, Charles; Fung, Caroline L-S; Clarke, Candice; Lin, Betty P C; Robertson, Graham; Molloy, Mark; Chapuis, Pierre H; Bokey, Les; Dent, Owen F; Clarke, Stephen J
2011-12-01
This study investigated the association between glutathione S-transferase Pi (GST Pi) expression, histopathology and overall survival in 468 patients after resection of stage C colonic adenocarcinoma. Data were drawn from a prospective hospital registry of consecutive bowel cancer resections with a minimum follow-up of 5 years. Nuclear and cytoplasmic GST Pi expression, assessed by both intensity of staining and percentage of stained cells at both the central part of the tumour and the invasive tumour front, were evaluated retrospectively by tissue microarray immunohistochemistry on archival specimens. The most effective measure of GST Pi expression was the percentage of immunostained nuclei in central tumour tissue, where >40% stained was associated significantly with high grade, invasion beyond the muscularis propria, involvement of a free serosal surface or apical node, and invasion into an adjacent organ or structure. After adjustment of other predictors, GST Pi expression remained independently prognostic for reduced overall survival (hazard ratio 1.4, P = 0.002). In patients with clinicopathological stage C colonic cancer, GST Pi expression is associated with features of tumour aggressiveness and with reduced overall survival. Further appropriately designed studies should aim to discover whether GST Pi can predict response to adjuvant chemotherapy. © 2011 Blackwell Publishing Limited.
Leishmania cell surface prohibitin: role in host-parasite interaction.
Jain, Rohit; Ghoshal, Angana; Mandal, Chitra; Shaha, Chandrima
2010-04-01
Proteins selectively upregulated in infective parasitic forms could be critical for disease pathogenesis. A mammalian prohibitin orthologue is upregulated in infective metacyclic promastigotes of Leishmania donovani, a parasite that causes visceral leishmaniasis. Leishmania donovani prohibitin shares 41% similarity with mammalian prohibitin and 95-100% within the genus. Prohibitin is concentrated at the surface of the flagellar and the aflagellar pole, the aflagellar pole being a region through which host-parasite interactions occur. Prohibitin is attached to the membrane through a GPI anchor. Overexpression of wild-type prohibitin increases protein surface density resulting in parasites with higher infectivity. However, parasites overexpressing a mutant prohibitin with an amino acid substitution at the GPI anchor site to prevent surface expression through GPI-link show lesser surface expression and lower infective abilities. Furthermore, the presence of anti-prohibitin antibodies during macrophage-Leishmania interaction in vitro reduces infection. The cognate binding partner for Leishmania prohibitin on the host cell appears to be macrophage surface HSP70, siRNA mediated downregulation of which abrogates the capability of the macrophage to bind to parasites. Leishmania prohibitin is able to generate a strong humoral response in visceral leishmaniasis patients. The above observations suggest that prohibitin plays an important role in events leading to Leishmania-host interaction.
Schicht, Martin; Garreis, Fabian; Hartjen, Nadine; Beileke, Stephanie; Jacobi, Christina; Sahin, Afsun; Holland, Detlef; Schröder, Henrik; Hammer, Christian M; Paulsen, Friedrich; Bräuer, Lars
2018-06-28
The study aimed to characterize the expression and function of SFTA3 at the ocular surface and in tears. Ocular tissues, conjunctival (HCjE) and human corneal (HCE) epithelial cell lines as well as tearfilm of patients suffering from different forms of dry eye disease (DED) were analyzed by means of RT-PCR, western blot, immunohistochemistry, and ELISA. A possible role of recombinant SFTA3 in corneal wound healing was investigated performing in vitro scratch assays. Tear film regulatory properties were analyzed with the spinning drop method and the regulation of SFTA3 transcripts was studied in HCE and HCjE after incubation with proinflammatory cytokines as well as typical ocular pathogens by real-time RT-PCR and ELISA. The results reveal that human ocular tissue as well as tears of healthy volunteers express SFTA3 whereas tears from patients with DED showed significantly increased SFTA3 levels. In vitro wounding of HCE cell cultures that had been treated with recombinant SFTA3 demonstrated a significantly increased wound closure rate and rSFTA3 reduced the surface tension of tear fluid. The results indicate that SFTA3 at the ocular surface seemed to be involved in wound healing and the reduction of surface tension.
Lawrence, Alexandra; Xu, Xin; Bible, Melissa D; Calve, Sarah; Neu, Corey P; Panitch, Alyssa
2015-12-01
The lubricating proteoglycan, lubricin, facilitates the remarkable low friction and wear properties of articular cartilage in the synovial joints of the body. Lubricin lines the joint surfaces and plays a protective role as a boundary lubricant in sliding contact; decreased expression of lubricin is associated with cartilage degradation and the pathogenesis of osteoarthritis. An unmet need for early osteoarthritis treatment is the development of therapeutic molecules that mimic lubricin function and yet are also resistant to enzymatic degradation common in the damaged joint. Here, we engineered a lubricin mimic (mLub) that is less susceptible to enzymatic degradation and binds to the articular surface to reduce friction. mLub was synthesized using a chondroitin sulfate backbone with type II collagen and hyaluronic acid (HA) binding peptides to promote interaction with the articular surface and synovial fluid constituents. In vitro and in vivo characterization confirmed the binding ability of mLub to isolated type II collagen and HA, and to the cartilage surface. Following trypsin treatment to the cartilage surface, application of mLub, in combination with purified or commercially available hyaluronan, reduced the coefficient of friction, and adhesion, to control levels as assessed over macro-to micro-scales by rheometry and atomic force microscopy. In vivo studies demonstrate an mLub residency time of less than 1 week. Enhanced lubrication by mLub reduces surface friction and adhesion, which may suppress the progression of degradation and cartilage loss in the joint. mLub therefore shows potential for treatment in early osteoarthritis following injury. Copyright © 2015 Elsevier Ltd. All rights reserved.
Behbehani, Gregory K.; Thom, Colin; Zunder, Eli R.; Finck, Rachel; Gaudilliere, Brice; Fragiadakis, Gabriela K.; Fantl, Wendy J.; Nolan, Garry P.
2015-01-01
Fluorescent cellular barcoding and mass-tag cellular barcoding are cytometric methods that enable high sample throughput, minimize inter-sample variation, and reduce reagent consumption. Previously employed barcoding protocols require that barcoding be performed after surface marker staining, complicating combining the technique with measurement of alcohol-sensitive surface epitopes. This report describes a method of barcoding fixed cells after a transient partial permeabilization with 0.02% saponin that results in efficient and consistent barcode staining with fluorescent or mass-tagged reagents while preserving surface marker staining. This approach simplifies barcoding protocols and allows direct comparison of surface marker staining of multiple samples without concern for variations in the antibody cocktail volume, antigen-antibody ratio, or machine sensitivity. Using this protocol, cellular barcoding can be used to reliably detect subtle differences in surface marker expression. PMID:25274027
Goppelt-Struebe, M; Reiser, C O; Schneider, N; Grell, M
1996-10-01
Regulation of tumor necrosis factor receptors by glucocorticoids was investigated during phorbol ester-induced monocytic differentiation. As model system the human monocytic cell lines U937 and THP-1, which express both types of TNF receptors (TNF-R60 and TNF-R80), were differentiated with tetradecanoyl phorbol-13-acetate (TPA, 5 x 10(-9) M) in the presence or absence of dexamethasone (10(-9) - 10(-6) M). Expression of TNF receptors was determined at the mRNA level by Northern blot analysis and at the protein level by FACS analysis. During differentiation, TNF-R60 mRNA was down-regulated, whereas TNF-R80 mRNA levels were increased. Dexamethasone had no effect on TNF-R60 mRNA expression but attenuated TNF-R80 mRNA expression in both cell lines. Cell surface expression of TNF-R60 protein remained essentially unchanged during differentiation of THP-1 cells, whereas a rapid down-regulation of TNF-R80 was observed that was followed by a slow recovery. Surface expression of TNF-R80 was not affected by dexamethasone, whereas TNF-R60 expression was reduced by about 25%. These results indicate differential regulation of the two types of TNF receptors at the mRNA and protein level during monocytic differentiation. Glucocorticoids interfered with mRNA expression of TNF-R80 and protein expression of TNF-R60, but the rather limited effect leaves the question of its functional relevance open. In contrast to other cytokine systems, TNF receptors do not appear to be major targets of glucocorticoid action.
Lifeng, Zhao; Yan, Hong; Dayun, Yang; Xiaoying, Lü; Tingfei, Xi; Deyuan, Zhang; Ying, Hong; Jinfeng, Yuan
2011-04-01
TiN coating has been demonstrated to improve the biocompatibility of bare NiTi alloys; however, essential biocompatibility differences between NiTi alloys before and after TiN coating are not known so far. In this study, to explore the underlying biological mechanisms of biocompatibility differences between them, the changes of bare and TiN-coated NiTi alloys in surface chemical composition, morphology, hydrophilicity, Ni ions release, cytotoxicity, apoptosis, and gene expression profiles were compared using energy-dispersive spectroscopy, scanning electron microscopy, contact angle, surface energy, Ni ions release analysis, the methylthiazoltetrazolium (MTT) method, flow cytometry and microarray methods, respectively. Pathways binding to networks and real-time polymerase chain reaction (PCR) were employed to analyze and validate the microarray data, respectively. It was found that, compared with the bare NiTi alloys, TiN coating significantly decreased Ni ions content on the surfaces of the NiTi alloys and reduced the release of Ni ions from the alloys, attenuated the inhibition of Ni ions to the expression of genes associated with anti-inflammatory, and also suppressed the promotion of Ni ions to the expression of apoptosis-related genes. Moreover, TiN coating distinctly improved the hydrophilicity and uniformity of the surfaces of the NiTi alloys, and contributed to the expression of genes participating in cell adhesion and other physiological activities. These results indicate that the TiN-coated NiTi alloys will help overcome the shortcomings of NiTi alloys used in clinical application currently, and can be expected to be a replacement of biomaterials for a medical device field.
Induction of IL-17 production from human peripheral blood CD4+ cells by asbestos exposure.
Maeda, Megumi; Chen, Ying; Lee, Suni; Kumagai-Takei, Naoko; Yoshitome, Kei; Matsuzaki, Hidenori; Yamamoto, Shoko; Hatayama, Tamayo; Ikeda, Miho; Nishimura, Yasumitsu; Otsuki, Takemi
2017-06-01
We have previously reported that chronic, recurrent and low-dose exposure to asbestos fibers causes a reduction in antitumor immunity. Investigation of natural killer (NK) cells using an in vitro cell line model and comprising in vitro activation using freshly isolated NK cells co-cultured with chrysotile fibers, as well as NK cells derived from asbestos-exposed patients with pleural plaque (PP) or malignant mesothelioma (MM), revealed decreased expression of NK cell activating receptors such as NKG2D, 2B4 and NKp46. An in vitro differentiation and clonal expansion model for CD8+ cytotoxic T lymphocytes (CTLs) showed reduced cytotoxicity with decreased levels of cytotoxic molecules such as granzyme B and perforin, as well as suppressed proliferation of CTLs. Additionally, analysis of T helper cells showed that surface CXCR3, chemokine receptor, and the productive potential of interferon (IFN)γ were reduced following asbestos exposure in an in vitro cell line model and in peripheral CD4+ cells of asbestos-exposed patients. Moreover, experiments revealed that asbestos exposure enhanced regulatory T cell (Treg) function. This study also focused on CXCR3 expression and the Th-17 cell fraction. Following activation with T-cell receptor and co-culture with various concentrations of chrysotile fibers using freshly isolated CD4+ surface CXCR3 positive and negative fractions, the intracellular expression of CXCR3, IFNγ and IL-17 remained unchanged when co-cultured with chrysotile. However, subsequent re-stimulation with phorbol 12-myristate 13-acetate (PMA) and ionomycin resulted in enhanced IL-17 production and expression, particularly in CD4+ surface CXCR3 positive cells. These results indicated that the balance and polarization between Treg and Th-17 fractions play an important role with respect to the immunological effects of asbestos and the associated reduction in antitumor immunity.
Lindner, Karina; Ströbele, Michael; Schlick, Sandra; Webering, Sina; Jenckel, André; Kopf, Johannes; Danov, Olga; Sewald, Katherina; Buj, Christian; Creutzenberg, Otto; Tillmann, Thomas; Pohlmann, Gerhard; Ernst, Heinrich; Ziemann, Christina; Hüttmann, Gereon; Heine, Holger; Bockhorn, Henning; Hansen, Tanja; König, Peter; Fehrenbach, Heinz
2017-03-21
Carbon black nanoparticles (CBNP) are mainly composed of carbon, with a small amount of other elements (including hydrogen and oxygen). The toxicity of CBNP has been attributed to their large surface area, and through adsorbing intrinsically toxic substances, such as polycyclic aromatic hydrocarbons (PAH). It is not clear whether a PAH surface coating changes the toxicological properties of CBNP by influencing their physicochemical properties, through the specific toxicity of the surface-bound PAH, or by a combination of both. Printex ® 90 (P90) was used as CBNP; the comparators were P90 coated with either benzo[a]pyrene (BaP) or 9-nitroanthracene (9NA), and soot from acetylene combustion that bears various PAHs on the surface (AS-PAH). Oxidative stress and IL-8/KC mRNA expression were determined in A549 and bronchial epithelial cells (16HBE14o-, Calu-3), mouse intrapulmonary airways and tracheal epithelial cells. Overall toxicity was tested in a rat inhalation study according to Organization for Economic Co-operation and Development (OECD) criteria. Effects on cytochrome monooxygenase (Cyp) mRNA expression, cell viability and mucociliary clearance were determined in acute exposure models using explanted murine trachea. All particles had similar primary particle size, shape, hydrodynamic diameter and ζ-potential. All PAH-containing particles had a comparable specific surface area that was approximately one third that of P90. AS-PAH contained a mixture of PAH with expected higher toxicity than BaP or 9NA. PAH-coating reduced some effects of P90 such as IL-8 mRNA expression and oxidative stress in A549 cells, granulocyte influx in the in vivo OECD experiment, and agglomeration of P90 and mucus release in the murine trachea ex vivo. Furthermore, P90-BaP decreased particle transport speed compared to P90 at 10 μg/ml. In contrast, PAH-coating induced IL-8 mRNA expression in bronchial epithelial cell lines, and Cyp mRNA expression and apoptosis in tracheal epithelial cells. In line with the higher toxicity compared to P90-BaP and P90-9NA, AS-PAH had the strongest biological effects both ex vivo and in vivo. Our results demonstrate that the biological effect of CBNP is determined by a combination of specific surface area and surface-bound PAH, and varies in different target cells.
Cauchy problem as a two-surface based ‘geometrodynamics’
NASA Astrophysics Data System (ADS)
Rácz, István
2015-01-01
Four-dimensional spacetimes foliated by a two-parameter family of homologous two-surfaces are considered in Einstein's theory of gravity. By combining a 1 + (1 + 2) decomposition, the canonical form of the spacetime metric and a suitable specification of the conformal structure of the foliating two-surfaces, a gauge fixing is introduced. It is shown that, in terms of the chosen geometrically distinguished variables, the 1 + 3 Hamiltonian and momentum constraints can be recast into the form of a parabolic equation and a first order symmetric hyperbolic system, respectively. Initial data to this system can be given on one of the two-surfaces foliating the three-dimensional initial data surface. The 1 + 3 reduced Einstein's equations are also determined. By combining the 1 + 3 momentum constraint with the reduced system of the secondary 1 + 2 decomposition, a mixed hyperbolic-hyperbolic system is formed. It is shown that solutions to this mixed hyperbolic-hyperbolic system are also solutions to the full set of Einstein's equations provided that the 1 + 3 Hamiltonian constraint is solved on the initial data surface {{Σ }0} and the 1 + 2 Hamiltonian and momentum type expressions vanish on a world-tube yielded by the Lie transport of one of the two-surfaces foliating {{Σ }0} along the time evolution vector field. Whenever the foliating two-surfaces are compact without boundary in the spacetime and a regular origin exists on the time-slices—this is the location where the foliating two-surfaces smoothly reduce to a point—it suffices to guarantee that the 1 + 3 Hamiltonian constraint holds on the initial data surface. A short discussion on the use of the geometrically distinguished variables in identifying the degrees of freedom of gravity are also included. Dedicated to Zoltán Cseke on the occasion of his 70th birthday.
Wood, Peta; Mulay, Vishwaroop; Darabi, Masoud; Chan, Karen Cecilia; Heeren, Joerg; Pol, Albert; Lambert, Gilles; Rye, Kerry-Anne; Enrich, Carlos; Grewal, Thomas
2011-01-01
The mitogen-activated protein kinase (MAPK) Erk1/2 has been implicated to modulate the activity of nuclear receptors, including peroxisome proliferator activator receptors (PPARs) and liver X receptor, to alter the ability of cells to export cholesterol. Here, we investigated if the Ras-Raf-Mek-Erk1/2 signaling cascade could affect reverse cholesterol transport via modulation of scavenger receptor class BI (SR-BI) levels. We demonstrate that in Chinese hamster ovary (CHO) and human embryonic kidney (HEK293) cells, Mek1/2 inhibition reduces PPARα-inducible SR-BI protein expression and activity, as judged by reduced efflux onto high density lipoprotein (HDL). Ectopic expression of constitutively active H-Ras and Mek1 increases SR-BI protein levels, which correlates with elevated PPARα Ser-21 phosphorylation and increased cholesterol efflux. In contrast, SR-BI levels are insensitive to Mek1/2 inhibitors in PPARα-depleted cells. Most strikingly, Mek1/2 inhibition promotes SR-BI degradation in SR-BI-overexpressing CHO cells and human HuH7 hepatocytes, which is associated with reduced uptake of radiolabeled and 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyane-labeled HDL. Loss of Mek1/2 kinase activity reduces SR-BI expression in the presence of bafilomycin, an inhibitor of lysosomal degradation, indicating down-regulation of SR-BI via proteasomal pathways. In conclusion, Mek1/2 inhibition enhances the PPARα-dependent degradation of SR-BI in hepatocytes. PMID:21525007
Majeed, Sophia R; Vasudevan, Lavanya; Chen, Chih-Ying; Luo, Yi; Torres, Jorge A; Evans, Timothy M; Sharkey, Andrew; Foraker, Amy B; Wong, Nicole M L; Esk, Christopher; Freeman, Theresa A; Moffett, Ashley; Keen, James H; Brodsky, Frances M
2014-05-23
The clathrin light chain (CLC) subunits participate in several membrane traffic pathways involving both clathrin and actin, through binding the actin-organizing huntingtin-interacting proteins (Hip). However, CLCs are dispensable for clathrin-mediated endocytosis of many cargoes. Here we observe that CLC depletion affects cell migration through Hip binding and reduces surface expression of β1-integrin by interference with recycling following normal endocytosis of inactive β1-integrin. CLC depletion and expression of a modified CLC also inhibit the appearance of gyrating (G)-clathrin structures, known mediators of rapid recycling of transferrin receptor from endosomes. Expression of the modified CLC reduces β1-integrin and transferrin receptor recycling, as well as cell migration, implicating G-clathrin in these processes. Supporting a physiological role for CLC in migration, the CLCb isoform of CLC is upregulated in migratory human trophoblast cells during uterine invasion. Together, these studies establish CLCs as mediating clathrin-actin interactions needed for recycling by G-clathrin during migration.
Manning, John T; Seregin, Alexey V; Yun, Nadezhda E; Koma, Takaaki; Huang, Cheng; Barral, José; de la Torre, Juan C; Paessler, Slobodan
2017-01-01
Junin virus (JUNV), a highly pathogenic New World arenavirus, is the causative agent of Argentine hemorrhagic fever (AHF). The live-attenuated Candid #1 (Can) strain currently serves as a vaccine for at-risk populations. We have previously shown that the Can glycoprotein (GPC) gene is the primary gene responsible for attenuation in a guinea pig model of AHF. However, the mechanisms through which the GPC contributes to the attenuation of the Can strain remain unknown. A more complete understanding of the mechanisms underlying the attenuation and immunogenicity of the Can strain will potentially allow for the rational design of additional safe and novel vaccines. Here, we provide a detailed comparison of both RNA and protein expression profiles between both inter- and intra-segment chimeric JUNV recombinant clones expressing combinations of genes from the Can strain and the pathogenic Romero (Rom) strain. The recombinant viruses that express Can GPC, which were shown to be attenuated in guinea pigs, displayed different RNA levels and GPC processing patterns as determined by Northern and Western blot analyses, respectively. Analysis of recombinant viruses containing amino acid substitutions selected at different mouse brain passages during the generation of Can revealed that altered Can GPC processing was primarily due to the T168A substitution within G1, which eliminates an N-linked glycosylation motif. Incorporation of the T168A substitution in the Rom GPC resulted in a Can-like processing pattern of Rom GPC. In addition, JUNV GPCs containing T168A substitution were retained within the endoplasmic reticulum (ER) and displayed significantly lower cell surface expression than wild-type Rom GPC. Interestingly, the reversion A168T in Can GPC significantly increased GPC expression at the cell surface. Our results demonstrate that recombinant JUNV (rJUNV) expressing Can GPC display markedly different protein expression and elevated genomic RNA expression when compared to viruses expressing Rom GPC. Additionally, our findings indicate that the N-linked glycosylation motif at amino acid positions 166-168 is important for trafficking of JUNV GPC to the cell surface, and the elimination of this motif interferes with the GPC release from the ER.
Takahashi, Yoichiro; Kubo, Rieko; Sano, Rie; Nakajima, Tamiko; Takahashi, Keiko; Kobayashi, Momoko; Handa, Hiroshi; Tsukada, Junichi; Kominato, Yoshihiko
2017-03-01
The ABO system is of fundamental importance in the fields of transfusion and transplantation and has apparent associations with certain diseases, including cardiovascular disorders. ABO expression is reduced in the late phase of erythroid differentiation in vitro, whereas histone deacetylase inhibitors (HDACIs) are known to promote cell differentiation. Therefore, whether or not HDACIs could reduce the amount of ABO transcripts and A or B antigens is an intriguing issue. Quantitative polymerase chain reactions were carried out for the ABO transcripts in erythroid-lineage K562 and epithelial-lineage KATOIII cells after incubation with HDACIs, such as sodium butyrate, panobinostat, vorinostat, and sodium valproate. Flow cytometric analysis was conducted to evaluate the amounts of antigen in KATOIII cells treated with panobinostat. Quantitative chromatin immunoprecipitation (ChIP) assays and luciferase assays were performed on both cell types to examine the mechanisms of ABO suppression. HDACIs reduced the ABO transcripts in both K562 and KATOIII cells, with panobinostat exerting the most significant effect. Flow cytometric analysis demonstrated a decrease in B-antigen expression on panobinostat-treated KATOIII cells. ChIP assays indicated that panobinostat altered the modification of histones in the transcriptional regulatory regions of ABO, and luciferase assays demonstrated reduced activity of these elements. ABO transcription seems to be regulated by an epigenetic mechanism. Panobinostat appears to suppress ABO transcription, reducing the amount of antigens on the surface of cultured cells. © 2016 AABB.
Neurturin-deficient mice develop dry eye and keratoconjunctivitis sicca.
Song, Xiu Jun; Li, De-Quan; Farley, William; Luo, Li Hui; Heuckeroth, Robert O; Milbrandt, Jeffrey; Pflugfelder, Stephen C
2003-10-01
Neurturin has been identified as a neurotrophic factor for parasympathetic neurons. Neurturin-deficient (NRTN(-/-)) mice have defective parasympathetic innervation of their lacrimal glands. This study was conducted to evaluate tear function and ocular surface phenotype in NRTN(-/-) mice. Determined by tail genomic DNA PCR, 25 NRTN(-/-) mice and 17 neurturin-normal (NRTN(+/+)) mice aged 6 weeks to 4 months were evaluated. Aqueous tear production, tear fluorescein clearance and corneal sensation were serially measured. Corneal permeability to AlexaFluor dextran (AFD; Molecular Probes, Eugene, OR) was measured by a fluorometric assay at 485 nm excitation and 530 nm emission. Histology was evaluated in PAS-stained sections. Mucin and HLA class II (IA) antigen were assessed by immunofluorescent staining. Tear IL-1beta was measured by ELISA, and tear matrix metalloproteinase (MMP)-9 by zymography. Gene expression in the corneal epithelia was analyzed by semiquantitative RT-PCR. In comparison to that in age-matched NRTN(+/+) mice, aqueous tear production, tear fluorescein clearance, and corneal sensation were significantly reduced in NRTN(-/-) mice, whereas corneal permeability to AFD was significantly increased. Immunoreactive MUC-4 and -5AC mucin and goblet cell density (P < 0.001) in the conjunctiva of NRTN(-/-) mice were lower than in NRTN(+/+) mice. The expression of MUC-1 and -4 mRNA by the corneal epithelium was reduced in NRTN(-/-) mice. There were a significantly greater number of IA antigen-positive conjunctival epithelial cells in NRTN(-/-) mice than NRTN(+/+) mice. Tear fluid IL-1beta and MMP-9 concentrations and the expression of IL-1beta, TNF-alpha, macrophage inflammatory protein (MIP)-2, cytokine-induced neutrophil chemoattractant (KC), and MMP-9 mRNA by the corneal epithelia were significantly increased in NRTN(-/-) mice, compared with NRTN(+/+) mice. Neurturin-deficient mice show phenotypic changes and ocular surface inflammation that mimic human keratoconjunctivitis sicca. This model supports the importance of a functional ocular surface-central nervous system-lacrimal gland sensory-autonomic neural network in maintaining ocular surface health and homeostasis.
Tauber, Svantje; Hauschild, Swantje; Paulsen, Katrin; Gutewort, Annett; Raig, Christiane; Hürlimann, Eva; Biskup, Josefine; Philpot, Claudia; Lier, Hartwin; Engelmann, Frank; Pantaleo, Antonella; Cogoli, Augusto; Pippia, Proto; Layer, Liliana E; Thiel, Cora S; Ullrich, Oliver
2015-01-01
Several limiting factors for human health and performance in microgravity have been clearly identified arising from the immune system, and substantial research activities are required in order to provide the basic information for appropriate integrated risk management. The gravity-sensitive nature of cells of the immune system renders them an ideal biological model in search for general gravity-sensitive mechanisms and to understand how the architecture and function of human cells is related to the gravitational force and therefore adapted to life on Earth. We investigated the influence of altered gravity in parabolic flight and 2D clinostat experiments on key proteins of activation and signaling in primary T lymphocytes. We quantified components of the signaling cascade 1.) in non-activated T lymphocytes to assess the "basal status" of the cascade and 2.) in the process of activation to assess the signal transduction. We found a rapid decrease of CD3 and IL-2R surface expression and reduced p-LAT after 20 seconds of altered gravity in non-activated primary T lymphocytes during parabolic flight. Furthermore, we observed decreased CD3 surface expression, reduced ZAP-70 abundance and increased histone H3-acetylation in activated T lymphocytes after 5 minutes of clinorotation and a transient downregulation of CD3 and stable downregulation of IL-2R during 60 minutes of clinorotation. CD3 and IL-2R are downregulated in primary T lymphocytes in altered gravity. We assume that a gravity condition around 1g is required for the expression of key surface receptors and appropriate regulation of signal molecules in T lymphocytes. © 2015 S. Karger AG, Basel.
Serradell, Marianela C; Saura, Alicia; Rupil, Lucia L; Gargantini, Pablo R; Faya, Marcela I; Furlan, Paulina J; Lujan, Hugo D
2016-01-01
Giardia lamblia is a human intestinal parasite and one of the most frequent enteric pathogen of companion animals. Clinical manifestations of giardiasis, such as diarrhoea, anorexia, weight loss and lethargy, have been associated with Giardia infections in both domestic and farm animals. A few anti-parasitic drugs are routinely used to treat giardiasis, but re-infections are common and drug-resistant strains have already been reported. Unfortunately, efficient vaccines against Giardia are not available. Giardia undergoes antigenic variation; through this mechanism, parasites can avoid the host’s immune defenses, causing chronic infections and/or re-infections. Antigenic variation is characterised by a continuous switch in the expression of members of a homologous family of genes encoding surface antigens. In a previous report, we indicated that in Giardia, the mechanism responsible for the exchange of variant-specific surface proteins (VSPs) involves the RNA interference (RNAi) pathway. From a repertoire of ~200 VSP genes, only one is expressed on the surface of single trophozoites; however, RNAi machinery disruption generates trophozoites that express the complete VSP repertoire. We also demonstrated that gerbils orally immunised with VSPs isolated from these altered parasites showed high levels of protection. Here we tested this vaccine in cats and dogs, and found that it is highly efficient in preventing new infections and reducing chronic giardiasis in domestic animals both in experimental and natural infections. Remarkably, immunisation of dogs in a highly endemic area strongly decreased the percentage of infected children in the community, suggesting that this vaccine would block the zoonotic transmission of the disease. PMID:29263857
Sierra, Ana; Zhu, Zhiyong; Sapay, Nicolas; Sharotri, Vikas; Kline, Crystal F.; Luczak, Elizabeth D.; Subbotina, Ekaterina; Sivaprasadarao, Asipu; Snyder, Peter M.; Mohler, Peter J.; Anderson, Mark E.; Vivaudou, Michel; Zingman, Leonid V.; Hodgson-Zingman, Denice M.
2013-01-01
Cardiac ATP-sensitive potassium (KATP) channels are key sensors and effectors of the metabolic status of cardiomyocytes. Alteration in their expression impacts their effectiveness in maintaining cellular energy homeostasis and resistance to injury. We sought to determine how activation of calcium/calmodulin-dependent protein kinase II (CaMKII), a central regulator of calcium signaling, translates into reduced membrane expression and current capacity of cardiac KATP channels. We used real-time monitoring of KATP channel current density, immunohistochemistry, and biotinylation studies in isolated hearts and cardiomyocytes from wild-type and transgenic mice as well as HEK cells expressing wild-type and mutant KATP channel subunits to track the dynamics of KATP channel surface expression. Results showed that activation of CaMKII triggered dynamin-dependent internalization of KATP channels. This process required phosphorylation of threonine at 180 and 224 and an intact 330YSKF333 endocytosis motif of the KATP channel Kir6.2 pore-forming subunit. A molecular model of the μ2 subunit of the endocytosis adaptor protein, AP2, complexed with Kir6.2 predicted that μ2 docks by interaction with 330YSKF333 and Thr-180 on one and Thr-224 on the adjacent Kir6.2 subunit. Phosphorylation of Thr-180 and Thr-224 would favor interactions with the corresponding arginine- and lysine-rich loops on μ2. We concluded that calcium-dependent activation of CaMKII results in phosphorylation of Kir6.2, which promotes endocytosis of cardiac KATP channel subunits. This mechanism couples the surface expression of cardiac KATP channels with calcium signaling and reveals new targets to improve cardiac energy efficiency and stress resistance. PMID:23223335
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tomioka, Yukiko, E-mail: ytomi@muses.tottori-u.ac.jp; Avian Zoonosis Research Center, Faculty of Agriculture, Tottori University, Tottori 680-8553; Morimatsu, Masami, E-mail: mmorimat@vetmed.hokudai.ac.jp
Highlights: • Tumor-associated antigen MUC1 binds to Siglec-9. • Soluble Siglec-9 reduced proliferation of MUC1-positive tumor in transgenic mice. • Soluble Siglec-9 and MUC1 on tumor cells were colocalized in transgenic mice. • MUC1 expression on tumor cells were reduced in soluble Siglec-9 transgenic mice. - Abstract: Tumor-associated MUC1 binds to Siglec-9, which is expected to mediate tumor cell growth and negative immunomodulation. We hypothesized that a soluble form of Siglec-9 (sSiglec-9) competitively inhibits a binding of MUC1 to its receptor molecules like human Siglec-9, leading to provide antitumor benefit against MUC1-expressing tumor, and generated transgenic mouse lines expressing sSiglec-9more » (sSiglec-9 Tg). When mammary tumor cells expressing MUC1 were intraperitoneally transplanted into sSiglec-9 Tg, tumor proliferation was slower with the lower histological malignancy as compared with non-transgenic mice. The sSiglec-9 was detected in the ascites caused by the tumor in the sSiglec-9 Tg, and sSiglec-9 and MUC1 were often colocalized on surfaces of the tumor cells. PCNA immunohistochemistry also revealed the reduced proliferation of the tumor cells in sSiglec-9 Tg. In sSiglec-9 Tg with remarkable suppression of tumor proliferation, MUC1 expressions were tend to be reduced. In the ascites of sSiglec-9 Tg bearing the tumor, T cells were uniformly infiltrated, whereas aggregations of degenerative T cells were often observed in the non-transgenic mice. These results suggest that sSiglec-9 has an antitumor benefit against MUC1-expressing tumor in the transgenic mice, which may avoid the negative immunomodulation and/or suppress tumor-associated MUC1 downstream signal transduction, and subsequent tumor proliferation.« less
Frankel, Matthew B.; Wojcik, Brandon; DeDent, Andrea C.; Missiakas, Dominique M.; Schneewind, Olaf
2012-01-01
Summary The human pathogen Staphyloccocus aureus requires cell wall anchored surface proteins to cause disease. During cell division, surface proteins with YSIRK signal peptides are secreted into the cross wall, a layer of newly synthesized peptidoglycan between separating daughter cells. The molecular determinants for the trafficking of surface proteins are, however, still unknown. We screened mutants with non-redundant transposon insertions by fluorescence-activated cell sorting for reduced deposition of protein A (SpA) into the staphylococcal envelope. Three mutants, each of which harbored transposon insertions in genes for transmembrane proteins, displayed greatly reduced envelope abundance of SpA and surface proteins with YSIRK signal peptides. Characterization of the corresponding mutations identified three transmembrane proteins with abortive infectivity (ABI) domains, elements first described in lactococci for their role in phage exclusion. Mutations in genes for ABI domain proteins, designated spdA, spdB and spdC (surface protein display), diminish the expression of surface proteins with YSIRK signal peptides, but not of precursor proteins with conventional signal peptides. spdA, spdB and spdC mutants display an increase in the thickness of cross walls and in the relative abundance of staphylococci with cross walls, suggesting that spd mutations may represent a possible link between staphylococcal cell division and protein secretion. PMID:20923422
Frankel, Matthew B; Wojcik, Brandon M; DeDent, Andrea C; Missiakas, Dominique M; Schneewind, Olaf
2010-10-01
The human pathogen Staphylococcus aureus requires cell wall anchored surface proteins to cause disease. During cell division, surface proteins with YSIRK signal peptides are secreted into the cross-wall, a layer of newly synthesized peptidoglycan between separating daughter cells. The molecular determinants for the trafficking of surface proteins are, however, still unknown. We screened mutants with non-redundant transposon insertions by fluorescence-activated cell sorting for reduced deposition of protein A (SpA) into the staphylococcal envelope. Three mutants, each of which harboured transposon insertions in genes for transmembrane proteins, displayed greatly reduced envelope abundance of SpA and surface proteins with YSIRK signal peptides. Characterization of the corresponding mutations identified three transmembrane proteins with abortive infectivity (ABI) domains, elements first described in lactococci for their role in phage exclusion. Mutations in genes for ABI domain proteins, designated spdA, spdB and spdC (surface protein display), diminish the expression of surface proteins with YSIRK signal peptides, but not of precursor proteins with conventional signal peptides. spdA, spdB and spdC mutants display an increase in the thickness of cross-walls and in the relative abundance of staphylococci with cross-walls, suggesting that spd mutations may represent a possible link between staphylococcal cell division and protein secretion. © 2010 Blackwell Publishing Ltd.
Gordon, Nancy; Koshkina, Nadezhda V.; Jia, Shu-Fang; Khanna, Chand; Mendoza, Arnulfo; Worth, Laura L.; Kleinerman, Eugenie S.
2015-01-01
Purpose Pulmonary metastases continue to be a significant problem in osteosarcoma. Apoptosis dysfunction is known to influence tumor development. Fas (CD95, APO-1)/FasL is one of the most extensively studied apoptotic pathways. Because FasL is constitutively expressed in the lung, cells that express Fas should be eliminated by lung endothelium. Cells with low or no cell surface Fas expression may be able to evade this innate defense mechanism. The purpose of these studies was to evaluate Fas expression in osteosarcoma lung metastases and the effect of gemcitabine on Fas expression and tumor growth. Experimental Design and Results Using the K7M2 murine osteosarcoma model, Fas expression was quantified using immunohistochemistry. High levels of Fas were present in primary tumors, but no Fas expression was present in actively growing lung metastases. Blocking the Fas pathway using Fas-associated death domain dominant-negative delayed tumor cell clearance from the lung and increased metastatic potential. Treatment of mice with aerosol gemcitabine resulted in increased Fas expression and subsequent tum or regression. Conclusions We conclude that corruption of the Fas pathway is critical to the ability of osteosarcoma cells to grow in the lung. Agents such as gemcitabine that up-regulate cell surface Fas expression may therefore be effective in treating osteosarcoma lung metastases. These data also suggest that an additional mechanism by which gemcitabine induces regression of osteosarcoma lung metastases is mediated by enhancing the sensitivity of the tumor cells to the constitutive FasL in the lung. PMID:17671136
CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties.
Paduano, Francesco; Marrelli, Massimo; Palmieri, Francesca; Tatullo, Marco
2016-10-01
Recent studies have identified a new human dental derived progenitor cell population with multi-lineage differentiation potential referred to as human periapical cyst mesenchymal stem cells (hPCy-MSCs). In the present study, we compared two subpopulations of hPCy-MSCs characterised by the low or high expression of CD146 to establish whether this expression can regulate their stem cell properties. Using flow cytometry, we evaluated the stem cell marker profile of hPCy-MSCs during passaging. Furthermore, CD146 Low and CD146 High cells were sorted by magnetic beads and subsequently both cell populations were evaluated for differences in their proliferation, self-renewal, stem cell surface markers, stemness genes expression and osteogenic differentiation potential.We found that hPCy-MSCs possessed a stable expression of several mesenchymal stem cell surface markers, whereas CD146 expression declined during passaging.In addition, sorted CD146 Low cells proliferated significantly faster, displayed higher colony-forming unit-fibroblast capacity and showed higher expression of Klf4 when compared to the CD146 High subset. Significantly, the osteogenic potential of hPCy-MSCs was greater in the CD146 Low than in CD146 High population. These results demonstrate that CD146 is spontaneously downregulated with passaging at both mRNA and protein levels and that the high expression of CD146 reduces the proliferative, self-renewal and osteogenic differentiation potential of hPCy-MSCs. In conclusion, our study demonstrates that changes in the expression of CD146 can influence the stem cell properties of hPCy-MSCs.
Prevention of neutrophil extravasation by α2-adrenoceptor-mediated endothelial stabilization.
Herrera-García, Ada María; Domínguez-Luis, María Jesús; Arce-Franco, María; Armas-González, Estefanía; Álvarez de La Rosa, Diego; Machado, José David; Pec, Martina K; Feria, Manuel; Barreiro, Olga; Sánchez-Madrid, Francisco; Díaz-González, Federico
2014-09-15
Adrenergic receptors are expressed on the surface of inflammation-mediating cells, but their potential role in the regulation of the inflammatory response is still poorly understood. The objectives of this work were to study the effects of α2-adrenergic agonists on the inflammatory response in vivo and to determine their mechanism of action. In two mouse models of inflammation, zymosan air pouch and thioglycolate-induced peritonitis models, the i.m. treatment with xylazine or UK14304, two α2-adrenergic agonists, reduced neutrophil migration by 60%. The α2-adrenergic antagonist RX821002 abrogated this effect. In flow cytometry experiments, the basal surface expression of L-selectin and CD11b was modified neither in murine nor in human neutrophils upon α2-agonist treatment. Similar experiments in HUVEC showed that UK14304 prevented the activation-dependent upregulation of ICAM-1. In contrast, UK14304 augmented electrical resistance and reduced macromolecular transport through a confluent HUVEC monolayer. In flow chamber experiments, under postcapillary venule-like flow conditions, the pretreatment of HUVECs, but not neutrophils, with α2-agonists decreased transendothelial migration, without affecting neutrophil rolling. Interestingly, α2-agonists prevented the TNF-α-mediated decrease in expression of the adherens junctional molecules, VE-cadherin, β-catenin, and plakoglobin, and reduced the ICAM-1-mediated phosphorylation of VE-cadherin by immunofluorescence and confocal analysis and Western blot analysis, respectively. These findings indicate that α2-adrenoceptors trigger signals that protect the integrity of endothelial adherens junctions during the inflammatory response, thus pointing at the vascular endothelium as a therapeutic target for the management of inflammatory processes in humans. Copyright © 2014 by The American Association of Immunologists, Inc.
MK2 inhibitor reduces alkali burn-induced inflammation in rat cornea
Chen, Yanfeng; Yang, Wenzhao; Zhang, Xiaobo; Yang, Shu; Peng, Gao; Wu, Ting; Zhou, Yueping; Huang, Caihong; Reinach, Peter S.; Li, Wei; Liu, Zuguo
2016-01-01
MK2 activation by p38 MAPK selectively induces inflammation in various diseases. We determined if a MK2 inhibitor (MK2i), improves cornea wound healing by inhibiting inflammation caused by burning rat corneas with alkali. Our study, for the first time, demonstrated that MK2i inhibited alkali burn-induced MK2 activation as well as rises in inflammation based on: a) blunting rises in inflammatory index, inflammatory cell infiltration, ED1+ macrophage and PMN+ neutrophil infiltration; b) suppressing IL-6 and IL-1β gene expression along with those of macrophage inflammatory protein-1α (MIP-1α), intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1); c) reducing angiogenic gene expression levels and neovascularization (NV) whereas anti-angiogenic PEDF levels increased. In addition, this study found that MK2i did not affect human corneal epithelial cell (HCEC) proliferation and migration and had no detectable side effects on ocular surface integrity. Taken together, MK2i selectively inhibited alkali burn-induced corneal inflammation by blocking MK2 activation, these effects have clinical relevance in the treatment of inflammation related ocular surface diseases. PMID:27329698
Dexamethasone Suppresses Oxysterol-Induced Differentiation of Monocytic Cells
Son, Yonghae; Kim, Bo-Young; Eo, Seong-Kug; Park, Young Chul; Kim, Koanhoi
2016-01-01
Oxysterol like 27-hydroxycholesterol (27OHChol) has been reported to induce differentiation of monocytic cells into a mature dendritic cell phenotype. We examined whether dexamethasone (Dx) affects 27OHChol-induced differentiation using THP-1 cells. Treatment of monocytic cells with Dx resulted in almost complete inhibition of transcription and surface expression of CD80, CD83, and CD88 induced by 27OHChol. Elevated surface levels of MHC class I and II molecules induced by 27OHChol were reduced to basal levels by treatment with Dx. A decreased endocytosis ability caused by 27OHChol was recovered by Dx. We also examined effects of Dx on expression of CD molecules involved in atherosclerosis. Increased levels of surface protein and transcription of CD105, CD137, and CD166 by treatment with 27OHChol were significantly inhibited by cotreatment with Dx. These results indicate that Dx inhibits 27OHChol-induced differentiation of monocytic cells into a mature dendritic cell phenotype and expression of CD molecules whose levels are associated with atherosclerosis. In addition, we examined phosphorylation of AKT induced by 27OHChol and effect of Dx, where cotreatment with Dx inhibited the phosphorylation of AKT. The current study reports that Dx regulates oxysterol-mediated dendritic cell differentiation of monocytic cells. PMID:27340507
Dexamethasone Suppresses Oxysterol-Induced Differentiation of Monocytic Cells.
Son, Yonghae; Kim, Bo-Young; Eo, Seong-Kug; Park, Young Chul; Kim, Koanhoi
2016-01-01
Oxysterol like 27-hydroxycholesterol (27OHChol) has been reported to induce differentiation of monocytic cells into a mature dendritic cell phenotype. We examined whether dexamethasone (Dx) affects 27OHChol-induced differentiation using THP-1 cells. Treatment of monocytic cells with Dx resulted in almost complete inhibition of transcription and surface expression of CD80, CD83, and CD88 induced by 27OHChol. Elevated surface levels of MHC class I and II molecules induced by 27OHChol were reduced to basal levels by treatment with Dx. A decreased endocytosis ability caused by 27OHChol was recovered by Dx. We also examined effects of Dx on expression of CD molecules involved in atherosclerosis. Increased levels of surface protein and transcription of CD105, CD137, and CD166 by treatment with 27OHChol were significantly inhibited by cotreatment with Dx. These results indicate that Dx inhibits 27OHChol-induced differentiation of monocytic cells into a mature dendritic cell phenotype and expression of CD molecules whose levels are associated with atherosclerosis. In addition, we examined phosphorylation of AKT induced by 27OHChol and effect of Dx, where cotreatment with Dx inhibited the phosphorylation of AKT. The current study reports that Dx regulates oxysterol-mediated dendritic cell differentiation of monocytic cells.
Li, Tiandao; Roer, Robert; Vana, Matthew; Pate, Susan; Check, Jennifer
2006-03-01
Juvenile blue crabs, Callinectes sapidus, extensively utilize oligohaline and freshwater regions of the estuary. With a presumptively larger surface-area-to-body weight ratio, juvenile crabs could experience osmo- and ionoregulatory costs well in excess of that of adults. To test this hypothesis, crabs ranging over three orders of magnitude in body weight were acclimated to either sea water (1,000 mOsm) or dilute sea water (150 mOsm), and gill surface area, water and sodium permeabilities (calculated from the passive efflux of 3H2O and 22Na+), gill Na+, K+ -ATPase activity and expression were measured. Juveniles had a relatively larger gill surface area; weight-specific gill surface area decreased with body weight. Weight-specific water and sodium fluxes also decreased with weight, but not to the same extent as gill surface area; thus juveniles were able to decrease gill permeability slightly more than adults upon acclimation to dilute media. Crabs < 5 g in body weight had markedly higher activities of gill Na+ ,K+ -ATPase than crabs > 5 g in both posterior and anterior gills. Acclimation to dilute medium induced increased expression of Na+, K+ -ATPase and enzyme activity, but the increase was not as great in juveniles as in larger crabs. The increased weight-specific surface area for water gain and salt loss for small crabs in dilute media presents a challenge that is incompletely compensated by reduced permeability and increased affinity of gill Na+, K+ -ATPase for Na+. Juveniles maintain osmotic and ionic homeostasis by the expression and utilization of extremely high levels of gill Na+, K+ -ATPase, in posterior, as well as in anterior, gills. Copyright 2006 Wiley-Liss, Inc.
A novel Triclosan Methacrylate-based composite reduces the virulence of Streptococcus mutans biofilm
2018-01-01
The use of antimicrobial monomers, linked to the polymer chain of resin composites, is an interesting approach to circumvent the effects of bacteria on the dental and material surfaces. In addition, it can likely reduce the incidence of recurrent caries lesions. The aim of this study was to evaluate the effects of a novel Triclosan Methacrylate (TM) monomer, which was developed and incorporated into an experimental resin composite, on Streptococcus mutans (S. mutans) biofilms, focusing on the analyses of vicR, gtfD, gtfC, covR, and gbpB gene expression, cell viability and biofilm characteristics. The contact time between TM-composite and S. mutans down-regulated the gbpB and covR and up-regulated the gtfC gene expression, reduced cell viability and significantly decreased parameters of the structure and characteristics of S. mutans biofilm virulence. The presence of Triclosan Methacrylate monomer causes harmful effects at molecular and cellular levels in S. mutans, implying a reduction in the virulence of those microorganisms. PMID:29608622
Villanueva-Cabello, Tania M; Mollicone, Rosella; Cruz-Muñoz, Mario E; López-Guerrero, Delia V; Martínez-Duncker, Iván
2015-12-01
CD4+ T helper lymphocytes (Th) orchestrate the immune response after their activation by antigen-presenting cells. Activation of naïve Th cells is reported to generate the reduction in surface epitopes of sialic acid (Sia) in α2,3 and α2,6 linkages. In this work, we report that in spite of this glycophenotype, anti-CD3/anti-CD28-activated purified human naïve Th cells show a significant increase in surface Sia, as assessed by metabolic labeling, compared with resting naïve Th cells, suggesting an increased flux of Sia toward Siaα2,8 glycoconjugates. To understand this increase as a result of ganglioside up-regulation, we observed that very early after activation, human naïve Th cells show an increased expression in surface GD3 and neoexpression of surface GD2 gangliosides, the latter clustering with the T cell receptor (TCR). Also, we report that in contrast to GM2/GD2 synthase null mice, lentiviral vector-mediated silencing of the GM2/GD2 synthase in activated human naïve Th cells reduced efficient TCR clustering and downstream signaling, as assessed by proliferation assays and IL-2 and IL-2R expression, pointing to an important role of this enzyme in activation of human naive Th cells. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
NASA Astrophysics Data System (ADS)
Meyer-Dombard, D. R.; Cardace, D.; Woycheese, K. M.; Vallalar, B.; Casar, C.; Simon, A.; Arcilla, C. A.
2016-12-01
Serpentinization in the subsurface produces highly reduced, high pH fluids that provide microbial habitats. It is assumed that these deep subsurface fluids contain copious H2 and CH4 gas, little/no inorganic carbon, and limited electron acceptors. As serpentinized fluids reach the oxygenated surface environment, microbial biomes shift and organisms capable of metabolizing O2 thrive (Woycheese et al., 2015). However, the relationship of microbial communities found in surface expressions of serpentinizing fluids to the subsurface biosphere is still a target of exploration. Our work in the Zambales ophiolite (Philippines) defines surface microbial habitats with geochemistry, targeted culturing efforts, and community analysis (Cardace et al., 2015; Woycheese et al., 2015). Springs range from pH 9-11.5, and contain 0.06-2 ppm DO, 0-3.7 ppm sulfide, 30-800 ppm silica. Gases include H2 and CH4 > 10uM, CO2 > 1 mM, and trace amounts of CO. These surface data allow prediction of the subsurface metabolic landscape. For example, Cardace et al., (2015) predicted that metabolism of iron is important in both biospheres. Growth media were designed to target iron reduction yielding heterotrophic and autotrophic iron reducers at high pH. Reduced iron minerals were produced in several cultures (Casar et al., sub.), and isolation efforts are underway. Shotgun metagenomic analysis shows the metabolic capacity for methanogenesis, suggesting microbial origins for some CH4 present. The enzymes methyl coenzyme M reductase, and formylmethanofuran dehydrogenase were detected, and relative abundance increased near the near-anoxic spring source. The metagenomes indicate carbon cycling at these sites is reliant on methanogenesis, acetogenesis, sulfate reduction, and H2 and CH4 oxidation. In this tropical climate, cellulose is also a likely carbon source; cellulose degrading isolates have been obtained. These results indicate a metabolically flexible community at the surface where serpentinizing fluids are expressed. The next step is to understand what these surface systems might tell us about the subsurface biosphere. References: Cardace et al., 2015 Frontiers in Extreme Microbiology 6: doi: 10.3389/fmicb.2015.00010 Woycheese et al., 2015 Frontiers in Extreme Microbiology 6: doi: 10.3389/fmicb.2015.00044
TGF-β induces surface LAP expression on murine CD4 T cells independent of Foxp3 induction.
Oida, Takatoku; Weiner, Howard L
2010-11-24
It has been reported that human FOXP3(+) CD4 Tregs express GARP-anchored surface latency-associated peptide (LAP) after activation, based on the use of an anti-human LAP mAb. Murine CD4 Foxp3(+) Tregs have also been reported to express surface LAP, but these studies have been hampered by the lack of suitable anti-mouse LAP mAbs. We generated anti-mouse LAP mAbs by immunizing TGF-β(-/-) animals with a mouse Tgfb1-transduced P3U1 cell line. Using these antibodies, we demonstrated that murine Foxp3(+) CD4 Tregs express LAP on their surface. In addition, retroviral transduction of Foxp3 into mouse CD4(+)CD25(-) T cells induced surface LAP expression. We then examined surface LAP expression after treating CD4(+)CD25(-) T cells with TGF-β and found that TGF-β induced surface LAP not only on T cells that became Foxp3(+) but also on T cells that remained Foxp3(-) after TGF-β treatment. GARP expression correlated with the surface LAP expression, suggesting that surface LAP is GARP-anchored also in murine T cells. Unlike human CD4 T cells, surface LAP expression on mouse CD4 T cells is controlled by Foxp3 and TGF-β. Our newly described anti-mouse LAP mAbs will provide a useful tool for the investigation and functional analysis of T cells that express LAP on their surface.
Hormonal Regulation and Distinct Functions of Semaphorin-3B and Semaphorin-3F in Ovarian Cancer
Joseph, Doina; Ho, Shuk-Mei; Syed, Viqar
2009-01-01
Semaphorins comprise a family of molecules that influence neuronal growth and guidance. Class-3 semaphorins, semaphorin-3B (SEMA3B) and semaphorin-3F (SEMA3F) illustrate their effects by forming a complex with neuropilins (NP-1 or NP-2) and plexins. We examined the status and regulation of semaphorins and their receptors in human ovarian cancer cells. A significantly reduced expression of SEMA3B (83 kD), SEMA3F (90 kD), and plexin-A3 was observed in ovarian cancer (OVCA) cell lines when compared to normal human ovarian surface epithelial (HOSE) cells. The expression of NP-1, NP-2 and plexin-A1 was not altered in HOSE and OVCA cells. The decreased expression of SEMA3B, SEMA3F, and plexin-A3 was confirmed in stage 3 ovarian tumors. Treatment of OVCA cells with luteinizing hormone, follicle-stimulating hormone, and estrogen induced a significant upregulation of SEMA3B, whereas SEMA3F was upregulated only by estrogen. Co-treatment of cell lines with a hormone and its specific antagonist blocked the effect of the hormone. Ectopic expression of SEMA3B or SEMA3F reduced soft-agar colony formation, adhesion, and cell invasion of OVCA cell cultures. Forced expression of SEMA3B, but not SEMA3F, inhibited viability of OVCA cells. Overexpression of SEMA3B and SEMA3F reduced focal adhesion kinase (FAK) phosphorylation and matrix metalloproteinase (MMP)-2 and -9 expression in OVCA cells. Forced expression of SEMA3F, but not SEMA3B in OVCA cells, significantly inhibited endothelial cell tube formation. Collectively, our results suggest loss of SEMA3 expression could be a hallmark of cancer progression. Furthermore, gonadotropin- and/or estrogen-mediated maintenance of SEMA3 expression could control ovarian cancer angiogenesis and metastasis. PMID:20124444
Kowalewicz-Kulbat, Magdalena; Ograczyk, Elżbieta; Włodarczyk, Marcin; Krawczyk, Krzysztof; Fol, Marek
2016-06-01
The immunomagnetic separation technique is the basis of monocyte isolation and further generation of monocyte-derived dendritic cells. To compare the efficiency of monocyte positive and negative separation, concentration of beads, and their impact on generated dendritic cells. Monocytes were obtained using monoclonal antibody-coated magnetic beads followed the Ficoll-Paque gradient separation of mononuclear cell fraction from the peripheral blood of 6 healthy volunteers. CD14 expression was analyzed by flow cytometry. Both types of magnetic separation including recommended and reduced concentrations of beads did not affect the yield and the purity of monocytes and their surface CD14 expression. However, DCs originated from the "positively" separated monocytes had noticeable higher expression of CD80.
Contreras-Ruiz, Laura; Mir, Fayaz A; Turpie, Bruce; Krauss, Achim H; Masli, Sharmila
2016-02-01
Sjögren's syndrome is an autoimmune disease associated with inflammation of exocrine glands with clinical manifestations of dry eye and dry mouth. Dry eye in this disease involves inflammation of the ocular surface tissues - cornea and conjunctiva. While systemic blockade of adhesion molecules has been used to treat autoimmune diseases, the purpose of this study was to determine the therapeutic efficacy of topical application of an integrin α4 adhesion molecule antagonist in a mouse model of dry eye associated with Sjögren's syndrome. To assess this spontaneously developed ocular surface inflammation related to Sjögren's syndrome in TSP-1null mice (12 wks) was evaluated. Mice were treated with topical formulations containing 0.1% dexamethasone or 30 mg/ml GW559090 or vehicle control. Corneal fluorescein staining and conjunctival goblet cell density were assessed. Real-time PCR analysis was performed to assess expression of the inflammatory marker IL-1β in the cornea and Tbet and RORγt in the draining lymph nodes. Ocular surface inflammation was detectable in TSP-1null mice (≥12 wk old), which resulted in increased corneal fluorescein staining indicative of corneal barrier disruption and reduced conjunctival goblet cell density. These changes were accompanied by increased corneal expression of IL-1β as compared to WT controls and an altered balance of Th1 (Tbet) and Th17 (RORγt) markers in the draining lymph nodes. Topically applied dexamethasone and GW559090 significantly reduced corneal fluorescein staining compared to vehicle treatment (p = 0.023 and p < 0.001, respectively). This improved corneal barrier integrity upon adhesion molecule blockade was consistent with significantly reduced corneal expression of pro-inflammatory IL-1β compared to vehicle treated groups (p < 0.05 for both treatments). Significant improvement in goblet cell density was also noted in mice treated with 0.1% dexamethasone and GW559090 (p < 0.05 for both). We conclude that similar to topical dexamethasone, topically administered GW559090 successfully improved corneal barrier integrity and inflammation in an established ocular surface disease associated with Sjögren's syndrome. Copyright © 2015 Elsevier Ltd. All rights reserved.
Zeller, Iris; Wiedemann, Dominik; Schwaiger, Stefan; Stelzmüller, Marlies; Kreutmayer, Simone; Leberfing, Oliver; Stuppner, Hermann; Bernhard, David
2012-01-01
OBJECTIVES Despite rapid progress in surgical techniques, there is still a significant lack of surgery-supportive pharmacological treatments. The aim of this study was to test the hypothesis that ursolic acid (UA) may prevent intimal hyperplasia of venous bypass grafts. METHODS The hypothesis was tested by means of primary cell isolation and culture followed by real-time polymerase chain reaction, western blotting, fluorescence microscopy and fluorescence-activated cell sorting analyses, as well as an in vivo rat model for intimal hyperplasia of venous bypass grafts and immunohistochemistry and histochemistry. RESULTS The local application of UA significantly inhibited intimal hyperplasia in vivo (intimal thickness control: 25 μm, UA group: 18 μM–8 weeks after surgery). The UA treatment of grafts significantly resulted in reduced endothelial vascular cell adhesion molecule-1 (VCAM-1) expression, reduced infiltration of the grafts vessel wall by CD45-positive cells and increased smooth muscle cell (SMC) death. In in vitro condition, it could be shown that UA inhibits VCAM-1 expression downstream of NFκB and is likely to interfere with VCAM-1 protein synthesis in endothelial cells. Quantification of cell death in vascular smooth muscle cells treated with UA indicated that UA is a potent inducer of SMC apoptosis. CONCLUSIONS Our results suggest that UA-mediated inhibition of endothelial VCAM-1 expression reduces the infiltration of venous bypass grafts by CD45-positive cells and inhibits intimal hyperplasia. Apoptosis induction in SMCs may be another method in which UA reduces intimal thickening. UA may constitute a surgery-supportive pharmacon that reduces intimal hyperplasia of vein grafts. PMID:22551965
Cortese, Giuseppe P; Zhu, Mei; Williams, Damian; Heath, Sarah; Waites, Clarissa L
2016-11-30
Mutations in the gene encoding Parkin, an E3 ubiquitin ligase, lead to juvenile-onset Parkinson's disease by inducing the selective death of midbrain dopaminergic neurons. Accumulating evidence indicates that Parkin also has an important role in excitatory glutamatergic neurotransmission, although its precise mechanism of action remains unclear. Here, we investigate Parkin's role at glutamatergic synapses of rat hippocampal neurons. We find that Parkin-deficient neurons exhibit significantly reduced AMPA receptor (AMPAR)-mediated currents and cell-surface expression, and that these phenotypes result from decreased postsynaptic expression of the adaptor protein Homer1, which is necessary for coupling AMPAR endocytic zones with the postsynaptic density. Accordingly, Parkin loss of function leads to the reduced density of postsynaptic endocytic zones and to impaired AMPAR internalization. These findings demonstrate a novel and essential role for Parkin in glutamatergic neurotransmission, as a stabilizer of postsynaptic Homer1 and the Homer1-linked endocytic machinery necessary for maintaining normal cell-surface AMPAR levels. Mutations in Parkin, a ubiquitinating enzyme, lead to the selective loss of midbrain dopaminergic neurons and juvenile-onset Parkinson's disease (PD). Parkin loss of function has also been shown to alter hippocampal glutamatergic neurotransmission, providing a potential explanation for PD-associated cognitive impairment. However, very little is known about Parkin's specific sites or mechanisms of action at glutamatergic synapses. Here, we show that Parkin deficiency leads to decreased AMPA receptor-mediated activity due to disruption of the postsynaptic endocytic zones required for maintaining proper cell-surface AMPA receptor levels. These findings demonstrate a novel role for Parkin in synaptic AMPA receptor internalization and suggest a Parkin-dependent mechanism for hippocampal dysfunction that may explain cognitive deficits associated with some forms of PD. Copyright © 2016 the authors 0270-6474/16/3612243-16$15.00/0.
Liu, Mengting; Hao, Liying; Huang, Qian; Zhao, Dan; Li, Qianshun; Cai, Xiaoxiao
2018-05-01
Graphene, a novel carbon-based material, has been widely used as osteogenic agent for the potential effect on the promotion of osteoblast proliferation. Tea polyphenol-reduced graphene oxide (TPG) is a simple and environmental-friendly raw material to obtain graphene. In this study, TPG was deposited on the Ti substrate to promote the bone regeneration. We prepared a honeycomb-like structure by acid and alkali pretreatment and immobilized the TPG layer (Ti-TPG) on the surface via electrochemical deposition. Scanning electron microscopy (SEM), atomic force microscopy (AFM) and X-ray diffraction (XRD) were used to identify the immobilization of TPG on the titanium (Ti) successfully. Furthermore, the biological response of the Ti-TPG surface to rat osteoblast was evaluated. We also studied the cell adhesion, proliferation and expression of ossification genes on the sample. The results revealed that Ti-TPG had an advantage over Ti alloys in modulating cellular activity and Ti-TPG may be a promising coating for biological materials.
Ji, Jie; Upadhyay, Swapna; Xiong, Xiaomiao; Malmlöf, Maria; Sandström, Thomas; Gerde, Per; Palmberg, Lena
2018-05-02
Diesel exhaust particles (DEP) are a major component of outdoor air pollution. DEP mediated pulmonary effects are plausibly linked to inflammatory and oxidative stress response in which macrophages (MQ), epithelial cells and their cell-cell interaction plays a crucial role. Therefore, in this study we aimed at studying the cellular crosstalk between airway epithelial cells with MQ and MQ polarization following exposure to aerosolized DEP by assessing inflammation, oxidative stress, and MQ polarization response markers. Lung mucosa models including primary bronchial epithelial cells (PBEC) cultured at air-liquid interface (ALI) were co-cultured without (PBEC-ALI) and with MQ (PBEC-ALI/MQ). Cells were exposed to 12.7 μg/cm 2 aerosolized DEP using XposeALI ® . Control (sham) models were exposed to clean air. Cell viability was assessed. CXCL8 and IL-6 were measured in the basal medium by ELISA. The mRNA expression of inflammatory markers (CXCL8, IL6, TNFα), oxidative stress (NFKB, HMOX1, GPx) and MQ polarization markers (IL10, IL4, IL13, MRC1, MRC2 RETNLA, IL12 andIL23) were measured by qRT-PCR. The surface/mRNA expression of TLR2/TLR4 was detected by FACS and qRT-PCR. In PBEC-ALI exposure to DEP significantly increased the secretion of CXCL8, mRNA expression of inflammatory markers (CXCL8, TNFα) and oxidative stress markers (NFKB, HMOX1, GPx). However, mRNA expressions of these markers (CXCL8, IL6, NFKB, and HMOX1) were reduced in PBEC-ALI/MQ models after DEP exposure. TLR2 and TLR4 mRNA expression increased after DEP exposure in PBEC-ALI. The surface expression of TLR2 and TLR4 on PBEC was significantly reduced in sham-exposed PBEC-ALI/MQ compared to PBEC-ALI. After DEP exposure surface expression of TLR2 was increased on PBEC of PBEC-ALI/MQ, while TLR4 was decreased in both models. DEP exposure resulted in similar expression pattern of TLR2/TLR4 on MQ as in PBEC. In PBEC-ALI/MQ, DEP exposure increased the mRNA expression of anti-inflammatory M2 macrophage markers (IL10, IL4, IL13, MRC1, MRC2). The cellular interaction of PBEC with MQ in response to DEP plays a pivotal role for MQ phenotypic alteration towards M2-subtypes, thereby promoting an efficient resolution of the inflammation. Furthermore, this study highlighted the fact that cell-cell interaction using multicellular ALI-models combined with an in vivo-like inhalation exposure system is critical in better mimicking the airway physiology compared with traditional cell culture systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Weiwen; Culley, David E.; Nie, Lei
2007-08-01
The build-up of biofilms of sulphate -reducing bacteria (SRB) on metals surfaces may lead to severe corrosion of iron. To understand the processes at molecular level, in this study, a whole-genome oligonucleotide microarray was used to examine differential expression patterns between planktonic populations and mature biofilm of model SRB species Desulfovibrio vulgaris. Statistical analysis revealed that 472 genes were differentially expressed (1.5 fold or more with a p value less than 0.025) when comparing biofilm to planktonic cells. Among the differentially expressed genes were several that corresponded to biofilm formation genes identified in many aerobic bacterial biofilms (i.e., Pseudomonas speciesmore » and Escherichia coli), such as down-regulation of genes encoding flagellin, flagellar motor switch protein and chemotaxis proteins involved in cell motility and induction of genes encoding sugar transferase and glycogen synthase involved in exopolysaccharide biosynthesis. In addition, D. vulgaris biofilm-bound cells exhibited decreased transcription of genes involved in protein synthesis, energy metabolism and sulfate reduction, as well as genes involved in general stress responses. These findings were all consistent with early suggestion that the average physiology of biofilm cells were similar to planktonic cells of stationary phases. Most notably, up-regulation of large number of outer membrane proteins was observed in D. vulgaris biofilm. Although their function is still unknown, the higher expression of these genes in D. vulgaris biofilm could implicate important roles formation and maintenance of multi-cellular consortium on metal surface. The study provided insights into the metabolic networks associated with D. vulgaris biofilm formation and maintenance on an iron surface.« less
Domain-swapped T cell receptors improve the safety of TCR gene therapy
Bethune, Michael T; Gee, Marvin H; Bunse, Mario; Lee, Mark S; Gschweng, Eric H; Pagadala, Meghana S; Zhou, Jing; Cheng, Donghui; Heath, James R; Kohn, Donald B; Kuhns, Michael S; Uckert, Wolfgang; Baltimore, David
2016-01-01
T cells engineered to express a tumor-specific αβ T cell receptor (TCR) mediate anti-tumor immunity. However, mispairing of the therapeutic αβ chains with endogenous αβ chains reduces therapeutic TCR surface expression and generates self-reactive TCRs. We report a general strategy to prevent TCR mispairing: swapping constant domains between the α and β chains of a therapeutic TCR. When paired, domain-swapped (ds)TCRs assemble with CD3, express on the cell surface, and mediate antigen-specific T cell responses. By contrast, dsTCR chains mispaired with endogenous chains cannot properly assemble with CD3 or signal, preventing autoimmunity. We validate this approach in cell-based assays and in a mouse model of TCR gene transfer-induced graft-versus-host disease. We also validate a related approach whereby replacement of αβ TCR domains with corresponding γδ TCR domains yields a functional TCR that does not mispair. This work enables the design of safer TCR gene therapies for cancer immunotherapy. DOI: http://dx.doi.org/10.7554/eLife.19095.001 PMID:27823582
Modulation of Candida albicans virulence by bacterial biofilms on titanium surfaces.
Cavalcanti, Yuri Wanderley; Wilson, Melanie; Lewis, Michael; Del-Bel-Cury, Altair Antoninha; da Silva, Wander José; Williams, David W
2016-01-01
Whilst Candida albicans occurs in peri-implant biofilms, its role in peri-implantitis remains unclear. This study therefore examined the virulence of C. albicans in mixed-species biofilms on titanium surfaces. Biofilms of C. albicans (Ca), C. albicans with streptococci (Streptococcus sanguinis, S. mutans) (Ca-Ss-Sm) and those incorporating Porphyromonas gingivalis (Ca-Pg and Ca-Ss-Sm-Pg) were developed. Expression of C. albicans genes associated with adhesion (ALS1, ALS3, HWP1) and hydrolytic enzymes (SAP2, SAP4, SAP6, PLD1) was measured and hyphal production by C. albicans quantified. Compared with Ca biofilms, significant (p<0.05) up-regulation of ALS3, HWP1, SAP2 and SAP6, and hyphal production occurred in biofilms containing streptococci (Ca-Ss-Sm). In Ca-Pg biofilms, down-regulation of HWP1 and SAP4 expression, with reduced hyphal production occurred. Ca-Ss-Sm-Pg biofilms had increased hyphal proportions and up-regulation of ALS3, SAP2 and SAP6. In conclusion, C. albicans expressed virulence factors in biofilms that could contribute to peri-implantitis, but this was dependent on associated bacterial species.
Du, Zhibin; Xiao, Yin; Hashimi, Saeed; Hamlet, Stephen M; Ivanovski, Saso
2016-09-15
Compromised bone quality and/or healing in osteoporosis are recognised risk factors for impaired dental implant osseointegration. This study examined the effects of (1) experimentally induced osteoporosis on titanium implant osseointegration and (2) the effect of modified implant surface topography on osseointegration under osteoporosis-like conditions. Machined and micro-roughened surface implants were placed into the maxillary first molar root socket of 64 ovariectomised and sham-operated Sprague-Dawley rats. Subsequent histological and SEM observations showed tissue maturation on the micro-rough surfaced implants in ovariectomised animals as early as 3days post-implantation. The degree of osseointegration was also significantly higher around the micro-rough implants in ovariectomised animals after 14days of healing although by day 28, similar levels of osseointegration were found for all test groups. The micro-rough implants significantly increased the early (day 3) gene expression of alkaline phosphatase, osteocalcin, receptor activator of nuclear factor kappa-B ligand and dentin matrix protein 1 in implant adherent cells. By day 7, the expression of inflammatory genes decreased while the expression of the osteogenic markers increased further although there were few statistically significant differences between the micro-rough and machined surfaces. Osteocyte morphology was also affected by estrogen deficiency with the size of the cells being reduced in trabecular bone. In conclusion, estrogen deficiency induced osteoporotic conditions negatively influenced the early osseointegration of machined implants while micro-rough implants compensated for these deleterious effects by enhancing osteogenic cell differentiation on the implant surface. Lower bone density, poor bone quality and osseous microstructural changes are all features characteristic of osteoporosis that may impair the osseointegration of dental implants. Using a clinically relevant trabecular bone model in the rat maxilla, we demonstrated histologically that the negative effects of surgically-induced osteoporosis on osseointegration could be ameliorated by the biomaterial's surface topography. Furthermore, gene expression analysis suggests this may be a result of enhanced osteogenic cell differentiation on the implant surface. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Martínez, Juan A; Tavárez, José J; Oliveira, Caroline M; Banerjee, Dipak K
2006-05-01
During tumor growth and invasion, the endothelial cells from a relatively quiescent endothelium start proliferating. The exact mechanism of switching to a new angiogenic phenotype is currently unknown. We have examined the role of intracellular cAMP in this process. When a non-transformed capillary endothelial cell line was treated with 2 mM 8Br-cAMP, cell proliferation was enhanced by approximately 70%. Cellular morphology indicated enhanced mitosis after 32-40 h with almost one-half of the cell population in the S phase. Bcl-2 expression and caspase-3, -8, and -9 activity remained unaffected. A significant increase in the Glc(3)Man(9)GlcNAc(2)-PP-Dol biosynthesis and turnover, Factor VIIIC N-glycosylation, and cell surface expression of N-glycans was observed in cells treated with 8Br-cAMP. Dol-P-Man synthase activity in the endoplasmic reticulum membranes also increased. A 1.4-1.6-fold increase in HSP-70 and HSP-90 expression was also observed in 8Br-cAMP treated cells. On the other hand, the expression of GRP-78/Bip was 2.3-fold higher compared to that of GRP-94 in control cells, but after 8Br-cAMP treatment for 32 h, it was reduced by 3-fold. GRP-78/Bip expression in untreated cells was 1.2-1.5-fold higher when compared with HSP-70 and HSP-90, whereas that of the GRP-94 was 1.5-1.8-fold lower. After 8Br-cAMP treatment, GRP-78/Bip expression was reduced 4.5-4.8-fold, but the GRP-94 was reduced by 1.5-1.6-fold only. Upon comparison, a 2.9-fold down-regulation of GRP-78/Bip was observed compared to GRP-94. We, therefore, conclude that a high level of Glc(3)Man(9)GlcNAc(2)-PP-Dol, resulting from 8Br-cAMP stimulation up-regulated HSP-70 expression and down-regulated that of the GRP-78/Bip, maintained adequate protein folding, and reduced endoplasmic reticulum stress. As a result capillary endothelial cell proliferation was induced.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bertola, Marco, E-mail: Marco.Bertola@concordia.ca; Centre de Recherches Mathématiques, Université de Montréal, Montréal, Québec H3C 3J7; SISSA/ISAS, via Bonomea 265, Trieste
2015-06-15
Two-phase solutions of focusing NLS equation are classically constructed out of an appropriate Riemann surface of genus two and expressed in terms of the corresponding theta-function. We show here that in a certain limiting regime, such solutions reduce to some elementary ones called “Solitons on unstable condensate.” This degeneration turns out to be conveniently studied by means of basic tools from the theory of Riemann-Hilbert problems. In particular, no acquaintance with Riemann surfaces and theta-function is required for such analysis.
Liu, Dan-Qing; Li, Li-Min; Guo, Ya-Lan; Bai, Rui; Wang, Chen; Bian, Zhen; Zhang, Chen-Yu; Zen, Ke
2008-01-01
Background Signal regulate protein α (SIRPα) is involved in many functional aspects of monocytes. Here we investigate the role of SIRPα in regulating β2 integrin-mediated monocyte adhesion, transendothelial migration (TEM) and phagocytosis. Methodology/Principal Findings THP-1 monocytes/macropahges treated with advanced glycation end products (AGEs) resulted in a decrease of SIRPα expression but an increase of β2 integrin cell surface expression and β2 integrin-mediated adhesion to tumor necrosis factor-α (TNFα)–stimulated human microvascular endothelial cell (HMEC-1) monolayers. In contrast, SIRPα overexpression in THP-1 cells showed a significant less monocyte chemotactic protein-1 (MCP-1)–triggered cell surface expression of β2 integrins, in particular CD11b/CD18. SIRPα overexpression reduced β2 integrin-mediated firm adhesion of THP-1 cells to either TNFα–stimulated HMEC-1 monolayers or to immobilized intercellular adhesion molecule-1 (ICAM-1). SIRPα overexpression also reduced MCP-1–initiated migration of THP-1 cells across TNFα–stimulated HMEC-1 monolayers. Furthermore, β2 integrin-mediated THP-1 cell spreading and actin polymerization in response to MCP-1, and phagocytosis of bacteria were both inhibited by SIRPα overexpression. Conclusions/Significance SIRPα negatively regulates β2 integrin-mediated monocyte adhesion, transendothelial migration and phagocytosis, thus may serve as a critical molecule in preventing excessive activation and accumulation of monocytes in the arterial wall during early stage of atherosclerosis. PMID:18820737
Manz, Judith; Rodríguez, Elke; ElSharawy, Abdou; Oesau, Eva-Maria; Petersen, Britt-Sabina; Baurecht, Hansjörg; Mayr, Gabriele; Weber, Susanne; Harder, Jürgen; Reischl, Eva; Schwarz, Agatha; Novak, Natalija; Franke, Andre; Weidinger, Stephan
2016-12-01
Gene-mapping studies have consistently identified a susceptibility locus for atopic dermatitis and other inflammatory diseases on chromosome band 11q13.5, with the strongest association observed for a common variant located in an intergenic region between the two annotated genes C11orf30 and LRRC32. Using a targeted resequencing approach we identified low-frequency and rare missense mutations within the LRRC32 gene encoding the protein GARP, a receptor on activated regulatory T cells that binds latent transforming growth factor-β. Subsequent association testing in more than 2,000 atopic dermatitis patients and 2,000 control subjects showed a significant excess of these LRRC32 variants in individuals with atopic dermatitis. Structural protein modeling and bioinformatic analysis predicted a disruption of protein transport upon these variants, and overexpression assays in CD4 + CD25 - T cells showed a significant reduction in surface expression of the mutated protein. Consistently, flow cytometric (FACS) analyses of different T-cell subtypes obtained from atopic dermatitis patients showed a significantly reduced surface expression of GARP and a reduced conversion of CD4 + CD25 - T cells into regulatory T cells, along with lower expression of latency-associated protein upon stimulation in carriers of the LRRC32 A407T variant. These results link inherited disturbances of transforming growth factor-β signaling with atopic dermatitis risk. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Gilbert, Stéphane; Loranger, Anne; Omary, M. Bishr
2016-01-01
ABSTRACT Keratins are epithelial cell intermediate filament (IF) proteins that are expressed as pairs in a cell-differentiation-regulated manner. Hepatocytes express the keratin 8 and 18 pair (denoted K8/K18) of IFs, and a loss of K8 or K18, as in K8-null mice, leads to degradation of the keratin partner. We have previously reported that a K8/K18 loss in hepatocytes leads to altered cell surface lipid raft distribution and more efficient Fas receptor (FasR, also known as TNFRSF6)-mediated apoptosis. We demonstrate here that the absence of K8 or transgenic expression of the K8 G62C mutant in mouse hepatocytes reduces lipid raft size. Mechanistically, we find that the lipid raft size is dependent on acid sphingomyelinase (ASMase, also known as SMPD1) enzyme activity, which is reduced in absence of K8/K18. Notably, the reduction of ASMase activity appears to be caused by a less efficient redistribution of surface membrane PKCδ toward lysosomes. Moreover, we delineate the lipid raft volume range that is required for an optimal FasR-mediated apoptosis. Hence, K8/K18-dependent PKCδ- and ASMase-mediated modulation of lipid raft size can explain the more prominent FasR-mediated signaling resulting from K8/K18 loss. The fine-tuning of ASMase-mediated regulation of lipid rafts might provide a therapeutic target for death-receptor-related liver diseases. PMID:27422101
NASA Astrophysics Data System (ADS)
Rosado, Helena; O'Neill, Alex J.; Blake, Katy L.; Walther, Meik; Long, Paul F.; Hinds, Jason; Taylor, Peter W.
2012-04-01
Staphylococcus aureus is routinely recovered from air and surface samples taken aboard the International Space Station (ISS) and poses a health threat to crew. As bacteria respond to the low shear forces engendered by continuous rotation conditions in a Rotating Wall Vessel (RWV) and the reduced gravitational field of near-Earth flight by altering gene expression, we examined the effect of low-shear RWV growth on protein secretion and gene expression by three S. aureus isolates. When cultured under 1 g, the total amount of protein secreted by these strains varied up to fourfold; under continuous rotation conditions, protein secretion by all three strains was significantly reduced. Concentrations of individual proteins were differentially reduced and no evidence was found for increased lysis. These data suggest that growth under continuous rotation conditions reduces synthesis or secretion of proteins. A limited number of changes in gene expression under continuous rotation conditions were noted: in all isolates vraX, a gene encoding a polypeptide associated with cell wall stress, was down-regulated. A vraX deletion mutant of S. aureus SH1000 was constructed: no differences were found between SH1000 and ΔvraX with respect to colony phenotype, viability, protein export, antibiotic susceptibility, vancomycin kill kinetics, susceptibility to cold or heat and gene modulation. An ab initio protein-ligand docking simulation suggests a major binding site for β-lactam drugs such as imipenem. If such changes to the bacterial phenotype occur during spaceflight, they will compromise the capacity of staphylococci to cause systemic infection and to circumvent antibacterial chemotherapy.
Björnfot Holmström, Sofia; Clark, Reuben; Zwicker, Stephanie; Bureik, Daniela; Kvedaraite, Egle; Bernasconi, Eric; Nguyen Hoang, Anh Thu; Johannsen, Gunnar; Marsland, Benjamin J; Boström, Elisabeth A; Svensson, Mattias
2017-12-15
Irreversible tissue recession in chronic inflammatory diseases is associated with dysregulated immune activation and production of tissue degradative enzymes. In this study, we identified elevated levels of matrix metalloproteinase (MMP)-12 in gingival tissue of patients with the chronic inflammatory disease periodontitis (PD). The source of MMP12 was cells of monocyte origin as determined by the expression of CD14, CD68, and CD64. These MMP12-producing cells showed reduced surface levels of the coinhibitory molecule CD200R. Similarly, establishing a multicellular three-dimensional model of human oral mucosa with induced inflammation promoted MMP12 production and reduced CD200R surface expression by monocyte-derived cells. MMP12 production by monocyte-derived cells was induced by CSF2 rather than the cyclooxygenase-2 pathway, and treatment of monocyte-derived cells with a CD200R ligand reduced CSF2-induced MMP12 production. Further, MMP12-mediated degradation of the extracellular matrix proteins tropoelastin and fibronectin in the tissue model coincided with a loss of Ki-67, a protein strictly associated with cell proliferation. Reduced amounts of tropoelastin were confirmed in gingival tissue from PD patients. Thus, this novel association of the CD200/CD200R pathway with MMP12 production by monocyte-derived cells may play a key role in PD progression and will be important to take into consideration in the development of future strategies to diagnose, treat, and prevent PD. Copyright © 2017 by The American Association of Immunologists, Inc.
SCN3A deficiency associated with increased seizure susceptibility
Lamar, Tyra; Vanoye, Carlos G.; Calhoun, Jeffrey; Wong, Jennifer C.; Dutton, Stacey B.B.; Jorge, Benjamin S.; Velinov, Milen; Escayg, Andrew; Kearney, Jennifer A.
2017-01-01
Mutations in voltage-gated sodium channels expressed highly in the brain (SCN1A, SCN2A, SCN3A, and SCN8A) are responsible for an increasing number of epilepsy syndromes. In particular, mutations in the SCN3A gene, encoding the pore-forming Nav1.3 α subunit, have been identified in patients with focal epilepsy. Biophysical characterization of epilepsy-associated SCN3A variants suggests that both gain- and loss-of-function SCN3A mutations may lead to increased seizure susceptibility. In this report, we identified a novel SCN3A variant (L247P) by whole exome sequencing of a child with focal epilepsy, developmental delay, and autonomic nervous system dysfunction. Voltage clamp analysis showed no detectable sodium current in a heterologous expression system expressing the SCN3A-L247P variant. Furthermore, cell surface biotinylation demonstrated a reduction in the amount of SCN3A-L247P at the cell surface, suggesting the SCN3A-L247P variant is a trafficking-deficient mutant. To further explore the possible clinical consequences of reduced SCN3A activity, we investigated the effect of a hypomorphic Scn3a allele (Scn3aHyp) on seizure susceptibility and behavior using a gene trap mouse line. Heterozygous Scn3a mutant mice (Scn3a+/Hyp) did not exhibit spontaneous seizures nor were they susceptible to hyperthermia-induced seizures. However, they displayed increased susceptibility to electroconvulsive (6 Hz) and chemiconvulsive (flurothyl and kainic acid) induced seizures. Scn3a+/Hyp mice also exhibited deficits in locomotor activity and motor learning. Taken together, these results provide evidence that loss-of-function of SCN3A caused by reduced protein expression or deficient trafficking to the plasma membrane may contribute to increased seizure susceptibility. PMID:28235671
Tchedre, Kissaou; Imayasu, Masaki; Hori, Yuichi; Cavanagh, H Dwight
2013-11-01
The purpose of this study was first to evaluate the effect of multipurpose contact lens care solutions (MPSs) on the expression of membrane-associated mucins (MUC1 and MUC16) in SV40-transformed human corneal epithelial (HCE-T) cells and in vivo rat cornea. The second aim of this study was to determine the role of the common MPS additive boric acid in reducing mucin expression and release. The HCE-T cells were exposed to different concentrations of MPS-F, MPS-G, MPS-H, MPS-I, and MPS-J with 100% treatment for 30 minutes and 10% treatment for 24 hours. MUC1 and MUC16 expressions were subsequently analyzed by Western blotting. Wister rats were also subjected to MPS-A, MPS-B, MPS-C, MPS-D, and MPS-E and received phosphate-buffered saline exposure (1 drop in the right eye every 10 minutes for 1 hour). The left eye was used as control. Cornea sections and lysates were used for the immunohistochemical assay of MUC1 and MUC16 expressions. Conditioned media from treated HCE-T cells were also analyzed using Western blotting. The MPSs containing boric acid downregulated MUC1 and MUC16 in the rat cornea, whereas MPSs without boric acid had no effect as demonstrated by the Western blotting and immunohistochemical analysis. Conditioned media from MPS-containing boric acid revealed some trace of MUC16. The clinical use of MPSs containing boric acid that reduce MUC1 and MUC16 availability should be avoided. Additionally, the presence of MUC16 in the conditioned media suggests that boric acid may have enhanced cleavage of MUC16 at the cell membrane surface.
Lingblom, Christine; Bergquist, Henrik; Johnsson, Marianne; Sundström, Patrik; Quiding-Järbrink, Marianne; Bove, Mogens; Wennerås, Christine
2014-12-01
Swallowed topical corticosteroids are the standard therapy for eosinophilic esophagitis (EoE) in adults. Eosinophils in the blood of untreated EoE patients have an activated phenotype. Our aim was to determine if corticosteroids restore the phenotype of eosinophils to a healthy phenotype and if certain cell-surface molecules on blood eosinophils correlate with eosinophilic infiltration of the esophagus. Levels of eight surface markers on eosinophils from treated and untreated EoE patients were determined by flow cytometry and analyzed using multivariate methods of pattern recognition. Corticosteroid-treated EoE patients' eosinophils had decreased levels of CD18 compared to both untreated patients and healthy controls, but maintained their activated phenotype. CD18 expression correlated positively with eosinophil numbers in the esophagus and promoted the adherence of eosinophils to ICAM-1, ICAM-2, and to endothelial cells. The diminished expression of CD18 may be one mechanism behind the reduced entry of eosinophils into the esophagus in corticosteroid-treated EoE patients.
Laihia, J K; Jansen, C T
2000-08-01
It has been postulated that Langerhans cells (LC) provide tolerogenic signals in the local impairment of cutaneous immune functions and antigen-specific tolerance induced by UV radiation. Studies in vitro and ex vivo have indicated that UV radiation may down-regulate the expression of costimulatory molecules on LC, leading to reduced antigen-presenting function. In contrast, we recently observed an up-regulatory stage in the number of human epidermal LC with induced expression of B7 costimulatory molecules 12-24 h after solar-simulating UV radiation (SSR) in vivo. To examine the apparent discrepancy between the observed human LC responses in vitro, ex vivo and in vivo, we compared the three protocols in a parallel fashion. The intact skin as well as skin explants and epidermal cell suspensions from the same individuals were irradiated with a single erythematogenic dose of SSR. The expression of cell surface markers in the epidermal cells was analysed with flow cytometry 24 h later. The number of CD1a+/HLA-DR+ LC increased post-SSR in vivo by a factor of 2.8+/-0.4, whereas in irradiated skin explants ex vivo or in cell suspensions in vitro, reduced numbers were seen. HLA-DR expression intensities were found to have increased on DR+ and CD1a+/DR+ cells in vivo. Similarly, SSR induced B7-2 (CD86) expression in CD1a+ cells significantly in vivo (P=0.031) but reduced the expression ex vivo or in vitro. We conclude that the early up-regulatory stage of human LC number and membrane markers, recorded at 24 h after a single exposure to SSR, is exclusively an in vivo phenomenon.
Florean, Cristina; Schnekenburger, Michael; Lee, Jin-Young; Kim, Kyung Rok; Mazumder, Aloran; Song, Sungmi; Kim, Jae-Myun; Grandjenette, Cindy; Kim, Jeoung-Gyun; Yoon, Ah-Young; Dicato, Mario; Kim, Kyu-Won; Christov, Christo; Han, Byung-Woo; Proksch, Peter; Diederich, Marc
2016-01-01
We characterized the brominated alkaloid Isofistularin-3 (Iso-3), from the marine sponge Aplysina aerophoba, as a new DNA methyltransferase (DNMT)1 inhibitor. Docking analysis confirmed our in vitro DNMT inhibition data and revealed binding of Iso-3 within the DNA binding site of DNMT1. Subsequent increased expression of tumor suppressor gene aryl hydrocarbon receptor (AHR) could be correlated to decreased methylation of CpG sites within the essential Sp1 regulatory region of its promoter. Iso-3 induced growth arrest of cancer cells in G0/G1 concomitant with increased p21 and p27 expression and reduced cyclin E1, PCNA and c-myc levels. Reduced proliferation was accompanied by morphological changes typical of autophagy revealed by fluorescent and transmission electron microscopy and validated by LC3I-II conversion. Furthermore, Iso-3 strongly synergized with tumor-necrosis-factor related apoptosis inducing ligand (TRAIL) in RAJI [combination index (CI) = 0.22] and U-937 cells (CI = 0.21) and increased TRAIL-induced apoptosis via a mechanism involving reduction of survivin expression but not of Bcl-2 family proteins nor X-linked inhibitor of apoptosis protein (XIAP). Iso-3 treatment decreased FLIPL expression and triggered activation of endoplasmatic reticulum (ER) stress with increased GRP78 expression, eventually inducing TRAIL receptor death receptor (DR)5 surface expression. Importantly, as a potential candidate for further anticancer drug development, Iso-3 reduced the viability, colony and in vivo tumor forming potential without affecting the viability of PBMCs from healthy donors or zebrafish development. PMID:27006469
Florean, Cristina; Schnekenburger, Michael; Lee, Jin-Young; Kim, Kyung Rok; Mazumder, Aloran; Song, Sungmi; Kim, Jae-Myun; Grandjenette, Cindy; Kim, Jeoung-Gyun; Yoon, Ah-Young; Dicato, Mario; Kim, Kyu-Won; Christov, Christo; Han, Byung-Woo; Proksch, Peter; Diederich, Marc
2016-04-26
We characterized the brominated alkaloid Isofistularin-3 (Iso-3), from the marine sponge Aplysina aerophoba, as a new DNA methyltransferase (DNMT)1 inhibitor. Docking analysis confirmed our in vitro DNMT inhibition data and revealed binding of Iso-3 within the DNA binding site of DNMT1. Subsequent increased expression of tumor suppressor gene aryl hydrocarbon receptor (AHR) could be correlated to decreased methylation of CpG sites within the essential Sp1 regulatory region of its promoter. Iso-3 induced growth arrest of cancer cells in G0/G1 concomitant with increased p21 and p27 expression and reduced cyclin E1, PCNA and c-myc levels. Reduced proliferation was accompanied by morphological changes typical of autophagy revealed by fluorescent and transmission electron microscopy and validated by LC3I-II conversion. Furthermore, Iso-3 strongly synergized with tumor-necrosis-factor related apoptosis inducing ligand (TRAIL) in RAJI [combination index (CI) = 0.22] and U-937 cells (CI = 0.21) and increased TRAIL-induced apoptosis via a mechanism involving reduction of survivin expression but not of Bcl-2 family proteins nor X-linked inhibitor of apoptosis protein (XIAP). Iso-3 treatment decreased FLIPL expression and triggered activation of endoplasmatic reticulum (ER) stress with increased GRP78 expression, eventually inducing TRAIL receptor death receptor (DR)5 surface expression. Importantly, as a potential candidate for further anticancer drug development, Iso-3 reduced the viability, colony and in vivo tumor forming potential without affecting the viability of PBMCs from healthy donors or zebrafish development.
Sheel Bansal; Bradley J. St. Clair; Constance A. Harrington; Peter J. Gould
2015-01-01
The success of conifers over much of the worldâs terrestrial surface is largely attributable to their tolerance to cold stress (i.e., cold hardiness). Due to an increase in climate variability, climate change may reduce conifer cold hardiness, which in turn could impact ecosystem functioning and productivity in conifer-dominated forests. The expression of cold...
USDA-ARS?s Scientific Manuscript database
Feed costs make up the largest portion of the total cost to produce beef. One way to reduce this cost, thereby increasing profitability of beef production, is to improve feed efficiency. The rumen is responsible for digestion and absorption of nutrients and microbial by-products and may play a sig...
Characterizing and modeling protein-surface interactions in lab-on-chip devices
NASA Astrophysics Data System (ADS)
Katira, Parag
Protein adsorption on surfaces determines the response of other biological species present in the surrounding solution. This phenomenon plays a major role in the design of biomedical and biotechnological devices. While specific protein adsorption is essential for device function, non-specific protein adsorption leads to the loss of device function. For example, non-specific protein adsorption on bioimplants triggers foreign body response, in biosensors it leads to reduced signal to noise ratios, and in hybrid bionanodevices it results in the loss of confinement and directionality of molecular shuttles. Novel surface coatings are being developed to reduce or completely prevent the non-specific adsorption of proteins to surfaces. A novel quantification technique for extremely low protein coverage on surfaces has been developed. This technique utilizes measurement of the landing rate of microtubule filaments on kinesin proteins adsorbed on a surface to determine the kinesin density. Ultra-low limits of detection, dynamic range, ease of detection and availability of a ready-made kinesin-microtubule kit makes this technique highly suitable for detecting protein adsorption below the detection limits of standard techniques. Secondly, a random sequential adsorption model is presented for protein adsorption to PEO-coated surfaces. The derived analytical expressions accurately predict the observed experimental results from various research groups, suggesting that PEO chains act as almost perfect steric barriers to protein adsorption. These expressions can be used to predict the performance of a variety of systems towards resisting protein adsorption and can help in the design of better non-fouling surface coatings. Finally, in biosensing systems, target analytes are captured and concentrated on specifically adsorbed proteins for detection. Non-specific adsorption of proteins results in the loss of signal, and an increase in the background. The use of nanoscale transducers as receptors is beneficial from the point of view of signal enhancement, but has a strong mass transport limitation. To overcome this, the use of molecular shuttles has been proposed that can selectively capture analytes and actively transport them to the nanoreceptors. The effect of employing such a two-stage capture process on biosensor sensitivity is theoretically investigated and an optimum design for a kinesin-microtubule-driven hybrid biosensor is proposed.
[Effect of glutamine on small intestinal repair in weanling rats after chronic diarrhea].
Huang, Zu-xiong; Ye, Li-yan; Zheng, Zhi-yong; Chen, Xin-min; Ren, Rong-na; Tong, Guo-yuan
2005-05-01
To investigate the nutrient effect of glutamine on small intestinal repair in weanling rats after chronic diarrhea. Forty 21-day-old wistar rats were randomly divided into five groups (8 in each). Animal model of chronic diarrhea was induced by a lactose enriched diet in the weanling Wistar rat, normal control group was fed with a standard semipurified diet, and after 14 days the rats in both groups were killed to test the establishment of the model. After the establishment of the model, the other groups were fed with the standard semipurified diet to recover for 7 days, and were randomly divided into three groups: non-intervention group, glutamine (Gln)-intervention group and control group. Glutamine concentrations in blood was detected by high-performance liquid chromatography (HPLC). Morphological changes including villus height and villus surface area of the jejunum were measured under a light microscope and electron microscope, expression of proliferating cell nuclear antigen (PCNA) as an index of cell proliferation was observed using immunohistochemical staining and image analysis. The diarrhea rate in model group was 100 percent, average diarrhea index was 1.16 +/- 0.06, but both diarrhea rate and average diarrhea index in control group were 0 (P < 0.01), which affirmed establishment of the model. There was significant decrease of body weight, plasma Gln concentration, villus height, villus surface area and expression of PCNA in non-intervened group compared with the control group (P < 0.01). There was still significant decrease of body weight, villus height and villus surface area in Gln-intervened group compared with control group (P < 0.01), but plasma Gln concentration and expression of PCNA in Gln-intervened group had recovered to normal (P > 0.05). And compared with non-intervened group, except for body weight (P > 0.05), plasma glutamine, villus height, villus surface area and expression of PCNA were all significantly increased in Gln-intervened group. Chronic diarrhea can induce malnutrition and reduce the villus height, villus surface area, expression of PCNA and plasm glutamine concentration. Oral glutamine could improve the proliferation of crypt cell and promote repair of intestinal mucosa after chronic diarrhea.
Interleukin 18 function requires both interleukin 18 receptor and Na-Cl co-transporter
Wang, Jing; Sun, Chongxiu; Gerdes, Norbert; Liu, Conglin; Liao, Mengyang; Liu, Jian; Shi, Michael A.; He, Aina; Zhou, Yi; Sukhova, Galina K.; Chen, Huimei; Cheng, Xianwu; Kuzuya, Masafumi; Murohara, Toyoaki; Zhang, Jie; Cheng, Xiang; Jiang, Mengmeng; Shull, Gary E.; Rogers, Shaunessy; Yang, Chao-Ling; Ke, Qiang; Jelen, Sabina; Bindels, René; Ellison, David H.; Jarolim, Petr; Libby, Peter; Shi, Guo-Ping
2015-01-01
Interleukin-18 (IL18) participates in atherogenesis through several putative mechanisms1,2. Interruption of IL18 action reduces atherosclerosis in mice3,4. This study shows that the absence of IL18 receptor (IL18r) does not affect atherosclerosis in apolipoprotein E-deficient (Apoe−/−) mice, nor does it affect IL18 cell surface binding or signaling. IL18 antibody-mediated immunoprecipitation identified an interaction between IL18 and Na-Cl co-transporter (NCC), a 12-transmembrane-domain ion transporter protein preferentially expressed in the kidney5. Yet, we find NCC expression and colocalization with IL18r in atherosclerotic lesions and both molecules form a complex. IL18 also binds to the cell surface and induces cell signaling and down-stream cytokine expression in NCC-transfected COS-7 cells that do not express IL18r. In Apoe−/− mice, combined deficiency of IL18r and NCC, but not single deficiency, protects mice from atherosclerosis. Peritoneal macrophages from Apoe−/− mice or those lacking IL18r or NCC respond to IL18 binding or IL18 induction of cell signaling and cytokine and chemokine production, but those with combined deficiency of IL18r and NCC do not. This study identifies NCC as an IL18-binding protein that coordinates with IL18r in cell signaling, inflammatory molecule expression, and experimental atherogenesis. PMID:26099046
Lu, Zhi Hong; Kaliberov, Sergey; Zhang, Jingzhu; Muz, Barbara; Azab, Abdel K; Sohn, Rebecca E; Kaliberova, Lyudmila; Du, Yingqiu; Curiel, David T; Arbeit, Jeffrey M
2014-08-01
Vascular endothelial cells (ECs) are ideal gene therapy targets as they provide widespread tissue access and are the first contact surfaces following intravenous vector administration. Human recombinant adenovirus serotype 5 (Ad5) is the most frequently used gene transfer system because of its appreciable transgene payload capacity and lack of somatic mutation risk. However, standard Ad5 vectors predominantly transduce liver but not the vasculature following intravenous administration. We recently developed an Ad5 vector with a myeloid cell-binding peptide (MBP) incorporated into the knob-deleted, T4 fibritin chimeric fiber (Ad.MBP). This vector was shown to transduce pulmonary ECs presumably via a vector handoff mechanism. Here we tested the body-wide tropism of the Ad.MBP vector, its myeloid cell necessity, and vector-EC expression dose response. Using comprehensive multi-organ co-immunofluorescence analysis, we discovered that Ad.MBP produced widespread EC transduction in the lung, heart, kidney, skeletal muscle, pancreas, small bowel, and brain. Surprisingly, Ad.MBP retained hepatocyte tropism albeit at a reduced frequency compared with the standard Ad5. While binding specifically to myeloid cells ex vivo, multi-organ Ad.MBP expression was not dependent on circulating monocytes or macrophages. Ad.MBP dose de-escalation maintained full lung-targeting capacity but drastically reduced transgene expression in other organs. Swapping the EC-specific ROBO4 for the CMV promoter/enhancer abrogated hepatocyte expression but also reduced gene expression in other organs. Collectively, our multilevel targeting strategy could enable therapeutic biological production in previously inaccessible organs that pertain to the most debilitating or lethal human diseases.
Effect of bleaching agent extracts on murine macrophages.
Fernandes, Aletéia M M; Vilela, Polyana G F; Valera, Marcia C; Bolay, Carola; Hiller, Karl Anton; Schweikl, Helmut; Schmalz, Gottfried
2018-05-01
The aim of this study was to evaluate the cytotoxicity and the influence of bleaching agents on immunologically cell surface antigens of murine macrophages in vitro. RAW 264.7 cells were exposed to bleaching gel extracts (40% hydrogen peroxide or 20% carbamide peroxide) and different H 2 O 2 concentrations after 1 and 24-h exposure periods and 1-h exposure and 23-h recovery. Tests were performed with and without N-acetyl cysteine (NAC) and buthionine sulfoximine (BSO). Cell viability was determined by MTT assay. The expression of surface markers CD14, CD40, and CD54 with and without LPS stimulation was detected by flow cytometry, while the production of TNF-α was measured by ELISA. Statistical analysis was performed using the Mann-Whitney U test (α = 0.05). Extracts of bleaching agents were cytotoxic for cells after a 1-h exposure; cells could not recover after 24 h. This effect can be mitigated by the antioxidant NAC and increased by BSO, an inhibitor of glutathione (GSH) synthesis. LPS stimulated expression of all surface markers and TNF-α production. Exposure to bleaching agent extracts and H 2 O 2 leads to a reduction of TNF-α, CD14, and CD40 expression, while the expression of CD54 was upregulated at non-cytotoxic concentrations. Whereas NAC reduced this effect, it was increased in the presence of BSO. Extracts of bleaching agents were irreversibly cytotoxic to macrophages after a 1-h exposure. Only the expression of CD54 was upregulated. The reactions are mediated by the non-enzymatic antioxidant GSH. The addition of an antioxidant can downregulate unfavorable effects of dental bleaching.
Mckeown, Lynn; Burnham, Matthew P; Hodson, Charlotte; Jones, Owen T
2008-10-31
The dynamic expression of voltage-gated potassium channels (Kvs) at the cell surface is a fundamental factor controlling membrane excitability. In exploring possible mechanisms controlling Kv surface expression, we identified a region in the extracellular linker between the first and second of the six (S1-S6) transmembrane-spanning domains of the Kv1.4 channel, which we hypothesized to be critical for its biogenesis. Using immunofluorescence microscopy, flow cytometry, patch clamp electrophysiology, and mutagenesis, we identified a single threonine residue at position 330 within the Kv1.4 S1-S2 linker that is absolutely required for cell surface expression. Mutation of Thr-330 to an alanine, aspartate, or lysine prevented surface expression. However, surface expression occurred upon co-expression of mutant and wild type Kv1.4 subunits or mutation of Thr-330 to a serine. Mutation of the corresponding residue (Thr-211) in Kv3.1 to alanine also caused intracellular retention, suggesting that the conserved threonine plays a generalized role in surface expression. In support of this idea, sequence comparisons showed conservation of the critical threonine in all Kv families and in organisms across the evolutionary spectrum. Based upon the Kv1.2 crystal structure, further mutagenesis, and the partial restoration of surface expression in an electrostatic T330K bridging mutant, we suggest that Thr-330 hydrogen bonds to equally conserved outer pore residues, which may include a glutamate at position 502 that is also critical for surface expression. We propose that Thr-330 serves to interlock the voltage-sensing and gating domains of adjacent monomers, thereby yielding a structure competent for the surface expression of functional tetramers.
Yukata, Kiminori; Xie, Chao; Li, Tian-Fang; Takahata, Masahiko; Hoak, Donna; Kondabolu, Sirish; Zhang, Xinping; Awad, Hani A.; Schwarz, Edward M.; Beck, Christopher A.; Jonason, Jennifer H.; O’Keefe, Regis J.
2014-01-01
A stabilized tibia fracture model was used in young (8-week old) and aged (1-year old) mice to define the relative bone regenerative potential and the relative responsiveness of the periosteal progenitor population with aging and PTH 1-34 (PTH) systemic therapy. Bone regeneration was assessed through gene expressions, radiographic imaging, histology/histomorphometry, and biomechanical testing. Radiographs and microCT showed increased calcified callus tissue and enhanced bone healing in young compared to aged mice. A key mechanism involved reduced proliferation, expansion, and differentiation of periosteal progenitor cell populations in aged mice. The experiments showed that PTH increased calcified callus tissue and torsional strength with a greater response in young mice. Histology and quantitative histomorphometry confirmed that PTH increased callus tissue area due primarily to an increase in bone formation, since minimal changes in cartilage and mesenchyme tissue area occurred. Periosteum examined at 3, 5, and 7 days showed that PTH increased cyclin D1 expression, the total number of cells in the periosteum, and width of the periosteal regenerative tissue. Gene expression showed that aging delayed differentiation of both bone and cartilage tissues during fracture healing. PTH resulted in sustained Col10a1 expression consistent with delayed chondrocyte maturation, but otherwise minimally altered cartilage gene expression. In contrast, PTH 1-34 stimulated expression of Runx2 and Osterix, but resulted in reduced Osteocalcin. β-catenin staining was present in mesenchymal chondroprogenitors and chondrocytes in early fracture healing, but was most intense in osteoblastic cells at later times. PTH increased active β-catenin staining in the osteoblast populations of both young and aged mice, but had a lesser effect in cartilage. Altogether the findings show that reduced fracture healing in aging involves decreased proliferation and differentiation of stem cells lining the bone surface. While PTH 1-34 enhances the proliferation and expansion of the periosteal stem cell population and accelerates bone formation and fracture healing, the effects are proportionately reduced in aged mice compared to young mice. β-catenin is induced by PTH in early and late fracture healing and is a potential target of PTH 1-34 effects. PMID:24530870
The upper bounds of reduced axial and shear moduli in cross-ply laminates with matrix cracks
NASA Technical Reports Server (NTRS)
Lee, Jong-Won; Allen, D. H.; Harris, C. E.
1991-01-01
The present study proposes a mathematical model utilizing the internal state variable concept for predicting the upper bounds of the reduced axial and shear stiffnesses in cross-ply laminates with matrix cracks. The displacement components at the matrix crack surfaces are explicitly expressed in terms of the observable axial and shear strains and the undamaged material properties. The reduced axial and shear stiffnesses are predicted for glass/epoxy and graphite/epoxy laminates. Comparison of the model with other theoretical and experimental studies is also presented to confirm direct applicability of the model to angle-ply laminates with matrix cracks subjected to general in-plane loading.
Indian hedgehog roles in post-natal TMJ development and organization.
Ochiai, T; Shibukawa, Y; Nagayama, M; Mundy, C; Yasuda, T; Okabe, T; Shimono, K; Kanyama, M; Hasegawa, H; Maeda, Y; Lanske, B; Pacifici, M; Koyama, E
2010-04-01
Indian hedgehog (Ihh) is essential for embryonic mandibular condylar growth and disc primordium formation. To determine whether it regulates those processes during post-natal life, we ablated Ihh in cartilage of neonatal mice and assessed the consequences on temporomandibular joint (TMJ) growth and organization over age. Ihh deficiency caused condylar disorganization and growth retardation and reduced polymorphic cell layer proliferation. Expression of Sox9, Runx2, and Osterix was low, as was that of collagen II, collagen I, and aggrecan, thus altering the fibrocartilaginous nature of the condyle. Though a disc formed, it exhibited morphological defects, partial fusion with the glenoid bone surface, reduced synovial cavity space, and, unexpectedly, higher lubricin expression. Analysis of the data shows, for the first time, that continuous Ihh action is required for completion of post-natal TMJ growth and organization. Lubricin overexpression in mutants may represent a compensatory response to sustain TMJ movement and function.
Aboud, Lindsay; Ball, Terry Blake; Tjernlund, Annelie; Burgener, Adam
2014-01-01
Antiproteases play diverse roles in nature, from regulating protease activity to innate defense against microorganisms. Recently, antiproteases have been shown to play important roles in HIV pathogenesis including, inhibiting HIV binding and replication and reducing activation and inflammation of susceptible cells. They have also been implicated as one of the initial host responders, in plasma, to control replication of HIV. More recently, antiproteases expressed at the mucosal surface have been linked to reduced susceptibility to HIV infection in HIV-exposed sero-negative individuals. These factors are expressed in the epithelial layer of the female genital tract, thus at the frontline of defense against mucosal infection. This review focuses on the specific antimicrobial roles of antiproteases, focusing on serpins and cystatins, with an emphasis on their known and potential roles in HIV infection. Their potential as therapeutic interventions to combat HIV is also discussed. © 2013 John Wiley & Sons Ltd.
Paehler Vor der Nolte, Anja; Chodisetti, Giriprakash; Yuan, Zhenglin; Busch, Florian; Riederer, Brigitte; Luo, Min; Yu, Yan; Menon, Manoj B; Schneider, Andreas; Stripecke, Renata; Nikolovska, Katerina; Yeruva, Sunil; Seidler, Ursula
2017-07-01
Following superficial injury, neighbouring gastric epithelial cells close the wound by rapid cell migration, a process called epithelial restitution. Na + /H + exchange (NHE) inhibitors interfere with restitution, but the role of the different NHE isoforms expressed in gastric pit cells has remained elusive. The role of the basolaterally expressed NHE1 (Slc9a1) and the presumably apically expressed NHE2 (Slc9a2) in epithelial restitution was investigated in the nontransformed rat gastric surface cell line RGM1. Migration velocity was assessed by loading the cells with the fluorescent dye DiR and following closure of an experimental wound over time. Since RGM1 cells expressed very low NHE2 mRNA and have low transport activity, NHE2 was introduced by lentiviral gene transfer. In medium with pH 7.4, RGM1 cells displayed slow wound healing even in the absence of growth factors and independently of NHE activity. Growth factors accelerated wound healing in a partly NHE1-dependent fashion. Preincubation with acidic pH 7.1 stimulated restitution in a NHE1-dependent fashion. When pH 7.1 was maintained during the restitution period, migratory speed was reduced to ∼10% of the speed at pH 7,4, and the residual restitution was further inhibited by NHE1 inhibition. Lentiviral NHE2 expression increased the steady-state pH i and reduced the restitution velocity after low pH preincubation, which was reversible by pharmacological NHE2 inhibition. The results demonstrate that in RGM1 cells, migratory velocity is increased by NHE1 activation, while NHE2 activity inhibit this process. A differential activation of NHE1 and NHE2 may therefore, play a role in the initiation and completion of the epithelial restitution process. © 2016 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adebiyi, Adebowale, E-mail: aadebiyi@uthsc.edu; Soni, Hitesh; John, Theresa A.
Angiotensin II (ANG-II) receptors (AGTRs) contribute to renal physiology and pathophysiology, but the underlying mechanisms that regulate AGTR function in glomerular mesangium are poorly understood. Here, we show that AGTR1 is the functional AGTR subtype expressed in neonatal pig glomerular mesangial cells (GMCs). Cyclodextrin (CDX)-mediated cholesterol depletion attenuated cell surface AGTR1 protein expression and ANG-II-induced intracellular Ca{sup 2+} ([Ca{sup 2+}]{sub i}) elevation in the cells. The COOH-terminus of porcine AGTR1 contains a caveolin (CAV)-binding motif. However, neonatal GMCs express CAV-1, but not CAV-2 and CAV-3. Colocalization and in situ proximity ligation assay detected an association between endogenous AGTR1 and CAV-1more » in the cells. A synthetic peptide corresponding to the CAV-1 scaffolding domain (CSD) sequence also reduced ANG-II-induced [Ca{sup 2+}]{sub i} elevation in the cells. Real-time imaging of cell growth revealed that ANG-II stimulates neonatal GMC proliferation. ANG-II-induced GMC growth was attenuated by EMD 66684, an AGTR1 antagonist; BAPTA, a [Ca{sup 2+}]{sub i} chelator; KN-93, a Ca{sup 2+}/calmodulin-dependent protein kinase II inhibitor; CDX; and a CSD peptide, but not PD 123319, a selective AGTR2 antagonist. Collectively, our data demonstrate [Ca{sup 2+}]{sub i}-dependent proliferative effect of ANG-II and highlight a critical role for lipid raft microdomains in AGTR1-mediated signal transduction in neonatal GMCs. - Highlights: • AGTR1 is the functional AGTR subtype expressed in neonatal mesangial cells. • Endogenous AGTR1 associates with CAV-1 in neonatal mesangial cells. • Lipid raft disruption attenuates cell surface AGTR1 protein expression. • Lipid raft disruption reduces ANG-II-induced [Ca{sup 2+}]{sub i} elevation in neonatal mesangial cells. • Lipid raft disruption inhibits ANG-II-induced neonatal mesangial cell growth.« less
Carraway, K L; Price-Schiavi, S A; Komatsu, M; Idris, N; Perez, A; Li, P; Jepson, S; Zhu, X; Carvajal, M E; Carraway, C A
2000-01-01
Sialomucin complex (SMC, MUC4) is a high Mr glycoprotein heterodimer, composed of mucin (ASGP-1) and transmembrane (ASGP-2) subunits. ASGP-2 contains two EGF-like domains and acts as an intramembrane ligand for the receptor tyrosine kinase ErbB2. Transfection studies with SMC DNAs showed that SMC expression could markedly reduce both cell-cell and cell-matrix interactions in vitro and increase the growth of primary tumors and the formation of metastatic foci of human A375 melanoma cells as xenotransplants in nude mice, possibly through the ability to suppress apoptosis. SMC is expressed in most vulnerable epithelia as a protective agent, which is found in both membrane and soluble forms at luminal surfaces and secreted into fluids such as milk and tears. SMC appears to be constitutively expressed by most accessible epithelia, notable exceptions being the mammary gland and uterine luminal epithelium, in which it is tightly regulated during pregnancy. Down-regulation at the luminal uterine surface appears necessary for blastocyst implantation. TGF-b is a potent repressor of SMC expression in the mammary gland and uterus, though by different mechanisms. These combined results suggest that SMC has multiple functions in epithelia and is tightly regulated in those tissues where its special functions are required.
Winterhoff, Boris J N; Arlt, Alexander; Duttmann, Angelika; Ungefroren, Hendrik; Schäfer, Heiner; Kalthoff, Holger; Kruse, Marie-Luise
2012-03-01
The present study investigated the expression and localisation of FAP-1 (Fas associated phosphatase-1) and CD95 in a 3D differentiation model in comparison to 2D monolayers of the pancreatic adenocarcinoma cell line A818-6. Under non-adherent growth conditions, A818-6 cells differentiate into 3D highly organised polarised epithelial hollow spheres, resembling duct-like structures. A818-6 cells showed a differentiation-dependent FAP-1 localisation. Cells grown as 2D monolayers revealed FAP-1 staining in a juxtanuclear cisternal position, as well as localisation in the nucleus. After differentiation into hollow spheres, FAP-1 was relocated towards the actin cytoskeleton beneath the outer plasma membrane of polarised cells and no further nuclear localisation was observed. CD95 surface staining was found only in a subset of A818-6 monolayer cells, while differentiated hollow spheres appeared to express CD95 in all cells of a given sphere. We rarely observed co-localisation of CD95 and FAP-1 in A818-6 monolayer cells, but strong co-localisation beneath the outer plasma membrane in polarised cells. Analysis of surface expression by flow cytometry revealed that only a subset (36%) of monolayer cells showed CD95 surface expression, and after induction of hollow spheres, CD95 presentation at the outer plasma membrane was reduced to 13% of hollow spheres. Induction of apoptosis by stimulation with agonistic anti-CD95 antibodies, resulted in increased caspase activity in both, monolayer cells and hollow spheres. Knock down of FAP-1 mRNA in A818-6 monolayer cells did not alter resposiveness to CD95 agonistic antibodies. These data suggested that CD95 signal transduction was not affected by FAP-1 expression in A818-6 monolayer cells. In differentiated 3D hollow spheres, we found a polarisation-induced co-localisation of CD95 and FAP-1. A tight control of receptor surface representation and signalling induced apoptosis ensures controlled removal of individual cells instead of a "snowball effect" of apoptotic events. Copyright © 2011 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.
Goel, Suchi; Muthusamy, Arivalagan; Miao, Jun; Cui, Liwang; Salanti, Ali; Winzeler, Elizabeth A.; Gowda, D. Channe
2014-01-01
The Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family proteins mediate the adherence of infected erythrocytes to microvascular endothelia of various organs, including the placenta, thereby contributing to cerebral, placental, and other severe malaria pathogenesis. Several parasite proteins, including KAHRP and PfEMP3, play important roles in the cytoadherence by mediating the clustering of PfEMP1 in rigid knoblike structures on the infected erythrocyte surface. The lack of a subtelomeric region of chromosome 2 that contains kahrp and pfemp3 causes reduced cytoadherence. In this study, microarray transcriptome analysis showed that the absence of a gene cluster, comprising kahrp, pfemp3, and four other genes, results in the loss of parasitized erythrocytes adhering to chondroitin 4-sulfate (C4S). The role of one of these genes, PF3D7_0201600/PFB0080c, which encodes PHISTb (Plasmodium helical interspersed subtelomeric b) domain-containing RESA-like protein 1 expressed on the infected erythrocyte surface, was investigated. Disruption of PFB0080c resulted in increased var2csa transcription and VAR2CSA surface expression, leading to higher C4S-binding capacity of infected erythrocytes. Further, PFB0080c-knock-out parasites stably maintained the C4S adherence through many generations of growth. Although the majority of PFB0080c-knock-out parasites bound to C4S even after culturing for 6 months, a minor population bound to both C4S and CD36. These results strongly suggest that the loss of PFB0080c markedly compromises the var gene switching process, leading to a marked reduction in the switching rate and additional PfEMP1 expression by a minor population of parasites. PFB0080c interacts with VAR2CSA and modulates knob-associated Hsp40 expression. Thus, PFB0080c may regulate VAR2CSA expression through these processes. Overall, we conclude that PFB0080c regulates PfEMP1 expression and the parasite's cytoadherence. PMID:25342752
Changes in Monocyte Functions of Astronauts
NASA Technical Reports Server (NTRS)
Kaur, I.; Simons, E.; Castro, V.; Ott, C. Mark; Pierson, Duane L.
2004-01-01
Monocyte cell numbers and functions, including phagocytosis, oxidative burst capacity, and degranulation and expression of related surface molecules, were studied in blood specimens from 25 astronauts and 9 healthy control subjects. Blood samples were obtained 10 days before a space flight, 3 hours after landing and 3 days after landing. The number of monocytes in astronauts did not change significantly among the three sample collection periods. Following space flight, the monocytes ability to phagocytize Escherichia coli, to exhibit an oxidative burst, and to degranulate was reduced as compared to monocytes from control subjects. These alterations in monocyte functions after space flight correlated with alterations in the expression of CD32 and CD64.
Use of CFD Analyses to Predict Disk Friction Loss of Centrifugal Compressor Impellers
NASA Astrophysics Data System (ADS)
Cho, Leesang; Lee, Seawook; Cho, Jinsoo
To improve the total efficiency of centrifugal compressors, it is necessary to reduce disk friction loss, which is expressed as the power loss. In this study, to reduce the disk friction loss due to the effect of axial clearance and surface roughness is analyzed and methods to reduce disk friction loss are proposed. The rotating reference frame technique using a commercial CFD tool (FLUENT) is used for steady-state analysis of the centrifugal compressor. Numerical results of the CFD analysis are compared with theoretical results using established experimental empirical equations. The disk friction loss of the impeller is decreased in line with increments in axial clearance until the axial clearance between the impeller disk and the casing is smaller than the boundary layer thickness. In addition, the disk friction loss of the impeller is increased in line with the increments in surface roughness in a similar pattern as that of existing experimental empirical formulas. The disk friction loss of the impeller is more affected by the surface roughness than the change of the axial clearance. To minimize disk friction loss on the centrifugal compressor impeller, the axial clearance and the theoretical boundary layer thickness should be designed to be the same. The design of the impeller requires careful consideration in order to optimize axial clearance and minimize surface roughness.
Targeting of drugs and nanoparticles to tumors
Bhatia, Sangeeta N.; Sailor, Michael J.
2010-01-01
The various types of cells that comprise the tumor mass all carry molecular markers that are not expressed or are expressed at much lower levels in normal cells. These differentially expressed molecules can be used as docking sites to concentrate drug conjugates and nanoparticles at tumors. Specific markers in tumor vessels are particularly well suited for targeting because molecules at the surface of blood vessels are readily accessible to circulating compounds. The increased concentration of a drug in the site of disease made possible by targeted delivery can be used to increase efficacy, reduce side effects, or achieve some of both. We review the recent advances in this delivery approach with a focus on the use of molecular markers of tumor vasculature as the primary target and nanoparticles as the delivery vehicle. PMID:20231381
Behner, Laura; Zimmermann, Louisa; Ringel, Marc; Weis, Michael; Maisner, Andrea
2018-05-01
Hendra virus (HeV) and Nipah virus (NiV) are highly pathogenic henipaviruses originating from fruit bats in Australia and Asia that can cause severe infections in livestock and humans. In recent years, also African bat henipaviruses were identified at the nucleic acid level. To assess their potential to replicate in non-bat species, several studies were performed to characterize the two surface glycoproteins required for virus entry and spread by cell-cell fusion. It has been shown that surface expression and fusion-helper function of the receptor-binding G protein of Kumasi virus (KV), the prototypic Ghanaian bat henipavirus, is reduced compared to other non-African henipavirus G proteins. Immunostainings and pulse-chase analysis revealed a delayed export of KV G from the ER. As defects in oligomerization of viral glycoproteins can be responsible for limited surface transport thereby restricting the bioactivity, we analyzed the oligomerization pattern of KV G. In contrast to HeV and NiV whose G proteins are known to be expressed at a dimer-tetramer ratio of 1:1, KV G almost exclusively formed stable tetramers or higher oligomers. KV G also showed less stringent requirements for defined stalk cysteines to form dimers and tetramers. Interestingly, any changes in the oligomeric forms negatively affected the fusion-helper activity although surface expression and receptor binding was unchanged. This clearly indicates that the formation of mostly higher oligomeric KV G forms is not a deficiency responsible for ER retention, but is rather a basic structural feature essential for the bioactivity of this African bat henipavirus glycoprotein. Copyright © 2018 Elsevier B.V. All rights reserved.
Liberio, Michelle S.; Sadowski, Martin C.; Soekmadji, Carolina; Davis, Rohan A.; Nelson, Colleen C.
2014-01-01
Weak cell-surface adhesion of cell lines to tissue culture surfaces is a common problem and presents technical limitations to the design of experiments. To overcome this problem, various surface coating protocols have been developed. However, a comparative and precise real-time measurement of their impact on cell behavior has not been conducted. The prostate cancer cell line LNCaP, derived from a patient lymph node metastasis, is a commonly used model system in prostate cancer research. However, the cells’ characteristically weak attachment to the surface of tissue culture vessels and cover slips has impeded their manipulation and analysis and use in high throughput screening. To improve the adherence of LNCaP cells to the culture surface, we compared different coating reagents (poly-l-lysine, poly-l-ornithine, collagen type IV, fibronectin, and laminin) and culturing conditions and analyzed their impact on cell proliferation, adhesion, morphology, mobility and gene expression using real-time technologies. The results showed that fibronectin, poly-l-lysine and poly-l-ornithine improved LNCaP cells adherence and provoked cell morphology alterations, such as increase of nuclear and cellular area. These coating reagents also induced a higher expression of F-actin and reduced cell mobility. In contrast, laminin and collagen type IV did not improve adherence but promoted cell aggregation and affected cell morphology. Cells cultured in the presence of laminin displayed higher mobility than control cells. All the coating conditions significantly affected cell viability; however, they did not affect the expression of androgen receptor-regulated genes. Our comparative findings provide important insight for the selection of the ideal coating reagent and culture conditions for the cancer cell lines with respect to their effect on proliferation rate, attachment, morphology, migration, transcriptional response and cellular cytoskeleton arrangement. PMID:25375165
Carbohydrate Coating Reduces Adhesion of Biofilm-Forming Bacillus subtilis to Gold Surfaces
Kesel, S.; Mader, A.; Seeberger, P. H.; Lieleg, O.
2014-01-01
The growth of bacterial biofilms in pipes and food tanks causes severe problems in industry. Biofilms growing on medical implants or catheters are of great concern, as they can cause serious infections and decrease the functionality of the medical device. The prevention of bacterial adhesion—the first step in colonization and biofilm formation—is therefore very important. Current research comprises alterations in surface properties, the prevention of adhesin biosynthesis, inhibition with receptor analogs, or the development of anti-adhesive vaccines. We present a new approach that allows us to study bacterial adhesion with high sensitivity in real-time while testing several different surfaces in parallel. Using the cantilever-array technique we demonstrate that coating of gold surfaces with mono- or disaccharides results in a reduction of the bacterial adhesion of the biofilm-forming bacterium Bacillus subtilis NCIB 3610 to these gold surfaces. This reduction in bacterial adhesion is independent of the studied carbohydrate. Using several mutant strains, we investigate the underlying molecular interactions, and our results suggest that adhesion to gold surfaces is mediated by thiol groups present in proteins of the bacterial cell membrane or biofilm matrix proteins expressed at low levels by the wild-type strain. Furthermore, our data indicate that the adhesion of B. subtilis NCIB 3610 to carbohydrate-coated gold surfaces is facilitated by interactions between carbohydrates installed on the cantilever gold surface and an exopolysaccharide expressed by this strain. Understanding general and specific contributions of molecular interactions mediating bacterial adhesion will enable its prevention in the future. PMID:25038098
Anderson, Ericka L; Cole, Jason N; Olson, Joshua; Ryba, Bryan; Ghosh, Partho; Nizet, Victor
2014-02-07
Group A Streptococcus (GAS) is a leading human pathogen producing a diverse array of infections from simple pharyngitis ("strep throat") to invasive conditions, including necrotizing fasciitis and toxic shock syndrome. The surface-anchored GAS M1 protein is a classical virulence factor that promotes phagocyte resistance and exaggerated inflammation by binding host fibrinogen (Fg) to form supramolecular networks. In this study, we used a virulent WT M1T1 GAS strain and its isogenic M1-deficient mutant to examine the role of M1-Fg binding in a proximal step in GAS infection-interaction with the pharyngeal epithelium. Expression of the M1 protein reduced GAS adherence to human pharyngeal keratinocytes by 2-fold, and this difference was increased to 4-fold in the presence of Fg. In stationary phase, surface M1 protein cleavage by the GAS cysteine protease SpeB eliminated Fg binding and relieved its inhibitory effect on GAS pharyngeal cell adherence. In a mouse model of GAS colonization of nasal-associated lymphoid tissue, M1 protein expression was associated with an average 6-fold decreased GAS recovery in isogenic strain competition assays. Thus, GAS M1 protein-Fg binding reduces GAS pharyngeal cell adherence and colonization in a fashion that is counterbalanced by SpeB. Inactivation of SpeB during the shift to invasive GAS disease allows M1-Fg binding, increasing pathogen phagocyte resistance and proinflammatory activities.
[Over-expression of BDNF inhibits angiotensin II-induced apoptosis of cardiomyocytes in SD rats].
Cao, Jingli; Wu, Yingfeng; Liu, Geming; Li, Zhenlong
2018-03-01
Objective To investigate the role and molecular mechanism of brain-derived neurotrophic factor (BDNF) against the process of cardiomyocyte hypertrophy and apoptosis. Methods Cardiomyocyte hypertrophy were estabolished by angiotensin II (Ang II) in neonatal cardiomyocytes in vitro and incomplete ligature of abdominal aorta of SD rats in vivo. BDNF over-expressing recombinant vector pcDNA5-BDNF was transfected into cardiomyocytes by liposomes. Immunofluorescence staining was used to detect the effect of BDNF transfection on the surface area of myocardial cells. The effect of BDNF transfection on the apoptosis of cardiomyocytes was assayed by flow cytometry. Real-time fluorescent quantitative PCR was performed to detect the effect of over-expression of BDNF on the expressions of atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) mRNAs in cardiomyocytes. Western blot assay was used to observe the changes of BDNF, ANP and BNP, calmodulin kinase 2 (CaMK2) and phosphorylated calmodulin kinase 2 (p-CaMK2), calcineurin (CaN), p-CaN, nuclear factor of activated T cells 3 (NFATC3) and p-NFATC3 protein expressions in the myocardial tissues and cardiomyocytes. Results The expression of BDNF protein increased significantly in cardiac hypertrophy animal and cell models in a time-dependent manner. Compared with the untransfected control cardiomyocytes, the surface area of cardiomyocytes, the rate of apoptosis, the levels of ANP and BNP mRNA and protein expression, the levels of p-CaMK2 and CaN protein in the BDNF over-expressed cardiomyocytes were remarkably reduced, while the level of p-NFATC3 protein rose significantly. Conclusion BDNF inhibits the apoptosis of cardiomyocytes induced by Ang II, and it plays the role by inhibiting CaMK2 and CaN signaling pathways.
Buferne, Michel; Chasson, Lionel; Grange, Magali; Mas, Amandine; Arnoux, Fanny; Bertuzzi, Mélanie; Naquet, Philippe; Leserman, Lee; Schmitt-Verhulst, Anne-Marie; Auphan-Anezin, Nathalie
2015-01-01
Tumors with reduced expression of MHC class I (MHC-I) molecules may be unrecognized by tumor antigen-specific CD8+ T cells and thus constitute a challenge for cancer immunotherapy. Here we monitored development of autochthonous melanomas in TiRP mice that develop tumors expressing a known tumor antigen as well as a red fluorescent protein (RFP) reporter knock in gene. The latter permits non-invasive monitoring of tumor growth by biofluorescence. One developing melanoma was deficient in cell surface expression of MHC-I, but MHC-I expression could be rescued by exposure of these cells to IFNγ. We show that CD8+ T cells specific for tumor antigen/MHC-I were efficient at inducing regression of the MHC-I-deficient melanoma, provided that the T cells were endowed with properties permitting their migration into the tumor and their efficient production of IFNγ. This was the case for CD8+ T cells transfected to express an active form of STAT5 (STAT5CA). The amount of IFNγ produced ex vivo from T cells present in tumors after adoptive transfer of the CD8+ T cells was correlated with an increase in surface expression of MHC-I molecules by the tumor cells. We also show that these CD8+ T cells expressed PD-1 and upregulated its ligand PDL-1 on melanoma cells within the tumor. Despite upregulation of this immunosuppressive pathway, efficient IFNγ production in the melanoma microenvironment was found associated with resistance of STAT5CA-expressing CD8+ T cells to inhibition both by PD-1/PDL-1 engagement and by TGFβ1, two main immune regulatory mechanisms hampering the efficiency of immunotherapy in patients. PMID:25949872
Prulière-Escabasse, Virginie; Planès, Carole; Escudier, Estelle; Fanen, Pascale; Coste, André; Clerici, Christine
2007-11-23
Sodium 4-phenylbutyrate (4-PBA) has been shown to correct the cellular trafficking of several mutant or nonmutant plasma membrane proteins such as cystic fibrosis transmembrane conductance regulator through the expression of 70-kDa heat shock proteins. The objective of the study was to determine whether 4-PBA may influence the functional expression of epithelial sodium channels (ENaC) in human nasal epithelial cells (HNEC). Using primary cultures of HNEC, we demonstrate that 4-PBA (5 mm for 6 h) markedly stimulated amiloride-sensitive sodium channel activity and that this was related to an increased abundance of alpha-, beta-, and gamma-ENaC subunits in the apical membrane. The increase in ENaC cell surface expression (i) was due to insertion of newly ENaC subunits as determined by brefeldin A experiments and (ii) was not associated with cell surface retention of ENaC subunits because endocytosis of ENaC subunits was unchanged. In addition, we find that ENaC co-immunoprecipitated with the heat shock protein constitutively expressed Hsc70, that has been reported to modulate ENaC trafficking, and that 4-PBA decreased Hsc70 protein level. Finally, we report that in cystic fibrosis HNEC obtained from two cystic fibrosis patients, 4-PBA increased functional expression of ENaC as demonstrated by the increase in amiloride-sensitive sodium transport and in alpha-, beta-, and gamma-ENaC subunit expression in the apical membrane. Our results suggest that in HNEC, 4-PBA increases the functional expression of ENaC through the insertion of new alpha-, beta-, and gamma-ENaC subunits into the apical membrane and also suggest that 4-PBA could modify ENaC trafficking by reducing Hsc70 protein expression.
Characterization of novel biomarkers in selecting for subtype specific medulloblastoma phenotypes.
Liang, Lisa; Aiken, Christopher; McClelland, Robyn; Morrison, Ludivine Coudière; Tatari, Nazanin; Remke, Marc; Ramaswamy, Vijay; Issaivanan, Magimairajan; Ryken, Timothy; Del Bigio, Marc R; Taylor, Michael D; Werbowetski-Ogilvie, Tamra E
2015-11-17
Major research efforts have focused on defining cell surface marker profiles for characterization and selection of brain tumor stem/progenitor cells. Medulloblastoma is the most common primary malignant pediatric brain cancer and consists of 4 molecular subgroups: WNT, SHH, Group 3 and Group 4. Given the heterogeneity within and between medulloblastoma variants, surface marker profiles may be subtype-specific. Here, we employed a high throughput flow cytometry screen to identify differentially expressed cell surface markers in self-renewing vs. non-self-renewing SHH medulloblastoma cells. The top 25 markers were reduced to 4, CD271/p75NTR/NGFR, CD106/VCAM1, EGFR and CD171/NCAM-L1, by evaluating transcript levels in SHH tumors relative to samples representing the other variants. However, only CD271/p75NTR/NGFR and CD171/NCAM-L1 maintain differential expression between variants at the protein level. Functional characterization of CD271, a low affinity neurotrophin receptor, in cell lines and primary cultures suggested that CD271 selects for lower self-renewing progenitors or stem cells. Moreover, CD271 levels were negatively correlated with expression of SHH pathway genes. Our study reveals a novel role for CD271 in SHH medulloblastoma and suggests that targeting CD271 pathways could lead to the design of more selective therapies that lessen the broad impact of current treatments on developing nervous systems.
Luo, Hongyu; Wu, Zenghui; Qi, Shijie; Jin, Wei; Han, Bing; Wu, Jiangping
2011-01-01
IL-7 plays vital roles in thymocyte development, T cell homeostasis, and the survival of these cells. IL-7 receptor α (IL-7Rα) on thymocytes and T cells is rapidly internalized upon IL-7 ligation. Ephrins (Efns) are cell surface molecules and ligands of the largest receptor kinase family, Eph kinases. We discovered that T cell-specific double gene knock-out (dKO) of Efnb1 and Efnb2 in mice led to reduced IL-7Rα expression in thymocytes and T cells, and that IL-7Rα down-regulation was accelerated in dKO CD4 cells upon IL-7 treatment. On the other hand, Efnb1 and Efnb2 overexpression on T cell lymphoma EL4 cells retarded IL-7Rα down-regulation. dKO T cells manifested compromised STAT5 activation and homeostatic proliferation, an IL-7-dependent process. Fluorescence resonance energy transfer and immunoprecipitation demonstrated that Efnb1 and Efnb2 interacted physically with IL-7Rα. Such interaction likely retarded IL-7Rα internalization, as Efnb1 and Efnb2 were not internalized. Therefore, we revealed a novel function of Efnb1 and Efnb2 in stabilizing IL-7Rα expression at the post-translational level, and a previously unknown modus operandi of Efnbs in the regulation of expression of other vital cell surface receptors. PMID:22069310
Deep Coherent Vortices and Their Sea Surface Expressions
NASA Astrophysics Data System (ADS)
Ienna, Federico; Bashmachnikov, Igor; Dias, Joaquim; Peliz, Alvaro
2017-04-01
Mediterranean Water eddies, known as Meddies, are an important dynamic process occurring at depths of 1000-meters in the Northeast Atlantic Ocean. Meddies occur as a direct result of the Mediterranean Outflow exiting through the Gibraltar Strait, and represent a prevalent mechanism that can be found extensively throughout the ocean. Moreover, Meddy cores are known to produce measurable expressions at the sea surface in the form of rotating coherent vortices, not only affecting the sea surface from beneath, but also allowing for the possibility to remotely study these deep phenomena through data gathered at the sea surface. While many past studies have focused on the properties of Meddy cores, only a handful of studies focus on the physical characteristics and behavior of the surface expressions produced. Are Meddy surface expressions different from other like vortices that dominate the physical ocean surface? What are the relationships between deep and surface mechanisms, and do any feedbacks exist? To shed light on these questions, we investigate the relationship between Meddies and their sea-surface expressions through observations using in-situ float and drifter profiles and satellite altimetry. A total of 782 Meddy cores were examined in the Northeast Atlantic using temperature and salinity data obtained by CTD and Argo during the Mecanismos de transporte e de dispersão da Água Mediterrânica no Atlântico Nordeste (MEDTRANS) project, and their corresponding sea-level expressions were geo-temporally matched in satellite altimetry data. We report several statistical properties of the sea-surface expressions of Meddies, including their mean diameter and vertical magnitude, and compare the properties of their surface features to the underlying Meddy cores. We investigate how the deep core affects the surface, and whether surface expressions may in return yield information about the underlying cores. Additionally, we examine the variability of the surface expressions, including seasonal and geographical variability.
Gumireddy, Kiranmai; Li, Anping; Kossenkov, Andrew V.; Sakurai, Masayuki; Yan, Jinchun; Li, Yan; Xu, Hua; Wang, Jian; Zhang, Paul J.; Zhang, Lin; Showe, Louise C.; Nishikura, Kazuko; Huang, Qihong
2016-01-01
Metastasis is a critical event affecting breast cancer patient survival. To identify molecules contributing to the metastatic process, we analysed The Cancer Genome Atlas (TCGA) breast cancer data and identified 41 genes whose expression is inversely correlated with survival. Here we show that GABAA receptor alpha3 (Gabra3), normally exclusively expressed in adult brain, is also expressed in breast cancer, with high expression of Gabra3 being inversely correlated with breast cancer survival. We demonstrate that Gabra3 activates the AKT pathway to promote breast cancer cell migration, invasion and metastasis. Importantly, we find an A-to-I RNA-edited form of Gabra3 only in non-invasive breast cancers and show that edited Gabra3 suppresses breast cancer cell invasion and metastasis. A-to-I-edited Gabra3 has reduced cell surface expression and suppresses the activation of AKT required for cell migration and invasion. Our study demonstrates a significant role for mRNA-edited Gabra3 in breast cancer metastasis. PMID:26869349
Gumireddy, Kiranmai; Li, Anping; Kossenkov, Andrew V; Sakurai, Masayuki; Yan, Jinchun; Li, Yan; Xu, Hua; Wang, Jian; Zhang, Paul J; Zhang, Lin; Showe, Louise C; Nishikura, Kazuko; Huang, Qihong
2016-02-12
Metastasis is a critical event affecting breast cancer patient survival. To identify molecules contributing to the metastatic process, we analysed The Cancer Genome Atlas (TCGA) breast cancer data and identified 41 genes whose expression is inversely correlated with survival. Here we show that GABAA receptor alpha3 (Gabra3), normally exclusively expressed in adult brain, is also expressed in breast cancer, with high expression of Gabra3 being inversely correlated with breast cancer survival. We demonstrate that Gabra3 activates the AKT pathway to promote breast cancer cell migration, invasion and metastasis. Importantly, we find an A-to-I RNA-edited form of Gabra3 only in non-invasive breast cancers and show that edited Gabra3 suppresses breast cancer cell invasion and metastasis. A-to-I-edited Gabra3 has reduced cell surface expression and suppresses the activation of AKT required for cell migration and invasion. Our study demonstrates a significant role for mRNA-edited Gabra3 in breast cancer metastasis.
Radial orbit error reduction and sea surface topography determination using satellite altimetry
NASA Technical Reports Server (NTRS)
Engelis, Theodossios
1987-01-01
A method is presented in satellite altimetry that attempts to simultaneously determine the geoid and sea surface topography with minimum wavelengths of about 500 km and to reduce the radial orbit error caused by geopotential errors. The modeling of the radial orbit error is made using the linearized Lagrangian perturbation theory. Secular and second order effects are also included. After a rather extensive validation of the linearized equations, alternative expressions of the radial orbit error are derived. Numerical estimates for the radial orbit error and geoid undulation error are computed using the differences of two geopotential models as potential coefficient errors, for a SEASAT orbit. To provide statistical estimates of the radial distances and the geoid, a covariance propagation is made based on the full geopotential covariance. Accuracy estimates for the SEASAT orbits are given which agree quite well with already published results. Observation equations are develped using sea surface heights and crossover discrepancies as observables. A minimum variance solution with prior information provides estimates of parameters representing the sea surface topography and corrections to the gravity field that is used for the orbit generation. The simulation results show that the method can be used to effectively reduce the radial orbit error and recover the sea surface topography.
Soto, Lilian; Ferrier, Ashley; Aravena, Octavio; Fonseca, Elianet; Berendsen, Jorge; Biere, Andrea; Bueno, Daniel; Ramos, Verónica; Aguillón, Juan Carlos; Catalán, Diego
2015-01-01
The activation threshold of B cells is tightly regulated by an array of inhibitory and activator receptors in such a way that disturbances in their expression can lead to the appearance of autoimmunity. The aim of this study was to evaluate the expression of activating and inhibitory molecules involved in the modulation of B cell functions in transitional, naive, and memory B-cell subpopulations from systemic sclerosis patients. To achieve this, blood samples were drawn from 31 systemic sclerosis patients and 53 healthy individuals. Surface expression of CD86, MHC II, CD19, CD21, CD40, CD22, Siglec 10, CD35, and FcγRIIB was determined by flow cytometry. IL-10 production was evaluated by intracellular flow cytometry from isolated B cells. Soluble IL-6 and IL-10 levels were measured by ELISA from supernatants of stimulated B cells. Systemic sclerosis patients exhibit an increased frequency of transitional and naive B cells related to memory B cells compared with healthy controls. Transitional and naive B cells from patients express higher levels of CD86 and FcγRIIB than healthy donors. Also, B cells from patients show high expression of CD19 and CD40, whereas memory cells from systemic sclerosis patients show reduced expression of CD35. CD19 and CD35 expression levels associate with different autoantibody profiles. IL-10+ B cells and secreted levels of IL-10 were markedly reduced in patients. In conclusion, systemic sclerosis patients show alterations in the expression of molecules involved in B-cell regulation. These abnormalities may be determinant in the B-cell hyperactivation observed in systemic sclerosis. PMID:26483788
Liang, N W; Shi, L; Huang, Y; Deng, X L
2017-02-18
To study the role of different scale structure of Ti implants on the biological behaviors of human umbilical vein endothelial cell (HUVECs) and to reveal the role of material surface topographical features on peri-implant angiogenesis. Titanium (Ti) discs with different surface structures (Ti discs with smooth surface, Ti discs with nano scale structure, Ti discs with micro scale structure and Ti discs with micro/nano scale structure, named as SM-Ti, Nano-Ti, Micro-Ti and Micro/Nano-Ti, respectively) were prepared and their surface topographical features were confirmed via scanning electron microscopy (SEM) observation. HUVECs were cultured on these Ti discs. Biological outcomes of HUVECs on different surfaces were carried out, including cell adhesive capacity, proliferation, vascular endothelial growth factor (VEGF) production and intracellular expression of Ca(2+). The results of SEM images and immunofluorescence double staining of rhodamine-phalloidin and DAPI showed that compared with the SM-Ti and Nano-Ti group, the adhesive capacity and proliferation behavior of HUVECs on the surfaces of Micro-Ti and Micro/Nano-Ti was decreased. The results of culturing HUVECs on different groups of Ti discs after 24 hours showed that the cells number grew from (18±4) to (42±6)/ vision on SM-Ti, (28±6) to (52±10)/vision on Nano-Ti, (20±4) to (21±6)/vision on Micro-Ti and (16±4) to (18±6)/vision on Micro/Nano-Ti. Moreover, compared with the adhesion and proliferation of HUVECs on SM-Ti group and Nano-Ti, the adhesion and proliferation of HUVECs on Micro-Ti group and Micro/Nano-Ti group was significantly reduced (P<0.05).The results of enzyme-linked immunosorbent assay (ELISA) showed that the VEGF productions of SM-Ti, Nano-Ti, Micro-Ti and Micro/Nano-Ti were (690±35) ng/L, (560±20) ng/L, (474±43) ng/L and (517±29) ng/L, respectively. Moreover, compared with the VEGF production of HUVECs on SM-Ti group, the VEGF production of HUVECs on Micro-Ti group and Micro/Nano-Ti group was significantly reduced (P<0.05). The results of Ca(2+) ion detection showed that the Ca(2+) expression of HUVECs on Micro-Ti and Micro/Nano-Ti was significantly higher than that on the surface of SM-Ti and Nano-Ti. These results implied that the over expressed Ca(2+) might contributed to the impaired biological function of HUVECs on Micro-Ti and Micro/Nano-Ti. Different topographical features on titanium influenced the biological behaviors of the HUVECs, which may illustrate how topographical features of Ti implant affect peri-implant angiogenesis. These results also suggest that the biological behaviors of HUVECs might be relative to the changed expression of intracellular Ca(2+).
Kadurin, Ivan; Rothwell, Simon W.; Lana, Beatrice; Nieto-Rostro, Manuela; Dolphin, Annette C.
2017-01-01
Voltage-gated Ca2+ (CaV) channels consist of a pore-forming α1 subunit, which determines the main functional and pharmacological attributes of the channel. The CaV1 and CaV2 channels are associated with auxiliary β- and α2δ-subunits. The molecular mechanisms involved in α2δ subunit trafficking, and the effect of α2δ subunits on trafficking calcium channel complexes remain poorly understood. Here we show that α2δ-1 is a ligand for the Low Density Lipoprotein (LDL) Receptor-related Protein-1 (LRP1), a multifunctional receptor which mediates trafficking of cargoes. This interaction with LRP1 is direct, and is modulated by the LRP chaperone, Receptor-Associated Protein (RAP). LRP1 regulates α2δ binding to gabapentin, and influences calcium channel trafficking and function. Whereas LRP1 alone reduces α2δ-1 trafficking to the cell-surface, the LRP1/RAP combination enhances mature glycosylation, proteolytic processing and cell-surface expression of α2δ-1, and also increase plasma-membrane expression and function of CaV2.2 when co-expressed with α2δ-1. Furthermore RAP alone produced a small increase in cell-surface expression of CaV2.2, α2δ-1 and the associated calcium currents. It is likely to be interacting with an endogenous member of the LDL receptor family to have these effects. Our findings now provide a key insight and new tools to investigate the trafficking of calcium channel α2δ subunits. PMID:28256585
McKenzie, Marcus E; Malinin, Alex I; Bell, Christopher R; Dzhanashvili, Alex; Horowitz, Eric D; Oshrine, Benjamin R; Atar, Dan; Serebruany, Victor L
2003-04-01
Platelet inhibition after aspirin therapy reduces the risk for the development of acute coronary syndromes. However, the mechanism by which aspirin affect platelets other than by prostaglandin blockade is unclear. We sought to determine the in vitro effects of aspirin on the surface expression of nine platelet receptors using whole blood flow cytometry. Blood from 24 healthy volunteers was incubated for 30 min with 1.8 and 7.2 mg/l phosphate-buffered saline-diluted acetylsalicylic acid in the presence or absence of apyrase. Platelet serotonin release, and the surface expression of platelet receptors with or without apyrase were determined using the following monoclonal antibodies: anit-CD41 [glycoprotein (GP)IIb/IIIa], CD42b (GPIb), CD62p (P-selectin), CD51/CD61 (vitronectin receptor), CD31 [platelet/endothelial cellular adhesion molecule-1 (PECAM-1)], CD107a [lysosomal associated membrane protein (LAMP)-1], CD107b (LAMP-2), CD63 (LIMP or LAMP-3), and CD151 (PETA-3). Samples were then immediately fixed with 2% paraformaldehyde, and run on the flow cytometer within 48 h. Aspirin does not affect serotonin release from human platelets. Dose-dependent inhibition of GPIIb/IIIa, P-selectin, CD63, and CD107a receptor expression was observed in the aspirin-treated whole-blood samples. Apyrase potentiates the effects of aspirin, and independently inhibits PECAM-1. In addition to the known effect of irreversibly inhibiting platelet cyclooxygenase-1, thereby blocking thromboxane A(2) synthesis, it appears that aspirin exhibits direct effects on selective major platelet receptors.
JPRS Report, Nuclear Developments
1991-04-23
East countries. Bush once expressed Taishan. the hope of reducing arms sales to the Middle East but has never taken effective measures to weaken the flow...structure containing sand armament will bring enormous effects in strategic envi- 350 meters to 500 meters below the surface and then ronment in Northeast...underestimation of its consequences may have some Kozloduy Nuclear Power Plant which results in radioac- tragic effects on Bulgaria’s population which
Lin, Sisi; Zhou, Chun; Neufeld, Edward; Wang, Yu-Hua; Xu, Suo-Wen; Lu, Liang; Wang, Ying; Liu, Zhi-Ping; Li, Dong; Li, Cuixian; Chen, Shaorui; Le, Kang; Huang, Heqing; Liu, Peiqing; Moss, Joel; Vaughan, Martha; Shen, Xiaoyan
2013-01-01
Objective Cell surface localization and intracellular trafficking of ATP-binding cassette transporter A-1 (ABCA1) are essential for its function. However, regulation of these activities is still largely unknown. Brefeldin A (BFA), a uncompetitive inhibitor of brefeldin A-inhibited guanine nucleotide-exchange proteins (BIGs), disturbs the intracellular distribution of ABCA1, and thus inhibits cholesterol efflux. This study aimed to define the possible roles of BIGs in regulating ABCA1 trafficking and cholesterol efflux, and further to explore the potential mechanism. Methods and Results By vesicle immunoprecipitation, we found that BIG1 was associated with ABCA1 in vesicles preparation from rat liver. BIG1 depletion reduced surface ABCA1 on HepG2 cells and inhibited by 60% cholesterol release. In contrast, BIG1 over-expression increased surface ABCA1 and cholesterol secretion. With partial restoration of BIG1 through over-expression in BIG1-depleted cells, surface ABCA1 was also restored. Biotinylation and glutathione cleavage revealed that BIG1 siRNA dramatically decreased the internalization and recycling of ABCA1. This novel function of BIG1 was dependent on the guanine nucleotide-exchange activity and achieved through activation of ADP-ribosylation factor 1 (ARF1). Conclusions BIG1, through its ability to activate ARF1, regulates cell surface levels and function of ABCA1, indicating a transcription-independent mechanism for controlling ABCA1 action. PMID:23220274
Ouyang, Wei; Guo, Bobo; Hao, Fanghua; Huang, Haobo; Li, Junqi; Gong, Yongwei
2012-12-30
Managing storm rainfall runoff is paramount in semi-arid regions with urban development. In Beijing, pollution prevention in urban storm runoff and storm water utilization has been identified as the primary strategy for urban water management. In this paper, we sampled runoff during storm rainfall events and analyzed the concentration of chemical oxygen demand (COD), total suspended solids (TSS) and total phosphorus (TP) in the runoff. Furthermore, the first flush effect of storm rainfall from diverse underlying surfaces was also analyzed. With the Storm Water Management Model (SWMM), the different impervious rates of underlying surfaces during the storm runoff process were expressed. The removal rates of three typical pollutants and their interactions with precipitation and underlying surfaces were identified. From these rates, the scenarios regarding the urban storm runoff pollution loading from different designs of underlying previous rates were assessed with the SWMM. First flush effect analysis showed that the first 20% of the storm runoff should be discarded, which can help in utilizing the storm water resource. The results of this study suggest that the SWMM can express in detail the storm water pollution patterns from diverse underlying surfaces in Beijing, which significantly affected water quality. The scenario analysis demonstrated that impervious rate adjustment has the potential to reduce runoff peak and decrease pollution loading. Copyright © 2012 Elsevier Ltd. All rights reserved.
Lutterschmid, Georg; Muranyi, Monika; Stübner, Matthias; Vogel, Rudi F; Niessen, Ludwig
2011-05-14
The spontaneous over-foaming of beer upon opening, i.e. beer gushing, is an unwanted phenomenon for the brewing industry. Currently, surface-active proteins from filamentous fungi and non-specific lipid transfer proteins (nsLTP1) from barley are discussed as gushing inducers. In our study the class I hydrophobin FcHyd3p from Fusarium culmorum, the class II hydrophobin Hfb2 from Trichoderma reesei, the alkaline foam protein A (AfpA) from F. graminearum and nsLTP1 from Hordeum vulgare cv. Marnie (barley) were heterologously expressed in Pichia pastoris and used in gushing tests. The class I hydrophobin FcHyd3p was unable to induce gushing in beer. The class II hydrophobin Hfb2 was able to induce gushing in beer, but proved to be inhibited by heat treatment as well as by the presence of enriched hop compounds. Both resulted in a reduced gushing potential. AfpA and nsLTP1 exhibited no gushing-inducing potential at the amounts added to beer. Addition of these proteins to beer or carbonated water previously treated with class II hydrophobins revealed a gushing reducing character. Copyright © 2011 Elsevier B.V. All rights reserved.
Huang, Chun-Ping; Chen, Hsiang-Ni; Su, Hong-Lin; Hsieh, Ching-Liang; Chen, Wei-Hsin; Lai, Zhen-Rung; Lin, Yi-Wen
2013-01-01
Several voltage-gated sodium channels (Navs) from nociceptive nerve fibers have been identified as important effectors in pain signaling. The objective of this study is to investigate the electroacupuncture (EA) analgesia mechanism by changing the expression of Navs in mice dorsal root ganglia (DRG). We injected carrageenan and complete Freund's adjuvant (CFA) into the mice plantar surface of the hind paw to induce inflammation and examined the antinociception effect of EA at the Zusanli (ST36) acupoint at 2 Hz low frequency. Mechanical hyperalgesia was evaluated by using electronic von Frey filaments, and thermal hyperalgesia was assessed using Hargreaves' test. Furthermore, we observed the expression and quality of Navs in DRG neurons. Our results showed that EA reduced mechanical and thermal pain in inflammatory animal model. The expression of Nav1.7 and Nav1.8 was increased after 4 days of carrageenan- and CFA-elicited inflammatory pain and further attenuated by 2 Hz EA stimulation. The attenuation cannot be observed in Nav1.9 sodium channels. We demonstrated that EA at Zusanli (ST36) acupoint at 2 Hz low-frequency stimulation attenuated inflammatory pain accompanied by decreasing the expression of Nav1.7 and 1.8, rather than Nav1.9, sodium channels in peripheral DRG neurons.
Surface expression of ω-transaminase in Escherichia coli.
Gustavsson, Martin; Muraleedharan, Madhu Nair; Larsson, Gen
2014-04-01
Chiral amines are important for the chemical and pharmaceutical industries, and there is rapidly growing interest to use transaminases for their synthesis. Since the cost of the enzyme is an important factor for process economy, the use of whole-cell biocatalysts is attractive, since expensive purification and immobilization steps can be avoided. Display of the protein on the cell surface provides a possible way to reduce the mass transfer limitations of such biocatalysts. However, transaminases need to dimerize in order to become active, and furthermore, they require the cofactor pyridoxal phosphate; consequently, successful transaminase surface expression has not been reported thus far. In this work, we produced an Arthrobacter citreus ω-transaminase in Escherichia coli using a surface display vector based on the autotransporter adhesin involved in diffuse adherence (AIDA-I), which has previously been used for display of dimeric proteins. The correct localization of the transaminase in the E. coli outer membrane and its orientation toward the cell exterior were verified. Furthermore, transaminase activity was detected exclusively in the outer membrane protein fraction, showing that successful dimerization had occurred. The transaminase was found to be present in both full-length and proteolytically degraded forms. The removal of this proteolysis is considered to be the main obstacle to achieving sufficient whole-cell transaminase activity.
Surface Expression of ω-Transaminase in Escherichia coli
Gustavsson, Martin; Muraleedharan, Madhu Nair
2014-01-01
Chiral amines are important for the chemical and pharmaceutical industries, and there is rapidly growing interest to use transaminases for their synthesis. Since the cost of the enzyme is an important factor for process economy, the use of whole-cell biocatalysts is attractive, since expensive purification and immobilization steps can be avoided. Display of the protein on the cell surface provides a possible way to reduce the mass transfer limitations of such biocatalysts. However, transaminases need to dimerize in order to become active, and furthermore, they require the cofactor pyridoxal phosphate; consequently, successful transaminase surface expression has not been reported thus far. In this work, we produced an Arthrobacter citreus ω-transaminase in Escherichia coli using a surface display vector based on the autotransporter adhesin involved in diffuse adherence (AIDA-I), which has previously been used for display of dimeric proteins. The correct localization of the transaminase in the E. coli outer membrane and its orientation toward the cell exterior were verified. Furthermore, transaminase activity was detected exclusively in the outer membrane protein fraction, showing that successful dimerization had occurred. The transaminase was found to be present in both full-length and proteolytically degraded forms. The removal of this proteolysis is considered to be the main obstacle to achieving sufficient whole-cell transaminase activity. PMID:24487538
Chung, Heesung; Jung, Hyejung; Jho, Eek-Hoon; Multhaupt, Hinke A B; Couchman, John R; Oh, Eok-Soo
2018-06-14
In human skin, melanocytes and their neighboring keratinocytes have a close functional interrelationship. Keratinocytes, which represent the prevalent cell type of human skin, regulate melanocytes through various mechanisms. Here, we use a keratinocyte and melanoma co-culture system to show for the first time that keratinocytes regulate the cell surface expression of N-cadherin through cell-cell contact. Compared to mono-cultured human melanoma A375 cells, which expressed high levels of N-cadherin, those co-cultured with the HaCaT human keratinocyte cell line showed reduced levels of N-cadherin. This reduction was most evident in areas of A375 cells that underwent cell-cell contact with the HaCaT cells, whereas HaCaT cell-derived extracellular matrix and conditioned medium both failed to reduce N-cadherin levels. The intracellular level of calcium in co-cultured A375 cells was lower than that in mono-cultured A375 cells, and treatment with a cell-permeant calcium chelator (BAPTA) reduced the N-cadherin level of mono-cultured A375 cells. Furthermore, co-culture with HaCaT cells reduced the expression levels of transient receptor potential cation channel (TRPC) 1, -3 and -6 in A375 cells, and siRNA-mediated multi-depletion of TRPC1, -3 and -6 reduced the N-cadherin level in these cells. Taken together, these data suggest that keratinocytes negatively regulate the N-cadherin levels of melanoma cells via cell-to-cell contact-mediated calcium regulation. Copyright © 2018. Published by Elsevier Inc.
Research on the effect of coverage rate on the surface quality in laser direct writing process
NASA Astrophysics Data System (ADS)
Pan, Xuetao; Tu, Dawei
2017-07-01
Direct writing technique is usually used in femtosecond laser two-photon micromachining. The size of the scanning step is an important factor affecting the surface quality and machining efficiency of micro devices. According to the mechanism of two-photon polymerization, combining the distribution function of light intensity and the free radical concentration theory, we establish the mathematical model of coverage of solidification unit, then analyze the effect of coverage on the machining quality and efficiency. Using the principle of exposure equivalence, we also obtained the analytic expressions of the relationship among the surface quality characteristic parameters of microdevices and the scanning step, and carried out the numerical simulation and experiment. The results show that the scanning step has little influence on the surface quality of the line when it is much smaller than the size of the solidification unit. However, with increasing scanning step, the smoothness of line surface is reduced rapidly, and the surface quality becomes much worse.
Hathroubi, S.; Hancock, M. A.; Langford, P. R.; Tremblay, Y. D. N.; Labrie, J.
2015-01-01
Actinobacillus pleuropneumoniae is a Gram-negative bacterium belonging to the Pasteurellaceae family and the causative agent of porcine pleuropneumonia, a highly contagious lung disease causing important economic losses. Surface polysaccharides, including lipopolysaccharides (LPS) and capsular polysaccharides (CPS), are implicated in the adhesion and virulence of A. pleuropneumoniae, but their role in biofilm formation is still unclear. In this study, we investigated the requirement for these surface polysaccharides in biofilm formation by A. pleuropneumoniae serotype 1. Well-characterized mutants were used: an O-antigen LPS mutant, a truncated core LPS mutant with an intact O antigen, a capsule mutant, and a poly-N-acetylglucosamine (PGA) mutant. We compared the amount of biofilm produced by the parental strain and the isogenic mutants using static and dynamic systems. Compared to the findings for the biofilm of the parental or other strains, the biofilm of the O antigen and the PGA mutants was dramatically reduced, and it had less cell-associated PGA. Real-time PCR analyses revealed a significant reduction in the level of pgaA, cpxR, and cpxA mRNA in the biofilm cells of the O-antigen mutant compared to that in the biofilm cells of the parental strain. Specific binding between PGA and LPS was consistently detected by surface plasmon resonance, but the lack of O antigen did not abolish these interactions. In conclusion, the absence of the O antigen reduces the ability of A. pleuropneumoniae to form a biofilm, and this is associated with the reduced expression and production of PGA. PMID:26483403
Hunt, N P; Cunningham, S J; Golden, C G; Sheriff, M
1999-10-01
The purpose of this study was to investigate the effect of surface roughness on the relative corrosion rates of wires of four alloys-stainless steel, nickel titanium, cobalt chromium, and beta titanium. Batches of wire were divided into two groups. Wires in one group were industrially polished to provide a uniform surface finish; wires in the other group were left for comparison "as received." Wire diameter, hardness, and relative corrosion rates were compared within groups before and after polishing. Comparisons were also made across the four groups of alloys. The samples of as-received wires showed variations in surface finish, with beta titanium having the roughest appearance and cobalt chromium the smoothest. Nickel titanium and stainless steel surfaces were similar. Polishing provided a more uniform finish, but significantly reduced the diameter of the wires. Microhardness testing of wire surfaces of each alloy indicated that no significant work-hardening occurred as a result of polishing. The relative corrosion rates (expressed in terms of corrosion current density) in a 0.9% sodium chloride solution were estimated using the electrochemical technique of polarization resistance. Nickel titanium wires exhibited the greatest corrosion current density in the as-received state. Polishing significantly reduced the corrosion rate of nickel titanium, such that comparison between the four alloys in the polished state revealed no significant difference in their relative corrosion rate/corrosion current density.
NASA Astrophysics Data System (ADS)
Bourlier, C.; Berginc, G.
2004-07-01
In this paper the first- and second-order Kirchhoff approximation is applied to study the backscattering enhancement phenomenon, which appears when the surface rms slope is greater than 0.5. The formulation is reduced to the geometric optics approximation in which the second-order illumination function is taken into account. This study is developed for a two-dimensional (2D) anisotropic stationary rough dielectric surface and for any surface slope and height distributions assumed to be statistically even. Using the Weyl representation of the Green function (which introduces an absolute value over the surface elevation in the phase term), the incoherent scattering coefficient under the stationary phase assumption is expressed as the sum of three terms. The incoherent scattering coefficient then requires the numerical computation of a ten- dimensional integral. To reduce the number of numerical integrations, the geometric optics approximation is applied, which assumes that the correlation between two adjacent points is very strong. The model is then proportional to two surface slope probabilities, for which the slopes would specularly reflect the beams in the double scattering process. In addition, the slope distributions are related with each other by a propagating function, which accounts for the second-order illumination function. The companion paper is devoted to the simulation of this model and comparisons with an 'exact' numerical method.
Mallery, Susan R.; Zwick, Jared C.; Pei, Ping; Tong, Meng; Larsen, Peter E.; Shumway, Brian S.; Lu, Bo; Fields, Henry W.; Mumper, Russell J.; Stoner, Gary D.
2010-01-01
Reduced expression of proapoptotic and terminal differentiation genes in conjunction with increased levels of the proinflammatory and angiogenesis-inducing enzymes, cyclooxygenase 2 (COX-2) and inducible nitric oxide synthase (iNOS), correlate with malignant transformation of oral intraepithelial neoplasia (IEN). Accordingly, this study investigated the effects of a 10% (w/w) freeze-dried black raspberry gel on oral IEN histopathology, gene expression profiles, intraepithelial COX-2 and iNOS proteins, and microvascular densities. Our laboratories have shown that freeze-dried black raspberries possess antioxidant properties and also induce keratinocyte apoptosis and terminal differentiation. Oral IEN tissues were hemisected to provide samples for pretreatment diagnoses and establish baseline biochemical and molecular variables. Treatment of the remaining lesional tissue (0.5 g gel applied four times daily for 6 weeks) began 1 week after the initial biopsy. RNA was isolated from snap-frozen IEN lesions for microarray analyses, followed by quantitative reverse transcription-PCR validation. Additional epithelial gene-specific quantitative reverse transcription-PCR analyses facilitated the assessment of target tissue treatment effects. Surface epithelial COX-2 and iNOS protein levels and microvascular densities were determined by image analysis quantified immunohistochemistry. Topical berry gel application uniformly suppressed genes associated with RNA processing, growth factor recycling, and inhibition of apoptosis. Although the majority of participants showed posttreatment decreases in epithelial iNOS and COX-2 proteins, only COX-2 reductions were statistically significant. These data show that berry gel application modulated oral IEN gene expression profiles, ultimately reducing epithelial COX-2 protein. In a patient subset, berry gel application also reduced vascular densities in the superficial connective tissues and induced genes associated with keratinocyte terminal differentiation. PMID:18559542
Effect of microculture on cell metabolism and biochemistry: do cells get stressed in microchannels?
Su, Xiaojing; Theberge, Ashleigh B; January, Craig T; Beebe, David J
2013-02-05
Microfluidics is emerging as a promising platform for cell culture, enabling increased microenvironment control and potential for integrated analysis compared to conventional macroculture systems such as well plates and Petri dishes. To advance the use of microfluidic devices for cell culture, it is necessary to better understand how miniaturization affects cell behavior. In particular, microfluidic devices have significantly higher surface-area-to-volume ratios than conventional platforms, resulting in lower volumes of media per cell, which can lead to cell stress. We investigated cell stress under a variety of culture conditions using three cell lines: parental HEK (human embryonic kidney) cells and transfected HEK cells that stably express wild-type (WT) and mutant (G601S) human ether-a-go-go related gene (hERG) potassium channel protein. These three cell lines provide a unique model system through which to study cell-type-specific responses in microculture because mutant hERG is known to be sensitive to environmental conditions, making its expression a particularly sensitive readout through which to compare macro- and microculture. While expression of WT-hERG was similar in microchannel and well culture, the expression of mutant G601S-hERG was reduced in microchannels. Expression of the endoplasmic reticulum (ER) stress marker immunoglobulin binding protein (BiP) was upregulated in all three cell lines in microculture. Using BiP expression, glucose consumption, and lactate accumulation as readouts we developed methods for reducing ER stress including properly increasing the frequency of media replacement, reducing cell seeding density, and adjusting the serum concentration and buffering capacity of culture medium. Indeed, increasing the buffering capacity of culture medium or frequency of media replacement partially restored the expression of the G601S-hERG in microculture. This work illuminates how biochemical properties of cells differ in macro- and microculture and suggests strategies that can be used to modify cell culture protocols for future studies involving miniaturized culture platforms.
Marko, Victoria A; Kilmury, Sara L N; MacNeil, Lesley T; Burrows, Lori L
2018-05-18
Type IV pili are expressed by a wide range of prokaryotes, including the opportunistic pathogen Pseudomonas aeruginosa. These flexible fibres mediate twitching motility, biofilm maturation, surface adhesion, and virulence. The pilus is composed mainly of major pilin subunits while the low abundance minor pilins FimU-PilVWXE and the putative adhesin PilY1 prime pilus assembly and are proposed to form the pilus tip. The minor pilins and PilY1 are encoded in an operon that is positively regulated by the FimS-AlgR two-component system. Independent of pilus assembly, PilY1 was proposed to be a mechanosensory component that-in conjunction with minor pilins-triggers up-regulation of acute virulence phenotypes upon surface attachment. Here, we investigated the link between the minor pilins/PilY1 and virulence. pilW, pilX, and pilY1 mutants had reduced virulence towards Caenorhabditis elegans relative to wild type or a major pilin mutant, implying a role in pathogenicity that is independent of pilus assembly. We hypothesized that loss of specific minor pilins relieves feedback inhibition on FimS-AlgR, increasing transcription of the AlgR regulon and delaying C. elegans killing. Reporter assays confirmed that FimS-AlgR were required for increased expression of the minor pilin operon upon loss of select minor pilins. Overexpression of AlgR or its hyperactivation via a phosphomimetic mutation reduced virulence, and the virulence defects of pilW, pilX, and pilY1 mutants required FimS-AlgR expression and activation. We propose that PilY1 and the minor pilins inhibit their own expression, and that loss of these proteins leads to FimS-mediated activation of AlgR that suppresses expression of acute-phase virulence factors and delays killing. This mechanism could contribute to adaptation of P. aeruginosa in chronic lung infections, as mutations in the minor pilin operon result in the loss of piliation and increased expression of AlgR-dependent virulence factors-such as alginate-that are characteristic of such infections.
Two-dimensional subsonic compressible flow past elliptic cylinders
NASA Technical Reports Server (NTRS)
Kaplan, Carl
1938-01-01
The method of Poggi is used to calculate, for perfect fluids, the effect of compressibility upon the flow on the surface of an elliptic cylinder at zero angle of attack and with no circulation. The result is expressed in a closed form and represents a rigorous determination of the velocity of the fluid at the surface of the obstacle insofar as the second approximation is concerned. Comparison is made with Hooker's treatment of the same problem according to the method of Janzen and Rayleight and it is found that, for thick elliptic cylinders, the two methods agree very well. The labor of computation is considerably reduced by the present solution.
Nguyen, Tracy T.
2011-01-01
Purpose. To identify and localize the monocarboxylate transporters (MCTs) expressed in bovine corneal endothelial cells (BCEC) and to test the hypothesis that buffering contributed by HCO3−, sodium bicarbonate cotransporter (NBCe1), sodium hydrogen exchanger (NHE), and carbonic anhydrase (CA) activity facilitates lactate flux. Methods. MCT1–4 expression was screened by RT-PCR, Western blot analysis, and immunofluorescence. Endogenous lactate efflux and/or pHi were measured in BCEC in HCO3−-free or HCO3−-rich Ringer, with and without niflumic acid (MCT inhibitor), acetazolamide (ACTZ, a CA inhibitor), 5-(N-Ethyl-N-isopropyl)amiloride (EIPA) (Na+/H+ exchange blocker), disodium 4,4′-diisothiocyanatostilbene-2,2′-disulfonate (DIDS; anion transport inhibitor), or with NBCe1-specific small interfering (si) RNA-treated cells. Results. MCT1, 2, and 4 are expressed in BCEC. MCT1 was localized to the lateral membrane, MCT2 was lateral and apical, while MCT4 was apical. pHi measurements showed significant lactate-induced cell acidification (LIA) in response to 20-second pulses of lactate. Incubation with niflumic acid significantly reduced the rate of pHi change (dpHi/dt) and lactate-induced cell acidification. EIPA inhibited alkalinization after lactate removal. Lactate-dependent proton flux was significantly greater in the presence of HCO3− but was reduced by ACTZ. Efflux of endogenously produced lactate was significantly faster in the presence of HCO3−, was greater on the apical surface, was reduced on the apical side by ACTZ, as well as on the apical and basolateral side by NBCe1-specific siRNA, DIDS, or EIPA. Conclusions. MCT1, 2, and 4 are expressed in BCEC on both the apical and basolateral membrane (BL) surfaces consistent with niflumic acid-sensitive lactate-H+ transport. Lactate dependent proton flux can activate Na+/H+ exchange and be facilitated by maximizing intracellular buffering capacity through the presence of HCO3−, HCO3− transport, NHE and CA activity. PMID:21896839
Pybus, Marc; Andrews, Glen K.; Lalueza-Fox, Carles; Comas, David; Sekler, Israel; de la Rasilla, Marco; Rosas, Antonio; Stoneking, Mark; Valverde, Miguel A.; Vicente, Rubén; Bosch, Elena
2014-01-01
Extreme differences in allele frequency between West Africans and Eurasians were observed for a leucine-to-valine substitution (Leu372Val) in the human intestinal zinc uptake transporter, ZIP4, yet no further evidence was found for a selective sweep around the ZIP4 gene (SLC39A4). By interrogating allele frequencies in more than 100 diverse human populations and resequencing Neanderthal DNA, we confirmed the ancestral state of this locus and found a strong geographical gradient for the derived allele (Val372), with near fixation in West Africa. In extensive coalescent simulations, we show that the extreme differences in allele frequency, yet absence of a classical sweep signature, can be explained by the effect of a local recombination hotspot, together with directional selection favoring the Val372 allele in Sub-Saharan Africans. The possible functional effect of the Leu372Val substitution, together with two pathological mutations at the same codon (Leu372Pro and Leu372Arg) that cause acrodermatitis enteropathica (a disease phenotype characterized by extreme zinc deficiency), was investigated by transient overexpression of human ZIP4 protein in HeLa cells. Both acrodermatitis mutations cause absence of the ZIP4 transporter cell surface expression and nearly absent zinc uptake, while the Val372 variant displayed significantly reduced surface protein expression, reduced basal levels of intracellular zinc, and reduced zinc uptake in comparison with the Leu372 variant. We speculate that reduced zinc uptake by the ZIP4-derived Val372 isoform may act by starving certain pathogens of zinc, and hence may have been advantageous in Sub-Saharan Africa. Moreover, these functional results may indicate differences in zinc homeostasis among modern human populations with possible relevance for disease risk. PMID:24586184
A novel human Fab antibody for Trop2 inhibits breast cancer growth in vitro and in vivo.
Lin, Hong; Zhang, Huiling; Wang, Jun; Lu, Meiping; Zheng, Feng; Wang, Changjun; Tang, Xiaojun; Xu, Ning; Chen, Renjie; Zhang, Dawei; Zhao, Ping; Zhu, Jin; Mao, Yuan; Feng, Zhenqing
2014-03-01
Human trophoblastic cell surface antigen 2 (Trop2) has been suggested as an oncogene, which is associated with the different types of tumors. In this study, a human Fab antibody against Trop2 extracellular domain was isolated from phage library by phage display technology, and characterized by ELISA, FACS, fluorescence staining and Western blotting analysis. MTT, apoptosis assay and wound healing assay were employed to evaluate the inhibitory effects of Trop2 Fab on breast cancer cell growth in vitro, while tumor-xenograft model was employed to evaluate the inhibitory effects on breast cancer growth in vivo. The results showed that Trop2 Fab inhibited the proliferation, induced the apoptosis and suspended the migration of MDA-MB-231 cells in a dose dependent manner. The expression caspase-3 was activated, and the expression of Bcl-2 was reduced while that of Bax was elevated in MDA-MB-231 cells by treating with Trop2 Fab. In addition, Trop2 Fab inhibited the growth of breast cancer xenografts and the expression of Bcl-2 was reduced while that of Bax was elevated in xenografts. Trop2 Fab, which was isolated successfully in this research, is a promising therapeutic agent for the treatment of Trop2 expressing breast cancer. © 2013 UICC.
Effects of phytoestrogens derived from soy bean on expression of adhesion molecules on HUVEC.
Andrade, C M de; Sá, M F Silva de; Toloi, M R Torqueti
2012-04-01
The risks of hormone replacement therapy have led to a search for new alternatives such as phytoestrogens, plant compounds with estrogen-like biological activity. Isoflavones are the phytoestrogens most extensively studied and can be found in soybean, red clover and other plants. Due to this estrogen-like activity, phytoestrogens can have some effect on atherosclerosis. Human umbilical vein endothelial cells (HUVEC) have been extensively used to study the biology and pathobiology of human endothelial cells and most of the knowledge acquired is due to experiments with cultures of these cells. To evaluate the effects of the phytoestrogen extracts from Glycine max soy bean, genistein, formononetin, biochanin A and daidzein, as well as a mixture of these extracts (Mix), on expression of adhesion molecules, VCAM-1, ICAM-1 and E-selectin, by endothelial cell HUVEC, stimulated with lipopolysaccharide. HUVEC were cultured in medium EBM(2), pretreated with isoflavones for 24 and 48 h and then stimulated with lipopolysaccharide; in addition, isoflavones were added, after stimulation by lipopolysaccharide, to HUVEC. We evaluated the production of VCAM-1, ICAM-1 and E-selectin on cell surface, by cell-based enzyme immunoassay, and of sVCAM-1, sICAM-1 and sE-selectin in culture supernatant, by ELISA. Genistein, formononetin, biochanin A and daidzein, as well as the Mix were able to reduce VCAM-1, ICAM-1 and E-selectin on cell surface and in culture supernatant. Conclusion Isoflavones extracted from Glycine max soy bean, in vitro, presented antiatherogenic effects, reducing the expression of adhesion molecules and acting as preventive agents as well as therapeutic agents.
Gilbert, Stéphane; Loranger, Anne; Omary, M Bishr; Marceau, Normand
2016-09-01
Keratins are epithelial cell intermediate filament (IF) proteins that are expressed as pairs in a cell-differentiation-regulated manner. Hepatocytes express the keratin 8 and 18 pair (denoted K8/K18) of IFs, and a loss of K8 or K18, as in K8-null mice, leads to degradation of the keratin partner. We have previously reported that a K8/K18 loss in hepatocytes leads to altered cell surface lipid raft distribution and more efficient Fas receptor (FasR, also known as TNFRSF6)-mediated apoptosis. We demonstrate here that the absence of K8 or transgenic expression of the K8 G62C mutant in mouse hepatocytes reduces lipid raft size. Mechanistically, we find that the lipid raft size is dependent on acid sphingomyelinase (ASMase, also known as SMPD1) enzyme activity, which is reduced in absence of K8/K18. Notably, the reduction of ASMase activity appears to be caused by a less efficient redistribution of surface membrane PKCδ toward lysosomes. Moreover, we delineate the lipid raft volume range that is required for an optimal FasR-mediated apoptosis. Hence, K8/K18-dependent PKCδ- and ASMase-mediated modulation of lipid raft size can explain the more prominent FasR-mediated signaling resulting from K8/K18 loss. The fine-tuning of ASMase-mediated regulation of lipid rafts might provide a therapeutic target for death-receptor-related liver diseases. © 2016. Published by The Company of Biologists Ltd.
Human Diversity in a Cell Surface Receptor that Inhibits Autophagy.
Chaudhary, Anu; Leite, Mara; Kulasekara, Bridget R; Altura, Melissa A; Ogahara, Cassandra; Weiss, Eli; Fu, Wenqing; Blanc, Marie-Pierre; O'Keeffe, Michael; Terhorst, Cox; Akey, Joshua M; Miller, Samuel I
2016-07-25
Mutations in genes encoding autophagy proteins have been associated with human autoimmune diseases, suggesting that diversity in autophagy responses could be associated with disease susceptibility or severity. A cellular genome-wide association study (GWAS) screen was performed to explore normal human diversity in responses to rapamycin, a microbial product that induces autophagy. Cells from several human populations demonstrated variability in expression of a cell surface receptor, CD244 (SlamF4, 2B4), that correlated with changes in rapamycin-induced autophagy. High expression of CD244 and receptor activation with its endogenous ligand CD48 inhibited starvation- and rapamycin-induced autophagy by promoting association of CD244 with the autophagy complex proteins Vps34 and Beclin-1. The association of CD244 with this complex reduced Vps34 lipid kinase activity. Lack of CD244 is associated with auto-antibody production in mice, and lower expression of human CD244 has previously been implicated in severity of human rheumatoid arthritis and systemic lupus erythematosus, indicating that increased autophagy as a result of low levels of CD244 may alter disease outcomes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mucosal Antibodies to the C Terminus of Toxin A Prevent Colonization of Clostridium difficile
Hong, Huynh A.; Hitri, Krisztina; Hosseini, Siamand; Kotowicz, Natalia; Bryan, Donna; Mawas, Fatme; Wilkinson, Anthony J.; van Broekhoven, Annie; Kearsey, Jonathan
2017-01-01
ABSTRACT Mucosal immunity is considered important for protection against Clostridium difficile infection (CDI). We show that in hamsters immunized with Bacillus subtilis spores expressing a carboxy-terminal segment (TcdA26–39) of C. difficile toxin A, no colonization occurs in protected animals when challenged with C. difficile strain 630. In contrast, animals immunized with toxoids showed no protection and remained fully colonized. Along with neutralizing toxins, antibodies to TcdA26–39 (but not to toxoids), whether raised to the recombinant protein or to TcdA26–39 expressed on the B. subtilis spore surface, cross-react with a number of seemingly unrelated proteins expressed on the vegetative cell surface or spore coat of C. difficile. These include two dehydrogenases, AdhE1 and LdhA, as well as the CdeC protein that is present on the spore. Anti-TcdA26–39 mucosal antibodies obtained following immunization with recombinant B. subtilis spores were able to reduce the adhesion of C. difficile to mucus-producing intestinal cells. This cross-reaction is intriguing yet important since it illustrates the importance of mucosal immunity for complete protection against CDI. PMID:28167669
Orr, Mark T.; Sun, Joseph C.; Hesslein, David G.T.; Arase, Hisashi; Phillips, Joseph H.; Takai, Toshiyuki
2009-01-01
The activating natural killer (NK) cell receptor Ly49H recognizes the mouse cytomegalovirus (MCMV) m157 glycoprotein expressed on the surface of infected cells and is required for protection against MCMV. Although Ly49H has previously been shown to signal via DAP12, we now show that Ly49H must also associate with and signal via DAP10 for optimal function. In the absence of DAP12, DAP10 enables Ly49H-mediated killing of m157-bearing target cells, proliferation in response to MCMV infection, and partial protection against MCMV. DAP10-deficient Ly49H+ NK cells, expressing only Ly49H–DAP12 receptor complexes, are partially impaired in their ability to proliferate during MCMV infection, display diminished ERK1/2 activation, produce less IFN-γ upon Ly49H engagement, and demonstrate reduced control of MCMV infection. Deletion of both DAP10 and DAP12 completely abrogates Ly49H surface expression and control of MCMV infection. Thus, optimal NK cell–mediated immunity to MCMV depends on Ly49H signaling through both DAP10 and DAP12. PMID:19332875
Sangboonruang, S; Thammasit, P; Intasai, N; Kasinrerk, W; Tayapiwatana, C; Tragoolpua, K
2014-06-01
Extracellular matrix metalloproteinase inducer (EMMPRIN) exhibits overexpression in various cancers and promotes cancer progression and metastasis via the interaction with its associated molecules. The scFv-M6-1B9 intrabody has a potential ability to reduce EMMPRIN cell surface expression. However, the subsequent effect of scFv-M6-1B9 intrabody-mediated EMMPRIN abatement on its related molecules, α3β1-integrin, MCT1, MMP-2 and MMP-9, is undefined. Our results demonstrated that the scFv-M6-1B9 intrabody efficiently decreased α3β1-integrin cell surface expression levels. In addition, intracellular accumulation of MCT1 and lactate were increased. These results lead to suppression of features characteristic for tumor progression, including cell migration, proliferation and invasion, in a colorectal cancer cell line (Caco-2) although there was no difference in MMP expression. Thus, EMMPRIN represents an attractive target molecule for the disruption of cancer proliferation and metastasis. An scFv-M6-1B9 intrabody-based approach could be relevant for cancer gene therapy.
Limonene inhibits streptococcal biofilm formation by targeting surface-associated virulence factors.
Subramenium, Ganapathy Ashwinkumar; Vijayakumar, Karuppiah; Pandian, Shunmugiah Karutha
2015-08-01
The present study explores the efficacy of limonene, a cyclic terpene found in the rind of citrus fruits, for antibiofilm potential against species of the genus Streptococcus, which have been deeply studied worldwide owing to their multiple pathogenic efficacy. Limonene showed a concentration-dependent reduction in the biofilm formation of Streptococcus pyogenes (SF370), with minimal biofilm inhibitory concentration (MBIC) of 400 μg ml - 1. Limonene was found to possess about 75-95 % antibiofilm activity against all the pathogens tested, viz. Streptococcus pyogenes (SF370 and 5 clinical isolates), Streptococcus mutans (UA159) and Streptococcus mitis (ATCC 6249) at 400 μg ml - 1 concentration. Microscopic analysis of biofilm architecture revealed a quantitative breach in biofilm formation. Results of a surface-coating assay suggested that the possible mode of action of limonene could be by inhibiting bacterial adhesion to surfaces, thereby preventing the biofilm formation cascade. Susceptibility of limonene-treated Streptococcus pyogenes to healthy human blood goes in unison with gene expression studies in which the mga gene was found to be downregulated. Anti-cariogenic efficacy of limonene against Streptococcus mutans was confirmed, with inhibition of acid production and downregulation of the vicR gene. Downregulation of the covR, mga and vicR genes, which play a critical role in regulating surface-associated proteins in Streptococcus pyogenes and Streptococcus mutans, respectively, is yet further evidence to show that limonene targets surface-associated proteins. The results of physiological assays and gene expression studies clearly show that the surface-associated antagonistic mechanism of limonene also reduces surface-mediated virulence factors.
Hanson, Andrea M; Ickstadt, Alicia T; Marquart, Dillon J; Kittilson, Jeffrey D; Sheridan, Mark A
2017-05-15
Fish in aquatic habitats are exposed to increasing concentrations and types of environmental contaminants, including environmental estrogens (EE). While there is growing evidence to support the observation that endocrine-disrupting compounds (EDCs) possess growth-inhibiting effects, the mechanisms by which these physiological effects occur are poorly understood. In this study, we examined the direct effects of EE, specifically 17β-estradiol (E2), β-sitosterol (βS), and 4-n-nonylphenol (NP), on GH sensitivity as assessed by mRNA expression and functional expression of growth hormone receptor in hepatocytes, gill filaments, and muscle in rainbow trout (Oncorhynchus mykiss). Additionally, we examined the effects of EE on signaling cascades related to growth hormone signal transduction (i.e., JAK-STAT, MAPK, and PI3K-Akt). Environmental estrogens directly suppressed the expression of GHRs in a tissue- and compound-related manner. The potency and efficacy varied with EE; effects were most pronounced with E2 in liver. EE treatment deactivated the JAK-STAT, MAPK, and PI3K-Akt pathways in liver a time-, EE- and concentration-dependent manner. Generally, E2 and NP were most effective in deactivating pathway elements; maximum suppression for each pathway was rapid, typically occurring at 10-30min. The observed effects occurred via an estrogen-dependent pathway, as indicated by treatment with an ER antagonist, ICI 182,780. These findings suggest that EEs suppress growth by reducing GH sensitivity in terms of reduced GHR synthesis and reduced surface GHR expression and by repressing GH signaling pathways. Copyright © 2016. Published by Elsevier Inc.
Bouma, G; Baggen, J M; van Bodegraven, A A; Mulder, C J J; Kraal, G; Zwiers, A; Horrevoets, A J; van der Pouw Kraan, C T M
2013-07-01
Crohn's disease (CD) is characterized by chronic inflammation of the gastrointestinal tract, as a result of aberrant activation of the innate immune system through TLR stimulation by bacterial products. The conventional immunosuppressive thiopurine derivatives (azathioprine and mercaptopurine) are used to treat CD. The effects of thiopurines on circulating immune cells and TLR responsiveness are unknown. To obtain a global view of affected gene expression of the immune system in CD patients and the treatment effect of thiopurine derivatives, we performed genome-wide transcriptome analysis on whole blood samples from 20 CD patients in remission, of which 10 patients received thiopurine treatment, compared to 16 healthy controls, before and after TLR4 stimulation with LPS. Several immune abnormalities were observed, including increased baseline interferon activity, while baseline expression of ribosomal genes was reduced. After LPS stimulation, CD patients showed reduced cytokine and chemokine expression. None of these effects were related to treatment. Strikingly, only one highly correlated set of 69 genes was affected by treatment, not influenced by LPS stimulation and consisted of genes reminiscent of effector cytotoxic NK cells. The most reduced cytotoxicity-related gene in CD was the cell surface marker CD160. Concordantly, we could demonstrate an in vivo reduction of circulating CD160(+)CD3(-)CD8(-) cells in CD patients after treatment with thiopurine derivatives in an independent cohort. In conclusion, using genome-wide profiling, we identified a disturbed immune activation status in peripheral blood cells from CD patients and a clear treatment effect of thiopurine derivatives selectively affecting effector cytotoxic CD160-positive cells. Copyright © 2013 Elsevier Ltd. All rights reserved.
Mostafavi-Pour, Zohreh; Ashrafi, Mohammad Reza; Talaei-Khozani, Tahereh
2018-06-01
Human Wharton's jelly mesenchymal stem cells (hWJSCs) are multipotent stem cells that could be aggregated into 3D spherules. ITGA4 and ITGA5 genes encode α4 and α5 subunits of integrins, respectively. In this study, we analyzed expression levels of ITGA4 and ITGA5 gene mRNAs in undifferentiated and 3D spherules forming hWJSCs in order to determine their expression pattern for possible future treatment of cancer cells in a co-culture fashion. For the purpose of obtaining hWJSCs, umbilical cords were collected from patients with caesarian section at full term delivery. The cells were then characterized according to cell surface markers using flow cytometry. Furthermore pluripotency of the obtained cells was verified. Subsequently the cells were aggregated in 3D spherules using hanging drop cultures. Expression levels of ITGA4 and ITGA5 gene mRNAs were determined by RT-PCR and Real time PCR, both in the initial undifferentiated cells and those aggregated in the spherules. The obtained hWJSCs demonstrated pluripotency, differentiating to adipogenic and osteogenic cells. They also expressed mesenchymal stem cell surface markers. Following the aggregation of these cells and formation of 3D spherules, mRNA expression levels of both genes were significantly reduced (P < 0.05) compared with the initial undifferentiated state. The results of this study demonstrated that aggregation of hWJSCs into spherules alters their expression of ITGA4 and ITGA5. The implications of such an alteration would require further research.
Neisseria gonorrhoeae Aggregation Reduces Its Ceftriaxone Susceptibility.
Wang, Liang-Chun; Litwin, Madeline; Sahiholnasab, Zahraossadat; Song, Wenxia; Stein, Daniel C
2018-06-15
Antibiotic resistance in Neisseria gonorrhoeae (GC) has become an emerging threat worldwide and heightens the need for monitoring treatment failures. N. gonorrhoeae , a gram-negative bacterium responsible for gonorrhea, infects humans exclusively and can form aggregates during infection. While minimal inhibitory concentration (MIC) tests are often used for determining antibiotic resistance development and treatment, the knowledge of the true MIC in individual patients and how it relates to this laboratory measure is not known. We examined the effect of aggregation on GC antibiotic susceptibility and the relationship between bacterial aggregate size and their antibiotic susceptibility. Aggregated GC have a higher survival rate when treated with ceftriaxone than non-aggregated GC, with bacteria in the core of the aggregates surviving the treatment. GC lacking opacity-associated protein or pili, or expressing a truncated lipooligosaccharide, three surface molecules that mediate GC-GC interactions, reduce both aggregation and ceftriaxone survival. This study demonstrates that the aggregation of N. gonorrhoeae can reduce the susceptibility to antibiotics, and suggests that antibiotic utilization can select for GC surface molecules that promote aggregation which in turn drive pathogen evolution. Inhibiting aggregation may be a potential way of increasing the efficacy of ceftriaxone treatment, consequently reducing treatment failure.
NASA Astrophysics Data System (ADS)
Kjelstrup, S.; Bedeaux, D.
1997-02-01
The electric potential profile and the temperature profile across a formation cell have been derived for the first time, using irreversible thermodynamics for bulk and surface systems. The method was demonstrated with the solid oxide fuel cell. The expression for the cell potential reduces to the classical formula when we assume equilibrium for polarized oxygen atoms across the electrolyte. Using data from the literature, we show for some likely assumptions, how the cell potential is generated at the anode, and how the energy is dissipated throughout the cell. The thermal gradient amounts to 5 × 10 8 Km -1 when the current density is 10 4 Am -2 and the thermal resistance of the surface scales like the electrical resistance.
Spi-C has opposing effects to PU.1 on gene expression in progenitor B cells.
Schweitzer, Brock L; Huang, Kelly J; Kamath, Meghana B; Emelyanov, Alexander V; Birshtein, Barbara K; DeKoter, Rodney P
2006-08-15
The Ets transcription factor Spi-C, expressed in B cells and macrophages, is closely related to PU.1 and has the ability to recognize the same DNA consensus sequence. However, the function of Spi-C has yet to be determined. The purpose of this study is to further examine Spi-C activity in B cell development. First, using retroviral vectors to infect PU.1(-/-) fetal liver progenitors, Spi-C was found to be inefficient at inducing cytokine-dependent proliferation and differentiation of progenitor B (pro-B) cells or macrophages relative to PU.1 or Spi-B. Next, Spi-C was ectopically expressed in fetal liver-derived, IL-7-dependent pro-B cell lines. Wild-type (WT) pro-B cells ectopically expressing Spi-C (WT-Spi-C) have several phenotypic characteristics of pre-B cells such as increased CD25 and decreased c-Kit surface expression. In addition, WT-Spi-C pro-B cells express increased levels of IgH sterile transcripts and reduced levels of expression and transcription of the FcgammaRIIb gene. Gel-shift analysis suggests that Spi-C, ectopically expressed in pro-B cells, can bind PU.1 consensus sites in the IgH intronic enhancer and FcgammaRIIb promoter. Transient transfection analysis demonstrated that PU.1 functions to repress the IgH intronic enhancer and activate the FcgammaRIIb promoter, while Spi-C opposes these activities. WT-Spi-C pro-B cells have reduced levels of dimethylation on lysine 9 of histone H3 within the IgH 3' regulatory region, indicating that Spi-C can contribute to removal of repressive features in the IgH locus. Overall, these studies suggest that Spi-C may promote B cell differentiation by modulating the activity of PU.1-dependent genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheong, Chee Man; Chow, Annie W.S.; Department of Haematology, SA Pathology, Adelaide 5000, SA
Background: Increased expression of the tetraspanin TSPAN7 has been observed in a number of cancers; however, it is unclear how TSPAN7 plays a role in cancer progression. Methods: We investigated the expression of TSPAN7 in the haematological malignancy multiple myleoma (MM) and assessed the consequences of TSPAN7 expression in the adhesion, migration and growth of MM plasma cells (PC) in vitro and in bone marrow (BM) homing and tumour growth in vivo. Finally, we characterised the association of TSPAN7 with cell surface partner molecules in vitro. Results: TSPAN7 was found to be highly expressed at the RNA and protein levelmore » in CD138{sup +} MM PC from approximately 50% of MM patients. TSPAN7 overexpression in the murine myeloma cell line 5TGM1 significantly reduced tumour burden in 5TGM1/KaLwRij mice 4 weeks after intravenous adminstration of 5TGM1 cells. While TSPAN7 overexpression did not affect cell proliferation in vitro, TSPAN7 increased 5TGM1 cell adhesion to BM stromal cells and transendothelial migration. In addition, TSPAN7 was found to associate with the molecular chaperone calnexin on the cell surface. Conclusion: These results suggest that elevated TSPAN7 may be associated with better outcomes for up to 50% of MM patients. - Highlights: • TSPAN7 expression is upregulated in newly-diagnosed patients with active multiple myeloma. • Overexpression of TSPAN7 inhibits myeloma tumour development in vivo. • TSPAN7 interacts with calnexin at the plasma membrane in a myeloma cell line.« less
Radiant heat loss, an unexploited path for heat stress reduction in shaded cattle.
Berman, A; Horovitz, T
2012-06-01
Reducing thermal radiation on shaded animals reduces heat stress independently of other means of stress relief. Radiant heat exchange was estimated as a function of climate, shade structure, and animal density. Body surface portion exposed to radiant sources in shaded environments was determined by geometrical relations to determine angles of view of radiation sources (roof underside, sky, sun-exposed ground, shaded ground) on the animal's surface. The relative representation of environment radiation sources on the body surface was determined. Animal thermal radiation balance was derived from radiant heat gained from radiation sources (including surrounding animals) and that lost from the animal surface. The animal environment was assumed to have different shade dimensions and temperatures. These were summed to the radiant heat balance of the cow. The data formed served to estimate the effect of changes in intensity of radiation sources, roof and shaded surface dimensions, and animal density on radiant heat balance (Rbal) of cattle. Roof height effect was expressed by effect of roof temperature on Rbal. Roof underside temperature (35 to 75°C) effect on Rbal was reduced by roof height. If roof height were 4m, an increase in its underside temperature from 35 to 75°C would increase mean Rbal from -63 to -2 W·m⁻², whereas if roof height were 10 m, Rbal would only increase from -99 to -88 W·m⁻². A hot ground temperature increase from 35 to 65°C reduced mean Rbal heat loss from -45 to 3 W·m⁻². Increasing the surface of the shaded area had only a minor effect on Rbal and on the effect of hot ground on Rbal. Increasing shade roof height reduced the effect of roof temperature on Rbal to minor levels when height was > 8m. Increasing the roof height from 4 to 10 m decreased Rbal from -32 to -94 W·m⁻². Increasing indirect radiation from 100 to 500 W·m⁻² was associated with an increase in Rbal from -135 to +23 W·m⁻². Their combined effects were lower Rbal with increasing roof height and a reduction in rate of decrease with increasing level of indirect radiation. Roof height as an Rbal attenuator declined with increasing indirect radiation level. The latter factor might be reduced by lowering roof surface radiation absorption and through roof heat transfer, as well as by use of shade structure elements to reduce indirect radiation in the shaded area. Radiant heat from the cow body surface may be reduced by lower cow density. Radiant heat attenuation may thus further elevate animal productivity in warm climates, with no associated operation costs. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Wang, N. N.
1974-01-01
The reaction concept is employed to formulate an integral equation for radiation and scattering from plates, corner reflectors, and dielectric-coated conducting cylinders. The surface-current density on the conducting surface is expanded with subsectional bases. The dielectric layer is modeled with polarization currents radiating in free space. Maxwell's equation and the boundary conditions are employed to express the polarization-current distribution in terms of the surface-current density on the conducting surface. By enforcing reaction tests with an array of electric test sources, the moment method is employed to reduce the integral equation to a matrix equation. Inversion of the matrix equation yields the current distribution, and the scattered field is then obtained by integrating the current distribution. The theory, computer program and numerical results are presented for radiation and scattering from plates, corner reflectors, and dielectric-coated conducting cylinders.
NASA Technical Reports Server (NTRS)
Kerr, Yann H.; Njoku, Eni G.
1990-01-01
A radiative-transfer model for simulating microwave brightness temperatures over land surfaces is described. The model takes into account sensor viewing conditions (spacecraft altitude, viewing angle, frequency, and polarization) and atmospheric parameters over a soil surface characterized by its moisture, roughness, and temperature and covered with a layer of vegetation characterized by its temperature, water content, single scattering albedo, structure, and percent coverage. In order to reduce the influence of atmospheric and surface temperature effects, the brightness temperatures are expressed as polarization ratios that depend primarily on the soil moisture and roughness, canopy water content, and percentage of cover. The sensitivity of the polarization ratio to these parameters is investigated. Simulation of the temporal evolution of the microwave signal over semiarid areas in the African Sahel is presented and compared to actual satellite data from the SMMR instrument on Nimbus-7.
Jindal, Shivali; Anand, Sanjeev; Huang, Kang; Goddard, Julie; Metzger, Lloyd; Amamcharla, Jayendra
2016-12-01
The development of bacterial biofilms on stainless steel (SS) surfaces poses a great threat to the quality of milk and other dairy products as the biofilm-embedded bacteria can survive thermal processing. Established biofilms offer cleaning challenges because they are resistant to most of the regular cleaning protocols. Sporeforming thermoduric organisms entrapped within biofilm matrix can also form heat-resistant spores, and may result in a long-term persistent contamination. The main objective of this study was to evaluate the efficacy of different nonfouling coatings [AMC 18 (Advanced Materials Components Express, Lemont, PA), Dursan (SilcoTek Corporation, Bellefonte, PA), Ni-P-polytetrafluoroethylene (PTFE, Avtec Finishing Systems, New Hope, MN), and Lectrofluor 641 (General Magnaplate Corporation, Linden, NJ)] on SS plate heat exchanger surfaces, to resist the formation of bacterial biofilms. It was hypothesized that modified SS surfaces would promote a lesser amount of deposit buildup and bacterial adhesion as compared with the native SS surface. Vegetative cells of aerobic sporeformers, Geobacillus stearothermophilus (ATCC 15952), Bacillus licheniformis (ATCC 6634), and Bacillus sporothermodurans (DSM 10599), were used to study biofilm development on the modified and native SS surfaces. The adherence of these organisms, though influenced by surface energy and hydrophobicity, exhibited no apparent relation with surface roughness. The Ni-P-PTFE coating exhibited the least bacterial attachment and milk solid deposition, and hence, was the most resistant to biofilm formation. Scanning electron microscopy, which was used to visualize the extent of biofilm formation on modified and native SS surfaces, also revealed lower bacterial attachment on the Ni-P-PTFE as compared with the native SS surface. This study thus provides evidence of reduced biofilm formation on the modified SS surfaces. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Hamuro, Junji; Toda, Munetoyo; Asada, Kazuko; Hiraga, Asako; Schlötzer-Schrehardt, Ursula; Montoya, Monty; Sotozono, Chie; Ueno, Morio; Kinoshita, Shigeru
2016-09-01
To identify the subpopulation (SP) among heterogeneous cultured human corneal endothelial cells (cHCECs) devoid of cell-state transition applicable for cell-based therapy. Subpopulation presence in cHCECs was confirmed via surface CD-marker expression level by flow cytometry. CD markers effective for distinguishing distinct SPs were selected by analyzing those on established cHCECs with a small cell area and high cell density. Contrasting features among three typical cHCEC SPs was confirmed by PCR array for extracellular matrix (ECM). Combined analysis of CD markers was performed to identify the SP (effector cells) applicable for therapy. ZO-1 and Na+/K+ ATPase, CD200, and HLA expression were compared among heterogeneous SPs. Flow cytometry analysis identified the effector cell expressing CD166+CD105-CD44-∼+/-CD26-CD24-, but CD200-, and the presence of other SPs with CD166+ CD105-CD44+++ (CD26 and CD24, either + or -) was confirmed. PCR array revealed three distinct ECM expression profiles. Some SPs expressed ZO-1 and Na+/K+ ATPase at comparable levels with effector cells, while only one SP expressed CD200, but not on effector cells. Human leukocyte antigen expression was most reduced in the effector SP. The proportion of effector cells (E-ratio) inversely paralleled donor age and decreased during prolonged culture passages. The presence of Rho-associated protein kinase (ROCK) inhibitor increased the E-ratio in cHCECs. The average area of effector cells was approximately 200∼220 μm2, and the density of cHCECs exceeded 2500 cells/mm2. A specified cultured effector cell population sharing the surface phenotypes with mature HCECs in corneal tissues may serve as an alternative to donor corneas for the treatment of corneal endothelial dysfunction.
Hassan, Nathaniel; McCarville, Kirstin; Morinaga, Kenzo; Mengatto, Cristiane M; Langfelder, Peter; Hokugo, Akishige; Tahara, Yu; Colwell, Christopher S; Nishimura, Ichiro
2017-01-01
Circadian rhythms maintain a high level of homeostasis through internal feed-forward and -backward regulation by core molecules. In this study, we report the highly unusual peripheral circadian rhythm of bone marrow mesenchymal stromal cells (BMSCs) induced by titanium-based biomaterials with complex surface modifications (Ti biomaterial) commonly used for dental and orthopedic implants. When cultured on Ti biomaterials, human BMSCs suppressed circadian PER1 expression patterns, while NPAS2 was uniquely upregulated. The Ti biomaterials, which reduced Per1 expression and upregulated Npas2, were further examined with BMSCs harvested from Per1::luc transgenic rats. Next, we addressed the regulatory relationship between Per1 and Npas2 using BMSCs from Npas2 knockout mice. The Npas2 knockout mutation did not rescue the Ti biomaterial-induced Per1 suppression and did not affect Per2, Per3, Bmal1 and Clock expression, suggesting that the Ti biomaterial-induced Npas2 overexpression was likely an independent phenomenon. Previously, vitamin D deficiency was reported to interfere with Ti biomaterial osseointegration. The present study demonstrated that vitamin D supplementation significantly increased Per1::luc expression in BMSCs, though the presence of Ti biomaterials only moderately affected the suppressed Per1::luc expression. Available in vivo microarray data from femurs exposed to Ti biomaterials in vitamin D-deficient rats were evaluated by weighted gene co-expression network analysis. A large co-expression network containing Npas2, Bmal1, and Vdr was observed to form with the Ti biomaterials, which was disintegrated by vitamin D deficiency. Thus, the aberrant BMSC peripheral circadian rhythm may be essential for the integration of Ti biomaterials into bone.
Quinn, Laura L.; Williams, Luke R.; White, Claire; Forrest, Calum; Rowe, Martin
2015-01-01
ABSTRACT The ability of Epstein-Barr virus (EBV) to spread and persist in human populations relies on a balance between host immune responses and EBV immune evasion. CD8+ cells specific for EBV late lytic cycle antigens show poor recognition of target cells compared to immediate early and early antigen-specific CD8+ cells. This phenomenon is due in part to the early EBV protein BILF1, whose immunosuppressive activity increases with lytic cycle progression. However, published data suggest the existence of a hitherto unidentified immune evasion protein further enhancing protection against late EBV antigen-specific CD8+ cells. We have now identified the late lytic BDLF3 gene as the missing link accounting for efficient evasion during the late lytic cycle. Interestingly, BDLF3 also contributes to evasion of CD4+ cell responses to EBV. We report that BDLF3 downregulates expression of surface major histocompatibility complex (MHC) class I and class II molecules in the absence of any effect upon other surface molecules screened, including CD54 (ICAM-1) and CD71 (transferrin receptor). BDLF3 both enhanced internalization of surface MHC molecules and reduced the rate of their appearance at the cell surface. The reduced expression of surface MHC molecules correlated with functional protection against CD8+ and CD4+ T cell recognition. The molecular mechanism was identified as BDLF3-induced ubiquitination of MHC molecules and their subsequent downregulation in a proteasome-dependent manner. IMPORTANCE Immune evasion is a necessary feature of viruses that establish lifelong persistent infections in the face of strong immune responses. EBV is an important human pathogen whose immune evasion mechanisms are only partly understood. Of the EBV immune evasion mechanisms identified to date, none could explain why CD8+ T cell responses to late lytic cycle genes are so infrequent and, when present, recognize lytically infected target cells so poorly relative to CD8+ T cells specific for early lytic cycle antigens. The present work identifies an additional immune evasion protein, BDLF3, that is expressed late in the lytic cycle and impairs CD8+ T cell recognition by targeting cell surface MHC class I molecules for ubiquitination and proteasome-dependent downregulation. Interestingly, BDLF3 also targets MHC class II molecules to impair CD4+ T cell recognition. BDLF3 is therefore a rare example of a viral protein that impairs both the MHC class I and class II antigen-presenting pathways. PMID:26468525
Quinn, Laura L; Williams, Luke R; White, Claire; Forrest, Calum; Zuo, Jianmin; Rowe, Martin
2016-01-01
The ability of Epstein-Barr virus (EBV) to spread and persist in human populations relies on a balance between host immune responses and EBV immune evasion. CD8(+) cells specific for EBV late lytic cycle antigens show poor recognition of target cells compared to immediate early and early antigen-specific CD8(+) cells. This phenomenon is due in part to the early EBV protein BILF1, whose immunosuppressive activity increases with lytic cycle progression. However, published data suggest the existence of a hitherto unidentified immune evasion protein further enhancing protection against late EBV antigen-specific CD8(+) cells. We have now identified the late lytic BDLF3 gene as the missing link accounting for efficient evasion during the late lytic cycle. Interestingly, BDLF3 also contributes to evasion of CD4(+) cell responses to EBV. We report that BDLF3 downregulates expression of surface major histocompatibility complex (MHC) class I and class II molecules in the absence of any effect upon other surface molecules screened, including CD54 (ICAM-1) and CD71 (transferrin receptor). BDLF3 both enhanced internalization of surface MHC molecules and reduced the rate of their appearance at the cell surface. The reduced expression of surface MHC molecules correlated with functional protection against CD8(+) and CD4(+) T cell recognition. The molecular mechanism was identified as BDLF3-induced ubiquitination of MHC molecules and their subsequent downregulation in a proteasome-dependent manner. Immune evasion is a necessary feature of viruses that establish lifelong persistent infections in the face of strong immune responses. EBV is an important human pathogen whose immune evasion mechanisms are only partly understood. Of the EBV immune evasion mechanisms identified to date, none could explain why CD8(+) T cell responses to late lytic cycle genes are so infrequent and, when present, recognize lytically infected target cells so poorly relative to CD8(+) T cells specific for early lytic cycle antigens. The present work identifies an additional immune evasion protein, BDLF3, that is expressed late in the lytic cycle and impairs CD8(+) T cell recognition by targeting cell surface MHC class I molecules for ubiquitination and proteasome-dependent downregulation. Interestingly, BDLF3 also targets MHC class II molecules to impair CD4(+) T cell recognition. BDLF3 is therefore a rare example of a viral protein that impairs both the MHC class I and class II antigen-presenting pathways. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Kirton, Christopher M; Laukkanen, Marja-Leena; Nieminen, Antti; Merinen, Marika; Stolen, Craig M; Armour, Kathryn; Smith, David J; Salmi, Marko; Jalkanen, Sirpa; Clark, Michael R
2005-11-01
Human vascular adhesion protein-1 (VAP-1) is a homodimeric 170-kDa sialoglycoprotein that is expressed on the surface of endothelial cells and functions as a semicarbazide-sensitive amine oxidase and as an adhesion molecule. Blockade of VAP-1 has been shown to reduce leukocyte adhesion and transmigration in in vivo and in vitro models, suggesting that VAP-1 is a potential target for anti-inflammatory therapy. In this study we have constructed mouse-human chimeric antibodies by genetic engineering in order to circumvent the potential problems involved in using murine antibodies in man. Our chimeric anti-VAP-1 antibodies, which were designed to lack Fc-dependent effector functions, bound specifically to cell surface-expressed recombinant human VAP-1 and recognized VAP-1 in different cell types in tonsil. Furthermore, the chimeric antibodies prevented leukocyte adhesion and transmigration in vitro and in vivo. Hence, these chimeric antibodies have the potential to be used as a new anti-inflammatory therapy.
Targeting the latent cytomegalovirus reservoir with an antiviral fusion toxin protein
Krishna, B. A.; Spiess, K.; Poole, E. L.; Lau, B.; Voigt, S.; Kledal, T. N.; Rosenkilde, M. M.; Sinclair, J. H.
2017-01-01
Reactivation of human cytomegalovirus (HCMV) in transplant recipients can cause life-threatening disease. Consequently, for transplant recipients, killing latently infected cells could have far-reaching clinical benefits. In vivo, myeloid cells and their progenitors are an important site of HCMV latency, and one viral gene expressed by latently infected myeloid cells is US28. This viral gene encodes a cell surface G protein-coupled receptor (GPCR) that binds chemokines, triggering its endocytosis. We show that the expression of US28 on the surface of latently infected cells allows monocytes and their progenitor CD34+ cells to be targeted and killed by F49A-FTP, a highly specific fusion toxin protein that binds this viral GPCR. As expected, this specific targeting of latently infected cells by F49A-FTP also robustly reduces virus reactivation in vitro. Consequently, such specific fusion toxin proteins could form the basis of a therapeutic strategy for eliminating latently infected cells before haematopoietic stem cell transplantation. PMID:28148951
Huang, Fen; Zhang, Hongkang; Wu, Meng; Yang, Huanghe; Kudo, Makoto; Peters, Christian J; Woodruff, Prescott G; Solberg, Owen D; Donne, Matthew L; Huang, Xiaozhu; Sheppard, Dean; Fahy, John V; Wolters, Paul J; Hogan, Brigid L M; Finkbeiner, Walter E; Li, Min; Jan, Yuh-Nung; Jan, Lily Yeh; Rock, Jason R
2012-10-02
Mucous cell hyperplasia and airway smooth muscle (ASM) hyperresponsiveness are hallmark features of inflammatory airway diseases, including asthma. Here, we show that the recently identified calcium-activated chloride channel (CaCC) TMEM16A is expressed in the adult airway surface epithelium and ASM. The epithelial expression is increased in asthmatics, particularly in secretory cells. Based on this and the proposed functions of CaCC, we hypothesized that TMEM16A inhibitors would negatively regulate both epithelial mucin secretion and ASM contraction. We used a high-throughput screen to identify small-molecule blockers of TMEM16A-CaCC channels. We show that inhibition of TMEM16A-CaCC significantly impairs mucus secretion in primary human airway surface epithelial cells. Furthermore, inhibition of TMEM16A-CaCC significantly reduces mouse and human ASM contraction in response to cholinergic agonists. TMEM16A-CaCC blockers, including those identified here, may positively impact multiple causes of asthma symptoms.
27-Hydroxycholesterol upregulates the production of heat shock protein 60 of monocytic cells.
Kim, Bo-Young; Son, Yonghae; Choi, Jeongyoon; Eo, Seong-Kug; Park, Young Chul; Kim, Koanhoi
2017-09-01
Investigating differentially expressed proteins in a milieu rich in cholesterol oxidation products, we found via mass spectrometry-based proteomics that surface levels of heat shock protein 60 (HSP60) were upregulated on monocytic cells in the presence of 27-hydroxycholesterol (27OHChol). The elevated levels of cytoplasmic membrane HSP60 were verified via Western blot analysis and visualized by confocal microscopy. Treatment with 27OHChol also resulted in increased levels of cellular HSP60 without altering its transcription. Cholesterol, however, did not affect cell-surface levels and cellular amount of HSP60. GSK 2033, an LXR antagonist, inhibited expression of live X receptor α, but not of HSP60, induced by 27OHChol. Treatment with 27OHChol also resulted in increased release of HSP60 from monocytic cells, but the release was significantly reduced by inhibitors of endoplasmic reticulum-Golgi protein trafficking, brefeldin A and monensin. Results of the current study indicate that 27OHChol upregulates not only cell-surface and cellular levels of HSP60 but also its release from monocytic cells, thereby contributing to activation of the immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.
Li, Suzhao; Neff, C Preston; Barber, Kristina; Hong, Jaewoo; Luo, Yuchun; Azam, Tania; Palmer, Brent E; Fujita, Mayumi; Garlanda, Cecilia; Mantovani, Alberto; Kim, Soohyun; Dinarello, Charles Anthony
2015-02-24
Similar to IL-1α and IL-33, IL-1 family member IL-37b translocates to the nucleus and is associated with suppression of innate and adaptive immunity. Here we demonstrate an extracellular function of the IL-37 precursor and a processed form. Recombinant IL-37 precursor reduced LPS-induced IL-6 by 50% (P < 0.001) in highly inflammatory human blood-derived M1 differentiated macrophages derived from selective subjects but not M2 macrophages. In contrast, a neutralizing monoclonal anti-IL-37 increased LPS-induced IL-6, TNFα and IL-1β (P < 0.01). The suppression by IL-37 was consistently observed at low picomolar but not nanomolar concentrations. Whereas LPS induced a 12-fold increase in TNFα mRNA, IL-37 pretreatment decreased the expression to only 3-fold over background (P < 0.01). Mechanistically, LPS-induced p38 and pERK were reduced by IL-37. Recombinant IL-37 bound to the immobilized ligand binding α-chain of the IL-18 receptor as well as to the decoy receptor IL-1R8. In M1 macrophages, LPS increased the surface expression of IL-1R8. Compared with human blood monocytes, resting M1 cells express more surface IL-1R8 as well as total IL-1R8; there was a 16-fold increase in IL-1R8 mRNA levels when pretreated with IL-37. IL-37 reduced LPS-induced TNFα and IL-6 by 50-55% in mouse bone marrow-derived dendritic cells, but not in dendritic cells derived from IL-1R8-deficient mice. In mice subjected to systemic LPS-induced inflammation, pretreatment with IL-37 reduced circulating and organ cytokine levels. Thus, in addition to a nuclear function, IL-37 acts as an extracellular cytokine by binding to the IL-18 receptor but using the IL-1R8 for its anti-inflammatory properties.
Mukherjee, Anindit; Mueller, Gunhild M; Kinlough, Carol L; Sheng, Nan; Wang, Zhijian; Mustafa, S Atif; Kashlan, Ossama B; Kleyman, Thomas R; Hughey, Rebecca P
2014-05-16
The epithelial sodium channel (ENaC) is composed of three homologous subunits (α, β, and γ) with cytoplasmic N and C termini. Our previous work revealed that two cytoplasmic Cys residues in the β subunit, βCys-43 and βCys-557, are Cys-palmitoylated. ENaCs with mutant βC43A/C557A exhibit normal surface expression but enhanced Na(+) self-inhibition and reduced channel open probability. Although the α subunit is not palmitoylated, we now show that the two cytoplasmic Cys residues in the γ subunit are palmitoylated. ENaCs with mutant γC33A, γC41A, or γC33A/C41A exhibit reduced activity compared with wild type channels but normal surface expression and normal levels of α and γ subunit-activating cleavage. These mutant channels have significantly enhanced Na(+) self-inhibition and reduced open probability compared with wild type ENaCs. Channel activity was enhanced by co-expression with the palmitoyltransferase DHHC2 that also co-immunoprecipitates with ENaCs. Secondary structure prediction of the N terminus of the γ subunit places γCys-33 within an α-helix and γCys-44 on a coil before the first transmembrane domain within a short tract that includes a well conserved His-Gly motif, where mutations have been associated with altered channel gating. Our current and previous results suggest that palmitoylation of the β and γ subunits of ENaCs enhances interactions of their respective cytoplasmic domains with the plasma membrane and stabilizes the open state of the channel. Comparison of activities of channels lacking palmitoylation sites in individual or multiple subunits revealed that γ subunit palmitoylation has a dominant role over β subunit palmitoylation in modulating ENaC gating. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Phenotypic and gene expression responses of E. coli to antibiotics during spaceflight
NASA Astrophysics Data System (ADS)
Zea, Luis
Bacterial susceptibility to antibiotics has been shown in vitro to be reduced during spaceflight; however, the underlying mechanisms responsible for this outcome are not fully understood. In particular, it is not yet clear whether this observed response is due to increased drug resistance (a microbial defense response) or decreased drug efficacy (a microgravity biophysical mass transport effect). To gain insight into the differentiation between these two potential causes, an investigation was undertaken onboard the International Space Station (ISS) in 2014 termed Antibiotic Effectiveness in Space-1 (AES-1). For this purpose, E. coli was challenged with two antibiotics, Gentamicin Sulfate and Colistin Sulfate, at concentrations higher than those needed to inhibit growth on Earth. Phenotypic parameters (cell size, cell envelope thickness, population density and lag phase duration) and gene expression were compared between the spaceflight samples and ground controls cultured in varying levels of drug concentration. It was observed that flight samples proliferated in antibiotic concentrations that were inhibitory on Earth, growing on average to a 13-fold greater concentration than matched 1g controls. Furthermore, at the highest drug concentrations in space, E. coli cells were observed to aggregate into visible clusters. In spaceflight, cell size was significantly reduced, translating to a decrease in cell surface area to about one half of the ground controls. Smaller cell surface area can in turn proportionally reduce the rate of antibiotic molecules reaching the cell. Additionally, it was observed that genes --- in some cases more than 2000 --- were overexpressed in space with respect to ground controls. Up-regulated genes include poxB, which helps catabolize glucose into organic acids that alter acidity around and inside the cell, and the gadABC family genes, which confer resistance to extreme acid conditions. The next step is to characterize the mechanisms behind the observed gene expression, its implications, and most importantly, how this knowledge can help prevent the acquisition and spread of antibiotic resistance in pathogens on Earth.
Scaling laws for AC gas breakdown and implications for universality
NASA Astrophysics Data System (ADS)
Loveless, Amanda M.; Garner, Allen L.
2017-10-01
The reduced dependence on secondary electron emission and electrode surface properties makes radiofrequency (RF) and microwave (MW) plasmas advantageous over direct current (DC) plasmas for various applications, such as microthrusters. Theoretical models relating molecular constants to alternating current (AC) breakdown often fail due to incomplete understanding of both the constants and the mechanisms involved. This work derives simple analytic expressions for RF and MW breakdown, demonstrating the transition between these regimes at their high and low frequency limits, respectively. We further show that the limiting expressions for DC, RF, and MW breakdown voltage all have the same universal scaling dependence on pressure and gap distance at high pressure, agreeing with experiment.
2011-01-01
Introduction In Sjögren's syndrome, keratoconjunctivitis sicca (dry eye) is associated with infiltration of lacrimal glands by leukocytes and consequent losses of tear-fluid production and the integrity of the ocular surface. We investigated the effect of blockade of the lymphotoxin-beta receptor (LTBR) pathway on lacrimal-gland pathology in the NOD mouse model of Sjögren's syndrome. Methods Male NOD mice were treated for up to ten weeks with an antagonist, LTBR-Ig, or control mouse antibody MOPC-21. Extra-orbital lacrimal glands were analyzed by immunohistochemistry for high endothelial venules (HEV), by Affymetrix gene-array analysis and real-time PCR for differential gene expression, and by ELISA for CXCL13 protein. Leukocytes from lacrimal glands were analyzed by flow-cytometry. Tear-fluid secretion-rates were measured and the integrity of the ocular surface was scored using slit-lamp microscopy and fluorescein isothiocyanate (FITC) staining. The chemokine CXCL13 was measured by ELISA in sera from Sjögren's syndrome patients (n = 27) and healthy controls (n = 30). Statistical analysis was by the two-tailed, unpaired T-test, or the Mann-Whitney-test for ocular integrity scores. Results LTBR blockade for eight weeks reduced B-cell accumulation (approximately 5-fold), eliminated HEV in lacrimal glands, and reduced the entry rate of lymphocytes into lacrimal glands. Affymetrix-chip analysis revealed numerous changes in mRNA expression due to LTBR blockade, including reduction of homeostatic chemokine expression. The reduction of CXCL13, CCL21, CCL19 mRNA and the HEV-associated gene GLYCAM-1 was confirmed by PCR analysis. CXCL13 protein increased with disease progression in lacrimal-gland homogenates, but after LTBR blockade for 8 weeks, CXCL13 was reduced approximately 6-fold to 8.4 pg/mg (+/- 2.7) from 51 pg/mg (+/-5.3) in lacrimal glands of 16 week old control mice. Mice given LTBR blockade exhibited an approximately two-fold greater tear-fluid secretion than control mice (P = 0.001), and had a significantly improved ocular surface integrity score (P = 0.005). The mean CXCL13 concentration in sera from Sjögren's patients (n = 27) was 170 pg/ml, compared to 92.0 pg/ml for sera from (n = 30) healthy controls (P = 0.01). Conclusions Blockade of LTBR pathways may have therapeutic potential for treatment of Sjögren's syndrome. PMID:22044682
Involvement of Rab9 and Rab11 in the intracellular trafficking of TRPC6.
Cayouette, Sylvie; Bousquet, Simon M; Francoeur, Nancy; Dupré, Emilie; Monet, Michaël; Gagnon, Hugo; Guedri, Youssef B; Lavoie, Christine; Boulay, Guylain
2010-07-01
TRPC proteins become involved in Ca2+ entry following the activation of Gq-protein coupled receptors. TRPC6 is inserted into the plasma membrane upon stimulation and remains in the plasma membrane as long as the stimulus is present. However, the mechanism that regulates the trafficking of TRPC6 is unclear. In the present study, we highlighted the involvement of two Rab GTPases in the trafficking of TRPC6. Rab9 co-localized in vesicular structures with TRPC6 in HeLa cells and co-immunoprecipitated with TRPC6. When co-expressed with TRPC6, Rab9(S21N), a dominant negative mutant, caused an increase in the level of TRPC6 at the plasma membrane and in TRPC6-mediated Ca2+ entry upon activation by a muscarinic receptor agonist. Similarly, the expression of Rab11 also caused an increase in TRPC6 expression at the cell surface and an increase in TRPC6-mediated Ca2+ entry. The co-expression of TRPC6 with the dominant negative mutant Rab11(S25N) abolished CCh-induced TRPC6 activation and reduced the level of TRPC6 at the plasma membrane. This study demonstrates that the trans-Golgi network and recycling endosomes are involved in the intracellular trafficking of TRPC6 by regulating channel density at the cell surface. 2010 Elsevier B.V. All rights reserved.
Jin, Hye Jin; Bae, Yun Kyung; Kim, Miyeon; Kwon, Soon-Jae; Jeon, Hong Bae; Choi, Soo Jin; Kim, Seong Who; Yang, Yoon Sun; Oh, Wonil; Chang, Jong Wook
2013-01-01
Various source-derived mesenchymal stem cells (MSCs) have been considered for cell therapeutics in incurable diseases. To characterize MSCs from different sources, we compared human bone marrow (BM), adipose tissue (AT), and umbilical cord blood-derived MSCs (UCB-MSCs) for surface antigen expression, differentiation ability, proliferation capacity, clonality, tolerance for aging, and paracrine activity. Although MSCs from different tissues have similar levels of surface antigen expression, immunosuppressive activity, and differentiation ability, UCB-MSCs had the highest rate of cell proliferation and clonality, and significantly lower expression of p53, p21, and p16, well known markers of senescence. Since paracrine action is the main action of MSCs, we examined the anti-inflammatory activity of each MSC under lipopolysaccharide (LPS)-induced inflammation. Co-culture of UCB-MSCs with LPS-treated rat alveolar macrophage, reduced expression of inflammatory cytokines including interleukin-1α (IL-1α), IL-6, and IL-8 via angiopoietin-1 (Ang-1). Using recombinant Ang-1 as potential soluble paracrine factor or its small interference RNA (siRNA), we found that Ang-1 secretion was responsible for this beneficial effect in part by preventing inflammation. Our results demonstrate that primitive UCB-MSCs have biological advantages in comparison to adult sources, making UCB-MSCs a useful model for clinical applications of cell therapy. PMID:24005862
Qin, Z; Dai, L; Bratoeva, M; Slomiany, MG; Toole, BP; Parsons, C
2013-01-01
The Kaposi’s sarcoma-associated herpesvirus is the causative agent of primary effusion lymphoma (PEL), for which cytotoxic chemotherapy represents the standard of care. The high mortality associated with PEL may be explained in part by resistance of these tumors to chemotherapy. The membrane-bound glycoprotein emmprin (CD147) enhances chemoresistance in tumors through effects on transporter expression, trafficking and interactions. Interactions between hyaluronan and hyaluronan receptors on the cell surface also facilitate emmprin-mediated chemoresistance. Whether emmprin or hyaluronan-receptor interactions regulate chemotherapeutic resistance for virus-associated malignancies is unknown. Using human PEL tumor cells, we found that PEL sensitivity to chemotherapy is directly proportional to expression of emmprin, the lymphatic vessel endothelial hyaluronan receptor-1 (LYVE-1) and a drug transporter known as the breast cancer resistance protein/ABCG2 (BCRP), and that emmprin, LYVE-1 and BCRP interact with each other and colocalize on the PEL cell surface. In addition, we found that emmprin induces chemoresistance in PEL cells through upregulation of BCRP expression, and RNA interference targeting of emmprin, LYVE-1 or BCRP enhances PEL cell apoptosis induced by chemotherapy. Finally, disruption of hyaluronan-receptor interactions using small hyaluronan oligosaccharides reduces expression of emmprin and BCRP while sensitizing PEL cells to chemotherapy. Collectively, these data support interdependent roles for emmprin, LYVE-1 and BCRP in chemotherapeutic resistance for PEL. PMID:21660043
Bressan, Eriberto; Gardin, Chiara; Ferroni, Letizia; Soldini, Maria Costanza; Mandelli, Federico; Soldini, Claudio
2017-01-01
Osteogenesis process displays a fundamental role during dental implant osteointegration. In the present work, we studied the influence of Osteon Growth Induction (OGI) surface properties on the angiogenic and osteogenic behaviors of Mesenchymal Stem cells (MSC). MSC derived from dental pulp and HUVEC (Human Umbilical Vein Endothelial Cells) were grown in on OGI titanium surfaces, and cell proliferation and DNA synthesis were evaluated by MTT [3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide] test and DNA quantification. Gene expression has been performed in order to evaluate the presence of mRNA related to endothelial and osteogenesis markers. Moreover, morphological and biochemical analyses of osteogenesis commitments has been performed. On OGI surfaces, MSC and HUVEC are able to proliferate. Gene expression profiler confirms that MSC on OGI surfaces are able to express endothelial and osteogenic markers, and that these expression are higher compared the expression on control surfaces. In conclusion On OGI surfaces proliferation, expression and morphological analyses of angiogenesis-associated markers in MSC are promoted. This process induces an increasing on their osteogenesis commitment. PMID:29149082
Reduced Notch signalling leads to postnatal skeletal muscle hypertrophy in Pofut1cax/cax mice.
Al Jaam, Bilal; Heu, Katy; Pennarubia, Florian; Segelle, Alexandre; Magnol, Laetitia; Germot, Agnès; Legardinier, Sébastien; Blanquet, Véronique; Maftah, Abderrahman
2016-09-01
Postnatal skeletal muscle growth results from the activation of satellite cells and/or an increase in protein synthesis. The Notch signalling pathway maintains satellite cells in a quiescent state, and once activated, sustains their proliferation and commitment towards differentiation. In mammals, POFUT1-mediated O-fucosylation regulates the interactions between NOTCH receptors and ligands of the DELTA/JAGGED family, thus initiating the activation of canonical Notch signalling. Here, we analysed the consequences of downregulated expression of the Pofut1 gene on postnatal muscle growth in mutant Pofut1(cax/cax) (cax, compact axial skeleton) mice and differentiation of their satellite cell-derived myoblasts (SCDMs). Pofut1(cax/cax) mice exhibited muscle hypertrophy, no hyperplasia and a decrease in satellite cell numbers compared with wild-type C3H mice. In agreement with these observations, Pofut1(cax/cax) SCDMs differentiated earlier concomitant with reduced Pax7 expression and decrease in PAX7(+)/MYOD(-) progenitor cells. In vitro binding assays showed a reduced interaction of DELTA-LIKE 1 ligand (DLL1) with NOTCH receptors expressed at the cell surface of SCDMs, leading to a decreased Notch signalling as seen by the quantification of cleaved NICD and Notch target genes. These results demonstrated that POFUT1-mediated O-fucosylation of NOTCH receptors regulates myogenic cell differentiation and affects postnatal muscle growth in mice. © 2016 The Authors.
Reduced Notch signalling leads to postnatal skeletal muscle hypertrophy in Pofut1cax/cax mice
Al Jaam, Bilal; Heu, Katy; Pennarubia, Florian; Segelle, Alexandre; Magnol, Laetitia; Germot, Agnès; Blanquet, Véronique; Maftah, Abderrahman
2016-01-01
Postnatal skeletal muscle growth results from the activation of satellite cells and/or an increase in protein synthesis. The Notch signalling pathway maintains satellite cells in a quiescent state, and once activated, sustains their proliferation and commitment towards differentiation. In mammals, POFUT1-mediated O-fucosylation regulates the interactions between NOTCH receptors and ligands of the DELTA/JAGGED family, thus initiating the activation of canonical Notch signalling. Here, we analysed the consequences of downregulated expression of the Pofut1 gene on postnatal muscle growth in mutant Pofut1cax/cax (cax, compact axial skeleton) mice and differentiation of their satellite cell-derived myoblasts (SCDMs). Pofut1cax/cax mice exhibited muscle hypertrophy, no hyperplasia and a decrease in satellite cell numbers compared with wild-type C3H mice. In agreement with these observations, Pofut1cax/cax SCDMs differentiated earlier concomitant with reduced Pax7 expression and decrease in PAX7+/MYOD− progenitor cells. In vitro binding assays showed a reduced interaction of DELTA-LIKE 1 ligand (DLL1) with NOTCH receptors expressed at the cell surface of SCDMs, leading to a decreased Notch signalling as seen by the quantification of cleaved NICD and Notch target genes. These results demonstrated that POFUT1-mediated O-fucosylation of NOTCH receptors regulates myogenic cell differentiation and affects postnatal muscle growth in mice. PMID:27628322
Kalandadze, Avtandil; Wu, Ying; Robinson, Michael B
2002-11-29
Na(+)-dependent glutamate transporters are required for the clearance of extracellular glutamate and influence both physiological and pathological effects of this excitatory amino acid. In the present study, the effects of a protein kinase C (PKC) activator on the cell surface expression and activity of the GLT-1 subtype of glutamate transporter were examined in two model systems, primary co-cultures of neurons and astrocytes that endogenously express GLT-1 and C6 glioma cells transfected with GLT-1. In both systems, activation of PKC with phorbol ester caused a decrease in GLT-1 cell surface expression. This effect is opposite to the one observed for the EAAC1 subtype of glutamate transporter (Davis, K. E., Straff, D. J., Weinstein, E. A., Bannerman, P. G., Correale, D. M., Rothstein, J. D., and Robinson, M. B. (1998) J. Neurosci. 18, 2475-2485). Several recombinant chimeric proteins between GLT-1 and EAAC1 transporter subtypes were generated to identify domains required for the subtype-specific redistribution of GLT-1. We identified a carboxyl-terminal domain consisting of 43 amino acids (amino acids 475-517) that is required for PKC-induced GLT-1 redistribution. Mutation of a non-conserved serine residue at position 486 partially attenuated but did not completely abolish the PKC-dependent redistribution of GLT-1. Although we observed a phorbol ester-dependent incorporation of (32)P into immunoprecipitable GLT-1, mutation of serine 486 did not reduce this signal. We also found that chimeras containing the first 446 amino acids of GLT-1 were not functional unless amino acids 475-517 of GLT-1 were also present. These non-functional transporters were not as efficiently expressed on the cell surface and migrated to a smaller molecular weight, suggesting that a subtype-specific interaction is required for the formation of functional transporters. These studies demonstrate a novel effect of PKC on GLT-1 activity and define a unique carboxyl-terminal domain as an important determinant in cellular localization and regulation of GLT-1.
Bagheri, Bahador; Sohrabi, Bahram; Movassaghpour, Ali Akbar; Mashayekhi, Simin; Garjani, Afagh; Shokri, Mehriar; Pezeshkian, Masoud; Garjani, Alireza
2014-01-01
Evidence from several lines of investigations suggests that Toll-like receptor 4 (TLR4) is involved in atherosclerosis as a bridge between innate and acquired immunity. Percutaneous coronary intervention (PCI) can trigger inflammation through activation of human TLR4 (hTLR4) on monocytes. Hydrocortisone as an anti-inflammatory and immuno-suppressant agent has multiple mechanisms of action. In this study, we aimed at assessing the effects of hydrocortisone on monocyte expression and activity of hTLR4 in patients underwent PCI. Blood samples were taken from a total of 71 patients with chronic stable angina who were scheduled for a PCI, before the intervention. Thirty patients received 100 mg hydrocortisone prior to the procedure. Control group was composed of 41 patients underwent PCI without receiving hydrocortisone. Blood collection was repeated 2 and 4 h after PCI. The expression of hTLR4 on the surface of CD14+ monocytes and the serum levels of TNF-α and IL-1β were measured using flowcytometry and Sandwich ELISA. Compared with controls, hydrocortisone significantly reduced monocyte expression of hTLR4 in test group (P<0.01). In addition, it had a significant effect on reduction of serum concentrations of TNF-α and IL-1β in test group in a time-dependent manner (P<0.01). In this study, hydrocortisone was able to reduce the hTLR4/CD14 positive monocytes and its related pro-inflammatory cytokines, thus it can decrease inflammatory responses following PCI.
Mandal, Manoj K; Fischer, Rainer; Schillberg, Stefan; Schiermeyer, Andreas
2014-08-01
Recombinant proteins produced in plant suspension cultures are often degraded by endogenous plant proteases when secreted into the medium, resulting in low yields. To generate protease-deficient tobacco BY-2 cell lines and to retrieve the sequence information, we cloned four different protease cDNAs from tobacco BY-2 cells (NtAP, NtCP, NtMMP1, and NtSP), which represent the major catalytic classes. The simultaneous expression of antisense RNAs against these endogenous proteases led to the establishment of cell lines with reduced levels of endogenous protease expression and activity at late stages of the cultivation cycle. One of the cell lines showing reduced proteolytic activity in the culture medium was selected for the expression of the recombinant full-length IgG1(κ) antibody 2F5, recognizing the gp41 surface protein of HIV-1. This cell line showed significantly reduced degradation of the 2F5 heavy chain, resulting in four-fold higher accumulation of the intact antibody heavy chain when compared to transformed wild type cells expressing the same antibody. N-terminal sequencing data revealed that the antibody has two cleavage sites within the CDR-H3 and one site at the end of the H4-framework region. These cleavage sites are found to be vulnerable to serine proteases. The data provide a basis for further improvement of plant cells for the production of recombinant proteins in plant cell suspension cultures. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Melo, A D B; Silveira, H; Luciano, F B; Andrade, C; Costa, L B; Rostagno, M H
2016-01-01
The intestinal environment plays a critical role in maintaining swine health. Many factors such as diet, microbiota, and host intestinal immune response influence the intestinal environment. Intestinal alkaline phosphatase (IAP) is an important apical brush border enzyme that is influenced by these factors. IAP dephosphorylates bacterial lipopolysaccharides (LPS), unmethylated cytosine-guanosine dinucleotides, and flagellin, reducing bacterial toxicity and consequently regulating toll-like receptors (TLRs) activation and inflammation. It also desphosphorylates extracellular nucleotides such as uridine diphosphate and adenosine triphosphate, consequently reducing inflammation, modulating, and preserving the homeostasis of the intestinal microbiota. The apical localization of IAP on the epithelial surface reveals its role on LPS (from luminal bacteria) detoxification. As the expression of IAP is reported to be downregulated in piglets at weaning, LPS from commensal and pathogenic gram-negative bacteria could increase inflammatory processes by TLR-4 activation, increasing diarrhea events during this phase. Although some studies had reported potential IAP roles to promote gut health, investigations about exogenous IAP effects or feed additives modulating IAP expression and activity yet are necessary. However, we discussed in this paper that the critical assessment reported can suggest that exogenous IAP or feed additives that could increase its expression could show beneficial effects to reduce diarrhea events during the post weaning phase. Therefore, the main goals of this review are to discuss IAP's role in intestinal inflammatory processes and present feed additives used as growth promoters that may modulate IAP expression and activity to promote gut health in piglets.
Bagheri, Bahador; Sohrabi, Bahram; Movassaghpour, Ali Akbar; Mashayekhi, Simin; Garjani, Afagh; Shokri, Mehriar; Pezeshkian, Masoud; Garjani, Alireza
2014-01-01
Bacground: Evidence from several lines of investigations suggests that Toll-like receptor 4 (TLR4) is involved in atherosclerosis as a bridge between innate and acquired immunity. Percutaneous coronary intervention (PCI) can trigger inflammation through activation of human TLR4 (hTLR4) on monocytes. Hydrocortisone as an anti-inflammatory and immuno-suppressant agent has multiple mechanisms of action. In this study, we aimed at assessing the effects of hydrocortisone on monocyte expression and activity of hTLR4 in patients underwent PCI. Methods: Blood samples were taken from a total of 71 patients with chronic stable angina who were scheduled for a PCI, before the intervention. Thirty patients received 100 mg hydrocortisone prior to the procedure. Control group was composed of 41 patients underwent PCI without receiving hydrocortisone. Blood collection was repeated 2 and 4 h after PCI. The expression of hTLR4 on the surface of CD14+ monocytes and the serum levels of TNF-α and IL-1β were measured using flowcytometry and Sandwich ELISA. Results: Compared with controls, hydrocortisone significantly reduced monocyte expression of hTLR4 in test group (P<0.01). In addition, it had a significant effect on reduction of serum concentrations of TNF-α and IL-1β in test group in a time-dependent manner (P<0.01). Conclusion: In this study, hydrocortisone was able to reduce the hTLR4/CD14 positive monocytes and its related pro-inflammatory cytokines, thus it can decrease inflammatory responses following PCI. PMID:24518547
Elaboration of antibiofilm materials by chemical grafting of an antimicrobial peptide.
Yala, Jean-Fabrice; Thebault, Pascal; Héquet, Arnaud; Humblot, Vincent; Pradier, Claire-Marie; Berjeaud, Jean-Marc
2011-02-01
A peptide antibiotic, gramicidin A, was covalently bound to cystamine self-assembled monolayers on gold surfaces. Each step of the surface functionalization was characterized by polarization modulation infrared reflection absorption spectroscopy and X-ray photoelectron spectroscopy. The antimicrobial activity of the anchored gramicidin was tested against three Gram-positive bacteria (Listeria ivanovii, Enterococcus faecalis, and Staphylococcus aureus), the Gram-negative bacterium Escherichia coli and the yeast Candida albicans. The results revealed that the adsorbed gramicidin reduced, from 60% for E. coli to 90% for C. albicans, the number of culturable microorganisms attached to the surface. The activity was proven to be persistent overtime, up to 6 months after the first use. The bacteria attached to the functionalized surfaces were permeabilized as shown by confocal microscopy. Taken together, these results indicate a bacteriostatic mode of action of the immobilized peptide. Finally, using green fluorescent protein-expressing bacteria, it was shown that the development of a bacterial biofilm was delayed on peptide-grafted surfaces for at least 24 h.
Moon, Andrea F; Mueller, Geoffrey A; Zhong, Xuejun; Pedersen, Lars C
2010-01-01
Protein crystallographers are often confronted with recalcitrant proteins not readily crystallizable, or which crystallize in problematic forms. A variety of techniques have been used to surmount such obstacles: crystallization using carrier proteins or antibody complexes, chemical modification, surface entropy reduction, proteolytic digestion, and additive screening. Here we present a synergistic approach for successful crystallization of proteins that do not form diffraction quality crystals using conventional methods. This approach combines favorable aspects of carrier-driven crystallization with surface entropy reduction. We have generated a series of maltose binding protein (MBP) fusion constructs containing different surface mutations designed to reduce surface entropy and encourage crystal lattice formation. The MBP advantageously increases protein expression and solubility, and provides a streamlined purification protocol. Using this technique, we have successfully solved the structures of three unrelated proteins that were previously unattainable. This crystallization technique represents a valuable rescue strategy for protein structure solution when conventional methods fail. PMID:20196072
Iron plaque decreases cadmium accumulation in Oryza sativa L. and serves as a source of iron.
Sebastian, A; Prasad, M N V
2016-11-01
Cadmium (Cd) contamination occurs in paddy soils; hence it is necessary to reduce Cd content of rice. Application and mode of action of ferrous sulphate in minimizing Cd in rice was monitored in the present study. Pot culture with Indian rice variety Swarna (MTU 7029) was maintained in Cd-spiked soil containing ferrous sulphates, which is expected to reduce Cd accumulation in rice. Responses in rhizosphere pH, root surface, metal accumulation in plant and molecular physiological processes were monitored. Iron plaque was induced on root surfaces after FeSO4 application and the amount of Fe in plaque reduced with increases in Cd in the soil. Rhizosphere pH decreased during plaque formation and became more acidic due to secretion of organic acids from the roots under Cd treatment. Moreover, iron chelate reductase activity increased with Cd treatment, but in the absence of Cd, activity of this enzyme increased in plaque-induced plants. Cd treatment caused expression of OsYSL18, whereas OsYSL15 was expressed only in roots without iron plaque. Fe content of plants increased during plaque formation, which protected plants from Cd-induced Fe deficiency and metal toxicity. This was corroborated with increased biomass, chlorophyll content and quantum efficiency of photo-synthesis among plaque-induced plants. We conclude that ferrous sulphate-induced iron plaque prevents Cd accumulation and Fe deficiency in rice. Iron released from plaque via organic acid mediated dissolution during Cd stress. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.
Bromelain treatment reduces CD25 expression on activated CD4+ T cells in vitro✩
Secor, Eric R.; Singh, Anurag; Guernsey, Linda A.; McNamara, Jeff T.; Zhan, Lijun; Maulik, Nilanjana; Thrall, Roger S.
2009-01-01
Bromelain (Br), an extract from pineapple stem with cysteine protease activity, exerts anti-inflammatory effects in a number of inflammatory models. We have previously shown that Br treatment decreased activated CD4+ T cells and has a therapeutic role in an ovalbumin-induced murine model of allergic airway disease. The current study was designed to determine the effect of Br on CD4+ T cell activation, specifically the expression of CD25 in vitro. CD25 is up regulated upon T cell activation, found as a soluble fraction (sCD25) and is a therapeutic target in inflammation, autoimmunity and allergy. Br treatment of anti-CD3 stimulated CD4+ T cells reduced CD25 expression in a dose and time dependent manner. This reduction of CD25 was dependent on the proteolytic action of Br as the addition of E64 (a cysteine protease inhibitor) abrogated this response. The concentration of sCD25 was increased in supernatants of Br treated activated CD4+ T cells as compared to control cells, suggesting that Br proteolytically cleaved cell-surface CD25. This novel mechanism of action identifies how Br may exert its therapeutic benefits in inflammatory conditions. PMID:19162239
Cam, Judy A; Zerbinatti, Celina V; Knisely, Jane M; Hecimovic, Silva; Li, Yonghe; Bu, Guojun
2004-07-09
The low density lipoprotein (LDL) receptor-related protein 1B (LRP1B) is a newly identified member of the LDL receptor family that shares high homology with the LDL receptor-related protein (LRP). LRP1B was originally described as a putative tumor suppressor in lung cancer cells; however, its expression profile in several regions of adult human brain suggests it may have additional functions in the central nervous system. Since LRP1B has overlapping ligand binding properties with LRP, we investigated whether LRP1B, like LRP, could interact with the beta-amyloid precursor protein (APP) and modulate its processing to amyloid-beta peptides (Abetas). Using an LRP1B minireceptor (mLRP1B4) generated to study the trafficking of LRP1B, we found that mLRP1B4 and APP form an immunoprecipitable complex. Furthermore mLRP1B4 bound and facilitated the degradation of a soluble isoform of APP containing a Kunitz proteinase inhibitor domain but not soluble APP lacking a Kunitz proteinase inhibitor domain. A functional consequence of mLRP1B4 expression was a significant accumulation of APP at the cell surface, which is likely related to the slow endocytosis rate of LRP1B. More importantly, mLRP1B4-expressing cells that accumulated cell surface APP produced less Abeta and secreted more soluble APP. These findings reveal that LRP1B is a novel binding partner of APP that functions to decrease APP processing to Abeta. Consequently LRP1B expression could function to protect against the pathogenesis of Alzheimer's disease.
Vargas García, Cynthia E.; Petrova, Mariya; Claes, Ingmar J. J.; De Boeck, Ilke; Verhoeven, Tine L. A.; Dilissen, Ellen; von Ossowski, Ingemar; Palva, Airi; Bullens, Dominique M.; Vanderleyden, Jos
2015-01-01
Recently, spaCBA-encoded pili on the cell surface of Lactobacillus rhamnosus GG were identified to be key molecules for binding to human intestinal mucus and Caco-2 intestinal epithelial cells. Here, we investigated the role of the SpaCBA pilus of L. rhamnosus GG in the interaction with macrophages in vitro by comparing the wild type with surface mutants. Our results show that SpaCBA pili play a significant role in the capacity for adhesion to macrophages and also promote bacterial uptake by these phagocytic cells. Interestingly, our data suggest that SpaCBA pili also mediate anti-inflammatory effects by induction of interleukin-10 (IL-10) mRNA and reduction of interleukin-6 (IL-6) mRNA in a murine RAW 264.7 macrophage cell line. These pili appear to mediate these effects indirectly by promoting close contact with the macrophages, facilitating the exertion of anti-inflammatory effects by other surface molecules via yet unknown mechanisms. Blockage of complement receptor 3 (CR3), previously identified to be a receptor for streptococcal pili, significantly decreased the uptake of pilus-expressing strains in RAW 264.7 cells, while the expression of IL-10 and IL-6 mRNA by these macrophages was not affected by this blocking. On the other hand, blockage of Toll-like receptor 2 (TLR2) significantly reduced the expression of IL-6 mRNA irrespective of the presence of pili. PMID:25576613
Mehta, J S; Futter, C E; Sandeman, S R; Faragher, R G A F; Hing, K A; Tanner, K E; Allan, B D S
2005-10-01
Published clinical series suggest the osteoodontokeratoprosthesis (OOKP) may have a lower extrusion rate than current synthetic keratoprostheses. The OOKP is anchored in the eye wall by autologous tooth. The authors' aim was to compare adhesion, proliferation, and morphology for telomerase transformed keratocytes seeded on calcium hydroxyapatite (the principal mineral constituent of tooth) and materials used in the anchoring elements of commercially available synthetic keratoprostheses. Test materials were hydroxyapatite, polytetrafluoroethylene (PTFE), polyhydroxyethyl methacrylate (HEMA), and glass (control). Cell adhesion and viability were quantified at 4 hours, 24 hours, and 1 week using a calcein-AM/EthD-1 viability/cytotoxicity assay. Focal contact expression and cytoskeletal organisation were studied at 24 hours by confocal microscopy with immunoflourescent labelling. Further studies of cell morphology were performed using light and scanning electron microscopy. Live cell counts were significantly greater on hydroxyapatite surfaces at each time point (p<0.04). Dead cell counts were significantly higher for PTFE at 7 days (p<0.002). ss(1) integrin expression was highest on hydroxyapatite. Adhesion structures were well expressed in flat, spread out keratocytes on both HA and glass. Keratocytes tended to be thinner and spindle shaped on PTFE. The relatively few keratocytes visible on HEMA test surfaces were rounded and poorly adherent. Keratocyte adhesion, spreading, and viability on hydroxyapatite test surfaces is superior to that seen on PTFE and HEMA. Improving the initial cell adhesion environment in the skirt element of keratoprostheses may enhance tissue integration and reduce device failure rates.
PAR(2) expression in peripheral blood monocytes of patients with rheumatoid arthritis.
Crilly, A; Burns, E; Nickdel, M B; Lockhart, J C; Perry, M E; Ferrell, P W; Baxter, D; Dale, J; Dunning, L; Wilson, H; Nijjar, J S; Gracie, J A; Ferrell, W R; McInnes, I B
2012-06-01
Proteinase-activated receptor 2 (PAR(2)) is a G protein-coupled receptor activated by serine proteinases with proinflammatory activity. A study was undertaken to investigate the presence and functional significance of PAR(2) expression on rheumatoid arthritis (RA)-derived leucocyte subsets. Venous blood was obtained from patients with RA and osteoarthritis (OA) as well as healthy control subjects. Surface expression of PAR(2) on peripheral blood mononuclear cells (PBMCs) was analysed by flow cytometry and interleukin 6 (IL-6) generation by ELISA. Patients with RA had elevated but variable surface expression of PAR(2) on CD14+ monocytes compared with control subjects (median (1st to 3rd quartiles) 1.76% (0.86-4.10%) vs 0.06% (0.03-0.81%), p<0.0001). CD3+ T cells showed a similar pattern with significantly higher PAR(2) expression in patients with RA compared with controls (3.05% (0.36-11.82%) vs 0.08% (0.02-0.28%), p<0.0001). For both subsets, PAR(2) expression was significantly higher (p<0.00001) in patients with high levels of disease activity: PAR(2) expression for both CD14+ and CD3+ cells correlated to C reactive protein and erythrocyte sedimentation rate. Furthermore, in a cohort of patients with newly diagnosed RA, elevated PAR(2) expression in both CD14+ and CD3+ cells was significantly reduced 3 months after methotrexate or sulfasalazine treatment and this reduction correlated significantly with the reduction in the 28-joint Disease Activity Scale score (p<0.05). PAR(2) expression on cells from patients with OA was low, similar to levels seen in control subjects. Generation of IL-6 by monocytes in response to a selective PAR(2) agonist was significantly greater in patients with RA than in patients with OA and control subjects (p<0.05). These findings are consistent with a pathogenic role for PAR(2) in RA.
Ahrens, Ingo; Chen, Yung-Chih; Topcic, Danijal; Bode, Michael; Haenel, David; Hagemeyer, Christoph E; Seeba, Hannah; Duerschmied, Daniel; Bassler, Nicole; Jandeleit-Dahm, Karin A; Sweet, Matthew J; Agrotis, Alex; Bobik, Alex; Peter, Karlheinz
2015-11-01
High mobility group box 1 (HMGB1) acts as both a nuclear protein that regulates gene expression, as well as a pro-inflammatory alarmin that is released from necrotic or activated cells. Recently, HMGB1-expression in human atherosclerotic plaques was identified. Therapeutic blockade of HMGB1 reduced the development of diet-induced atherosclerosis in ApoE knockout mice. Thus, we hypothesised an interaction between HMGB1 and activated platelets. Binding of recombinant HMGB1 to platelets was assessed by flow cytometry. HMGB1 bound to thrombin-activated human platelets (MFI 2.49 vs 25.01, p=0.0079). Blood from wild-type, TLR4 and RAGE knockout mice was used to determine potential HMGB1 receptors on platelets. HMGB1 bound to platelets from wild type C57Bl6 (MFI 2.64 vs 20.3, p< 0.05), and TLR4-/- mice (MFI 2.11 vs 25.65, p< 0.05) but failed to show binding to platelets from RAGE-/- mice (p > 0.05). RAGE expression on human platelets was detected by RT-PCR with mRNA extracted from highly purified platelets and confirmed by Western blot and immunofluorescence microscopy. Platelet activation increased RAGE surface expression (MFI 4.85 vs 6.74, p< 0.05). Expression of HMGB1 in human coronary artery thrombi was demonstrated by immunohistochemistry and revealed high expression levels. Platelets bind HMGB1 upon thrombin-induced activation. Platelet specific expression of RAGE could be detected at the mRNA and protein level and is involved in the binding of HMGB1. Furthermore, platelet activation up-regulates platelet surface expression of RAGE. HMGB1 is highly expressed in platelet-rich human coronary artery thrombi pointing towards a central role for HMGB1 in atherothrombosis, thereby suggesting the possibility of platelet targeted anti-inflammatory therapies for atherothrombosis.
PAR2 expression in peripheral blood monocytes of patients with rheumatoid arthritis
Crilly, A; Burns, E; Nickdel, M B; Lockhart, J C; Perry, M E; Ferrell, P W; Baxter, D; Dale, J; Dunning, L; Wilson, H; Nijjar, J S; Gracie, J A; Ferrell, W R; McInnes, I B
2012-01-01
Objectives Proteinase-activated receptor 2 (PAR2) is a G protein-coupled receptor activated by serine proteinases with proinflammatory activity. A study was undertaken to investigate the presence and functional significance of PAR2 expression on rheumatoid arthritis (RA)-derived leucocyte subsets. Methods Venous blood was obtained from patients with RA and osteoarthritis (OA) as well as healthy control subjects. Surface expression of PAR2 on peripheral blood mononuclear cells (PBMCs) was analysed by flow cytometry and interleukin 6 (IL-6) generation by ELISA. Results Patients with RA had elevated but variable surface expression of PAR2 on CD14+ monocytes compared with control subjects (median (1st to 3rd quartiles) 1.76% (0.86–4.10%) vs 0.06% (0.03–0.81%), p<0.0001). CD3+ T cells showed a similar pattern with significantly higher PAR2 expression in patients with RA compared with controls (3.05% (0.36–11.82%) vs 0.08% (0.02–0.28%), p<0.0001). For both subsets, PAR2 expression was significantly higher (p<0.00001) in patients with high levels of disease activity: PAR2 expression for both CD14+ and CD3+ cells correlated to C reactive protein and erythrocyte sedimentation rate. Furthermore, in a cohort of patients with newly diagnosed RA, elevated PAR2 expression in both CD14+ and CD3+ cells was significantly reduced 3 months after methotrexate or sulfasalazine treatment and this reduction correlated significantly with the reduction in the 28-joint Disease Activity Scale score (p<0.05). PAR2 expression on cells from patients with OA was low, similar to levels seen in control subjects. Generation of IL-6 by monocytes in response to a selective PAR2 agonist was significantly greater in patients with RA than in patients with OA and control subjects (p<0.05). Conclusions These findings are consistent with a pathogenic role for PAR2 in RA. PMID:22294633
Haines, Sara; Gautheron, Sylviane; Nasser, William; Renauld-Mongénie, Geneviève
2015-01-01
Colonization factors (CFs) mediate early adhesion of Enterotoxigenic Escherichia coli (ETEC) in the small intestine. Environmental signals including bile, glucose, and contact with epithelial cells have previously been shown to modulate CF expression in a strain dependent manner. To identify novel components modulating CF surface expression, 20 components relevant to the intestinal environment were selected for evaluation. These included mucin, bicarbonate, norepinephrine, lincomycin, carbon sources, and cations. Effects of individual components on surface expression of the archetype CF, CFA/I, were screened using a fractional factorial Hadamard matrix incorporating 24 growth conditions. As most CFs agglutinate erythrocytes, surface expression was evaluated by mannose resistant hemagglutination. Seven components, including porcine gastric mucin, lincomycin, glutamine, and glucose were found to induce CFA/I surface expression in vitro in a minimal media while five others were inhibitory, including leucine and 1,10-phenanthroline. To further explore the effect of components positively influencing CFA/I surface expression, a response surface methodology (RSM) was designed incorporating 36 growth conditions. The optimum concentration for each component was identified, thereby generating a novel culture media, SP1, for CFA/I expression. CFs closely related to CFA/I, including CS4 and CS14 were similarly induced in SP1 media. Other epidemiologically relevant CFs were also induced when compared to the level obtained in minimal media. These results indicate that although CF surface expression is complex and highly variable among strains, the CF response can be predicted for closely related strains. A novel culture media inducing CFs in the CF5a group was successfully identified. In addition, mucin was found to positively influence CF expression in strains expressing either CFA/I or CS1 and CS3, and may function as a common environmental cue. PMID:26517723
Haines, Sara; Gautheron, Sylviane; Nasser, William; Renauld-Mongénie, Geneviève
2015-01-01
Colonization factors (CFs) mediate early adhesion of Enterotoxigenic Escherichia coli (ETEC) in the small intestine. Environmental signals including bile, glucose, and contact with epithelial cells have previously been shown to modulate CF expression in a strain dependent manner. To identify novel components modulating CF surface expression, 20 components relevant to the intestinal environment were selected for evaluation. These included mucin, bicarbonate, norepinephrine, lincomycin, carbon sources, and cations. Effects of individual components on surface expression of the archetype CF, CFA/I, were screened using a fractional factorial Hadamard matrix incorporating 24 growth conditions. As most CFs agglutinate erythrocytes, surface expression was evaluated by mannose resistant hemagglutination. Seven components, including porcine gastric mucin, lincomycin, glutamine, and glucose were found to induce CFA/I surface expression in vitro in a minimal media while five others were inhibitory, including leucine and 1,10-phenanthroline. To further explore the effect of components positively influencing CFA/I surface expression, a response surface methodology (RSM) was designed incorporating 36 growth conditions. The optimum concentration for each component was identified, thereby generating a novel culture media, SP1, for CFA/I expression. CFs closely related to CFA/I, including CS4 and CS14 were similarly induced in SP1 media. Other epidemiologically relevant CFs were also induced when compared to the level obtained in minimal media. These results indicate that although CF surface expression is complex and highly variable among strains, the CF response can be predicted for closely related strains. A novel culture media inducing CFs in the CF5a group was successfully identified. In addition, mucin was found to positively influence CF expression in strains expressing either CFA/I or CS1 and CS3, and may function as a common environmental cue.
Precursor Forms of Vitamin D Reduce HIV-1 Infection In Vitro.
Aguilar-Jimenez, Wbeimar; Villegas-Ospina, Simon; Gonzalez, Sandra; Zapata, Wildeman; Saulle, Irma; Garziano, Micaela; Biasin, Mara; Clerici, Mario; Rugeles, Maria T
2016-12-15
Although the anti-HIV-1 effects of vitamin D (VitD) have been reported, mechanisms behind such protection remain largely unexplored. The effects of two precursor forms (cholecalciferol/calciol at 0.01, 1 and 100 nM and calcidiol at 100 and 250 nM) on HIV-1 infection, immune activation, and gene expression were analyzed in vitro in cells of Colombian and Italian healthy donors. We quantified levels of released p24 by enzyme-linked immunosorbent assay, of intracellular p24 and cell-surface expression of CD38 and HLA-DR by flow cytometry, and mRNA expression of antiviral and immunoregulatory genes by real-time reverse transcription-polymerase chain reaction. Cholecalciferol decreased the frequency of HIV-1-infected p24CD4 T cells and levels of p24 in supernatants in a dose-dependent manner. Moreover, the CD4CD38HLA-DR and CD4CD38HLA-DR subpopulations were more susceptible to infection but displayed the greatest cholecalciferol-induced decreases in infection rate by an X4-tropic strain. Likewise, cholecalciferol at its highest concentration decreased the frequency of CD38HLA-DR but not of CD38HLA-DR T-cell subsets. Analyzing the effects of calcidiol, the main VitD source for immune cells and an R5-tropic strain as the most frequently transmitted virus, a reduction in HIV-1 productive infection was also observed. In addition, an increase in mRNA expression of APOBEC3G and PI3 and a reduction of TRIM22 and CCR5 expression, this latter positively correlated with p24 levels, was noted. VitD reduces HIV-1 infection in T cells possibly by inducing antiviral gene expression, reducing the viral co-receptor CCR5 and, at least at the highest cholecalciferol concentration, by promoting an HIV-1-restrictive CD38HLA-DR immunophenotype.
Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C
2006-12-01
Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.
Karkov, Hanne Sophie; Krogh, Berit Olsen; Woo, James; Parimal, Siddharth; Ahmadian, Haleh; Cramer, Steven M
2015-11-01
In this study, a unique set of antibody Fab fragments was designed in silico and produced to examine the relationship between protein surface properties and selectivity in multimodal chromatographic systems. We hypothesized that multimodal ligands containing both hydrophobic and charged moieties would interact strongly with protein surface regions where charged groups and hydrophobic patches were in close spatial proximity. Protein surface property characterization tools were employed to identify the potential multimodal ligand binding regions on the Fab fragment of a humanized antibody and to evaluate the impact of mutations on surface charge and hydrophobicity. Twenty Fab variants were generated by site-directed mutagenesis, recombinant expression, and affinity purification. Column gradient experiments were carried out with the Fab variants in multimodal, cation-exchange, and hydrophobic interaction chromatographic systems. The results clearly indicated that selectivity in the multimodal system was different from the other chromatographic modes examined. Column retention data for the reduced charge Fab variants identified a binding site comprising light chain CDR1 as the main electrostatic interaction site for the multimodal and cation-exchange ligands. Furthermore, the multimodal ligand binding was enhanced by additional hydrophobic contributions as evident from the results obtained with hydrophobic Fab variants. The use of in silico protein surface property analyses combined with molecular biology techniques, protein expression, and chromatographic evaluations represents a previously undescribed and powerful approach for investigating multimodal selectivity with complex biomolecules. © 2015 Wiley Periodicals, Inc.
Straight, Paul D; Willey, Joanne M; Kolter, Roberto
2006-07-01
Using mixed-species cultures, we have undertaken a study of interactions between two common spore-forming soil bacteria, Bacillus subtilis and Streptomyces coelicolor. Our experiments demonstrate that the development of aerial hyphae and spores by S. coelicolor is inhibited by surfactin, a lipopeptide surfactant produced by B. subtilis. Current models of aerial development by sporulating bacteria and fungi postulate a role for surfactants in reducing surface tension at air-liquid interfaces, thereby removing the major barrier to aerial growth. S. coelicolor produces SapB, an amphipathic peptide that is surface active and required for aerial growth on certain media. Loss of aerial hyphae in developmental mutants can be rescued by addition of purified SapB. While a surfactant from a fungus can substitute for SapB in a mutant that lacks aerial hyphae, not all surfactants have this effect. We show that surfactin is required for formation of aerial structures on the surface of B. subtilis colonies. However, in contrast to this positive role, our experiments reveal that surfactin acts antagonistically by arresting S. coelicolor aerial development and causing altered expression of developmental genes. Our observations support the idea that surfactants function specifically for a given organism regardless of their shared ability to reduce surface tension. Production of surfactants with antagonistic activity could provide a powerful competitive advantage during surface colonization and in competition for resources.
Vrăbiescu, A; Radu, D; Dolganiuc, A; Bordea, M; Olinescu, A
1998-01-01
The authors worked on 3 groups of 8 male rabbits, New Zealand race: 1) controls; 2) procain injected i.m., 15 mg/kg body weight, daily, for 30 days; 3) i.m. injected with diethylaminoethanol (DEAE), 15 mg/kg body weight, daily, for 35 days. The expression of the MHC I, MHC II, CD43, CD4 and IgM antigenic markers on the plasmatic membrane of the lymphocytes was studied using flow cytometry and monoclonal antibodies. Procain or DEAE treatment reduced the percentage of lymphocytes expressing I MHC, from 99.06 in the control group, to 94.51 in procain group and to 96.91 in the DEAE group. The intensity of expression of MHC complexes of class II decreases from 160.94 in the control group, to 107.21 in the procain group and to 104.05 in the DEAE group. No significant differences were noticed between the three groups of rabbits concerning the rate of lymphocytes that have on their surface expressed markers for CD43 (lymphocytes T), CD4 (Th), or IgM (lymphocytes B). Lymphocytosis induced in rabbits as a result of the DEAE treatment took place without a change in the proportions of lymphocyte subpopulations. The authors consider that owing to their capacity to reduce the expression of antigens MHC of class I and class II on the membrane of lymphocytes, procain and DEAE can have benefic effects in some autoimmune, autoaggression and inflammatory diseases.
2011-01-01
Background Elevated numbers of regulatory T cells (Tregs) have been implicated in certain cancers. Depletion of Tregs has been shown to increase anti-tumor immunity. Tregs also play a critical role in the suppression of autoimmune responses. The study of Tregs has been hampered by a lack of adequate surface markers. Leucine Rich Repeat Containing 32 (LRRC32), also known as Glycoprotein A Repetitions Predominant (GARP), has been postulated as a novel surface marker of activated Tregs. However, there is limited information regarding the processing of LRRC32 or the regulatory phenotype and functional activity of Tregs expressing LRRC32. Results Using naturally-occurring freshly isolated Tregs, we demonstrate that low levels of LRRC32 are present intracellularly prior to activation and that freshly isolated LRRC32+ Tregs are distinct from LRRC32- Tregs with respect to the expression of surface CD62L. Using LRRC32 transfectants of HEK cells, we demonstrate that the N-terminus of LRRC32 is cleaved prior to expression of the protein at the cell surface. Furthermore, we demonstrate using a construct containing a deleted putative signal peptide region that the presence of a signal peptide region is critical to cell surface expression of LRRC32. Finally, mixed lymphocyte assays demonstrate that LRRC32+ Tregs are more potent suppressors than LRRC32- Tregs. Conclusions A cleaved signal peptide site in LRRC32 is necessary for surface localization of native LRRC32 following activation of naturally-occurring freshly-isolated regulatory T cells. LRRC32 expression appears to alter the surface expression of activation markers of T cells such as CD62L. LRRC32 surface expression may be useful as a marker that selects for more potent Treg populations. In summary, understanding the processing and expression of LRRC32 may provide insight into the mechanism of action of Tregs and the refinement of immunotherapeutic strategies aimed at targeting these cells. PMID:21615933
Wu, Chunxiao; Wang, Shu
2012-01-01
Binding to heparan sulfate is essential for baculovirus transduction of mammalian cells. Our previous study shows that gp64, the major glycoprotein on the virus surface, binds to heparin in a pH-dependent way, with a stronger binding at pH 6.2 than at 7.4. Using fluorescently labeled peptides, we mapped the pH-dependent heparin-binding sequence of gp64 to a 22-amino-acid region between residues 271 and 292. Binding of this region to the cell surface was also pH dependent, and peptides containing this sequence could efficiently inhibit baculovirus transduction of mammalian cells at pH 6.2. When the heparin-binding peptide was immobilized onto the bead surface to mimic the high local concentration of gp64 on the virus surface, the peptide-coated magnetic beads could efficiently pull down cells expressing heparan sulfate but not cells pretreated with heparinase or cells not expressing heparan sulfate. Interestingly, although this heparin-binding function is essential for baculovirus transduction of mammalian cells, it is dispensable for infection of Sf9 insect cells. Virus infectivity on Sf9 cells was not reduced by the presence of heparin or the identified heparin-binding peptide, even though the peptide could bind to Sf9 cell surface and be efficiently internalized. Thus, our data suggest that, depending on the availability of the target molecules on the cell surface, baculoviruses can use two different methods, electrostatic interaction with heparan sulfate and more specific receptor binding, for cell attachment.
Atzingen, Marina V; Barbosa, Angela S; De Brito, Thales; Vasconcellos, Silvio A; de Morais, Zenáide M; Lima, Dirce MC; Abreu, Patricia AE; Nascimento, Ana LTO
2008-01-01
Background It has been well documented over past decades that interaction of pathogens with the extracellular matrix (ECM) plays a primary role in host cell attachment and invasion. Adherence to host tissues is mediated by surface-exposed proteins expressed by the microorganisms during infection. The mechanisms by which pathogenic leptospires invade and colonize the host remain poorly understood since few virulence factors contributing to the pathogenesis of the disease have been identified. Whole-genome sequencing analysis of L. interrogans allowed identification of a repertoire of putative leptospiral surface proteins. Results Here, we report the identification and characterization of a new leptospiral protein that exhibits extracellular matrix-binding properties, called as Lsa21 (leptospiral surface adhesin, 21 kDa). Compatible with its role in adhesion, the protein was shown to be surface-exposed by indirect immunofluorescence. Attachment of Lsa21 to laminin, collagen IV, and plasma fibronectin was specific and dose dependent. Laminin oxidation by sodium metaperiodate reduced the protein-laminin interaction in a concentration-dependent manner, indicating that laminin sugar moieties are crucial for this interaction. The gene coding for Lsa21 is present in pathogenic strains belonging to the L. interrogans species but was not found in the saprophytic L. biflexa serovar Patoc strain Patoc 1. Loss of gene expression occurs upon culture attenuation of pathogenic strains. Environmental factors such as osmolarity and temperature affect Lsa21 expression at the transcriptional level. Moreover, anti-Lsa21 serum labeled liver and kidney tissues of human fatal cases of leptospirosis. Conclusion Our data suggest a role of Lsa21 in the pathogenesis of leptospirosis. PMID:18445272
Nanbo, Asuka; Maruyama, Junki; Imai, Masaki; Ujie, Michiko; Fujioka, Yoichiro; Nishide, Shinya; Takada, Ayato; Ohba, Yusuke; Kawaoka, Yoshihiro
2018-01-01
Cell surface receptors for phosphatidylserine contribute to the entry of Ebola virus (EBOV) particles, indicating that the presence of phosphatidylserine in the envelope of EBOV is important for the internalization of EBOV particles. Phosphatidylserine is typically distributed in the inner layer of the plasma membrane in normal cells. Progeny virions bud from the plasma membrane of infected cells, suggesting that phosphatidylserine is likely flipped to the outer leaflet of the plasma membrane in infected cells for EBOV virions to acquire it. Currently, the intracellular dynamics of phosphatidylserine during EBOV infection are poorly understood. Here, we explored the role of XK-related protein (Xkr) 8, which is a scramblase responsible for exposure of phosphatidylserine in the plasma membrane of apoptotic cells, to understand its significance in phosphatidylserine-dependent entry of EBOV. We found that Xkr8 and transiently expressed EBOV glycoprotein GP often co-localized in intracellular vesicles and the plasma membrane. We also found that co-expression of GP and viral major matrix protein VP40 promoted incorporation of Xkr8 into ebolavirus-like particles (VLPs) and exposure of phosphatidylserine on their surface, although only a limited amount of phosphatidylserine was exposed on the surface of the cells expressing GP and/or VP40. Downregulating Xkr8 or blocking caspase-mediated Xkr8 activation did not affect VLP production, but they reduced the amount of phosphatidylserine on the VLPs and their uptake in recipient cells. Taken together, our findings indicate that Xkr8 is trafficked to budding sites via GP-containing vesicles, is incorporated into VLPs, and then promote the entry of the released EBOV to cells in a phosphatidylserine-dependent manner.
Imai, Masaki; Ujie, Michiko; Fujioka, Yoichiro; Nishide, Shinya; Takada, Ayato; Ohba, Yusuke; Kawaoka, Yoshihiro
2018-01-01
Cell surface receptors for phosphatidylserine contribute to the entry of Ebola virus (EBOV) particles, indicating that the presence of phosphatidylserine in the envelope of EBOV is important for the internalization of EBOV particles. Phosphatidylserine is typically distributed in the inner layer of the plasma membrane in normal cells. Progeny virions bud from the plasma membrane of infected cells, suggesting that phosphatidylserine is likely flipped to the outer leaflet of the plasma membrane in infected cells for EBOV virions to acquire it. Currently, the intracellular dynamics of phosphatidylserine during EBOV infection are poorly understood. Here, we explored the role of XK-related protein (Xkr) 8, which is a scramblase responsible for exposure of phosphatidylserine in the plasma membrane of apoptotic cells, to understand its significance in phosphatidylserine-dependent entry of EBOV. We found that Xkr8 and transiently expressed EBOV glycoprotein GP often co-localized in intracellular vesicles and the plasma membrane. We also found that co-expression of GP and viral major matrix protein VP40 promoted incorporation of Xkr8 into ebolavirus-like particles (VLPs) and exposure of phosphatidylserine on their surface, although only a limited amount of phosphatidylserine was exposed on the surface of the cells expressing GP and/or VP40. Downregulating Xkr8 or blocking caspase-mediated Xkr8 activation did not affect VLP production, but they reduced the amount of phosphatidylserine on the VLPs and their uptake in recipient cells. Taken together, our findings indicate that Xkr8 is trafficked to budding sites via GP-containing vesicles, is incorporated into VLPs, and then promote the entry of the released EBOV to cells in a phosphatidylserine-dependent manner. PMID:29338048
Ohneck, Emily J.; Arivett, Brock A.; Fiester, Steven E.; Wood, Cecily R.; Metz, Maeva L.; Simeone, Gabriella M.
2018-01-01
The capacity of Acinetobacter baumannii to persist and cause infections depends on its interaction with abiotic and biotic surfaces, including those found on medical devices and host mucosal surfaces. However, the extracellular stimuli affecting these interactions are poorly understood. Based on our previous observations, we hypothesized that mucin, a glycoprotein secreted by lung epithelial cells, particularly during respiratory infections, significantly alters A. baumannii’s physiology and its interaction with the surrounding environment. Biofilm, virulence and growth assays showed that mucin enhances the interaction of A. baumannii ATCC 19606T with abiotic and biotic surfaces and its cytolytic activity against epithelial cells while serving as a nutrient source. The global effect of mucin on the physiology and virulence of this pathogen is supported by RNA-Seq data showing that its presence in a low nutrient medium results in the differential transcription of 427 predicted protein-coding genes. The reduced expression of ion acquisition genes and the increased transcription of genes coding for energy production together with the detection of mucin degradation indicate that this host glycoprotein is a nutrient source. The increased expression of genes coding for adherence and biofilm biogenesis on abiotic and biotic surfaces, the degradation of phenylacetic acid and the production of an active type VI secretion system further supports the role mucin plays in virulence. Taken together, our observations indicate that A. baumannii recognizes mucin as an environmental signal, which triggers a response cascade that allows this pathogen to acquire critical nutrients and promotes host-pathogen interactions that play a role in the pathogenesis of bacterial infections. PMID:29309434
Comparison of two free-energy expressions and their implications in surface enrichment
NASA Astrophysics Data System (ADS)
Jerry, Rocco A.; Nauman, E. Bruce
1993-08-01
We compare two free-energy expressions, developed by Cohen and Muthukumar [J. Chem. Phys. 90, 5749 (1989)] and by Jerry and Nauman [J. Colloid Interface Sci. 154, 122 (1992)], in terms of their predictions concerning surface enrichment. We show that a term must be added to the former expression so that it may predict the correct dependence of the surface composition on the bulk. The latter expression does predict the correct dependence. We have also derived the quadratic surface-energy contribution from a finite (nonzero) range interaction model.
Ezetimibe inhibits platelet activation and uPAR expression on endothelial cells.
Becher, Tobias; Schulze, Torsten J; Schmitt, Melanie; Trinkmann, Frederik; El-Battrawy, Ibrahim; Akin, Ibrahim; Kälsch, Thorsten; Borggrefe, Martin; Stach, Ksenija
2017-01-15
Lipid lowering therapy constitutes the basis of cardiovascular disease therapy. The purpose of this study was to investigate effects of ezetimibe, a selective inhibitor of intestinal cholesterol absorption, on platelets and endothelial cells in an in vitro endothelial cell model. After a 24h incubation period with ezetimibe (concentrations 1, 50, 100 and 1000ng/ml), human umbilical vein endothelial cells (HUVEC) were stimulated for 1h with lipopolysaccharide (LPS) and were then incubated in direct contact with activated platelets. Following this, the expression of CD40L and CD62P on platelets, and the expression of ICAM-1, VCAM-1, uPAR, and MT1-MMP on endothelial cells were measured by flow cytometry. Supernatants were analysed by enzyme linked immunosorbent assay for soluble MCP-1, IL-6 and MMP-1. The increased expression of uPAR on endothelial cells by proinflammatory stimulation with LPS and by direct endothelial contact with activated platelets was significantly reduced through pre-incubation with 100ng/ml and 1000ng/ml ezetimibe (p<0.05). Platelets directly incubated with ezetimibe but without endothelial cell contact showed significantly reduced CD62P and CD40L surface expression (p<0.05). Ezetimibe had no significant effects on HUVEC expression of MT1-MMP, ICAM-1 and VCAM-1 and on CD40L expression on platelets in direct contact with endothelial cells. Levels of soluble IL-6 in HUVEC supernatants were significantly lower after pre-incubation with ezetimibe. In this in vitro analysis, ezetimibe directly attenuates platelet activation and has significant endothelial cell mediated effects on selected markers of atherosclerosis. Copyright © 2016. Published by Elsevier Ireland Ltd.
Horii, Yoshio; Iino, Yuichi; Maemura, Michio; Horiguchi, Jun; Morishita, Yasuo
2005-02-01
We investigated the potent inhibitory effects of OK-432 (Picibanil) on both cellular adhesion and cell proliferation of estrogen-dependent (MCF-7) or estrogen-independent (MDA-MB-231) breast carcinoma cells. Cellular proliferation of both MCF-7 and MDA-MB-231 cells was markedly inhibited in a dose-dependent manner, when the carcinoma cells were exposed to OK-432. Cell attachment assay demonstrated that incubation with OK-432 for 24 h reduced integrin-mediated cellular adhesion of both cell types. However, fluorescence activated cell sorter (FACS) analysis revealed that incubation with OK-432 for 24 h did not decrease the cell surface expressions of any integrins. These results suggest that the binding avidity of integrins is reduced by OK-432 without alteration of the integrin expression. We conclude that OK-432 inhibits integrin-mediated cellular adhesion as well as cell proliferation of breast carcinoma cells regardless of estrogen-dependence, and that these actions of OK-432 contribute to prevention or inhibition of breast carcinoma invasion and metastasis.
Schiro, Michelle M.; Stauber, Sara E.; Peterson, Tami L.; Krueger, Chateen; Darnell, Steven J.; Satyshur, Kenneth A.; Drinkwater, Norman R.; Newton, Michael A.; Hoffmann, F. Michael
2011-01-01
Background Hub proteins are connected through binding interactions to many other proteins. Smad3, a mediator of signal transduction induced by transforming growth factor beta (TGF-β), serves as a hub protein for over 50 protein-protein interactions. Different cellular responses mediated by Smad3 are the product of cell-type and context dependent Smad3-nucleated protein complexes acting in concert. Our hypothesis is that perturbation of this spectrum of protein complexes by mutation of single protein-binding hot-spots on Smad3 will have distinct consequences on Smad3-mediated responses. Methodology/Principal Findings We mutated 28 amino acids on the surface of the Smad3 MH2 domain and identified 22 Smad3 variants with reduced binding to subsets of 17 Smad3-binding proteins including Smad4, SARA, Ski, Smurf2 and SIP1. Mutations defective in binding to Smad4, e.g., D408H, or defective in nucleocytoplasmic shuttling, e.g., W406A, were compromised in modulating the expression levels of a Smad3-dependent reporter gene or six endogenous Smad3-responsive genes: Mmp9, IL11, Tnfaip6, Fermt1, Olfm2 and Wnt11. However, the Smad3 mutants Y226A, Y297A, W326A, K341A, and E267A had distinct differences on TGF-β signaling. For example, K341A and Y226A both reduced the Smad3-mediated activation of the reporter gene by ∼50% but K341A only reduced the TGF-β inducibilty of Olfm2 in contrast to Y226A which reduced the TGF-β inducibility of all six endogenous genes as severely as the W406A mutation. E267A had increased protein binding but reduced TGF-β inducibility because it caused higher basal levels of expression. Y297A had increased TGF-β inducibility because it caused lower Smad3-induced basal levels of gene expression. Conclusions/Significance Mutations in protein binding hot-spots on Smad3 reduced the binding to different subsets of interacting proteins and caused a range of quantitative changes in the expression of genes induced by Smad3. This approach should be useful for unraveling which Smad3 protein complexes are critical for specific biological responses. PMID:21949838
Schiro, Michelle M; Stauber, Sara E; Peterson, Tami L; Krueger, Chateen; Darnell, Steven J; Satyshur, Kenneth A; Drinkwater, Norman R; Newton, Michael A; Hoffmann, F Michael
2011-01-01
Hub proteins are connected through binding interactions to many other proteins. Smad3, a mediator of signal transduction induced by transforming growth factor beta (TGF-β), serves as a hub protein for over 50 protein-protein interactions. Different cellular responses mediated by Smad3 are the product of cell-type and context dependent Smad3-nucleated protein complexes acting in concert. Our hypothesis is that perturbation of this spectrum of protein complexes by mutation of single protein-binding hot-spots on Smad3 will have distinct consequences on Smad3-mediated responses. We mutated 28 amino acids on the surface of the Smad3 MH2 domain and identified 22 Smad3 variants with reduced binding to subsets of 17 Smad3-binding proteins including Smad4, SARA, Ski, Smurf2 and SIP1. Mutations defective in binding to Smad4, e.g., D408H, or defective in nucleocytoplasmic shuttling, e.g., W406A, were compromised in modulating the expression levels of a Smad3-dependent reporter gene or six endogenous Smad3-responsive genes: Mmp9, IL11, Tnfaip6, Fermt1, Olfm2 and Wnt11. However, the Smad3 mutants Y226A, Y297A, W326A, K341A, and E267A had distinct differences on TGF-β signaling. For example, K341A and Y226A both reduced the Smad3-mediated activation of the reporter gene by ∼50% but K341A only reduced the TGF-β inducibilty of Olfm2 in contrast to Y226A which reduced the TGF-β inducibility of all six endogenous genes as severely as the W406A mutation. E267A had increased protein binding but reduced TGF-β inducibility because it caused higher basal levels of expression. Y297A had increased TGF-β inducibility because it caused lower Smad3-induced basal levels of gene expression. Mutations in protein binding hot-spots on Smad3 reduced the binding to different subsets of interacting proteins and caused a range of quantitative changes in the expression of genes induced by Smad3. This approach should be useful for unraveling which Smad3 protein complexes are critical for specific biological responses.
Tang, Weihao; Tam, Joshua H K; Seah, Claudia; Chiu, Justin; Tyrer, Andrea; Cregan, Sean P; Meakin, Susan O; Pasternak, Stephen H
2015-07-14
Alzheimer's disease (AD) is characterized by the deposition of Beta-Amyloid (Aβ) peptides in the brain. Aβ peptides are generated by cleavage of the Amyloid Precursor Protein (APP) by the β - and γ - secretase enzymes. Although this process is tightly linked to the internalization of cell surface APP, the compartments responsible are not well defined. We have found that APP can be rapidly internalized from the cell surface to lysosomes, bypassing early and late endosomes. Here we show by confocal microscopy and electron microscopy that this pathway is mediated by macropinocytosis. APP internalization is enhanced by antibody binding/crosslinking of APP suggesting that APP may function as a receptor. Furthermore, a dominant negative mutant of Arf6 blocks direct transport of APP to lysosomes, but does not affect classical endocytosis to endosomes. Arf6 expression increases through the hippocampus with the development of Alzheimer's disease, being expressed mostly in the CA1 and CA2 regions in normal individuals but spreading through the CA3 and CA4 regions in individuals with pathologically diagnosed AD. Disruption of lysosomal transport of APP reduces both Aβ40 and Aβ42 production by more than 30 %. Our findings suggest that the lysosome is an important site for Aβ production and that altering APP trafficking represents a viable strategy to reduce Aβ production.
Murtaza, Ghulam; Mermer, Petra; Pfeil, Uwe; Kummer, Wolfgang
2016-01-01
Volatile anesthetics inhibit mucociliary clearance in the airways. The two-pore domain K+ channel, TASK-1, represents one of their molecular targets in that they increase its open probability. Here, we determine whether particle transport speed (PTS) at the mucosal surface of the mouse trachea, an important factor of the cilia-driven mechanism in mucociliary clearance, is regulated by TASK-1. RT-PCR analysis revealed expression of TASK-1 mRNA in the manually dissected and laser-assisted microdissected tracheal epithelium of the mouse. Effects of anesthetics (isoflurane and Avertin®) and TASK-1 inhibitors (anandamide and A293) on ciliary activity were investigated by assessment of PTS at the mucosal surface of the explanted and opened murine trachea. Neither TASK-1 inhibitors nor isoflurane had any impact on basal and ATP-stimulated PTS. Avertin® reduced basal PTS, and ATP-stimulated PTS decreased in its presence in wild-type (WT) mice. Avertin®-induced decrease in basal PTS persisted in WT mice in the presence of TASK-1 inhibitors, and in two different strains of TASK-1 knockout mice. Our findings indicate that TASK-1 is expressed by the tracheal epithelium but is not critically involved in the regulation of tracheal PTS in mice. Avertin® reduces PTS independent of TASK-1.
Li, Zhili; Wang, Jigui; Yuan, Daoli; Wang, Shuang; Sun, Jiazeng; Yi, Bao; Hou, Qiang; Mao, Yaping; Liu, Weiquan
2015-06-01
Canine distemper virus (CDV) and rabies virus (RV) are two important pathogens of the dog. CDV, a member of the morbillivirus genus, has shown promise as an expression vector. The glycoprotein from RV is a main contributor to protective immunity and capable of eliciting the production of virus-neutralizing antibodies. In this study, we recovered an attenuated strain of canine distemper virus and constructed a recombinant virus, rCDV-RV-G, expressing a modified (R333Q) rabies virus glycoprotein (RV-G) of RV Flury strain LEP. RV-G expression by the recombinant viruses was confirmed. Furthermore, G was proved to be incorporated into the surface of CDV particles. While replication of the recombinant virus was slightly reduced compared with the parental CDV, it stably expressed the RV-G over ten serial passages. Inoculation of mice induced specific neutralizing antibodies against both RV-G and CDV. Therefore, the rCDV-RV-G has the potential as a vaccine that may be used to control rabies virus infection in dogs and other animals.
Dai, Haibin; Yu, Zhanyang; Fan, Xiang; Liu, Ning; Yan, Min; Chen, Zhong; Lo, Eng H; Hajjar, Katherine A; Wang, Xiaoying
2013-06-01
Hyperglycaemia impairs fibrinolytic activity on the surface of endothelial cells, but the underlying mechanisms are not fully understood. In this study, we tested the hypothesis that hyperglycaemia causes dysfunction of the endothelial membrane protein annexin A2, thereby leading to an overall reduction of fibrinolytic activity. Hyperglycaemia for 7 days significantly reduced cell surface fibrinolytic activity in human brain microvascular endothelial cells (HBMEC). Hyperglycaemia also decreased tissue type plasminogen activator (t-PA), plasminogen, and annexin A2 mRNA and protein expression, while increasing plasminogen activator inhibitor-1 (PAI-1). No changes in p11 mRNA or protein expression were detected. Hyperglycaemia significantly increased AGE-modified forms of total cellular and membrane annexin A2. The hyperglycemia-associated reduction in fibrinolytic activity was fully restored upon incubation with recombinant annexin A2 (rA2), but not AGE-modified annexin A2 or exogenous t-PA. Hyperglycaemia decreased t-PA, upregulated PAI-1 and induced AGE-related disruption of annexin A2 function, all of which contributed to the overall reduction in endothelial cell surface fibrinolytic activity. Further investigations to elucidate the underlying molecular mechanisms and pathophysiological implications of A2 derivatisation might ultimately lead to a better understanding of mechanisms of impaired vascular fibrinolysis, and to development of new interventional strategies for the thrombotic vascular complications in diabetes.
Dai, Haibin; Yu, Zhanyang; Fan, Xiang; Liu, Ning; Yan, Min; Chen, Zhong; Lo, Eng H.; Hajjar, Katherine A.; Wang, Xiaoying
2014-01-01
Summary Hyperglycaemia impairs fibrinolytic activity on the surface of endothelial cells, but the underlying mechanisms are not fully understood. In this study, we tested the hypothesis that hyperglycaemia causes dysfunction of the endothelial membrane protein annexin A2, thereby leading to an overall reduction of fibrinolytic activity. Hyperglycaemia for 7 days significantly reduced cell surface fibrinolytic activity in human brain microvascular endothelial cells (HBMEC). Hyperglycaemia also decreased tissue type plasminogen activator (t-PA), plasminogen, and annexin A2 mRNA and protein expression, while increasing plasminogen activator inhibitor-1 (PAI-1). No changes in p11 mRNA or protein expression were detected. Hyperglycaemia significantly increased AGE-modified forms of total cellular and membrane annexin A2. The hyperglycemia-associated reduction in fibrinolytic activity was fully restored upon incubation with recombinant annexin A2 (rA2), but not AGE-modified annexin A2 or exogenous t-PA. Hyperglycaemia decreased t-PA, upregulated PAI-1 and induced AGE-related disruption of annexin A2 function, all of which contributed to the overall reduction in endothelial cell surface fibrinolytic activity. Further investigations to elucidate the underlying molecular mechanisms and pathophysiological implications of A2 derivatisation might ultimately lead to a better understanding of mechanisms of impaired vascular fibrinolysis, and to development of new interventional strategies for the thrombotic vascular complications in diabetes. PMID:23572070
Sweat, J M; Johnson, C M; Marikar, Y; Gibbs, E P
2005-12-15
An in vitro system to determine surface interleukin-2 receptor (IL-2R) expression on mitogen-stimulated peripheral blood mononuclear cells (PBMC) from free-ranging manatees, Trichechus manatus latirostris was developed. Human recombinant IL-2, conjugated with a fluorescein dye was used in conjunction with flow cytometric analysis to determine changes in surface expression of IL-2R at sequential times over a 48-h period of in vitro stimulation. Surface expression of IL-2R was detected on manatee PBMC, which also cross-reacted with an anti-feline pan T-cell marker. An expression index (EI) was calculated by comparing mitogen-activated and non-activated PBMC. Based on side- and forward-scatter properties, flow cytometric analysis showed an increase in the number of larger, more granular "lymphoblasts" following concanavalin A (Con A) stimulation. The appearance of lymphoblasts was correlated with an increase in their surface expression of IL-2 receptors. Surface IL-2R expression, in Con A-stimulated PBMC, was detected at 16 h, peaked at 24-36 h, and began to decrease by 48 h. Characterization of the IL-2R expression should provide additional information on the health status of manatees, and the effect of their sub lethal exposure to brevetoxin.
Lee, Wook-Bin; Kang, Ji-Seon; Yan, Ji-Jing; Lee, Myeong Sup; Jeon, Bo-Young; Cho, Sang-Nae; Kim, Young-Joon
2012-01-01
Trehalose 6,6′-dimycolate (TDM), a cord factor of Mycobacterium tuberculosis (Mtb), is an important regulator of immune responses during Mtb infections. Macrophages recognize TDM through the Mincle receptor and initiate TDM-induced inflammatory responses, leading to lung granuloma formation. Although various immune cells are recruited to lung granulomas, the roles of other immune cells, especially during the initial process of TDM-induced inflammation, are not clear. In this study, Mincle signaling on neutrophils played an important role in TDM-induced lung inflammation by promoting adhesion and innate immune responses. Neutrophils were recruited during the early stage of lung inflammation following TDM-induced granuloma formation. Mincle expression on neutrophils was required for infiltration of TDM-challenged sites in a granuloma model induced by TDM-coated-beads. TDM-induced Mincle signaling on neutrophils increased cell adherence by enhancing F-actin polymerization and CD11b/CD18 surface expression. The TDM-induced effects were dependent on Src, Syk, and MAPK/ERK kinases (MEK). Moreover, coactivation of the Mincle and TLR2 pathways by TDM and Pam3CSK4 treatment synergistically induced CD11b/CD18 surface expression, reactive oxygen species, and TNFα production by neutrophils. These synergistically-enhanced immune responses correlated with the degree of Mincle expression on neutrophil surfaces. The physiological relevance of the Mincle-mediated anti-TDM immune response was confirmed by defective immune responses in Mincle−/− mice upon aerosol infections with Mtb. Mincle-mutant mice had higher inflammation levels and mycobacterial loads than WT mice. Neutrophil depletion with anti-Ly6G antibody caused a reduction in IL-6 and monocyte chemotactic protein-1 expression upon TDM treatment, and reduced levels of immune cell recruitment during the initial stage of infection. These findings suggest a new role of Mincle signaling on neutrophils during anti-mycobacterial responses. PMID:22496642
Intasai, Nutjeera; Tragoolpua, Khajornsak; Pingmuang, Prakitnavin; Khunkaewla, Panida; Moonsom, Seangdeun; Kasinrerk, Watchara; Lieber, André; Tayapiwatana, Chatchai
2008-01-01
CD147, a multifunctional type I transmembrane glycoprotein, has been implicated in various physiological and pathological processes. It is involved in signal transduction pathways and also plays a crucial role in the invasive and metastatic activity of malignant tumor cells. Diminished expression of this molecule has been shown to be beneficial in suppression of tumor progression. In a previous study, we generated and characterized a recombinant antibody fragment, scFv, which reacted specifically to CD147. In the present study, we further investigated the biological properties, function and the effect of generated scFv on CD147 expression. The in vitro study showed that soluble scFv-M6-1B9 produced from E. coli HB2151 bound to CD147 surface molecule and inhibited OKT3-induced T cell proliferation. Furthermore, soluble lysate of scFv-M6-1B9 from 293A cells, transduced with a scFv-M6-1B9 expressing adenovirus vector, recognized both recombinant and native CD147. These results indicate that scFv-M6-1B9 binds with high efficiency and specificity. Importantly, scFv-M6-1B9 intrabody reduced the expression of CD147 on the cell surface of HeLa cells suggesting that scFv-M6-1B9 is biologically active. In conclusion, our present study demonstrated that scFv-M6-1B9 has a great potential to target both the intracellular and the extracellular CD147. The generated scFv-M6-1B9 may be an effective agent to clarify the cellular function of CD147 and may aid in efforts to develop a novel treatment in various human carcinomas.
Dendritic Cell-Based Genetic Immunotherapy for Ovarian Cancer
2007-12-01
CAR. CD40 is a surface marker expressed by DCs that plays a crucial role in their maturation and subsequent stimulation of T cells. DC infection with... surface . CD40 is a cell surface marker expressed by DCs, is crucial for their maturation and the subsequent activation of the immune system by the DCs...cell surface . CD40 is a cell surface marker expressed by DCs, is crucial for their maturation and the subsequent activation of the immune system by the
The Influence of Roughness on Gear Surface Fatigue
NASA Technical Reports Server (NTRS)
Krantz, Timothy
2005-01-01
Gear working surfaces are subjected to repeated rolling and sliding contacts, and often designs require loads sufficient to cause eventual fatigue of the surface. This research provides experimental data and analytical tools to further the understanding of the causal relationship of gear surface roughness to surface fatigue. The research included evaluations and developments of statistical tools for gear fatigue data, experimental evaluation of the surface fatigue lives of superfinished gears with a near-mirror quality, and evaluations of the experiments by analytical methods and surface inspections. Alternative statistical methods were evaluated using Monte Carlo studies leading to a final recommendation to describe gear fatigue data using a Weibull distribution, maximum likelihood estimates of shape and scale parameters, and a presumed zero-valued location parameter. A new method was developed for comparing two datasets by extending the current methods of likelihood-ratio based statistics. The surface fatigue lives of superfinished gears were evaluated by carefully controlled experiments, and it is shown conclusively that superfinishing of gears can provide for significantly greater lives relative to ground gears. The measured life improvement was approximately a factor of five. To assist with application of this finding to products, the experimental condition was evaluated. The fatigue life results were expressed in terms of specific film thickness and shown to be consistent with bearing data. Elastohydrodynamic and stress analyses were completed to relate the stress condition to fatigue. Smooth-surface models do not adequately explain the improved fatigue lives. Based on analyses using a rough surface model, it is concluded that the improved fatigue lives of superfinished gears is due to a reduced rate of near-surface micropitting fatigue processes, not due to any reduced rate of spalling (sub-surface) fatigue processes. To complete the evaluations, surface inspection were completed. The surface topographies of the ground gears changed substantially due to running, but the topographies of the superfinished gears were essentially unchanged with running.
Chen, Ya-Bin; Xiao, Wei; Li, Ming; Zhang, Yan; Yang, Yang; Hu, Jian-Sheng; Luo, Kai-Jun
2016-05-01
The hemichannel and gap junction channel are major portals for the release of factors responsible for the effects of apoptotic cells on the spread of apoptosis to neighboring cells and apoptotic corpse clearance, typically by phagocytes. The N-terminal cytoplasmic domain in the connexins, gap junction proteins in vertebrate, has been implicated in regulating channel closure. However, little is known about how the hemichannel close responds to apoptotic signaling transduction leading to the reduction of neighboring cellular apoptosis in an invertebrate. An insect Bac-to-Bac expression system, pFastBac(TM) HT A, allows us to construct an N-terminally elongated SpliInx2 (Nte-Inx2) and SpliInx3 (Nte-Inx3). Here, we demonstrated that recombinant baculovirus Bac-Nte-Inx2 (reBac-Net-Inx2) and Bac-Nte-Inx3 (reBac-Nte-Inx3) closed the endogenous hemichannel on the Sf9 cell surface. Importantly, primary baculovirus infections significantly caused early apoptosis, and this apoptosis was reduced by hemichannel-closed Sf9 cells at 24-h post-infection (PI). Although N-terminal-elongated residue led to the increase in the phosphorylated sites in both Nte-Inx2 and Nte-Inx3 and an additional transmembrane domain in Nte-Inx3, both the proteins localized on the cell surface, suggesting Nte-Inxs proteins could mediate hemichannel closure. Further supporting evidence showed that hemichannel closure was dependent on N-Inxs expressed by baculovirus polyhedrin promoter, which began to express at 18-24 h PI. These results identify an unconventional function of N-terminal-elongated innexins that could act as a plug to manipulate hemichannel closure and provide a mechanism connecting the effect of hemichannel closure directly to apoptotic signaling transduction from intracellular to extracellular compartment. © 2016 Wiley Periodicals, Inc.
CXCL4 downregulates the atheroprotective hemoglobin receptor CD163 in human macrophages.
Gleissner, Christian A; Shaked, Iftach; Erbel, Christian; Böckler, Dittmar; Katus, Hugo A; Ley, Klaus
2010-01-08
CXCL4 is a platelet-derived chemokine that promotes macrophage differentiation from monocytes. Deletion of the PF4 gene that encodes CXCL4 reduces atherosclerotic lesions in ApoE(-/-) mice. We sought to study effects of CXCL4 on macrophage differentiation with possible relevance for atherogenesis. Flow cytometry for expression of surface markers in macrophage colony-stimulating factor (M-CSF)- and CXCL4-induced macrophages demonstrated virtually complete absence of the hemoglobin scavenger receptor CD163 in CXCL4-induced macrophages. mRNA for CD163 was downregulated as early as 2 hours after CXCL4. CD163 protein reached a minimum after 3 days, which was not reversed by treatment of cells with M-CSF. The CXCL4 effect was entirely neutralized by heparin, which bound CXCL4 and prevented CXCL4 surface binding to monocytes. Pretreatment of cells with chlorate, which inhibits glycosaminoglycan synthesis, strongly inhibited CXCL4-dependent downregulation of CD163. Similar to recombinant CXCL4, releasate from human platelets also reduced CD163 expression. CXCL4-differentiated macrophages were unable to upregulate the atheroprotective enzyme heme oxygenase-1 at the RNA and protein level in response to hemoglobin-haptoglobin complexes. Immunofluorescence of human atherosclerotic plaques demonstrated presence of both CD68+CD163+ and CD68+CD163- macrophages. PF4 and CD163 gene expression within human atherosclerotic lesions were inversely correlated, supporting the in vivo relevance of CXCL4-induced downregulation of CD163. CXCL4 may promote atherogenesis by suppressing CD163 in macrophages, which are then unable to upregulate the atheroprotective enzyme heme oxygenase-1 in response to hemoglobin.
CXCL4 Downregulates the Atheroprotective Hemoglobin Receptor CD163 in Human Macrophages
Gleissner, Christian A.; Shaked, Iftach; Erbel, Christian; Böckler, Dittmar; Katus, Hugo A.; Ley, Klaus
2010-01-01
Rationale CXCL4 is a platelet-derived chemokine that promotes macrophage differentiation from monocytes. Deletion of the PF4 gene that encodes CXCL4 reduces atherosclerotic lesions in ApoE−/− mice. Objective We sought to study effects of CXCL4 on macrophage differentiation with possible relevance for atherogenesis. Methods and Results Flow cytometry for expression of surface markers in macrophage colony–stimulating factor (M-CSF)– and CXCL4-induced macrophages demonstrated virtually complete absence of the hemoglobin scavenger receptor CD163 in CXCL4-induced macrophages. mRNA for CD163 was downregulated as early as 2 hours after CXCL4. CD163 protein reached a minimum after 3 days, which was not reversed by treatment of cells with M-CSF. The CXCL4 effect was entirely neutralized by heparin, which bound CXCL4 and prevented CXCL4 surface binding to monocytes. Pretreatment of cells with chlorate, which inhibits glycosaminoglycan synthesis, strongly inhibited CXCL4-dependent downregulation of CD163. Similar to recombinant CXCL4, releasate from human platelets also reduced CD163 expression. CXCL4-differentiated macrophages were unable to upregulate the atheroprotective enzyme heme oxygenase-1 at the RNA and protein level in response to hemoglobin–haptoglobin complexes. Immunofluorescence of human atherosclerotic plaques demonstrated presence of both CD68+CD163+ and CD68+CD163− macrophages. PF4 and CD163 gene expression within human atherosclerotic lesions were inversely correlated, supporting the in vivo relevance of CXCL4-induced downregulation of CD163. Conclusions CXCL4 may promote atherogenesis by suppressing CD163 in macrophages, which are then unable to upregulate the atheroprotective enzyme heme oxygenase-1 in response to hemoglobin. PMID:19910578
Xu, Fan; Zhen, Peng; Zheng, Yu; LIjuan, Feng; Aiting, Yang; Min, Cong; Hong, You; Jidong, Jia
2013-04-01
The aim of this study was to optimise a collagenase perfusion protocol for the isolation of a liver non-parenchymal cell (NPC) suspension enriched for Kupffer cells that reduced damage to F4/80 antigen cell surface expression to allow analysis by flow cytometry. Kupffer cell-enriched liver NPCs were isolated from C57BL/6 mice using different protocols. Flow cytometry was used to examine the effect of collagenase digestion on F4/80 expression on Kupffer cells, and results were represented by the percentage of F4/80 positive cells and by the F4/80 mean fluorescence intensity (MFI). The perfusion temperature, concentration of collagenase solution and total dosage of collagenase for liver perfusion influenced the effect of collagenase perfusion on the expression of F4/80 antigen on Kupffer cells. Collagenase perfusion at 28°C resulted in an increased percentage of F4/80 positive cells (P = 0.001) and MFI (P = 0.005) compared with 37°C. Perfusion with a total dose of 1.0 g/kg BW collagenase (using a 0.75 mg/mL solution) resulted in the highest percentage of F4/80 positive cells (P = 0.001) compared with 0.8 g/kg BW and 1.2 g/kg BW collagenase. Isolation of cells using the modified protocol resulted in a higher percentage of Kupffer cells (P < 0.001) and a higher MFI of F4/80 antigen (P < 0.001) compared with the common protocol. © 2013 International Federation for Cell Biology.
NASA Astrophysics Data System (ADS)
Elango, Narayanasamy; Prince, Gregory A.; Murphy, Brian R.; Venkatesan, Sundararajan; Chanock, Robert M.; Moss, Bernard
1986-03-01
A cDNA copy of the G glycoprotein gene of human respiratory syncytial virus (RSV) was placed under control of a vaccinia virus promoter and inserted into the thymidine kinase locus of the vaccinia virus genome. The recombinant vaccinia virus retained infectivity and expressed a 93-kDa protein that migrated with the authentic RSV G glycoprotein upon polyacrylamide gel electrophoresis. Glycosylation of the expressed protein and transport to the cell surface were demonstrated in the absence of other RSV proteins. Cotton rats that were inoculated intradermally with the infectious recombinant virus produced serum antibody to the G glycoprotein that neutralized RSV in vitro. Furthermore, the vaccinated animals were resistant to lower respiratory tract infection upon intranasal inoculation with RSV and had reduced titers of RSV in the nose.
Sun, Hengchang; Lin, Zhipeng; Zhao, Lu; Chen, Tingjin; Shang, Mei; Jiang, Hongye; Tang, Zeli; Zhou, Xinyi; Shi, Mengchen; Zhou, Lina; Ren, Pengli; Qu, Honglin; Lin, Jinsi; Li, Xuerong; Xu, Jin; Huang, Yan; Yu, Xinbing
2018-03-07
Clonorchiasis caused by Clonorchis sinensis has become increasingly prevalent in recent years. Effective prevention strategies are urgently needed to control this food-borne infectious disease. Previous studies indicated that paramyosin of C. sinensis (CsPmy) is a potential vaccine candidate. We constructed a recombinant plasmid of PEB03-CotC-CsPmy, transformed it into Bacillus subtilis WB600 strain (B.s-CotC-CsPmy), and confirmed CsPmy expression on the spore surface by SDS-PAGE, Western blotting and immunofluorescence assay. The immune response and protective efficacy of the recombinant spore were investigated in BALB/c mice after intragastrical or intraperitoneal immunization. Additionally, biochemical enzyme activities in sera, the intestinal histopathology and gut microflora of spore-treated mice were investigated. CsPmy was successfully expressed on the spore surface and the fusion protein on the spore surface with thermostability. Specific IgG in sera and intestinal mucus were increased after intraperitoneal and intragastrical immunization. The sIgA level in intestinal mucus, feces and bile of B.s-CotC-CsPmy orally treated mice were also significantly raised. Furthermore, numerous IgA-secreting cells were detected in intestinal mucosa of intragastrically immunized mice. No inflammatory injury was observed in the intestinal tissues and there was no significant difference in levels of enzyme-indicated liver function among the groups. Additionally, the diversity and abundance of gut microbiota were not changed after oral immunization. Intragastric and intraperitoneal immunization of B.s-CotC-CsPmy spores in mice resulted in egg reduction rates of 48.3 and 51.2% after challenge infection, respectively. Liver fibrosis degree in B.s-CotC-CsPmy spores treated groups was also significantly reduced. CsPmy expressed on the spore surface maintained its immunogenicity. Both intragastrical and intraperitoneal immunization with B.s-CotC-CsPmy spores induced systemic and local mucosal immune response in mice. Although both intragastric and intraperitoneal immunization elicited a similar protective effect, intragastric immunization induced stronger mucosal immune response without side effects to the liver, intestine and gut microbiota, compared with intraperitoneal immunization. Oral immunization with B. subtilis spore expressing CsPmy on the surface was a promising, safe and needle-free vaccination strategy against clonorchiasis.
Cellular and molecular mechanisms of autosomal dominant form of progressive hearing loss, DFNA2.
Kim, Hyo Jeong; Lv, Ping; Sihn, Choong-Ryoul; Yamoah, Ebenezer N
2011-01-14
Despite advances in identifying deafness genes, determination of the underlying cellular and functional mechanisms for auditory diseases remains a challenge. Mutations of the human K(+) channel hKv7.4 lead to post-lingual progressive hearing loss (DFNA2), which affects world-wide population with diverse racial backgrounds. Here, we have generated the spectrum of point mutations in the hKv7.4 that have been identified as diseased mutants. We report that expression of five point mutations in the pore region, namely L274H, W276S, L281S, G285C, and G296S, as well as the C-terminal mutant G321S in the heterologous expression system, yielded non-functional channels because of endoplasmic reticulum retention of the mutant channels. We mimicked the dominant diseased conditions by co-expressing the wild-type and mutant channels. As compared with expression of wild-type channel alone, the blend of wild-type and mutant channel subunits resulted in reduced currents. Moreover, the combinatorial ratios of wild type:mutant and the ensuing current magnitude could not be explained by the predictions of a tetrameric channel and a dominant negative effect of the mutant subunits. The results can be explained by the dependence of cell surface expression of the mutant on the wild-type subunit. Surprisingly, a transmembrane mutation F182L, which has been identified in a pre-lingual progressive hearing loss patient in Taiwan, yielded cell surface expression and functional features that were similar to that of the wild type, suggesting that this mutation may represent redundant polymorphism. Collectively, these findings provide traces of the cellular mechanisms for DFNA2.
Strekalova, Elena; Malin, Dmitry; Good, David M.; Cryns, Vincent L.
2015-01-01
Purpose Many neoplasms are vulnerable to methionine deficiency by mechanisms that are poorly understood. Because gene profiling studies have revealed that methionine depletion increases TNF-related apoptosis-inducing ligand receptor-2 (TRAIL-R2) mRNA, we postulated that methionine stress sensitizes breast cancer cells to proapoptotic TRAIL-R2 agonists. Experimental Design Human triple (ER/PR/HER2)-negative breast carcinoma cell lines were cultured in control or methionine-free media. The effects of methionine depletion on TRAIL receptor expression and sensitivity to chemotherapy or a humanized agonistic TRAIL-R2 monoclonal antibody (lexatumumab) were determined. The melanoma-associated antigen MAGED2 was silenced to delineate its functional role in sensitizing TNBC cells to methionine stress. An orthotopic TNBC model was utilized to evaluate the effects of dietary methionine deficiency, lexatumumab or the combination. Results Methionine depletion sensitized TNBC cells to lexatumumab-induced caspase activation and apoptosis by increasing TRAIL-R2 mRNA and cell surface expression. MCF-10A cells transformed by oncogenic H-Ras, but not untransformed cells, and matrix-detached TNBC cells were highly sensitive to the combination of lexatumumab and methionine depletion. Proteomics analyses revealed that MAGED2, which has been reported to reduce TRAIL-R2 expression, was suppressed by methionine stress. Silencing MAGED2 recapitulated features of methionine deprivation, including enhanced mRNA and cell surface expression of TRAIL receptors and increased sensitivity to TRAIL receptor agonists. Dietary methionine deprivation enhanced the antitumor effects of lexatumumab in an orthotopic metastatic TNBC model. Conclusion Methionine depletion exposes a targetable defect in TNBC cells by increasing TRAIL-R2 expression. Our findings provide the foundation for a clinical trial combining dietary methionine restriction and TRAIL-R2 agonists. PMID:25724522
Poe, Jonathan C; Minard-Colin, Veronique; Kountikov, Evgueni I; Haas, Karen M; Tedder, Thomas F
2012-09-01
Malignant B cells responding to external stimuli are likely to gain a growth advantage in vivo. These cells may therefore maintain surface CD19 expression to amplify transmembrane signals and promote their expansion and survival. To determine whether CD19 expression influences this process, Eμ-Myc transgenic (c-Myc(Tg)) mice that develop aggressive and lethal B cell lymphomas were made CD19 deficient (c-Myc(Tg)CD19⁻/⁻). Compared with c-Myc(Tg) and c-Myc(Tg)CD19⁺/⁻ littermates, the median life span of c-Myc(Tg)CD19⁻/⁻ mice was prolonged by 81-83% (p < 0.0001). c-Myc(Tg)CD19⁻/⁻ mice also lived 42% longer than c-Myc(Tg) littermates following lymphoma detection (p < 0.01). Tumor cells in c-Myc(Tg) and c-Myc(Tg)CD19⁻/⁻ mice were B lineage derived, had a similar phenotype with a large blastlike appearance, invaded multiple lymphoid tissues, and were lethal when adoptively transferred into normal recipient mice. Importantly, reduced lymphomagenesis in c-Myc(Tg)CD19⁻/⁻ mice was not due to reductions in early B cell numbers prior to disease onset. In mechanistic studies, constitutive c-Myc expression enhanced CD19 expression and phosphorylation on active sites. Reciprocally, CD19 expression in c-Myc(Tg) B cells enhanced c-Myc phosphorylation at regulatory sites, sustained higher c-Myc protein levels, and maintained a balance of cyclin D2 expression over that of cyclin D3. These findings define a new and novel c-Myc:CD19 regulatory loop that positively influences B cell transformation and lymphoma progression.
Frazao, Alexandra; Colombo, Marina; Fourmentraux-Neves, Emmanuelle; Messaoudene, Meriem; Rusakiewicz, Sylvie; Zitvogel, Laurence; Vivier, Eric; Vély, Frédéric; Faure, Florence; Dréno, Brigitte; Benlalam, Houssem; Bouquet, Fanny; Savina, Ariel; Pasmant, Eric; Toubert, Antoine; Avril, Marie-Françoise; Caignard, Anne
2017-07-01
Over 60% of human melanoma tumors bear a mutation in the BRAF gene. The most frequent mutation is a substitution at codon 600 (V600E), leading to a constitutively active BRAF and overactivation of the MAPK pathway. Patients harboring mutated BRAF respond to kinase inhibitors such as vemurafenib. However, these responses are transient, and relapses are frequent. Melanoma cells are efficiently lysed by activated natural killer (NK) cells. Melanoma cells express several stress-induced ligands that are recognized by activating NK-cell receptors. We have investigated the effect of vemurafenib on the immunogenicity of seven BRAF -mutated melanoma cells to NK cells and on their growth and sensitivity to NK-cell-mediated lysis. We showed that vemurafenib treatment modulated expression of ligands for two activating NK receptors, increasing expression of B7-H6, a ligand for NKp30, and decreasing expression of MICA and ULBP2, ligands for NKG2D. Vemurafenib also increased expression of HLA class I and HLA-E molecules, likely leading to higher engagement of inhibitory receptors (KIRs and NKG2A, respectively), and decreased lysis of vemurafenib-treated melanoma cell lines by cytokine-activated NK cells. Finally, we showed that whereas batimastat (a broad-spectrum matrix metalloprotease inhibitor) increased cell surface ULBP2 by reducing its shedding, vemurafenib lowered soluble ULBP2, indicating that BRAF signal inhibition diminished expression of both cell-surface and soluble forms of NKG2D ligands. Vemurafenib, inhibiting BRAF signaling, shifted the balance of activatory and inhibitory NK ligands on melanoma cells and displayed immunoregulatory effects on NK-cell functional activities. Cancer Immunol Res; 5(7); 582-93. ©2017 AACR . ©2017 American Association for Cancer Research.
Nelson, Katja; Helmstaedter, Victor; Moreau, Cynthia; Lage, Hermann
2008-01-01
Adhesion molecules such as integrins and extracellular matrix proteins like laminins have been identified to play an important role in cell proliferation, migration and invasion by regulating cell-extracellular matrix interaction in various cancers including oral squamous cell carcinoma (OSCC). In this study, the effect of estradiol (E2), and the E2 antagonists tamoxifen (TAM) and ICI 182,780 (ICI) on the expression of integrins and adhesion to laminin-1 in different OSCC in vitro models was analyzed. TAM and ICI inhibited growth in all OSCC cell lines. Dependent on estrogen receptor (ER) status E2 displayed a significant influence on growth after long-term administration. ICI reduced laminin-1 adhesion in all cell lines. beta1 Integrin transcription is reduced with TAM and E2 and alpha3 cell surface expression with TAM. This study shows that OSCC is estrogen and SERM sensitive and that these compounds can modulate cell-matrix interaction in part by modulating integrin expression and translation. The investigation also confirms that growth is significantly influenced by these adjuvant therapeutics. These data suggest that a greater understanding of basic biology and mechanisms of the ER and its ligands in oral squamous cells is needed to elucidate the use of specific pharmacological agents as therapeutics of anti-tumorigenic pathways.
Svensson, Sara; Forsberg, Magnus; Hulander, Mats; Vazirisani, Forugh; Palmquist, Anders; Lausmaa, Jukka; Thomsen, Peter; Trobos, Margarita
2014-01-01
The role of material surface properties in the direct interaction with bacteria and the indirect route via host defense cells is not fully understood. Recently, it was suggested that nanostructured implant surfaces possess antimicrobial properties. In the current study, the adhesion and biofilm formation of Staphylococcus epidermidis and human monocyte adhesion and activation were studied separately and in coculture in different in vitro models using smooth gold and well-defined nanostructured gold surfaces. Two polystyrene surfaces were used as controls in the monocyte experiments. Fluorescent viability staining demonstrated a reduction in the viability of S. epidermidis close to the nanostructured gold surface, whereas the smooth gold correlated with more live biofilm. The results were supported by scanning electron microscopy observations, showing higher biofilm tower formations and more mature biofilms on smooth gold compared with nanostructured gold. Unstimulated monocytes on the different substrates demonstrated low activation, reduced gene expression of pro- and anti-inflammatory cytokines, and low cytokine secretion. In contrast, stimulation with opsonized zymosan or opsonized live S. epidermidis for 1 hour significantly increased the production of reactive oxygen species, the gene expression of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), IL-6, and IL-10, as well as the secretion of TNF-α, demonstrating the ability of the cells to elicit a response and actively phagocytose prey. In addition, cells cultured on the smooth gold and the nanostructured gold displayed a different adhesion pattern and a more rapid oxidative burst than those cultured on polystyrene upon stimulation. We conclude that S. epidermidis decreased its viability initially when adhering to nanostructured surfaces compared with smooth gold surfaces, especially in the bacterial cell layers closest to the surface. In contrast, material surface properties neither strongly promoted nor attenuated the activity of monocytes when exposed to zymosan particles or S. epidermidis. PMID:24550671
Ultraviolet light treatment for the restoration of age-related degradation of titanium bioactivity.
Hori, Norio; Ueno, Takeshi; Suzuki, Takeo; Yamada, Masahiro; Att, Wael; Okada, Shunsaku; Ohno, Akinori; Aita, Hideki; Kimoto, Katsuhiko; Ogawa, Takahiro
2010-01-01
To examine the bioactivity of differently aged titanium (Ti) disks and to determine whether ultraviolet (UV) light treatment reverses the possible adverse effects of Ti aging. Ti disks with three different surface topographies were prepared: machined, acid-etched, and sandblasted. The disks were divided into three groups: disks tested for biologic capacity immediately after processing (fresh surfaces), disks stored under dark ambient conditions for 4 weeks, and disks stored for 4 weeks and treated with UV light. The protein adsorption capacity of Ti was examined using albumin and fibronectin. Cell attraction to Ti was evaluated by examining migration, attachment, and spreading behaviors of human osteoblasts on Ti disks. Osteoblast differentiation was evaluated by examining alkaline phosphatase activity, the expression of bone-related genes, and mineralized nodule area in the culture. Four-week-old Ti disks showed = or < 50% protein adsorption after 6 hours of incubation compared with fresh disks, regardless of surface topography. Total protein adsorption for 4-week-old surfaces did not reach the level of fresh surfaces, even after 24 hours of incubation. Fifty percent fewer human osteoblasts migrated and attached to 4-week-old surfaces compared with fresh surfaces. Alkaline phosphatase activity, gene expression, and mineralized nodule area were substantially reduced on the 4-week-old surfaces. The reduction of these biologic parameters was associated with the conversion of Ti disks from superhydrophilicity to hydrophobicity during storage for 4 weeks. UV-treated 4-week-old disks showed even higher protein adsorption, osteoblast migration, attachment, differentiation, and mineralization than fresh surfaces, and were associated with regenerated superhydrophilicity. Time-related degradation of Ti bioactivity is substantial and impairs the recruitment and function of human osteoblasts as compared to freshly prepared Ti surfaces, suggesting a "biologic aging"-like change of Ti. UV treatment of aged Ti, however, restores and even enhances bioactivity, exceeding its innate levels.
Greiff, Kirsti; Mathiassen, John Reidar; Misimi, Ekrem; Hersleth, Margrethe; Aursand, Ida G.
2015-01-01
The European diet today generally contains too much sodium (Na+). A partial substitution of NaCl by KCl has shown to be a promising method for reducing sodium content. The aim of this work was to investigate the sensorial changes of cooked ham with reduced sodium content. Traditional sensorial evaluation and objective multimodal machine vision were used. The salt content in the hams was decreased from 3.4% to 1.4%, and 25% of the Na+ was replaced by K+. The salt reduction had highest influence on the sensory attributes salty taste, after taste, tenderness, hardness and color hue. The multimodal machine vision system showed changes in lightness, as a function of reduced salt content. Compared to the reference ham (3.4% salt), a replacement of Na+-ions by K+-ions of 25% gave no significant changes in WHC, moisture, pH, expressed moisture, the sensory profile attributes or the surface lightness and shininess. A further reduction of salt down to 1.7–1.4% salt, led to a decrease in WHC and an increase in expressible moisture. PMID:26422367
Greiff, Kirsti; Mathiassen, John Reidar; Misimi, Ekrem; Hersleth, Margrethe; Aursand, Ida G
2015-01-01
The European diet today generally contains too much sodium (Na(+)). A partial substitution of NaCl by KCl has shown to be a promising method for reducing sodium content. The aim of this work was to investigate the sensorial changes of cooked ham with reduced sodium content. Traditional sensorial evaluation and objective multimodal machine vision were used. The salt content in the hams was decreased from 3.4% to 1.4%, and 25% of the Na(+) was replaced by K(+). The salt reduction had highest influence on the sensory attributes salty taste, after taste, tenderness, hardness and color hue. The multimodal machine vision system showed changes in lightness, as a function of reduced salt content. Compared to the reference ham (3.4% salt), a replacement of Na(+)-ions by K(+)-ions of 25% gave no significant changes in WHC, moisture, pH, expressed moisture, the sensory profile attributes or the surface lightness and shininess. A further reduction of salt down to 1.7-1.4% salt, led to a decrease in WHC and an increase in expressible moisture.
CD40 expression in Wehi-164 cell line
Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Moazzeni, Seyed Mohammad
2010-01-01
CD40-CD154 interaction is an important process for cellular and humoral immunity regulation and can be effective in the body’s defense against tumors. In the present study, we evaluated the expression of CD40 in Wehi-164 cell line. CD40 expressions on the cell surface and in the cytoplasm were assessed by flow cytometry and intracellular staining assay, respectively. Also, the mRNA expression was identified by real time-PCR. The obtained results showed the high mRNA and cytoplasmic protein expression of CD40 but no surface expression. These results suggest that the Wehi-164 cell line down regulates expression of CD40 on the surface for evasion of immune system. PMID:20496113
CD40 expression in Wehi-164 cell line.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Moazzeni, Seyed Mohammad
2010-07-01
CD40-CD154 interaction is an important process for cellular and humoral immunity regulation and can be effective in the body's defense against tumors. In the present study, we evaluated the expression of CD40 in Wehi-164 cell line. CD40 expressions on the cell surface and in the cytoplasm were assessed by flow cytometry and intracellular staining assay, respectively. Also, the mRNA expression was identified by real time-PCR. The obtained results showed the high mRNA and cytoplasmic protein expression of CD40 but no surface expression. These results suggest that the Wehi-164 cell line down regulates expression of CD40 on the surface for evasion of immune system.
Ohguchi, Takeshi; Kojima, Takashi; Ibrahim, Osama M; Nagata, Taeko; Shimizu, Takahiko; Shirasawa, Takuji; Kawakita, Tetsuya; Satake, Yoshiyuki; Tsubota, Kazuo; Shimazaki, Jun; Ishida, Susumu
2013-11-21
To investigate the efficacy of 2% rebamipide ophthalmic solution on the tear functions and ocular surface status of the superoxide dismutase-1(Sod1(-/-)) mice. Two percent Rebamipide ophthalmic solution was applied to 40-week-old male Sod1(-/-) and wild-type (WT) mice four times a day for 2 weeks. We examined the cytokine concentrations in the tear fluid (by CytoBead assay), tear film break-up time, amount of tear production, and expressions of mucins 1, 4, and 5AC, by RT-PCR. We also performed vital staining of the ocular surface, PAS staining for muc5AC, and immunohistochemical stainings for 4-hydroxy-2-nonenal (4-HNE), 8-hydroxy-2'-deoxyguanosine (8-OHdG), in the conjunctiva to compare the results before and after rebamipide instillations. The tear functions and ocular surface epithelial damage scores were significantly worse in the Sod1(-/-) than in the WT mice. Application of 2% rebamipide for 2 weeks significantly improved the tear film break-up time, the amount of tear production, and the corneal epithelial damage scores, which also significantly increased the conjunctival goblet cell density and muc5 mRNA expression, in the Sod1(-/-) mice. The mean IL-6, IL-17, TNF-α, and IFN-γ levels in the tear fluid were reduced significantly along with a significant decrease in the density of cells positive for 4-HNE and 8-OHdG in the conjunctiva. Two percent Rebamipide ophthalmic solution significantly improved the tear stability and corneal epithelial damage, and enhanced the expression of muc5 mRNA on the ocular surface. We also observed anti-inflammatory effects in the tear film together with antioxidative effects in the conjunctiva, suggesting the efficacy of rebamipide in age-related dry eye disease attributable to SOD1 knockout.
Urquhart, Bradley L.; Ware, Joseph A.; Tirona, Rommel G.; Ho, Richard H.; Leake, Brenda F.; Schwarz, Ute I.; Zaher, Hani; Palandra, Joe; Gregor, Jamie C.; Dresser, George K.; Kim, Richard B.
2014-01-01
Breast cancer resistance protein (BCRP) is an efflux transporter expressed in tissues that act as barriers to drug entry. Given that single nucleotide polymorphisms (SNPs) in the ABCG2 gene encoding BCRP are common, the possibility exists that these genetic variants may be a determinant of interindividual variability in drug response. The objective of this study is to confirm the human BCRP-mediated transport of sulfasalazine in vitro, evaluate interindividual variation in BCRP expression in human intestine and to determine the role of ABCG2 SNPs to drug disposition in healthy patients using sulfasalazine as a novel in vivo probe. To evaluate these objectives, pinch biopsies were obtained from 18 patients undergoing esophagogastro–duodenoscopy or colonoscopy for determination of BCRP expression in relation to genotype. Wild-type and variant BCRP were expressed in a heterologous expression system to evaluate the effect of SNPs on cell-surface trafficking. A total of 17 healthy individuals participated in a clinical investigation to determine the effect of BCRP SNPs on sulfasalazine pharmacokinetics. In vitro, the cell surface protein expression of the common BCRP 421 C>A variant was reduced in comparison with the wild-type control. Intestinal biopsy samples revealed that BCRP protein and mRNA expression did not significantly differ between patients with 34GG/421CC versus patients with 34GG/421CA genotypes. Remarkably, in subjects with 34GG/421CA genotype, sulfasalazine area under the concentration-time curve was 2.4-fold greater compared with 34GG/421CC subjects (P<0.05). This study links commonly occurring SNPs in BCRP with significantly increased oral sulfasalazine plasma exposure in humans. Accordingly, sulfasalazine may prove to have utility as in vivo probe for assessing the clinical impact of BCRP for the disposition and efficacy of drugs. PMID:18408567
Wu, Chi-Hao; Hong, Bo-Han; Ho, Chi-Tang; Yen, Gow-Chin
2015-03-11
Breast cancer stem cells (BCSCs) constitute a small fraction of the primary tumor that can self-renew and become a drug-resistant cell population, thus limiting the treatment effects of chemotherapeutic drugs. The present study evaluated the cytotoxic effects of five phytochemicals including 6-gingerol (6-G), 6-shogaol (6-S), 5-hydroxy-3,6,7,8,3',4'-hexamethoxyflavone (5-HF), nobiletin (NOL), and pterostilbene (PTE) on MCF-7 breast cancer cells and BCSCs. The results showed that 6-G, 6-S, and PTE selectively killed BCSCs and had high sensitivity for BCSCs isolated from MCF-7 cells that expressed the surface antigen CD44(+)/CD24(-). 6-S and PTE induced cell necrosis phenomena such as membrane injury and bleb formation in BCSCs and inhibited mammosphere formation. In addition, 6-S and PTE increased the sensitivity of isolated BCSCs to chemotherapeutic drugs and significantly increased the anticancer activity of paclitaxel. Analysis of the underlying mechanism showed that 6-S and PTE decreased the expression of the surface antigen CD44 on BCSCs and promoted β-catenin phosphorylation through the inhibition of hedgehog/Akt/GSK3β signaling, thus decreasing the protein expression of downstream c-Myc and cyclin D1 and reducing BCSC stemness.
β-Subunits Promote the Expression of CaV2.2 Channels by Reducing Their Proteasomal Degradation*
Waithe, Dominic; Ferron, Laurent; Page, Karen M.; Chaggar, Kanchan; Dolphin, Annette C.
2011-01-01
The β-subunits of voltage-gated calcium channels regulate their functional expression and properties. Two mechanisms have been proposed for this, an effect on gating and an enhancement of expression. With respect to the effect on expression, β-subunits have been suggested to enhance trafficking by masking an unidentified endoplasmic reticulum (ER) retention signal. Here we have investigated whether, and how, β-subunits affect the level of CaV2.2 channels within somata and neurites of cultured sympathetic neurons. We have used YFP-CaV2.2 containing a mutation (W391A), that prevents binding of β-subunits to its I-II linker and found that expression of this channel was much reduced compared with WT CFP-CaV2.2 when both were expressed in the same neuron. This effect was particularly evident in neurites and growth cones. The difference between the levels of YFP-CaV2.2(W391A) and CFP-CaV2.2(WT) was lost in the absence of co-expressed β-subunits. Furthermore, the relative reduction of expression of CaV2.2(W391A) compared with the WT channel was reversed by exposure to two proteasome inhibitors, MG132 and lactacystin, particularly in the somata. In further experiments in tsA-201 cells, we found that proteasome inhibition did not augment the cell surface CaV2.2(W391A) level but resulted in the observation of increased ubiquitination, particularly of mutant channels. In contrast, we found no evidence for selective retention of CaV2.2(W391A) in the ER, in either the soma or growth cones. In conclusion, there is a marked effect of β-subunits on CaV2.2 expression, particularly in neurites, but our results point to protection from proteasomal degradation rather than masking of an ER retention signal. PMID:21233207
Kaba, Nubia K.; Schultz, Joanne; Law, Foon-Yee; Lefort, Craig T.; Martel-Gallegos, Guadalupe; Kim, Minsoo; Waugh, Richard E.; Arreola, Jorge; Knauf, Philip A.
2008-01-01
Ischemia-reperfusion injury is a common pathological occurrence causing tissue damage in heart attack and stroke. Entrapment of neutrophils in the vasculature during ischemic events has been implicated in this process. In this study, we examine the effects that lactacidosis and consequent reductions in intracellular pH (pHi) have on surface expression of adhesion molecules on neutrophils. When human neutrophils were exposed to pH 6 lactate, there was a marked decrease in surface L-selectin (CD62L) levels, and the decrease was significantly enhanced by inclusion of Na+/H+ exchanger (NHE) inhibitor 5-(N,N-hexamethylene)amiloride (HMA). Similar effects were observed when pHi was reduced while maintaining normal extracellular pH, by using an NH4Cl prepulse followed by washes and incubation in pH 7.4 buffer containing NHE inhibitors [HMA, cariporide, or 5-(N,N-dimethyl)amiloride (DMA)]. The amount of L-selectin shedding induced by different concentrations of NH4Cl in the prepulse correlated with the level of intracellular acidification with an apparent pK of 6.3. In contrast, β2-integrin (CD11b and CD18) was only slightly upregulated in the low-pHi condition and was enhanced by NHE inhibition to a much lesser extent. L-selectin shedding was prevented by treating human neutrophils with inhibitors of extracellular metalloproteases (RO-31-9790 and KD-IX-73-4) or with inhibitors of intracellular signaling via p38 MAP kinase (SB-203580 and SB-239063), implying a transmembrane effect of pHi. Taken together, these data suggest that the ability of NHE inhibitors such as HMA to reduce ischemia-reperfusion injury may be related to the nearly complete removal of L-selectin from the neutrophil surface. PMID:18829897
Effect of anti-biofilm glass-ionomer cement on Streptococcus mutans biofilms.
Wang, Su-Ping; Ge, Yang; Zhou, Xue-Dong; Xu, Hockin Hk; Weir, Michael D; Zhang, Ke-Ke; Wang, Hao-Hao; Hannig, Matthias; Rupf, Stefan; Li, Qian; Cheng, Lei
2016-06-30
Dental restorative materials with antimicrobial properties can inhibit bacterial colonization, which may result in a reduction of caries at tooth-filling interaction zones. This study aimed to develop antibacterial glass-ionomer cements (GIC) containing a quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM), and to investigate their effect on material performance and antibacterial properties. Different mass fractions (0, 1.1% and 2.2%) of DMADDM were incorporated into the GIC. The flexure strength, surface charge density, surface roughness and fluoride release were tested. A Streptococcus mutans biofilm model was used. Exopolysaccharides (EPS) staining was used to analyze the inhibitory effect of DMADDM on the biofilm matrix. In addition, biofilm metabolic activity, lactic acid metabolism and the expression of glucosyltransferase genes gtfB, gtfC and gtfD were measured. GIC containing 1.1% and 2.2% DMADDM had flexural strengths matching those of the commercial control (P>0.1). DMADDM was able to increase the surface charge density but reduced surface roughness (P<0.05). The incorporation of 1.1% and 2.2% DMADDM elevated the release of fluoride by the GIC in the first 2 days (P<0.05). The novel DMADDM-modified GIC significantly reduced biofilm metabolic activity (P<0.05) and decreased lactic acid production (P<0.05). The quantitative polymerase chain reaction (qPCR) results showed that the expression of gtfB, gtfC and gtfD decreased when mass fractions of DMADDM increased (P<0.05). EPS staining showed that both the bacteria and EPS in biofilm decreased in the DMADDM groups. The incorporation of DMADDM could modify the properties of GIC to influence the development of S. mutans biofilms. In this study, we investigated the interface properties of antibacterial materials for the first time. GIC containing DMADDM can improve material performance and antibacterial properties and may contribute to the better management of secondary caries.
The Rho-GEF Kalirin regulates bone mass and the function of osteoblasts and osteoclasts
Huang, Su; Eleniste, Pierre P.; Wayakanon, Kornchanok; Mandela, Prashant; Eipper, Betty A.; Mains, Richard E.; Allen, Matthew R.; Bruzzaniti, Angela
2014-01-01
Bone homeostasis is maintained by the balance between bone resorption by osteoclasts and bone formation by osteoblasts. Dysregulation in the activity of the bone cells can lead to osteoporosis, a disease characterized by low bone mass and an increase in bone fragility and risk of fracture. Kalirin is a novel GTP-exchange factor protein that has been shown to play a role in cytoskeletal remodeling and dendritic spine formation in neurons. We examined Kalirin expression in skeletal tissue and found that it was expressed in osteoclasts and osteoblasts. Furthermore, micro-CT analyses of the distal femur of global Kalirin knockout (Kal-KO) mice revealed significantly reduced trabecular and cortical bone parameters in Kal-KO mice, compared to WT mice, with significantly reduced bone mass in 8, 14 and 36 week-old female Kal-KO mice. Male mice also exhibited a decrease in bone parameters but not to the level seen in female mice. Histomorphometric analyses also revealed decreased bone formation rate in 14 week-old female Kal-KO mice, as well as decreased osteoblast number/bone surface and increased osteoclast surface/bone surface. Consistent with our in vivo findings, the bone resorbing activity and differentiation of Kal-KO osteoclasts was increased in vitro. Although alkaline phosphatase activity by Kal-KO osteoblasts was increased in vitro, Kal-KO osteoblasts showed decreased mineralizing activity, as well as decreased secretion of OPG, which was inversely correlated with ERK activity. Taken together, our findings suggest that deletion of Kalirin directly affects osteoclast and osteoblast activity, leading to decreased OPG secretion by osteoblasts which is likely to alter the RANKL/OPG ratio and promote osteoclastogenesis. Therefore, Kalirin may play a role in paracrine and/or endocrine signaling events that control skeletal bone remodeling and the maintenance of bone mass. PMID:24380811
A study of forced convection boiling under reduced gravity
NASA Technical Reports Server (NTRS)
Merte, Herman, Jr.
1992-01-01
This report presents the results of activities conducted over the period 1/2/85-12/31/90, in which the study of forced convection boiling under reduced gravity was initiated. The study seeks to improve the understanding of the basic processes that constitute forced convection boiling by removing the buoyancy effects which may mask other phenomena. Specific objectives may also be expressed in terms of the following questions: (1) what effects, if any, will the removal of body forces to the lowest possible levels have on the forced convection boiling heat transfer processes in well-defined and meaningful circumstances? (this includes those effects and processes associated with the nucleation or onset of boiling during the transient increase in heater surface temperature, as well as the heat transfer and vapor bubble behaviors with established or steady-state conditions); and (2) if such effects are present, what are the boundaries of the relevant parameters such as heat flux, heater surface superheat, fluid velocity, bulk subcooling, and geometric/orientation relationships within which such effects will be produced?
Shepard, Blythe D.; Natarajan, Niranjana; Protzko, Ryan J.; Acres, Omar W.; Pluznick, Jennifer L.
2013-01-01
Olfactory receptors (ORs) are G protein-coupled receptors that detect odorants in the olfactory epithelium, and comprise the largest gene family in the genome. Identification of OR ligands typically requires OR surface expression in heterologous cells; however, ORs rarely traffic to the cell surface when exogenously expressed. Therefore, most ORs are orphan receptors with no known ligands. To date, studies have utilized non-cleavable rhodopsin (Rho) tags and/or chaperones (i.e. Receptor Transporting Protein, RTP1S, Ric8b and Gαolf) to improve surface expression. However, even with these tools, many ORs still fail to reach the cell surface. We used a test set of fifteen ORs to examine the effect of a cleavable leucine-rich signal peptide sequence (Lucy tag) on OR surface expression in HEK293T cells. We report here that the addition of the Lucy tag to the N-terminus increases the number of ORs reaching the cell surface to 7 of the 15 ORs (as compared to 3/15 without Rho or Lucy tags). Moreover, when ORs tagged with both Lucy and Rho were co-expressed with previously reported chaperones (RTP1S, Ric8b and Gαolf), we observed surface expression for all 15 receptors examined. In fact, two-thirds of Lucy-tagged ORs are able to reach the cell surface synergistically with chaperones even when the Rho tag is removed (10/15 ORs), allowing for the potential assessment of OR function with only an 8-amino acid Flag tag on the mature protein. As expected for a signal peptide, the Lucy tag was cleaved from the mature protein and did not alter OR-ligand binding and signaling. Our studies demonstrate that widespread surface expression of ORs can be achieved in HEK293T cells, providing promise for future large-scale deorphanization studies. PMID:23840901
Basbous, Sara; Levescot, Anaïs; Piccirilli, Nathalie; Brizard, Françoise; Guilhot, François; Roy, Lydia; Bourmeyster, Nicolas; Gombert, Jean-Marc; Herbelin, André
2016-11-01
CD1d-restricted invariant natural killer T (iNKT) cells are believed to play a key role in cancer immune surveillance, and are functionally deficient in patients with chronic myeloid leukaemia (CML). Herein, we have hypothesized that this defect might originate from BCR-ABL-dependent dysfunctions in myeloid dendritic cells (mDCs). Indeed, flow cytometry and confocal microscopy revealed that cell surface expression of CD1d was downregulated in CML mDCs, relative to healthy donor (HD) controls. The decreased cell surface display of CD1d could not be ascribed to defective mDC differentiation, as attested by normal expression of HLA-DR and the CD86 maturation marker. On the other hand, reduced membrane expression was not associated with decreased intracytoplasmic levels of CD1d or its mRNA transcripts, consistent with intracellular retention. In vitro treatment of CML mDCs with the Rho-associated protein kinase (ROCK) inhibitor Y-27632 partially restored both cell surface CD1d expression and CD1d-mediated antigen presentation, whereas it had no effect on HD mDCs. An inhibitor of BCR-ABL tyrosine kinase (TK), imatinib mesylate (IM), had no such activity. Similar recovery of CD1d expression occurred with fasudil, another ROCK inhibitor that is commonly used in clinical trials. Our data support the conclusion that BCR-ABL-dependent ROCK, but not TK, is involved in CD1d downregulation. We propose that ROCK, which is most likely activated by the DH/PH domain of BCR-ABL, mediates iNKT-cell immune subversion in CML patients by downregulating CD1d expression on CML mDCs. Our study reveals the ROCK-mDC axis as a new potential target to restore immune surveillance in patients with CML, offering new therapeutic perspectives for CML treatment. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Mulay, Vishwaroop; Wood, Peta; Manetsch, Melanie; Darabi, Masoud; Cairns, Rose; Hoque, Monira; Chan, Karen Cecilia; Reverter, Meritxell; Alvarez-Guaita, Anna; Rye, Kerry-Anne; Rentero, Carles; Heeren, Joerg; Enrich, Carlos; Grewal, Thomas
2013-01-01
Signal transduction modulates expression and activity of cholesterol transporters. We recently demonstrated that the Ras/mitogen-activated protein kinase (MAPK) signaling cascade regulates protein stability of Scavenger Receptor BI (SR-BI) through Proliferator Activator Receptor (PPARα) -dependent degradation pathways. In addition, MAPK (Mek/Erk 1/2) inhibition has been shown to influence liver X receptor (LXR) -inducible ATP Binding Cassette (ABC) transporter ABCA1 expression in macrophages. Here we investigated if Ras/MAPK signaling could alter expression and activity of ABCA1 and ABCG1 in steroidogenic and hepatic cell lines. We demonstrate that in Chinese Hamster Ovary (CHO) cells and human hepatic HuH7 cells, extracellular signal-regulated kinase 1/2 (Erk1/2) inhibition reduces PPARα-inducible ABCA1 protein levels, while ectopic expression of constitutively active H-Ras, K-Ras and MAPK/Erk kinase 1 (Mek1) increases ABCA1 protein expression, respectively. Furthermore, Mek1/2 inhibitors reduce ABCG1 protein levels in ABCG1 overexpressing CHO cells (CHO-ABCG1) and human embryonic kidney 293 (HEK293) cells treated with LXR agonist. This correlates with Mek1/2 inhibition reducing ABCG1 cell surface expression and decreasing cholesterol efflux onto High Density Lipoproteins (HDL). Real Time reverse transcriptase polymerase chain reaction (RT-PCR) and protein turnover studies reveal that Mek1/2 inhibitors do not target transcriptional regulation of ABCA1 and ABCG1, but promote ABCA1 and ABCG1 protein degradation in HuH7 and CHO cells, respectively. In line with published data from mouse macrophages, blocking Mek1/2 activity upregulates ABCA1 and ABCG1 protein levels in human THP1 macrophages, indicating opposite roles for the Ras/MAPK pathway in the regulation of ABC transporter activity in macrophages compared to steroidogenic and hepatic cell types. In summary, this study suggests that Ras/MAPK signaling modulates PPARα- and LXR-dependent protein degradation pathways in a cell-specific manner to regulate the expression levels of ABCA1 and ABCG1 transporters.
Two Patients with Dry Eye Disease Followed Up Using an Expression Assay of Ocular Surface Mucin.
Machida, Yumiko; Shoji, Jun; Harada, Natsuko; Inada, Noriko
2016-01-01
We report 2 patients with dry eye disease followed up using the expression levels of ocular surface mucin. Patient 1: a 57-year-old woman with Sjögren's syndrome-associated dry eyes experienced severe dryness and foreign body sensation in both her eyes, and instilled sodium hyaluronate ophthalmic solution 0.3% about 10-15 times daily. We measured the expression levels of MUC5AC mRNA (MUC5AC) and MUC16 mRNA (MUC16) by using real-time reversed transcription polymerase chain reaction for the specimens of modified impression cytology. Expression levels of MUC5AC and MUC16 on her ocular surface were very low. Subjective symptoms and expression levels of ocular surface mucin improved after combined treatment of rebamipide (4 times daily) and fluorometholone (once daily) ophthalmic suspension. Patient 2: a 62-year-old man with chronic graft-versus-host disease-associated dry eye experienced severe foreign body sensation and developed superficial punctate keratopathy with mucous thread and filamentary keratitis. Expression level of MUC5AC was very high at baseline. Subjective symptoms and expression levels of ocular surface mucin improved by combined treatment of rebamipide (4 times daily) and fluorometholone (once daily) ophthalmic suspension. Clinical test for MUC gene expression on the ocular surface was found to be useful in the follow-up of dry eye treatment.
Nogueira, Luciana Gabriel; Santos, Ronaldo Honorato Barros; Ianni, Barbara Maria; Fiorelli, Alfredo Inácio; Mairena, Eliane Conti; Benvenuti, Luiz Alberto; Frade, Amanda; Donadi, Eduardo; Dias, Fabrício; Saba, Bruno; Wang, Hui-Tzu Lin; Fragata, Abilio; Sampaio, Marcelo; Hirata, Mario Hiroyuki; Buck, Paula; Mady, Charles; Bocchi, Edimar Alcides; Stolf, Noedir Antonio; Kalil, Jorge; Cunha-Neto, Edecio
2012-01-01
Background Chronic Chagas cardiomyopathy (CCC), a life-threatening inflammatory dilated cardiomyopathy, affects 30% of the approximately 8 million patients infected by Trypanosoma cruzi. Even though the Th1 T cell-rich myocarditis plays a pivotal role in CCC pathogenesis, little is known about the factors controlling inflammatory cell migration to CCC myocardium. Methods and Results Using confocal immunofluorescence and quantitative PCR, we studied cell surface staining and gene expression of the CXCR3, CCR4, CCR5, CCR7, CCR8 receptors and their chemokine ligands in myocardial samples from end-stage CCC patients. CCR5+, CXCR3+, CCR4+, CCL5+ and CXCL9+ mononuclear cells were observed in CCC myocardium. mRNA expression of the chemokines CCL5, CXCL9, CXCL10, CCL17, CCL19 and their receptors was upregulated in CCC myocardium. CXCL9 mRNA expression directly correlated with the intensity of myocarditis, as well as with mRNA expression of CXCR3, CCR4, CCR5, CCR7, CCR8 and their ligands. We also analyzed single-nucleotide polymorphisms for genes encoding the most highly expressed chemokines and receptors in a cohort of Chagas disease patients. CCC patients with ventricular dysfunction displayed reduced genotypic frequencies of CXCL9 rs10336 CC, CXCL10 rs3921 GG, and increased CCR5 rs1799988CC as compared to those without dysfunction. Significantly, myocardial samples from CCC patients carrying the CXCL9/CXCL10 genotypes associated to a lower risk displayed a 2–6 fold reduction in mRNA expression of CXCL9, CXCL10, and other chemokines and receptors, along with reduced intensity of myocarditis, as compared to those with other CXCL9/CXCL10 genotypes. Conclusions Results may indicate that genotypes associated to reduced risk in closely linked CXCL9 and CXCL10 genes may modulate local expression of the chemokines themselves, and simultaneously affect myocardial expression of other key chemokines as well as intensity of myocarditis. Taken together our results may suggest that CXCL9 and CXCL10 are master regulators of myocardial inflammatory cell migration, perhaps affecting clinical progression to the life-threatening form of CCC. PMID:23150742
Chan, Derek V; Somani, Ally-Khan; Young, Andrew B; Massari, Jessica V; Ohtola, Jennifer; Sugiyama, Hideaki; Garaczi, Edina; Babineau, Denise; Cooper, Kevin D; McCormick, Thomas S
2011-05-26
Elevated numbers of regulatory T cells (T(regs)) have been implicated in certain cancers. Depletion of T(regs) has been shown to increase anti-tumor immunity. T(regs) also play a critical role in the suppression of autoimmune responses. The study of T(regs) has been hampered by a lack of adequate surface markers. Leucine Rich Repeat Containing 32 (LRRC32), also known as Glycoprotein A Repetitions Predominant (GARP), has been postulated as a novel surface marker of activated T(regs). However, there is limited information regarding the processing of LRRC32 or the regulatory phenotype and functional activity of T(regs) expressing LRRC32. Using naturally-occurring freshly isolated T(regs), we demonstrate that low levels of LRRC32 are present intracellularly prior to activation and that freshly isolated LRRC32+ T(regs) are distinct from LRRC32- T(regs) with respect to the expression of surface CD62L. Using LRRC32 transfectants of HEK cells, we demonstrate that the N-terminus of LRRC32 is cleaved prior to expression of the protein at the cell surface. Furthermore, we demonstrate using a construct containing a deleted putative signal peptide region that the presence of a signal peptide region is critical to cell surface expression of LRRC32. Finally, mixed lymphocyte assays demonstrate that LRRC32+ T(regs) are more potent suppressors than LRRC32- T(regs). A cleaved signal peptide site in LRRC32 is necessary for surface localization of native LRRC32 following activation of naturally-occurring freshly-isolated regulatory T cells. LRRC32 expression appears to alter the surface expression of activation markers of T cells such as CD62L. LRRC32 surface expression may be useful as a marker that selects for more potent T(reg) populations. In summary, understanding the processing and expression of LRRC32 may provide insight into the mechanism of action of T(regs) and the refinement of immunotherapeutic strategies aimed at targeting these cells.
Realistic Bomber Training Initiative Supplemental Environmental Impact Statement
2007-03-01
mph at the surface and 27 mph at 22 feet AGL; e ) A pull-up maneuver by the B-1B, which may be executed once or twice per sortie- operation, can...avoid resources, where feasible. ( e ) Developing and implementing site-specifi.c mitigation measures, if required. (3) The Air Force will avoid or...form a complete MOA, the LancerMOA. (2) Concerns were expressed about the structw~ e of the proposed MTR, IR 178. The Air Force reduced noise
Arosa, F A; de Jesus, O; Porto, G; Carmo, A M; de Sousa, M
1999-06-11
Calreticulin is an endoplasmic reticulum resident molecule known to be involved in the folding and assembly of major histocompatibility complex (MHC) class I molecules. In the present study, expression of calreticulin was analyzed in human peripheral blood T lymphocytes. Pulse-chase experiments in [35S]methionine-labeled T cell blasts showed that calreticulin was associated with several proteins in the endoplasmic reticulum and suggested that it was expressed at the cell surface. Indeed, the 60-kDa calreticulin was labeled by cell surface biotinylation and precipitated from the surface of activated T cells together with a protein with an apparent molecular mass of 46 kDa. Cell surface expression of calreticulin by activated T lymphocytes was further confirmed by immunofluorescence and flow cytometry, studies that showed that both CD8+ and CD4+ T cells expressed calreticulin in the plasma membrane. Low amounts of cell surface calreticulin were detected in resting T lymphocytes. By sequential immunoprecipitation using the conformation independent monoclonal antibody HC-10, we provided evidence that the cell surface 46-kDa protein co-precipitated with calreticulin is unfolded MHC I. These results show for the first time that after T cell activation, significant amounts of calreticulin are expressed on the T cell surface, where they are found in physical association with a pool of beta2-free MHC class I molecules.
Hepp, Yanil; Salles, Angeles; Carbo-Tano, Martin
2016-01-01
The aim of the present study was to analyze the surface expression of the NMDA-like receptors during the consolidation of contextual learning in the crab Neohelice granulata. Memory storage is based on alterations in the strength of synaptic connections between neurons. The glutamatergic synapses undergo various forms of N-methyl-D aspartate receptor (NMDAR)-dependent changes in strength, a process that affects the abundance of other receptors at the synapse and underlies some forms of learning and memory. Here we propose a direct regulation of the NMDAR. Changes in NMDAR's functionality might be induced by the modification of the subunit's expression or cellular trafficking. This trafficking does not only include NMDAR's movement between synaptic and extra-synaptic localizations but also the cycling between intracellular compartments and the plasma membrane, a process called surface expression. Consolidation of contextual learning affects the surface expression of the receptor without affecting its general expression. The surface expression of the GluN1 subunit of the NMDAR is down-regulated immediately after training, up-regulated 3 h after training and returns to naïve and control levels 24 h after training. The changes in NMDAR surface expression observed in the central brain are not seen in the thoracic ganglion. A similar increment in surface expression of GluN1 in the central brain is observed 3 h after administration of the competitive GABAA receptor antagonist, bicuculline. These consolidation changes are part of a plasticity event that first, during the down-regulation, stabilizes the trace and later, at 3-h post-training, changes the threshold for synapse activation. PMID:27421895
Wong, Chi-Wai; Lam, Kevin K W; Lee, Cheuk-Lun; Yeung, William S B; Zhao, Wei E; Ho, Pak-Chung; Ou, Jian-Ping; Chiu, Philip C N
2017-04-01
Are multimeric sperm plasma membrane protein complexes, ERp57 and sperm surface thiol content involved in human spermatozoa-zona pellucida (ZP) interaction? ERp57 is a component of a multimeric spermatozoa-ZP receptor complex involved in regulation of human spermatozoa-ZP binding via up-regulation of sperm surface thiol content. A spermatozoon acquires its fertilization capacity within the female reproductive tract by capacitation. Spermatozoa-ZP receptor is suggested to be a composite structure that is assembled into a functional complex during capacitation. Sperm surface thiol content is elevated during capacitation. ERp57 is a protein disulphide isomerase that modulates the thiol-disulphide status of proteins. The binding ability and components of protein complexes in extracted membrane protein fractions of spermatozoa were studied. The roles of capacitation, thiol-disulphide reagent treatments and ERp57 on sperm functions and sperm surface thiol content were assessed. Spermatozoa were obtained from semen samples from normozoospermic men. Human oocytes were obtained from an assisted reproduction programme. Blue native polyacrylamide gel electrophoresis, western ligand blotting and mass spectrometry were used to identify the components of solubilized ZP/ZP3-binding complexes. The localization and expression of sperm surface thiol and ERp57 were studied by immunostaining and sperm surface protein biotinylation followed by western blotting. Sperm functions were assessed by standard assays. Several ZP-binding complexes were isolated from the cell membrane of capacitated spermatozoa. ERp57 was a component of one of these complexes. Capacitation significantly increased the sperm surface thiol content, acrosomal thiol distribution and ERp57 expression on sperm surface. Sperm surface thiol and ERp57 immunoreactivity were localized to the acrosomal region of spermatozoa, a region responsible for ZP-binding. Up-regulation of the surface thiol content or ERp57 surface expression in vitro stimulated ZP-binding capacity of human spermatozoa. Blocking of ERp57 function by specific antibody or inhibitors against ERp57 reduced the surface thiol content and ZP-binding capacity of human spermatozoa. N/A. The mechanisms by which up-regulation of surface thiol content stimulates spermatozoa-ZP binding have not been depicted. Thiol-disulphide exchange is a crucial event in capacitation. ERp57 modulates the event and the subsequent fertilization process. Modulation of the surface thiol content of the spermatozoa of subfertile men may help to increase fertilization rate in assisted reproduction. This work was supported by The Hong Kong Research Grant Council Grant HKU764611 and HKU764512M to P.C.N.C. The authors have no competing interests. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
Mahdavi, Jafar; Oldfield, Neil J.; Wheldon, Lee M.; Wooldridge, Karl G.; Ala'Aldeen, Dlawer A. A.
2012-01-01
Neisseria meningitidis, Haemophilus influenzae and Streptococcus pneumoniae are major bacterial agents of meningitis. They each bind the 37/67-kDa laminin receptor (LamR) via the surface protein adhesins: meningococcal PilQ and PorA, H. influenzae OmpP2 and pneumococcal CbpA. We have previously reported that a surface-exposed loop of the R2 domain of CbpA mediates LamR-binding. Here we have identified the LamR-binding regions of PorA and OmpP2. Using truncated recombinant proteins we show that binding is dependent on amino acids 171–240 and 91–99 of PorA and OmpP2, respectively, which are predicted to localize to the fourth and second surface-exposed loops, respectively, of these proteins. Synthetic peptides corresponding to the loops bound LamR and could block LamR-binding to bacterial ligands in a dose dependant manner. Meningococci expressing PorA lacking the apex of loop 4 and H. influenzae expressing OmpP2 lacking the apex of loop 2 showed significantly reduced LamR binding. Since both loops are hyper-variable, our data may suggest a molecular basis for the range of LamR-binding capabilities previously reported among different meningococcal and H. influenzae strains. PMID:23049988
Abouseada, Noha M; Assafi, Mahde Saleh A; Mahdavi, Jafar; Oldfield, Neil J; Wheldon, Lee M; Wooldridge, Karl G; Ala'Aldeen, Dlawer A A
2012-01-01
Neisseria meningitidis, Haemophilus influenzae and Streptococcus pneumoniae are major bacterial agents of meningitis. They each bind the 37/67-kDa laminin receptor (LamR) via the surface protein adhesins: meningococcal PilQ and PorA, H. influenzae OmpP2 and pneumococcal CbpA. We have previously reported that a surface-exposed loop of the R2 domain of CbpA mediates LamR-binding. Here we have identified the LamR-binding regions of PorA and OmpP2. Using truncated recombinant proteins we show that binding is dependent on amino acids 171-240 and 91-99 of PorA and OmpP2, respectively, which are predicted to localize to the fourth and second surface-exposed loops, respectively, of these proteins. Synthetic peptides corresponding to the loops bound LamR and could block LamR-binding to bacterial ligands in a dose dependant manner. Meningococci expressing PorA lacking the apex of loop 4 and H. influenzae expressing OmpP2 lacking the apex of loop 2 showed significantly reduced LamR binding. Since both loops are hyper-variable, our data may suggest a molecular basis for the range of LamR-binding capabilities previously reported among different meningococcal and H. influenzae strains.
Fujita, H; Okada, F; Hamada , J; Hosokawa, M; Moriuchi, T; Koya, R C; Kuzumaki, N
2001-09-01
Gelsolin, an actin-binding protein, is implicated as a critical regulator in cell motility. In addition, we have reported that cellular levels of gelsolin are decreased in various tumor cells, and overexpression of gelsolin by gene transfer suppresses tumorigenicity. We sought to assess the effects of gelsolin overexpression on metastasis and to determine the importance of a carboxyl-terminus that confers Ca(2+) dependency on gelsolin for effects of its overexpression. Expression vectors with cDNA encoding either full-length wild-type or His321 mutant form, isolated from a flat revertant of Ras-transformed cells and a carboxyl-terminal truncate, C-del of gelsolin, were transfected into a highly metastatic murine melanoma cell line, B16-BL6. Expression of introduced cDNA in transfectants was confirmed using Western blotting, 2-dimensional gel electrophoresis and reverse transcription-polymerase chain reaction (RT-PCR). We characterized phenotypes of transfectants, such as growth rate, colony formation in soft agar, cell motility and metastasis formation in vivo. Transfectants expressing the wild-type, His321 mutant and C-del gelsolin exhibited reduced growth ability in soft agar. Although expression of integrin beta1 or alpha4 on the cell surface of transfectants was not changed, wild-type and His321 mutant gelsolin, except for C-del gelsolin, exhibited retardation of cell spreading, reduced chemotatic migration to fibronectin and suppressed lung colonization in spontaneous metastasis assay. Gelsolin may function as a metastasis suppressor as well as a tumor suppressor gene. The carboxyl-terminus of gelsolin is important for retardation of cell spreading, reduced chemotasis and metastasis suppression. Copyright 2001 Wiley-Liss, Inc.
Shadwell, Naomi; Villalobos, Fatima; Kern, Mark; Hong, Mee Young
2013-05-01
Dark chocolate contains high levels of antioxidants which are linked to a reduced risk of cardiovascular disease. Chocolate blooming occurs after exposure to high temperatures. Although bloomed chocolate is safe for human consumption, it is not known whether or not the biological function of bloomed chocolate is affected. We hypothesized that bloomed chocolate would reduce the antioxidant potential and lipid-lowering properties of chocolate through altered expression of related genes. Thirty Sprague-Dawley rats were divided into 3 groups and fed either the control (CON), regular dark chocolate (RDC), or bloomed dark chocolate (BDC) diet. After 3 weeks, serum lipid levels and antioxidant capacity were measured. Hepatic expression of key genes was determined by real time polymerase chain reaction (PCR). Sensory characteristics of bloomed versus regular chocolate were assessed in 28 semi-trained panelists. Rats fed RDC exhibited greater serum antioxidant capacities compared to the CON (P < .05). Antioxidant levels of BDC were not different from RDC or CON. Both RDC and BDC lowered TG compared to CON (P < .05). The rats fed RDC had higher high-density lipoprotein levels compared to the CON (P < .05). In rats given RDC, fatty acid synthase gene expression was down-regulated and low-density lipoprotein receptor transcription was up-regulated (P < .05). Sensory panelists preferred the appearance and surface smoothness of the regular chocolate compared to bloomed chocolate (P < .001). Although blooming blunted the robust antioxidant response produced by regular dark chocolate, these results suggest that bloomed dark chocolate yields similarly beneficial effects on most blood lipid parameters or biomarkers. However, regular dark chocolate may be more beneficial for the improvement of antioxidant status and modulation of gene expression involved in lipid metabolism and promoted greater sensory ratings. Copyright © 2013 Elsevier Inc. All rights reserved.
Release of Membrane-associated Mucins from Ocular Surface Epithelia
Blalock, Timothy D.; Spurr-Michaud, Sandra J.; Tisdale, Ann S.; Gipson, Ilene K.
2008-01-01
Purpose Three membrane-associated mucins (MAMs)—MUC1, MUC4 and MUC16—are expressed at the ocular surface epithelium. Soluble forms of MAMs are detected in human tears, but the mechanisms of their release from the apical cells are unknown. The purpose of this study was to identify physiologic agents that induce ocular surface MAM release. Methods An immortalized human corneal-limbal epithelial cell line (HCLE) expressing the same MAMs as native tissue was used. An antibody specific to MUC16’s cytoplasmic tail was developed to confirm that only the extracellular domain is released into the tear fluid or culture media. Effects of agents that have been shown to be present in tears or are implicated in release/shedding of MAMs in other epithelia (neutrophil elastase, tumor necrosis factor (TNF), TNF-α-converting enzyme, and matrix metalloproteinases-7 and –9) were assessed on HCLE cells. HCLE cell surface proteins were biotinylated to measure efficiency of induced MAM release and surface restoration. Effects of induced release on surface barrier function were measured by rose bengal dye penetrance. Results MUC16 in tears and in HCLE-conditioned medium lacked the cytoplasmic tail. TNF induced release of MUC1, MUC4, and MUC16 from the HCLE surface. Matrix metalloproteinase-7 and neutrophil elastase induced release of MUC16 but not MUC1 or MUC4. Neutrophil elastase removed 68% of MUC16—78% of which was restored to the HCLE cell surface 24 hours after release. Neutrophil elastase-treated HCLE cells showed significantly reduced rose bengal dye exclusion. Conclusions Results suggest that extracellular domains of MUC1, 4, and 16 can be released from the ocular surface by agents present in tears. Neutrophil elastase and TNF present in higher amounts in dry eye patients’ tears may cause MAM release—allowing rose bengal staining. PMID:18436821
Martin, Erik W.; Buzza, Marguerite S.; Driesbaugh, Kathryn H.; Liu, Shihui; Fortenberry, Yolanda M.; Leppla, Stephen H.; Antalis, Toni M.
2015-01-01
The membrane-anchored serine proteases are a unique group of trypsin-like serine proteases that are tethered to the cell surface via transmembrane domains or glycosyl-phosphatidylinositol-anchors. Overexpressed in tumors, with pro-tumorigenic properties, they are attractive targets for protease-activated prodrug-like anti-tumor therapies. Here, we sought to engineer anthrax toxin protective antigen (PrAg), which is proteolytically activated on the cell surface by the proprotein convertase furin to instead be activated by tumor cell-expressed membrane-anchored serine proteases to function as a tumoricidal agent. PrAg's native activation sequence was mutated to a sequence derived from protein C inhibitor (PCI) that can be cleaved by membrane-anchored serine proteases, to generate the mutant protein PrAg-PCIS. PrAg-PCIS was resistant to furin cleavage in vitro, yet cytotoxic to multiple human tumor cell lines when combined with FP59, a chimeric anthrax toxin lethal factor-Pseudomonas exotoxin fusion protein. Molecular analyses showed that PrAg-PCIS can be cleaved in vitro by several serine proteases including the membrane-anchored serine protease testisin, and mediates increased killing of testisin-expressing tumor cells. Treatment with PrAg-PCIS also potently attenuated the growth of testisin-expressing xenograft tumors in mice. The data indicates PrAg can be engineered to target tumor cell-expressed membrane-anchored serine proteases to function as a potent tumoricidal agent. PMID:26392335
Saifudeen, Ismael; Subhadra, Lakshmi; Konnottil, Remani; Nair, R Renuka
2017-03-01
Left ventricular hypertrophy (LVH) is characterized by a decrease in oxidation of long-chain fatty acids, possibly mediated by reduced expression of the cell-surface protein cluster of differentiation 36 (CD36). Spontaneously hypertensive rats (SHRs) were therefore supplemented with medium-chain triglycerides (MCT), a substrate that bypasses CD36, based on the assumption that the metabolic modulation will ameliorate ventricular remodeling. The diet of 2-month-old and 6-month-old SHRs was supplemented with 5% MCT (Tricaprylin), for 4 months. Metabolic modulation was assessed by mRNA expression of peroxisome proliferator-activated receptor α and medium-chain acyl-CoA dehydrogenase. Blood pressure was measured noninvasively. LVH was assessed with the use of hypertrophy index, cardiomyocyte cross-sectional area, mRNA expression of B-type natriuretic peptide, cardiac fibrosis, and calcineurin-A levels. Oxidative stress indicators (cardiac malondialdehyde, protein carbonyl, and 3-nitrotyrosine levels), myocardial energy level (ATP, phosphocreatine), and lipid profile were determined. Supplementation of MCT stimulated fatty acid oxidation in animals of both age groups, reduced hypertrophy and oxidative stress along with the maintenance of energy level. Blood pressure, body weight, and lipid profile were unaffected by the treatment. The results indicate that modulation of myocardial fatty acid metabolism by MCT prevents progressive cardiac remodeling in SHRs, possibly by maintenance of energy level and decrease in oxidative stress. Copyright © 2016 Elsevier Inc. All rights reserved.
Enqvist, Monika; Nilsonne, Gustav; Hammarfjord, Oscar; Wallin, Robert P A; Björkström, Niklas K; Björnstedt, Mikael; Hjerpe, Anders; Ljunggren, Hans-Gustaf; Dobra, Katalin; Malmberg, Karl-Johan; Carlsten, Mattias
2011-10-01
CD94/NKG2A is an inhibitory receptor that controls the activity of a large proportion of human NK cells following interactions with the nonclassical HLA class Ib molecule HLA-E expressed on target cells. In this study, we show that selenite (SeO(3)(2-)), an inorganic selenium compound, induces an almost complete loss of cell surface expression of HLA-E on tumor cells of various origins. Selenite abrogated the HLA-E expression at a posttranscriptional level, since selenite exposure led to a dose-dependent decrease in cellular HLA-E protein expression whereas the mRNA levels remained intact. The loss of HLA-E expression following selenite treatment was associated with decreased levels of intracellular free thiols in the tumor cells, suggesting that the reduced HLA-E protein synthesis was caused by oxidative stress. Indeed, HLA-E expression and the level of free thiols remained intact following treatment with selenomethionine, a selenium compound that does not generate oxidative stress. Loss of HLA-E expression, but not of total HLA class I expression, on tumor cells resulted in increased susceptibility to CD94/NK group 2A-positive NK cells. Our results suggest that selenite may be used to potentiate the anti-tumor cytotoxicity in settings of NK cell-based immunotherapies.
Radhakrishnan, Vijayababu M; Kojs, Pawel; Young, Gavin; Ramalingam, Rajalakshmy; Jagadish, Bhumasamudram; Mash, Eugene A; Martinez, Jesse D; Ghishan, Fayez K; Kiela, Pawel R
2014-01-01
Cortactin (CTTN), first identified as a major substrate of the Src tyrosine kinase, actively participates in branching F-actin assembly and in cell motility and invasion. CTTN gene is amplified and its protein is overexpressed in several types of cancer. The phosphorylated form of cortactin (pTyr(421)) is required for cancer cell motility and invasion. In this study, we demonstrate that a majority of the tested primary colorectal tumor specimens show greatly enhanced expression of pTyr(421)-CTTN, but no change at the mRNA level as compared to healthy subjects, thus suggesting post-translational activation rather than gene amplification in these tumors. Curcumin (diferulolylmethane), a natural compound with promising chemopreventive and chemosensitizing effects, reduced the indirect association of cortactin with the plasma membrane protein fraction in colon adenocarcinoma cells as measured by surface biotinylation, mass spectrometry, and Western blotting. Curcumin significantly decreased the pTyr(421)-CTTN in HCT116 cells and SW480 cells, but was ineffective in HT-29 cells. Curcumin physically interacted with PTPN1 tyrosine phosphatases to increase its activity and lead to dephosphorylation of pTyr(421)-CTTN. PTPN1 inhibition eliminated the effects of curcumin on pTyr(421)-CTTN. Transduction with adenovirally-encoded CTTN increased migration of HCT116, SW480, and HT-29. Curcumin decreased migration of HCT116 and SW480 cells which highly express PTPN1, but not of HT-29 cells with significantly reduced endogenous expression of PTPN1. Curcumin significantly reduced the physical interaction of CTTN and pTyr(421)-CTTN with p120 catenin (CTNND1). Collectively, these data suggest that curcumin is an activator of PTPN1 and can reduce cell motility in colon cancer via dephosphorylation of pTyr(421)-CTTN which could be exploited for novel therapeutic approaches in colon cancer therapy based on tumor pTyr(421)-CTTN expression.
Radhakrishnan, Vijayababu M.; Kojs, Pawel; Young, Gavin; Ramalingam, Rajalakshmy; Jagadish, Bhumasamudram; Mash, Eugene A.; Martinez, Jesse D.; Ghishan, Fayez K.; Kiela, Pawel R.
2014-01-01
Cortactin (CTTN), first identified as a major substrate of the Src tyrosine kinase, actively participates in branching F-actin assembly and in cell motility and invasion. CTTN gene is amplified and its protein is overexpressed in several types of cancer. The phosphorylated form of cortactin (pTyr421) is required for cancer cell motility and invasion. In this study, we demonstrate that a majority of the tested primary colorectal tumor specimens show greatly enhanced expression of pTyr421-CTTN, but no change at the mRNA level as compared to healthy subjects, thus suggesting post-translational activation rather than gene amplification in these tumors. Curcumin (diferulolylmethane), a natural compound with promising chemopreventive and chemosensitizing effects, reduced the indirect association of cortactin with the plasma membrane protein fraction in colon adenocarcinoma cells as measured by surface biotinylation, mass spectrometry, and Western blotting. Curcumin significantly decreased the pTyr421-CTTN in HCT116 cells and SW480 cells, but was ineffective in HT-29 cells. Curcumin physically interacted with PTPN1 tyrosine phosphatases to increase its activity and lead to dephosphorylation of pTyr421-CTTN. PTPN1 inhibition eliminated the effects of curcumin on pTyr421-CTTN. Transduction with adenovirally-encoded CTTN increased migration of HCT116, SW480, and HT-29. Curcumin decreased migration of HCT116 and SW480 cells which highly express PTPN1, but not of HT-29 cells with significantly reduced endogenous expression of PTPN1. Curcumin significantly reduced the physical interaction of CTTN and pTyr421-CTTN with p120 catenin (CTNND1). Collectively, these data suggest that curcumin is an activator of PTPN1 and can reduce cell motility in colon cancer via dephosphorylation of pTyr421-CTTN which could be exploited for novel therapeutic approaches in colon cancer therapy based on tumor pTyr421-CTTN expression. PMID:24465712
Surface Expression of Hsp25 and Hsp72 Differentially Regulates Tumor Growth and Metastasis
Bausero, María A.; Page, Diana T.; Osinaga, Eduardo; Asea, Alexzander
2006-01-01
The expression of unique surface structures on tumors that allow for recognition and activation of host immunocompetent cells plays an important role in determining tumor growth and/or metastasis. Recent studies have identified an important role for heat shock proteins (Hsp) in antitumor surveillance; however, the exact role of Hsp expressed on the surface of tumors has not been fully addressed. In this study, we show that 4T1 mammary adenocarcinoma cells sorted for high Hsp25 surface expression (Hsp25high) grow significantly faster than cells sorted for intermediate Hsp25 surface expression (Hsp25intermediate) or wild-type 4T1 cells implanted into the abdominal breast gland of female BALB/c mice (p < 0.05). In addition, histological examination of lung tissues revealed that Hsp25high 4T1 cells metastasized to the lungs more aggressively than either Hsp25intermediate or wild-type 4T1 cells (p < 0.05). Exposure of 4T1 cells to nonlethal heat shock (43°C, 30 min) induced the surface expression of Hsp72 and a concomitant reduction in Hsp25 surface expression. The growth and metastastic potential of Hsp72+ 4T1 cells was significantly less than that of Hsp25high, Hsp25intermediate or wild-type 4T1 cells (p < 0.05). Taken together, these studies identify an important role for expression of Hsp25 and Hsp72 during tumor growth and metastatic spread which might be helpful in the design of antimetastatic therapies. PMID:15627887
Surface expression of Hsp25 and Hsp72 differentially regulates tumor growth and metastasis.
Bausero, María A; Page, Diana T; Osinaga, Eduardo; Asea, Alexzander
2004-01-01
The expression of unique surface structures on tumors that allow for recognition and activation of host immunocompetent cells plays an important role in determining tumor growth and/or metastasis. Recent studies have identified an important role for heat shock proteins (Hsp) in antitumor surveillance; however, the exact role of Hsp expressed on the surface of tumors has not been fully addressed. In this study, we show that 4T1 mammary adenocarcinoma cells sorted for high Hsp25 surface expression (Hsp25(high)) grow significantly faster than cells sorted for intermediate Hsp25 surface expression (Hsp25(intermediate)) or wild-type 4T1 cells implanted into the abdominal breast gland of female BALB/c mice (p < 0.05). In addition, histological examination of lung tissues revealed that Hsp25(high) 4T1 cells metastasized to the lungs more aggressively than either Hsp25(intermediate) or wild-type 4T1 cells (p < 0.05). Exposure of 4T1 cells to nonlethal heat shock (43 degrees C, 30 min) induced the surface expression of Hsp72 and a concomitant reduction in Hsp25 surface expression. The growth and metastastic potential of Hsp72(+) 4T1 cells was significantly less than that of Hsp25(high), Hsp25(intermediate) or wild-type 4T1 cells (p < 0.05). Taken together, these studies identify an important role for expression of Hsp25 and Hsp72 during tumor growth and metastatic spread which might be helpful in the design of antimetastatic therapies. Copyright 2004 S. Karger AG, Basel.
L-asparaginase inhibits invasive and angiogenic activity and induces autophagy in ovarian cancer
Yu, Minshu; Henning, Ryan; Walker, Amanda; Kim, Geoffrey; Perroy, Alyssa; Alessandro, Riccardo; Virador, Victoria; Kohn, Elise C
2012-01-01
Recent work identified L-asparaginase (L-ASP) as a putative therapeutic target for ovarian cancer. We suggest that L-ASP, a dysregulator of glycosylation, would interrupt the local microenvironment, affecting the ovarian cancer cell—endothelial cell interaction and thus angiogenesis without cytotoxic effects. Ovarian cancer cell lines and human microvascular endothelial cells (HMVEC) were exposed to L-ASP at physiologically attainable concentrations and subjected to analyses of endothelial tube formation, invasion, adhesion and the assessment of sialylated proteins involved in matrix-associated and heterotypic cell adhesion. Marked reduction in HMVEC tube formation in vitro, HMVEC and ovarian cancer cell invasion, and heterotypic cell-cell and cell-matrix adhesion was observed (P < 0.05–0.0001). These effects were associated with reduced binding to ß1integrin, activation of FAK, and cell surface sialyl LewisX (sLex) expression. No reduction in HMVEC E-selectin expression was seen consistent with the unidirectional inhibitory actions observed. L-ASP concentrations were non-toxic to either ovarian cancer or HMVEC lines in the time frame of the assays. However, early changes of autophagy were observed in both cell types with induction of ATG12, beclin-1, and cleavage of LC-3, indicating cell injury did occur. These data and the known mechanism of action of L-ASP on glycosylation of nascent proteins suggest that L-ASP reduces of ovarian cancer dissemination and progression through modification of its microenvironment. The reduction of ovarian cancer cell surface sLex inhibits interaction with HMVEC and thus HMVEC differentiation into tubes, inhibits interaction with the local matrix reducing invasive behaviour, and causes cell injury initiating autophagy in tumour and vascular cells. PMID:22333033
Trichinella spiralis Calreticulin Binds Human Complement C1q As an Immune Evasion Strategy.
Zhao, Limei; Shao, Shuai; Chen, Yi; Sun, Ximeng; Sun, Ran; Huang, Jingjing; Zhan, Bin; Zhu, Xinping
2017-01-01
As a multicellular parasitic nematode, Trichinella spiralis regulates host immune responses by producing a variety of immunomodulatory molecules to escape from host immune attack, but the mechanisms underlying the immune evasion are not well understood. Here, we identified that T. spiralis calreticulin ( Ts -CRT), a Ca 2+ -binding protein, facilitated T. spiralis immune evasion by interacting with the first component of human classical complement pathway, C1q. In the present study, Ts -CRT was found to be expressed on the surface of different developmental stages of T. spiralis as well as in the secreted products of adult and muscle larval worms. Functional analysis identified that Ts -CRT was able to bind to human C1q, resulting in the inhibition of C1q-initiated complement classical activation pathway reflected by reduced C4/C3 generation and C1q-dependent lysis of antibody-sensitized sheep erythrocytes. Moreover, recombinant Ts -CRT (r Ts -CRT) binding to C1q suppressed C1q-induced THP-1-derived macrophages chemotaxis and reduced monocyte-macrophages release of reactive oxygen intermediates (ROIs). Blocking Ts -CRT on the surface of newborn larvae (NBL) of T. spiralis with anti- Ts -CRT antibody increased the C1q-mediated adherence of monocyte-macrophages to larvae and impaired larval infectivity. All of these results suggest that T. spiralis -expressed Ts -CRT plays crucial roles in T. spiralis immune evasion and survival in host mostly by directly binding to host complement C1q, which not only reduces C1q-mediated activation of classical complement pathway but also inhibits the C1q-induced non-complement activation of macrophages.
Trichinella spiralis Calreticulin Binds Human Complement C1q As an Immune Evasion Strategy
Zhao, Limei; Shao, Shuai; Chen, Yi; Sun, Ximeng; Sun, Ran; Huang, Jingjing; Zhan, Bin; Zhu, Xinping
2017-01-01
As a multicellular parasitic nematode, Trichinella spiralis regulates host immune responses by producing a variety of immunomodulatory molecules to escape from host immune attack, but the mechanisms underlying the immune evasion are not well understood. Here, we identified that T. spiralis calreticulin (Ts-CRT), a Ca2+-binding protein, facilitated T. spiralis immune evasion by interacting with the first component of human classical complement pathway, C1q. In the present study, Ts-CRT was found to be expressed on the surface of different developmental stages of T. spiralis as well as in the secreted products of adult and muscle larval worms. Functional analysis identified that Ts-CRT was able to bind to human C1q, resulting in the inhibition of C1q-initiated complement classical activation pathway reflected by reduced C4/C3 generation and C1q-dependent lysis of antibody-sensitized sheep erythrocytes. Moreover, recombinant Ts-CRT (rTs-CRT) binding to C1q suppressed C1q-induced THP-1-derived macrophages chemotaxis and reduced monocyte–macrophages release of reactive oxygen intermediates (ROIs). Blocking Ts-CRT on the surface of newborn larvae (NBL) of T. spiralis with anti-Ts-CRT antibody increased the C1q-mediated adherence of monocyte–macrophages to larvae and impaired larval infectivity. All of these results suggest that T. spiralis-expressed Ts-CRT plays crucial roles in T. spiralis immune evasion and survival in host mostly by directly binding to host complement C1q, which not only reduces C1q-mediated activation of classical complement pathway but also inhibits the C1q-induced non-complement activation of macrophages. PMID:28620388
Lipid reducing activity and toxicity profiles of a library of polyphenol derivatives.
Urbatzka, Ralph; Freitas, Sara; Palmeira, Andreia; Almeida, Tiago; Moreira, João; Azevedo, Carlos; Afonso, Carlos; Correia-da-Silva, Marta; Sousa, Emilia; Pinto, Madalena; Vasconcelos, Vitor
2018-05-10
Obesity is an increasing epidemic worldwide and novel treatments are urgently needed. Polyphenols are natural compounds derived from plants, which are known in particular for their antioxidant properties. However, some polyphenols were described to possess anti-obesity activities in vitro and in vivo. In this study, we aimed to screen a library of 85 polyphenol derivatives for their lipid reducing activity and toxicity. Compounds were analyzed at 5 μM with the zebrafish Nile red fluorescence fat metabolism assay and for general toxicity in vivo. To improve the safety profile, compounds were screened at 50 μM in murine preadipocytes in vitro for cytotoxicity. Obtained activity data were used to create a 2D-QSAR (quantitative structure activity relationship) model. 38 polyphenols showed strong lipid reducing activity. Toxicity analysis revealed that 18 of them did not show any toxicity in vitro or in vivo. QSAR analysis revealed the importance of the number of rings, fractional partial positively charged surface area, relative positive charge, relative number of oxygen atoms, and partial negative surface area for lipid-reducing activity. The five most potent compounds with EC 50 values in the nanomolar range for lipid reducing activity and without any toxic effects are strong candidates for future research and development into anti-obesity drugs. Molecular profiling for fasn, sirt1, mtp and ppary revealed one compound that reduced significantly fasn mRNA expression. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
2014-01-01
Background Changes in serotonin transporter (SERT) function have been implicated in autism. SERT function is influenced by the number of transporter molecules present at the cell surface, which is regulated by various cellular mechanisms including interactions with other proteins. Thus, we searched for novel SERT-binding proteins and investigated whether the expression of one such protein was affected in subjects with autism. Methods Novel SERT-binding proteins were examined by a pull-down system. Alterations of SERT function and membrane expression upon knockdown of the novel SERT-binding protein were studied in HEK293-hSERT cells. Endogenous interaction of SERT with the protein was evaluated in mouse brains. Alterations in the mRNA expression of SERT (SLC6A4) and the SERT-binding protein in the post-mortem brains and the lymphocytes of autism patients were compared to nonclinical controls. Results N-ethylmaleimide-sensitive factor (NSF) was identified as a novel SERT-binding protein. NSF was co-localized with SERT at the plasma membrane, and NSF knockdown resulted in decreased SERT expression at the cell membranes and decreased SERT uptake function. NSF was endogenously co-localized with SERT and interacted with SERT. While SLC6A4 expression was not significantly changed, NSF expression tended to be reduced in post-mortem brains, and was significantly reduced in lymphocytes of autistic subjects, which correlated with the severity of the clinical symptoms. Conclusions These data clearly show that NSF interacts with SERT under physiological conditions and is required for SERT membrane trafficking and uptake function. A possible role for NSF in the pathophysiology of autism through modulation of SERT trafficking, is suggested. PMID:24834316
Lee, Kyu-Sup; Baek, Dae-Won; Kim, Ki-Hyung; Shin, Byoung-Sub; Lee, Dong-Hyung; Kim, Ja-Woong; Hong, Young-Seoub; Bae, Yoe-Sik; Kwak, Jong-Young
2005-11-01
Endometriosis is a gynecologic disorder characterized by the ectopic growth of misplaced endometrial cells. Moreover, immunological abnormalities of cell-mediated and humoral immunity may be associated with the pathogenesis of endometriosis. The effects of peritoneal fluid (PF) from endometriosis patients on the expression levels of MHC class II and costimulatory molecules on the cell surfaces of monocytes were investigated. Compared to the PF of controls, the addition of 10% PF (n=10) from patients with endometriosis to culture medium significantly reduced the percentage of MHC class II-positive cells in cultures of a THP-1, monocytic cell line at 48 h. The effect of endometriosis patient PF (EPF) was dose-dependent, and similar effect was observed in peripheral blood monocytes. An inverse correlation was found between MHC class II expression level and IL-10 concentration in EPF (r=-0.518; p=0.019) and in the supernatant of peripheral blood monocyte cultured in EPF (r=-0.459; p=0.042) (n=20). The expression levels of costimulatory molecules (CD80 and CD86), but not of CD54 and B7-H1, were down-regulated by EPF. The mRNA level of HLA-DR was unaffected by EPF but protein level was reduced by EPF. Neutralizing IL-10 antibody abrogated MHC class II down-regulation on monocytes, which had been induced by EPF. However, in a functional assay, monocytes treated with EPF failed to stimulate T cell in mixed leukocyte reaction, although T cell proliferation was increased with EPF-treated monocytes and Staphylococcus enterotoxin B. These results suggest that MHC class II expression level on monocytes is down-regulated by EPF, but the cell stimulatory ability of monocytes does not coincide with MHC class II expression level.
Functional Significance of VEGFR-2 on Ovarian Cancer Cells
Spannuth, Whitney A.; Nick, Alpa M.; Jennings, Nicholas B.; Armaiz-Pena, Guillermo N.; Mangala, Lingegowda S.; Danes, Christopher G.; Lin, Yvonne G.; Merritt, William M.; Thaker, Premal H.; Kamat, Aparna A.; Han, Liz Y.; Tonra, James R.; Coleman, Robert L.; Ellis, Lee M.; Sood, Anil K.
2009-01-01
Vascular endothelial growth factor receptor (VEGFR) has recently been discovered on ovarian cancer cells, but its functional significance is unknown and is the focus of the current study. By protein analysis, A2780-par and HeyA8 ovarian cancer cell lines expressed VEGFR-1 and HeyA8 and SKOV3ip1 expressed VEGFR-2. By in situ hybridization (ISH), 85% of human ovarian cancer specimens showed moderate to high VEGFR-2 expression while only 15% showed moderate to high VEGFR-1 expression. By immunofluorescence, little or no VEGFR-2 was detected in normal ovarian surface epithelial cells, whereas expression was detected in 75% of invasive ovarian cancer specimens. To differentiate between the effects of tumor versus host expression of VEGFR, nude mice were injected with SKOV3ip1 cells and treated with either human VEGFR-2 specific antibody (1121B), murine VEGFR-2 specific antibody (DC101), or the combination. Treatment with 1121B reduced SKOV3ip1 cell migration by 68% (p < 0.01) and invasion by 72% (p < 0.01), but exposure to VEGFR-1 antibody had no effect. Treatment with 1121B effectively blocked VEGF-induced phosphorylation of p130Cas. In vivo, treatment with either DC101 or 1121B significantly reduced tumor growth alone and in combination in the SKOV3ip1 and A2774 models. Decreased tumor burden after treatment with DC101 or 1121B correlated with increased tumor cell apoptosis, decreased proliferative index, and decreased microvessel density. These effects were significantly greater in the combination group (p<0.001). We show functionally active VEGFR-2 is present on most ovarian cancer cells. The observed anti-tumor activity of VEGF-targeted therapies may be mediated by both anti-angiogenic and direct anti-tumor effects. PMID:19058181
Zhao, Li-li; Chen, Hong-juan; Chen, Jun-zhu; Yu, Min; Ni, Yun-lan; Zhang, Wei-fang
2008-01-01
Objective: To assess the effect of angiotensin II type 1 (AT1) receptor antagonist losartan on myocardium connexin43 (Cx43) gap junction (GJ) expression in spontaneously hypertensive rats (SHRs) and investigate possible mechanisms. Methods: Sixteen 9-week-old male SHRs and 8 age-matched male Wistar-Kyoto (WKY) rats were included in this study. SHRs were randomly divided into two groups to receive losartan at 30 mg/(kg·d) by oral gavage once daily for 8 weeks (SHR-L) or vehicle (0.9% saline) to act as controls (SHR-V); WKY rats receiving vehicle for 8 weeks served as normotensive controls. At the end of the experiment, rats were sacrificed and the hearts were removed. Expressions of Cx43 and nuclear factor-kappaB p65 (NF-κB p65) proteins in all three groups were observed and further investigations on the effect of angiotensin II type 1 receptor antagonist losartan (30 mg/(kg·d), 8 weeks) on Cx43 expression were conducted with Western blot and immunohistochemistry. NF-κB p65 protein in nuclear extracts was determined by Western blot. Results: Left ventricular (LV) hypertrophy was prominent in SHRs, Cx43 and NF-κB p65 protein expressions were obviously upregulated and Cx43 distribution was dispersed over the cell surface. Treatment with losarton reduced the over-expressions of Cx43 and NF-κB p65 in LV myocardium. The distribution of Cx43 gap junction also became much regular and confined to intercalated disk after losartan treatment. Conclusion: Cx43 level was upregulated in LV myocardium of SHR during early stage of hypertrophy. Angiotensin II type 1 receptor antagonist losartan prevented Cx43 gap junction remodeling in hypertrophied left ventricles, possibly through the NF-κB pathway. PMID:18543397
Image method for induced surface charge from many-body system of dielectric spheres
NASA Astrophysics Data System (ADS)
Qin, Jian; de Pablo, Juan J.; Freed, Karl F.
2016-09-01
Charged dielectric spheres embedded in a dielectric medium provide the simplest model for many-body systems of polarizable ions and charged colloidal particles. We provide a multiple scattering formulation for the total electrostatic energy for such systems and demonstrate that the polarization energy can be rapidly evaluated by an image method that generalizes the image methods for conducting spheres. Individual contributions to the total electrostatic energy are ordered according to the number of polarized surfaces involved, and each additional surface polarization reduces the energy by a factor of (a/R)3ɛ, where a is the sphere radius, R the average inter-sphere separation, and ɛ the relevant dielectric mismatch at the interface. Explicit expressions are provided for both the energy and the forces acting on individual spheres, which can be readily implemented in Monte Carlo and molecular dynamics simulations of polarizable charged spheres, thereby avoiding costly computational techniques that introduce a surface charge distribution that requires numerical solution.
IImage method for induced surface charge from many-body system of dielectric spheres
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qin, Jian; de Pablo, Juan J.; Freed, Karl F.
2016-09-28
Charged dielectric spheres embedded in a dielectric medium provide the simplest model for many-body systems of polarizable ions and charged colloidal particles. We provide a multiple scattering formulation for the total electrostatic energy for such systems and demonstrate that the polarization energy can be rapidly evaluated by an image method that generalizes the image methods for conducting spheres. Individual contributions to the total electrostatic energy are ordered according to the number of polarized surfaces involved, and each additional surface polarization reduces the energy by a factor of (a/R)(3) epsilon, where a is the sphere radius, R the average inter-sphere separation,more » and. the relevant dielectric mismatch at the interface. Explicit expressions are provided for both the energy and the forces acting on individual spheres, which can be readily implemented in Monte Carlo and molecular dynamics simulations of polarizable charged spheres, thereby avoiding costly computational techniques that introduce a surface charge distribution that requires numerical solution.« less
Excitation of ship waves by a submerged object: New solution to the classical problem
NASA Astrophysics Data System (ADS)
Arzhannikov, A. V.; Kotelnikov, I. A.
2016-08-01
We have proposed a new method for solving the problem of ship waves excited on the surface of a nonviscous liquid by a submerged object that moves at a variable speed. As a first application of this method, we have obtained a new solution to the classic problem of ship waves generated by a submerged ball that moves rectilinearly with constant velocity parallel to the equilibrium surface of the liquid. For this example, we have derived asymptotic expressions describing the vertical displacement of the liquid surface in the limit of small and large values of the Froude number. The exact solution is presented in the form of two terms, each of which is reduced to one-dimensional integrals. One term describes the "Bernoulli hump" and another term the "Kelvin wedge." As a second example, we considered vertical oscillation of the submerged ball. In this case, the solution leads to the calculation of one-dimensional integral and describes surface waves propagating from the epicenter above the ball.
Excitation of ship waves by a submerged object: New solution to the classical problem.
Arzhannikov, A V; Kotelnikov, I A
2016-08-01
We have proposed a new method for solving the problem of ship waves excited on the surface of a nonviscous liquid by a submerged object that moves at a variable speed. As a first application of this method, we have obtained a new solution to the classic problem of ship waves generated by a submerged ball that moves rectilinearly with constant velocity parallel to the equilibrium surface of the liquid. For this example, we have derived asymptotic expressions describing the vertical displacement of the liquid surface in the limit of small and large values of the Froude number. The exact solution is presented in the form of two terms, each of which is reduced to one-dimensional integrals. One term describes the "Bernoulli hump" and another term the "Kelvin wedge." As a second example, we considered vertical oscillation of the submerged ball. In this case, the solution leads to the calculation of one-dimensional integral and describes surface waves propagating from the epicenter above the ball.
DE Colli, Marianna; Radunovic, Milena; Zizzari, Vincenzo L; DI Giacomo, Viviana; DI Nisio, Chiara; Piattelli, Adriano; Calvo Guirado, José L; Zavan, Barbara; Cataldi, Amelia; Zara, Susi
2018-03-30
Titanium surface modification is critical for dental implant success. Our aim was to determine surfaces influence on dental pulp stem cells (DPSCs) viability and differentiation. Implants were divided into sandblasted/acid-etched (control) and sandblasted/acid-etched coated with calcium and magnesium ions (CaMg), supplied as composite (test). Proliferation was evaluated by MTT, differentiation checking osteoblastic gene expression, PGE2 secretion and matrix formation, inflammation by Interleukin 6 (IL-6) detection. MTT and IL-6 do not modify on test. A PGE2 increase on test is recorded. BMP2 is higher on test at early experimental points, Osterix and RUNX2 augment later. Alizarin-red S reveals higher matrix production on test. These results suggest that test surface is more osteoinductive, representing a start point for in vivo studies aiming at the construction of more biocompatible dental implants, whose integration and clinical performance are improved and some undesired effects, such as implant stability loss and further surgical procedures, are reduced.
Surface diffusion of astrocytic glutamate transporters shapes synaptic transmission.
Murphy-Royal, Ciaran; Dupuis, Julien P; Varela, Juan A; Panatier, Aude; Pinson, Benoît; Baufreton, Jérôme; Groc, Laurent; Oliet, Stéphane H R
2015-02-01
Control of the glutamate time course in the synapse is crucial for excitatory transmission. This process is mainly ensured by astrocytic transporters, high expression of which is essential to compensate for their slow transport cycle. Although molecular mechanisms regulating transporter intracellular trafficking have been identified, the relationship between surface transporter dynamics and synaptic function remains unexplored. We found that GLT-1 transporters were highly mobile on rat astrocytes. Surface diffusion of GLT-1 was sensitive to neuronal and glial activities and was strongly reduced in the vicinity of glutamatergic synapses, favoring transporter retention. Notably, glutamate uncaging at synaptic sites increased GLT-1 diffusion, displacing transporters away from this compartment. Functionally, impairing GLT-1 membrane diffusion through cross-linking in vitro and in vivo slowed the kinetics of excitatory postsynaptic currents, indicative of a prolonged time course of synaptic glutamate. These data provide, to the best of our knowledge, the first evidence for a physiological role of GLT-1 surface diffusion in shaping synaptic transmission.
The Design of Case Products’ Shape Form Information Database Based on NURBS Surface
NASA Astrophysics Data System (ADS)
Liu, Xing; Liu, Guo-zhong; Xu, Nuo-qi; Zhang, Wei-she
2017-07-01
In order to improve the computer design of product shape design,applying the Non-uniform Rational B-splines(NURBS) of curves and surfaces surface to the representation of the product shape helps designers to design the product effectively.On the basis of the typical product image contour extraction and using Pro/Engineer(Pro/E) to extract the geometric feature of scanning mold,in order to structure the information data base system of value point,control point and node vector parameter information,this paper put forward a unified expression method of using NURBS curves and surfaces to describe products’ geometric shape and using matrix laboratory(MATLAB) to simulate when products have the same or similar function.A case study of electric vehicle’s front cover illustrates the access process of geometric shape information of case product in this paper.This method can not only greatly reduce the capacity of information debate,but also improve the effectiveness of computer aided geometric innovation modeling.
Intracellular mGluR5 plays a critical role in neuropathic pain
Vincent, Kathleen; Cornea, Virginia M.; Jong, Yuh-Jiin I.; Laferrière, André; Kumar, Naresh; Mickeviciute, Aiste; Fung, Jollee S. T.; Bandegi, Pouya; Ribeiro-da-Silva, Alfredo; O'Malley, Karen L.; Coderre, Terence J.
2016-01-01
Spinal mGluR5 is a key mediator of neuroplasticity underlying persistent pain. Although brain mGluR5 is localized on cell surface and intracellular membranes, neither the presence nor physiological role of spinal intracellular mGluR5 is established. Here we show that in spinal dorsal horn neurons >80% of mGluR5 is intracellular, of which ∼60% is located on nuclear membranes, where activation leads to sustained Ca2+ responses. Nerve injury inducing nociceptive hypersensitivity also increases the expression of nuclear mGluR5 and receptor-mediated phosphorylated-ERK1/2, Arc/Arg3.1 and c-fos. Spinal blockade of intracellular mGluR5 reduces neuropathic pain behaviours and signalling molecules, whereas blockade of cell-surface mGluR5 has little effect. Decreasing intracellular glutamate via blocking EAAT-3, mimics the effects of intracellular mGluR5 antagonism. These findings show a direct link between an intracellular GPCR and behavioural expression in vivo. Blockade of intracellular mGluR5 represents a new strategy for the development of effective therapies for persistent pain. PMID:26837579
Glozman, Rina; Okiyoneda, Tsukasa; Mulvihill, Cory M; Rini, James M; Barriere, Herve; Lukacs, Gergely L
2009-03-23
N-glycosylation, a common cotranslational modification, is thought to be critical for plasma membrane expression of glycoproteins by enhancing protein folding, trafficking, and stability through targeting them to the ER folding cycles via lectin-like chaperones. In this study, we show that N-glycans, specifically core glycans, enhance the productive folding and conformational stability of a polytopic membrane protein, the cystic fibrosis transmembrane conductance regulator (CFTR), independently of lectin-like chaperones. Defective N-glycosylation reduces cell surface expression by impairing both early secretory and endocytic traffic of CFTR. Conformational destabilization of the glycan-deficient CFTR induces ubiquitination, leading to rapid elimination from the cell surface. Ubiquitinated CFTR is directed to lysosomal degradation instead of endocytic recycling in early endosomes mediated by ubiquitin-binding endosomal sorting complex required for transport (ESCRT) adaptors Hrs (hepatocyte growth factor-regulated tyrosine kinase substrate) and TSG101. These results suggest that cotranslational N-glycosylation can exert a chaperone-independent profolding change in the energetic of CFTR in vivo as well as outline a paradigm for the peripheral trafficking defect of membrane proteins with impaired glycosylation.
Sasaki, Takanori; Kanaseki, Takayuki; Shionoya, Yosuke; Tokita, Serina; Miyamoto, Sho; Saka, Eri; Kochin, Vitaly; Takasawa, Akira; Hirohashi, Yoshihiko; Tamura, Yasuaki; Miyazaki, Akihiro; Torigoe, Toshihiko; Hiratsuka, Hiroyoshi; Sato, Noriyuki
2016-04-01
Hypoxia and glucose deprivation are often observed in the microenvironment surrounding solid tumors in vivo. However, how they interfere with MHC class I antigen processing and CD8(+) T-cell responses remains unclear. In this study, we analyzed the production of antigenic peptides presented by classical MHC class I in mice, and showed that it is quantitatively decreased in the cells exposed to either hypoxia or glucose deprivation. In addition, we unexpectedly found increased surface expression of HLA-E in human and Qa-1 in mouse tumor cells exposed to combined oxygen and glucose deprivation. The induced Qa-1 on the stressed tumor model interacted with an inhibitory NKG2/CD94 receptor on activated CD8(+) T cells and attenuated their specific response to the antigen. Our results thus suggest that microenvironmental stresses modulate not only classical but also nonclassical MHC class I presentation, and confer the stressed cells the capability to escape from the CD8(+) T-cell recognition. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mehta, Dipakkumar; Kumar, M H Sathish; Sabikhi, Latha
2017-11-01
The current work aimed to formulate smoothie by optimizing varying levels of soy protein isolate (1.5-2.5% w/w), sucralose (150-190 ppm) and pectin (0.3-0.5% w/w) along with milk, legume (chickpea), vegetable (carrot), fruit (mango), honey and trisodium citrate by response surface methodology on the basis of sensory (color and appearance, flavor, consistency, sweetness and overall acceptability) and physical (expressible serum and viscosity) responses. Soy protein isolate and pectin levels influenced color and appearance, flavor, consistency and overall acceptability significantly. Soy protein isolate and pectin showed a positive correlation with viscosity of smoothie with reduced expressible serum. Smoothie was optimized with 1.8% (w/w) soy protein isolate, 166.8 ppm sucralose, and 0.5% (w/w) pectin with acceptable quality. One serving (325 ml) of optimized smoothie provides approximately 23% protein, 27% dietary fiber of the recommended daily values and provides approximately 74 kcal per 100 ml of smoothie, which renders smoothie as a high protein, high fiber, grab-and-go breakfast option.
Ahuja, Gaurav; Reichel, Vera; Kowatschew, Daniel; Syed, Adnan S; Kotagiri, Aswani Kumar; Oka, Yuichiro; Weth, Franco; Korsching, Sigrun I
2018-05-23
The sense of smell is unrivaled in terms of molecular complexity of its input channels. Even zebrafish, a model vertebrate system in many research fields including olfaction, possesses several hundred different olfactory receptor genes, organized in four different gene families. For one of these families, the initially discovered odorant receptors proper, segregation of expression into distinct spatial subdomains within a common sensory surface has been observed both in teleost fish and in mammals. However, for the remaining three families, little to nothing was known about their spatial coding logic. Here we wished to investigate, whether the principle of spatial segregation observed for odorant receptors extends to another olfactory receptor family, the V2R-related OlfC genes. Furthermore we thought to examine, how expression of OlfC genes is integrated into expression zones of odorant receptor genes, which in fish share a single sensory surface with OlfC genes. To select representative genes, we performed a comprehensive phylogenetic study of the zebrafish OlfC family, which identified a novel OlfC gene, reduced the number of pseudogenes to 1, and brought the total family size to 60 intact OlfC receptors. We analyzed the spatial pattern of OlfC-expressing cells for seven representative receptors in three dimensions (height within the epithelial layer, horizontal distance from the center of the olfactory organ, and height within the olfactory organ). We report non-random distributions of labeled neurons for all OlfC genes analysed. Distributions for sparsely expressed OlfC genes are significantly different from each other in nearly all cases, broad overlap notwithstanding. For two of the three coordinates analyzed, OlfC expression zones are intercalated with those of odorant receptor zones, whereas in the third dimension some segregation is observed. Our results show that V2R-related OlfC genes follow the same spatial logic of expression as odorant receptors and their expression zones intermingle with those of odorant receptor genes. Thus, distinctly different expression zones for individual receptor genes constitute a general feature shared by teleost and tetrapod V2R/OlfC and odorant receptor families alike.
Tsukaguchi, H; Matsubara, H; Taketani, S; Mori, Y; Seido, T; Inada, M
1995-01-01
Nephrogenic diabetes insipidus (NDI) is most often an X-linked disorder in which urine is not concentrated due to renal resistance to arginine vasopressin. We recently identified four vasopressin type 2 receptor gene mutations in unrelated X-linked NDI families, including R143P, delta V278, R202C, and 804insG. All these mutations reduced ligand binding activity to < 10% of the normal without affecting mRNA accumulation. To elucidate whether the receptors are expressed on the cell surface, we analyzed biosynthesis and localization of tagged or untagged receptors stably expressed in Chinese hamster ovary (CHO) cells, using two antibodies directed against distinct termini. Whole-cell and surface labeling studies revealed that the R202C clone had both surface-localized (50-55 kD) and intracellular proteins (40 and 75 kD), similar to the wild-type AVPR2 clone, whereas the R143P and delta V278 clones lacked the surface receptors, despite relatively increased intracellular components. The 804insG mutant cell produced no proteins despite an adequate mRNA level. Immunofluorescence staining confirmed that the R202C mutant reaches the cell surface, whereas the R143P and delta V278 mutants are retained within the cytoplasmic compartment. Thus, R202C, R143P/delta V278, and 804insG result in three distinct phenotypes, that is, a simple binding impairment at the cell surface, blocked intracellular transport, and ineffective biosynthesis or/and accelerated degradation of the receptor, respectively, and therefore are responsible for NDI. This phenotypic classification will help understanding of molecular pathophysiology of this disorder. Images PMID:7560098
[Recent progress of research and applications of fractal and its theories in medicine].
Cai, Congbo; Wang, Ping
2014-10-01
Fractal, a mathematics concept, is used to describe an image of self-similarity and scale invariance. Some organisms have been discovered with the fractal characteristics, such as cerebral cortex surface, retinal vessel structure, cardiovascular network, and trabecular bone, etc. It has been preliminarily confirmed that the three-dimensional structure of cells cultured in vitro could be significantly enhanced by bionic fractal surface. Moreover, fractal theory in clinical research will help early diagnosis and treatment of diseases, reducing the patient's pain and suffering. The development process of diseases in the human body can be expressed by the fractal theories parameter. It is of considerable significance to retrospectively review the preparation and application of fractal surface and its diagnostic value in medicine. This paper gives an application of fractal and its theories in the medical science, based on the research achievements in our laboratory.
Hinc, Krzysztof; Isticato, Rachele; Dembek, Marcin; Karczewska, Joanna; Iwanicki, Adam; Peszyńska-Sularz, Grazyna; De Felice, Maurilio; Obuchowski, Michał; Ricca, Ezio
2010-01-18
The bacterial endospore (spore) has recently been proposed as a new surface display system. Antigens and enzymes have been successfully exposed on the surface layers of the Bacillus subtilis spore, but only in a few cases the efficiency of expression and the effective surface display and have been determined. We used this heterologous expression system to produce the A subunit of the urease of the animal pathogen Helicobater acinonychis. Ureases are multi-subunit enzymes with a central role in the virulence of various bacterial pathogens and necessary for colonization of the gastric mucosa by the human pathogen H. pylori. The urease subunit UreA has been recognized as a major antigen, able to induce high levels of protection against challenge infections. We expressed UreA from H. acinonychis on the B. subtilis spore coat by using three different spore coat proteins as carriers and compared the efficiency of surface expression and surface display obtained with the three carriers. A combination of western-, dot-blot and immunofluorescence microscopy allowed us to conclude that, when fused to CotB, UreA is displayed on the spore surface (ca. 1 x 10(3) recombinant molecules per spore), whereas when fused to CotC, although most efficiently expressed (7-15 x 10(3) recombinant molecules per spore) and located in the coat layer, it is not displayed on the surface. Experiments with CotG gave results similar to those with CotC, but the CotG-UreA recombinant protein appeared to be partially processed. UreA was efficiently expressed on the spore coat of B. subtilis when fused to CotB, CotC or CotG. Of these three coat proteins CotC allows the highest efficiency of expression, whereas CotB is the most appropriate for the display of heterologous proteins on the spore surface.
Bancroft, Tara; Bouaouina, Mohamed; Roberts, Sophia; Lee, Monica; Calderwood, David A.; Schwartz, Martin; Simons, Michael; Sessa, William C.; Kyriakides, Themis R.
2015-01-01
Vascular remodeling is essential for tissue repair and is regulated by multiple factors, including thrombospondin-2 (TSP2) and hypoxia/VEGF-induced activation of Akt. In contrast to TSP2 knock-out (KO) mice, Akt1 KO mice have elevated TSP2 expression and delayed tissue repair. To investigate the contribution of increased TSP2 to Akt1 KO mice phenotypes, we generated Akt1/TSP2 double KO (DKO) mice. Full-thickness excisional wounds in DKO mice healed at an accelerated rate when compared with Akt1 KO mice. Isolated dermal Akt1 KO fibroblasts expressed increased TSP2 and displayed altered morphology and defects in migration and adhesion. These defects were rescued in DKO fibroblasts or after TSP2 knockdown. Conversely, the addition of exogenous TSP2 to WT cells induced cell morphology and migration rates that were similar to those of Akt1 KO cells. Akt1 KO fibroblasts displayed reduced adhesion to fibronectin with manganese stimulation when compared with WT and DKO cells, revealing an Akt1-dependent role for TSP2 in regulating integrin-mediated adhesions; however, this effect was not due to changes in β1 integrin surface expression or activation. Consistent with these results, Akt1 KO fibroblasts displayed reduced Rac1 activation that was dependent upon expression of TSP2 and could be rescued by a constitutively active Rac mutant. Our observations show that repression of TSP2 expression is a critical aspect of Akt1 function in tissue repair. PMID:25389299
Zou, Yuquan; Lai, Benjamin F L; Kizhakkedathu, Jayachandran N; Brooks, Donald E
2010-12-08
Poly(N,N-dimethylacrylamide) (PDMA) brushes are successfully grown from unplasticized poly(vinyl chloride) (uPVC) by well-controlled surface-initiated atom transfer radical polymerization (SI-ATRP). Molecular weights of the grafted PDMA brushes vary from ≈ 35,000 to 2,170000 Da, while the graft density ranges from 0.08 to 1.13 chains · nm(-2). The polydispersity of the grafted PDMA brushes is controlled within 1.20 to 1.80. Platelet activation (expression of CD62) and adhesion studies reveal that the graft densities of the PDMA brushes play an important role in controlling interfacial properties. PDMA brushes with graft densities between 0.35 and 0.50 chains · nm(-2) induce a significantly reduced platelet activation compared to unmodified uPVC. Moreover, the surface adhesion of platelets on uPVC is significantly reduced by the densely grafted PDMA brushes. PDMA brushes that have high molecular weights lead to a relatively lower platelet activation compared to low-molecular-weight brushes. However, the graft density of the brush is more important than molecular weight in controlling platelet interactions with PVC. PDMA brushes do not produce any significant platelet consumption in platelet rich plasma. Up to a seven-fold decrease in the number of platelets adhered on high graft density brushes is observed compared to the bare PVC surface. Unlike the bare PVC, platelets do not form pseudopodes or change morphology on PDMA brush-coated surfaces. Copyright © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Morita, Chisato; Sumioka, Ryuichi; Nakata, Masanobu; Okahashi, Nobuo; Wada, Satoshi; Yamashiro, Takashi; Hayashi, Mikako; Hamada, Shigeyuki; Sumitomo, Tomoko; Kawabata, Shigetada
2014-01-01
Streptococcus sanguinis, a member of the commensal mitis group of streptococci, is a primary colonizer of the tooth surface, and has been implicated in infectious complications including bacteremia and infective endocarditis. During disease progression, S. sanguinis may utilize various cell surface molecules to evade the host immune system to survive in blood. In the present study, we discovered a novel cell surface nuclease with a cell-wall anchor domain, termed SWAN (streptococcal wall-anchored nuclease), and investigated its contribution to bacterial resistance against the bacteriocidal activity of neutrophil extracellular traps (NETs). Recombinant SWAN protein (rSWAN) digested multiple forms of DNA including NET DNA and human RNA, which required both Mg(2+) and Ca(2+) for optimum activity. Furthermore, DNase activity of S. sanguinis was detected around growing colonies on agar plates containing DNA. In-frame deletion of the swan gene mostly reduced that activity. These findings indicated that SWAN is a major nuclease displayed on the surface, which was further confirmed by immuno-detection of SWAN in the cell wall fraction. The sensitivity of S. sanguinis to NET killing was reduced by swan gene deletion. Moreover, heterologous expression of the swan gene rendered a Lactococcus lactis strain more resistant to NET killing. Our results suggest that the SWAN nuclease on the bacterial surface contributes to survival in the potential situation of S. sanguinis encountering NETs during the course of disease progression.
Nakata, Masanobu; Okahashi, Nobuo; Wada, Satoshi; Yamashiro, Takashi; Hayashi, Mikako; Hamada, Shigeyuki; Sumitomo, Tomoko; Kawabata, Shigetada
2014-01-01
Streptococcus sanguinis, a member of the commensal mitis group of streptococci, is a primary colonizer of the tooth surface, and has been implicated in infectious complications including bacteremia and infective endocarditis. During disease progression, S. sanguinis may utilize various cell surface molecules to evade the host immune system to survive in blood. In the present study, we discovered a novel cell surface nuclease with a cell-wall anchor domain, termed SWAN (streptococcal wall-anchored nuclease), and investigated its contribution to bacterial resistance against the bacteriocidal activity of neutrophil extracellular traps (NETs). Recombinant SWAN protein (rSWAN) digested multiple forms of DNA including NET DNA and human RNA, which required both Mg2+ and Ca2+ for optimum activity. Furthermore, DNase activity of S. sanguinis was detected around growing colonies on agar plates containing DNA. In-frame deletion of the swan gene mostly reduced that activity. These findings indicated that SWAN is a major nuclease displayed on the surface, which was further confirmed by immuno-detection of SWAN in the cell wall fraction. The sensitivity of S. sanguinis to NET killing was reduced by swan gene deletion. Moreover, heterologous expression of the swan gene rendered a Lactococcus lactis strain more resistant to NET killing. Our results suggest that the SWAN nuclease on the bacterial surface contributes to survival in the potential situation of S. sanguinis encountering NETs during the course of disease progression. PMID:25084357
Balyasnikova, Irina V; Franco-Gou, Rosa; Mathis, J Michael; Lesniak, Maciej S
2010-06-01
Human adult mesenchymal stem cells (hMSCs) are under active investigation as cellular carriers for gene therapy. hMSCs possess natural tropism toward tumours; however, the targeting of hMSCs to specific cell populations within tumours is unexplored. In the case of glioblastoma multiforme (GBM), at least half of the tumours express EGFRvIII on the cell surface, an ideal target for antibody-mediated gene/drug delivery. In this study, we investigated the feasibility of genetically modifying hMSCs to express a single-chain antibody (scFv) to EGFRvIII on their surfaces. Nucleofection was used to transfect hMSCs with cDNA encoding scFv EGFRvIII fused with PDGFR or human B7-1 transmembrane domains. The expression of scFv EGFRvIII on the cell surface was assessed by FACS. A stable population of scFv EGFRvIII-expressing hMSCs was selected, based on antibiotic resistance, and enriched using FACS. We found that nucleofection allows the efficient expression of scFv EGFRvIII on the cell surface of hMSCs. hMSCs transfected with the construct encoding scFv EGFRvIII as a fusion with PDGFRtm showed scFv EGFRvIII expression in up to 86% of cells. Most importantly, human MSCs expressing scFv against EGFRvIII demonstrated enhanced binding to U87-EGFRvIII cells in vitro and significantly increased retention in human U87-EGFRvIII-expressing tumours in vivo. In summary, we provide the first conclusive evidence of genetic modification of hMSCs with a single-chain antibody against an antigen expressed on the surface of tumour cells, thereby opening up a new venue for enhanced delivery of gene therapy applications in the context of malignant brain cancer. Copyright 2009 John Wiley & Sons, Ltd.
Winkler, Martin Sebastian; Rissiek, Anne; Priefler, Marion; Schwedhelm, Edzard; Robbe, Linda; Bauer, Antonia; Zahrte, Corinne; Zoellner, Christian; Kluge, Stefan; Nierhaus, Axel
2017-01-01
Background Sepsis is defined as a dysregulated immune response to infection. Impaired immune response in sepsis, often described as endotoxin tolerance, is characterized by unresponsiveness of monocytes on lipopolysaccharide (LPS) stimulation to release tumor necrosis factor α (TNFα). Furthermore, decreased monocyte surface protein expression of human leucocyte antigen DR (HLA-DR) is a marker for changes of the innate immune response during sepsis. Quantitative polymerase chain reaction (qPCR) and flow-cytometry (FACS) have been used to measure protein or gene expression of HLA-DR. We aimed to determine whether changes in mRNA expression of HLA-DR are associated with impaired TNFα response in human sepsis. Methods Surface protein together with mRNA expression of HLA-DR were measured by FACS and qPCR in a cohort of 9 sepsis patients and compared to 10 pre-operative control patients in a prospective study. In addition, 20 patients with post-surgical inflammation, 20 patients with sepsis or septic shock were included and TNFα was determined following ex vivo stimulation of whole blood with 500 pg/mL LPS. Total RNA was prepared from whole blood and subjected to qPCR analysis for expression analysis of HLA-DR alpha (HLA-DRA) to correlate TNFα response with HLA-DRA expression. Results Patients with sepsis presented higher numbers of monocytes in peripheral blood (P<0.001) but decreased surface protein and mRNA HLA-DR levels when compared to controls. In all patients mRNA expression of HLA-DRA was decreased by approximately 70% compared to controls (P<0.01) and was lowest in patients with sepsis or septic shock (P<0.01). TNFα response to LPS was decreased in all patients (median 319 pg/mL versus controls 1256 pg/mL; P<0.01) and lowest in patients with sepsis or septic shock (median 128 pg/mL; P<0.01). HLA-DRA correlated positively with TNFα response in all study participants (r +0.60, P<0.001) and within patients (r +0.67, P<0.001). The TNFα:HLA-DRA ratio correlated negatively with severity and the Sequential Organ Failure Assessment (SOFA) score (Spearman’s rho -0.59, P<0.001) Conclusion In this study, HLA-DRA expression was associated with a functional assay of the innate immune response. Future interventional studies aimed at the immune response during sepsis could make use of these methods for optimizing target groups based on biological plausibility and intervention effectiveness. PMID:28771573
Winkler, Martin Sebastian; Rissiek, Anne; Priefler, Marion; Schwedhelm, Edzard; Robbe, Linda; Bauer, Antonia; Zahrte, Corinne; Zoellner, Christian; Kluge, Stefan; Nierhaus, Axel
2017-01-01
Sepsis is defined as a dysregulated immune response to infection. Impaired immune response in sepsis, often described as endotoxin tolerance, is characterized by unresponsiveness of monocytes on lipopolysaccharide (LPS) stimulation to release tumor necrosis factor α (TNFα). Furthermore, decreased monocyte surface protein expression of human leucocyte antigen DR (HLA-DR) is a marker for changes of the innate immune response during sepsis. Quantitative polymerase chain reaction (qPCR) and flow-cytometry (FACS) have been used to measure protein or gene expression of HLA-DR. We aimed to determine whether changes in mRNA expression of HLA-DR are associated with impaired TNFα response in human sepsis. Surface protein together with mRNA expression of HLA-DR were measured by FACS and qPCR in a cohort of 9 sepsis patients and compared to 10 pre-operative control patients in a prospective study. In addition, 20 patients with post-surgical inflammation, 20 patients with sepsis or septic shock were included and TNFα was determined following ex vivo stimulation of whole blood with 500 pg/mL LPS. Total RNA was prepared from whole blood and subjected to qPCR analysis for expression analysis of HLA-DR alpha (HLA-DRA) to correlate TNFα response with HLA-DRA expression. Patients with sepsis presented higher numbers of monocytes in peripheral blood (P<0.001) but decreased surface protein and mRNA HLA-DR levels when compared to controls. In all patients mRNA expression of HLA-DRA was decreased by approximately 70% compared to controls (P<0.01) and was lowest in patients with sepsis or septic shock (P<0.01). TNFα response to LPS was decreased in all patients (median 319 pg/mL versus controls 1256 pg/mL; P<0.01) and lowest in patients with sepsis or septic shock (median 128 pg/mL; P<0.01). HLA-DRA correlated positively with TNFα response in all study participants (r +0.60, P<0.001) and within patients (r +0.67, P<0.001). The TNFα:HLA-DRA ratio correlated negatively with severity and the Sequential Organ Failure Assessment (SOFA) score (Spearman's rho -0.59, P<0.001). In this study, HLA-DRA expression was associated with a functional assay of the innate immune response. Future interventional studies aimed at the immune response during sepsis could make use of these methods for optimizing target groups based on biological plausibility and intervention effectiveness.
Dexmedetomidine Prevents Excessive γ-Aminobutyric Acid Type A Receptor Function after Anesthesia.
Wang, Dian-Shi; Kaneshwaran, Kirusanthy; Lei, Gang; Mostafa, Fariya; Wang, Junhui; Lecker, Irene; Avramescu, Sinziana; Xie, Yu-Feng; Chan, Nathan K; Fernandez-Escobar, Alejandro; Woo, Junsung; Chan, Darren; Ramsey, Amy J; Sivak, Jeremy M; Lee, C Justin; Bonin, Robert P; Orser, Beverley A
2018-06-08
Postoperative delirium is associated with poor long-term outcomes and increased mortality. General anesthetic drugs may contribute to delirium because they increase cell-surface expression and function of α5 subunit-containing γ-aminobutyric acid type A receptors, an effect that persists long after the drugs have been eliminated. Dexmedetomidine, an α2 adrenergic receptor agonist, prevents delirium in patients and reduces cognitive deficits in animals. Thus, it was postulated that dexmedetomidine prevents excessive function of α5 γ-aminobutyric acid type A receptors. Injectable (etomidate) and inhaled (sevoflurane) anesthetic drugs were studied using cultured murine hippocampal neurons, cultured murine and human cortical astrocytes, and ex vivo murine hippocampal slices. γ-Aminobutyric acid type A receptor function and cell-signaling pathways were studied using electrophysiologic and biochemical methods. Memory and problem-solving behaviors were also studied. The etomidate-induced sustained increase in α5 γ-aminobutyric acid type A receptor cell-surface expression was reduced by dexmedetomidine (mean ± SD, etomidate: 146.4 ± 51.6% vs. etomidate + dexmedetomidine: 118.4 ± 39.1% of control, n = 8 each). Dexmedetomidine also reduced the persistent increase in tonic inhibitory current in hippocampal neurons (etomidate: 1.44 ± 0.33 pA/pF, n = 10; etomidate + dexmedetomidine: 1.01 ± 0.45 pA/pF, n = 9). Similarly, dexmedetomidine prevented a sevoflurane-induced increase in the tonic current. Dexmedetomidine stimulated astrocytes to release brain-derived neurotrophic factor, which acted as a paracrine factor to reduce excessive α5 γ-aminobutyric acid type A receptor function in neurons. Finally, dexmedetomidine attenuated memory and problem-solving deficits after anesthesia. Dexmedetomidine prevented excessive α5 γ-aminobutyric acid type A receptor function after anesthesia. This novel α2 adrenergic receptor- and brain-derived neurotrophic factor-dependent pathway may be targeted to prevent delirium.
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
Parasar, Parveen; Wilhelm, Amanda; Rutigliano, Heloisa M; Thomas, Aaron J; Teng, Lihong; Shi, Bi; Davis, William C; Suarez, Carlos E; New, Daniel D; White, Kenneth L; Davies, Christopher J
2016-08-01
Major histocompatibility complex class I (MHC-I) proteins can be expressed as cell surface or secreted proteins. To investigate whether bovine non-classical MHC-I proteins are expressed as cell surface or secreted proteins, and to assess the reactivity pattern of monoclonal antibodies with non-classical MHC-I isoforms, we expressed the MHC proteins in murine P815 and human K562 (MHC-I deficient) cells. Following antibiotic selection, stably transfected cell lines were stained with H1A or W6/32 antibodies to detect expression of the MHC-I proteins by flow cytometry. Two non-classical proteins (BoLA-NC1*00501 and BoLA-NC3*00101) were expressed on the cell surface in both cell lines. Surprisingly, the BoLA-NC4*00201 protein was expressed on the cell membrane of human K562 but not mouse P815 cells. Two non-classical proteins (BoLA-NC1*00401, which lacks a transmembrane domain, and BoLA-NC2*00102) did not exhibit cell surface expression. Nevertheless, Western blot analyses demonstrated expression of the MHC-I heavy chain in all transfected cell lines. Ammonium-sulfate precipitation of proteins from culture supernatants showed that BoLA-NC1*00401 was secreted and that all surface expressed proteins where shed from the cell membrane by the transfected cells. Interestingly, the surface expressed MHC-I proteins were present in culture supernatants at a much higher concentration than BoLA-NC1*00401. This comprehensive study shows that bovine non-classical MHC-I proteins BoLA-NC1*00501, BoLA-NC3*00101, and BoLA-NC4*00201 are expressed as surface isoforms with the latter reaching the cell membrane only in K562 cells. Furthermore, it demonstrated that BoLA-NC1*00401 is a secreted isoform and that significant quantities of membrane associated MHC-I proteins can be shed from the cell membrane. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Harris, W F
1989-03-01
The exact equation for sagitta of spherical surfaces is generalized to toric surfaces which include spherical and cylindrical surfaces as special cases. Lens thickness, therefore, can be calculated accurately anywhere on a lens even in cases of extreme spherical and cylindrical powers and large diameters. The sagittae of tire- and barrel-form toric surfaces differ off the principal meridians, as is shown by a numerical example. The same holds for pulley- and capstan-form toric surfaces. A general expression is given for thickness at an arbitrary point on a toric lens. Approximate expressions are derived and re-expressed in terms of matrices. The matrix provides an elegant means of generalizing equations for spherical surfaces and lenses to toric surfaces and lenses.
Hao, Yuwei; Li, Yingying; Zhang, Feilong; Cui, Haijun; Hu, Jinsong; Meng, Jingxin; Wang, Shutao
2018-03-23
Highly efficient cell capture and release with low background are urgently required for early diagnosis of diseases such as cancer. Herein, we report an electrochemical responsive superhydrophilic surface exhibiting specific cell capture and release with high yields and extremely low nonspecific adhesion. Through electrochemical deposition, 3-substituted thiophene derivatives are deposited onto indium tin oxide (ITO) nanowire arrays with 4-n-nonylbenzeneboronic acid (BA) as dopant, fabricating the electrochemical responsive superhydrophilic surfaces. The molecular recognition between sialic acids over-expressed on the cell membrane and doped BAs endows the electrochemical responsive surfaces with the ability to capture and release targeted cancer cells. By adjusting the substituent group of thiophene derivatives, the surface wettability can be readily regulated and further utilized for reducing nonspecific cell adhesion. Significantly, the released cells still maintain a high proliferation ability, which indicates that the applied potential does not significantly harm the cells. Therefore, these results may provide a new strategy to achieve advanced functions of biomedical materials, such as low nonspecific adhesion. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Surface activation of dyed fabric for cellulase treatment.
Schimper, Christian B; Ibanescu, Constanta; Bechtold, Thomas
2011-10-01
Surface activation of fabric made from cellulose fibres, such as viscose, lyocell, modal fibres and cotton, can be achieved by printing of a concentrated NaOH-containing paste. From the concentration of reducing sugars formed in solution, an increase in intensity of the cellulase hydrolysis by a factor of six to eight was observed, which was mainly concentrated at the activated parts of the fabric surface. This method of local activation is of particular interest for modification of materials that have been dyed with special processes to attain an uneven distribution of dyestuff within the yarn cross-section, e.g., indigo ring-dyed denim yarn for jeans production. Fabrics made from regenerated cellulose fibres were used as model substrate to express the effects of surface activation on indigo-dyed material. Wash-down experiments on indigo-dyed denim demonstrated significant colour removal from the activated surface at low overall weight loss of 4-5%. The method is of relevance for a more eco-friendly processing of jeans in the garment industry. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hammond, Stephanie; Wagenknecht-Wiesner, Alice; Veatch, Sarah L; Holowka, David; Baird, Barbara
2009-10-01
In mast cells, antigen-mediated cross-linking of IgE bound to its high-affinity surface receptor, FcepsilonRI, initiates a signaling cascade that culminates in degranulation and release of allergic mediators. Antigen-patterned surfaces, in which the antigen is deposited in micron-sized features on a silicon substrate, were used to examine the spatial relationship between clustered IgE-FcepsilonRI complexes and Lyn, the signal-initiating tyrosine kinase. RBL mast cells expressing wild-type Lyn-EGFP showed co-redistribution of this protein with clustered IgE receptors on antigen-patterned surfaces, whereas Lyn-EGFP containing an inhibitory point mutation in its SH2 domain did not significantly accumulate with the patterned antigen, and Lyn-EGFP with an inhibitory point mutation in its SH3 domain exhibited reduced interactions. Our results using antigen-patterned surfaces and quantitative cross-correlation image analysis reveal that both the SH2 and SH3 domains contribute to interactions between Lyn kinase and cross-linked IgE receptors in stimulated mast cells.
Tsiklauri, Lali; Werner, Janina; Kampschulte, Marian; Frommer, Klaus W; Berninger, Lucija; Irrgang, Martina; Glenske, Kristina; Hose, Dirk; El Khassawna, Thaqif; Pons-Kühnemann, Jörn; Rehart, Stefan; Wenisch, Sabine; Müller-Ladner, Ulf; Neumann, Elena
2018-06-13
Age-related bone loss is associated with bone marrow adiposity. Adipokines (e.g. visfatin, resistin, leptin) are adipocyte-derived factors with immunomodulatory properties and might influence differentiation of bone marrow-derived mesenchymal stem cells (MSC) in osteoarthritis (OA) and osteoporosis. Thus, the presence of adipokines and MMPs in bone marrow and their effects on MSC differentiation were analyzed. MSC and RNA were isolated from femoral heads after hip replacement surgery of OA or osteoporotic femoral neck fracture (FF) patients. Bone structural parameters were evaluated by μCT. MSC were differentiated towards adipocytes or osteoblasts with/without adipokines. Gene expression (adipokines, bone marker genes, MMPs, TIMPs) and cytokine production was evaluated by realtime-PCR and ELISA. Matrix mineralization was quantified using Alizarin red S staining. μCT showed an osteoporotic phenotype of FF compared to OA bone (reduced trabecular thickness and increased ratio of bone surface vs. volume of solid bone). Visfatin and leptin were increased in FF vs OA. Visfatin induced the secretion of IL-6, IL-8, and MCP-1 during osteogenic and adipogenic differentiation. In contrast to resistin and leptin, visfatin increased MMP2 and MMP13 during Adipognesis. In osteogenically differentiated cells, MMPs and TIMPs were reduced by visfatin. Visfatin significantly increased matrix mineralization during osteogenesis, whereas collagen type I expression was reduced. Visfatin-mediated increase of matrix mineralization and reduced collagen type I expression could contribute to bone fragility. Visfatin is involved in impaired bone remodeling at the adipose tissue/bone interface through induction of proinflammatory factors and dysregulated MMP/TIMP balance during MSC differentiation. Copyright © 2018. Published by Elsevier Ltd.
Paradoxical leanness in the imprinting-centre deletion mouse model for Prader–Willi syndrome
Golding, David M; Rees, Daniel J; Davies, Jennifer R; Relkovic, Dinko; Furby, Hannah V; Guschina, Irina A; Hopkins, Anna L; Davies, Jeffrey S; Resnick, James L; Isles, Anthony R
2016-01-01
Prader–Willi syndrome (PWS), a neurodevelopmental disorder caused by loss of paternal gene expression from 15q11–q13, is characterised by growth retardation, hyperphagia and obesity. However, as single gene mutation mouse models for this condition display an incomplete spectrum of the PWS phenotype, we have characterised the metabolic impairment in a mouse model for ‘full’ PWS, in which deletion of the imprinting centre (IC) abolishes paternal gene expression from the entire PWS cluster. We show that PWS-ICdel mice displayed postnatal growth retardation, with reduced body weight, hyperghrelinaemia and marked abdominal leanness; proportionate retroperitoneal, epididymal/omental and inguinal white adipose tissue (WAT) weights being reduced by 82%, 84% and 67%, respectively. PWS-ICdel mice also displayed a 48% reduction in proportionate interscapular brown adipose tissue (isBAT) weight with significant ‘beiging’ of abdominal WAT, and a 2°C increase in interscapular surface body temperature. Maintenance of PWS-ICdel mice under thermoneutral conditions (30°C) suppressed the thermogenic activity in PWS-ICdel males, but failed to elevate the abdominal WAT weight, possibly due to a normalisation of caloric intake. Interestingly, PWS-ICdel mice also showed exaggerated food hoarding behaviour with standard and high-fat diets, but despite becoming hyperphagic when switched to a high-fat diet, PWS-ICdel mice failed to gain weight. This evidence indicates that, unlike humans with PWS, loss of paternal gene expression from the PWS cluster in mice results in abdominal leanness. Although reduced subcutaneous insulation may lead to exaggerated heat loss and thermogenesis, abdominal leanness is likely to arise from a reduced lipid storage capacity rather than increased energy utilisation in BAT. PMID:27799465
Paradoxical leanness in the imprinting-centre deletion mouse model for Prader-Willi syndrome.
Golding, David M; Rees, Daniel J; Davies, Jennifer R; Relkovic, Dinko; Furby, Hannah V; Guschina, Irina A; Hopkins, Anna L; Davies, Jeffrey S; Resnick, James L; Isles, Anthony R; Wells, Timothy
2017-01-01
Prader-Willi syndrome (PWS), a neurodevelopmental disorder caused by loss of paternal gene expression from 15q11-q13, is characterised by growth retardation, hyperphagia and obesity. However, as single gene mutation mouse models for this condition display an incomplete spectrum of the PWS phenotype, we have characterised the metabolic impairment in a mouse model for 'full' PWS, in which deletion of the imprinting centre (IC) abolishes paternal gene expression from the entire PWS cluster. We show that PWS-IC del mice displayed postnatal growth retardation, with reduced body weight, hyperghrelinaemia and marked abdominal leanness; proportionate retroperitoneal, epididymal/omental and inguinal white adipose tissue (WAT) weights being reduced by 82%, 84% and 67%, respectively. PWS-IC del mice also displayed a 48% reduction in proportionate interscapular brown adipose tissue (isBAT) weight with significant 'beiging' of abdominal WAT, and a 2°C increase in interscapular surface body temperature. Maintenance of PWS-IC del mice under thermoneutral conditions (30°C) suppressed the thermogenic activity in PWS-IC del males, but failed to elevate the abdominal WAT weight, possibly due to a normalisation of caloric intake. Interestingly, PWS-IC del mice also showed exaggerated food hoarding behaviour with standard and high-fat diets, but despite becoming hyperphagic when switched to a high-fat diet, PWS-IC del mice failed to gain weight. This evidence indicates that, unlike humans with PWS, loss of paternal gene expression from the PWS cluster in mice results in abdominal leanness. Although reduced subcutaneous insulation may lead to exaggerated heat loss and thermogenesis, abdominal leanness is likely to arise from a reduced lipid storage capacity rather than increased energy utilisation in BAT. © 2017 The authors.
NASA Astrophysics Data System (ADS)
Guo, Weibo; Wang, Shu; Yu, Xin; Qiu, Jichuan; Li, Jianhua; Tang, Wei; Li, Zhou; Mou, Xiaoning; Liu, Hong; Wang, Zhonglin
2016-01-01
The cell-material interface is one of the most important considerations in designing a high-performance tissue engineering scaffold because the surface of the scaffold can determine the fate of stem cells. A conductive surface is required for a scaffold to direct stem cells toward neural differentiation. However, most conductive polymers are toxic and not amenable to biological degradation, which restricts the design of neural tissue engineering scaffolds. In this study, we used a bioactive three-dimensional (3D) porcine acellular dermal matrix (PADM), which is mainly composed of type I collagen, as a basic material and successfully assembled a layer of reduced graphene oxide (rGO) nanosheets on the surface of the PADM channels to obtain a porous 3D, biodegradable, conductive and biocompatible PADM-rGO hybrid neural tissue engineering scaffold. Compared with the PADM scaffold, assembling the rGO into the scaffold did not induce a significant change in the microstructure but endowed the PADM-rGO hybrid scaffold with good conductivity. A comparison of the neural differentiation of rat bone-marrow-derived mesenchymal stem cells (MSCs) was performed by culturing the MSCs on PADM and PADM-rGO scaffolds in neuronal culture medium, followed by the determination of gene expression and immunofluorescence staining. The results of both the gene expression and protein level assessments suggest that the rGO-assembled PADM scaffold may promote the differentiation of MSCs into neuronal cells with higher protein and gene expression levels after 7 days under neural differentiation conditions. This study demonstrated that the PADM-rGO hybrid scaffold is a promising scaffold for neural tissue engineering; this scaffold can not only support the growth of MSCs at a high proliferation rate but also enhance the differentiation of MSCs into neural cells.The cell-material interface is one of the most important considerations in designing a high-performance tissue engineering scaffold because the surface of the scaffold can determine the fate of stem cells. A conductive surface is required for a scaffold to direct stem cells toward neural differentiation. However, most conductive polymers are toxic and not amenable to biological degradation, which restricts the design of neural tissue engineering scaffolds. In this study, we used a bioactive three-dimensional (3D) porcine acellular dermal matrix (PADM), which is mainly composed of type I collagen, as a basic material and successfully assembled a layer of reduced graphene oxide (rGO) nanosheets on the surface of the PADM channels to obtain a porous 3D, biodegradable, conductive and biocompatible PADM-rGO hybrid neural tissue engineering scaffold. Compared with the PADM scaffold, assembling the rGO into the scaffold did not induce a significant change in the microstructure but endowed the PADM-rGO hybrid scaffold with good conductivity. A comparison of the neural differentiation of rat bone-marrow-derived mesenchymal stem cells (MSCs) was performed by culturing the MSCs on PADM and PADM-rGO scaffolds in neuronal culture medium, followed by the determination of gene expression and immunofluorescence staining. The results of both the gene expression and protein level assessments suggest that the rGO-assembled PADM scaffold may promote the differentiation of MSCs into neuronal cells with higher protein and gene expression levels after 7 days under neural differentiation conditions. This study demonstrated that the PADM-rGO hybrid scaffold is a promising scaffold for neural tissue engineering; this scaffold can not only support the growth of MSCs at a high proliferation rate but also enhance the differentiation of MSCs into neural cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06602f
Grid cells on steeply sloping terrain: evidence for planar rather than volumetric encoding
Hayman, Robin M. A.; Casali, Giulio; Wilson, Jonathan J.; Jeffery, Kate J.
2015-01-01
Neural encoding of navigable space involves a network of structures centered on the hippocampus, whose neurons –place cells – encode current location. Input to the place cells includes afferents from the entorhinal cortex, which contains grid cells. These are neurons expressing spatially localized activity patches, or firing fields, that are evenly spaced across the floor in a hexagonal close-packed array called a grid. It is thought that grids function to enable the calculation of distances. The question arises as to whether this odometry process operates in three dimensions, and so we queried whether grids permeate three-dimensional (3D) space – that is, form a lattice – or whether they simply follow the environment surface. If grids form a 3D lattice then this lattice would ordinarily be aligned horizontally (to explain the usual hexagonal pattern observed). A tilted floor would transect several layers of this putative lattice, resulting in interruption of the hexagonal pattern. We model this prediction with simulated grid lattices, and show that the firing of a grid cell on a 40°-tilted surface should cover proportionally less of the surface, with smaller field size, fewer fields, and reduced hexagonal symmetry. However, recording of real grid cells as animals foraged on a 40°-tilted surface found that firing of grid cells was almost indistinguishable, in pattern or rate, from that on the horizontal surface, with if anything increased coverage and field number, and preserved field size. It thus appears unlikely that the sloping surface transected a lattice. However, grid cells on the slope displayed slightly degraded firing patterns, with reduced coherence and slightly reduced symmetry. These findings collectively suggest that the grid cell component of the metric representation of space is not fixed in absolute 3D space but is influenced both by the surface the animal is on and by the relationship of this surface to the horizontal, supporting the hypothesis that the neural map of space is “multi-planar” rather than fully volumetric. PMID:26236245
Kahounová, Zuzana; Kurfürstová, Daniela; Bouchal, Jan; Kharaishvili, Gvantsa; Navrátil, Jiří; Remšík, Ján; Šimečková, Šárka; Študent, Vladimír; Kozubík, Alois; Souček, Karel
2017-04-06
The identification of fibroblasts and cancer-associated fibroblasts from human cancer tissue using surface markers is difficult, especially because the markers used currently are usually not expressed solely by fibroblasts, and the identification of fibroblast-specific surface molecules is still under investigation. It was aimed to compare three commercially available antibodies in the detection of different surface epitopes of fibroblasts (anti-fibroblast, fibroblast activation protein α, and fibroblast surface protein). The specificity of their expression, employing fibroblast cell lines and tumor-derived fibroblasts from breast and prostate tissues was investigated. Both the established fibroblast cell line HFF-1 and ex vivo primary fibroblasts isolated from breast and prostate cancer tissues expressed the tested surface markers to different degrees. Surprisingly, those markers were expressed also by permanent cell lines of epithelial origin, both benign and cancer-derived (breast-cell lines MCF 10A, HMLE and prostate-cell lines BPH-1, DU 145, and PC-3). The expression of fibroblast activation protein α increased on the surface of previously described models of epithelial cells undergoing epithelial-to-mesenchymal transition in response to treatment with TGF-β1. To prove the co-expression of the fibroblast markers on cells of epithelial origin, we used freshly dissociated human prostate and breast cancer tissues. The results confirmed the co-expression of anti-fibroblast and fibroblast surface protein on CD31/CD45-negative/EpCAM-positive epithelial cells. In summary, our data support the findings that the tested fibroblast markers are not fibroblast specific and may be expressed also by cells of epithelial origin (e.g., cells undergoing EMT). Therefore, the expression of these markers should be interpreted with caution, and the combination of several epitopes for both positive (anti-fibroblast or fibroblast activation protein α) and negative (EpCAM) identification of fibroblasts from breast and prostate tumor tissues is advised. © 2017 International Society for Advancement of Cytometry. © 2017 International Society for Advancement of Cytometry.
Pekosz, Andrew; Lamb, Robert A.
1999-01-01
The hemagglutinin, esterase, and fusion (HEF) glycoprotein of influenza C virus possesses receptor binding, receptor destroying, and membrane fusion activities. The HEF cDNAs from influenza C/Ann Arbor/1/50 (HEF-AA) and influenza C/Taylor/1223/47 (HEF-Tay) viruses were cloned and expressed, and transport of HEF to the cell surface was monitored by susceptibility to cleavage by exogenous trypsin, indirect immunofluorescence microscopy, and flow cytometry. Previously it has been found in studies with the C/Johannesburg/1/66 strain of influenza C virus (HEF-JHB) that transport of HEF to the cell surface is severely inhibited, and it is thought that the short cytoplasmic tail, Arg-Thr-Lys, is involved in blocking HEF cell surface expression (F. Oeffner, H.-D. Klenk, and G. Herrler, J. Gen. Virol. 80:363–369, 1999). As the cytoplasmic tail amino acid sequences of HEF-AA and HEF-Tay are identical to that of HEF-JHB, the data indicate that cell surface expression of HEF-AA and HEF-Tay is not inhibited by this amino acid sequence. Furthermore, the abundant cell surface transport of HEF-AA and HEF-Tay indicates that their cell surface expression does not require coexpression of another viral protein. The HEF-AA and HEF-Tay HEF glycoproteins bound human erythrocytes, promoted membrane fusion in a low-pH and trypsin-dependent manner, and displayed esterase activity, indicating that the HEF glycoprotein alone mediates all three known functions at the cell surface. PMID:10482635
Modulation of TCRβ surface expression during TCR revision.
Simmons, Kalynn B; Wubeshet, Maramawit; Ames, Kristina T; McMahan, Catherine J; Hale, J Scott; Fink, Pamela J
2012-01-01
TCR revision is a tolerance mechanism by which self-reactive TCRs expressed by mature CD4(+) peripheral T cells are replaced by receptors encoded by genes generated by post-thymic DNA rearrangement. The downmodulation of surface TCR expression initiates TCR revision, and serves as a likely trigger for the induction of the recombinase machinery. We show here in a Vβ5 transgenic mouse model system that downregulation of the self-reactive transgene-encoded TCR is not maintained by transgene loss or diminished transcription or translation. The downregulation of surface TCR expression likely occurs in two stages, only one of which requires tolerogen expression. Copyright © 2011 Elsevier Inc. All rights reserved.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Seifart, C; Muyal, J P; Plagens, A; Yildirim, A Ö; Kohse, K; Grau, V; Sandu, S; Reinke, C; Tschernig, T; Vogelmeier, C; Fehrenbach, H
2011-08-01
All-trans retinoic acid (ATRA) is controversially discussed in emphysema therapy. We re-evaluated ATRA in the elastase model and hypothesised that beneficial effects should be reflected by increased alveolar surface area, elastin expression and downregulation of inflammatory mediators and matrix metalloproteinases (MMPs). Emphysema was induced by porcine pancreatic elastase versus saline in Sprague-Dawley rats. On days 26-37, rats received daily intraperitoneal injections with ATRA (500 μg · kg(-1) body weight) versus olive oil. Lungs were removed at day 38. Rat alveolar epithelial L2 cells were incubated with/without elastase followed by ATRA- or vehicle-treatment, respectively. ATRA only partially ameliorated structural defects. Alveolar walls exhibited irregular architecture: increased arithmetic mean thickness, reduction in surface coverage by alveolar epithelial cells type II. ATRA only partially restored reduced soluble elastin. It tended to increase the ratio of ED1(+):ED2(+) macrophages. Bronchoalveolar lavage (BAL) cells exhibited a proinflammatory state and high expression of interleukin-1β, cytokine-induced neutrophil chemoattractant-1, tumour necrosis factor-α, nuclear factor-κB, MMP-2, MMP-9, MMP-12, tissue inhibitor of metalloproteinase (TIMP)-1 and TIMP-2 in emphysema, with ATRA exerting only few effects. MMP-7 was highly induced by ATRA in healthy but not in emphysematous lungs. ATRA reduced both MMP-2 and TIMP-1 activity in BAL fluid of emphysematous lungs. ATRA-therapy may bear the risk of unwanted side-effects on alveolar septal architecture in emphysematous lungs.
Watarai, Hiroshi; Sekine, Etsuko; Inoue, Sayo; Nakagawa, Ryusuke; Kaisho, Tsuneyasu; Taniguchi, Masaru
2008-02-26
Type I interferons (IFNs) derived from plasmacytoid dendritic cells (PDCs) are critical for antiviral responses; however, the mechanisms underlying their production remain unclear. We have identified a receptor, PDC-TREM, which is associated with Plexin-A1 (PlxnA1) on the PDC cell surface and is preferentially expressed after TLR-stimulation. Limited TLR signals induced PDC-TREM expression but failed to induce IFN-alpha production. However, when coupled with Sema6D, a ligand for Plexin-A1, limited TLR-stimulation resulted in PDC-TREM-mediated DAP12-dependent phosphorylation of phosphoinositide 3-kinase (PI3K) and extracellular regulated kinase (Erk) 1/2 at 6-9 h, and IFN-alpha was produced. Inhibition of PDC-TREM expression by pdctrem-shRNA, blocking of PDC-TREM-binding with PlxnA1 by PDC-TREM mAb, and DAP12 deficiency all resulted in greatly reduced PDC-TREM-dependent activation of signaling molecules and IFN-alpha production. Thus, PDC-TREM is responsible for IFN-alpha production, whereas TLR signals are essential for PDC-TREM expression.
Scavenger receptor WC1 contributes to the γδ T cell response to Leptospira.
Wang, Fei; Herzig, Carolyn T A; Chen, Chuang; Hsu, Haoting; Baldwin, Cynthia L; Telfer, Janice C
2011-03-01
WC1 molecules are exclusively expressed on the surface of γδ T cells. They belong to the scavenger receptor cysteine-rich (SRCR) superfamily and are encoded by a multi-gene family. WC1 molecules have been grouped on the basis of antibody reactivity. The expression of WC1 molecules from these serologically defined groups is correlated with differences in γδ T cell responses. The expression of receptors within the WC1.1 group correlates with the capacity of γδ T cells to respond to Leptospira antigen. In this study, we used RNA interference to directly investigate the role of WC1 expression in the response to Leptospira borgpetersenii. We found that when three out of thirteen WC1 gene products were downregulated by RNA interference, γδ T cell proliferation and IFN-γ production in response to Leptospira antigen was significantly reduced. Our data demonstrate that specific receptors in the WC1 family directly participate in Leptospira recognition and/or activation of γδ T cells. Copyright © 2010 Elsevier Ltd. All rights reserved.
Klymenko, Yuliya; Johnson, Jeffrey; Bos, Brandi; Lombard, Rachel; Campbell, Leigh; Loughran, Elizabeth; Stack, M Sharon
2017-07-01
Epithelial ovarian carcinoma spreads via shedding of cells and multicellular aggregates (MCAs) from the primary tumor into peritoneal cavity, with subsequent intraperitoneal tumor cell:mesothelial cell adhesion as a key early event in metastatic seeding. Evaluation of human tumor extracts and tissues confirms that well-differentiated ovarian tumors express abundant E-cadherin (Ecad), whereas advanced lesions exhibit upregulated N-cadherin (Ncad). Two expression patterns are observed: "mixed cadherin," in which distinct cells within the same tumor express either E- or Ncad, and "hybrid cadherin," wherein single tumor cell(s) simultaneously expresses both cadherins. We demonstrate striking cadherin-dependent differences in cell-cell interactions, MCA formation, and aggregate ultrastructure. Mesenchymal-type Ncad+ cells formed stable, highly cohesive solid spheroids, whereas Ecad+ epithelial-type cells generated loosely adhesive cell clusters covered by uniform microvilli. Generation of "mixed cadherin" MCAs using fluorescently tagged cell populations revealed preferential sorting into cadherin-dependent clusters, whereas mixing of cell lines with common cadherin profiles generated homogeneous aggregates. Recapitulation of the "hybrid cadherin" Ecad+/Ncad+ phenotype, via insertion of the CDH2 gene into Ecad+ cells, resulted in the ability to form heterogeneous clusters with Ncad+ cells, significantly enhanced adhesion to organotypic mesomimetic cultures and peritoneal explants, and increased both migration and matrix invasion. Alternatively, insertion of CDH1 gene into Ncad+ cells greatly reduced cell-to-collagen, cell-to-mesothelium, and cell-to-peritoneum adhesion. Acquisition of the hybrid cadherin phenotype resulted in altered MCA surface morphology with increased surface projections and increased cell proliferation. Overall, these findings support the hypothesis that MCA cadherin composition impacts intraperitoneal cell and MCA dynamics and thereby affects ultimate metastatic success. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Van den Bergh, F.; Eliason, S.L.; Giudice, G.J.
2010-01-01
Collagen XVII (COL17) is a transmembrane glycoprotein that is expressed on the basal surface of basal epidermal keratinocytes. Previous observations have led to the hypothesis that an interaction between COL17 and laminin 332, an extracellular matrix protein, contributes to the attachment of the basal keratinocyte to the basement membrane. In order to isolate and manipulate COL17 interactions with ECM components, we induced COL17 expression in two cells lines, SK-MEL1 and K562, that exhibit little or no capacity to attach to our test substrates, including laminin 332, types I and IV collagen, and fibronectin. Cells expressing high levels of COL17 preferentially adhered to a laminin 332 matrix, and, to a lesser extent, type IV collagen, while showing little or no binding to type I collagen or fibronectin. A quantitative analysis of cell adhesive forces revealed that, compared with COL17-negative cells, COL17-positive cells required over 7-fold greater force to achieve 50% detachment from a laminin 332 substrate. When a cell preparation (either K562 or SK-MEL1) with heterogeneous COL17 expression levels was allowed to attach to a laminin 332 matrix, the COL17-positive and COL17-negative cells differentially sorted to the bound and unbound cell fractions, respectively. COL17-dependent attachment to laminin 332 could be reduced or abolished by siRNA-mediated knockdown of COL17 expression or by adding to the assay wells specific antibodies against COL17 or laminin 332. These findings provide strong support for the hypothesis that cell surface COL17 can interact with laminin 332 and, together, participate in the adherence of a cell to the extracellular matrix. PMID:21034821
Wood, Ben; Padula, Matthew P; Marks, Denese C; Johnson, Lacey
2016-10-01
Platelets (PLTs) are currently stored at room temperature (22°C), which limits their shelf life, primarily due to the risk of bacterial growth. Alternatives to room temperature storage include PLT refrigeration (2-6°C), which inhibits bacterial growth, thus potentially allowing an extension of shelf life. Additionally, refrigerated PLTs appear more hemostatically active than conventional PLTs, which may be beneficial in certain clinical situations. However, the mechanisms responsible for this hemostatic function are not well characterized. The aim of this study was to assess the protein profile of refrigerated PLTs in an effort to understand these functional consequences. Buffy coat PLTs were pooled, split, and stored either at room temperature (20-24°C) or under refrigerated (2-6°C) conditions (n = 8 in each group). PLTs were assessed for changes in external receptor expression and actin filamentation using flow cytometry. Intracellular proteomic changes were assessed using two-dimensional gel electrophoresis and Western blotting. PLT refrigeration significantly reduced the abundance of glycoproteins (GPIb, GPIX, GPIIb, and GPIV) on the external membrane. However, refrigeration resulted in the increased expression of high-affinity integrins (αIIbβ3 and β1) and activation and apoptosis markers (CD62P, CD63, and phosphatidylserine). PLT refrigeration substantially altered the abundance and localization of several cytoskeletal proteins and resulted in an increase in actin filamentation, as measured by phalloidin staining. Refrigerated storage of PLTs induces significant changes in the expression and localization of both surface-expressed and intracellular proteins. Understanding these proteomic changes may help to identify the mechanisms resulting in the refrigeration-associated alterations in PLT function and clearance. © 2016 AABB.
Yu, Jinyun; Chen, Tingjin; Xie, Zhizhi; Liang, Pei; Qu, Honglin; Shang, Mei; Mao, Qiang; Ning, Dan; Tang, Zeli; Shi, Mengchen; Zhou, Lina; Huang, Yan; Yu, Xinbing
2015-07-01
Caused by the consumption of raw or undercooked freshwater fish containing infective metacercariae of Clonorchis sinensis, human clonorchiasis remains a major public health problem in China. In previous study, we had expressed enolase from C. sinensis (CsENO) on the surface of Bacillus subtilis spore and the recombinant spore induced a pronounced protection in terms of reduced worm burden and eggs per gram feces, suggesting B. subtilis spore as an ideal vehicle for antigen delivery by oral treatment and CsENO as a promising vaccine candidate against clonorchiasis. In the current study, we detected CsENO-specific IgG and IgA levels both in serum and in intestinal mucus from rats orally administrated with B. subtilis spore surface expressing CsENO by ELISA. Lysozyme levels in serum and in intestinal mucus were analyzed too. In addition, IgA-secreting cells in intestine epithelium of the rats were detected by immunohistochemistry assay. The intestinal villi lengths of duodenum, jejunum, and ileum were also measured. Rats orally treated with B. subtilis spore or normal saline were used as controls. Our results showed that, compared with the control groups, oral administration of B. subtilis spore expressing CsENO induced both systemic and local mucosal immune response. The recombinant spores also enhanced non-specific immune response in rats. The spores had no side effect on liver function. Moreover, it might facilitate food utilization and digestion of the rats. Our work will pave the way to clarify the involved mechanisms of protective efficacy elicited by B. subtilis spore expressing CsENO and encourage us to carry out more assessment trails of the oral treated spore to develop vaccine against clonorchiasis.
Natsume, Tohru; Taoka, Masato; Manki, Hiroshi; Kume, Shouen; Isobe, Toshiaki; Mikoshiba, Katsuhiko
2002-09-01
We describe a rapid analysis of interactions between antibodies and a recombinant protein present in total cell lysates. Using a surface plasmon resonance biosensor, a low concentration of glutathione-S-transferase (GST) fused protein expressed in small scale Esherichia coli culture was purified on an anti-GST antibody immobilized sensor chip. The 'on-chip purification' was verified using matrix-assisted laser desorption/ionization-time of flight mass spectrometry by measuring the molecular masses of recombinant proteins purified on the sensor chip. The specific binding of monoclonal antibodies for the on-chip micropurified recombinant proteins can then be monitored, thus enabling kinetic analysis and epitope mapping of the bound antibodies. This approach reduced time, resources and sample consumption by avoiding conventional steps related to concentration and purification.
Investigation of the Cell Surface Proteome of Human Periodontal Ligament Stem Cells
Xiong, Jimin; Menicanin, Danijela; Marino, Victor
2016-01-01
The present study examined the cell surface proteome of human periodontal ligament stem cells (PDLSC) compared to human fibroblasts. Cell surface proteins were prelabelled with CyDye before processing to extract the membrane lysates, which were separated using 2D electrophoresis. Selected differentially expressed protein “spots” were identified using Mass spectrometry. Four proteins were selected for validation: CD73, CD90, Annexin A2, and sphingosine kinase 1 previously associated with mesenchymal stem cells. Flow cytometric analysis found that CD73 and CD90 were highly expressed by human PDLSC and gingival fibroblasts but not by keratinocytes, indicating that these antigens could be used as potential markers for distinguishing between mesenchymal cells and epithelial cell populations. Annexin A2 was also found to be expressed at low copy number on the cell surface of human PDLSC and gingival fibroblasts, while human keratinocytes lacked any cell surface expression of Annexin A2. In contrast, sphingosine kinase 1 expression was detected in all the cell types examined using immunocytochemical analysis. These proteomic studies form the foundation to further define the cell surface protein expression profile of PDLSC in order to better characterise this cell population and help develop novel strategies for the purification of this stem cell population. PMID:27579043
Investigation of the Cell Surface Proteome of Human Periodontal Ligament Stem Cells.
Xiong, Jimin; Menicanin, Danijela; Zilm, Peter S; Marino, Victor; Bartold, P Mark; Gronthos, Stan
2016-01-01
The present study examined the cell surface proteome of human periodontal ligament stem cells (PDLSC) compared to human fibroblasts. Cell surface proteins were prelabelled with CyDye before processing to extract the membrane lysates, which were separated using 2D electrophoresis. Selected differentially expressed protein "spots" were identified using Mass spectrometry. Four proteins were selected for validation: CD73, CD90, Annexin A2, and sphingosine kinase 1 previously associated with mesenchymal stem cells. Flow cytometric analysis found that CD73 and CD90 were highly expressed by human PDLSC and gingival fibroblasts but not by keratinocytes, indicating that these antigens could be used as potential markers for distinguishing between mesenchymal cells and epithelial cell populations. Annexin A2 was also found to be expressed at low copy number on the cell surface of human PDLSC and gingival fibroblasts, while human keratinocytes lacked any cell surface expression of Annexin A2. In contrast, sphingosine kinase 1 expression was detected in all the cell types examined using immunocytochemical analysis. These proteomic studies form the foundation to further define the cell surface protein expression profile of PDLSC in order to better characterise this cell population and help develop novel strategies for the purification of this stem cell population.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arnold, Ralf; Koenig, Wolfgang
2006-07-05
We have previously shown that peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) agonists inhibited the inflammatory response of RSV-infected human lung epithelial cells. In this study, we supply evidence that specific PPAR{gamma} agonists (15d-PGJ{sub 2}, ciglitazone, troglitazone, Fmoc-Leu) efficiently blocked the RSV-induced cytotoxicity and development of syncytia in tissue culture (A549, HEp-2). All PPAR{gamma} agonists under study markedly inhibited the cell surface expression of the viral G and F protein on RSV-infected A549 cells. This was paralleled by a reduced cellular amount of N protein-encoding mRNA determined by real-time RT-PCR. Concomitantly, a reduced release of infectious progeny virus into the cell supernatants ofmore » human lung epithelial cells (A549, normal human bronchial epithelial cells (NHBE)) was observed. Similar results were obtained regardless whether PPAR{gamma} agonists were added prior to RSV infection or thereafter, suggesting that the agonists inhibited viral gene expression and not the primary adhesion or fusion process.« less
Endothelial protein kinase MAP4K4 promotes vascular inflammation and atherosclerosis
Roth Flach, Rachel J.; Skoura, Athanasia; Matevossian, Anouch; Danai, Laura V.; Zheng, Wei; Cortes, Christian; Bhattacharya, Samit K.; Aouadi, Myriam; Hagan, Nana; Yawe, Joseph C.; Vangala, Pranitha; Menendez, Lorena Garcia; Cooper, Marcus P.; Fitzgibbons, Timothy P.; Buckbinder, Leonard; Czech, Michael P.
2015-01-01
Signalling pathways that control endothelial cell (EC) permeability, leukocyte adhesion and inflammation are pivotal for atherosclerosis initiation and progression. Here we demonstrate that the Sterile-20-like mitogen-activated protein kinase kinase kinase kinase 4 (MAP4K4), which has been implicated in inflammation, is abundantly expressed in ECs and in atherosclerotic plaques from mice and humans. On the basis of endothelial-specific MAP4K4 gene silencing and gene ablation experiments in Apoe−/− mice, we show that MAP4K4 in ECs markedly promotes Western diet-induced aortic macrophage accumulation and atherosclerotic plaque development. Treatment of Apoe−/− and Ldlr−/− mice with a selective small-molecule MAP4K4 inhibitor also markedly reduces atherosclerotic lesion area. MAP4K4 silencing in cultured ECs attenuates cell surface adhesion molecule expression while reducing nuclear localization and activity of NFκB, which is critical for promoting EC activation and atherosclerosis. Taken together, these results reveal that MAP4K4 is a key signalling node that promotes immune cell recruitment in atherosclerosis. PMID:26688060
Alakbarzade, Vafa; Hameed, Abdul; Quek, Debra Q Y; Chioza, Barry A; Baple, Emma L; Cazenave-Gassiot, Amaury; Nguyen, Long N; Wenk, Markus R; Ahmad, Arshia Q; Sreekantan-Nair, Ajith; Weedon, Michael N; Rich, Phil; Patton, Michael A; Warner, Thomas T; Silver, David L; Crosby, Andrew H
2015-07-01
The major pathway by which the brain obtains essential omega-3 fatty acids from the circulation is through a sodium-dependent lysophosphatidylcholine (LPC) transporter (MFSD2A), expressed in the endothelium of the blood-brain barrier. Here we show that a homozygous mutation affecting a highly conserved MFSD2A residue (p.Ser339Leu) is associated with a progressive microcephaly syndrome characterized by intellectual disability, spasticity and absent speech. We show that the p.Ser339Leu alteration does not affect protein or cell surface expression but rather significantly reduces, although not completely abolishes, transporter activity. Notably, affected individuals displayed significantly increased plasma concentrations of LPCs containing mono- and polyunsaturated fatty acyl chains, indicative of reduced brain uptake, confirming the specificity of MFSD2A for LPCs having mono- and polyunsaturated fatty acyl chains. Together, these findings indicate an essential role for LPCs in human brain development and function and provide the first description of disease associated with aberrant brain LPC transport in humans.
An Ribonuclease T2 Family Protein Modulates Acinetobacter baumannii Abiotic Surface Colonization
Jacobs, Anna C.; Blanchard, Catlyn E.; Catherman, Seana C.; Dunman, Paul M.; Murata, Yoshihiko
2014-01-01
Acinetobacter baumannii is an emerging bacterial pathogen of considerable medical concern. The organism's transmission and ability to cause disease has been associated with its propensity to colonize and form biofilms on abiotic surfaces in health care settings. To better understand the genetic determinants that affect biomaterial attachment, we performed a transposon mutagenesis analysis of abiotic surface-colonization using A. baumannii strain 98-37-09. Disruption of an RNase T2 family gene was found to limit the organism's ability to colonize polystyrene, polypropylene, glass, and stainless steel surfaces. DNA microarray analyses revealed that in comparison to wild type and complemented cells, the RNase T2 family mutant exhibited reduced expression of 29 genes, 15 of which are predicted to be associated with bacterial attachment and surface-associated motility. Motility assays confirmed that RNase T2 mutant displays a severe motility defect. Taken together, our results indicate that the RNase T2 family protein identified in this study is a positive regulator of A. baumannii's ability to colonize inanimate surfaces and motility. Moreover, the enzyme may be an effective target for the intervention of biomaterial colonization, and consequently limit the organism's transmission within the hospital setting. PMID:24489668
Allen, Sariah J.; Rhode-Kurnow, Antje; Mott, Kevin R.; Jiang, Xianzhi; Carpenter, Dale; Rodriguez-Barbosa, J. Ignacio; Jones, Clinton; Wechsler, Steven L.; Ware, Carl F.
2014-01-01
Herpesvirus entry mediator (HVEM) is one of several cell surface proteins herpes simplex virus (HSV) uses for attachment/entry. HVEM regulates cellular immune responses and can also increase cell survival. Interestingly, latency-associated transcript (LAT), the only viral gene consistently expressed during neuronal latency, enhances latency and reactivation by promoting cell survival and by helping the virus evade the host immune response. However, the mechanisms of these LAT activities are not well understood. We show here for the first time that one mechanism by which LAT enhances latency and reactivation appears to be by upregulating HVEM expression. HSV-1 latency/reactivation was significantly reduced in Hvem−/− mice, indicating that HVEM plays a significant role in HSV-1 latency/reactivation. Furthermore, LAT upregulated HVEM expression during latency in vivo and also when expressed in vitro in the absence of other viral factors. This study suggests a mechanism whereby LAT upregulates HVEM expression potentially through binding of two LAT small noncoding RNAs to the HVEM promoter and that the increased HVEM then leads to downregulation of immune responses in the latent microenvironment and increased survival of latently infected cells. Thus, one of the mechanisms by which LAT enhances latency/reactivation appears to be through increasing expression of HVEM. PMID:24307582
Regulation of surface expression of TRPV2 channels in the retinal pigment epithelium.
Reichhart, Nadine; Keckeis, Susanne; Fried, Frederik; Fels, Gabriele; Strauss, Olaf
2015-06-01
The retinal pigment epithelium (RPE) interacts closely with the photoreceptors in fulfilling tasks of visual function. Since an understanding of the RPE function is essential for understanding the patho-mechanisms involved in vision loss, we explored the regulation of the vanilloid receptor subtype transient receptor potential TRPV2 channels that trigger insulin-like growth factor-1 (IGF-1)-induced vascular endothelial growth factor A (VEGF-A) secretion. Immunohistochemistry was used to assess TRPV2 expression in retinal cross-sections or ARPE-19 cells, and surface expression of TRPV2 was quantified using confocal microscopy. Membrane currents of ARPE-19 cells were recorded using a whole-cell configuration of the patch-clamp technique. TRPV2 expression was detected in the RPE of the mouse retina as well as in ARPE-19 cells. Increasing the temperature to 45 °C activated membrane conductance sensitive to SKF-96365 and ruthenium red in 60 % of cells. Preincubation with either cannabidiol (CBD) or IGF-1 led to a three- or fourfold increase in current density, respectively, in all cells, which was blocked by SKF-96365. In contrast to IGF-1, CBD stimulation of membrane conductance was further increased by heat. TRPV2 surface expression was increased by both IGF-1 and CBD, with the increase by CBD twice as large as that by IGF-1. The phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002 abolished the effects on membrane conductance and surface expression. Both CBD and IGF-1 enhance TRPV2 channel activity by specific proportions of both channel activation and PI 3-kinase-dependent surface expression: IGF-1 predominantly increases ion channel activity, whereas CBD is more active in increasing TRPV2 surface expression. Thus, differential regulation of TRPV2 surface expression is an important mechanism for modulating the responsiveness of the RPE to growth factors.
Zhong, Xiaopeng; Wang, Xiujuan; Fei, Fei; Zhang, ManCui; Ding, Po; Zhang, Shiwu
2018-06-01
To investigate the molecular mechanism of dihydrocapsaicin (DHC)-induced mild hypothermia in rats, and to compare its protective effect on the central nervous system with that of a conventional method of inducing hypothermia, 24 healthy male Sprague Dawley rats were randomly divided into four groups based on the following conditions: control group, cardiopulmonary resuscitation (CPR) group, body surface cooling group, and DHC group. Tracheal clipping was used to mimic asphyxia arrest. Rats were assessed for their neurological deficit scores. After sacrifice, immunohistochemical staining was used to examine caspase-3 expression in the cerebral cortex and TRPV1 (transient receptor potential vanilloid subfamily, member 1) expression in the hypothalamus. Terminal TdT-mediated dUTP-biotin nick end labeling (TUNEL) staining was used to evaluate cell apoptosis in the cerebral cortex. Furthermore, intracellular Ca 2+ concentration in the hypothalamus and arginine vasopressin (AVP) concentration in ventral septal tissues were also detected in these four groups. Results of our study showed that neurological deficit scores in the DHC group were significantly higher than those in the CPR and body surface cooling groups (p < 0.05). Caspase-3 expression in the cerebral cortex of control group rats was significantly lower than that in other three groups (p < 0.05). Hypothalamic TRPV1 expression, hypothalamic intracellular Ca 2+ concentration, and AVP concentration in the ventral septum in the DHC group were significantly higher than that in the other three groups (p < 0.05). Within these three groups, there were significantly fewer apoptotic cells in the DHC and body surface cooling group rats than in the CPR group rats (p < 0.05). DHC has the neuroprotective effect. DHC induced mild hypothermia and reduces apoptosis through a mechanism whereby DHC activates TRPV1 on hypothalamic cells to cause a large Ca 2+ influx, which alters corresponding physiological functions and causes the release of AVP to induce hypothermia.
Cell Surface Trafficking of TLR1 Is Differentially Regulated by the Chaperones PRAT4A and PRAT4B*
Hart, Bryan E.; Tapping, Richard I.
2012-01-01
The subcellular localization of Toll-like receptors (TLRs) is critical to their ability to function as innate immune sensors of microbial infection. We previously reported that an I602S polymorphism of human TLR1 is associated with aberrant trafficking of the receptor to the cell surface, loss of responses to TLR1 agonists, and differential susceptibility to diseases caused by pathogenic mycobacteria. Through an extensive analysis of receptor deletion and point mutants we have discovered that position 602 resides within a short 6 amino acid cytoplasmic region that is required for TLR1 surface expression. This short trafficking motif, in conjunction with the adjacent transmembrane domain, is sufficient to direct TLR1 to the cell surface. A serine at position 602 interrupts this trafficking motif and prevents cell surface expression of TLR1. Additionally, we have found that ER-resident TLR chaperones, PRAT4A and PRAT4B, act as positive and negative regulators of TLR1 surface trafficking, respectively. Importantly, either over-expression of PRAT4A or knock-down of PRAT4B rescues cell surface expression of the TLR1 602S variant. We also report that IFN-γ treatment of primary human monocytes derived from homozygous 602S individuals rescues TLR1 cell surface trafficking and cellular responses to soluble agonists. This event appears to be mediated by PRAT4A whose expression is strongly induced in human monocytes by IFN-γ. Collectively, these results provide a mechanism for the differential trafficking of TLR1 I602S variants, and highlight the distinct roles for PRAT4A and PRAT4B in the regulation of TLR1 surface expression. PMID:22447933
Dougan, G; Dowd, G; Kehoe, M
1983-01-01
Escherichia coli K-12 minicells, harboring recombinant plasmids encoding polypeptides involved in the expression of K88ac adhesion pili on the bacterial cell surface, were labeled with [35S]methionine and fractionated by a variety of techniques. A 70,000-dalton polypeptide, the product of the K88ac adhesion cistron adhA, was primarily located in the outer membrane of minicells, although it was less clearly associated with this membrane than the classical outer membrane proteins OmpA and matrix protein. Two polypeptides of molecular weights 26,000 and 17,000 (the products of adhB and adhC, respectively) were located in significant amounts in the periplasmic space. The 29,000-dalton polypeptide was shown to be processed in E. coli minicells. The 23.500-dalton K88ac pilus subunit (the product of adhD) was detected in both inner and outer membrane fractions. E. coli mutants defective in the synthesis of murein lipoprotein or the major outer membrane polypeptide OmpA were found to express normal amounts of K88ac antigen on the cell surface, whereas expression of the K88ac antigen was greatly reduced in perA mutants. The possible functions of the adh cistron products are discussed.
Misra, Neha; Wines, Tyler F; Knopp, Colton L; McGuire, Mark A; Tinker, Juliette K
2017-05-01
Staphylococcus aureus iron-regulated surface protein A (IsdA) is a fibrinogen and fibronectin adhesin that also contributes to iron sequestration and resistance to innate immunity. IsdA is conserved in human isolates and has been investigated as a human vaccine candidate. Here we report the expression of isdA, the efficacy of anti-IsdA responses and the existence of IsdA sequence variants from bovine Staphylococcus. Clinical staphylococci were obtained from US dairy farms and assayed by PCR for the presence and expression of isdA. isdA-positive species from bovines included S. aureus, S. haemolyticus and S. chromogenes. Immunoassays on bovine milk and serum confirmed the induction and opsonophagocytic activity of anti-IsdA humoral responses. The variable region of isdA was sequenced and protein alignments predicted the presence of two main variants consistent with those from human S. aureus. Mouse antibodies against one IsdA variant reduced staphylococcal binding to fibronectin in vitro in an isotype-dependent manner. Purified IsdA variants bound distinctly to fibronectin and fibrinogen. Our findings demonstrate that variability within the C-terminus of this adhesin affects immune reactivity and binding specificity, but are consistent with the significance of IsdA in bovine disease and relevant for vaccine development. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Effect of Water Stress on Cotton Leaves 1
Berlin, Jerry; Quisenberry, J. E.; Bailey, Franklin; Woodworth, Margaret; McMichael, B. L.
1982-01-01
Palisade cells from fully expanded leaves from irrigated and nonirrigated, field grown cotton (Gossypium hirsutum L. cv. Paymaster 266) were subjected to a microscopic examination to evaluate the effect of water stress on subcellular structures. The water potential difference between the two treatments was 13 bars at the time of sampling. The dimensions of the palisade cells and their density per unit leaf area were determined by light microscopy. Palisade cells from stressed plants had the same diameter, but were taller than their counterparts in irrigated plants. The density of the palisade cells was the same in both treatments as was the fractional volume of the intercellular space. It was concluded that the reduced leaf area observed in the stressed plants resulted primarily from a mitotic sensitivity to water stress. Further, expansion of palisade cells was not inhibited by the stress imposed in this study. Morphometric analysis of electron micrographs was used to evaluate the subcellular structure of palisade cells from nonstressed and stressed plants. The fractional volumes of cell walls, total cytoplasm, chloroplasts, starch granules, intrachloroplast bodies, mitochondria, peroxisomes, and central vacuoles were determined. The surface densities of grana and stroma lamellae, outer chloroplast membranes, mitochondrial cristae, endoplasmic reticulum and Golgi cisternae were also measured. The number of chloroplasts, mitochondria, and peroxisomes were determined. These data were expressed as actual volumes, areas, and numbers per palisade cell for each treatment. Palisade cells from stressed plants had thinner cell walls, larger central vacuoles and approximately the same amount of cytoplasm compared to cells from nonstressed plants. Within the cytoplasm, stressed plants had more but smaller chloroplasts with increased grana and stroma lamellae surfaces, larger mithchondria with reduced cristae surfaces, smaller peroxisomes and reduced membrane surfaces of endoplasmic reticulum and Golgi cisternae. Images Fig. 1 PMID:16662453
Berlin, J; Quisenberry, J E; Bailey, F; Woodworth, M; McMichael, B L
1982-07-01
Palisade cells from fully expanded leaves from irrigated and nonirrigated, field grown cotton (Gossypium hirsutum L. cv. Paymaster 266) were subjected to a microscopic examination to evaluate the effect of water stress on subcellular structures. The water potential difference between the two treatments was 13 bars at the time of sampling. The dimensions of the palisade cells and their density per unit leaf area were determined by light microscopy. Palisade cells from stressed plants had the same diameter, but were taller than their counterparts in irrigated plants. The density of the palisade cells was the same in both treatments as was the fractional volume of the intercellular space. It was concluded that the reduced leaf area observed in the stressed plants resulted primarily from a mitotic sensitivity to water stress. Further, expansion of palisade cells was not inhibited by the stress imposed in this study.Morphometric analysis of electron micrographs was used to evaluate the subcellular structure of palisade cells from nonstressed and stressed plants. The fractional volumes of cell walls, total cytoplasm, chloroplasts, starch granules, intrachloroplast bodies, mitochondria, peroxisomes, and central vacuoles were determined. The surface densities of grana and stroma lamellae, outer chloroplast membranes, mitochondrial cristae, endoplasmic reticulum and Golgi cisternae were also measured. The number of chloroplasts, mitochondria, and peroxisomes were determined. These data were expressed as actual volumes, areas, and numbers per palisade cell for each treatment. Palisade cells from stressed plants had thinner cell walls, larger central vacuoles and approximately the same amount of cytoplasm compared to cells from nonstressed plants. Within the cytoplasm, stressed plants had more but smaller chloroplasts with increased grana and stroma lamellae surfaces, larger mithchondria with reduced cristae surfaces, smaller peroxisomes and reduced membrane surfaces of endoplasmic reticulum and Golgi cisternae.
Hu, Jie; Zhang, Zhonghua; Shen, Wen-Jun; Nomoto, Ann; Azhar, Salman
2011-01-01
The scavenger receptor, class B, type I (SR-BI) binds high-density lipoprotein (HDL) and mediates selective delivery of cholesteryl esters (CEs) to the liver and steroidogenic cells of the adrenal and gonads. Although it is clear that the large extracellular domain (ECD) of SR-BI binds HDL, the role of ECD in the selective HDL-CE transport remains poorly understood. In this study, we used a combination of mutational and chemical approaches to systematically evaluate the contribution of cysteine residues, especially six cysteine residues of ECD, in SR-BI-mediated selective HDL-CE uptake, intracellular trafficking and SR-BI dimerization. Pretreatment of SR-BI overexpressing COS-7 cells with disulfide (S-S) bond reducing agent, β-mercaptoethanol (100 mM) or dithiothreitol (DTT) (10 mM) modestly, but significantly impaired the SR-BI mediated selective HDL-CE uptake. Treatment of SR-BI overexpressing COS-7 cells with the optimum doses of membrane permeant alkyl methanethiosulfonate (MTS) reagents, positively charged MTSEA or neutral MMTS that specifically react with the free sulfhydryl group of cysteine reduced the SR-BI-mediated selective HDL-CE uptake, indicating that certain intracellular free cysteine residues may also be critically involved in the selective cholesterol transport process. In contrast, use of membrane impermeant MTS reagent, positively charged MTSET and negatively charged MTSES showed no such effect. Next, the importance of eight cysteine residues in SR-BI expression, cell surface expression, dimer formation and selective HDL-derived CE transport was evaluated. These cysteine residues were replaced either singly or in pairs with serine and the mutant SR-BIs expressed in either COS-7 or CHO cells. Four mutations, C280S, C321S, C323S or C334S of the ECD, either singly or in various pair combinations, resulted in significant decreases in SR-BI (HDL) binding activity, selective-CE uptake, and trafficking to cell surface. Surprisingly, we found that mutation of the two remaining cysteine residues, C251 and C384 of the ECD, had no effect on either SR-BI expression or function. Other cysteine mutations and substitutions were also without any effect. Western blot data indicated that single and double mutants of C280, C321, C323 and C334 residues strongly favor dimer formation. However, they are rendered non-functional presumably due to mutation-induced formation of aberrant disulfide linkages resulting in inhibition of optimal HDL binding and, thus, selective HDL-CE uptake. These results provide novel insights about the functional role of four cysteine residues, C280, C321, C323 and C334 of SR-BI ECD domain in SR-BI expression and trafficking to cell surface, its dimerization, and associated selective CE transport function. PMID:22097902
Hamlet, Stephen; Alfarsi, Mohammed; George, Roy; Ivanovski, Saso
2012-05-01
Chemical modification of microrough titanium dental implants to produce a hydrophilic surface with increased wettability and improved surface energy has been demonstrated clinically to achieve superior bone wound healing and osseointegration compared to that achieved with a microrough titanium surface alone. As the recruitment of the necessary osseoinductive precursors involved in bone wound healing and osseointegration to the wound site is facilitated by the action of cytokines, this study sought to determine the in vitro effect of hydrophilic surface modification on the expression of pro-inflammatory cytokines from adherent macrophages. The surface topography and composition of the titanium surfaces was characterized by scanning electron microscopy and X-ray photoelectron spectroscopy. Macrophage attachment and proliferation was assessed using an MTT assay. The expression of 84 pro-inflammatory cytokines and chemokines by adherent RAW 264.7 cells, a murine leukaemic monocyte cell line, was assessed by PCR array after 24 h culture on either smooth polished, sand-blasted acid-etched (SLA) or hydrophilic-modified SLA (SLActive) titanium surfaces. Following 24 h culture on titanium, surface microroughness activated pro-inflammatory cytokine gene transcription in RAW 264.7 cells. Although there was no significant difference in the degree of cellular attachment or proliferation of RAW 264.7 cells to the different titanium surfaces, by 24 h the hydrophilic surface elicited a gene expression profile with significant down-regulation of the key pro-inflammatory cytokines Tnfα, IL-1α, IL-1β and the chemokine Ccl-2. Down-regulation of the expression of pro-inflammatory cytokine genes may thus modulate the inflammatory response and may facilitate the enhanced bone wound healing and osseointegration observed clinically using implants with a microrough hydrophilic surface. © 2011 John Wiley & Sons A/S.
Liu, Shuxi; Zhou, Liang; Yuan, Hongjie; Vieira, Marta; Sanz-Clemente, Antonio; Badger, John D; Lu, Wei; Traynelis, Stephen F; Roche, Katherine W
2017-04-12
NMDA receptors (NMDARs) are ionotropic glutamate receptors that are crucial for neuronal development and higher cognitive processes. NMDAR dysfunction is involved in a variety of neurological and psychiatric diseases; however, the mechanistic link between the human pathology and NMDAR dysfunction is poorly understood. Rare missense variants within NMDAR subunits have been identified in numerous patients with mental or neurological disorders. We specifically focused on the GluN2B NMDAR subunit, which is highly expressed in the hippocampus and cortex throughout development. We analyzed several variants located in the GluN2B C terminus and found that three variants in patients with autism (S1415L) or schizophrenia (L1424F and S1452F) (S1413L, L1422F, and S1450F in rodents, respectively) displayed impaired binding to membrane-associated guanylate kinase (MAGUK) proteins. In addition, we observed a deficit in surface expression for GluN2B S1413L. Furthermore, there were fewer dendritic spines in GluN2B S1413L-expressing neurons. Importantly, synaptic NMDAR currents in neurons transfected with GluN2B S1413L in GluN2A/B-deficient mouse brain slices revealed only partial rescue of synaptic current amplitude. Functional properties of GluN2B S1413L in recombinant systems revealed no change in receptor properties, consistent with synaptic defects being the result of reduced trafficking and targeting of GluN2B S1413L to the synapse. Therefore, we find that GluN2B S1413L displays deficits in NMDAR trafficking, synaptic currents, and spine density, raising the possibility that this mutation may contribute to the phenotype in this autism patient. More broadly, our research demonstrates that the targeted study of certain residues in NMDARs based on rare variants identified in patients is a powerful approach to studying receptor function. SIGNIFICANCE STATEMENT We have used a "bedside-to-bench" approach to investigate the functional regulation of NMDA receptors (NMDARs). Using information from deep sequencing of patients with neurological or psychiatric disorders, we investigated missense variants identified in the intracellular C-terminal domain of the GluN2B NMDAR subunit. We found several variants that displayed altered properties. In particular, one variant identified in a patient with autism, human GluN2B S1415L, displayed reduced surface expression and binding to PSD-95. Furthermore expression of GluN2B S1415L (S1413L in mouse) showed a deficit in rescue of synaptic NMDAR currents and fewer dendritic spines, consistent with other reports of spine abnormalities being associated with autism. More broadly, we demonstrate that using patient data is an effective approach to probing the structure/function relationship of NMDARs. Copyright © 2017 the authors 0270-6474/17/374094-10$15.00/0.
Zhang, Fang; Sodroski, Catherine; Cha, Helen; Li, Qisheng; Liang, T Jake
2017-01-01
The signaling molecule and transcriptional regulator SMAD6, which inhibits the transforming growth factor β signaling pathway, is required for infection of hepatocytes by hepatitis C virus (HCV). We investigated the mechanisms by which SMAD6 and another inhibitory SMAD (SMAD7) promote HCV infection in human hepatoma cells and hepatocytes. We infected Huh7 and Huh7.5.1 cells and primary human hepatocytes with Japanese fulminant hepatitis-1 (JFH1) HCV cell culture system (HCVcc). We then measured HCV binding, intracellular levels of HCV RNA, and expression of target genes. We examined HCV entry in HepG2/microRNA (miR) 122/CD81 cells, which support entry and replication of HCV, were transfected these cells with small interfering RNAs targeting inhibitory SMADs to analyze gene expression profiles. Uptake of labeled low-density lipoprotein (LDL) and cholesterol was measured. Cell surface proteins were quantified by flow cytometry. We obtained liver biopsy samples from 69 patients with chronic HCV infection and 19 uninfected individuals (controls) and measured levels of syndecan 1 (SDC1), SMAD7, and SMAD6 messenger RNAs (mRNAs). Small interfering RNA knockdown of SMAD6 blocked the binding and infection of hepatoma cell lines and primary human hepatocytes by HCV, whereas SMAD6 overexpression increased HCV infection. We found levels of mRNAs encoding heparan sulfate proteoglycans (HSPGs), particularly SDC1 mRNA, and cell surface levels of heparan sulfate to be reduced in cells after SMAD6 knockdown. SMAD6 knockdown also reduced transcription of genes encoding lipoprotein and cholesterol uptake receptors, including the LDL receptor (LDLR), the very LDLR, and the scavenger receptor class B member 1 in hepatocytes; knockdown of SMAD6 also inhibited cell uptake of cholesterol and lipoprotein. Overexpression of SMAD6 increased the expression of these genes. Similar effects were observed with knockdown and overexpression of SMAD7. In addition, HCV infection of cells increased the expression of SMAD6, which required the activity of nuclear factor-κB, but not transforming growth factor β. Liver tissues from patients with chronic HCV infection had significantly higher levels of SMAD6, SMAD7, and HSPG mRNAs than controls. In studies of hepatoma cell lines and primary human hepatocytes, we found that infection with HCV leads to activation of nuclear factor-κB, resulting in increased expression of SMAD6 and SMAD7. Up-regulation of SMAD6 and SMAD7 induces the expression of HSPGs, such as SDC1, as well as LDLR, very LDLR, and the scavenger receptor class B member 1, which promote HCV entry and propagation, as well as cellular uptake of cholesterol and lipoprotein. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.
Patel, Y M; Lordkipanidzé, M; Lowe, G C; Nisar, S P; Garner, K; Stockley, J; Daly, M E; Mitchell, M; Watson, S P; Austin, S K; Mundell, S J
2014-05-01
The study of patients with bleeding problems is a powerful approach in determining the function and regulation of important proteins in human platelets. We have identified a patient with a chronic bleeding disorder expressing a homozygous P2RY(12) mutation, predicting an arginine to cysteine (R122C) substitution in the G-protein-coupled P2Y(12) receptor. This mutation is found within the DRY motif, which is a highly conserved region in G-protein-coupled receptors (GPCRs) that is speculated to play a critical role in regulating receptor conformational states. To determine the functional consequences of the R122C substitution for P2Y(12) function. We performed a detailed phenotypic analysis of an index case and affected family members. An analysis of the variant R122C P2Y(12) stably expressed in cells was also performed. ADP-stimulated platelet aggregation was reduced as a result of a significant impairment of P2Y(12) activity in the patient and family members. Cell surface R122C P2Y(12) expression was reduced both in cell lines and in platelets; in cell lines, this was as a consequence of agonist-independent internalization followed by subsequent receptor trafficking to lysosomes. Strikingly, members of this family also showed reduced thrombin-induced platelet activation, owing to an intronic polymorphism in the F2R gene, which encodes protease-activated receptor 1 (PAR-1), that has been shown to be associated with reduced PAR-1 receptor activity. Our study is the first to demonstrate a patient with deficits in two stimulatory GPCR pathways that regulate platelet activity, further indicating that bleeding disorders constitute a complex trait. © 2014 International Society on Thrombosis and Haemostasis.
Expression of Pneumocystis jirovecii Major Surface Glycoprotein in Saccharomyces cerevisiae
Kutty, Geetha; England, Katherine J.; Kovacs, Joseph A.
2013-01-01
The major surface glycoprotein (Msg), which is the most abundant protein expressed on the cell surface of Pneumocystis organisms, plays an important role in the attachment of this organism to epithelial cells and macrophages. In the present study, we expressed Pneumocystis jirovecii Msg in Saccharomyces cerevisiae, a phylogenetically related organism. Full-length P. jirovecii Msg was expressed with a DNA construct that used codons optimized for expression in yeast. Unlike in Pneumocystis organisms, recombinant Msg localized to the plasma membrane of yeast rather than to the cell wall. Msg expression was targeted to the yeast cell wall by replacing its signal peptide, serine-threonine–rich region, and glycophosphatidylinositol anchor signal region with the signal peptide of cell wall protein α-agglutinin of S. cerevisiae, the serine-threonine–rich region of epithelial adhesin (Epa1) of Candida glabrata, and the carboxyl region of the cell wall protein (Cwp2) of S. cerevisiae, respectively. Immunofluorescence analysis and treatment with β-1,3 glucanase demonstrated that the expressed Msg fusion protein localized to the yeast cell wall. Surface expression of Msg protein resulted in increased adherence of yeast to A549 alveolar epithelial cells. Heterologous expression of Msg in yeast will facilitate studies of the biologic properties of Pneumocystis Msg. PMID:23532098
Aberrant neuronal activity-induced signaling and gene expression in a mouse model of RASopathy
Nakhaei-Rad, Saeideh; Montenegro-Venegas, Carolina; Pina-Fernández, Eneko; Marini, Claudia; Santos, Monica; Ahmadian, Mohammad R.; Stork, Oliver; Zenker, Martin
2017-01-01
Noonan syndrome (NS) is characterized by reduced growth, craniofacial abnormalities, congenital heart defects, and variable cognitive deficits. NS belongs to the RASopathies, genetic conditions linked to mutations in components and regulators of the Ras signaling pathway. Approximately 50% of NS cases are caused by mutations in PTPN11. However, the molecular mechanisms underlying cognitive impairments in NS patients are still poorly understood. Here, we report the generation and characterization of a new conditional mouse strain that expresses the overactive Ptpn11D61Y allele only in the forebrain. Unlike mice with a global expression of this mutation, this strain is viable and without severe systemic phenotype, but shows lower exploratory activity and reduced memory specificity, which is in line with a causal role of disturbed neuronal Ptpn11 signaling in the development of NS-linked cognitive deficits. To explore the underlying mechanisms we investigated the neuronal activity-regulated Ras signaling in brains and neuronal cultures derived from this model. We observed an altered surface expression and trafficking of synaptic glutamate receptors, which are crucial for hippocampal neuronal plasticity. Furthermore, we show that the neuronal activity-induced ERK signaling, as well as the consecutive regulation of gene expression are strongly perturbed. Microarray-based hippocampal gene expression profiling revealed profound differences in the basal state and upon stimulation of neuronal activity. The neuronal activity-dependent gene regulation was strongly attenuated in Ptpn11D61Y neurons. In silico analysis of functional networks revealed changes in the cellular signaling beyond the dysregulation of Ras/MAPK signaling that is nearly exclusively discussed in the context of NS at present. Importantly, changes in PI3K/AKT/mTOR and JAK/STAT signaling were experimentally confirmed. In summary, this study uncovers aberrant neuronal activity-induced signaling and regulation of gene expression in Ptpn11D61Y mice and suggests that these deficits contribute to the pathophysiology of cognitive impairments in NS. PMID:28346493
Yano, Shuya; Takehara, Kiyoto; Tazawa, Hiroshi; Kishimoto, Hiroyuki; Urata, Yasuo; Kagawa, Shunsuke; Fujiwara, Toshiyoshi; Hoffman, Robert M.
2016-01-01
Stomach cancer carcinomatosis peritonitis (SCCP) is a recalcitrant disease. The goal of the present study was to establish an in vitro-in vivo-like imageable model of SCCP to develop cell-cycle-based therapeutics of SCCP. We established 3-D Gelfoam® histoculture and tumor-sphere models of SCCP. FUCCI-expressing MKN-45 stomach cancer cells were transferred to express the fluorescence ubiquinized cell-cycle indicator (FUCCI). FUCCI-expressing MKN-45 cells formed spheres on agarose or on Gelfoam® grew into tumor-like structures with G0/G1 cancer cells in the center and S/G2 cancer cells located in the surface as indicated by FUCCI imaging when the cells fluoresced red or green, respectively. We treated FUCCI-expressing cancer cells forming SCCP tumors in Gelfoam® histoculture with OBP-301, cisplatinum (CDDP), or paclitaxel. CDDP or paclitaxel killed only cycling cancer cells and were ineffective against G1/G2 MKN-45 cells in tumors growing on Gelfoam®. In contrast, the telomerase-dependent adenovirus OBP-301 decoyed the MKN-45 cells in tumors on Gelfoam® to cycle from G0/G1 phase to S/G2 phase and reduced their viability. CDDP- or paclitaxel-treated MKN-45 tumors remained quiescent and did not change in size. In contrast, OB-301 reduced the size of the MKN-45 tumors on Gelfoam®. We examined the cell cycle-related proteins using Western blotting. CDDP increased the expression of p53 and p21 indicating cell cycle arrest. In contrast, OBP-301 decreased the expression of p53 and p21 Furthermore, OBP-301 increased the expression of E2F and pAkt as further indication of cell cycle decoy. This 3-D Gelfoam® histoculture and FUCCI imaging are powerful tools to discover effective therapy of SCCP such as OBP-301. PMID:27673332
Nakagawa, Hidetoshi; Sido, Jessica M; Reyes, Edwin E; Kiers, Valerie; Cantor, Harvey; Kim, Hye-Jung
2016-05-31
Expression of the transcription factor Helios by Tregs ensures stable expression of a suppressive and anergic phenotype in the face of intense inflammatory responses, whereas Helios-deficient Tregs display diminished lineage stability, reduced FoxP3 expression, and production of proinflammatory cytokines. Here we report that selective Helios deficiency within CD4 Tregs leads to enhanced antitumor immunity through induction of an unstable phenotype and conversion of intratumoral Tregs into T effector cells within the tumor microenvironment. Induction of an unstable Treg phenotype is associated with enhanced production of proinflammatory cytokines by tumor-infiltrating but not systemic Tregs and significantly delayed tumor growth. Ab-dependent engagement of Treg surface receptors that result in Helios down-regulation also promotes conversion of intratumoral but not systemic Tregs into T effector cells and leads to enhanced antitumor immunity. These findings suggest that selective instability and conversion of intratumoral CD4 Tregs through genetic or Ab-based targeting of Helios may represent an effective approach to immunotherapy.
From Allergen Back to Antigen:. a Rational Approach to New Forms of Immunotherapy
NASA Astrophysics Data System (ADS)
Colombo, Paolo; Trapani, Antonino; Geraci, Domenico; Golino, Massimiliano; Gianguzza, Fabrizio; Bonura, Angela
2007-12-01
Mapping an epitope on a protein by gene fragmentation and/or point mutations is often expensive and time consuming. Analysis of a 3D model can be utilized to detect the amino acids residues which are exposed to the solvent surface and thus represent potential epitope residues. Parj1 and Parj2 are the two major allergens of the Parietaria judaica pollen belonging to the Lipid Transfer Protein family. Using their three-dimensional structures as a guide, a head to tail dimer expressing disulphide bond variants of the major allergens was generated by means of DNA recombinant technology. The hybrid was expressed in E.coli and its immunological activity studied in vivo and in vitro. Our results demonstrate that a hybrid polypeptide expressing disulphide bond variants of the major allergens of the Parietaria pollen displayed reduced allergenicity and enhanced T cell reactivity for induction of protective antibodies able to block human IgE induced during the natural course of sensitization against the Parietaria pollen.
Tight junction proteins contribute to barrier properties in human pleura.
Markov, Alexander G; Voronkova, Maria A; Volgin, George N; Yablonsky, Piotr K; Fromm, Michael; Amasheh, Salah
2011-03-15
The permeability of pleural mesothelium helps to control the volume and composition of the liquid lubricating pleural surfaces. Information on pleural barrier function in health and disease, however, is scarce. Tissue specimens of human pleura were mounted in Ussing chambers for measurement of transmesothelial resistance. Expression of tight junction (TJ) proteins was studied by Western blots and immune fluorescence confocal microscopy. Both visceral and parietal pleura showed barrier properties represented by transmesothelial resistance. Occludin, claudin-1, -3, -5, and -7, were detected in visceral pleura. In parietal pleura, the same TJ proteins were detected, except claudin-7. In tissues from patients with pleural inflammation these tightening claudins were decreased and in visceral pleura claudin-2, a paracellular channel former, became apparent. We report that barrier function in human pleura coincides with expression of claudins known to be key determinants of epithelial barrier properties. In inflamed tissue, claudin expression indicates a reduced barrier function. Copyright © 2010 Elsevier B.V. All rights reserved.
Koi, Satoshi; Katayama, Natsu
2013-01-01
Podostemaceae is a family of aquatic angiosperms growing submerged on rocks in fast-flowing water and called moss-like or alga-like riverweeds. It evolved remarkable innovations to adapt to such an extreme environment, one of which is reduced shoots borne on roots adhering to rock surface. Recent observations revealed that the basal subfamily Tristichoideae, like most other angiosperms, has typical shoot apical meristems (SAMs). In species of the subfamily Podostemoideae, however, shoot apical meristems (SAMs) are not formed during development and new leaves arise from the meristematic basal region of preexisting leaves. The genetic basis of this shoot organogenesis process, e.g., the expression patterns of genes homologous to transcription factors regulating shoot development, is essential to better understand the evolution of Podostemaceae. A gene expression analysis found that the SAM-less Podostemoideae leaf has mixed identity of SAM and leaf, and provided insight into the evolution of the shoot in Podostemaceae.
Lionetti, Vincenzo; Raiola, Alessandro; Mattei, Benedetta; Bellincampi, Daniela
2015-01-01
Pectin is secreted in a highly methylesterified form and partially de-methylesterified in the cell wall by pectin methylesterases (PMEs). PME activity is expressed during plant growth, development and stress responses. PME activity is controlled at the post-transcriptional level by proteins named PME inhibitors (PMEIs). We have identified, expressed and characterized VvPMEI1, a functional PME inhibitor of Vitis vinifera. VvPMEI1 typically affects the activity of plant PMEs and is inactive against microbial PMEs. The kinetics of PMEI-PME interaction, studied by surface plasmon resonance, indicates that the inhibitor strongly interacts with PME at apoplastic pH while the stability of the complex is reduced by increasing the pH. The analysis of VvPMEI1 expression in different grapevine tissues and during grape fruit development suggests that this inhibitor controls PME activity mainly during the earlier phase of berry development. A proteomic analysis performed at this stage indicates a PME isoform as possible target of VvPMEI1. PMID:26204516
Pinazza, Marica; Ghisi, Margherita; Minuzzo, Sonia; Agnusdei, Valentina; Fossati, Gianluca; Ciminale, Vincenzo; Pezzè, Laura; Ciribilli, Yari; Pilotto, Giorgia; Venturoli, Carolina; Amadori, Alberto; Indraccolo, Stefano
2018-04-12
Several studies have revealed that endosomal sorting controls the steady-state levels of Notch at the cell surface in normal cells and prevents its inappropriate activation in the absence of ligands. However, whether this highly dynamic physiologic process can be exploited to counteract dysregulated Notch signaling in cancer cells remains unknown. T-ALL is a malignancy characterized by aberrant Notch signaling, sustained by activating mutations in Notch1 as well as overexpression of Notch3, a Notch paralog physiologically subjected to lysosome-dependent degradation in human cancer cells. Here we show that treatment with the pan-HDAC inhibitor Trichostatin A (TSA) strongly decreases Notch3 full-length protein levels in T-ALL cell lines and primary human T-ALL cells xenografted in mice without substantially reducing NOTCH3 mRNA levels. Moreover, TSA markedly reduced the levels of Notch target genes, including pTα, CR2, and DTX-1, and induced apoptosis of T-ALL cells. We further observed that Notch3 was post-translationally regulated following TSA treatment, with reduced Notch3 surface levels and increased accumulation of Notch3 protein in the lysosomal compartment. Surface Notch3 levels were rescued by inhibition of dynein with ciliobrevin D. Pharmacologic studies with HDAC1, 6, and 8-specific inhibitors disclosed that these effects were largely due to inhibition of HDAC6 in T-ALL cells. HDAC6 silencing by specific shRNA was followed by reduced Notch3 expression and increased apoptosis of T-ALL cells. Finally, HDAC6 silencing impaired leukemia outgrowth in mice, associated with reduction of Notch3 full-length protein in vivo. These results connect HDAC6 activity to regulation of total and surface Notch3 levels and suggest HDAC6 as a potential novel therapeutic target to lower Notch signaling in T-ALL and other Notch3-addicted tumors.
2012-01-01
The endoplasmic reticulum chaperone gp96 is required for the cell surface expression of a narrow range of proteins, including toll-like receptors (TLRs) and integrins. To identify a more comprehensive repertoire of proteins whose cell surface expression is dependent on gp96, we developed plasma membrane profiling (PMP), a technique that combines SILAC labeling with selective cell surface aminooxy-biotinylation. This approach allowed us to compare the relative abundance of plasma membrane (PM) proteins on gp96-deficient versus gp96-reconstituted murine pre-B cells. Analysis of unfractionated tryptic peptides initially identified 113 PM proteins, which extended to 706 PM proteins using peptide prefractionation. We confirmed a requirement for gp96 in the cell surface expression of certain TLRs and integrins and found a marked decrease in cell surface expression of four members of the extended LDL receptor family (LDLR, LRP6, Sorl1 and LRP8) in the absence of gp96. Other novel gp96 client proteins included CD180/Ly86, important in the B-cell response to lipopolysaccharide. We highlight common structural motifs in these client proteins that may be recognized by gp96, including the beta-propeller and leucine-rich repeat. This study therefore identifies the extended LDL receptor family as an important new family of proteins whose cell surface expression is regulated by gp96. PMID:22292497