Gong, Zu-Kang; Wang, Shuang-Jie; Huang, Yong-Qi; Zhao, Rui-Qiang; Zhu, Qi-Fang; Lin, Wen-Zhen
2014-12-01
RT-qPCR is a commonly used method for evaluating gene expression; however, its accuracy and reliability are dependent upon the choice of appropriate reference gene(s), and there is limited information available on suitable reference gene(s) that can be used in mouse testis at different stages. In this study, using the RT-qPCR method, we investigated the expression variations of six reference genes representing different functional classes (Actb, Gapdh, Ppia, Tbp, Rps29, Hprt1) in mice testis during embryonic and postnatal development. The expression stabilities of putative reference genes were evaluated using five algorithms: geNorm, NormFinder, Bestkeeper, the comparative delta C(t) method and integrated tool RefFinder. Analysis of the results showed that Ppia, Gapdh and Actb were identified as the most stable genes and the geometric mean of Ppia, Gapdh and Actb constitutes an appropriate normalization factor for gene expression studies. The mRNA expression of AT1 as a test gene of interest varied depending upon which of the reference gene(s) was used as an internal control(s). This study suggested that Ppia, Gapdh and Actb are suitable reference genes among the six genes used for RT-qPCR normalization and provide crucial information for transcriptional analyses in future studies of gene expression in the developing mouse testis.
Wang, Min; Wang, Qinglian; Zhang, Baohong
2013-11-01
Reference genes are critical for normalization of the gene expression level of target genes. The widely used housekeeping genes may change their expression levels at different tissue under different treatment or stress conditions. Therefore, systematical evaluation on the housekeeping genes is required for gene expression analysis. Up to date, no work was performed to evaluate the housekeeping genes in cotton under stress treatment. In this study, we chose 10 housekeeping genes to systematically assess their expression levels at two different tissues (leaves and roots) under two different abiotic stresses (salt and drought) with three different concentrations. Our results show that there is no best reference gene for all tissues at all stress conditions. The reliable reference gene should be selected based on a specific condition. For example, under salt stress, UBQ7, GAPDH and EF1A8 are better reference genes in leaves; TUA10, UBQ7, CYP1, GAPDH and EF1A8 were better in roots. Under drought stress, UBQ7, EF1A8, TUA10, and GAPDH showed less variety of expression level in leaves and roots. Thus, it is better to identify reliable reference genes first before performing any gene expression analysis. However, using a combination of housekeeping genes as reference gene may provide a new strategy for normalization of gene expression. In this study, we found that combination of four housekeeping genes worked well as reference genes under all the stress conditions. © 2013.
Selection and testing of reference genes for accurate RT-qPCR in rice seedlings under iron toxicity.
Santos, Fabiane Igansi de Castro Dos; Marini, Naciele; Santos, Railson Schreinert Dos; Hoffman, Bianca Silva Fernandes; Alves-Ferreira, Marcio; de Oliveira, Antonio Costa
2018-01-01
Reverse Transcription quantitative PCR (RT-qPCR) is a technique for gene expression profiling with high sensibility and reproducibility. However, to obtain accurate results, it depends on data normalization by using endogenous reference genes whose expression is constitutive or invariable. Although the technique is widely used in plant stress analyzes, the stability of reference genes for iron toxicity in rice (Oryza sativa L.) has not been thoroughly investigated. Here, we tested a set of candidate reference genes for use in rice under this stressful condition. The test was performed using four distinct methods: NormFinder, BestKeeper, geNorm and the comparative ΔCt. To achieve reproducible and reliable results, Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines were followed. Valid reference genes were found for shoot (P2, OsGAPDH and OsNABP), root (OsEF-1a, P8 and OsGAPDH) and root+shoot (OsNABP, OsGAPDH and P8) enabling us to perform further reliable studies for iron toxicity in both indica and japonica subspecies. The importance of the study of other than the traditional endogenous genes for use as normalizers is also shown here.
Selection and testing of reference genes for accurate RT-qPCR in rice seedlings under iron toxicity
dos Santos, Fabiane Igansi de Castro; Marini, Naciele; dos Santos, Railson Schreinert; Hoffman, Bianca Silva Fernandes; Alves-Ferreira, Marcio
2018-01-01
Reverse Transcription quantitative PCR (RT-qPCR) is a technique for gene expression profiling with high sensibility and reproducibility. However, to obtain accurate results, it depends on data normalization by using endogenous reference genes whose expression is constitutive or invariable. Although the technique is widely used in plant stress analyzes, the stability of reference genes for iron toxicity in rice (Oryza sativa L.) has not been thoroughly investigated. Here, we tested a set of candidate reference genes for use in rice under this stressful condition. The test was performed using four distinct methods: NormFinder, BestKeeper, geNorm and the comparative ΔCt. To achieve reproducible and reliable results, Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines were followed. Valid reference genes were found for shoot (P2, OsGAPDH and OsNABP), root (OsEF-1a, P8 and OsGAPDH) and root+shoot (OsNABP, OsGAPDH and P8) enabling us to perform further reliable studies for iron toxicity in both indica and japonica subspecies. The importance of the study of other than the traditional endogenous genes for use as normalizers is also shown here. PMID:29494624
Nazari, Fatemeh; Parham, Abbas; Maleki, Adham Fani
2015-01-01
Quantitative real time reverse transcription PCR (qRT-PCR) is one of the most important techniques for gene-expression analysis in molecular based studies. Selecting a proper internal control gene for normalizing data is a crucial step in gene expression analysis via this method. The expression levels of reference genes should be remained constant among cells in different tissues. However, it seems that the location of cells in different tissues might influence their expression. The purpose of this study was to determine whether the source of mesenchymal stem cells (MSCs) has any effect on expression level of three common reference genes (GAPDH, β-actin and β2-microglobulin) in equine marrow- and adipose- derived undifferentiated MSCs and consequently their reliability for comparative qRT-PCR. Adipose tissue (AT) and bone marrow (BM) samples were harvested from 3 mares. MSCs were isolated and cultured until passage 3 (P3). Total RNA of P3 cells was extracted for cDNA synthesis. The generated cDNAs were analyzed by quantitative real-time PCR. The PCR reactions were ended with a melting curve analysis to verify the specificity of amplicon. The expression levels of GAPDH were significantly different between AT- and BM- derived MSCs (p < 0.05). Differences in expression level of β-actin (P < 0.001) and B2M (P < 0.006.) between MSCs derived from AT and BM were substantially higher than GAPDH. In addition, the fold change in expression levels of GAPDH, β-actin and B2M in AT-derived MSCs compared to BM-derived MSCs were 2.38, 6.76 and 7.76, respectively. This study demonstrated that GAPDH and especially β-actin and B2M express in different levels in equine AT- and BM- derived MSCs. Thus they cannot be considered as reliable reference genes for comparative quantitative gene expression analysis in MSCs derived from equine bone marrow and adipose tissue.
NASA Astrophysics Data System (ADS)
Yan, Lulu; Su, Jiaqi; Wang, Zhaoping; Yan, Xiwu; Yu, Ruihai
2017-12-01
Quantitative real-time polymerase chain reaction (qRT-PCR) is a rapid and reliable technique which has been widely used to quantifying gene transcripts (expression analysis). It is also employed for studying heterosis, hybridization breeding and hybrid tolerability of oysters, an ecologically and economically important taxonomic group. For these studies, selection of a suitable set of housekeeping genes as references is crucial for correct interpretation of qRT-PCR data. To identify suitable reference genes for oysters during low temperature and low salinity stresses, we analyzed twelve genes from the gill tissue of Crassostrea sikamea (SS), Crassostrea angulata (AA) and their hybrid (SA), which included three ribosomal genes, 28S ribosomal protein S5 ( RPS5), ribosomal protein L35 ( RPL35), and 60S ribosomal protein L29 ( RPL29); three structural genes, tubulin gamma ( TUBγ), annexin A6 and A7 ( AA6 and AA7); three metabolic pathway genes, ornithine decarboxylase ( OD), glyceraldehyde-3-phosphate dehydrogenase ( GAPDH) and glutathione S-transferase P1 ( GSP); two transcription factors, elongation factor 1 alpha and beta ( EF1α and EF1β); and one protein synthesis gene (ubiquitin ( UBQ). Primers specific for these genes were successfully developed for the three groups of oysters. Three different algorithms, geNorm, NormFinder and BestKeeper, were used to evaluate the expression stability of these candidate genes. BestKeeper program was found to be the most reliable. Based on our analysis, we found that the expression of RPL35 and EF1α was stable under low salinity stress, and the expression of OD, GAPDH and EF1α was stable under low temperature stress in hybrid (SA) oyster; the expression of RPS5 and GAPDH was stable under low salinity stress, and the expression of RPS5, UBQ, GAPDH was stable under low temperature stress in SS oyster; the expression of RPS5, GAPDH, EF1β and AA7 was stable under low salinity stress, and the expression of RPL35, EF1α, GAPDH and EF1β was stable under low temperature stress in AA oyster. Furthermore, to evaluate their suitability, the reference genes were used to quantify six target genes. In conclusion, we have successfully developed primers appropriate for the expression analysis in SS, SA and AA.
Reference genes for reverse transcription quantitative PCR in canine brain tissue.
Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C
2015-12-09
In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and inexpensive method to study expression levels of genes involved in disease processes. Accurate normalisation with stably expressed so-called reference genes is crucial for reliable expression analysis. Following the minimum information for publication of quantitative real-time PCR experiments precise guidelines, the expression of ten frequently used reference genes, namely YWHAZ, HMBS, B2M, SDHA, GAPDH, HPRT, RPL13A, RPS5, RPS19 and GUSB was evaluated in seven brain regions (frontal lobe, parietal lobe, occipital lobe, temporal lobe, thalamus, hippocampus and cerebellum) and whole brain of healthy dogs. The stability of expression varied between different brain areas. Using the GeNorm and Normfinder software HMBS, GAPDH and HPRT were the most reliable reference genes for whole brain. Furthermore based on GeNorm calculations it was concluded that as little as two to three reference genes are sufficient to obtain reliable normalisation, irrespective the brain area. Our results amend/extend the limited previously published data on canine brain reference genes. Despite the excellent expression stability of HMBS, GAPDH and HRPT, the evaluation of expression stability of reference genes must be a standard and integral part of experimental design and subsequent data analysis.
Shekh, Kamran; Tang, Song; Niyogi, Som; Hecker, Markus
2017-09-01
Gene expression analysis represents a powerful approach to characterize the specific mechanisms by which contaminants interact with organisms. One of the key considerations when conducting gene expression analyses using quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is the selection of appropriate reference genes, which is often overlooked. Specifically, to reach meaningful conclusions when using relative quantification approaches, expression levels of reference genes must be highly stable and cannot vary as a function of experimental conditions. However, to date, information on the stability of commonly used reference genes across developmental stages, tissues and after exposure to contaminants such as metals is lacking for many vertebrate species including teleost fish. Therefore, in this study, we assessed the stability of expression of 8 reference gene candidates in the gills and skin of three different early life-stages of rainbow trout after acute exposure (24h) to two metals, cadmium (Cd) and copper (Cu) using qPCR. Candidate housekeeping genes were: beta actin (b-actin), DNA directed RNA polymerase II subunit I (DRP2), elongation factor-1 alpha (EF1a), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), glucose-6-phosphate dehydrogenase (G6PD), hypoxanthine phosphoribosyltransferase (HPRT), ribosomal protein L8 (RPL8), and 18S ribosomal RNA (18S). Four algorithms, geNorm, NormFinder, BestKeeper, and the comparative ΔCt method were employed to systematically evaluate the expression stability of these candidate genes under control and exposed conditions as well as across three different life-stages. Finally, stability of genes was ranked by taking geometric means of the ranks established by the different methods. Stability of reference genes was ranked in the following order (from lower to higher stability): HPRT
Optimal Reference Gene Selection for Expression Studies in Human Reticulocytes.
Aggarwal, Anu; Jamwal, Manu; Viswanathan, Ganesh K; Sharma, Prashant; Sachdeva, ManUpdesh S; Bansal, Deepak; Malhotra, Pankaj; Das, Reena
2018-05-01
Reference genes are indispensable for normalizing mRNA levels across samples in real-time quantitative PCR. Their expression levels vary under different experimental conditions and because of several inherent characteristics. Appropriate reference gene selection is thus critical for gene-expression studies. This study aimed at selecting optimal reference genes for gene-expression analysis of reticulocytes and at validating them in hereditary spherocytosis (HS) and β-thalassemia intermedia (βTI) patients. Seven reference genes (PGK1, MPP1, HPRT1, ACTB, GAPDH, RN18S1, and SDHA) were selected because of published reports. Real-time quantitative PCR was performed on reticulocytes in 20 healthy volunteers, 15 HS patients, and 10 βTI patients. Threshold cycle values were compared with fold-change method and RefFinder software. The stable reference genes recommended by RefFinder were validated with SLC4A1 and flow cytometric eosin-5'-maleimide binding assay values in HS patients and HBG2 and high performance liquid chromatography-derived percentage of hemoglobin F in βTI. Comprehensive ranking predicted MPP1 and GAPDH as optimal reference genes for reticulocytes that were not affected in HS and βTI. This was further confirmed on validation with eosin-5'-maleimide results and percentage of hemoglobin F in HS and βTI patients, respectively. Hence, MPP1 and GAPDH are good reference genes for reticulocyte expression studies compared with ACTB and RN18S1, the two most commonly used reference genes. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Harrison, Oliver J; Moorjani, Narain; Torrens, Christopher; Ohri, Sunil K; Cagampang, Felino R
2016-01-01
Bicuspid aortic valve (BAV) disease is the most common congenital cardiac abnormality and predisposes patients to life-threatening aortic complications including aortic aneurysm. Quantitative real-time reverse transcription PCR (qRT-PCR) is one of the most commonly used methods to investigate underlying molecular mechanisms involved in aortopathy. The accuracy of the gene expression data is dependent on normalization by appropriate housekeeping (HK) genes, whose expression should remain constant regardless of aortic valve morphology, aortic diameter and other factors associated with aortopathy. Here, we identified an appropriate set of HK genes to be used as endogenous reference for quantifying gene expression in ascending aortic tissue using a spin column-based RNA extraction method. Ascending aortic biopsies were collected intra-operatively from patients undergoing aortic valve and/or ascending aortic surgery. These patients had BAV or tricuspid aortic valve (TAV), and the aortas were either dilated (≥4.5cm) or undilated. The cohort had an even distribution of gender, valve disease and hypertension. The expression stability of 12 reference genes were investigated (ATP5B, ACTB, B2M, CYC1, EIF4A2, GAPDH, SDHA, RPL13A, TOP1, UBC, YWHAZ, and 18S) using geNorm software. The most stable HK genes were found to be GAPDH, UBC and ACTB. Both GAPDH and UBC demonstrated relative stability regardless of valve morphology, aortic diameter, gender and age. The expression of B2M and SDHA were found to be the least stable HK genes. We propose the use of GAPDH, UBC and ACTB as reference genes for gene expression studies of BAV aortopathy using ascending aortic tissue.
Fuentes, Alejandra; Ortiz, Javier; Saavedra, Nicolás; Salazar, Luis A; Meneses, Claudio; Arriagada, Cesar
2016-04-01
The gene expression stability of candidate reference genes in the roots and leaves of Solanum lycopersicum inoculated with arbuscular mycorrhizal fungi was investigated. Eight candidate reference genes including elongation factor 1 α (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), phosphoglycerate kinase (PGK), protein phosphatase 2A (PP2Acs), ribosomal protein L2 (RPL2), β-tubulin (TUB), ubiquitin (UBI) and actin (ACT) were selected, and their expression stability was assessed to determine the most stable internal reference for quantitative PCR normalization in S. lycopersicum inoculated with the arbuscular mycorrhizal fungus Rhizophagus irregularis. The stability of each gene was analysed in leaves and roots together and separated using the geNorm and NormFinder algorithms. Differences were detected between leaves and roots, varying among the best-ranked genes depending on the algorithm used and the tissue analysed. PGK, TUB and EF1 genes showed higher stability in roots, while EF1 and UBI had higher stability in leaves. Statistical algorithms indicated that the GAPDH gene was the least stable under the experimental conditions assayed. Then, we analysed the expression levels of the LePT4 gene, a phosphate transporter whose expression is induced by fungal colonization in host plant roots. No differences were observed when the most stable genes were used as reference genes. However, when GAPDH was used as the reference gene, we observed an overestimation of LePT4 expression. In summary, our results revealed that candidate reference genes present variable stability in S. lycopersicum arbuscular mycorrhizal symbiosis depending on the algorithm and tissue analysed. Thus, reference gene selection is an important issue for obtaining reliable results in gene expression quantification. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Barsalobres-Cavallari, Carla F; Severino, Fábio E; Maluf, Mirian P; Maia, Ivan G
2009-01-01
Background Quantitative data from gene expression experiments are often normalized by transcription levels of reference or housekeeping genes. An inherent assumption for their use is that the expression of these genes is highly uniform in living organisms during various phases of development, in different cell types and under diverse environmental conditions. To date, the validation of reference genes in plants has received very little attention and suitable reference genes have not been defined for a great number of crop species including Coffea arabica. The aim of the research reported herein was to compare the relative expression of a set of potential reference genes across different types of tissue/organ samples of coffee. We also validated the expression profiles of the selected reference genes at various stages of development and under a specific biotic stress. Results The expression levels of five frequently used housekeeping genes (reference genes), namely alcohol dehydrogenase (adh), 14-3-3, polyubiquitin (poly), β-actin (actin) and glyceraldehyde-3-phosphate dehydrogenase (gapdh) was assessed by quantitative real-time RT-PCR over a set of five tissue/organ samples (root, stem, leaf, flower, and fruits) of Coffea arabica plants. In addition to these commonly used internal controls, three other genes encoding a cysteine proteinase (cys), a caffeine synthase (ccs) and the 60S ribosomal protein L7 (rpl7) were also tested. Their stability and suitability as reference genes were validated by geNorm, NormFinder and BestKeeper programs. The obtained results revealed significantly variable expression levels of all reference genes analyzed, with the exception of gapdh, which showed no significant changes in expression among the investigated experimental conditions. Conclusion Our data suggests that the expression of housekeeping genes is not completely stable in coffee. Based on our results, gapdh, followed by 14-3-3 and rpl7 were found to be homogeneously expressed and are therefore adequate for normalization purposes, showing equivalent transcript levels in different tissue/organ samples. Gapdh is therefore the recommended reference gene for measuring gene expression in Coffea arabica. Its use will enable more accurate and reliable normalization of tissue/organ-specific gene expression studies in this important cherry crop plant. PMID:19126214
2014-01-01
Background Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. Results A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. Conclusions The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level of expression stability across three different olive cultivars, Barnea, Frantoio and Picual, however the combination of the three most stable reference genes do vary amongst individual cultivars. This study will provide guidance to other researchers to select reference genes for normalization against target genes by qPCR across tissues obtained from the mesocarp region of the olive fruit in the cultivars, Barnea, Frantoio and Picual. PMID:24884716
Selection of Reference Genes for Expression Studies in Diaphorina citri (Hemiptera: Liviidae).
Bassan, Meire Menezes; Angelotti-Mendonc A, Je Ssika; Alves, Gustavo Rodrigues; Yamamoto, Pedro Takao; Moura O Filho, Francisco de Assis Alves
2017-12-05
The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is considered the main vector of the bacteria associated with huanglongbing, a very serious disease that has threatened the world citrus industry. The absence of efficient control management protocols, including a lack of resistant cultivars, has led to the development of different approaches to study this pathosystem. The production of resistant genotypes relies on D. citri gene expression analyses by RT-qPCR to assess control of the vector population. High-quality, reliable RT-qPCR analyses depend upon proper reference gene selection and validation. However, adequate D. citri reference genes have not yet been identified. In the present study, we evaluated the genes EF 1-α, ACT, GAPDH, RPL7, RPL17, and TUB as candidate reference genes for this insect. Gene expression stability was evaluated using the mathematical algorithms deltaCt, NormFinder, BestKeeper, and geNorm, at five insect developmental stages, grown on two different plant hosts [Citrus sinensis (L.) Osbeck (Sapindales: Rutaceae) and Murraya paniculata (L.) Jack (Sapindales: Rutaceae)]. The final gene ranking was calculated using RefFinder software, and the V-ATPase-A gene was selected for validation. According to our results, two reference genes are recommended when different plant hosts and developmental stages are considered. Considering gene expression studies in D. citri grown on M. paniculata, regardless of the insect developmental stage, GAPDH and RPL7 have the best fit as reference genes in RT-qPCR analyses, whereas GAPDH and EF 1-α are recommended as reference genes in insect studies using C. sinensis. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Cai, Jing; Li, Tao; Huang, Bangxing; Cheng, Henghui; Ding, Hui; Dong, Weihong; Xiao, Man; Liu, Ling; Wang, Zehua
2014-01-01
Quantitative real-time PCR (qPCR) is a powerful and reproducible method of gene expression analysis in which expression levels are quantified by normalization against reference genes. Therefore, to investigate the potential biomarkers and therapeutic targets for epithelial ovarian cancer by qPCR, it is critical to identify stable reference genes. In this study, twelve housekeeping genes (ACTB, GAPDH, 18S rRNA, GUSB, PPIA, PBGD, PUM1, TBP, HRPT1, RPLP0, RPL13A, and B2M) were analyzed in 50 ovarian samples from normal, benign, borderline, and malignant tissues. For reliable results, laser microdissection (LMD), an effective technique used to prepare homogeneous starting material, was utilized to precisely excise target tissues or cells. One-way analysis of variance (ANOVA) and nonparametric (Kruskal-Wallis) tests were used to compare the expression differences. NormFinder and geNorm software were employed to further validate the suitability and stability of the candidate genes. Results showed that epithelial cells occupied a small percentage of the normal ovary indeed. The expression of ACTB, PPIA, RPL13A, RPLP0, and TBP were stable independent of the disease progression. In addition, NormFinder and geNorm identified the most stable combination (ACTB, PPIA, RPLP0, and TBP) and the relatively unstable reference gene GAPDH from the twelve commonly used housekeeping genes. Our results highlight the use of homogeneous ovarian tissues and multiple-reference normalization strategy, e.g. the combination of ACTB, PPIA, RPLP0, and TBP, for qPCR in epithelial ovarian tissues, whereas GAPDH, the most commonly used reference gene, is not recommended, especially as a single reference gene.
Chapman, Joanne R; Waldenström, Jonas
2015-01-01
The choice of reference genes that are stably expressed amongst treatment groups is a crucial step in real-time quantitative PCR gene expression studies. Recent guidelines have specified that a minimum of two validated reference genes should be used for normalisation. However, a quantitative review of the literature showed that the average number of reference genes used across all studies was 1.2. Thus, the vast majority of studies continue to use a single gene, with β-actin (ACTB) and/or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) being commonly selected in studies of vertebrate gene expression. Few studies (15%) tested a panel of potential reference genes for stability of expression before using them to normalise data. Amongst studies specifically testing reference gene stability, few found ACTB or GAPDH to be optimal, whereby these genes were significantly less likely to be chosen when larger panels of potential reference genes were screened. Fewer reference genes were tested for stability in non-model organisms, presumably owing to a dearth of available primers in less well characterised species. Furthermore, the experimental conditions under which real-time quantitative PCR analyses were conducted had a large influence on the choice of reference genes, whereby different studies of rat brain tissue showed different reference genes to be the most stable. These results highlight the importance of validating the choice of normalising reference genes before conducting gene expression studies.
Validation of reference genes for quantifying changes in gene expression in virus-infected tobacco.
Baek, Eseul; Yoon, Ju-Yeon; Palukaitis, Peter
2017-10-01
To facilitate quantification of gene expression changes in virus-infected tobacco plants, eight housekeeping genes were evaluated for their stability of expression during infection by one of three systemically-infecting viruses (cucumber mosaic virus, potato virus X, potato virus Y) or a hypersensitive-response-inducing virus (tobacco mosaic virus; TMV) limited to the inoculated leaf. Five reference-gene validation programs were used to establish the order of the most stable genes for the systemically-infecting viruses as ribosomal protein L25 > β-Tubulin > Actin, and the least stable genes Ubiquitin-conjugating enzyme (UCE) < PP2A < GAPDH. For local infection by TMV, the most stable genes were EF1α > Cysteine protease > Actin, and the least stable genes were GAPDH < PP2A < UCE. Using two of the most stable and the two least stable validated reference genes, three defense responsive genes were examined to compare their relative changes in gene expression caused by each virus. Copyright © 2017 Elsevier Inc. All rights reserved.
Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei
2012-01-01
Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2-ΔΔCt method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR. PMID:22938136
Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei
2012-01-01
Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.
Li, Mengmeng; Rao, Man; Chen, Kai; Zhou, Jianye; Song, Jiangping
2017-07-15
Real-time quantitative reverse transcriptase-PCR (qRT-PCR) is a feasible tool for determining gene expression profiles, but the accuracy and reliability of the results depends on the stable expression of selected housekeeping genes in different samples. By far, researches on stable housekeeping genes in human heart failure samples are rare. Moreover the effect of heart failure on the expression of housekeeping genes in right and left ventricles is yet to be studied. Therefore we aim to provide stable housekeeping genes for both ventricles in heart failure and normal heart samples. In this study, we selected seven commonly used housekeeping genes as candidates. By using the qRT-PCR, the expression levels of ACTB, RAB7A, GAPDH, REEP5, RPL5, PSMB4 and VCP in eight heart failure and four normal heart samples were assessed. The stability of candidate housekeeping genes was evaluated by geNorm and Normfinder softwares. GAPDH showed the least variation in all heart samples. Results also indicated the difference of gene expression existed in heart failure left and right ventricles. GAPDH had the highest expression stability in both heart failure and normal heart samples. We also propose using different sets of housekeeping genes for left and right ventricles respectively. The combination of RPL5, GAPDH and PSMB4 is suitable for the right ventricle and the combination of GAPDH, REEP5 and RAB7A is suitable for the left ventricle. Copyright © 2017 Elsevier B.V. All rights reserved.
Zhou, Liang-Yun; Mo, Ge; Wang, Sheng; Tang, Jin-Fu; Yue, Hong; Huang, Lu-Qi; Shao, Ai-Juan; Guo, Lan-Ping
2014-03-01
In this study, Actin, 18S rRNA, PAL, GAPDH and CPR of Artemisia annua were selected as candidate reference genes, and their gene-specific primers for real-time PCR were designed, then geNorm, NormFinder, BestKeeper, Delta CT and RefFinder were used to evaluate their expression stability in the leaves of A. annua under treatment of different concentrations of Cd, with the purpose of finding a reliable reference gene to ensure the reliability of gene-expression analysis. The results showed that there were some significant differences among the candidate reference genes under different treatments and the order of expression stability of candidate reference gene was Actin > 18S rRNA > PAL > GAPDH > CPR. These results suggested that Actin, 18S rRNA and PAL could be used as ideal reference genes of gene expression analysis in A. annua and multiple internal control genes were adopted for results calibration. In addition, differences in expression stability of candidate reference genes in the leaves of A. annua under the same concentrations of Cd were observed, which suggested that the screening of candidate reference genes was needed even under the same treatment. To our best knowledge, this study for the first time provided the ideal reference genes under Cd treatment in the leaves of A. annua and offered reference for the gene expression analysis of A. annua under other conditions.
Mahakapuge, T A N; Scheerlinck, J-P Y; Rojas, C A Alvarez; Every, A L; Hagen, J
2016-03-01
With the availability of genetic sequencing data, quantitative reverse transcription PCR (RT-qPCR) is increasingly being used for the quantification of gene transcription across species. Too often there is little regard to the selection of reference genes and the impact that a poor choice has on data interpretation. Indeed, RT-qPCR provides a snapshot of relative gene transcription at a given time-point, and hence is highly dependent on the stability of the transcription of the reference gene(s). Using ovine efferent lymph cells and peripheral blood mono-nuclear cells (PBMCs), the two most frequently used leukocytes in immunological studies, we have compared the stability of transcription of the most commonly used ovine reference genes: YWHAZ, RPL-13A, PGK1, B2M, GAPDH, HPRT, SDHA and ACTB. Using established algorithms for reference gene normalization "geNorm" and "Norm Finder", PGK1, GAPDH and YWHAZ were deemed the most stably transcribed genes for efferent leukocytes and PGK1, YWHAZ and SDHA were optimal in PBMCs. These genes should therefore be considered for accurate and reproducible RT-qPCR data analysis of gene transcription in sheep. Copyright © 2016. Published by Elsevier B.V.
Wang, Peihong; Xiong, Aisheng; Gao, Zhihong; Yu, Xinyi; Li, Man; Hou, Yingjun; Sun, Chao; Qu, Shenchun
2016-01-01
The success of quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) to quantify gene expression depends on the stability of the reference genes used for data normalization. To date, systematic screening for reference genes in persimmon (Diospyros kaki Thunb) has never been reported. In this study, 13 candidate reference genes were cloned from 'Nantongxiaofangshi' using information available in the transcriptome database. Their expression stability was assessed by geNorm and NormFinder algorithms under abiotic stress and hormone stimulation. Our results showed that the most suitable reference genes across all samples were UBC and GAPDH, and not the commonly used persimmon reference gene ACT. In addition, UBC combined with RPII or TUA were found to be appropriate for the "abiotic stress" group and α-TUB combined with PP2A were found to be appropriate for the "hormone stimuli" group. For further validation, the transcript level of the DkDREB2C homologue under heat stress was studied with the selected genes (CYP, GAPDH, TUA, UBC, α-TUB, and EF1-α). The results suggested that it is necessary to choose appropriate reference genes according to the test materials or experimental conditions. Our study will be useful for future studies on gene expression in persimmon. PMID:27513755
2017-01-01
Real-time quantitative PCR (qPCR) is the most reliable and accurate technique for analyses of gene expression. Endogenous reference genes are being used to normalize qPCR data even though their expression may vary under different conditions and in different tissues. Nonetheless, verification of expression of reference genes in selected studied tissue is essential in order to accurately assess the level of expression of target genes of interest. Therefore, in this study, we attempted to examine six commonly used reference genes in order to identify the gene being expressed most constantly under the influence of testosterone in the kidneys and hypothalamus. The reference genes include glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin beta (ACTB), beta-2 microglobulin (B2m), hypoxanthine phosphoribosyltransferase 1 (HPRT), peptidylprolylisomerase A (Ppia) and hydroxymethylbilane synthase (Hmbs). The cycle threshold (Ct) value for each gene was determined and data obtained were analyzed using the software programs NormFinder, geNorm, BestKeeper, and rank aggregation. Results showed that Hmbs and Ppia genes were the most stably expressed in the hypothalamus. Meanwhile, in kidneys, Hmbs and GAPDH appeared to be the most constant genes. In conclusion, variations in expression levels of reference genes occur in kidneys and hypothalamus under similar conditions; thus, it is important to verify reference gene levels in these tissues prior to commencing any studies. PMID:28591185
Wu, Keke; Liu, Wenwen; Mar, Thithi; Liu, Yan; Wu, Yunfeng; Wang, Xifeng
2014-01-01
The bird cherry-oat aphid (Rhopalosiphum padi), an important pest of cereal crops, not only directly sucks sap from plants, but also transmits a number of plant viruses, collectively the yellow dwarf viruses (YDVs). For quantifying changes in gene expression in vector aphids, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is a touchstone method, but the selection and validation of housekeeping genes (HKGs) as reference genes to normalize the expression level of endogenous genes of the vector and for exogenous genes of the virus in the aphids is critical to obtaining valid results. Such an assessment has not been done, however, for R. padi and YDVs. Here, we tested three algorithms (GeNorm, NormFinder and BestKeeper) to assess the suitability of candidate reference genes (EF-1α, ACT1, GAPDH, 18S rRNA) in 6 combinations of YDV and vector aphid morph. EF-1α and ACT1 together or in combination with GAPDH or with GAPDH and 18S rRNA could confidently be used to normalize virus titre and expression levels of endogenous genes in winged or wingless R. padi infected with Barley yellow dwarf virus isolates (BYDV)-PAV and BYDV-GAV. The use of only one reference gene, whether the most stably expressed (EF-1α) or the least stably expressed (18S rRNA), was not adequate for obtaining valid relative expression data from the RT-qPCR. Because of discrepancies among values for changes in relative expression obtained using 3 regions of the same gene, different regions of an endogenous aphid gene, including each terminus and the middle, should be analyzed at the same time with RT-qPCR. Our results highlight the necessity of choosing the best reference genes to obtain valid experimental data and provide several HKGs for relative quantification of virus titre in YDV-viruliferous aphids. PMID:24810421
Zeng, Lingfeng; Deng, Rong; Guo, Ziping; Yang, Shushen; Deng, Xiping
2016-03-16
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a central enzyme in glycolysi, we performed genome-wide identification of GAPDH genes in wheat and analyzed their structural characteristics and expression patterns under abiotic stress in wheat. A total of 22 GAPDH genes were identified in wheat cv. Chinese spring; the phylogenetic and structure analysis showed that these GAPDH genes could be divided into four distinct subfamilies. The expression profiles of GAPDH genes showed tissue specificity all over plant development stages. The qRT-PCR results revealed that wheat GAPDHs were involved in several abiotic stress response. Wheat carried 22 GAPDH genes, representing four types of plant GAPDHs (gapA/B, gapC, gapCp and gapN). Whole genome duplication and segmental duplication might account for the expansion of wheat GAPDHs. Expression analysis implied that GAPDHs play roles in plants abiotic stress tolerance.
Zhu, Wuzheng; Lin, Yaqiu; Liao, Honghai; Wang, Yong
2015-01-01
The identification of suitable reference genes is critical for obtaining reliable results from gene expression studies using quantitative real-time PCR (qPCR) because the expression of reference genes may vary considerably under different experimental conditions. In most cases, however, commonly used reference genes are employed in data normalization without proper validation, which may lead to incorrect data interpretation. Here, we aim to select a set of optimal reference genes for the accurate normalization of gene expression associated with intramuscular fat (IMF) deposition during development. In the present study, eight reference genes (PPIB, HMBS, RPLP0, B2M, YWHAZ, 18S, GAPDH and ACTB) were evaluated by three different algorithms (geNorm, NormFinder and BestKeeper) in two types of muscle tissues (longissimus dorsi muscle and biceps femoris muscle) across different developmental stages. All three algorithms gave similar results. PPIB and HMBS were identified as the most stable reference genes, while the commonly used reference genes 18S and GAPDH were the most variably expressed, with expression varying dramatically across different developmental stages. Furthermore, to reveal the crucial role of appropriate reference genes in obtaining a reliable result, analysis of PPARG expression was performed by normalization to the most and the least stable reference genes. The relative expression levels of PPARG normalized to the most stable reference genes greatly differed from those normalized to the least stable one. Therefore, evaluation of reference genes must be performed for a given experimental condition before the reference genes are used. PPIB and HMBS are the optimal reference genes for analysis of gene expression associated with IMF deposition in skeletal muscle during development.
Reference genes for normalization of qPCR assays in sugarcane plants under water deficit.
de Andrade, Larissa Mara; Dos Santos Brito, Michael; Fávero Peixoto Junior, Rafael; Marchiori, Paulo Eduardo Ribeiro; Nóbile, Paula Macedo; Martins, Alexandre Palma Boer; Ribeiro, Rafael Vasconcelos; Creste, Silvana
2017-01-01
Sugarcane ( Saccharum spp.) is the main raw material for sugar and ethanol production. Among the abiotic stress, drought is the main one that negatively impact sugarcane yield. Although gene expression analysis through quantitative PCR (qPCR) has increased our knowledge about biological processes related to drought, gene network that mediates sugarcane responses to water deficit remains elusive. In such scenario, validation of reference gene is a major requirement for successful analyzes involving qPCR. In this study, candidate genes were tested for their suitable as reference genes for qPCR analyses in two sugarcane cultivars with varying drought tolerance. Eight candidate reference genes were evaluated in leaves sampled in plants subjected to water deficit in both field and greenhouse conditions. In addition, five genes were evaluated in shoot roots of plants subjected to water deficit by adding PEG8000 to the nutrient solution. NormFinder and RefFinder algorithms were used to identify the most stable gene(s) among genotypes and under different experimental conditions. Both algorithms revealed that in leaf samples, UBQ1 and GAPDH genes were more suitable as reference genes, whereas GAPDH was the best reference one in shoot roots. Reference genes suitable for sugarcane under water deficit were identified, which would lead to a more accurate and reliable analysis of qPCR. Thus, results obtained in this study may guide future research on gene expression in sugarcane under varying water conditions.
Liu, Qiuxu; Qi, Xiao; Yan, Haidong; Huang, Linkai; Nie, Gang; Zhang, Xinquan
2018-01-16
To select the most stable reference genes in annual ryegrass ( Lolium multiflorum ), we studied annual ryegrass leaf tissues exposed to various abiotic stresses by qRT-PCR and selected 11 candidate reference genes, i.e., 18S rRNA, E2, GAPDH, eIF4A, HIS3, SAMDC, TBP-1, Unigene71, Unigene77, Unigene755, and Unigene14912. We then used GeNorm, NormFinder, and BestKeeper to analyze the expression stability of these 11 genes, and used RefFinder to comprehensively rank genes according to stability. Under different stress conditions, the most suitable reference genes for studies of leaf tissues of annual ryegrass were different. The expression of the eIF4A gene was the most stable under drought stress. Under saline-alkali stress, Unigene14912 has the highest expression stability. Under acidic aluminum stress, SAMDC expression stability was highest. Under heavy metal stress, Unigene71 expression had the highest stability. According to the software analyses, Unigene14912, HIS3, and eIF4A were the most suitable for analyses of abiotic stress in tissues of annual ryegrass. GAPDH was the least suitable reference gene. In conclusion, selecting appropriate reference genes under abiotic stress not only improves the accuracy of annual ryegrass gene expression analyses, but also provides a theoretical reference for the development of reference genes in plants of the genus Lolium .
Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis.
dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana
2015-01-01
Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.
Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis
dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana
2015-01-01
Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928
2010-01-01
Background Identification of genes with invariant levels of gene expression is a prerequisite for validating transcriptomic changes accompanying development. Ideally expression of these genes should be independent of the morphogenetic process or environmental condition tested as well as the methods used for RNA purification and analysis. Results In an effort to identify endogenous genes meeting these criteria nine reference genes (RG) were tested in two Petunia lines (Mitchell and V30). Growth conditions differed in Mitchell and V30, and different methods were used for RNA isolation and analysis. Four different software tools were employed to analyze the data. We merged the four outputs by means of a non-weighted unsupervised rank aggregation method. The genes identified as optimal for transcriptomic analysis of Mitchell and V30 were EF1α in Mitchell and CYP in V30, whereas the least suitable gene was GAPDH in both lines. Conclusions The least adequate gene turned out to be GAPDH indicating that it should be rejected as reference gene in Petunia. The absence of correspondence of the best-suited genes suggests that assessing reference gene stability is needed when performing normalization of data from transcriptomic analysis of flower and leaf development. PMID:20056000
Establishing references for gene expression analyses by RT-qPCR in Theobroma cacao tissues.
Pinheiro, T T; Litholdo, C G; Sereno, M L; Leal, G A; Albuquerque, P S B; Figueira, A
2011-11-17
Lack of continuous progress in Theobroma cacao (Malvaceae) breeding, especially associated with seed quality traits, requires more efficient selection methods based on genomic information. Reverse transcript quantitative PCR (RT-qPCR) has become the method of choice for gene expression analysis, but relative expression analysis requires various reference genes, which must be stable across various biological conditions. We sought suitable reference genes for various tissues of cacao, especially developing seeds. Ten potential reference genes were analyzed for stability at various stages of embryo development, leaves, stems, roots, flowers, and pod epicarp; seven of them were also evaluated in shoot tips treated either with hormones (salicylate; ethefon; methyl-jasmonate) or after inoculation with the fungus Moniliophthora perniciosa (Marasmiaceae sensu lato). For developing embryos, the three most stable genes were actin (ACT), polyubiquitin (PUB), and ribosomal protein L35 (Rpl35). In the analyses of various tissues, the most stable genes were malate dehydrogenase (MDH), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and acyl-carrier protein B (ACP B). GAPDH, MDH and tubulin (TUB) were the most appropriate for normalization when shoot apexes were treated with hormones, while ACT, TUB and Rpl35 were the most appropriate after inoculation with M. perniciosa. We conclude that for each plant system and biological or ontogenetical condition, there is a need to define suitable reference genes. This is the first report to define reference genes for expression studies in cacao.
Yang, Jie; Lin, Qi; Lin, Juan; Ye, Xiuyun
2016-01-01
With its ability to produce ligninolytic enzymes such as laccases, white-rot basidiomycete Cerrena unicolor, a medicinal mushroom, has great potential in biotechnology. Elucidation of the expression profiles of genes encoding ligninolytic enzymes are important for increasing their production. Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool to study transcriptional regulation of genes of interest. To ensure accuracy and reliability of qPCR analysis of C. unicolor, expression levels of seven candidate reference genes were studied at different growth phases, under various induction conditions, and with a range of carbon/nitrogen ratios and carbon and nitrogen sources. The stability of the genes were analyzed with five statistical approaches, namely geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder. Our results indicated that the selection of reference genes varied with sample sets. A combination of four reference genes (Cyt-c, ATP6, TEF1, and β-tubulin) were recommended for normalizing gene expression at different growth phases. GAPDH and Cyt-c were the appropriate reference genes under different induction conditions. ATP6 and TEF1 were most stable in fermentation media with various carbon/nitrogen ratios. In the fermentation media with various carbon or nitrogen sources, 18S rRNA and GAPDH were the references of choice. The present study represents the first validation analysis of reference genes in C. unicolor and serves as a foundation for its qPCR analysis.
Rhinn, Hervé; Marchand-Leroux, Catherine; Croci, Nicole; Plotkine, Michel; Scherman, Daniel; Escriou, Virginie
2008-01-01
Background Traumatic brain injury models are widely studied, especially through gene expression, either to further understand implied biological mechanisms or to assess the efficiency of potential therapies. A large number of biological pathways are affected in brain trauma models, whose elucidation might greatly benefit from transcriptomic studies. However the suitability of reference genes needed for quantitative RT-PCR experiments is missing for these models. Results We have compared five potential reference genes as well as total cDNA level monitored using Oligreen reagent in order to determine the best normalizing factors for quantitative RT-PCR expression studies in the early phase (0–48 h post-trauma (PT)) of a murine model of diffuse brain injury. The levels of 18S rRNA, and of transcripts of β-actin, glyceraldehyde-3P-dehydrogenase (GAPDH), β-microtubulin and S100β were determined in the injured brain region of traumatized mice sacrificed at 30 min, 3 h, 6 h, 12 h, 24 h and 48 h post-trauma. The stability of the reference genes candidates and of total cDNA was evaluated by three different methods, leading to the following rankings as normalization factors, from the most suitable to the less: by using geNorm VBA applet, we obtained the following sequence: cDNA(Oligreen); GAPDH > 18S rRNA > S100β > β-microtubulin > β-actin; by using NormFinder Excel Spreadsheet, we obtained the following sequence: GAPDH > cDNA(Oligreen) > S100β > 18S rRNA > β-actin > β-microtubulin; by using a Confidence-Interval calculation, we obtained the following sequence: cDNA(Oligreen) > 18S rRNA; GAPDH > S100β > β-microtubulin > β-actin. Conclusion This work suggests that Oligreen cDNA measurements, 18S rRNA and GAPDH or a combination of them may be used to efficiently normalize qRT-PCR gene expression in mouse brain trauma injury, and that β-actin and β-microtubulin should be avoided. The potential of total cDNA as measured by Oligreen as a first-intention normalizing factor with a broad field of applications is highlighted. Pros and cons of the three methods of normalization factors selection are discussed. A generic time- and cost-effective procedure for normalization factor validation is proposed. PMID:18611280
Li, Meng-Yao; Song, Xiong; Wang, Feng; Xiong, Ai-Sheng
2016-01-01
Parsley, one of the most important vegetables in the Apiaceae family, is widely used in the food, medicinal, and cosmetic industries. Recent studies on parsley mainly focus on its chemical composition, and further research involving the analysis of the plant's gene functions and expressions is required. qPCR is a powerful method for detecting very low quantities of target transcript levels and is widely used to study gene expression. To ensure the accuracy of results, a suitable reference gene is necessary for expression normalization. In this study, four software, namely geNorm, NormFinder, BestKeeper, and RefFinder were used to evaluate the expression stabilities of eight candidate reference genes of parsley (GAPDH, ACTIN, eIF-4α, SAND, UBC, TIP41, EF-1α, and TUB) under various conditions, including abiotic stresses (heat, cold, salt, and drought) and hormone stimuli treatments (GA, SA, MeJA, and ABA). Results showed that EF-1α and TUB were the most stable genes for abiotic stresses, whereas EF-1α, GAPDH, and TUB were the top three choices for hormone stimuli treatments. Moreover, EF-1α and TUB were the most stable reference genes among all tested samples, and UBC was the least stable one. Expression analysis of PcDREB1 and PcDREB2 further verified that the selected stable reference genes were suitable for gene expression normalization. This study can guide the selection of suitable reference genes in gene expression in parsley. PMID:27746803
Li, Meng-Yao; Song, Xiong; Wang, Feng; Xiong, Ai-Sheng
2016-01-01
Parsley, one of the most important vegetables in the Apiaceae family, is widely used in the food, medicinal, and cosmetic industries. Recent studies on parsley mainly focus on its chemical composition, and further research involving the analysis of the plant's gene functions and expressions is required. qPCR is a powerful method for detecting very low quantities of target transcript levels and is widely used to study gene expression. To ensure the accuracy of results, a suitable reference gene is necessary for expression normalization. In this study, four software, namely geNorm, NormFinder, BestKeeper, and RefFinder were used to evaluate the expression stabilities of eight candidate reference genes of parsley ( GAPDH, ACTIN, eIF-4 α, SAND, UBC, TIP41, EF-1 α, and TUB ) under various conditions, including abiotic stresses (heat, cold, salt, and drought) and hormone stimuli treatments (GA, SA, MeJA, and ABA). Results showed that EF-1 α and TUB were the most stable genes for abiotic stresses, whereas EF-1 α, GAPDH , and TUB were the top three choices for hormone stimuli treatments. Moreover, EF-1 α and TUB were the most stable reference genes among all tested samples, and UBC was the least stable one. Expression analysis of PcDREB1 and PcDREB2 further verified that the selected stable reference genes were suitable for gene expression normalization. This study can guide the selection of suitable reference genes in gene expression in parsley.
Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R
2013-07-10
The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process. In the rat SNI model, we validated and ranked Actb, RPL29, RPL13a, HMBS, GAPDH, HPRT1 and 18S as good reference genes in the spinal cord. In the DRG, 18S did not fulfill stability criteria. The combination of any two stable reference genes was sufficient to provide an accurate normalization.
Paolinelli-Alfonso, Marcos; Galindo-Sánchez, Clara Elizabeth; Hernandez-Martinez, Rufina
2016-08-01
Lasiodiplodia theobromae is a highly virulent plant pathogen. It has been suggested that heat stress increases its virulence. The aim of this work was to evaluate, compare, and recommend normalization strategies for gene expression analysis of the fungus growing with grapevine wood under heat stress. Using RT-qPCR-derived data, reference gene stability was evaluated through geNorm, NormFinder and Bestkeeper applications. Based on the geometric mean using the ranking position obtained for each independent analysis, genes were ranked from least to most stable as follows: glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin (ACT), β-tubulin (TUB) and elongation factor-1α (EF1α). Using RNAseq-derived data based on the calculated tagwise dispersion these genes were ordered by increasing stability as follows: GAPDH, ACT, TUB, and EF1α. The correlation between RNAseq and RTqPCR results was used as criteria to identify the best RT-qPCR normalization approach. The gene TUB is recommended as the best option for normalization among the commonly used reference genes, but alternative fungal reference genes are also suggested. Copyright © 2016 Elsevier B.V. All rights reserved.
Nguewa, Paul A; Agorreta, Jackeline; Blanco, David; Lozano, Maria Dolores; Gomez-Roman, Javier; Sanchez, Blas A; Valles, Iñaki; Pajares, Maria J; Pio, Ruben; Rodriguez, Maria Jose; Montuenga, Luis M; Calvo, Alfonso
2008-01-01
Background The accurate normalization of differentially expressed genes in lung cancer is essential for the identification of novel therapeutic targets and biomarkers by real time RT-PCR and microarrays. Although classical "housekeeping" genes, such as GAPDH, HPRT1, and beta-actin have been widely used in the past, their accuracy as reference genes for lung tissues has not been proven. Results We have conducted a thorough analysis of a panel of 16 candidate reference genes for lung specimens and lung cell lines. Gene expression was measured by quantitative real time RT-PCR and expression stability was analyzed with the softwares GeNorm and NormFinder, mean of |ΔCt| (= |Ct Normal-Ct tumor|) ± SEM, and correlation coefficients among genes. Systematic comparison between candidates led us to the identification of a subset of suitable reference genes for clinical samples: IPO8, ACTB, POLR2A, 18S, and PPIA. Further analysis showed that IPO8 had a very low mean of |ΔCt| (0.70 ± 0.09), with no statistically significant differences between normal and malignant samples and with excellent expression stability. Conclusion Our data show that IPO8 is the most accurate reference gene for clinical lung specimens. In addition, we demonstrate that the commonly used genes GAPDH and HPRT1 are inappropriate to normalize data derived from lung biopsies, although they are suitable as reference genes for lung cell lines. We thus propose IPO8 as a novel reference gene for lung cancer samples. PMID:19014639
Gentile, Adriana-Mariel; Lhamyani, Said; Coín-Aragüez, Leticia; Oliva-Olivera, Wilfredo; Zayed, Hatem; Vega-Rioja, Antonio; Monteseirin, Javier; Romero-Zerbo, Silvana-Yanina; Tinahones, Francisco-José; Bermúdez-Silva, Francisco-Javier; El Bekay, Rajaa
2016-01-01
Real-time or quantitative PCR (qPCR) is a useful technique that requires reliable reference genes for data normalization in gene expression analysis. Adipogenesis is among the biological processes suitable for this technique. The selection of adequate reference genes is essential for qPCR gene expression analysis of human Vascular Stromal Cells (hVSCs) during their differentiation into adipocytes. To the best of our knowledge, there are no studies validating reference genes for the analyses of visceral and subcutaneous adipose tissue hVSCs from subjects with different Body Mass Index (BMI) and Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) index. The present study was undertaken to analyze this question. We first analyzed the stability of expression of five potential reference genes: CYC, GAPDH, RPL13A, EEF1A1, and 18S ribosomal RNA, during in vitro adipogenic differentiation, in samples from these types of patients. The expression of RPL13A and EEF1A1 was not affected by differentiation, thus being these genes the most stable candidates, while CYC, GAPDH, and 18S were not suitable for this sort of analysis. This work highlights that RPL13A and EEF1A1 are good candidates as reference genes for qPCR analysis of hVSCs differentiation into adipocytes from subjects with different BMI and HOMA-IR.
Gentile, Adriana-Mariel; Lhamyani, Said; Coín-Aragüez, Leticia; Oliva-Olivera, Wilfredo; Zayed, Hatem; Vega-Rioja, Antonio; Monteseirin, Javier; Romero-Zerbo, Silvana-Yanina; Tinahones, Francisco-José; Bermúdez-Silva, Francisco-Javier; El Bekay, Rajaa
2016-01-01
Real-time or quantitative PCR (qPCR) is a useful technique that requires reliable reference genes for data normalization in gene expression analysis. Adipogenesis is among the biological processes suitable for this technique. The selection of adequate reference genes is essential for qPCR gene expression analysis of human Vascular Stromal Cells (hVSCs) during their differentiation into adipocytes. To the best of our knowledge, there are no studies validating reference genes for the analyses of visceral and subcutaneous adipose tissue hVSCs from subjects with different Body Mass Index (BMI) and Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) index. The present study was undertaken to analyze this question. We first analyzed the stability of expression of five potential reference genes: CYC, GAPDH, RPL13A, EEF1A1, and 18S ribosomal RNA, during in vitro adipogenic differentiation, in samples from these types of patients. The expression of RPL13A and EEF1A1 was not affected by differentiation, thus being these genes the most stable candidates, while CYC, GAPDH, and 18S were not suitable for this sort of analysis. This work highlights that RPL13A and EEF1A1 are good candidates as reference genes for qPCR analysis of hVSCs differentiation into adipocytes from subjects with different BMI and HOMA-IR. PMID:27304673
Selection of Reference Genes for Expression Studies of Xenobiotic Adaptation in Tetranychus urticae.
Morales, Mariany Ashanty; Mendoza, Bianca Marie; Lavine, Laura Corley; Lavine, Mark Daniel; Walsh, Douglas Bruce; Zhu, Fang
2016-01-01
Quantitative real-time PCR (qRT-PCR) is an extensively used, high-throughput method to analyze transcriptional expression of genes of interest. An appropriate normalization strategy with reliable reference genes is required for calculating gene expression across diverse experimental conditions. In this study, we aim to identify the most stable reference genes for expression studies of xenobiotic adaptation in Tetranychus urticae, an extremely polyphagous herbivore causing significant yield reduction of agriculture. We chose eight commonly used housekeeping genes as candidates. The qRT-PCR expression data for these genes were evaluated from seven populations: a susceptible and three acaricide resistant populations feeding on lima beans, and three other susceptible populations which had been shifted host from lima beans to three other plant species. The stability of the candidate reference genes was then assessed using four different algorithms (comparative ΔCt method, geNorm, NormFinder, and BestKeeper). Additionally, we used an online web-based tool (RefFinder) to assign an overall final rank for each candidate gene. Our study found that CycA and Rp49 are best for investigating gene expression in acaricide susceptible and resistant populations. GAPDH, Rp49, and Rpl18 are best for host plant shift studies. And GAPDH and Rp49 were the most stable reference genes when investigating gene expression under changes in both experimental conditions. These results will facilitate research in revealing molecular mechanisms underlying the xenobiotic adaptation of this notorious agricultural pest.
Selection of Reference Genes for Expression Studies of Xenobiotic Adaptation in Tetranychus urticae
Morales, Mariany Ashanty; Mendoza, Bianca Marie; Lavine, Laura Corley; Lavine, Mark Daniel; Walsh, Douglas Bruce; Zhu, Fang
2016-01-01
Quantitative real-time PCR (qRT-PCR) is an extensively used, high-throughput method to analyze transcriptional expression of genes of interest. An appropriate normalization strategy with reliable reference genes is required for calculating gene expression across diverse experimental conditions. In this study, we aim to identify the most stable reference genes for expression studies of xenobiotic adaptation in Tetranychus urticae, an extremely polyphagous herbivore causing significant yield reduction of agriculture. We chose eight commonly used housekeeping genes as candidates. The qRT-PCR expression data for these genes were evaluated from seven populations: a susceptible and three acaricide resistant populations feeding on lima beans, and three other susceptible populations which had been shifted host from lima beans to three other plant species. The stability of the candidate reference genes was then assessed using four different algorithms (comparative ΔCt method, geNorm, NormFinder, and BestKeeper). Additionally, we used an online web-based tool (RefFinder) to assign an overall final rank for each candidate gene. Our study found that CycA and Rp49 are best for investigating gene expression in acaricide susceptible and resistant populations. GAPDH, Rp49, and Rpl18 are best for host plant shift studies. And GAPDH and Rp49 were the most stable reference genes when investigating gene expression under changes in both experimental conditions. These results will facilitate research in revealing molecular mechanisms underlying the xenobiotic adaptation of this notorious agricultural pest. PMID:27570487
Zheng, Yu-Tao; Li, Hong-Bo; Lu, Ming-Xing; Du, Yu-Zhou
2014-01-01
Quantitative real time PCR (qRT-PCR) has emerged as a reliable and reproducible technique for studying gene expression analysis. For accurate results, the normalization of data with reference genes is particularly essential. Once the transcriptome sequencing of Frankliniella occidentalis was completed, numerous unigenes were identified and annotated. Unfortunately, there are no studies on the stability of reference genes used in F. occidentalis. In this work, seven candidate reference genes, including actin, 18S rRNA, H3, tubulin, GAPDH, EF-1 and RPL32, were evaluated for their suitability as normalization genes under different experimental conditions using the statistical software programs BestKeeper, geNorm, Normfinder and the comparative ΔCt method. Because the rankings of the reference genes provided by each of the four programs were different, we chose a user-friendly web-based comprehensive tool RefFinder to get the final ranking. The result demonstrated that EF-1 and RPL32 displayed the most stable expression in different developmental stages; RPL32 and GAPDH showed the most stable expression at high temperatures, while 18S and EF-1 exhibited the most stable expression at low temperatures. In this study, we validated the suitable reference genes in F. occidentalis for gene expression profiling under different experimental conditions. The choice of internal standard is very important in the normalization of the target gene expression levels, thus validating and selecting the best genes will help improve the quality of gene expression data of F. occidentalis. What is more, these validated reference genes could serve as the basis for the selection of candidate reference genes in other insects. PMID:25356721
Zheng, Yu-Tao; Li, Hong-Bo; Lu, Ming-Xing; Du, Yu-Zhou
2014-01-01
Quantitative real time PCR (qRT-PCR) has emerged as a reliable and reproducible technique for studying gene expression analysis. For accurate results, the normalization of data with reference genes is particularly essential. Once the transcriptome sequencing of Frankliniella occidentalis was completed, numerous unigenes were identified and annotated. Unfortunately, there are no studies on the stability of reference genes used in F. occidentalis. In this work, seven candidate reference genes, including actin, 18S rRNA, H3, tubulin, GAPDH, EF-1 and RPL32, were evaluated for their suitability as normalization genes under different experimental conditions using the statistical software programs BestKeeper, geNorm, Normfinder and the comparative ΔCt method. Because the rankings of the reference genes provided by each of the four programs were different, we chose a user-friendly web-based comprehensive tool RefFinder to get the final ranking. The result demonstrated that EF-1 and RPL32 displayed the most stable expression in different developmental stages; RPL32 and GAPDH showed the most stable expression at high temperatures, while 18S and EF-1 exhibited the most stable expression at low temperatures. In this study, we validated the suitable reference genes in F. occidentalis for gene expression profiling under different experimental conditions. The choice of internal standard is very important in the normalization of the target gene expression levels, thus validating and selecting the best genes will help improve the quality of gene expression data of F. occidentalis. What is more, these validated reference genes could serve as the basis for the selection of candidate reference genes in other insects.
Dang, Wei; Sun, Li
2011-02-01
In recent years, quantitative real time reverse transcriptase-PCR (qRT-PCR) has been used frequently in the study of gene expression in turbot (Scophthalmus maximus) in relation to bacterial infection. However, no investigations on appropriate qRT-PCR reference genes have been documented. In this report, we determined the potential of eight housekeeping genes, i.e. β-actin (ACTB), ribosomal protein L17 (RPL17), α-tubulin (TUBA), elongation factor-1-α(EF1A), β-2-Microglobulin (B2M), RNA polymerase II subunit D (RPSD), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and 18S ribosomal RNA (18S rRNA), as internal standards for qRT-PCR analysis of gene expression in turbot as a function of bacterial infection. For this purpose, the expression of the eight housekeeping genes in seven turbot tissues was determined by qRT-PCR before and after bacterial challenge, and the data were analyzed with the geNorm and NormFinder algorisms. The results showed that the expression of all the examined genes exhibited tissue-dependent variations both before and after bacterial challenge. Before bacterial challenge, geNorm and NormFinder identified RPSD as the gene that showed least tissue specific expression. At 12 h post-bacterial infection, geNorm ranked ACTB/GAPDH, 18S rRNA/ACTB, ACTB/GAPDH, 18S rRNA/ACTB, RPL17/TUBA, RPSD/GAPDH, and RPSD/B2M, respectively, as the most stably expressed genes in liver, spleen, kidney, gill, heart, muscle, and brain. Comparable ranking orders were produced by NormFinder. Similar results were obtained at 24 h post-bacterial infection. Taken together, these results indicate that RPSD is the most stable gene across tissue types under normal physiological conditions and that, during bacterial infection, ACTB might be used as an internal standard for the normalization of gene expression in immune relevant organs; however, no single gene or single pair of genes in the examined set of housekeeping genes can serve as a universal reference across all tissue types under the condition of bacterial infection. Copyright © 2011 Elsevier Ltd. All rights reserved.
Wang, Ming-Le; Li, Qing-Hui; Xin, Hua-Hong; Chen, Xuan; Zhu, Xu-Jun; Li, Xing-Hui
2017-01-01
Tea plants [Camellia sinensis (L.) O. Kuntze] are an important leaf-type crop that are widely used for the production of non-alcoholic beverages in the world. Exposure to excessive amounts of heavy metals adversely affects the quality and yield of tea leaves. To analyze the molecular responses of tea plants to heavy metals, a reliable quantification of gene expression is important and of major importance herein is the normalization of the measured expression levels for the target genes. Ideally, stably expressed reference genes should be evaluated in all experimental systems. In this study, 12 candidate reference genes (i.e., 18S rRNA, Actin, CYP, EF-1α, eIF-4α, GAPDH, MON1, PP2AA3, TBP, TIP41, TUA, and UBC) were cloned from tea plants, and the stability of their expression was examined systematically in 60 samples exposed to diverse heavy metals (i.e., manganese, aluminum, copper, iron, and zinc). Three Excel-based algorithms (geNorm, NormFinder, and BestKeeper) were used to evaluate the expression stability of these genes. PP2AA3 and 18S rRNA were the most stably expressed genes, even though their expression profiles exhibited some variability. Moreover, commonly used reference genes (i.e., GAPDH and TBP) were the least appropriate reference genes for most samples. To further validate the suitability of the analyzed reference genes, the expression level of a phytochelatin synthase gene (i.e., CsPCS1) was determined using the putative reference genes for data normalizations. Our results may be beneficial for future studies involving the quantification of relative gene expression levels in tea plants.
Wang, Ming-Le; Li, Qing-Hui; Xin, Hua-Hong; Chen, Xuan; Zhu, Xu-Jun
2017-01-01
Tea plants [Camellia sinensis (L.) O. Kuntze] are an important leaf-type crop that are widely used for the production of non-alcoholic beverages in the world. Exposure to excessive amounts of heavy metals adversely affects the quality and yield of tea leaves. To analyze the molecular responses of tea plants to heavy metals, a reliable quantification of gene expression is important and of major importance herein is the normalization of the measured expression levels for the target genes. Ideally, stably expressed reference genes should be evaluated in all experimental systems. In this study, 12 candidate reference genes (i.e., 18S rRNA, Actin, CYP, EF-1α, eIF-4α, GAPDH, MON1, PP2AA3, TBP, TIP41, TUA, and UBC) were cloned from tea plants, and the stability of their expression was examined systematically in 60 samples exposed to diverse heavy metals (i.e., manganese, aluminum, copper, iron, and zinc). Three Excel-based algorithms (geNorm, NormFinder, and BestKeeper) were used to evaluate the expression stability of these genes. PP2AA3 and 18S rRNA were the most stably expressed genes, even though their expression profiles exhibited some variability. Moreover, commonly used reference genes (i.e., GAPDH and TBP) were the least appropriate reference genes for most samples. To further validate the suitability of the analyzed reference genes, the expression level of a phytochelatin synthase gene (i.e., CsPCS1) was determined using the putative reference genes for data normalizations. Our results may be beneficial for future studies involving the quantification of relative gene expression levels in tea plants. PMID:28453515
Wang, Dunrui; Moothart, Daniel R.; Lowy, Douglas R.; Qian, Xiaolan
2013-01-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is often used as a stable housekeeping marker for constant gene expression. However, the transcriptional levels of GAPDH may be highly up-regulated in some cancers, including non-small cell lung cancers (NSCLC). Using a publically available microarray database, we identified a group of genes whose expression levels in some cancers are highly correlated with GAPDH up-regulation. The majority of the identified genes are cell cycle-dependent (GAPDH Associated Cell Cycle, or GACC). The up-regulation pattern of GAPDH positively associated genes in NSCLC is similar to that observed in cultured fibroblasts grown under conditions that induce anti-senescence. Data analysis demonstrated that up-regulated GAPDH levels are correlated with aberrant gene expression related to both glycolysis and gluconeogenesis pathways. Down-regulation of fructose-1,6-bisphosphatase (FBP1) in gluconeogenesis in conjunction with up-regulation of most glycolytic genes is closely related to high expression of GAPDH in the tumors. The data presented demonstrate that up-regulation of GAPDH positively associated genes is proportional to the malignant stage of various tumors and is associated with an unfavourable prognosis. Thus, this work suggests that GACC genes represent a potential new signature for cancer stage identification and disease prognosis. PMID:23620736
Ruduś, Izabela; Kępczyński, Jan
2018-01-01
Molecular studies of primary and secondary dormancy in Avena fatua L., a serious weed of cereal and other crops, are intended to reveal the species-specific details of underlying molecular mechanisms which in turn may be useable in weed management. Among others, quantitative real-time PCR (RT-qPCR) data of comparative gene expression analysis may give some insight into the involvement of particular wild oat genes in dormancy release, maintenance or induction by unfavorable conditions. To assure obtaining biologically significant results using this method, the expression stability of selected candidate reference genes in different data subsets was evaluated using four statistical algorithms i.e. geNorm, NormFinder, Best Keeper and ΔCt method. Although some discrepancies in their ranking outputs were noticed, evidently two ubiquitin-conjugating enzyme homologs, AfUBC1 and AfUBC2, as well as one homolog of glyceraldehyde 3-phosphate dehydrogenase AfGAPDH1 and TATA-binding protein AfTBP2 appeared as more stably expressed than AfEF1a (translation elongation factor 1α), AfGAPDH2 or the least stable α-tubulin homolog AfTUA1 in caryopses and seedlings of A. fatua. Gene expression analysis of a dormancy-related wild oat transcription factor VIVIPAROUS1 (AfVP1) allowed for a validation of candidate reference genes performance. Based on the obtained results it can be recommended that the normalization factor calculated as a geometric mean of Cq values of AfUBC1, AfUBC2 and AfGAPDH1 would be optimal for RT-qPCR results normalization in the experiments comprising A. fatua caryopses of different dormancy status.
Auler, Priscila Ariane; Benitez, Letícia Carvalho; do Amaral, Marcelo Nogueira; Vighi, Isabel Lopes; Dos Santos Rodrigues, Gabriela; da Maia, Luciano Carlos; Braga, Eugenia Jacira Bolacel
2017-05-01
Many studies use strategies that allow for the identification of a large number of genes expressed in response to different stress conditions to which the plant is subjected throughout its cycle. In order to obtain accurate and reliable results in gene expression studies, it is necessary to use reference genes, which must have uniform expression in the majority of cells in the organism studied. RNA isolation of leaves and expression analysis in real-time quantitative polymerase chain reaction (RT-qPCR) were carried out. In this study, nine candidate reference genes were tested, actin 11 (ACT11), ubiquitin conjugated to E2 enzyme (UBC-E2), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), beta tubulin (β-tubulin), eukaryotic initiation factor 4α (eIF-4α), ubiquitin 10 (UBQ10), ubiquitin 5 (UBQ5), aquaporin TIP41 (TIP41-Like) and cyclophilin, in two genotypes of rice, AN Cambará and BRS Querência, with different levels of soil moisture (20%, 10% and recovery) in the vegetative (V5) and reproductive stages (period preceding flowering). Currently, there are different softwares that perform stability analyses and define the most suitable reference genes for a particular study. In this study, we used five different methods: geNorm, BestKeeper, ΔCt method, NormFinder and RefFinder. The results indicate that UBC-E2 and UBQ5 can be used as reference genes in all samples and softwares evaluated. The genes β-tubulin and eIF-4α, traditionally used as reference genes, along with GAPDH, presented lower stability values. The gene expression of basic leucine zipper (bZIP23 and bZIP72) was used to validate the selected reference genes, demonstrating that the use of an inappropriate reference can induce erroneous results.
Reference gene stability of a synanthropic fly, Chrysomya megacephala.
Wang, Xiaoyun; Xiong, Mei; Wang, Jialu; Lei, Chaoliang; Zhu, Fen
2015-10-29
Stable reference genes are essential for accurate normalization in gene expression studies with reverse transcription quantitative polymerase chain reaction (qPCR). A synanthropic fly, Chrysomya megacephala, is a well known medical vector and forensic indicator. Unfortunately, previous studies did not look at the stability of reference genes used in C. megacephala. In this study, the expression level of Actin, ribosomal protein L8 (Rpl8), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), elongation factor 1α (EF1), α-tubulin (α-TUB), β-tubulin (β-TUB), TATA binding box (TBP), 18S rRNA (18S) and ribosomal protein S7 (Rps7) were evaluated for their stability using online software RefFinder, which combines the normal software of the ΔCt method, BestKeeper, Normfinder, and geNorm. Moreover the number of suitable reference gene pairs was also suggested by Excel-based geNorm. The expression levels of these reference genes were evaluated under different experimental conditions with special perspectives of forensic applications: developmental stages (eggs, first, second and third instar larvae, pupae and adults); food sources of larvae (pork, fish and chicken); feeding larvae with drugs (untreated control, Estazolam and Marvelon); feeding larvae with heavy metals (untreated control, cadmium and zinc); tissues of adults (head, thorax, abdomen, legs and wings). According to RefFinder, EF1 was the most suitable reference gene of developmental stages, food and tissues; 18S and GAPDH were the most suitable reference genes for drugs and heavy metals, respectively, which could be widely used for quantification of target gene expression with qPCR in C. megacephala. Suitable reference gene pairs were also suggested by geNorm. This fundamental but vital work should facilitate the gene studies of related biological processes and deepen the understanding in physiology, toxicology, and especially medical and forensic entomology of C. megacephala.
Liang, Chaoqiong; Hao, Jianjun; Meng, Yan; Luo, Laixin; Li, Jianqiang
2018-01-01
Cucumber green mottle mosaic virus (CGMMV) is an economically important pathogen and causes significant reduction of both yield and quality of cucumber (Cucumis sativus). Currently, there were no satisfied strategies for controlling the disease. A better understanding of microRNA (miRNA) expression related to the regulation of plant-virus interactions and virus resistance would be of great assistance when developing control strategies for CGMMV. However, accurate expression analysis is highly dependent on robust and reliable reference gene used as an internal control for normalization of miRNA expression. Most commonly used reference genes involved in CGMMV-infected cucumber are not universally expressed depending on tissue types and stages of plant development. It is therefore crucial to identify suitable reference genes in investigating the role of miRNA expression. In this study, seven reference genes, including Actin, Tubulin, EF-1α, 18S rRNA, Ubiquitin, GAPDH and Cyclophilin, were evaluated for the most accurate results in analyses using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Gene expression was assayed on cucumber leaves, stems and roots that were collected at different days post inoculation with CGMMV. The expression data were analyzed using algorithms including delta-Ct, geNorm, NormFinder, and BestKeeper as well as the comparative tool RefFinder. The reference genes were subsequently validated using miR159. The results showed that EF-1α and GAPDH were the most reliable reference genes for normalizing miRNA expression in leaf, root and stem samples, while Ubiquitin and EF-1α were the most suitable combination overall. PMID:29543906
Yang, Zhimin; Chen, Yu; Hu, Baoyun; Tan, Zhiqun; Huang, Bingru
2015-01-01
Tall fescue (Festuca arundinacea Schreb.) is widely utilized as a major forage and turfgrass species in the temperate regions of the world and is a valuable plant material for studying molecular mechanisms of grass stress tolerance due to its superior drought and heat tolerance among cool-season species. Selection of suitable reference genes for quantification of target gene expression is important for the discovery of molecular mechanisms underlying improved growth traits and stress tolerance. The stability of nine potential reference genes (ACT, TUB, EF1a, GAPDH, SAND, CACS, F-box, PEPKR1 and TIP41) was evaluated using four programs, GeNorm, NormFinder, BestKeeper, and RefFinder. The combinations of SAND and TUB or TIP41 and TUB were most stably expressed in salt-treated roots or leaves. The combinations of GAPDH with TIP41 or TUB were stable in roots and leaves under drought stress. TIP41 and PEPKR1 exhibited stable expression in cold-treated roots, and the combination of F-box, TIP41 and TUB was also stable in cold-treated leaves. CACS and TUB were the two most stable reference genes in heat-stressed roots. TIP41 combined with TUB and ACT was stably expressed in heat-stressed leaves. Finally, quantitative real-time polymerase chain reaction (qRT-PCR) assays of the target gene FaWRKY1 using the identified most stable reference genes confirmed the reliability of selected reference genes. The selection of suitable reference genes in tall fescue will allow for more accurate identification of stress-tolerance genes and molecular mechanisms conferring stress tolerance in this stress-tolerant species.
Liu, Mingying; Jiang, Jing; Han, Xiaojiao; Qiao, Guirong; Zhuo, Renying
2014-01-01
Dendrocalamus latiflorus Munro distributes widely in subtropical areas and plays vital roles as valuable natural resources. The transcriptome sequencing for D. latiflorus Munro has been performed and numerous genes especially those predicted to be unique to D. latiflorus Munro were revealed. qRT-PCR has become a feasible approach to uncover gene expression profiling, and the accuracy and reliability of the results obtained depends upon the proper selection of stable reference genes for accurate normalization. Therefore, a set of suitable internal controls should be validated for D. latiflorus Munro. In this report, twelve candidate reference genes were selected and the assessment of gene expression stability was performed in ten tissue samples and four leaf samples from seedlings and anther-regenerated plants of different ploidy. The PCR amplification efficiency was estimated, and the candidate genes were ranked according to their expression stability using three software packages: geNorm, NormFinder and Bestkeeper. GAPDH and EF1α were characterized to be the most stable genes among different tissues or in all the sample pools, while CYP showed low expression stability. RPL3 had the optimal performance among four leaf samples. The application of verified reference genes was illustrated by analyzing ferritin and laccase expression profiles among different experimental sets. The analysis revealed the biological variation in ferritin and laccase transcript expression among the tissues studied and the individual plants. geNorm, NormFinder, and BestKeeper analyses recommended different suitable reference gene(s) for normalization according to the experimental sets. GAPDH and EF1α had the highest expression stability across different tissues and RPL3 for the other sample set. This study emphasizes the importance of validating superior reference genes for qRT-PCR analysis to accurately normalize gene expression of D. latiflorus Munro.
NASA Astrophysics Data System (ADS)
Pu, Fei; Yang, Bingye; Ke, Caihuan
2015-07-01
Accurate quantification of transcripts using quantitative real-time polymerase chain reaction (qPCR) depends on the identification of reliable reference genes for normalization. This study aimed to identify and validate seven reference genes, including actin-2 ( ACT-2), elongation factor 1 alpha ( EF-1α), elongation factor 1 beta ( EF-1β), glyceraldehyde-3-phosphate dehydrogenase ( GAPDH), ubiquitin ( UBQ), β-tubulin ( β-TUB), and 18S ribosomal RNA, from Crassostrea angulata, a valuable marine bivalve cultured worldwide. Transcript levels of the candidate reference genes were examined using qPCR analysis and showed differential expression patterns in the mantle, gill, adductor muscle, labial palp, visceral mass, hemolymph and gonad tissues. Quantitative data were analyzed using the geNorm software to assess the expression stability of the candidate reference genes, revealing that β-TUB and UBQ were the most stable genes. The commonly used GAPDH and 18S rRNA showed low stability, making them unsuitable candidates in this system. The expression pattern of the G protein β-subunit gene ( Gβ) across tissue types was also examined and normalized to the expression of each or both of UBQ and β-TUB as internal controls. This revealed consistent trends with all three normalization approaches, thus validating the reliability of UBQ and β-TUB as optimal internal controls. The study provides the first validated reference genes for accurate data normalization in transcript profiling in Crassostrea angulata, which will be indispensable for further functional genomics studies in this economically valuable marine bivalve.
Espínola, Sergio Martin; Ferreira, Henrique Bunselmeyer; Zaha, Arnaldo
2014-01-01
In recent years, a significant amount of sequence data (both genomic and transcriptomic) for Echinococcus spp. has been published, thereby facilitating the analysis of genes expressed during a specific stage or involved in parasite development. To perform a suitable gene expression quantification analysis, the use of validated reference genes is strongly recommended. Thus, the aim of this work was to identify suitable reference genes to allow reliable expression normalization for genes of interest in Echinococcus granulosus sensu stricto (s.s.) (G1) and Echinococcus ortleppi upon induction of the early pre-adult development. Untreated protoscoleces (PS) and pepsin-treated protoscoleces (PSP) from E. granulosus s.s. (G1) and E. ortleppi metacestode were used. The gene expression stability of eleven candidate reference genes (βTUB, NDUFV2, RPL13, TBP, CYP-1, RPII, EF-1α, βACT-1, GAPDH, ETIF4A-III and MAPK3) was assessed using geNorm, Normfinder, and RefFinder. Our qPCR data showed a good correlation with the recently published RNA-seq data. Regarding expression stability, EF-1α and TBP were the most stable genes for both species. Interestingly, βACT-1 (the most commonly used reference gene), and GAPDH and ETIF4A-III (previously identified as housekeeping genes) did not behave stably in our assay conditions. We propose the use of EF-1α as a reference gene for studies involving gene expression analysis in both PS and PSP experimental conditions for E. granulosus s.s. and E. ortleppi. To demonstrate its applicability, EF-1α was used as a normalizer gene in the relative quantification of transcripts from genes coding for antigen B subunits. The same EF-1α reference gene may be used in studies with other Echinococcus sensu lato species. This report validates suitable reference genes for species of class Cestoda, phylum Platyhelminthes, thus providing a foundation for further validation in other epidemiologically important cestode species, such as those from the Taenia genus. PMID:25014071
Espínola, Sergio Martin; Ferreira, Henrique Bunselmeyer; Zaha, Arnaldo
2014-01-01
In recent years, a significant amount of sequence data (both genomic and transcriptomic) for Echinococcus spp. has been published, thereby facilitating the analysis of genes expressed during a specific stage or involved in parasite development. To perform a suitable gene expression quantification analysis, the use of validated reference genes is strongly recommended. Thus, the aim of this work was to identify suitable reference genes to allow reliable expression normalization for genes of interest in Echinococcus granulosus sensu stricto (s.s.) (G1) and Echinococcus ortleppi upon induction of the early pre-adult development. Untreated protoscoleces (PS) and pepsin-treated protoscoleces (PSP) from E. granulosus s.s. (G1) and E. ortleppi metacestode were used. The gene expression stability of eleven candidate reference genes (βTUB, NDUFV2, RPL13, TBP, CYP-1, RPII, EF-1α, βACT-1, GAPDH, ETIF4A-III and MAPK3) was assessed using geNorm, Normfinder, and RefFinder. Our qPCR data showed a good correlation with the recently published RNA-seq data. Regarding expression stability, EF-1α and TBP were the most stable genes for both species. Interestingly, βACT-1 (the most commonly used reference gene), and GAPDH and ETIF4A-III (previously identified as housekeeping genes) did not behave stably in our assay conditions. We propose the use of EF-1α as a reference gene for studies involving gene expression analysis in both PS and PSP experimental conditions for E. granulosus s.s. and E. ortleppi. To demonstrate its applicability, EF-1α was used as a normalizer gene in the relative quantification of transcripts from genes coding for antigen B subunits. The same EF-1α reference gene may be used in studies with other Echinococcus sensu lato species. This report validates suitable reference genes for species of class Cestoda, phylum Platyhelminthes, thus providing a foundation for further validation in other epidemiologically important cestode species, such as those from the Taenia genus.
Functional divergences of GAPDH isoforms during early development in two perciform fish species.
Sarropoulou, Elena; Nousdili, Dimitra; Kotoulas, Georgios; Magoulas, Antonios
2011-12-01
Glyceraldehyde-3-phospate dehydrogenase (GAPDH) is involved in basic cell catabolic processes and, as it is thought to be continuously expressed, belongs to the group of housekeeping genes. Thus, it is frequently used as an internal control in quantitative gene expression studies. However, the evidence of different expression patterns in a broad range of organisms and tissues, as well as the occurrence of different isoforms, shows that GAPDH has to be reevaluated as an internal control in qPCR studies, and its annotation has to be enriched. GAPDH has been shown to be involved in the pathway of energy and carbon molecule supply as well as in transcription and apoptosis. In the present study, we isolated the two isoforms, GAPDH-1 and GAPDH-2, of the gilthead sea bream (Sparus aurata) and the European sea bass (Dicentrarchus labrax). We inferred the phylogenetic relationships to ten other fish species and gave the gene structure of both genes. We further investigated gene expression analysis in both species for different developmental stages showing divergent gene expression of the two isoforms and the possible function of GAPDH-1 as a maternal gene.
Park, Sang-Je; Kim, Young-Hyun; Lee, Youngjeon; Kim, Kyoung-Min; Kim, Heui-Soo; Lee, Sang-Rae; Kim, Sun-Uk; Kim, Sang-Hyun; Kim, Ji-Su; Jeong, Kang-Jin; Lee, Kyoung-Min; Huh, Jae-Won; Chang, Kyu-Tae
2013-01-01
Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) has been widely used to quantify relative gene expression because of the specificity, sensitivity, and accuracy of this technique. In order to obtain reliable gene expression data from RT-qPCR experiments, it is important to utilize optimal reference genes for the normalization of target gene expression under varied experimental conditions. Previously, we developed and validated a novel icv-STZ cynomolgus monkey model for Alzheimer's disease (AD) research. However, in order to enhance the reliability of this disease model, appropriate reference genes must be selected to allow meaningful analysis of the gene expression levels in the icv-STZ cynomolgus monkey brain. In this study, we assessed the expression stability of 9 candidate reference genes in 2 matched-pair brain samples (5 regions) of control cynomolgus monkeys and those who had received intracerebroventricular injection of streptozotocin (icv-STZ). Three well-known analytical programs geNorm, NormFinder, and BestKeeper were used to choose the suitable reference genes from the total sample group, control group, and icv-STZ group. Combination analysis of the 3 different programs clearly indicated that the ideal reference genes are RPS19 and YWHAZ in the total sample group, GAPDH and RPS19 in the control group, and ACTB and GAPDH in the icv-STZ group. Additionally, we validated the normalization accuracy of the most appropriate reference genes (RPS19 and YWHAZ) by comparison with the least stable gene (TBP) using quantification of the APP and MAPT genes in the total sample group. To the best of our knowledge, this research is the first study to identify and validate the appropriate reference genes in cynomolgus monkey brains. These findings provide useful information for future studies involving the expression of target genes in the cynomolgus monkey.
Li, H; Chen, C; Yao, H; Li, X; Yang, N; Qiao, J; Xu, K; Zeng, L
2016-10-01
Bone marrow micro-environment changes during hematopoietic stem cell transplantation (HSCT) with subsequent alteration of genes expression. Quantitative polymerase chain reaction (q-PCR) is a reliable and reproducible technique for the analysis of gene expression. To obtain more accurate results, it is essential to find a reference during HSCT. However, which gene is suitable during HSCT remains unclear. This study aimed to identify suitable reference genes for mRNA studies in bone marrow after HSCT. C57BL/6 mice were treated with either total body irradiation (group T) or busulfan/cyclophosphamide (BU/CY) (group B) followed by infusion of bone marrow cells. Normal mice without treatments were served as a control. All samples (group T + group B + control) were defined as group G. On days 7, 14, and 21 after transplantation, transcription levels of 7 candidate genes, ACTB, B2M, GAPDH, HMBS, HPRT, SDHA, and YWHAZ, in bone marrow cells were measured by use of real-time quantitative PCR. The expression stability of these 7 candidate reference genes were analyzed by 2 statistical software programs, GeNorm and NormFinder. Our results showed that ACTB displayed the highest expression in group G, with lowest expression of PSDHA in group T and HPRT in groups B and G. Analysis of expression stability by use of GeNorm or NormFinder demonstrated that expression of B2M in bone marrow were much more stable during HSCT, compared with other candidate genes including commonly used reference genes GAPDH and ACTB. ACTB could be used as a suitable reference gene for mRNA studies in bone marrow after HSCT. Copyright © 2016 Elsevier Inc. All rights reserved.
Borowska, D; Rothwell, L; Bailey, R A; Watson, K; Kaiser, P
2016-02-01
Quantitative polymerase chain reaction (qPCR) is a powerful technique for quantification of gene expression, especially genes involved in immune responses. Although qPCR is a very efficient and sensitive tool, variations in the enzymatic efficiency, quality of RNA and the presence of inhibitors can lead to errors. Therefore, qPCR needs to be normalised to obtain reliable results and allow comparison. The most common approach is to use reference genes as internal controls in qPCR analyses. In this study, expression of seven genes, including β-actin (ACTB), β-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-glucuronidase (GUSB), TATA box binding protein (TBP), α-tubulin (TUBAT) and 28S ribosomal RNA (r28S), was determined in cells isolated from chicken lymphoid tissues and stimulated with three different mitogens. The stability of the genes was measured using geNorm, NormFinder and BestKeeper software. The results from both geNorm and NormFinder were that the three most stably expressed genes in this panel were TBP, GAPDH and r28S. BestKeeper did not generate clear answers because of the highly heterogeneous sample set. Based on these data we will include TBP in future qPCR normalisation. The study shows the importance of appropriate reference gene normalisation in other tissues before qPCR analysis. Copyright © 2016 Elsevier B.V. All rights reserved.
Cabiati, Manuela; Raucci, Serena; Caselli, Chiara; Guzzardi, Maria Angela; D'Amico, Andrea; Prescimone, Tommaso; Giannessi, Daniela; Del Ry, Silvia
2012-06-01
Obesity is a complex pathology with interacting and confounding causes due to the environment, hormonal signaling patterns, and genetic predisposition. At present, the Zucker rat is an eligible genetic model for research on obesity and metabolic syndrome, allowing scrutiny of gene expression profiles. Real-time PCR is the benchmark method for measuring mRNA expressions, but the accuracy and reproducibility of its data greatly depend on appropriate normalization strategies. In the Zucker rat model, no specific reference genes have been identified in myocardium, kidney, and lung, the main organs involved in this syndrome. The aim of this study was to select among ten candidates (Actb, Gapdh, Polr2a, Ywhag, Rpl13a, Sdha, Ppia, Tbp, Hprt1 and Tfrc) a set of reference genes that can be used for the normalization of mRNA expression data obtained by real-time PCR in obese and lean Zucker rats both at fasting and during acute hyperglycemia. The most stable genes in the heart were Sdha, Tbp, and Hprt1; in kidney, Tbp, Actb, and Gapdh were chosen, while Actb, Ywhag, and Sdha were selected as the most stably expressed set for pulmonary tissue. The normalization strategy was used to analyze mRNA expression of tumor necrosis factor α, the main inflammatory mediator in obesity, whose variations were more significant when normalized with the appropriately selected reference genes. The findings obtained in this study underline the importance of having three stably expressed reference gene sets for use in the cardiac, renal, and pulmonary tissues of an experimental model of obese and hyperglycemic Zucker rats.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2015-01-01
The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.
Liu, Shuang; Zhu, Pengfei; Zhang, Ling; Ding, Shanlong; Zheng, Sujun; Wang, Yang; Lu, Fengmin
2013-01-01
Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) has been widely used to quantify relative gene expression because of the high specificity, sensitivity and accuracy of this technique. However, its reliability is strongly depends on the expression stability of reference gene used for data normalization. Therefore, identification of reliable and condition specific reference genes is critical for the success of RT-qPCR. Hepatitis B virus (HBV) infection, male gender and the presence of cirrhosis are widely recognized as the leading independent risk factors for the development of hepatocellular carcinoma (HCC). This study aimed to select reliable reference gene for RT-qPCR analysis in HCC patients with all of those risk factors. Six candidate reference genes were analyzed in 33 paired tumor and non-tumor tissues from untreated HCC patients. The genes expression stabilities were assessed by geNorm and NormFinder. C-terminal binding protein 1(CTBP1) was the most stable gene among the 6 candidate genes evaluated by both geNorm and NormFinder. The expression stability values were 0.08 for CTBP1 and UBC, 0.09 for HPRT1, 0.12 for HMBS, 0.14 for GAPDH and 0.18 for 18S with geNorm analysis. The stability values suggested by NormFinder software were CTBP1: 0.044, UBC: 0.063, HMBS: 0.072, HPRT1: 0.072, GAPDH: 0.098 and 18S rRNA: 0.161. This is the first systematic analysis which suggested CTBP1 as the highest expression-stable gene in human male HBV infection related-HCC with cirrhosis. We recommend CTBP1 as the best candidate reference gene when RT-qPCR was used to determine gene(s) expression in HCC. This may facilitate the relevant HBV related HCC studies in the future.
Elberg, Gerard; Elberg, Dorit; Logan, Charlotte J; Chen, Lijuan; Turman, Martin A
2006-01-01
Progressive renal fibrotic disease is accompanied by the massive accumulation of myofibroblasts as defined by alpha smooth muscle actin (alphaSMA) expression. We quantitated gene expression using real-time RT-PCR analysis during conversion of primary cultured human renal tubular cells (RTC) to myofibroblasts after treatment with transforming growth factor-beta1 (TGF-beta1). We report herein the limitations of commonly used reference genes for mRNA quantitation. We determined the expression of alphaSMA and megakaryoblastic leukemia-1 (MKL1), a transcriptional regulator of alphaSMA, by quantitative real-time PCR using three common internal controls, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), cyclophilin A and 18S rRNA. Expression of GAPDH mRNA and cyclophilin A mRNA, and to a lesser extent, 18S rRNA levels varied over time in culture and with exposure to TGF-beta1. Thus, depending on which reference gene was used, TGF-beta1 appeared to have different effects on expression of MKL1 and alphaSMA. RTC converting to myofibroblasts in primary culture is a valuable system to study renal fibrosis in humans. However, variability in expression of reference genes with TGF-beta1 treatment illustrates the need to validate mRNA quantitation with multiple reference genes to provide accurate interpretation of fibrosis studies in the absence of a universal internal standard for mRNA expression. 2006 S. Karger AG, Basel.
Critical protein GAPDH and its regulatory mechanisms in cancer cells
Zhang, Jin-Ying; Zhang, Fan; Hong, Chao-Qun; Giuliano, Armando E.; Cui, Xiao-Jiang; Zhou, Guang-Ji; Zhang, Guo-Jun; Cui, Yu-Kun
2015-01-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), initially identified as a glycolytic enzyme and considered as a housekeeping gene, is widely used as an internal control in experiments on proteins, mRNA, and DNA. However, emerging evidence indicates that GAPDH is implicated in diverse functions independent of its role in energy metabolism; the expression status of GAPDH is also deregulated in various cancer cells. One of the most common effects of GAPDH is its inconsistent role in the determination of cancer cell fate. Furthermore, studies have described GAPDH as a regulator of cell death; other studies have suggested that GAPDH participates in tumor progression and serves as a new therapeutic target. However, related regulatory mechanisms of its numerous cellular functions and deregulated expression levels remain unclear. GAPDH is tightly regulated at transcriptional and posttranscriptional levels, which are involved in the regulation of diverse GAPDH functions. Several cancer-related factors, such as insulin, hypoxia inducible factor-1 (HIF-1), p53, nitric oxide (NO), and acetylated histone, not only modulate GAPDH gene expression but also affect protein functions via common pathways. Moreover, posttranslational modifications (PTMs) occurring in GAPDH in cancer cells result in new activities unrelated to the original glycolytic function of GAPDH. In this review, recent findings related to GAPDH transcriptional regulation and PTMs are summarized. Mechanisms and pathways involved in GAPDH regulation and its different roles in cancer cells are also described. PMID:25859407
Oliveira, Sara R; Vieira, Helena L A; Duarte, Carlos B
2015-09-15
Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a widely used technique to characterize changes in gene expression in complex cellular and tissue processes, such as cytoprotection or inflammation. The accurate assessment of changes in gene expression depends on the selection of adequate internal reference gene(s). Carbon monoxide (CO) affects several metabolic pathways and de novo protein synthesis is crucial in the cellular responses to this gasotransmitter. Herein a selection of commonly used reference genes was analyzed to identify the most suitable internal control genes to evaluate the effect of CO on gene expression in cultured cerebrocortical astrocytes. The cells were exposed to CO by treatment with CORM-A1 (CO releasing molecule A1) and four different algorithms (geNorm, NormFinder, Delta Ct and BestKeeper) were applied to evaluate the stability of eight putative reference genes. Our results indicate that Gapdh (glyceraldehyde-3-phosphate dehydrogenase) together with Ppia (peptidylpropyl isomerase A) is the most suitable gene pair for normalization of qRT-PCR results under the experimental conditions used. Pgk1 (phosphoglycerate kinase 1), Hprt1 (hypoxanthine guanine phosphoribosyl transferase I), Sdha (Succinate Dehydrogenase Complex, Subunit A), Tbp (TATA box binding protein), Actg1 (actin gamma 1) and Rn18s (18S rRNA) genes presented less stable expression profiles in cultured cortical astrocytes exposed to CORM-A1 for up to 60 min. For validation, we analyzed the effect of CO on the expression of Bdnf and bcl-2. Different results were obtained, depending on the reference genes used. A significant increase in the expression of both genes was found when the results were normalized with Gapdh and Ppia, in contrast with the results obtained when the other genes were used as reference. These findings highlight the need for a proper and accurate selection of the reference genes used in the quantification of qRT-PCR results in studies on the effect of CO in gene expression. Copyright © 2015 Elsevier Inc. All rights reserved.
Rocha-Martins, Maurício; Njaine, Brian; Silveira, Mariana S
2012-01-01
Housekeeping genes have been commonly used as reference to normalize gene expression and protein content data because of its presumed constitutive expression. In this paper, we challenge the consensual idea that housekeeping genes are reliable controls for expression studies in the retina through the investigation of a panel of reference genes potentially suitable for analysis of different stages of retinal development. We applied statistical tools on combinations of retinal developmental stages to assess the most stable internal controls for quantitative RT-PCR (qRT-PCR). The stability of expression of seven putative reference genes (Actb, B2m, Gapdh, Hprt1, Mapk1, Ppia and Rn18s) was analyzed using geNorm, BestKeeper and Normfinder software. In addition, several housekeeping genes were tested as loading controls for Western blot in the same sample panel, using Image J. Overall, for qRT-PCR the combination of Gapdh and Mapk1 showed the highest stability for most experimental sets. Actb was downregulated in more mature stages, while Rn18s and Hprt1 showed the highest variability. We normalized the expression of cyclin D1 using various reference genes and demonstrated that spurious results may result from blind selection of internal controls. For Western blot significant variation could be seen among four putative internal controls (β-actin, cyclophilin b, α-tubulin and lamin A/C), while MAPK1 was stably expressed. Putative housekeeping genes exhibit significant variation in both mRNA and protein content during retinal development. Our results showed that distinct combinations of internal controls fit for each experimental set in the case of qRT-PCR and that MAPK1 is a reliable loading control for Western blot. The results indicate that biased study outcomes may follow the use of reference genes without prior validation for qRT-PCR and Western blot.
Tian, Lu; Li, Wenyu; Huang, Xinmei; Tian, Di; Liu, Jianhua; Yang, Xinchao; Liu, Lianrui; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui; Song, Xiaokai
2017-01-01
Coccidiosis is an intestinal disorder of poultry and often caused by simultaneous infections of several Eimeria species. GAPDH is one of the immunogenic common antigens among Eimeria tenella, E. acervulina, and E. maxima identified in our previous study. The present study was performed to further evaluate its immunogenicity and protective efficacy. The genes of GAPDH cloned from E. acervulina and E. maxima were named as EaGAPDH and EmGAPDH, respectively. The immunogenicity of recombinant proteins of EaGAPDH and EmGAPDH were analyzed by Western blot. The transcription and expression of pVAX-EaGAPDH and pVAX-EmGAPDH in the injected muscles were detected by reverse transcription PCR (RT-PCR) and Western blot, respectively. GAPDH-induced changes of T lymphocytes subpopulation, cytokines production, and antibody were determined using flow cytometry, quantitative real-time PCR (qPCR), and ELISA, respectively. Finally, the protective efficacies of pVAX-EaGAPDH and pVAX-EmGAPDH were evaluated by vaccination and challenge experiments. The results revealed that the recombinant GAPDH proteins reacted with the corresponding chicken antisera. The EaGAPDH genes were successfully transcribed and expressed in the injected muscles. Vaccination with pVAX-EaGAPDH and pVAX-EmGAPDH significantly increased the proportion of CD4+ and CD8+ T lymphocytes, the cytokines productions of IFN-γ, IL-2, IL-4 et al., and IgG antibody levels compared to controls. The vaccination increased the weight gains, decreased the oocyst outputs, alleviate the enteric lesions compared to controls, and induced moderate anti-coccidial index (ACI). In conclusion, the coccidial common antigen of GAPDH induced significant humoral and cellular immune response and effective protection against E. tenella, E. acervulina, E. maxima, and mixed infection of the three Eimeria species. PMID:28769877
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2015-01-01
The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (−8, −6, −4, −2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens. PMID:25585250
Petriccione, Milena; Mastrobuoni, Francesco; Zampella, Luigi; Scortichini, Marco
2015-01-01
Normalization of data, by choosing the appropriate reference genes (RGs), is fundamental for obtaining reliable results in reverse transcription-quantitative PCR (RT-qPCR). In this study, we assessed Actinidia deliciosa leaves inoculated with two doses of Pseudomonas syringae pv. actinidiae during a period of 13 days for the expression profile of nine candidate RGs. Their expression stability was calculated using four algorithms: geNorm, NormFinder, BestKeeper and the deltaCt method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and protein phosphatase 2A (PP2A) were the most stable genes, while β-tubulin and 7s-globulin were the less stable. Expression analysis of three target genes, chosen for RGs validation, encoding the reactive oxygen species scavenging enzymes ascorbate peroxidase (APX), superoxide dismutase (SOD) and catalase (CAT) indicated that a combination of stable RGs, such as GAPDH and PP2A, can lead to an accurate quantification of the expression levels of such target genes. The APX level varied during the experiment time course and according to the inoculum doses, whereas both SOD and CAT resulted down-regulated during the first four days, and up-regulated afterwards, irrespective of inoculum dose. These results can be useful for better elucidating the molecular interaction in the A. deliciosa/P. s. pv. actinidiae pathosystem and for RGs selection in bacteria-plant pathosystems. PMID:26581656
Lin, Guo-Wang; Lu, Ping; Zeng, Tao; Tang, Hui-Ling; Chen, Yong-Hong; Liu, Shu-Jing; Gao, Mei-Mei; Zhao, Qi-Hua; Yi, Yong-Hong; Long, Yue-Sheng
2017-02-01
Abnormal expressions of sodium channel SCN1A and SCN3A genes alter neural excitability that are believed to contribute to the pathogenesis of epilepsy, a long-term risk of recurrent seizures. Ketogenic diet (KD), a high-fat and low-carbohydrate treatment for difficult-to-control (refractory) epilepsy in children, has been suggested to reverse gene expression patterns. Here, we reveal a novel role of GAPDH on the posttranscriptional regulation of mouse Scn1a and Scn3a expressions under seizure and KD conditions. We show that GAPDH binds to a conserved region in the 3' UTRs of human and mouse SCN1A and SCN3A genes, which decreases and increases genes' expressions by affecting mRNA stability through SCN1A 3' UTR and SCN3A 3' UTR, respectively. In seizure mice, the upregulation and phosphorylation of GAPDH enhance its binding to the 3' UTR, which lead to downregulation of Scn1a and upregulation of Scn3a. Furthermore, administration of KD generates β-hydroxybutyric acid which rescues the abnormal expressions of Scn1a and Scn3a by weakening the GAPDH's binding to the element. Taken together, these data suggest that GAPDH-mediated expression regulation of sodium channel genes may be associated with epilepsy and the anticonvulsant action of KD. Copyright © 2016 Elsevier Ltd. All rights reserved.
Urinary mRNA for the Diagnosis of Renal Allograft Rejection: The Issue of Normalization.
Galichon, P; Amrouche, L; Hertig, A; Brocheriou, I; Rabant, M; Xu-Dubois, Y-C; Ouali, N; Dahan, K; Morin, L; Terzi, F; Rondeau, E; Anglicheau, D
2016-10-01
Urinary messenger RNA (mRNA) quantification is a promising method for noninvasive diagnosis of renal allograft rejection (AR), but the quantification of mRNAs in urine remains challenging due to degradation. RNA normalization may be warranted to overcome these issues, but the strategies of gene normalization have been poorly evaluated. Herein, we address this issue in a case-control study of 108 urine samples collected at time of allograft biopsy in kidney recipients with (n = 52) or without (n = 56) AR by comparing the diagnostic value of IP-10 and CD3ε mRNAs-two biomarkers of AR-after normalization by the total amount of RNA, normalization by one of the three widely used reference RNAs-18S, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and Hypoxanthine-guanine phosphoribosyltransferase (HPRT)-or normalization using uroplakin 1A (UPK) mRNA as a possible urine-specific reference mRNA. Our results show that normalization based on the total quantity of RNA is not substantially improved by additional normalization and may even be worsened with some classical reference genes that are overexpressed during rejection. However, considering that normalization by a reference gene is necessary to ensure polymerase chain reaction (PCR) quality and reproducibility and to suppress the effect of RNA degradation, we suggest that GAPDH and UPK1A are preferable to 18S or HPRT RNA. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.
Thiel, Cora S; Hauschild, Swantje; Tauber, Svantje; Paulsen, Katrin; Raig, Christiane; Raem, Arnold; Biskup, Josefine; Gutewort, Annett; Hürlimann, Eva; Unverdorben, Felix; Buttron, Isabell; Lauber, Beatrice; Philpot, Claudia; Lier, Hartwin; Engelmann, Frank; Layer, Liliana E; Ullrich, Oliver
2015-01-01
Gene expression studies are indispensable for investigation and elucidation of molecular mechanisms. For the process of normalization, reference genes ("housekeeping genes") are essential to verify gene expression analysis. Thus, it is assumed that these reference genes demonstrate similar expression levels over all experimental conditions. However, common recommendations about reference genes were established during 1 g conditions and therefore their applicability in studies with altered gravity has not been demonstrated yet. The microarray technology is frequently used to generate expression profiles under defined conditions and to determine the relative difference in expression levels between two or more different states. In our study, we searched for potential reference genes with stable expression during different gravitational conditions (microgravity, normogravity, and hypergravity) which are additionally not altered in different hardware systems. We were able to identify eight genes (ALB, B4GALT6, GAPDH, HMBS, YWHAZ, ABCA5, ABCA9, and ABCC1) which demonstrated no altered gene expression levels in all tested conditions and therefore represent good candidates for the standardization of gene expression studies in altered gravity.
Wang, Qi; Ishikawa, Takaki; Michiue, Tomomi; Zhu, Bao-Li; Guan, Da-Wei; Maeda, Hitoshi
2013-09-01
Brain edema is believed to be linked to high mortality incidence after severe burns. The present study investigated the molecular pathology of brain damage and responses involving brain edema in forensic autopsy cases of fire fatality (n = 55) compared with sudden cardiac death (n = 11), mechanical asphyxia (n = 13), and non-brain injury cases (n = 22). Postmortem mRNA and immunohistochemical expressions of aquaporins (AQPs), claudin5 (CLDN5), and matrix metalloproteinases (MMPs) were examined. Prolonged deaths due to severe burns showed an increase in brain water content, but relative mRNA quantification, using different normalization methods, showed inconsistent results: in prolonged deaths due to severe burns, higher expression levels were detected for all markers when three previously validated reference genes, PES1, POLR2A, and IPO8, were used for normalization, higher for AQP1 and MMP9 when GAPDH alone was used for normalization and higher for MMP9, but lower for MMP2 when B2M alone was used for normalization. Additionally, when B2M alone was used for normalization, higher expression of AQP4 was detected in acute fire deaths. Furthermore, the expression stability values of these five reference genes calculated by geNorm demonstrated that B2M was the least stable one, followed by GAPDH. In immunostaining, only AQP1 and MMP9 showed differences among the causes of death: they were evident in most prolonged deaths due to severe burns. These findings suggest that systematic analysis of gene expressions using real-time PCR might be a useful procedure in forensic death investigation, and validation of reference genes is crucial.
Thiel, Cora S.; Hauschild, Swantje; Tauber, Svantje; Paulsen, Katrin; Raig, Christiane; Raem, Arnold; Biskup, Josefine; Gutewort, Annett; Hürlimann, Eva; Philpot, Claudia; Lier, Hartwin; Engelmann, Frank; Layer, Liliana E.
2015-01-01
Gene expression studies are indispensable for investigation and elucidation of molecular mechanisms. For the process of normalization, reference genes (“housekeeping genes”) are essential to verify gene expression analysis. Thus, it is assumed that these reference genes demonstrate similar expression levels over all experimental conditions. However, common recommendations about reference genes were established during 1 g conditions and therefore their applicability in studies with altered gravity has not been demonstrated yet. The microarray technology is frequently used to generate expression profiles under defined conditions and to determine the relative difference in expression levels between two or more different states. In our study, we searched for potential reference genes with stable expression during different gravitational conditions (microgravity, normogravity, and hypergravity) which are additionally not altered in different hardware systems. We were able to identify eight genes (ALB, B4GALT6, GAPDH, HMBS, YWHAZ, ABCA5, ABCA9, and ABCC1) which demonstrated no altered gene expression levels in all tested conditions and therefore represent good candidates for the standardization of gene expression studies in altered gravity. PMID:25654098
Manipulation and Biological Applications of Gold Nanorods
NASA Astrophysics Data System (ADS)
Rostro-Kohanloo, Betty Catalina
This thesis compared anionic polyelectrolyte wrapping stabilization with poly(sodium 4-stryene-sulfonate), (PSS), polyelectrolyte and methoxy (polyethylene glycol)-thiol (mPEG(5000)-SH) strategies. From this data the critical gold nanorod (GNR) and cetyl-trimethylammonium bromide (CTAB) concentration ratio needed for GNR stabilization was determined using optical and chemical extraction methods. This was followed by functionalization with a heterobifunctional Polyethylene glycol (PEG) linker, such as a-thio-w-carboxy poly(ethylene glycol) termed t-PEG-c and carbodiimide chemistries for antibody linkage with Immunoglobulin G (IgG), and epidermal growth factor receptor (EGFR) based Human Epidermal growth factor Receptor 2 (Her2), and Cetuximab (C225) antibodies, for in vitro cancer cell targeting. Confocal, two-photon luminescence (TPL), and dark scattering microscopy, and fluorescence, zeta potential, and Nanoparticle Enzyme-linked immunosorbent assay (ELISA) were used to monitor changes to the GNR surface. An untreatable form of bladder cancer was then studied using the t-GNR-PEG-c-Ab bioconjugates with C225 antibody, which housed a glyceraldehyde-3-phosphate (GAPDH), Fluorescein isothiocyanate (FITC) labeled siRNA, termed GAPDH-siRNA-FITC, which was included within a Luciferase based plasmid. A salt based electrostatic heating method was used to trap the GAPDH-siRNA-FITC from the PEG layer by activating the PEG polymer pour point, while a laser based heating system was used for in vitro release inside cancer cells. The down regulation of the GAPDH gene was targeted by the siRNA. as GAPDH has been shown to be up-regulated in many cancers and down-regulated by chemotherapeutic drugs. Cell culture, and subsequent imaging by transmission electron microscopy (TEM), TPL and confocal microscopy were used to view the internalized conjugates, and reverse transcriptase polymerase chain reaction (RT-PCR) were used to determine if the release of the GAPDH-siRNA caused a reduction in the expression of GAPDH-mRNA. Plasmonic gene silencing of the gene by the GAPDH-siRNA was then compared to a lipid based Dharmafect control in terms of transfection ability. RT-PCR results evidenced gene silencing of the plasmonic-GAPDH-siRNA vector when compared to the Dharmafect control. Silencing likely resulted from the zwitterionic charges of the plasmonic vector and the encapsulated GAPDH-siRNA, which yielded near neutral charge tendencies. This differs significantly from the Dharmafect lipid vector, which is cationic in nature. Endosomal release of the plasmonic vector is further enhanced by the laser excitation of the GNR at the longitudinal surface plasmon resonance (LSPR), which allows for the endosomal release of the GAPDH-siRNA through pore formation leading to cytoplasmic transport and subsequent gene silencing. Near neutral charges were welcomed in this plasmonic gene therapy study as they tend to favor endosomal release, pore formation, and transport.
Guelke, Eileen; Bucan, Vesna; Liebsch, Christina; Lazaridis, Andrea; Radtke, Christine; Vogt, Peter M; Reimers, Kerstin
2015-04-10
For the precise quantitative RT-PCR normalization a set of valid reference genes is obligatory. Moreover have to be taken into concern the experimental conditions as they bias the regulation of reference genes. Up till now, no reference targets have been described for the axolotl (Ambystoma mexicanum). In a search in the public database SalSite for genetic information of the axolotl we identified fourteen presumptive reference genes, eleven of which were further tested for their gene expression stability. This study characterizes the expressional patterns of 11 putative endogenous control genes during axolotl limb regeneration and in an axolotl tissue panel. All 11 reference genes showed variable expression. Strikingly, ACTB was to be found most stable expressed in all comparative tissue groups, so we reason it to be suitable for all different kinds of axolotl tissue-type investigations. Moreover do we suggest GAPDH and RPLP0 as suitable for certain axolotl tissue analysis. When it comes to axolotl limb regeneration, a validated pair of reference genes is ODC and RPLP0. With these findings, new insights into axolotl gene expression profiling might be gained. Copyright © 2015 Elsevier B.V. All rights reserved.
Ferrante, Jason; Hunter, Margaret; Wellehan, James F.X.
2018-01-01
Cytokines have important roles in the mammalian response to viral and bacterial infections, trauma, and wound healing. Because of early cytokine production after physiologic stresses, the regulation of messenger RNA (mRNA) transcripts can be used to assess immunologic responses before changes in protein production. To detect and assess early immune changes in endangered Florida manatees (Trichechus manatus latirostris), we developed and validated a panel of quantitative PCR assays to measure mRNA transcription levels for the cytokines interferon (IFN)-γ; interleukin (IL)-2, -6, and -10; tumor necrosis factor-α, and the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (reference genes). Assays were successfully validated using blood samples from free-ranging, apparently healthy manatees from the east and west coasts of central Florida. No cytokine or housekeeping gene transcription levels were significantly different among age classes or sexes. However, the transcription levels for GAPDH, IL-2, IL-6, and IFN-γ were significantly higher (P<0.05) in manatees from the east coast of Florida than they were from those from the west coast. We found IL-10 and β-actin to be consistent between sites and identified β-actin as a good candidate for use as a reference gene in future studies. Our assays can aid in the investigation of manatee immune response to physical trauma and novel or ongoing environmental stressors.
Ferrante, Jason A; Hunter, Margaret E; Wellehan, James F X
2018-04-01
Cytokines have important roles in the mammalian response to viral and bacterial infections, trauma, and wound healing. Because of early cytokine production after physiologic stresses, the regulation of messenger RNA (mRNA) transcripts can be used to assess immunologic responses before changes in protein production. To detect and assess early immune changes in endangered Florida manatees ( Trichechus manatus latirostris), we developed and validated a panel of quantitative PCR assays to measure mRNA transcription levels for the cytokines interferon (IFN)-γ; interleukin (IL)-2, -6, and -10; tumor necrosis factor-α; and the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (reference genes). Assays were successfully validated using blood samples from free-ranging, apparently healthy manatees from the east and west coasts of central Florida, US. No cytokine or housekeeping gene transcription levels were significantly different among age classes or sexes. However, the transcription levels for GAPDH, IL-2, IL-6, and IFN-γ were significantly higher ( P<0.05) in manatees from the east coast of Florida than they were from those from the west coast. We found IL-10 and β-actin to be consistent between sites and identified β-actin as a good candidate for use as a reference gene in future studies. Our assays can aid in the investigation of manatee immune response to physical trauma and novel or ongoing environmental stressors.
Liu, Tengfei; Fang, Hui; Liu, Jun; Reid, Stephen; Hou, Juan; Zhou, Tingting; Tian, Zhendong; Song, Botao; Xie, Conghua
2017-12-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is an important enzyme that functions in producing energy and supplying intermediates for cellular metabolism. Recent researches indicate that GAPDHs have multiple functions beside glycolysis. However, little information is available for functions of GAPDHs in potato. Here, we identified 4 putative cytosolic GAPDH genes in potato genome and demonstrated that the StGAPC1, StGAPC2, and StGAPC3, which are constitutively expressed in potato tissues and cold inducible in tubers, encode active cytosolic GAPDHs. Cosuppression of these 3 GAPC genes resulted in low tuber GAPDH activity, consequently the accumulation of reducing sugars in cold stored tubers by altering the tuber metabolite pool sizes favoring the sucrose pathway. Furthermore, GAPCs-silenced tubers exhibited a loss of apical dominance dependent on cell death of tuber apical bud meristem (TAB-meristem). It was also confirmed that StGAPC1, StGAPC2, and StGAPC3 interacted with the autophagy-related protein 3 (ATG3), implying that the occurrence of cell death in TAB-meristem could be induced by ATG3 associated events. Collectively, the present research evidences first that the GAPC genes play crucial roles in diverse physiological and developmental processes in potato tubers. © 2017 John Wiley & Sons Ltd.
Itakura, Masanori; Kubo, Takeya; Kaneshige, Akihiro; Harada, Naoki; Izawa, Takeshi; Azuma, Yasu-Taka; Kuwamura, Mitsuru; Yamaji, Ryouichi; Takeuchi, Tadayoshi
2017-01-01
Glycolytic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a multifunctional protein that also mediates cell death under oxidative stress. We reported previously that the active-site cysteine (Cys-152) of GAPDH plays an essential role in oxidative stress-induced aggregation of GAPDH associated with cell death, and a C152A-GAPDH mutant rescues nitric oxide (NO)-induced cell death by interfering with the aggregation of wild type (WT)-GAPDH. However, the detailed mechanism underlying GAPDH aggregate-induced cell death remains elusive. Here we report that NO-induced GAPDH aggregation specifically causes mitochondrial dysfunction. First, we observed a correlation between NO-induced GAPDH aggregation and mitochondrial dysfunction, when GAPDH aggregation occurred at mitochondria in SH-SY5Y cells. In isolated mitochondria, aggregates of WT-GAPDH directly induced mitochondrial swelling and depolarization, whereas mixtures containing aggregates of C152A-GAPDH reduced mitochondrial dysfunction. Additionally, treatment with cyclosporin A improved WT-GAPDH aggregate-induced swelling and depolarization. In doxycycline-inducible SH-SY5Y cells, overexpression of WT-GAPDH augmented NO-induced mitochondrial dysfunction and increased mitochondrial GAPDH aggregation, whereas induced overexpression of C152A-GAPDH significantly suppressed mitochondrial impairment. Further, NO-induced cytochrome c release into the cytosol and nuclear translocation of apoptosis-inducing factor from mitochondria were both augmented in cells overexpressing WT-GAPDH but ameliorated in C152A-GAPDH-overexpressing cells. Interestingly, GAPDH aggregates induced necrotic cell death via a permeability transition pore (PTP) opening. The expression of either WT- or C152A-GAPDH did not affect other cell death pathways associated with protein aggregation, such as proteasome inhibition, gene expression induced by endoplasmic reticulum stress, or autophagy. Collectively, these results suggest that NO-induced GAPDH aggregation specifically induces mitochondrial dysfunction via PTP opening, leading to cell death. PMID:28167533
Selecting and validating reference genes for quantitative real-time PCR in Plutella xylostella (L.).
You, Yanchun; Xie, Miao; Vasseur, Liette; You, Minsheng
2018-05-01
Gene expression analysis provides important clues regarding gene functions, and quantitative real-time PCR (qRT-PCR) is a widely used method in gene expression studies. Reference genes are essential for normalizing and accurately assessing gene expression. In the present study, 16 candidate reference genes (ACTB, CyPA, EF1-α, GAPDH, HSP90, NDPk, RPL13a, RPL18, RPL19, RPL32, RPL4, RPL8, RPS13, RPS4, α-TUB, and β-TUB) from Plutella xylostella were selected to evaluate gene expression stability across different experimental conditions using five statistical algorithms (geNorm, NormFinder, Delta Ct, BestKeeper, and RefFinder). The results suggest that different reference genes or combinations of reference genes are suitable for normalization in gene expression studies of P. xylostella according to the different developmental stages, strains, tissues, and insecticide treatments. Based on the given experimental sets, the most stable reference genes were RPS4 across different developmental stages, RPL8 across different strains and tissues, and EF1-α across different insecticide treatments. A comprehensive and systematic assessment of potential reference genes for gene expression normalization is essential for post-genomic functional research in P. xylostella, a notorious pest with worldwide distribution and a high capacity to adapt and develop resistance to insecticides.
Zhou, Xuguo; Gao, Xiwu
2014-01-01
Finding a suitable reference gene is the key for qRT-PCR analysis. However, none of the reference gene discovered thus far can be utilized universally under various biotic and abiotic experimental conditions. In this study, we further examine the stability of candidate reference genes under a single abiotic factor, insecticide treatment. After being exposed to eight commercially available insecticides, which belong to five different classes, the expression profiles of eight housekeeping genes in the sweetpotato whitefly, Bemisia tabaci, one of the most invasive and destructive pests in the world, were investigated using qRT-PCR analysis. In summary, elongation factor 1α (EF1α), α-tubulin (TUB1α) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were identified as the most stable reference genes under the insecticide treatment. The initial assessment of candidate reference genes was further validated with the expression of two target genes, a P450 (Cyp6cm1) and a glutathione S-transferase (GST). However, ranking of reference genes varied substantially among intra- and inter-classes of insecticides. These combined data strongly suggested the necessity of conducting custom reference gene selection designed for each and every experimental condition, even when examining the same abiotic or biotic factor. PMID:24498122
Xu, Yuanyuan; Zhu, Xianwen; Gong, Yiqin; Xu, Liang; Wang, Yan; Liu, Liwang
2012-08-03
Real-time quantitative reverse transcription PCR (RT-qPCR) is a rapid and reliable method for gene expression studies. Normalization based on reference genes can increase the reliability of this technique; however, recent studies have shown that almost no single reference gene is universal for all possible experimental conditions. In this study, eight frequently used reference genes were investigated, including Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Actin2/7 (ACT), Tubulin alpha-5 (TUA), Tubulin beta-1 (TUB), 18S ribosomal RNA (18SrRNA), RNA polymerase-II transcription factor (RPII), Elongation factor 1-b (EF-1b) and Translation elongation factor 2 (TEF2). Expression stability of candidate reference genes was examined across 27 radish samples, representing a range of tissue types, cultivars, photoperiodic and vernalization treatments, and developmental stages. The eight genes in these sample pools displayed a wide range of Ct values and were variably expressed. Two statistical software packages, geNorm and NormFinder showed that TEF2, RPII and ACT appeared to be relatively stable and therefore the most suitable for use as reference genes. These results facilitate selection of desirable reference genes for accurate gene expression studies in radish. Copyright © 2012 Elsevier Inc. All rights reserved.
Selection of reference genes for miRNA qRT-PCR under abiotic stress in grapevine.
Luo, Meng; Gao, Zhen; Li, Hui; Li, Qin; Zhang, Caixi; Xu, Wenping; Song, Shiren; Ma, Chao; Wang, Shiping
2018-03-13
Grapevine is among the fruit crops with high economic value, and because of the economic losses caused by abiotic stresses, the stress resistance of Vitis vinifera has become an increasingly important research area. Among the mechanisms responding to environmental stresses, the role of miRNA has received much attention recently. qRT-PCR is a powerful method for miRNA quantitation, but the accuracy of the method strongly depends on the appropriate reference genes. To determine the most suitable reference genes for grapevine miRNA qRT-PCR, 15 genes were chosen as candidate reference genes. After eliminating 6 candidate reference genes with unsatisfactory amplification efficiency, the expression stability of the remaining candidate reference genes under salinity, cold and drought was analysed using four algorithms, geNorm, NormFinder, deltaCt and Bestkeeper. The results indicated that U6 snRNA was the most suitable reference gene under salinity and cold stresses; whereas miR168 was the best for drought stress. The best reference gene sets for salinity, cold and drought stresses were miR160e + miR164a, miR160e + miR168 and ACT + UBQ + GAPDH, respectively. The selected reference genes or gene sets were verified using miR319 or miR408 as the target gene.
Fang, Peng; Lu, Rongfei; Sun, Feng; Lan, Ying; Shen, Wenbiao; Du, Linlin; Zhou, Yijun; Zhou, Tong
2015-10-24
Stably expressed reference gene(s) normalization is important for the understanding of gene expression patterns by quantitative Real-time PCR (RT-qPCR), particularly for Rice stripe virus (RSV) and Rice black streaked dwarf virus (RBSDV) that caused seriously damage on rice plants in China and Southeast Asia. The expression of fourteen common used reference genes of Oryza sativa L. were evaluated by RT-qPCR in RSV and RBSDV infected rice plants. Suitable normalization reference gene(s) were identified by geNorm and NormFinder algorithms. UBQ 10 + GAPDH and UBC + Actin1 were identified as suitable reference genes for RT-qPCR normalization under RSV and RBSDV infection, respectively. When using multiple reference genes, the expression patterns of OsPRIb and OsWRKY, two virus resistance genes, were approximately similar with that reported previously. Comparatively, by using single reference gene (TIP41-Like), a weaker inducible response was observed. We proposed that the combination of two reference genes could obtain more accurate and reliable normalization of RT-qPCR results in RSV- and RBSDV-infected plants. This work therefore sheds light on establishing a standardized RT-qPCR procedure in RSV- and RBSDV-infected rice plants, and might serve as an important point for discovering complex regulatory networks and identifying genes relevant to biological processes or implicated in virus.
Kaido, Masanori; Abe, Kazutomo; Mine, Akira; Hyodo, Kiwamu; Taniguchi, Takako; Taniguchi, Hisaaki; Mise, Kazuyuki; Okuno, Tetsuro
2014-01-01
The formation of virus movement protein (MP)-containing punctate structures on the cortical endoplasmic reticulum is required for efficient intercellular movement of Red clover necrotic mosaic virus (RCNMV), a bipartite positive-strand RNA plant virus. We found that these cortical punctate structures constitute a viral replication complex (VRC) in addition to the previously reported aggregate structures that formed adjacent to the nucleus. We identified host proteins that interacted with RCNMV MP in virus-infected Nicotiana benthamiana leaves using a tandem affinity purification method followed by mass spectrometry. One of these host proteins was glyceraldehyde 3-phosphate dehydrogenase-A (NbGAPDH-A), which is a component of the Calvin-Benson cycle in chloroplasts. Virus-induced gene silencing of NbGAPDH-A reduced RCNMV multiplication in the inoculated leaves, but not in the single cells, thereby suggesting that GAPDH-A plays a positive role in cell-to-cell movement of RCNMV. The fusion protein of NbGAPDH-A and green fluorescent protein localized exclusively to the chloroplasts. In the presence of RCNMV RNA1, however, the protein localized to the cortical VRC as well as the chloroplasts. Bimolecular fluorescence complementation assay and GST pulldown assay confirmed in vivo and in vitro interactions, respectively, between the MP and NbGAPDH-A. Furthermore, gene silencing of NbGAPDH-A inhibited MP localization to the cortical VRC. We discuss the possible roles of NbGAPDH-A in the RCNMV movement process. PMID:25411849
Pombo-Suarez, Manuel; Calaza, Manuel; Gomez-Reino, Juan J; Gonzalez, Antonio
2008-01-29
Assessment of gene expression is an important component of osteoarthritis (OA) research, greatly improved by the development of quantitative real-time PCR (qPCR). This technique requires normalization for precise results, yet no suitable reference genes have been identified in human articular cartilage. We have examined ten well-known reference genes to determine the most adequate for this application. Analyses of expression stability in cartilage from 10 patients with hip OA, 8 patients with knee OA and 10 controls without OA were done with classical statistical tests and the software programs geNorm and NormFinder. Results from the three methods of analysis were broadly concordant. Some of the commonly used reference genes, GAPDH, ACTB and 18S RNA, performed poorly in our analysis. In contrast, the rarely used TBP, RPL13A and B2M genes were the best. It was necessary to use together several of these three genes to obtain the best results. The specific combination depended, to some extent, on the type of samples being compared. Our results provide a satisfactory set of previously unused reference genes for qPCR in hip and knee OA This confirms the need to evaluate the suitability of reference genes in every tissue and experimental situation before starting the quantitative assessment of gene expression by qPCR.
Zhang, Hua; Zhao, Yu; Zhou, Dao-Xiu
2017-12-01
Sirtuins, a family of proteins with homology to the yeast silent information regulator 2 (Sir2), are NAD+-dependent histone deacetylases and play crucial roles in energy sensing and regulation in yeast and animal cells. Plants are autotrophic organisms and display distinct features of carbon and energy metabolism. It remains largely unexplored whether and how plant cells sense energy/redox status to control carbon metabolic flux under various growth conditions. In this work, we show that the rice nuclear sirtuin OsSRT1 not only functions as an epigenetic regulator to repress glycolytic genes expression and glycolysis in seedlings, but also inhibits transcriptional activity of glyceraldehyde-3-phosphatedehydrogenase (GAPDH) that is enriched on glycolytic genes promoters and stimulates their expression. We show that OsSRT1 reduces GAPDH lysine acetylation and nuclear accumulation that are enhanced by oxidative stress. Mass spectrometry identified six acetylated lysines regulated by OsSRT1. OsSRT1-dependent lysine deacetylation of OsGAPDH1 represses transcriptional activity of the protein. The results indicate that OsSRT1 represses glycolysis by both regulating epigenetic modification of histone and inhibiting the moonlighting function of GAPDH as a transcriptional activator of glycolytic genes in rice. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Filby, Amy L; Tyler, Charles R
2007-01-01
Background Attempts to develop a mechanistic understanding of the effects of environmental estrogens on fish are increasingly conducted at the level of gene expression. Appropriate application of real-time PCR in such studies requires the use of a stably expressed 'housekeeping' gene as an internal control to normalize for differences in the amount of starting template between samples. Results We sought to identify appropriate genes for use as internal controls in experimental treatments with estrogen by analyzing the expression of eight functionally distinct 'housekeeping' genes (18S ribosomal RNA [18S rRNA], ribosomal protein l8 [rpl8], elongation factor 1 alpha [ef1a], glucose-6-phosphate dehydrogenase [g6pd], beta actin [bactin], glyceraldehyde-3-phosphate dehydrogenase [gapdh], hypoxanthine phosphoribosyltransferase 1 [hprt1], and tata box binding protein [tbp]) following exposure to the environmental estrogen, 17α-ethinylestradiol (EE2), in the fathead minnow (Pimephales promelas). Exposure to 10 ng/L EE2 for 21 days down-regulated the expression of ef1a, g6pd, bactin and gapdh in the liver, and bactin and gapdh in the gonad. Some of these effects were gender-specific, with bactin in the liver and gapdh in the gonad down-regulated by EE2 in males only. Furthermore, when ef1a, g6pd, bactin or gapdh were used for normalization, the hepatic expression of two genes of interest, vitellogenin (vtg) and cytochrome P450 1A (cyp1a) following exposure to EE2 was overestimated. Conclusion Based on the data presented, we recommend 18S rRNA, rpl8, hprt1 and/or tbp, but not ef1a, g6pd, bactin and/or gapdh, as likely appropriate internal controls in real-time PCR studies of estrogens effects in fish. Our studies show that pre-validation of control genes considering the scope and nature of the experiments to be performed, including both gender and tissue type, is critical for accurate assessments of the effects of environmental estrogens on gene expression in fish. PMID:17288598
Nonis, Alberto; Vezzaro, Alice; Ruperti, Benedetto
2012-07-11
Genome wide transcriptomic surveys together with targeted molecular studies are uncovering an ever increasing number of differentially expressed genes in relation to agriculturally relevant processes in olive (Olea europaea L). These data need to be supported by quantitative approaches enabling the precise estimation of transcript abundance. qPCR being the most widely adopted technique for mRNA quantification, preliminary work needs to be done to set up robust methods for extraction of fully functional RNA and for the identification of the best reference genes to obtain reliable quantification of transcripts. In this work, we have assessed different methods for their suitability for RNA extraction from olive fruits and leaves and we have evaluated thirteen potential candidate reference genes on 21 RNA samples belonging to fruit developmental/ripening series and to leaves subjected to wounding. By using two different algorithms, GAPDH2 and PP2A1 were identified as the best reference genes for olive fruit development and ripening, and their effectiveness for normalization of expression of two ripening marker genes was demonstrated.
Chen, Lei; Zhong, Hai-ying; Kuang, Jian-fei; Li, Jian-guo; Lu, Wang-jin; Chen, Jian-ye
2011-08-01
Reverse transcription quantitative real-time PCR (RT-qPCR) is a sensitive technique for quantifying gene expression, but its success depends on the stability of the reference gene(s) used for data normalization. Only a few studies on validation of reference genes have been conducted in fruit trees and none in banana yet. In the present work, 20 candidate reference genes were selected, and their expression stability in 144 banana samples were evaluated and analyzed using two algorithms, geNorm and NormFinder. The samples consisted of eight sample sets collected under different experimental conditions, including various tissues, developmental stages, postharvest ripening, stresses (chilling, high temperature, and pathogen), and hormone treatments. Our results showed that different suitable reference gene(s) or combination of reference genes for normalization should be selected depending on the experimental conditions. The RPS2 and UBQ2 genes were validated as the most suitable reference genes across all tested samples. More importantly, our data further showed that the widely used reference genes, ACT and GAPDH, were not the most suitable reference genes in many banana sample sets. In addition, the expression of MaEBF1, a gene of interest that plays an important role in regulating fruit ripening, under different experimental conditions was used to further confirm the validated reference genes. Taken together, our results provide guidelines for reference gene(s) selection under different experimental conditions and a foundation for more accurate and widespread use of RT-qPCR in banana.
Zhang, Songdou; An, Shiheng; Li, Zhen; Wu, Fengming; Yang, Qingpo; Liu, Yichen; Cao, Jinjun; Zhang, Huaijiang; Zhang, Qingwen; Liu, Xiaoxia
2015-01-25
Recent studies have focused on determining functional genes and microRNAs in the pest Helicoverpa armigera (Lepidoptera: Noctuidae). Most of these studies used quantitative real-time PCR (qRT-PCR). Suitable reference genes are necessary to normalize gene expression data of qRT-PCR. However, a comprehensive study on the reference genes in H. armigera remains lacking. Twelve candidate reference genes of H. armigera were selected and evaluated for their expression stability under different biotic and abiotic conditions. The comprehensive stability ranking of candidate reference genes was recommended by RefFinder and the optimal number of reference genes was calculated by geNorm. Two target genes, thioredoxin (TRX) and Cu/Zn superoxide dismutase (SOD), were used to validate the selection of reference genes. Results showed that the most suitable candidate combinations of reference genes were as follows: 28S and RPS15 for developmental stages; RPS15 and RPL13 for larvae tissues; EF and RPL27 for adult tissues; GAPDH, RPL27, and β-TUB for nuclear polyhedrosis virus infection; RPS15 and RPL32 for insecticide treatment; RPS15 and RPL27 for temperature treatment; and RPL32, RPS15, and RPL27 for all samples. This study not only establishes an accurate method for normalizing qRT-PCR data in H. armigera but also serve as a reference for further study on gene transcription in H. armigera and other insects. Copyright © 2014 Elsevier B.V. All rights reserved.
Płachetka-Bożek, Anna; Augustyniak, Maria
2017-08-21
Studies on the transcriptional control of gene expression play an important role in many areas of biology. Reference genes, which are often referred to as housekeeping genes, such as GAPDH, G3PDH, EF2, RpL7A, RpL10, TUBα and Actin, have traditionally been assumed to be stably expressed in all conditions, and they are frequently used to normalize mRNA levels between different samples in qPCR analysis. However, it is known that the expression of these genes is influenced by numerous factors, such as experimental conditions. The difference in gene expression underlies a range of biological processes, including development, reproduction and behavior. The aim of this study was to show the problems associated with using reference genes in the qPCR technique, in a study on inbred strains of Spodoptera exigua selected toward cadmium resistance. We present and discuss our results and observations, and give some recommendations concerning the use and limitations of housekeeping genes as internal standards, especially in research on insects. Our results suggest that holometabolism and poikilothermia, as well as time since metamorphosis and the level of exposure to the selective factor (cadmium in this case), have a significant effect on the expression of reference genes.
2010-01-01
Background Due to the limited number of species specific antibodies against fish proteins, differential gene expression analyses are vital for the study of host immune responses. Quantitative real-time reverse transcription PCR (qRT-PCR) is one of the most powerful tools for this purpose. Nevertheless, the accuracy of the method will depend on the careful selection of genes whose expression are stable and can be used as internal controls for a particular experimental setting. Findings The expression stability of five commonly used housekeeping genes [beta-actin (ACTB), elongation factor 1-alpha (EF1A), ubiquitin (UBQ), glyceraldehyd-3-phosphate dehydrogenase (GAPDH) and tubulin alpha (TUBA)] were monitored in salmonid cell lines CHSE-214 and RTS11 after infection with two of the most fastidious fish pathogens, the facultative bacterium Piscirickettsia salmonis and the aquabirnavirus IPNV (Infectious Pancreatic Necrosis Virus). After geNorm analysis, UBQ and EF1A appeared as the most stable, although EF1A was slightly upregulated at late stages of P. salmonis infection in RTS11. ACTB instead, showed a good performance in each case, being always considered within the three most stable genes of the panel. In contrast, infection-dependent differential regulation of GAPDH and TUBA was also demonstrated. Conclusion Based on the data presented here with the cell culture models CHSE-214 and RTS11, we suggest the initial choice of UBQ, ACTB and EF1A as reference genes in qRT-PCR assays for studying the effect of P. salmonis and IPNV on the host immune response. PMID:20398263
Wang, X N; Yang, Q W; Du, Z W; Yu, T; Qin, Y G; Song, Y; Xu, M; Wang, J C
2016-05-25
This study aimed to evaluate 12 genes (18S, GAPDH, B2M, ACTB, ALAS1, GUSB, HPRT1, PBGD, PPIA, PUM1, RPL29, and TBP) for their reliability and stability as reference sequences for real-time quantitative PCR (RT-qPCR) in bone marrow-derived mesenchymal stem cells (BMSCs) isolated from patients with avascular necrosis of the femoral head (ANFH). BMSCs were isolated from 20 ANFH patients divided into four groups according to etiology, and four donors with femoral neck fractures. Total RNA was isolated from BMSCs and reverse transcribed into complementary DNA, which served as a template for RT-qPCR. Three commonly used programs were then used to analyze the results. Reference gene expression varied within each group, between specific groups, and among all five groups. Based on comparisons of all five groups, two of the programs used suggested that HPRT1 was the most stable reference gene, while 18S and ACTB were the most variable. Among the 12 candidate reference genes, HPRT1 exhibited the greatest reliability, followed by PPIA. Thus, these sequences could be used as references for the normalization of RT-qPCR results.
Selection of reference genes for RT-qPCR studies in blood of beluga whales (Delphinapterus leucas)
Chen, I-Hua; Wang, Jiann-Hsiung; Chou, Shih-Jen; Wu, Yeong-Huey; Li, Tsung-Hsien; Leu, Ming-Yih; Chang, Wen-Been
2016-01-01
Reverse transcription quantitative PCR (RT-qPCR) is used for research in gene expression, and it is vital to choose appropriate housekeeping genes (HKGs) as reference genes to obtain correct results. The purpose of this study is to determine stably expressed HKGs in blood of beluga whales (Delphinapterus leucas) that can be the appropriate reference genes in relative quantification in gene expression research. Sixty blood samples were taken from four beluga whales. Thirteen candidate HKGs (ACTB, B2M, GAPDH, HPRT1, LDHB, PGK1, RPL4, RPL8, RPL18, RPS9, RPS18, TFRC, YWHAZ) were tested using RT-qPCR. The stability values of the HKGs were determined by four different algorithms. Comprehensive analysis of the results revealed that RPL4, PGK1 and ACTB are strongly recommended for use in future RT-qPCR studies in beluga blood samples. This research provides recommendation of reference gene selection, which may contribute to further mRNA relative quantification research in the peripheral blood leukocytes in captive cetaceans. The gene expression assessment of the immune components in blood have the potential to serve as an important approach to evaluating cetacean health influenced by environmental insults. PMID:26998411
Selection of reference genes for RT-qPCR studies in blood of beluga whales (Delphinapterus leucas).
Chen, I-Hua; Wang, Jiann-Hsiung; Chou, Shih-Jen; Wu, Yeong-Huey; Li, Tsung-Hsien; Leu, Ming-Yih; Chang, Wen-Been; Yang, Wei Cheng
2016-01-01
Reverse transcription quantitative PCR (RT-qPCR) is used for research in gene expression, and it is vital to choose appropriate housekeeping genes (HKGs) as reference genes to obtain correct results. The purpose of this study is to determine stably expressed HKGs in blood of beluga whales (Delphinapterus leucas) that can be the appropriate reference genes in relative quantification in gene expression research. Sixty blood samples were taken from four beluga whales. Thirteen candidate HKGs (ACTB, B2M, GAPDH, HPRT1, LDHB, PGK1, RPL4, RPL8, RPL18, RPS9, RPS18, TFRC, YWHAZ) were tested using RT-qPCR. The stability values of the HKGs were determined by four different algorithms. Comprehensive analysis of the results revealed that RPL4, PGK1 and ACTB are strongly recommended for use in future RT-qPCR studies in beluga blood samples. This research provides recommendation of reference gene selection, which may contribute to further mRNA relative quantification research in the peripheral blood leukocytes in captive cetaceans. The gene expression assessment of the immune components in blood have the potential to serve as an important approach to evaluating cetacean health influenced by environmental insults.
Zhu, Yuanyuan; Yang, Chao; Weng, Mingjiao; Zhang, Yan; Yang, Chunhui; Jin, Yinji; Yang, Weiwei; He, Yan; Wu, Yiqi; Zhang, Yuhua; Wang, Guangyu; RajkumarEzakiel Redpath, Riju James; Zhang, Lei; Jin, Xiaoming; Liu, Ying; Sun, Yuchun; Ning, Ning; Qiao, Yu; Zhang, Fengmin; Li, Zhiwei; Wang, Tianzhen; Zhang, Yanqiao; Li, Xiaobo
2017-01-01
Numerous evidences indicate that aspirin usage causes a significant reduction in colorectal cancer. However, the molecular mechanisms about aspirin preventing colon cancer are largely unknown. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a most frequently used method to identify the target molecules regulated by certain compound. However, this method needs stable internal reference genes to analyze the expression change of the targets. In this study, the transcriptional stabilities of several traditional reference genes were evaluated in colon cancer cells treated with aspirin, and also, the suitable internal reference genes were screened by using a microarray and were further identified by using the geNorm and NormFinder softwares, and then were validated in more cell lines and xenografts. We have showed that three traditional internal reference genes, β-actin, GAPDH and α-tubulin, are not suitable for studying gene transcription in colon cancer cells treated with aspirin, and we have identified and validated TMEM208 and PQLC2 as the ideal internal reference genes for detecting the molecular targets of aspirin in colon cancer in vitro and in vivo. This study reveals stable internal reference genes for studying the target genes of aspirin in colon cancer, which will contribute to identify the molecular mechanism behind aspirin preventing colon cancer. PMID:28184026
Zhu, Yuanyuan; Yang, Chao; Weng, Mingjiao; Zhang, Yan; Yang, Chunhui; Jin, Yinji; Yang, Weiwei; He, Yan; Wu, Yiqi; Zhang, Yuhua; Wang, Guangyu; RajkumarEzakiel Redpath, Riju James; Zhang, Lei; Jin, Xiaoming; Liu, Ying; Sun, Yuchun; Ning, Ning; Qiao, Yu; Zhang, Fengmin; Li, Zhiwei; Wang, Tianzhen; Zhang, Yanqiao; Li, Xiaobo
2017-04-04
Numerous evidences indicate that aspirin usage causes a significant reduction in colorectal cancer. However, the molecular mechanisms about aspirin preventing colon cancer are largely unknown. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a most frequently used method to identify the target molecules regulated by certain compound. However, this method needs stable internal reference genes to analyze the expression change of the targets. In this study, the transcriptional stabilities of several traditional reference genes were evaluated in colon cancer cells treated with aspirin, and also, the suitable internal reference genes were screened by using a microarray and were further identified by using the geNorm and NormFinder softwares, and then were validated in more cell lines and xenografts. We have showed that three traditional internal reference genes, β-actin, GAPDH and α-tubulin, are not suitable for studying gene transcription in colon cancer cells treated with aspirin, and we have identified and validated TMEM208 and PQLC2 as the ideal internal reference genes for detecting the molecular targets of aspirin in colon cancer in vitro and in vivo. This study reveals stable internal reference genes for studying the target genes of aspirin in colon cancer, which will contribute to identify the molecular mechanism behind aspirin preventing colon cancer.
Evaluation of Reference Genes for Quantitative Real-Time PCR in Songbirds
Zinzow-Kramer, Wendy M.; Horton, Brent M.; Maney, Donna L.
2014-01-01
Quantitative real-time PCR (qPCR) is becoming a popular tool for the quantification of gene expression in the brain and endocrine tissues of songbirds. Accurate analysis of qPCR data relies on the selection of appropriate reference genes for normalization, yet few papers on songbirds contain evidence of reference gene validation. Here, we evaluated the expression of ten potential reference genes (18S, ACTB, GAPDH, HMBS, HPRT, PPIA, RPL4, RPL32, TFRC, and UBC) in brain, pituitary, ovary, and testis in two species of songbird: zebra finch and white-throated sparrow. We used two algorithms, geNorm and NormFinder, to assess the stability of these reference genes in our samples. We found that the suitability of some of the most popular reference genes for target gene normalization in mammals, such as 18S, depended highly on tissue type. Thus, they are not the best choices for brain and gonad in these songbirds. In contrast, we identified alternative genes, such as HPRT, RPL4 and PPIA, that were highly stable in brain, pituitary, and gonad in these species. Our results suggest that the validation of reference genes in mammals does not necessarily extrapolate to other taxonomic groups. For researchers wishing to identify and evaluate suitable reference genes for qPCR songbirds, our results should serve as a starting point and should help increase the power and utility of songbird models in behavioral neuroendocrinology. PMID:24780145
Yang, Hongli; Liu, Jing; Huang, Shunmou; Guo, Tingting; Deng, Linbin; Hua, Wei
2014-03-15
Selection of reference genes in Brassica napus, a tetraploid (4×) species, is a very difficult task without information on genome and transcriptome. By now, only several traditional reference genes which show significant expression differentiation under different conditions are used in B. napus. In the present study, based on genome and transcriptome data of the rapeseed Zhongshuang-11 cultivar, 14 candidate reference genes were screened for investigation in different tissues, cultivars, and treated conditions of B. napus. These genes were as follows: ELF5, ENTH, F-BOX7, F-BOX2, FYPP1, GDI1, GYF, MCP2d, OTP80, PPR, SPOC, Unknown1, Unknown2 and UBA. Among them, excluding GYF and FYPP1, another 12 genes, were identified to perform better than traditional reference genes ACTIN7 and GAPDH. To further validate the accuracy of the newly developed reference genes in normalization, expression levels of BnCAT1 (B. napus catalase 1) in different rapeseed tissues and seedlings under stress conditions were normalized by the three most stable reference genes PPR, GDI1, and ENTH and little difference existed in normalization results. To the best of our knowledge, this is the first time B. napus reference genes have been provided with the help of complete genome and transcriptome information. The new reference genes provided in this study are more accurate than previously reported reference genes in quantifying expression levels of B. napus genes. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.
Chen, Weixin; Chen, Jianye; Lu, Wangjin; Chen, Lei; Fu, Danwen
2012-01-01
Real-time reverse transcription PCR (RT-qPCR) is a preferred method for rapid and accurate quantification of gene expression studies. Appropriate application of RT-qPCR requires accurate normalization though the use of reference genes. As no single reference gene is universally suitable for all experiments, thus reference gene(s) validation under different experimental conditions is crucial for RT-qPCR analysis. To date, only a few studies on reference genes have been done in other plants but none in papaya. In the present work, we selected 21 candidate reference genes, and evaluated their expression stability in 246 papaya fruit samples using three algorithms, geNorm, NormFinder and RefFinder. The samples consisted of 13 sets collected under different experimental conditions, including various tissues, different storage temperatures, different cultivars, developmental stages, postharvest ripening, modified atmosphere packaging, 1-methylcyclopropene (1-MCP) treatment, hot water treatment, biotic stress and hormone treatment. Our results demonstrated that expression stability varied greatly between reference genes and that different suitable reference gene(s) or combination of reference genes for normalization should be validated according to the experimental conditions. In general, the internal reference genes EIF (Eukaryotic initiation factor 4A), TBP1 (TATA binding protein 1) and TBP2 (TATA binding protein 2) genes had a good performance under most experimental conditions, whereas the most widely present used reference genes, ACTIN (Actin 2), 18S rRNA (18S ribosomal RNA) and GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) were not suitable in many experimental conditions. In addition, two commonly used programs, geNorm and Normfinder, were proved sufficient for the validation. This work provides the first systematic analysis for the selection of superior reference genes for accurate transcript normalization in papaya under different experimental conditions. PMID:22952972
Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping
2015-01-01
The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.
2013-01-01
Background Importance of hereditary factors in the etiology of Idiopathic Scoliosis is widely accepted. In clinical practice some of the IS patients present with positive familial history of the deformity and some do not. Traditionally about 90% of patients have been considered as sporadic cases without familial recurrence. However the exact proportion of Familial and Sporadic Idiopathic Scoliosis is still unknown. Housekeeping genes encode proteins that are usually essential for the maintenance of basic cellular functions. ACTB and GAPDH are two housekeeping genes encoding respectively a cytoskeletal protein β-actin, and glyceraldehyde-3-phosphate dehydrogenase, an enzyme of glycolysis. Although their expression levels can fluctuate between different tissues and persons, human housekeeping genes seem to exhibit a preserved tissue-wide expression ranking order. It was hypothesized that expression ranking order of two representative housekeeping genes ACTB and GAPDH might be disturbed in the tissues of patients with Familial Idiopathic Scoliosis (with positive family history of idiopathic scoliosis) opposed to the patients with no family members affected (Sporadic Idiopathic Scoliosis). An artificial neural network (ANN) was developed that could serve to differentiate between familial and sporadic cases of idiopathic scoliosis based on the expression levels of ACTB and GAPDH in different tissues of scoliotic patients. The aim of the study was to investigate whether the expression levels of ACTB and GAPDH in different tissues of idiopathic scoliosis patients could be used as a source of data for specially developed artificial neural network in order to predict the positive family history of index patient. Results The comparison of developed models showed, that the most satisfactory classification accuracy was achieved for ANN model with 18 nodes in the first hidden layer and 16 nodes in the second hidden layer. The classification accuracy for positive Idiopathic Scoliosis anamnesis only with the expression measurements of ACTB and GAPDH with the use of ANN based on 6-18-16-1 architecture was 8 of 9 (88%). Only in one case the prediction was ambiguous. Conclusions Specially designed artificial neural network model proved possible association between expression level of ACTB, GAPDH and positive familial history of Idiopathic Scoliosis. PMID:23289769
2013-01-01
Carbon nanotubes are capable of penetrating the cell membrane and are widely considered as potential carriers for gene or drug delivery. Because the C-C and C=C bonds in carbon nanotubes are nonpolar, functionalization is required for carbon nanotubes to interact with genes or drugs as well as to improve their biocompatibility. In this study, polyethylenimine (PEI)-functionalized single-wall (PEI-NH-SWNTs) and multiwall carbon nanotubes (PEI-NH-MWNTs) were produced by direct amination method. PEI functionalization increased the positive charge on the surface of SWNTs and MWNTs, allowing carbon nanotubes to interact electrostatically with the negatively charged small interfering RNAs (siRNAs) and to serve as nonviral gene delivery reagents. PEI-NH-MWNTs and PEI-NH-SWNTs had a better solubility in water than pristine carbon nanotubes, and further removal of large aggregates by centrifugation produced a stable suspension of reduced particle size and improved homogeneity and dispersity. The amount of grafted PEI estimated by thermogravimetric analysis was 5.08% (w/w) and 5.28% (w/w) for PEI-NH-SWNTs and PEI-NH-MWNTs, respectively. For the assessment of cytotoxicity, various concentrations of PEI-NH-SWNTs and PEI-NH-MWNTs were incubated with human cervical cancer cells, HeLa-S3, for 48 h. PEI-NH-SWNTs and PEI-NH-MWNTs induced cell deaths in a dose-dependent manner but were less cytotoxic compared to pure PEI. As determined by electrophoretic mobility shift assay, siRNAs directed against glyceraldehyde-3-phosphate dehydrogenase (siGAPDH) were completely associated with PEI-NH-SWNTs or PEI-NH-MWNTs at a PEI-NH-SWNT/siGAPDH or PEI-NH-MWNT/siGAPDH mass ratio of 80:1 or 160:1, respectively. Furthermore, PEI-NH-SWNTs and PEI-NH-MWNTs successfully delivered siGAPDH into HeLa-S3 cells at PEI-NH-SWNT/siGAPDH and PEI-NH-MWNT/siGAPDH mass ratios of 1:1 to 20:1, resulting in suppression of the mRNA level of GAPDH to an extent similar to that of DharmaFECT, a common transfection reagent for siRNAs. Our results indicate that the PEI-NH-SWNTs and PEI-NH-MWNTs produced in this study are capable of delivering siRNAs into HeLa-S3 cells to suppress gene expression and may therefore be considered as novel nonviral gene delivery reagents. PMID:23742156
Park, Sang-Je; Huh, Jae-Won; Kim, Young-Hyun; Lee, Sang-Rae; Kim, Sang-Hyun; Kim, Sun-Uk; Kim, Heui-Soo; Kim, Min Kyu; Chang, Kyu-Tae
2013-05-01
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a specific and sensitive technique for quantifying gene expression. To analyze qRT-PCR data accurately, suitable reference genes that show consistent expression patterns across different tissues and experimental conditions should be selected. The objective of this study was to obtain the most stable reference genes in dogs, using samples from 13 different brain tissues and 10 other organs. 16 well-known candidate reference genes were analyzed by the geNorm, NormFinder, and BestKeeper programs. Brain tissues were derived from several different anatomical regions, including the forebrain, cerebrum, diencephalon, hindbrain, and metencephalon, and grouped accordingly. Combination of the three different analyses clearly indicated that the ideal reference genes are ribosomal protien S5 (RPS5) in whole brain, RPL8 and RPS5 in whole body tissues, RPS5 and RPS19 in the forebrain and cerebrum, RPL32 and RPS19 in the diencephalon, GAPDH and RPS19 in the hindbrain, and MRPS7 and RPL13A in the metencephalon. These genes were identified as ideal for the normalization of qRT-PCR results in the respective tissues. These findings indicate more suitable and stable reference genes for future studies of canine gene expression.
Wang, Erlong; Wang, Kaiyu; Chen, Defang; Wang, Jun; He, Yang; Long, Bo; Yang, Lei; Yang, Qian; Geng, Yi; Huang, Xiaoli; Ouyang, Ping; Lai, Weimin
2015-01-01
qPCR as a powerful and attractive methodology has been widely applied to aquaculture researches for gene expression analyses. However, the suitable reference selection is critical for normalizing target genes expression in qPCR. In the present study, six commonly used endogenous controls were selected as candidate reference genes to evaluate and analyze their expression levels, stabilities and normalization to immune-related gene IgM expression during vaccination and infection in spleen of tilapia with RefFinder and GeNorm programs. The results showed that all of these candidate reference genes exhibited transcriptional variations to some extent at different periods. Among them, EF1A was the most stable reference with RefFinder, followed by 18S rRNA, ACTB, UBCE, TUBA and GAPDH respectively and the optimal number of reference genes for IgM normalization under different experiment sets was two with GeNorm. Meanwhile, combination the Cq (quantification cycle) value and the recommended comprehensive ranking of reference genes, EF1A and ACTB, the two optimal reference genes, were used together as reference genes for accurate analysis of immune-related gene expression during vaccination and infection in Nile tilapia with qPCR. Moreover, the highest IgM expression level was at two weeks post-vaccination when normalized to EF1A, 18S rRNA, ACTB, and EF1A together with ACTB compared to one week post-vaccination before normalizing, which was also consistent with the IgM antibody titers detection by ELISA. PMID:25941937
Zeng, Hongqiu; Xie, Yanwei; Liu, Guoyin; Lin, Daozhe; He, Chaozu; Shi, Haitao
2018-06-01
MeGAPCs were identified as negative regulators of plant disease resistance, and the interaction of MeGAPCs and MeATG8s was highlighted in plant defense response. As an important enzyme of glycolysis metabolic pathway, glyceraldehyde-3-P dehydrogenase (GAPDH) plays important roles in plant development, abiotic stress and immune responses. Cassava (Manihot esculenta) is most important tropical crop and one of the major food crops, however, no information is available about GAPDH gene family in cassava. In this study, 14 MeGAPDHs including 6 cytosol GAPDHs (MeGAPCs) were identified from cassava, and the transcripts of 14 MeGAPDHs in response to Xanthomonas axonopodis pv manihotis (Xam) indicated their possible involvement in immune responses. Further investigation showed that MeGAPCs are negative regulators of disease resistance against Xam. Through transient expression in Nicotiana benthamiana, we found that overexpression of MeGAPCs led to decreased disease resistance against Xam. On the contrary, MeGAPCs-silenced cassava plants through virus-induced gene silencing (VIGS) conferred improved disease resistance. Notably, MeGAPCs physically interacted with autophagy-related protein 8b (MeATG8b) and MeATG8e and inhibited autophagic activity. Moreover, MeATG8b and MeATG8e negatively regulated the activities of NAD-dependent MeGAPDHs, and are involved in MeGAPCs-mediated disease resistance. Taken together, this study highlights the involvement of MeGAPCs in plant disease resistance, through interacting with MeATG8b and MeATG8e.
Zhang, Kun; Niu, Shaofang; Di, Dianping; Shi, Lindan; Liu, Deshui; Cao, Xiuling; Miao, Hongqin; Wang, Xianbing; Han, Chenggui; Yu, Jialin; Li, Dawei; Zhang, Yongliang
2013-10-10
Both genome-wide transcriptomic surveys of the mRNA expression profiles and virus-induced gene silencing-based molecular studies of target gene during virus-plant interaction involve the precise estimation of the transcript abundance. Quantitative real-time PCR (qPCR) is the most widely adopted technique for mRNA quantification. In order to obtain reliable quantification of transcripts, identification of the best reference genes forms the basis of the preliminary work. Nevertheless, the stability of internal controls in virus-infected monocots needs to be fully explored. In this work, the suitability of ten housekeeping genes (ACT, EF1α, FBOX, GAPDH, GTPB, PP2A, SAND, TUBβ, UBC18 and UK) for potential use as reference genes in qPCR were investigated in five different monocot plants (Brachypodium, barley, sorghum, wheat and maize) under infection with different viruses including Barley stripe mosaic virus (BSMV), Brome mosaic virus (BMV), Rice black-streaked dwarf virus (RBSDV) and Sugarcane mosaic virus (SCMV). By using three different algorithms, the most appropriate reference genes or their combinations were identified for different experimental sets and their effectiveness for the normalisation of expression studies were further validated by quantitative analysis of a well-studied PR-1 gene. These results facilitate the selection of desirable reference genes for more accurate gene expression studies in virus-infected monocots. Copyright © 2013 Elsevier B.V. All rights reserved.
Huang, Yong; Chen, Yabing; Sun, Huan; Lan, Daoliang
2016-01-01
Intestinal epithelial cells, which serve as the first physical barrier to protect intestinal tract from external antigens, have an important role in the local innate immunity. Screening of reference genes that have stable expression levels after viral infection in porcine intestinal epithelial cells is critical for ensuring the reliability of the expression analysis on anti-infection genes in porcine intestinal epithelial cells. In this study, nine common reference genes in pigs, including ACTB, B2M, GAPDH, HMBS, SDHA, HPRT1, TBP, YWHAZ, and RPL32, were chosen as the candidate reference genes. Porcine sapelovirus (PSV) was used as a model virus to infect porcine intestinal epithelial cell line (IPEC-J2). The expression stability of the nine genes was assessed by the geNorm, NormFinder, and BestKeeper software. Moreover, RefFinder program was used to evaluate the analytical results of above three softwares, and a relative expression experiment of selected target gene was used to verify the analysis results. The comprehensive results indicated that the gene combination of TBP and RPL32 has the most stable expression, which could be considered as an appropriate reference gene for research on gene expression after PSV infection in IPEC-J2cells. The results provided essential data for expression analysis of anti-infection genes in porcine intestinal epithelial cells.
Pathan, Ejaj K; Ghormade, Vandana; Deshpande, Mukund V
2017-01-01
Benjaminiella poitrasii, a dimorphic non-pathogenic zygomycetous fungus, exhibits a morphological yeast (Y) to hypha (H) reversible transition in the vegetative phase, sporangiospores (S) in the asexual phase and zygospores (Z) in the sexual phase. To study the gene expression across these diverse morphological forms, suitable reference genes are required. In the present study, 13 genes viz. ACT, 18S rRNA, eEF1α, eEF-Tu,eIF-1A, Tub-α, Tub-b, Ubc, GAPDH, Try, WS-21, NADGDH and NADPGDH were evaluated for their potential as a reference, particularly for studying gene expression during the Y-H reversible transition and also for other asexual and sexual life stages of B. poitrasii. Analysis of RT-qPCR data using geNorm, normFinder and BestKeeper software revealed that genes such as Ubc, 18S rRNA and WS-21 were expressed at constant levels in each given subset of RNA samples from all the morphological phases of B. poitrasii. Therefore, these reference genes can be used to elucidate the role of morpho-genes in B. poitrasii. Further, use of the two most stably expressed genes (Ubc and WS-21) to normalize the expression of the ornithine decarboxylase gene (Bpodc) in different morphological forms of B. poitrasii, generated more reliable results, indicating that our selection of reference genes was appropriate.
Ma, Yue-Jiao; Sun, Xiao-Hong; Xu, Xiao-Yan; Zhao, Yong; Pan, Ying-Jie; Hwang, Cheng-An; Wu, Vivian C H
2015-01-01
Vibrio parahaemolyticus is a significant human pathogen capable of causing foodborne gastroenteritis associated with the consumption of contaminated raw or undercooked seafood. Quantitative RT-PCR (qRT-PCR) is a useful tool for studying gene expression in V. parahaemolyticus to characterize its virulence factors and understand the effect of environmental conditions on its pathogenicity. However, there is not a stable gene in V. parahaemolyticus that has been identified for use as a reference gene for qRT-PCR. This study evaluated the stability of 6 reference genes (16S rRNA, recA, rpoS, pvsA, pvuA, and gapdh) in 5 V. parahaemolyticus strains (O3:K6-clinical strain-tdh+, ATCC33846-tdh+, ATCC33847-tdh+, ATCC17802-trh+, and F13-environmental strain-tdh+) cultured at 4 different temperatures (15, 25, 37 and 42°C). Stability values were calculated using GeNorm, NormFinder, BestKeeper, and Delta CT algorithms. The results indicated that recA was the most stably expressed gene in the V. parahaemolyticus strains cultured at different temperatures. This study examined multiple V. parahaemolyticus strains and growth temperatures, hence the finding provided stronger evidence that recA can be used as a reference gene for gene expression studies in V. parahaemolyticus.
Mafra, Valéria; Kubo, Karen S.; Alves-Ferreira, Marcio; Ribeiro-Alves, Marcelo; Stuart, Rodrigo M.; Boava, Leonardo P.; Rodrigues, Carolina M.; Machado, Marcos A.
2012-01-01
Real-time reverse transcription PCR (RT-qPCR) has emerged as an accurate and widely used technique for expression profiling of selected genes. However, obtaining reliable measurements depends on the selection of appropriate reference genes for gene expression normalization. The aim of this work was to assess the expression stability of 15 candidate genes to determine which set of reference genes is best suited for transcript normalization in citrus in different tissues and organs and leaves challenged with five pathogens (Alternaria alternata, Phytophthora parasitica, Xylella fastidiosa and Candidatus Liberibacter asiaticus). We tested traditional genes used for transcript normalization in citrus and orthologs of Arabidopsis thaliana genes described as superior reference genes based on transcriptome data. geNorm and NormFinder algorithms were used to find the best reference genes to normalize all samples and conditions tested. Additionally, each biotic stress was individually analyzed by geNorm. In general, FBOX (encoding a member of the F-box family) and GAPC2 (GAPDH) was the most stable candidate gene set assessed under the different conditions and subsets tested, while CYP (cyclophilin), TUB (tubulin) and CtP (cathepsin) were the least stably expressed genes found. Validation of the best suitable reference genes for normalizing the expression level of the WRKY70 transcription factor in leaves infected with Candidatus Liberibacter asiaticus showed that arbitrary use of reference genes without previous testing could lead to misinterpretation of data. Our results revealed FBOX, SAND (a SAND family protein), GAPC2 and UPL7 (ubiquitin protein ligase 7) to be superior reference genes, and we recommend their use in studies of gene expression in citrus species and relatives. This work constitutes the first systematic analysis for the selection of superior reference genes for transcript normalization in different citrus organs and under biotic stress. PMID:22347455
Zeng, Shaohua; Liu, Yongliang; Wu, Min; Liu, Xiaomin; Shen, Xiaofei; Liu, Chunzhao; Wang, Ying
2014-01-01
Lycium barbarum and L. ruthenicum are extensively used as traditional Chinese medicinal plants. Next generation sequencing technology provides a powerful tool for analyzing transcriptomic profiles of gene expression in non-model species. Such gene expression can then be confirmed with quantitative real-time polymerase chain reaction (qRT-PCR). Therefore, use of systematically identified suitable reference genes is a prerequisite for obtaining reliable gene expression data. Here, we calculated the expression stability of 18 candidate reference genes across samples from different tissues and grown under salt stress using geNorm and NormFinder procedures. The geNorm-determined rank of reference genes was similar to those defined by NormFinder with some differences. Both procedures confirmed that the single most stable reference gene was ACNTIN1 for L. barbarum fruits, H2B1 for L. barbarum roots, and EF1α for L. ruthenicum fruits. PGK3, H2B2, and PGK3 were identified as the best stable reference genes for salt-treated L. ruthenicum leaves, roots, and stems, respectively. H2B1 and GAPDH1+PGK1 for L. ruthenicum and SAMDC2+H2B1 for L. barbarum were the best single and/or combined reference genes across all samples. Finally, expression of salt-responsive gene NAC, fruit ripening candidate gene LrPG, and anthocyanin genes were investigated to confirm the validity of the selected reference genes. Suitable reference genes identified in this study provide a foundation for accurately assessing gene expression and further better understanding of novel gene function to elucidate molecular mechanisms behind particular biological/physiological processes in Lycium.
Karuppaiya, Palaniyandi; Yan, Xiao-Xue; Liao, Wang; Wu, Jun; Chen, Fang; Tang, Lin
2017-01-01
Physic nut (Jatropha curcas L) seed oil is a natural resource for the alternative production of fossil fuel. Seed oil production is mainly depended on seed yield, which was restricted by the low ratio of staminate flowers to pistillate flowers. Further, the mechanism of physic nut flower sex differentiation has not been fully understood yet. Quantitative Real Time-Polymerase Chain Reaction is a reliable and widely used technique to quantify the gene expression pattern in biological samples. However, for accuracy of qRT-PCR, appropriate reference gene is highly desirable to quantify the target gene level. Hence, the present study was aimed to identify the stable reference genes in staminate and pistillate flowers of J. curcas. In this study, 10 candidate reference genes were selected and evaluated for their expression stability in staminate and pistillate flowers, and their stability was validated by five different algorithms (ΔCt, BestKeeper, NormFinder, GeNorm and RefFinder). Resulting, TUB and EF found to be the two most stably expressed reference for staminate flower; while GAPDH1 and EF found to be the most stably expressed reference gene for pistillate flowers. Finally, RT-qPCR assays of target gene AGAMOUS using the identified most stable reference genes confirmed the reliability of selected reference genes in different stages of flower development. AGAMOUS gene expression levels at different stages were further proved by gene copy number analysis. Therefore, the present study provides guidance for selecting appropriate reference genes for analyzing the expression pattern of floral developmental genes in staminate and pistillate flowers of J. curcas.
Karuppaiya, Palaniyandi; Yan, Xiao-Xue; Liao, Wang; Chen, Fang; Tang, Lin
2017-01-01
Physic nut (Jatropha curcas L) seed oil is a natural resource for the alternative production of fossil fuel. Seed oil production is mainly depended on seed yield, which was restricted by the low ratio of staminate flowers to pistillate flowers. Further, the mechanism of physic nut flower sex differentiation has not been fully understood yet. Quantitative Real Time—Polymerase Chain Reaction is a reliable and widely used technique to quantify the gene expression pattern in biological samples. However, for accuracy of qRT-PCR, appropriate reference gene is highly desirable to quantify the target gene level. Hence, the present study was aimed to identify the stable reference genes in staminate and pistillate flowers of J. curcas. In this study, 10 candidate reference genes were selected and evaluated for their expression stability in staminate and pistillate flowers, and their stability was validated by five different algorithms (ΔCt, BestKeeper, NormFinder, GeNorm and RefFinder). Resulting, TUB and EF found to be the two most stably expressed reference for staminate flower; while GAPDH1 and EF found to be the most stably expressed reference gene for pistillate flowers. Finally, RT-qPCR assays of target gene AGAMOUS using the identified most stable reference genes confirmed the reliability of selected reference genes in different stages of flower development. AGAMOUS gene expression levels at different stages were further proved by gene copy number analysis. Therefore, the present study provides guidance for selecting appropriate reference genes for analyzing the expression pattern of floral developmental genes in staminate and pistillate flowers of J. curcas. PMID:28234941
Wu, Jianyang; Zhang, Hongna; Liu, Liqin; Li, Weicai; Wei, Yongzan; Shi, Shengyou
2016-01-01
Reverse transcription quantitative PCR (RT-qPCR) as the accurate and sensitive method is use for gene expression analysis, but the veracity and reliability result depends on whether select appropriate reference gene or not. To date, several reliable reference gene validations have been reported in fruits trees, but none have been done on preharvest and postharvest longan fruits. In this study, 12 candidate reference genes, namely, CYP, RPL, GAPDH, TUA, TUB, Fe-SOD, Mn-SOD, Cu/Zn-SOD, 18SrRNA, Actin, Histone H3, and EF-1a, were selected. Expression stability of these genes in 150 longan samples was evaluated and analyzed using geNorm and NormFinder algorithms. Preharvest samples consisted of seven experimental sets, including different developmental stages, organs, hormone stimuli (NAA, 2,4-D, and ethephon) and abiotic stresses (bagging and girdling with defoliation). Postharvest samples consisted of different temperature treatments (4 and 22°C) and varieties. Our findings indicate that appropriate reference gene(s) should be picked for each experimental condition. Our data further showed that the commonly used reference gene Actin does not exhibit stable expression across experimental conditions in longan. Expression levels of the DlACO gene, which is a key gene involved in regulating fruit abscission under girdling with defoliation treatment, was evaluated to validate our findings. In conclusion, our data provide a useful framework for choice of suitable reference genes across different experimental conditions for RT-qPCR analysis of preharvest and postharvest longan fruits. PMID:27375640
2013-01-01
Background Apomixis is a naturally occurring asexual mode of seed reproduction resulting in offspring genetically identical to the maternal plant. Identifying differential gene expression patterns between apomictic and sexual plants is valuable to help deconstruct the trait. Quantitative RT-PCR (qRT-PCR) is a popular method for analyzing gene expression. Normalizing gene expression data using proper reference genes which show stable expression under investigated conditions is critical in qRT-PCR analysis. We used qRT-PCR to validate expression and stability of six potential reference genes (EF1alpha, EIF4A, UBCE, GAPDH, ACT2 and TUBA) in vegetative and reproductive tissues of B-2S and B-12-9 accessions of C. ciliaris. Findings Among tissue types evaluated, EF1alpha showed the highest level of expression while TUBA showed the lowest. When all tissue types were evaluated and compared between genotypes, EIF4A was the most stable reference gene. Gene expression stability for specific ovary stages of B-2S and B-12-9 was also determined. Except for TUBA, all other tested reference genes could be used for any stage-specific ovary tissue normalization, irrespective of the mode of reproduction. Conclusion Our gene expression stability assay using six reference genes, in sexual and apomictic accessions of C. ciliaris, suggests that EIF4A is the most stable gene across all tissue types analyzed. All other tested reference genes, with the exception of TUBA, could be used for gene expression comparison studies between sexual and apomictic ovaries over multiple developmental stages. This reference gene validation data in C. ciliaris will serve as an important base for future apomixis-related transcriptome data validation. PMID:24083672
Wang, Kaicheng; Lu, Chengping
2007-01-01
A total of 36 streptococcal strains, including seven S. equi ssp.zooepidemicus, two S. suis type 1 (SS1), 24 SS2, two SS9, and one SS7, were tested for glyceraldehyde-3-phosphate dehydrogenase gene (gapdh). Except from non-virulent SS2 strain T1 5, all strains harboured gapdh. The gapdh of Chinese Sichuan SS2 isolate ZY05719 and Jiangsu SS2 isolate HA9801 were sequenced and then compared with published sequences in the GenBank. The comparison revealed a 99.9 % and 99.8 % similarity of ZY05719 and HA9801, respectively, with the published sequence. Adherence assay data demonstrated a significant ((p<0.05)) reduction in adhesion of SS2 in HEp-2 cells pre-incubated with purified GAPDH compared to non pre-incubated controls, suggesting the GAPDH mediates SS2 bacterial adhesion to host cells.
NASA Technical Reports Server (NTRS)
Evans, G. L.; Morey-Holton, E.; Turner, R. T.
1998-01-01
In the present study, we evaluated the possibility that the abnormal bone matrix produced during spaceflight may be associated with reduced expression of bone matrix protein genes. To test this possibility, we investigated the effects of a 14-day spaceflight (SLS-2 experiment) on steady-state mRNA levels for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), osteocalcin, osteonectin, and prepro-alpha(1) subunit of type I collagen in the major bone compartments of rat femur. There were pronounced site-specific differences in the steady-state levels of expression of the mRNAs for the three bone matrix proteins and GAPDH in normal weight-bearing rats, and these relationships were altered after spaceflight. Specifically, spaceflight resulted in decreases in mRNA levels for GAPDH (decreased in proximal metaphysis), osteocalcin (decreased in proximal metaphysis), osteonectin (decreased in proximal and distal metaphysis), and collagen (decreased in proximal and distal metaphysis) compared with ground controls. There were no changes in mRNA levels for matrix proteins or GAPDH in the shaft and distal epiphysis. These results demonstrate that spaceflight leads to site- and gene-specific decreases in mRNA levels for bone matrix proteins. These findings are consistent with the hypothesis that spaceflight-induced decreases in bone formation are caused by concomitant decreases in expression of genes for bone matrix proteins.
Liu, Jing; Wang, Qun; Sun, Minying; Zhu, Linlin; Yang, Michael; Zhao, Yu
2014-01-01
Quantitative real-time reverse transcription PCR (qRT-PCR) has become a widely used method for gene expression analysis; however, its data interpretation largely depends on the stability of reference genes. The transcriptomics of Panax ginseng, one of the most popular and traditional ingredients used in Chinese medicines, is increasingly being studied. Furthermore, it is vital to establish a series of reliable reference genes when qRT-PCR is used to assess the gene expression profile of ginseng. In this study, we screened out candidate reference genes for ginseng using gene expression data generated by a high-throughput sequencing platform. Based on the statistical tests, 20 reference genes (10 traditional housekeeping genes and 10 novel genes) were selected. These genes were tested for the normalization of expression levels in five growth stages and three distinct plant organs of ginseng by qPCR. These genes were subsequently ranked and compared according to the stability of their expressions using geNorm, NormFinder, and BestKeeper computational programs. Although the best reference genes were found to vary across different samples, CYP and EF-1α were the most stable genes amongst all samples. GAPDH/30S RPS20, CYP/60S RPL13 and CYP/QCR were the optimum pair of reference genes in the roots, stems, and leaves. CYP/60S RPL13, CYP/eIF-5A, aTUB/V-ATP, eIF-5A/SAR1, and aTUB/pol IIa were the most stably expressed combinations in each of the five developmental stages. Our study serves as a foundation for developing an accurate method of qRT-PCR and will benefit future studies on gene expression profiles of Panax Ginseng.
Cloning, expression and characterization of a mucin-binding GAPDH from Lactobacillus acidophilus.
Patel, Dhaval K; Shah, Kunal R; Pappachan, Anju; Gupta, Sarita; Singh, Desh Deepak
2016-10-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a ubiquitous enzyme involved in glycolysis. It is also referred to as a moonlighting protein as it has many diverse functions like regulation of apoptosis, iron homeostasis, cell-matrix interactions, adherence to human colon etc. apart from its principal role in glycolysis. Lactobacilli are lactic acid bacteria which colonize the human gut and confer various health benefits to humans. In the present study, we have cloned, expressed and purified the GAPDH from Lactobacillus acidophilus to get a recombinant product (r-LaGAPDH) and characterized it. Size exclusion chromatography shows that r-LaGAPDH exists as a tetramer in solution and have a mucin binding and hemagglutination activity indicating carbohydrate like binding adhesion mechanism. Fluorescence spectroscopy studies showed an interaction of r-LaGAPDH with mannose, galactose, N-acetylgalactosamine and N-acetylglucosamine with a Kd of 3.6±0.7×10(-3)M, 4.34±0.09×10(-3)M, 4±0.87×10(-3)M and 3.7±0.28×10(-3)M respectively. We hope that this preliminary data will generate more interest in further elucidation of the roles of GAPDH in the adhesion processes of the bacteria. Copyright © 2016 Elsevier B.V. All rights reserved.
Dai, Tian-Mei; Lü, Zhi-Chuang; Liu, Wan-Xue; Wan, Fang-Hao
2017-01-01
The Bemisia tabaci Mediterranean (MED) cryptic species has been rapidly invading to most parts of the world owing to its strong ecological adaptability, which is considered as a model insect for stress tolerance studies under rapidly changing environments. Selection of a suitable reference gene for quantitative stress-responsive gene expression analysis based on qRT-PCR is critical for elaborating the molecular mechanisms of thermotolerance. To obtain accurate and reliable normalization data in MED, eight candidate reference genes (β-act, GAPDH, β-tub, EF1-α, GST, 18S, RPL13A and α-tub) were examined under various thermal stresses for varied time periods by using geNorm, NormFinder and BestKeeper algorithms, respectively. Our results revealed that β-tub and EF1-α were the best reference genes across all sample sets. On the other hand, 18S and GADPH showed the least stability for all the samples studied. β-act was proved to be highly stable only in case of short-term thermal stresses. To our knowledge this was the first comprehensive report on validation of reference genes under varying temperature stresses in MED. The study could expedite particular discovery of thermotolerance genes in MED. Further, the present results can form the basis of further research on suitable reference genes in this invasive insect and will facilitate transcript profiling in other invasive insects.
López-Landavery, Edgar A; Portillo-López, Amelia; Gallardo-Escárate, Cristian; Del Río-Portilla, Miguel A
2014-10-10
The red abalone Haliotis rufescens is one of the most important species for aquaculture in Baja California, México, and despite this, few gene expression studies have been done in tissues such as gill, head and gonad. For this purpose, reverse transcription and quantitative real time PCR (RT-qPCR) is a powerful tool for gene expression evaluation. For a reliable analysis, however, it is necessary to select and validate housekeeping genes that allow proper transcription quantification. Stability of nine housekeeping genes (ACTB, BGLU, TUBB, CY, GAPDH, HPRTI, RPL5, SDHA and UBC) was evaluated in different tissues of red abalone (gill, head and gonad/digestive gland). Four-fold serial dilutions of cDNA (from 25 ngμL(-1) to 0.39 ngμL(-1)) were used to prepare the standard curve, and it showed gene efficiencies between 0.95 and 0.99, with R(2)=0.99. geNorm and NormFinder analysis showed that RPL5 and CY were the most stable genes considering all tissues, whereas in gill HPRTI and BGLU were most stable. In gonad/digestive gland, RPL5 and TUBB were the most stable genes with geNorm, while SDHA and HPRTI were the best using NormFinder. Similarly, in head the best genes were RPL5 and UBC with geNorm, and GAPDH and CY with NormFinder. The technical variability analysis with RPL5 and abalone gonad/digestive gland tissue indicated a high repeatability with a variation coefficient within groups ≤ 0.56% and between groups ≤ 1.89%. These results will help us for further research in reproduction, thermoregulation and endocrinology in red abalone. Copyright © 2014 Elsevier B.V. All rights reserved.
Koloušková, Pavla; Stone, James D.
2017-01-01
Accurate gene expression measurements are essential in studies of both crop and wild plants. Reverse transcription quantitative real-time PCR (RT-qPCR) has become a preferred tool for gene expression estimation. A selection of suitable reference genes for the normalization of transcript levels is an essential prerequisite of accurate RT-qPCR results. We evaluated the expression stability of eight candidate reference genes across roots, leaves, flower buds and pollen of Silene vulgaris (bladder campion), a model plant for the study of gynodioecy. As random priming of cDNA is recommended for the study of organellar transcripts and poly(A) selection is indicated for nuclear transcripts, we estimated gene expression with both random-primed and oligo(dT)-primed cDNA. Accordingly, we determined reference genes that perform well with oligo(dT)- and random-primed cDNA, making it possible to estimate levels of nucleus-derived transcripts in the same cDNA samples as used for organellar transcripts, a key benefit in studies of cyto-nuclear interactions. Gene expression variance was estimated by RefFinder, which integrates four different analytical tools. The SvACT and SvGAPDH genes were the most stable candidates across various organs of S. vulgaris, regardless of whether pollen was included or not. PMID:28817728
Durrenberger, Pascal F; Fernando, Francisca S; Magliozzi, Roberta; Kashefi, Samira N; Bonnert, Timothy P; Ferrer, Isidro; Seilhean, Danielle; Nait-Oumesmar, Brahim; Schmitt, Andrea; Gebicke-Haerter, Peter J; Falkai, Peter; Grünblatt, Edna; Palkovits, Miklos; Parchi, Piero; Capellari, Sabina; Arzberger, Thomas; Kretzschmar, Hans; Roncaroli, Federico; Dexter, David T; Reynolds, Richard
2012-12-01
The use of an appropriate reference gene to ensure accurate normalisation is crucial for the correct quantification of gene expression using qPCR assays and RNA arrays. The main criterion for a gene to qualify as a reference gene is a stable expression across various cell types and experimental settings. Several reference genes are commonly in use but more and more evidence reveals variations in their expression due to the presence of on-going neuropathological disease processes, raising doubts concerning their use. We conducted an analysis of genome-wide changes of gene expression in the human central nervous system (CNS) covering several neurological disorders and regions, including the spinal cord, and were able to identify a number of novel stable reference genes. We tested the stability of expression of eight novel (ATP5E, AARS, GAPVD1, CSNK2B, XPNPEP1, OSBP, NAT5 and DCTN2) and four more commonly used (BECN1, GAPDH, QARS and TUBB) reference genes in a smaller cohort using RT-qPCR. The most stable genes out of the 12 reference genes were tested as normaliser to validate increased levels of a target gene in CNS disease. We found that in human post-mortem tissue the novel reference genes, XPNPEP1 and AARS, were efficient in replicating microarray target gene expression levels and that XPNPEP1 was more efficient as a normaliser than BECN1, which has been shown to change in expression as a consequence of neuronal cell loss. We provide herein one more suitable novel reference gene, XPNPEP1, with no current neuroinflammatory or neurodegenerative associations that can be used for gene quantitative gene expression studies with human CNS post-mortem tissue and also suggest a list of potential other candidates. These data also emphasise the importance of organ/tissue-specific stably expressed genes as reference genes for RNA studies.
Sood, Tanushri Jerath; Lagah, Swati Viviyan; Sharma, Ankita; Singla, Suresh Kumar; Mukesh, Manishi; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat
2017-10-01
We evaluated the suitability of 10 candidate internal control genes (ICGs), belonging to different functional classes, namely ACTB, EEF1A1, GAPDH, HPRT1, HMBS, RPS15, RPS18, RPS23, SDHA, and UBC for normalizing the real-time quantitative polymerase chain reaction (qPCR) data of blastocyst-stage buffalo embryos produced by hand-made cloning and in vitro fertilization (IVF). Total RNA was isolated from three pools, each of cloned and IVF blastocysts (n = 50/pool) for cDNA synthesis. Two different statistical algorithms geNorm and NormFinder were used for evaluating the stability of these genes. Based on gene stability measure (M value) and pairwise variation (V value), calculated by geNorm analysis, the most stable ICGs were RPS15, HPRT1, and ACTB for cloned blastocysts, HMBS, UBC, and HPRT1 for IVF blastocysts and RPS15, GAPDH, and HPRT1 for both the embryo types analyzed together. RPS18 was the least stable gene for both cloned and IVF blastocysts. Following NormFinder analysis, the order of stability was RPS15 = HPRT1>GAPDH for cloned blastocysts, HMBS = UBC>RPS23 for IVF blastocysts, and HPRT1>GAPDH>RPS15 for cloned and IVF blastocysts together. These results suggest that despite overlapping of the three most stable ICGs between cloned and IVF blastocysts, the panel of ICGs selected for normalization of qPCR data of cloned and IVF blastocyst-stage embryos should be different.
Role of SRC-3delta4 in the Progression and Metastasis of Castration-Resistant Prostate Cancer
2013-10-01
Expression of SRC-3∆4, GAPDH, and AR target genes including PSA, KLK2, IGFBP5, Cyclin A2, and UBE2C was determined by RT-qPCR analysis . Data are...Expression of AR (B), GAPDH, and TMPRSS2- ERG (C) was determined by RT-qPCR analysis . Data are presented using the comparative Ct method, in which GAPDH...input. An irrelevant region (1800 bp downstream of transcription start site) was served as a negative control. (E) and (F). ChIP analysis of SRC-3∆4’s
Thiel, Cora S; Huge, Andreas; Hauschild, Swantje; Tauber, Svantje; Lauber, Beatrice A; Polzer, Jennifer; Paulsen, Katrin; Lier, Hartwin; Engelmann, Frank; Schmitz, Burkhard; Schütte, Andreas; Layer, Liliana E; Ullrich, Oliver
2017-01-01
In the last decades, a plethora of in vitro studies with living human cells contributed a vast amount of knowledge about cellular and molecular effects of microgravity. Previous studies focused mostly on the identification of gravity-responsive genes, whereas a multi-platform analysis at an integrative level, which specifically evaluates the extent and robustness of transcriptional response to an altered gravity environment was not performed so far. Therefore, we investigated the stability of gene expression response in non-activated human Jurkat T lymphocytic cells in different gravity environments through the combination of parabolic flights with a suborbital ballistic rocket and 2D clinostat and centrifuge experiments, using strict controls for excluding all possible other factors of influence. We revealed an overall high stability of gene expression in microgravity and identified olfactory gene expression in the chromosomal region 11p15.4 as particularly robust to altered gravity. We identified that classical reference genes ABCA5 , GAPDH , HPRT1 , PLA2G4A , and RPL13A were stably expressed in all tested gravity conditions and platforms, while ABCA5 and GAPDH were also known to be stably expressed in U937 cells in all gravity conditions. In summary, 10-20% of all transcripts remained totally unchanged in any gravitational environment tested (between 10 -4 and 9 g), 20-40% remained unchanged in microgravity (between 10 -4 and 10 -2 g) and 97-99% were not significantly altered in microgravity if strict exclusion criteria were applied. Therefore, we suppose a high stability of gene expression in microgravity. Comparison with other stressors suggests that microgravity alters gene expression homeostasis not stronger than other environmental factors.
Demidenko, Natalia V.; Logacheva, Maria D.; Penin, Aleksey A.
2011-01-01
Quantitative reverse transcription PCR (qRT-PCR) is one of the most precise and widely used methods of gene expression analysis. A necessary prerequisite of exact and reliable data is the accurate choice of reference genes. We studied the expression stability of potential reference genes in common buckwheat (Fagopyrum esculentum) in order to find the optimal reference for gene expression analysis in this economically important crop. Recently sequenced buckwheat floral transcriptome was used as source of sequence information. Expression stability of eight candidate reference genes was assessed in different plant structures (leaves and inflorescences at two stages of development and fruits). These genes are the orthologs of Arabidopsis genes identified as stable in a genome-wide survey gene of expression stability and a traditionally used housekeeping gene GAPDH. Three software applications – geNorm, NormFinder and BestKeeper - were used to estimate expression stability and provided congruent results. The orthologs of AT4G33380 (expressed protein of unknown function, Expressed1), AT2G28390 (SAND family protein, SAND) and AT5G46630 (clathrin adapter complex subunit family protein, CACS) are revealed as the most stable. We recommend using the combination of Expressed1, SAND and CACS for the normalization of gene expression data in studies on buckwheat using qRT-PCR. These genes are listed among five the most stably expressed in Arabidopsis that emphasizes utility of the studies on model plants as a framework for other species. PMID:21589908
da Costa, Andréa Pereira; Costa, Francisco Borges; Soares, Herbert Sousa; Ramirez, Diego Garcia; Mesquita, Eric Takashi Kamakura de Carvalho; Gennari, Solange Maria; Marcili, Arlei
2015-11-01
Trypanosoma and Leishmania are obligate parasites that cause important diseases in human and domestic animals. Wild mammals are the natural reservoirs of these parasites, which are transmitted by hematophagous arthropods. The present study aimed to detect the natural occurrence of trypanosomatids through serological diagnosis, PCR of whole blood and blood culture (hemoculture), and phylogenetic relationships using small subunit ribosomal DNA (SSU rDNA), cytochrome b, and glycosomal glyceraldehyde 3-phosphate dehydrogenase (gGAPDH) genes. Samples from 131 wild animals, including rodents, marsupials, and bats, were sampled in six areas in the state of Maranhão, in a transition zone of semiarid climates northeast of the equatorial humid Amazon. Serological analysis for Leishmania (Leishmania) infantum chagasi was performed in opossums by indirect fluorescent antibody test (IFAT), and all animals were serologically negative. Nine positive hemocultures (6.77%) were isolated and cryopreserved and from mammals of the Didelphimorphia and Chiroptera orders and positioned in phylogenies on the basis of sequences from different genes with reference strains of Trypanosoma cruzi marinkellei and T. cruzi. From primary samples (blood and tissues) only one bat, Pteronotus parnellii, was positive to SSU rDNA and gGAPDH genes and grouped with the L. infantum chagasi branch. The studies conducted in Maranhão State provide knowledge of parasite diversity. It is important to determine the presence of trypanosomatids in wild mammals with synanthropic habits.
Moazzam Jazi, Maryam; Ghadirzadeh Khorzoghi, Effat; Botanga, Christopher; Seyedi, Seyed Mahdi
2016-01-01
The tree species, Pistacia vera (P. vera) is an important commercial product that is salt-tolerant and long-lived, with a possible lifespan of over one thousand years. Gene expression analysis is an efficient method to explore the possible regulatory mechanisms underlying these characteristics. Therefore, having the most suitable set of reference genes is required for transcript level normalization under different conditions in P. vera. In the present study, we selected eight widely used reference genes, ACT, EF1α, α-TUB, β-TUB, GAPDH, CYP2, UBQ10, and 18S rRNA. Using qRT-PCR their expression was assessed in 54 different samples of three cultivars of P. vera. The samples were collected from different organs under various abiotic treatments (cold, drought, and salt) across three time points. Several statistical programs (geNorm, NormFinder, and BestKeeper) were applied to estimate the expression stability of candidate reference genes. Results obtained from the statistical analysis were then exposed to Rank aggregation package to generate a consensus gene rank. Based on our results, EF1α was found to be the superior reference gene in all samples under all abiotic treatments. In addition to EF1α, ACT and β-TUB were the second best reference genes for gene expression analysis in leaf and root. We recommended β-TUB as the second most stable gene for samples under the cold and drought treatments, while ACT holds the same position in samples analyzed under salt treatment. This report will benefit future research on the expression profiling of P. vera and other members of the Anacardiaceae family. PMID:27308855
Moazzam Jazi, Maryam; Ghadirzadeh Khorzoghi, Effat; Botanga, Christopher; Seyedi, Seyed Mahdi
2016-01-01
The tree species, Pistacia vera (P. vera) is an important commercial product that is salt-tolerant and long-lived, with a possible lifespan of over one thousand years. Gene expression analysis is an efficient method to explore the possible regulatory mechanisms underlying these characteristics. Therefore, having the most suitable set of reference genes is required for transcript level normalization under different conditions in P. vera. In the present study, we selected eight widely used reference genes, ACT, EF1α, α-TUB, β-TUB, GAPDH, CYP2, UBQ10, and 18S rRNA. Using qRT-PCR their expression was assessed in 54 different samples of three cultivars of P. vera. The samples were collected from different organs under various abiotic treatments (cold, drought, and salt) across three time points. Several statistical programs (geNorm, NormFinder, and BestKeeper) were applied to estimate the expression stability of candidate reference genes. Results obtained from the statistical analysis were then exposed to Rank aggregation package to generate a consensus gene rank. Based on our results, EF1α was found to be the superior reference gene in all samples under all abiotic treatments. In addition to EF1α, ACT and β-TUB were the second best reference genes for gene expression analysis in leaf and root. We recommended β-TUB as the second most stable gene for samples under the cold and drought treatments, while ACT holds the same position in samples analyzed under salt treatment. This report will benefit future research on the expression profiling of P. vera and other members of the Anacardiaceae family.
Validation of endogenous internal real-time PCR controls in renal tissues.
Cui, Xiangqin; Zhou, Juling; Qiu, Jing; Johnson, Martin R; Mrug, Michal
2009-01-01
Endogenous internal controls ('reference' or 'housekeeping' genes) are widely used in real-time PCR (RT-PCR) analyses. Their use relies on the premise of consistently stable expression across studied experimental conditions. Unfortunately, none of these controls fulfills this premise across a wide range of experimental conditions; consequently, none of them can be recommended for universal use. To determine which endogenous RT-PCR controls are suitable for analyses of renal tissues altered by kidney disease, we studied the expression of 16 commonly used 'reference genes' in 7 mildly and 7 severely affected whole kidney tissues from a well-characterized cystic kidney disease model. Expression levels of these 16 genes, determined by TaqMan RT-PCR analyses and Affymetrix GeneChip arrays, were normalized and tested for overall variance and equivalence of the means. Both statistical approaches and both TaqMan- and GeneChip-based methods converged on 3 out of the 4 top-ranked genes (Ppia, Gapdh and Pgk1) that had the most constant expression levels across the studied phenotypes. A combination of the top-ranked genes will provide a suitable endogenous internal control for similar studies of kidney tissues across a wide range of disease severity. Copyright 2009 S. Karger AG, Basel.
Galli, Vanessa; Borowski, Joyce Moura; Perin, Ellen Cristina; Messias, Rafael da Silva; Labonde, Julia; Pereira, Ivan dos Santos; Silva, Sérgio Delmar Dos Anjos; Rombaldi, Cesar Valmor
2015-01-10
The increasing demand of strawberry (Fragaria×ananassa Duch) fruits is associated mainly with their sensorial characteristics and the content of antioxidant compounds. Nevertheless, the strawberry production has been hampered due to its sensitivity to abiotic stresses. Therefore, to understand the molecular mechanisms highlighting stress response is of great importance to enable genetic engineering approaches aiming to improve strawberry tolerance. However, the study of expression of genes in strawberry requires the use of suitable reference genes. In the present study, seven traditional and novel candidate reference genes were evaluated for transcript normalization in fruits of ten strawberry cultivars and two abiotic stresses, using RefFinder, which integrates the four major currently available software programs: geNorm, NormFinder, BestKeeper and the comparative delta-Ct method. The results indicate that the expression stability is dependent on the experimental conditions. The candidate reference gene DBP (DNA binding protein) was considered the most suitable to normalize expression data in samples of strawberry cultivars and under drought stress condition, and the candidate reference gene HISTH4 (histone H4) was the most stable under osmotic stresses and salt stress. The traditional genes GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and 18S (18S ribosomal RNA) were considered the most unstable genes in all conditions. The expression of phenylalanine ammonia lyase (PAL) and 9-cis epoxycarotenoid dioxygenase (NCED1) genes were used to further confirm the validated candidate reference genes, showing that the use of an inappropriate reference gene may induce erroneous results. This study is the first survey on the stability of reference genes in strawberry cultivars and osmotic stresses and provides guidelines to obtain more accurate RT-qPCR results for future breeding efforts. Copyright © 2014 Elsevier B.V. All rights reserved.
Silver, Nicholas; Cotroneo, Emanuele; Proctor, Gordon; Osailan, Samira; Paterson, Katherine L; Carpenter, Guy H
2008-01-01
Background Real-time PCR is a reliable tool with which to measure mRNA transcripts, and provides valuable information on gene expression profiles. Endogenous controls such as housekeeping genes are used to normalise mRNA levels between samples for sensitive comparisons of mRNA transcription. Selection of the most stable control gene(s) is therefore critical for the reliable interpretation of gene expression data. For the purpose of this study, 7 commonly used housekeeping genes were investigated in salivary submandibular glands under normal, inflamed, atrophic and regenerative states. Results The program NormFinder identified the suitability of HPRT to use as a single gene for normalisation within the normal, inflamed and regenerative states, and GAPDH in the atrophic state. For normalisation to multiple housekeeping genes, for each individual state, the optimal number of housekeeping genes as given by geNorm was: ACTB/UBC in the normal, ACTB/YWHAZ in the inflamed, ACTB/HPRT in the atrophic and ACTB/GAPDH in the regenerative state. The most stable housekeeping gene identified between states (compared to normal) was UBC. However, ACTB, identified as one of the most stably expressed genes within states, was found to be one of the most variable between states. Furthermore we demonstrated that normalising between states to ACTB, rather than UBC, introduced an approximately 3 fold magnitude of error. Conclusion Using NormFinder, our studies demonstrated the suitability of HPRT to use as a single gene for normalisation within the normal, inflamed and regenerative groups and GAPDH in the atrophic group. However, if normalising to multiple housekeeping genes, we recommend normalising to those identified by geNorm. For normalisation across the physiological states, we recommend the use of UBC. PMID:18637167
Leal, Mariana Ferreira; Astur, Diego Costa; Debieux, Pedro; Arliani, Gustavo Gonçalves; Silveira Franciozi, Carlos Eduardo; Loyola, Leonor Casilla; Andreoli, Carlos Vicente; Smith, Marília Cardoso; Pochini, Alberto de Castro; Ejnisman, Benno; Cohen, Moises
2015-01-01
The anterior cruciate ligament (ACL) is one of the most frequently injured structures during high-impact sporting activities. Gene expression analysis may be a useful tool for understanding ACL tears and healing failure. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) has emerged as an effective method for such studies. However, this technique requires the use of suitable reference genes for data normalization. Here, we evaluated the suitability of six reference genes (18S, ACTB, B2M, GAPDH, HPRT1, and TBP) by using ACL samples of 39 individuals with ACL tears (20 with isolated ACL tears and 19 with ACL tear and combined meniscal injury) and of 13 controls. The stability of the candidate reference genes was determined by using the NormFinder, geNorm, BestKeeper DataAssist, and RefFinder software packages and the comparative ΔCt method. ACTB was the best single reference gene and ACTB+TBP was the best gene pair. The GenEx software showed that the accumulated standard deviation is reduced when a larger number of reference genes is used for gene expression normalization. However, the use of a single reference gene may not be suitable. To identify the optimal combination of reference genes, we evaluated the expression of FN1 and PLOD1. We observed that at least 3 reference genes should be used. ACTB+HPRT1+18S is the best trio for the analyses involving isolated ACL tears and controls. Conversely, ACTB+TBP+18S is the best trio for the analyses involving (1) injured ACL tears and controls, and (2) ACL tears of patients with meniscal tears and controls. Therefore, if the gene expression study aims to compare non-injured ACL, isolated ACL tears and ACL tears from patients with meniscal tear as three independent groups ACTB+TBP+18S+HPRT1 should be used. In conclusion, 3 or more genes should be used as reference genes for analysis of ACL samples of individuals with and without ACL tears.
Etich, Julia; Bergmeier, Vera; Pitzler, Lena; Brachvogel, Bent
2017-03-01
Wound healing is a coordinated process to restore tissue homeostasis and reestablish the protective barrier of the skin. miRNAs may modulate the expression of target genes to contribute to repair processes, but due to the complexity of the tissue it is challenging to quantify gene expression during the distinct phases of wound repair. Here, we aimed to identify a common reference gene to quantify changes in miRNA and mRNA expression during skin wound healing. Quantitative real-time PCR and bioinformatic analysis tools were used to identify suitable reference genes during skin repair and their reliability was tested by studying the expression of mRNAs and miRNAs. Morphological assessment of wounds showed that the injury model recapitulates the distinct phases of skin repair. Non-degraded RNA could be isolated from skin and wounds and used to study the expression of non-coding small nuclear RNAs during wound healing. Among those, RNU6B was most constantly expressed during skin repair. Using this reference gene we could confirm the transient upregulation of IL-1β and PTPRC/CD45 during the early phase as well as the increased expression of collagen type I at later stages of repair and validate the differential expression of miR-204, miR-205, and miR-31 in skin wounds. In contrast to Gapdh the normalization to multiple reference genes gave a similar outcome. RNU6B is an accurate alternative normalizer to quantify mRNA and miRNA expression during the distinct phases of skin wound healing when analysis of multiple reference genes is not feasible.
Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M.
2015-01-01
Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression profile of the target candidate genes. PMID:25793735
Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M
2015-01-01
Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression profile of the target candidate genes.
Taki, Faten A; Abdel-Rahman, Abdel A; Zhang, Baohong
2014-01-01
Gender and hormonal differences are often correlated with alcohol dependence and related complications like addiction and breast cancer. Estrogen (E2) is an important sex hormone because it serves as a key protein involved in organism level signaling pathways. Alcoholism has been reported to affect estrogen receptor signaling; however, identifying the players involved in such multi-faceted syndrome is complex and requires an interdisciplinary approach. In many situations, preliminary investigations included a straight forward, yet informative biotechniques such as gene expression analyses using quantitative real time PCR (qRT-PCR). The validity of qRT-PCR-based conclusions is affected by the choice of reliable internal controls. With this in mind, we compiled a list of 15 commonly used housekeeping genes (HKGs) as potential reference gene candidates in rat biological models. A comprehensive comparison among 5 statistical approaches (geNorm, dCt method, NormFinder, BestKeeper, and RefFinder) was performed to identify the minimal number as well the most stable reference genes required for reliable normalization in experimental rat groups that comprised sham operated (SO), ovariectomized rats in the absence (OVX) or presence of E2 (OVXE2). These rat groups were subdivided into subgroups that received alcohol in liquid diet or isocalroic control liquid diet for 12 weeks. Our results showed that U87, 5S rRNA, GAPDH, and U5a were the most reliable gene candidates for reference genes in heart and brain tissue. However, different gene stability ranking was specific for each tissue input combination. The present preliminary findings highlight the variability in reference gene rankings across different experimental conditions and analytic methods and constitute a fundamental step for gene expression assays.
Ovesná, Jaroslava; Kučera, Ladislav; Vaculová, Kateřina; Štrymplová, Kamila; Svobodová, Ilona; Milella, Luigi
2012-01-01
Reverse transcription coupled with real-time quantitative PCR (RT-qPCR) is a frequently used method for gene expression profiling. Reference genes (RGs) are commonly employed to normalize gene expression data. A limited information exist on the gene expression and profiling in developing barley caryopsis. Expression stability was assessed by measuring the cycle threshold (Ct) range and applying both the GeNorm (pair-wise comparison of geometric means) and Normfinder (model-based approach) principles for the calculation. Here, we have identified a set of four RGs suitable for studying gene expression in the developing barley caryopsis. These encode the proteins GAPDH, HSP90, HSP70 and ubiquitin. We found a correlation between the frequency of occurrence of a transcript in silico and its suitability as an RG. This set of RGs was tested by comparing the normalized level of β-amylase (β-amy1) transcript with directly measured quantities of the BMY1 gene product in the developing barley caryopsis. This panel of genes could be used for other gene expression studies, as well as to optimize β-amy1 analysis for study of the impact of β-amy1 expression upon barley end-use quality.
Chan, Pek-Lan; Rose, Ray J; Abdul Murad, Abdul Munir; Zainal, Zamri; Low, Eng-Ti Leslie; Ooi, Leslie Cheng-Li; Ooi, Siew-Eng; Yahya, Suzaini; Singh, Rajinder
2014-01-01
The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR). With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper) confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569) outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN). PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection of appropriate reference genes in other oil palm tissues and in the expression profiling of genes relating to yield, biotic and abiotic stresses.
Hoque, Tafazzal; Bhogal, Meetu; Boghal, Meetu; Webb, Rodney A
2007-12-01
The non-invasive parasitic cestode Hymenolepis diminuta induces hypertrophy, hyperplasia and other changes in cell activity in the intestine of rats which are indicated in the expression of mRNA. We have investigated various house-keeping genes (GAPDH, beta-actin, 18S and HPRT) and other internal controls (total RNA/unit biomass, total RNA/unit length of intestine) to validate gene expression in the rat intestine after cestode infection and drug-induced neuromodulation. Variation in GAPDH, beta-actin, 18S and HPRT expression was observed in rat jejunal tissue according to treatment. Total RNA/unit length of intestine was found to be the most suitable internal control for normalizing target gene mRNA expression in both infected and/or drug-induced rat intestine. This normalization method may be applied to studies of gene expression levels in intestinal tissue where hypertrophy, hyperplasia, rapid growth and cell differentiation generally occur.
V Patankar, Himanshu; M Assaha, Dekoum V; Al-Yahyai, Rashid; Sunkar, Ramanjulu; Yaish, Mahmoud W
2016-01-01
Date palm is an important crop plant in the arid and semi-arid regions supporting human population in the Middle East and North Africa. These areas have been largely affected by drought and salinity due to insufficient rainfall and improper irrigation practices. Date palm is a relatively salt- and drought-tolerant plant and more recently efforts have been directed to identifying genes and pathways that confer stress tolerance in this species. Quantitative real-time PCR (qPCR) is a promising technique for the analysis of stress-induced differential gene expression, which involves the use of stable reference genes for normalizing gene expression. In an attempt to find the best reference genes for date palm's drought and salinity research, we evaluated the stability of 12 most commonly used reference genes using the geNorm, NormFinder, BestKeeper statistical algorithms and the comparative ΔCT method. The comprehensive results revealed that HEAT SHOCK PROTEIN (HSP), UBIQUITIN (UBQ) and YTH domain-containing family protein (YT521) were stable in drought-stressed leaves whereas GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE (GAPDH), ACTIN and TUBULIN were stable in drought-stressed roots. On the other hand, SMALL SUBUNIT RIBOSOMAL RNA (25S), YT521 and 18S ribosomal RNA (18S); and UBQ, ACTIN and ELONGATION FACTOR 1-ALPHA (eEF1a) were stable in leaves and roots, respectively, under salt stress. The stability of these reference genes was verified by using the abiotic stress-responsive CYTOSOLIC Cu/Zn SUPEROXIDE DISMUTASE (Cyt-Cu/Zn SOD), an ABA RECEPTOR, and a PROLINE TRANSPORTER 2 (PRO) genes. A combination of top 2 or 3 stable reference genes were found to be suitable for normalization of the target gene expression and will facilitate gene expression analysis studies aimed at identifying functional genes associated with drought and salinity tolerance in date palm.
Schoen, K; Plendl, J; Gabler, C; Kaessmeyer, S
2015-06-01
Ovaries are highly complex organs displaying morphological, molecular and functional differences between their cortical zona parenchymatosa and medullary zona vasculosa, and also between the different cyclic luteal stages. Objective of the present study was to validate expression stability of twelve putative reference genes (RGs) in bovine ovaries, considering the intrinsic heterogeneity of bovine ovarian tissue with regard to different luteal stages and intra-ovarian localizations. The focus was on identifying RGs, which are suitable to normalize RT-qPCR results of ovaries collected from clinical healthy cattle, irrespective of localization and the hormonal stage. Expression profiles of twelve potential reference genes (GAPDH, ACTB, YWHAZ, HPRT1, SDHA, UBA52, POLR2C, RPS9, ACTG2, H3F3B, RPS18 and RPL19) were analysed. Evaluation of gene expression differences was performed using genorm, normfinder, and bestkeeper software. The most stably expressed genes according to genorm, normfinder and bestkeeper approaches contained the candidates H3F3B, RPS9, YWHAZ, RPS18, POLR2C and UBA52. Of this group, the genes YWHAZ, H3F3B and RPS9 could be recommended as best-suited RGs for normalization purposes on healthy bovine ovaries irrespective of the luteal stage or intra-ovarian localization. © 2014 Blackwell Verlag GmbH.
Branny, P; de la Torre, F; Garel, J R
1998-04-01
The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.
Carrol, Enitan D; Salway, Fiona; Pepper, Stuart D; Saunders, Emma; Mankhambo, Limangeni A; Ollier, William E; Hart, C Anthony; Day, Phillip
2007-01-01
Background The challenge of gene expression studies is to reliably quantify levels of transcripts, but this is hindered by a number of factors including sample availability, handling and storage. The PAXgene™ Blood RNA System includes a stabilizing additive in a plastic evacuated tube, but requires 2.5 mL blood, which makes routine implementation impractical for paediatric use. The aim of this study was to modify the PAXgene™ Blood RNA System kit protocol for application to small, sick chidren, without compromising RNA integrity, and subsequently to perform quantitative analysis of ICAM and interleukin-6 gene expression. Aliquots of 0.86 mL PAXgene™ reagent were put into microtubes and 0.3 mL whole blood added to maintain the same recommended proportions as in the PAXgene™ evacuated tube system. RNA quality was assessed using the Agilent BioAnalyser 2100 and an in-house TaqMan™ assay which measures GAPDH transcript integrity by determining 3' to 5' ratios. qPCR analysis was performed on an additional panel of 7 housekeeping genes. Three reference genes (HPRT1, YWHAZ and GAPDH) were identified using the GeNORM algorithm, which were subsequently used to normalising target gene expression levels. ICAM-1 and IL-6 gene expression were measured in 87 Malawian children with invasive pneumococcal disease. Results Total RNA yield was between 1,114 and 2,950 ng and the BioAnalyser 2100 demonstrated discernible 18s and 28s bands. The cycle threshold values obtained for the seven housekeeping genes were between 15 and 30 and showed good consistency. Median relative ICAM and IL-6 gene expression were significantly reduced in non-survivors compared to survivors (ICAM: 3.56 vs 4.41, p = 0.04, and IL-6: 2.16 vs 6.73, p = 0.02). Conclusion We have successfully modified the PAXgene™ blood collection system for use in small children and demonstrated preservation of RNA integrity and successful quantitative real-time PCR analysis. PMID:17850649
Liu, Xin; Guan, Huirui; Song, Min; Fu, Yanping; Han, Xiaomin; Lei, Meng; Ren, Jingyu; Guo, Bin; He, Wei; Wei, Yahui
2018-01-01
Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR) is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs) as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. In this study, 10 candidate RGs namely, 18S , 60S , CYP , GAPCP1 , GAPDH2 , EF1B , MDH , SAND , TUA1 , and TUA6 , were singled out from the transcriptome database of S. chamaejasme , and their expression stability under three abiotic stresses (drought, cold, and salt) and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH) were estimated with the programs geNorm, NormFinder, and BestKeeper. Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND , TUA1 and CYP , GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes ( P5CS2 and GI ) further verified that the RGs that we selected were suitable for gene expression normalization. This work is the first attempt to comprehensively estimate the stability of RGs in S. chamaejasme . Our results provide suitable RGs for high-precision normalization in qRT-PCR analysis, thereby making it more convenient to analyze gene expression under these experimental conditions.
Ren, Shengwei; Zhang, Feng; Li, Changyou; Jia, Changkai; Li, Siyuan; Xi, Haijie; Zhang, Hongbo; Yang, Lingling; Wang, Yiqiang
2010-06-11
To evaluate the suitability of common housekeeping genes (HKGs) for use in quantitative reverse transcription PCR (qRT-PCR) assays of the cornea in various murine disease models. CORNEAL DISEASE MODELS STUDIED WERE: 1) corneal neovascularization (CorNV) induced by suture or chemical burn, 2) corneal infection with Candida albicans or Aspergillus fumigatus by intrastromal injection of live spores, and 3) perforating corneal injury (PCI) in Balb/c mice or C57BL/6 mice. Expression of 8 HKGs (glyceraldehyde-3-phosphate dehydrogenase [GAPDH], beta-actin [ACTB], lactate dehydrogenase A [LDHA], ribosomal protein L5 [RPL5], ubiquitin C [UBC], peptidylprolyl isomerase A [PPIA], TATA-box binding protein [TBP1], and hypoxanthine guanine phosphoribosyl transferase [HPRT1]) in the cornea were measured at various time points by microarray hybridization or qRT-PCR and the data analyzed using geNorm and NormFinder. Microarray results showed that under the CorNV condition the expression stability of the 8 HKGs decreased in order of PPIA>RPL5>HPRT1>ACTB>UBC>TBP1>GAPDH>LDHA. qRT-PCR analyses demonstrated that expression of none of the 8 HKGs remained stable under all conditions, while GAPDH and ACTB were among the least stably expressed markers under most conditions. Both geNorm and NormFinder analyses proposed best HKGs or HKG combinations that differ between the various models. NormFinder proposed PPIA as best HKG for three CorNV models and PCI model, as well as UBC for two fungal keratitis models. geNorm analysis demonstrated that a similar model in different mice strains or caused by different stimuli may require different HKGs or HKG pairs for the best normalization. Namely, geNorm proposed PPIA and HRPT1 and PPIA and RPL5 pairs for chemical burn-induced CorNV in Balb/c and C57BL/6 mice, respectively, while UBC and HPRT1 and UBC and LDHA were best for Candida and Aspergillus induced keratitis in Balb/c mice, respectively. When qRT-PCR is designed for studies of gene expression in murine cornea, preselection of situation-specific reference genes is recommended. In the absence of knowledge about situation-specific HKGs, PPIA and UBC, either alone or in combination with HPRT1 or RPL5, can be employed.
GAPDH rs1136666 SNP indicates a high risk of Parkinson's disease.
Ping, Zhang; Xiaomu, Wu; Xufang, Xie; Wenfeng, Cao; Liang, Shao; Tao, Wang
2018-06-07
Development of Parkinson's disease (PD) is attributed to both genetic and environmental factors. Furthermore,GAPDH may play a key role in the development of neurodegenerative disease. Examination of genetic polymorphism in patients with sporadic PD will help uncover the mechanisms of PD pathogenesis and provide new insights into the treatment of PD. The SNaPshot method was applied to determine the gene sequences in 265 patients with idiopathic PD and 269 control cases (sex- and age-matched). The rs1136666 polymorphism of GAPDH was determined to be closely associated with PD. Subsequently, the CC genotype of the rs1136666 fragment was transfected into SH-SY5Y cells via a plasmid. The genetic expression of rs1136666 CC could induce SH-SY5Y cell injury and apoptosis via regulation of the oxidant-antioxidant and apoptosis-antiapoptosis balance. rs1136666 CC of the GAPDH had a pro-apoptotic effect similar to that of rotenone, and combination of the rs1136666 CC genetic variation and the rotenone neurotoxic effect could aggravate oxidative stress, cell injury, and apoptosis better than either single treatment alone. This study confirmed that the rs1136666 CC allele of theGAPDH increased the risk of PD, particularly in older male patients. Copyright © 2018. Published by Elsevier B.V.
Yang, Qingpo; Li, Zhen; Cao, Jinjun; Zhang, Songdou; Zhang, Huaijiang; Wu, Xiaoyun; Zhang, Qingwen; Liu, Xiaoxia
2014-01-01
Locusta migratoria is a classic hemimetamorphosis insect and has caused widespread economic damage to crops as a migratory pest. Researches on the expression pattern of functional genes in L. migratoria have drawn focus in recent years, especially with the release of genome information. Real-time quantitative PCR is the most reproducible and sensitive approach for detecting transcript expression levels of target genes, but optimal internal standards are key factors for its accuracy and reliability. Therefore, it's necessary to provide a systematic stability assessment of internal control for well-performed tests of target gene expression profile. In this study, twelve candidate genes (Ach, Act, Cht2, EF1α, RPL32, Hsp70, Tub, RP49, SDH, GAPDH, 18S, and His) were analyzed with four statistical methods: the delta Ct approach, geNorm, Bestkeeper and NormFinder. The results from these analyses aimed to choose the best suitable reference gene across different experimental situations for gene profile study in L. migratoria. The result demonstrated that for different developmental stages, EF1α, Hsp70 and RPL32 exhibited the most stable expression status for all samples; EF1α and RPL32 were selected as the best reference genes for studies involving embryo and larvae stages, while SDH and RP49 were identified for adult stage. The best-ranked reference genes across different tissues are RPL32, Hsp70 and RP49. For abiotic treatments, the most appropriate genes we identified were as follows: Act and SDH for larvae subjected to different insecticides; RPL32 and Ach for larvae exposed to different temperature treatments; and Act and Ach for larvae suffering from starvation. The present report should facilitate future researches on gene expression in L. migratoria with accessibly optimal reference genes under different experimental contexts.
Mogal, Ashish; Abdulkadir, Sarki A
2006-04-01
In quantitative RT-PCR (qRT-PCR), analysis of gene expression is dependent on normalization using housekeeping genes such as 18S rRNA, GAPDH and beta actin. However, variability in their expression has been reported to be caused by factors like drug treatment, pathological states and cell-cycle phase. An emerging area of cancer research focuses on identifying the role of epigenetic alterations such as histone modifications and DNA methylation in the initiation and progression of cancer. Histone acetylation is the best studied modification so far and has been probed through the use of histone deacetylase inhibitors (HDACi). Further, modulation of histone acetylation is currently being explored as a therapeutic strategy in the treatment of cancer and HDACis have shown promise in inhibiting tumorigenesis and metastasis. Trichostatin-A (TSA) is the most widely used HDACi. Therefore, we were driven to identify a suitable internal control for RT-PCR following TSA treatment. We performed quantitative RT-PCR analysis using mouse prostate tissue explants, human prostate cancer (LNCaP) cells and human breast cancer (T-47D and ZR-75-1) cells following TSA treatment. Expression of housekeeping genes including 18S rRNA, beta actin, GAPDH and ribosomal highly-basic 23-kDa protein (rb 23-kDa, RPL13A) were compared in vehicle versus TSA treated samples. Our results showed marked variations in 18S rRNA, beta actin mRNA and GAPDH mRNA levels in mouse prostate explants and a human prostate cancer (LNCaP) cell line following TSA treatment. Furthermore, in two human breast cancer cell lines (T-47D and ZR-75-1) 18S rRNA, beta actin mRNA and GAPDH mRNA levels varied significantly. However, RPL13A mRNA levels remained constant in all the conditions tested. Therefore, we recommend use of RPL13A as a standard for normalization during TSA treatment.
Cai, Jing; Li, Pengfei; Luo, Xiao; Chang, Tianliang; Li, Jiaxing; Zhao, Yuwei; Xu, Yao
2018-01-01
Hulless barley (Hordeum vulgare L. var. nudum. hook. f.) has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin), E2 (Ubiquitin conjugating enzyme 2), TUBα (Alpha-tubulin), TUBβ6 (Beta-tubulin 6), GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), EF-1α (Elongation factor 1-alpha), SAMDC (S-adenosylmethionine decarboxylase), PKABA1 (Gene for protein kinase HvPKABA1), PGK (Phosphoglycerate kinase), and HSP90 (Heat shock protein 90)-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression analysis under tested stress conditions by the qRT-PCR method.
2013-01-01
Background Coffee production in Africa represents a significant share of the total export revenues and influences the lives of millions of people, yet severe socio-economic repercussions are annually felt in result of the overall losses caused by the coffee berry disease (CBD). This quarantine disease is caused by the fungus Colletotrichum kahawae Waller and Bridge, which remains one of the most devastating threats to Coffea arabica production in Africa at high altitude, and its dispersal to Latin America and Asia represents a serious concern. Understanding the molecular genetic basis of coffee resistance to this disease is of high priority to support breeding strategies. Selection and validation of suitable reference genes presenting stable expression in the system studied is the first step to engage studies of gene expression profiling. Results In this study, a set of ten genes (S24, 14-3-3, RPL7, GAPDH, UBQ9, VATP16, SAND, UQCC, IDE and β-Tub9) was evaluated to identify reference genes during the first hours of interaction (12, 48 and 72 hpi) between resistant and susceptible coffee genotypes and C. kahawae. Three analyses were done for the selection of these genes considering the entire dataset and the two genotypes (resistant and susceptible), separately. The three statistical methods applied GeNorm, NormFinder, and BestKeeper, allowed identifying IDE as one of the most stable genes for all datasets analysed, and in contrast GADPH and UBQ9 as the least stable ones. In addition, the expression of two defense-related transcripts, encoding for a receptor like kinase and a pathogenesis related protein 10, were used to validate the reference genes selected. Conclusion Taken together, our results provide guidelines for reference gene(s) selection towards a more accurate and widespread use of qPCR to study the interaction between Coffea spp. and C. kahawae. PMID:24073624
Bai, W L; Yin, R H; Zhao, S J; Jiang, W Q; Yin, R L; Ma, Z J; Wang, Z Y; Zhu, Y B; Luo, G B; Yang, R J; Zhao, Z H
2014-02-01
Quantitative real-time PCR is the most sensitive technique for gene expression analysis. Data normalization is essential to correct for potential errors incurred in all steps from RNA isolation to PCR amplification. The commonly accepted approach for normalization is the use of reference gene. Until now, no suitable reference genes have been available for data normalization of gene expression in milk somatic cells of lactating yaks across lactation. In the present study, we evaluated the transcriptional stability of 10 candidate reference genes in milk somatic cells of lactating yak, including ACTB, B2M, GAPDH, GTP, MRPL39, PPP1R11, RPS9, RPS15, UXT, and RN18S1. Four genes, RPS9, PPP1R11, UXT, and MRPL39, were identified as being the most stable genes in milk somatic cells of lactating yak. Using the combination of RPS9, PPP1R11, UXT, and MRPL39 as reference genes, we further assessed the relative expression of 4 genes of interest in milk somatic cells of yak across lactation, including ELF5, ABCG2, SREBF2, and DGAT1. Compared with expression in colostrum, the overall transcription levels of ELF5, ABCG2, and SREBF2 in milk were found to be significantly upregulated in early, peak, and late lactation, and significantly downregulated thereafter, before the dry period. A similar pattern was observed in the relative expression of DGAT1, but no significant difference was revealed in its expression in milk from late lactation compared with colostrum. Based on these results, we suggest that the geometric mean of RPS9, PPP1R11, UXT, and MRPL39 can be used for normalization of real-time PCR data in milk somatic cells of lactating yak, if similar experiments are performed. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Chan, Pek-Lan; Rose, Ray J.; Abdul Murad, Abdul Munir; Zainal, Zamri; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ooi, Siew-Eng; Yahya, Suzaini; Singh, Rajinder
2014-01-01
Background The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR). With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. Results In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper) confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569) outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN). PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. Conclusions Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection of appropriate reference genes in other oil palm tissues and in the expression profiling of genes relating to yield, biotic and abiotic stresses. PMID:24927412
Nishimura, Ikuko; Shinohara, Yasutomo; Oguma, Tetsuya; Koyama, Yasuji
2018-04-08
In soy sauce brewing, the results of the fermentation of lactic acid greatly affect the quality of soy sauce. The soy sauce moromi produced with Aspergillus oryzae RIB40 allows the growth of Tetragenococcus halophilus NBRC 12172 but not T. halophilus D10. We isolated and identified heptelidic acid (HA), an inhibitor of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), produced by A. oryzae RIB40 as the growth inhibitor of the salt-tolerant lactic acid bacteria. The growth inhibition of T. halophilus D10 by HA was suggested to be associated with the direct inhibition of GAPDH activity under high salt environment. The difference in the susceptibility to HA among various strains of T. halophilus was caused by the mutations in the gene encoding GAPDH.
Problem-Based Test: The Effect of Fibroblast Growth Factor on Gene Expression
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2011-01-01
This paper shows the results of an experiment in which the effects of fibroblast growth factor (FGF), actinomycin D (Act D; an inhibitor of transcription), and cycloheximide (CHX; an inhibitor of translation) were studied on the expression of two genes: a gene called "Fnk" and the gene coding for glyceraldehyde-3-phosphate dehydrogenase (GAPDH).…
Evaluation of reference genes for insect olfaction studies.
Omondi, Bonaventure Aman; Latorre-Estivalis, Jose Manuel; Rocha Oliveira, Ivana Helena; Ignell, Rickard; Lorenzo, Marcelo Gustavo
2015-04-22
Quantitative reverse transcription PCR (qRT-PCR) is a robust and accessible method to assay gene expression and to infer gene regulation. Being a chain of procedures, this technique is subject to systematic error due to biological and technical limitations mainly set by the starting material and downstream procedures. Thus, rigorous data normalization is critical to grant reliability and repeatability of gene expression quantification by qRT-PCR. A number of 'housekeeping genes', involved in basic cellular functions, have been commonly used as internal controls for this normalization process. However, these genes could themselves be regulated and must therefore be tested a priori. We evaluated eight potential reference genes for their stability as internal controls for RT-qPCR studies of olfactory gene expression in the antennae of Rhodnius prolixus, a Chagas disease vector. The set of genes included were: α-tubulin; β-actin; Glyceraldehyde-3-phosphate dehydrogenase; Eukaryotic initiation factor 1A; Glutathione-S-transferase; Serine protease; Succinate dehydrogenase; and Glucose-6-phosphate dehydrogenase. Five experimental conditions, including changes in age,developmental stage and feeding status were tested in both sexes. We show that the evaluation of candidate reference genes is necessary for each combination of sex, tissue and physiological condition analyzed in order to avoid inconsistent results and conclusions. Although, Normfinder and geNorm software yielded different results between males and females, five genes (SDH, Tub, GAPDH, Act and G6PDH) appeared in the first positions in all rankings obtained. By using gene expression data of a single olfactory coreceptor gene as an example, we demonstrated the extent of changes expected using different internal standards. This work underlines the need for a rigorous selection of internal standards to grant the reliability of normalization processes in qRT-PCR studies. Furthermore, we show that particular physiological or developmental conditions require independent evaluation of a diverse set of potential reference genes.
Beer, Lucian; Mlitz, Veronika; Gschwandtner, Maria; Berger, Tanja; Narzt, Marie-Sophie; Gruber, Florian; Brunner, Patrick M; Tschachler, Erwin; Mildner, Michael
2015-10-01
Reverse transcription polymerase chain reaction (qRT-PCR) has become a mainstay in many areas of skin research. To enable quantitative analysis, it is necessary to analyse expression of reference genes (RGs) for normalization of target gene expression. The selection of reliable RGs therefore has an important impact on the experimental outcome. In this study, we aimed to identify and validate the best suited RGs for qRT-PCR in human primary keratinocytes (KCs) over a broad range of experimental conditions using the novel bioinformatics tool 'RefGenes', which is based on a manually curated database of published microarray data. Expression of 6 RGs identified by RefGenes software and 12 commonly used RGs were validated by qRT-PCR. We assessed whether these 18 markers fulfilled the requirements for a valid RG by the comprehensive ranking of four bioinformatics tools and the coefficient of variation (CV). In an overall ranking, we found GUSB to be the most stably expressed RG, whereas the expression values of the commonly used RGs, GAPDH and B2M were significantly affected by varying experimental conditions. Our results identify RefGenes as a powerful tool for the identification of valid RGs and suggest GUSB as the most reliable RG for KCs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Che Omar, Sarena; Bentley, Michael A; Morieri, Giulia; Preston, Gail M; Gurr, Sarah J
2016-01-01
The rice blast fungus causes significant annual harvest losses. It also serves as a genetically-tractable model to study fungal ingress. Whilst pathogenicity determinants have been unmasked and changes in global gene expression described, we know little about Magnaporthe oryzae cell wall remodelling. Our interests, in wall remodelling genes expressed during infection, vegetative growth and under exogenous wall stress, demand robust choice of reference genes for quantitative Real Time-PCR (qRT-PCR) data normalisation. We describe the expression stability of nine candidate reference genes profiled by qRT-PCR with cDNAs derived during asexual germling development, from sexual stage perithecia and from vegetative mycelium grown under various exogenous stressors. Our Minimum Information for Publication of qRT-PCR Experiments (MIQE) compliant analysis reveals a set of robust reference genes used to track changes in the expression of the cell wall remodelling gene MGG_Crh2 (MGG_00592). We ranked nine candidate reference genes by their expression stability (M) and report the best gene combination needed for reliable gene expression normalisation, when assayed in three tissue groups (Infective, Vegetative, and Global) frequently used in M. oryzae expression studies. We found that MGG_Actin (MGG_03982) and the 40S 27a ribosomal subunit MGG_40s (MGG_02872) proved to be robust reference genes for the Infection group and MGG_40s and MGG_Ef1 (Elongation Factor1-α) for both Vegetative and Global groups. Using the above validated reference genes, M. oryzae MGG_Crh2 expression was found to be significantly (p<0.05) elevated three-fold during vegetative growth as compared with dormant spores and two fold higher under cell wall stress (Congo Red) compared to growth under optimal conditions. We recommend the combinatorial use of two reference genes, belonging to the cytoskeleton and ribosomal synthesis functional groups, MGG_Actin, MGG_40s, MGG_S8 (Ribosomal subunit 40S S8) or MGG_Ef1, which demonstrated low M values across heterogeneous tissues. By contrast, metabolic pathway genes MGG_Fad (FAD binding domain-containing protein) and MGG_Gapdh (Glyceraldehyde-3-phosphate dehydrogenase) performed poorly, due to their lack of expression stability across samples.
Zhou, Bujin; Chen, Peng; Khan, Aziz; Zhao, Yanhong; Chen, Lihong; Liu, Dongmei; Liao, Xiaofang; Kong, Xiangjun; Zhou, Ruiyang
2017-01-01
Cytoplasmic male sterility (CMS) is a maternally inherited trait that results in the production of dysfunctional pollen. Based on reliable reference gene-normalized real-time quantitative PCR (RT-qPCR) data, examining gene expression profile can provide valuable information on the molecular mechanism of kenaf CMS. However, studies have not been conducted regarding selection of reference genes for normalizing RT-qPCR data in the CMS and maintainer lines of kenaf crop. Therefore, we studied 10 candidate reference genes (ACT3, ELF1A, G6PD, PEPKR1, TUB, TUA, CYP, GAPDH, H3, and 18S) to assess their expression stability at three stages of pollen development in CMS line 722A and maintainer line 722B of kenaf. Five computational statistical approaches (GeNorm, NormFinder, ΔCt, BestKeeper, and RefFinder) were used to evaluate the expression stability levels of these genes. According to RefFinder and GeNorm, the combination of TUB, CYP, and PEPKR1 was identified as an internal control for the accurate normalization across all sample set, which was further confirmed by validating the expression of HcPDIL5-2a. Furthermore, the combination of TUB, CYP, and PEPKR1 was used to differentiate the expression pattern of five mitochondria F1F0-ATPase subunit genes (atp1, atp4, atp6, atp8, and atp9) by RT-qPCR during pollen development in CMS line 722A and maintainer line 722B. We found that atp1, atp6, and atp9 exhibited significantly different expression patterns during pollen development in line 722A compared with line 722B. This is the first systematic study of reference genes selection for CMS and will provide useful information for future research on the gene expressions and molecular mechanisms underlying CMS in kenaf. PMID:28919905
Veazey, Kylee J; Golding, Michael C
2011-01-01
Isolation and culture of both embryonic and tissue specific stem cells provide an enormous opportunity to study the molecular processes driving development. To gain insight into the initial events underpinning mammalian embryogenesis, pluripotent stem cells from each of the three distinct lineages present within the preimplantation blastocyst have been derived. Embryonic (ES), trophectoderm (TS) and extraembryonic endoderm (XEN) stem cells possess the developmental potential of their founding lineages and seemingly utilize distinct epigenetic modalities to program gene expression. However, the basis for these differing cellular identities and epigenetic properties remain poorly defined.Quantitative reverse transcription-polymerase chain reaction (qPCR) is a powerful and efficient means of rapidly comparing patterns of gene expression between different developmental stages and experimental conditions. However, careful, empirical selection of appropriate reference genes is essential to accurately measuring transcriptional differences. Here we report the quantitation and evaluation of fourteen commonly used references genes between ES, TS and XEN stem cells. These included: Actb, B2m, Hsp70, Gapdh, Gusb, H2afz, Hk2, Hprt, Pgk1, Ppia, Rn7sk, Sdha, Tbp and Ywhaz. Utilizing three independent statistical analysis, we identify Pgk1, Sdha and Tbp as the most stable reference genes between each of these stem cell types. Furthermore, we identify Sdha, Tbp and Ywhaz as well as Ywhaz, Pgk1 and Hk2 as the three most stable reference genes through the in vitro differentiation of embryonic and trophectoderm stem cells respectively.Understanding the transcriptional and epigenetic regulatory mechanisms controlling cellular identity within these distinct stem cell types provides essential insight into cellular processes controlling both embryogenesis and stem cell biology. Normalizing quantitative RT-PCR measurements using the geometric mean CT values obtained for the identified mRNAs, offers a reliable method to assess differing patterns of gene expression between the three founding stem cell lineages present within the mammalian preimplantation embryo.
Hadziabdic, Naida; Kurtovic-Kozaric, Amina; Pojskic, Naris; Sulejmanagic, Nedim; Todorovic, Ljubomir
2016-03-01
Periapical inflammatory lesions have been investigated previously, but understanding of pathogenesis of these lesions (granulomas and radicular cysts) at the molecular level is still questionable. Matrix metalloproteinases (MMPs) are enzymes involved in the development of periapical pathology, specifically inflammation and tissue destruction. To elucidate pathogenesis of periapical granulomas and radicular cysts, we undertook a detailed analysis of gene expression of MMP-1, MMP-2 and their tissue inhibitors, TIMP-1 and TIMP-2. A total of 149 samples were analyzed using real-time PCR (59 radicular cysts, 50 periapical granulomas and 40 healthy gingiva samples as controls) for expression of MMP-1, MMP-2, TIMP-1 and TIMP-2 genes. The determination of best reference gene for expression analysis of periapical lesions was done using a panel of 12 genes. We have shown that β-actin and GAPDH are not the most stable reference controls for gene expression analysis of inflammatory periapical tissues and healthy gingiva. The most suitable reference gene was determined to be SDHA (a succinate dehydrogenase complex, subunit A, flavoprotein [Fp]). We found that granulomas (n = 50) and radicular cysts (n = 59) exhibited significantly higher expression of all four examined genes, MMP-1, MMP-2, TIMP-1, and TIMP-2, when compared to healthy gingiva (n = 40; P < 0.05). This study has confirmed that the expression of MMP-1, MMP-2, TIMP-1, and TIMP-2 genes is important for the pathogenesis of periapical inflammatory lesions. Since the abovementioned markers were not differentially expressed in periapical granulomas and radicular cysts, the challenge of finding the genetic differences between the two lesions still remains. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Han, Chenggui; Yu, Jialin; Li, Dawei; Zhang, Yongliang
2012-01-01
Nicotiana benthamiana is the most widely-used experimental host in plant virology. The recent release of the draft genome sequence for N. benthamiana consolidates its role as a model for plant–pathogen interactions. Quantitative real-time PCR (qPCR) is commonly employed for quantitative gene expression analysis. For valid qPCR analysis, accurate normalisation of gene expression against an appropriate internal control is required. Yet there has been little systematic investigation of reference gene stability in N. benthamiana under conditions of viral infections. In this study, the expression profiles of 16 commonly used housekeeping genes (GAPDH, 18S, EF1α, SAMD, L23, UK, PP2A, APR, UBI3, SAND, ACT, TUB, GBP, F-BOX, PPR and TIP41) were determined in N. benthamiana and those with acceptable expression levels were further selected for transcript stability analysis by qPCR of complementary DNA prepared from N. benthamiana leaf tissue infected with one of five RNA plant viruses (Tobacco necrosis virus A, Beet black scorch virus, Beet necrotic yellow vein virus, Barley stripe mosaic virus and Potato virus X). Gene stability was analysed in parallel by three commonly-used dedicated algorithms: geNorm, NormFinder and BestKeeper. Statistical analysis revealed that the PP2A, F-BOX and L23 genes were the most stable overall, and that the combination of these three genes was sufficient for accurate normalisation. In addition, the suitability of PP2A, F-BOX and L23 as reference genes was illustrated by expression-level analysis of AGO2 and RdR6 in virus-infected N. benthamiana leaves. This is the first study to systematically examine and evaluate the stability of different reference genes in N. benthamiana. Our results not only provide researchers studying these viruses a shortlist of potential housekeeping genes to use as normalisers for qPCR experiments, but should also guide the selection of appropriate reference genes for gene expression studies of N. benthamiana under other biotic and abiotic stress conditions. PMID:23029521
2014-01-01
Background Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Results Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. Conclusion This study proposes a first broad collection of teak tissue and organ mRNA expression data for nine selected candidate qRT-PCR reference genes. NormFinder, Bestkeeper, geNorm and Delta Ct analyses suggested that TgUbq and TgEf-1α have the highest expression stability and provided similar results when evaluating TgCAD gene expression, while the commonly used Act should be avoided. PMID:25048176
DOE Office of Scientific and Technical Information (OSTI.GOV)
Joo, Hyun-Yoo; Laboratory of Biochemistry, School of Life Sciences and Biotechnology, Korea University, Seoul 136-713; Woo, Seon Rang
2012-08-10
Highlights: Black-Right-Pointing-Pointer SIRT1 serves to retain GAPDH in the cytosol, preventing GAPDH nuclear translocation. Black-Right-Pointing-Pointer When SIRT1 is depleted, GAPDH translocation occurs even in the absence of stress. Black-Right-Pointing-Pointer Upon irradiation, SIRT1 interacts with GAPDH. Black-Right-Pointing-Pointer SIRT1 prevents irradiation-induced nuclear translocation of GAPDH. Black-Right-Pointing-Pointer SIRT1 presence rather than activity is essential for inhibiting GAPDH translocation. -- Abstract: Upon apoptotic stimulation, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a cytosolic enzyme normally active in glycolysis, translocates into the nucleus and activates an apoptotic cascade therein. In the present work, we show that SIRT1 prevents nuclear translocation of GAPDH via interaction with GAPDH. SIRT1 depletion triggeredmore » nuclear translocation of cytosolic GAPDH even in the absence of apoptotic stress. Such translocation was not, however, observed when SIRT1 enzymatic activity was inhibited, indicating that SIRT1 protein per se, rather than the deacetylase activity of the protein, is required to inhibit GAPDH translocation. Upon irradiation, SIRT1 prevented irradiation-induced nuclear translocation of GAPDH, accompanied by interaction of SIRT1 and GAPDH. Thus, SIRT1 functions to retain GAPDH in the cytosol, protecting the enzyme from nuclear translocation via interaction with these two proteins. This serves as a mechanism whereby SIRT1 regulates cell survival upon induction of apoptotic stress by means that include irradiation.« less
2005-01-01
the Selected Genes Sense Antisense Product length (bp) G3PDH 5=-TCCTGCACCACCAACTGCTTAG-3= 5=-TGCTTCACCACCTTCTTGATGTC-3= 341 iNOS 5...GAPDH, as a housekeeping gene, was not affected significantly by the hemorrhage protocol. The results showed that mRNA levels of all enzymes and
Kunjithapatham, Rani; Geschwind, Jean-Francois; Devine, Lauren; Boronina, Tatiana N; O'Meally, Robert N; Cole, Robert N; Torbenson, Michael S; Ganapathy-Kanniappan, Shanmugasundaram
2015-04-03
Cellular glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a phylogenetically conserved, ubiquitous enzyme that plays an indispensable role in energy metabolism. Although a wealth of information is available on cellular GAPDH, there is a clear paucity of data on its extracellular counterpart (i.e., the secreted or extracellular GAPDH). Here, we show that the extracellular GAPDH in human serum is a multimeric, high-molecular-weight, yet glycolytically active enzyme. The high-molecular-weight multimers of serum GAPDH were identified by immunodetection on one- and two-dimensional gel electrophoresis using multiple antibodies specific for various epitopes of GAPDH. Partial purification of serum GAPDH by DEAE Affigel affinity/ion exchange chromatography further established the multimeric composition of serum GAPDH. In vitro data demonstrated that human cell lines secrete a multimeric, high-molecular-weight enzyme similar to that of serum GAPDH. Furthermore, LC-MS/MS analysis of extracellular GAPDH from human cell lines confirmed the presence of unique peptides of GAPDH in the high-molecular-weight subunits. Furthermore, data from pulse-chase experiments established the presence of high-molecular-weight subunits in the secreted, extracellular GAPDH. Taken together, our findings demonstrate the presence of a high-molecular-weight, enzymatically active secretory GAPDH in human serum that may have a hitherto unknown function in humans.
Jeong, Jae-Kyo; Kang, Min-Hee; Gurunathan, Sangiliyandi; Cho, Ssang-Goo; Park, Chankyu; Seo, Han Geuk; Kim, Jin-Hoi
2014-09-25
Real-time quantitative reverse-transcriptase polymerase chain reaction (RT-qPCR) is the most sensitive, and valuable technique for rare mRNA detection. However, the expression profiles of reference genes under different experimental conditions, such as different mouse strains, developmental stage, and culture conditions have been poorly studied. mRNA stability of the actb, gapdh, sdha, ablim, ywhaz, sptbn, h2afz, tgfb1, 18 s and wrnip genes was analyzed. Using the NormFinder program, the most stable genes are as follows: h2afz for the B6D2F-1 and C57BL/6 strains; sptbn for ICR; h2afz for KOSOM and CZB cultures of B6D2F-1 and C57BL/6 strain-derived embryos; wrnip for M16 culture of B6D2F-1 and C57BL/6 strain-derived embryos; ywhaz, tgfb1, 18 s, 18 s, ywhaz, and h2afz for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst embryonic stages cultured in KSOM medium, respectively; h2afz, wrnip, wrnip, h2afz, ywhaz, and ablim for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst stage embryos cultured in CZB medium, respectively; 18 s, h2afz, h2afz, actb, h2afz, and wrnip for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst stage embryos cultured in M16 medium, respectively. These results demonstrated that candidate reference genes for normalization of target gene expression using RT-qPCR should be selected according to mouse strains, developmental stage, and culture conditions.
Transdermal Delivery of siRNA through Microneedle Array
NASA Astrophysics Data System (ADS)
Deng, Yan; Chen, Jiao; Zhao, Yi; Yan, Xiaohui; Zhang, Li; Choy, Kwongwai; Hu, Jun; Sant, Himanshu J.; Gale, Bruce K.; Tang, Tao
2016-02-01
Successful development of siRNA therapies has significant potential for the treatment of skin conditions (alopecia, allergic skin diseases, hyperpigmentation, psoriasis, skin cancer, pachyonychia congenital) caused by aberrant gene expression. Although hypodermic needles can be used to effectively deliver siRNA through the stratum corneum, the major challenge is that this approach is painful and the effects are restricted to the injection site. Microneedle arrays may represent a better way to deliver siRNAs across the stratum corneum. In this study, we evaluated for the first time the ability of the solid silicon microneedle array for punching holes to deliver cholesterol-modified housekeeping gene (Gapdh) siRNA to the mouse ear skin. Treating the ear with microneedles showed permeation of siRNA in the skin and could reduce Gapdh gene expression up to 66% in the skin without accumulation in the major organs. The results showed that microneedle arrays could effectively deliver siRNA to relevant regions of the skin noninvasively.
Baibai, Tarik; Oukhattar, Laila; Mountassif, Driss; Assobhei, Omar; Serrano, Aurelio; Soukri, Abdelaziz
2010-12-01
The NAD(+)-dependent cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12), which is recognized as a key to central carbon metabolism in glycolysis and gluconeogenesis and as an important allozymic polymorphic biomarker, was purified from muscles of two marine species: the skeletal muscle of Sardina pilchardus Walbaum (Teleost, Clupeida) and the incompressible arm muscle of Octopus vulgaris (Mollusca, Cephalopoda). Comparative biochemical studies have revealed that they differ in their subunit molecular masses and in pI values. Partial cDNA sequences corresponding to an internal region of the GapC genes from Sardina and Octopus were obtained by polymerase chain reaction using degenerate primers designed from highly conserved protein motifs. Alignments of the deduced amino acid sequences were used to establish the 3D structures of the active site of two enzymes as well as the phylogenetic relationships of the sardine and octopus enzymes. These two enzymes are the first two GAPDHs characterized so far from teleost fish and cephalopod, respectively. Interestingly, phylogenetic analyses indicated that the sardina GAPDH is in a cluster with the archetypical enzymes from other vertebrates, while the octopus GAPDH comes together with other molluscan sequences in a distant basal assembly closer to bacterial and fungal orthologs, thus suggesting their different evolutionary scenarios.
Glenting, Jacob; Beck, Hans Christian; Vrang, Astrid; Riemann, Holger; Ravn, Peter; Hansen, Anne Maria; Antonsson, Martin; Ahrné, Siv; Israelsen, Hans; Madsen, Søren
2013-06-12
An important criterion for the selection of a probiotic bacterial strain is its ability to adhere to the mucosal surface. Adhesion is usually mediated by proteins or other components located on the outer cell surface of the bacterium. In the present study we characterized the adhesive properties of two classical intracellular enzymes glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and enolase (ENO) isolated from the outer cell surface of the probiotic bacterium Lactobacillus plantarum 299v. None of the genes encoded signal peptides or cell surface anchoring motifs that could explain their extracellular location on the bacterial surface. The presence of the glycolytic enzymes on the outer surface was verified by western blotting using polyclonal antibodies raised against the specific enzymes. GAPDH and ENO showed a highly specific binding to plasminogen and fibronectin whereas GAPDH but not ENO showed weak binding to mucin. Furthermore, a pH dependent and specific binding of GAPDH and ENO to intestinal epithelial Caco-2 cells at pH 5 but not at pH 7 was demonstrated. The results showed that these glycolytic enzymes could play a role in the adhesion of the probiotic bacterium L. plantarum 299v to the gastrointestinal tract of the host. Finally, a number of probiotic as well non-probiotic Lactobacillus strains were analyzed for the presence of GAPDH and ENO on the outer surface, but no correlation between the extracellular location of these enzymes and the probiotic status of the applied strains was demonstrated. Copyright © 2013 Elsevier GmbH. All rights reserved.
Lactobacillus plantarum 299v surface-bound GAPDH: a new insight into enzyme cell walls location.
Saad, N; Urdaci, M; Vignoles, C; Chaignepain, S; Tallon, R; Schmitter, J M; Bressollier, P
2009-12-01
The aim of this study was to provide new insight into the mechanism whereby the housekeeping enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) locates to cell walls of Lactobacillus plantarum 299v. After purification, cytosolic and cell wall GAPDH (cw-GAPDH) forms were characterized and shown to be identical homotetrameric active enzymes. GAPDH concentration on cell walls was growth-time dependent. Free GAPDH was not observed on the culture supernatant at any time during growth, and provoked cell lysis was not concomitant with any reassociation of GAPDH onto the cell surface. Hence, with the possibility of cw-GAPDH resulting from autolysis being unlikely, entrapment of intracellular GAPDH on the cell wall after a passive efflux through altered plasma membrane was investigated. Flow cytometry was used to assess L. plantarum 299v membrane permeabilization after labeling with propidium iodide (PI). By combining PI uptake and cw-GAPDH activity measurements, we demonstrate here that the increase in cw-GAPDH concentration from the early exponential phase to the late stationary phase is closely related to an increase in plasma membrane permeability during growth. Moreover, we observed that increases in both plasma membrane permeability and cw-GAPDH activity were delayed when glucose was added during L. plantarum 299v growth. Using a double labeling of L. plantarum 299v cells with anti-GAPDH antibodies and propidium iodide, we established unambiguously that cells with impaired membrane manifest five times more cw-GAPDH than unaltered cells. Our results show that plasma membrane permeability appears to be closely related to the efflux of GAPDH on the bacterial cell surface, offering new insight into the understanding of the cell wall location of this enzyme.
Ziegenhagen, Birgit; Liepelt, Sascha
2015-01-01
Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings. PMID:25924061
Baker, Bo Y; Shi, Wuxian; Wang, Benlian; Palczewski, Krzysztof
2014-01-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzes the oxidative phosphorylation of d-glyceraldehyde 3-phosphate (G3P) into 1,3-diphosphoglycerate (BGP) in the presence of the NAD cofactor. GAPDH is an important drug target because of its central role in glycolysis, and nonglycolytic processes such as nuclear RNA transport, DNA replication/repair, membrane fusion and cellular apoptosis. Recent studies found that GAPDH participates in the development of diabetic retinopathy and its progression after the cessation of hyperglycemia. Here, we report two structures for native bovine photoreceptor GAPDH as a homotetramer with differing occupancy by NAD, bGAPDH(NAD)4, and bGAPDH(NAD)3. The bGAPDH(NAD)4 was solved at 1.52 Å, the highest resolution for GAPDH. Structural comparison of the bGAPDH(NAD)4 and bGAPDH(NAD)3 models revealed novel details of conformational changes induced by cofactor binding, including a loop region (residues 54–56). Structure analysis of bGAPDH confirmed the importance of Phe34 in NAD binding, and demonstrated that Phe34 was stabilized in the presence of NAD but displayed greater mobility in its absence. The oxidative state of the active site Cys149 residue is regulated by NAD binding, because this residue was found oxidized in the absence of dinucleotide. The distance between Cys149 and His176 decreased upon NAD binding and Cys149 remained in a reduced state when NAD was bound. These findings provide an important structural step for understanding the mechanism of GAPDH activity in vision and its pathological role in retinopathies. PMID:25176140
Pariona-Llanos, Ricardo; Pavani, Raphael Souza; Reis, Marcelo; Noël, Vincent; Silber, Ariel Mariano; Armelin, Hugo Aguirre; Cano, Maria Isabel Nogueira; Elias, Maria Carolina
2015-01-01
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a classical metabolic enzyme involved in energy production and plays a role in additional nuclear functions, including transcriptional control, recognition of misincorporated nucleotides in DNA and maintenance of telomere structure. Here, we show that the recombinant protein T. cruzi GAPDH (rTcGAPDH) binds single-stranded telomeric DNA. We demonstrate that the binding of GAPDH to telomeric DNA correlates with the balance between oxidized and reduced forms of nicotinamide adenine dinucleotides (NAD+/NADH). We observed that GAPDH-telomere association and NAD+/NADH balance changed throughout the T. cruzi life cycle. For example, in replicative epimastigote forms of T. cruzi, which show similar intracellular concentrations of NAD+ and NADH, GAPDH binds to telomeric DNA in vivo and this binding activity is inhibited by exogenous NAD+. In contrast, in the T. cruzi non-proliferative trypomastigote forms, which show higher NAD+ concentration, GAPDH was absent from telomeres. In addition, NAD+ abolishes physical interaction between recombinant GAPDH and synthetic telomere oligonucleotide in a cell free system, mimicking exogenous NAD+ that reduces GAPDH-telomere interaction in vivo. We propose that the balance in the NAD+/NADH ratio during T. cruzi life cycle homeostatically regulates GAPDH telomere association, suggesting that in trypanosomes redox status locally modulates GAPDH association with telomeric DNA.
Pariona-Llanos, Ricardo; Pavani, Raphael Souza; Reis, Marcelo; Noël, Vincent; Silber, Ariel Mariano; Armelin, Hugo Aguirre; Cano, Maria Isabel Nogueira; Elias, Maria Carolina
2015-01-01
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a classical metabolic enzyme involved in energy production and plays a role in additional nuclear functions, including transcriptional control, recognition of misincorporated nucleotides in DNA and maintenance of telomere structure. Here, we show that the recombinant protein T. cruzi GAPDH (rTcGAPDH) binds single-stranded telomeric DNA. We demonstrate that the binding of GAPDH to telomeric DNA correlates with the balance between oxidized and reduced forms of nicotinamide adenine dinucleotides (NAD+/NADH). We observed that GAPDH-telomere association and NAD+/NADH balance changed throughout the T. cruzi life cycle. For example, in replicative epimastigote forms of T. cruzi, which show similar intracellular concentrations of NAD+ and NADH, GAPDH binds to telomeric DNA in vivo and this binding activity is inhibited by exogenous NAD+. In contrast, in the T. cruzi non-proliferative trypomastigote forms, which show higher NAD+ concentration, GAPDH was absent from telomeres. In addition, NAD+ abolishes physical interaction between recombinant GAPDH and synthetic telomere oligonucleotide in a cell free system, mimicking exogenous NAD+ that reduces GAPDH-telomere interaction in vivo. We propose that the balance in the NAD+/NADH ratio during T. cruzi life cycle homeostatically regulates GAPDH telomere association, suggesting that in trypanosomes redox status locally modulates GAPDH association with telomeric DNA. PMID:25775131
McGowan, Ian; Janocko, Laura; Burneisen, Shaun; Bhat, Anand; Richardson-Harman, Nicola
2015-01-01
To determine the intra- and inter-subject variability of mucosal cytokine gene expression in rectal biopsies from healthy volunteers and to screen cytokine and chemokine mRNA as potential biomarkers of mucosal inflammation. Rectal biopsies were collected from 8 participants (3 biopsies per participant) and 1 additional participant (10 biopsies). Quantitative reverse transcription polymerase chain reaction (RT-qPCR) was used to quantify IL-1β, IL-6, IL-12p40, IL-8, IFN-γ, MIP-1α, MIP-1β, RANTES, and TNF-α gene expression in the rectal tissue. The intra-assay, inter-biopsy and inter-subject variance was measured in the eight participants. Bootstrap re-sampling of the biopsy measurements was performed to determine the accuracy of gene expression data obtained for 10 biopsies obtained from one participant. Cytokines were both non-normalized and normalized using four reference genes (GAPDH, β-actin, β2 microglobulin, and CD45). Cytokine measurement accuracy was increased with the number of biopsy samples, per person; four biopsies were typically needed to produce a mean result within a 95% confidence interval of the subject's cytokine level approximately 80% of the time. Intra-assay precision (% geometric standard deviation) ranged between 8.2 and 96.9 with high variance between patients and even between different biopsies from the same patient. Variability was not greatly reduced with the use of reference genes to normalize data. The number of biopsy samples required to provide an accurate result varied by target although 4 biopsy samples per subject and timepoint, provided for >77% accuracy across all targets tested. Biopsies within the same subjects and between subjects had similar levels of variance while variance within a biopsy (intra-assay) was generally lower. Normalization of inflammatory cytokines against reference genes failed to consistently reduce variance. The accuracy and reliability of mRNA expression of inflammatory cytokines will set a ceiling on the ability of these measures to predict mucosal inflammation. Techniques to reduce variability should be developed within a larger cohort of individuals before normative reference values can be validated. Copyright © 2014 Elsevier Ltd. All rights reserved.
Falnoga, Ingrid; Zelenik Pevec, Andreja; Šlejkovec, Zdenka; Žnidarič, Magda Tušek; Zajc, Irena; Mlakar, Simona Jurković; Marc, Janja
2012-12-01
Arsenic trioxide (As(2)O(3); ATO, TRISENOX®) is used to treat patients with refractory or relapsed acute promyelocytic leukaemia while its application for treatment of solid cancers like glioblastoma is still under evaluation. In the present study, we investigated the interaction of arsenic trioxide with metallothionein (MT) isoforms as a possible (protective response) resistance of glioblastoma cells to arsenic-induced cytotoxicity. Special attention was focused on MT3, the isoform expressed mainly in the brain. MT3 has low metal inducibility, fast metal binding/releasing properties and outstanding neuronal inhibitory activity. The human astrocytoma (glioblastoma) cell line U87 MG was treated with 0.6, 2 and 6-7 μM arsenic (equivalent to 0.3, 1 and 3-3.5 μM As(2)O(3)) for 12, 24 or 48 h and gene expression for different MT isoforms, namely MT2A, MT1A, MT1F, MT1X, MT1E and MT3, was measured by real time qPCR using SYBR Green I and Taqman® gene expression assays. TfR, 18S rRNA, GAPDH and AB were tested as reference genes, and the last two evaluated to be appropriate in conditions of low (GAPDH) and high (AB) arsenic exposure. The gene expression of MT3 gene was additionally tested and confirmed by restriction enzyme analysis with PvuII. In the given conditions the mRNAs of six MT isoforms were identified in human glioblastoma cell line U87 MG. Depending on arsenic exposure conditions, an increase or decrease of MT gene expression was observed for each isoform, with the highest increase for isoforms MT1X, MT1F and MT2A mRNA (up to 13-fold) and more persistent decreases for MT1A, MT1E and MT3 mRNA. Despite the common assumption of the noninducibility of MT3, the evident MT3 mRNA increase was observed during high As exposure (up to 4-fold). In conclusion, our results clearly demonstrate the influence of As on MT isoform gene expression. The MT1X, MT1F and MT2A increase could represent brain tumour acquired resistance to As cytotoxicity while the MT3 increase is more enigmatic, with its possible involvement in arsenic-related induction of type II cell death.
Itakura, Masanori; Nakajima, Hidemitsu; Semi, Yuko; Higashida, Shusaku; Azuma, Yasu-Taka; Takeuchi, Tadayoshi
2015-11-13
The glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has multiple functions, including mediating oxidative stress-induced neuronal cell death. This process is associated with disulfide-bonded GAPDH aggregation. Some reports suggest a link between GAPDH and the pathogenesis of several oxidative stress-related diseases. However, the pathological significance of GAPDH aggregation in disease pathogenesis remains unclear due to the lack of an effective GAPDH aggregation inhibitor. In this study, we identified a GAPDH aggregation inhibitor (GAI) peptide and evaluated its biological profile. The decapeptide GAI specifically inhibited GAPDH aggregation in a concentration-dependent manner. Additionally, the GAI peptide did not affect GAPDH glycolytic activity or cell viability. The GAI peptide also exerted a protective effect against oxidative stress-induced cell death in SH-SY5Y cells. This peptide could potentially serve as a tool to investigate GAPDH aggregation-related neurodegenerative and neuropsychiatric disorders and as a possible therapy for diseases associated with oxidative stress-induced cell death. Copyright © 2015 Elsevier Inc. All rights reserved.
Samson, Andre L.; Knaupp, Anja S.; Kass, Itamar; Kleifeld, Oded; Marijanovic, Emilia M.; Hughes, Victoria A.; Lupton, Chris J.; Buckle, Ashley M.; Bottomley, Stephen P.; Medcalf, Robert L.
2014-01-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a ubiquitous and abundant protein that participates in cellular energy production. GAPDH normally exists in a soluble form; however, following necrosis, GAPDH and numerous other intracellular proteins convert into an insoluble disulfide-cross-linked state via the process of “nucleocytoplasmic coagulation.” Here, free radical-induced aggregation of GAPDH was studied as an in vitro model of nucleocytoplasmic coagulation. Despite the fact that disulfide cross-linking is a prominent feature of GAPDH aggregation, our data show that it is not a primary rate-determining step. To identify the true instigating event of GAPDH misfolding, we mapped the post-translational modifications that arise during its aggregation. Solvent accessibility and energy calculations of the mapped modifications within the context of the high resolution native GAPDH structure suggested that oxidation of methionine 46 may instigate aggregation. We confirmed this by mutating methionine 46 to leucine, which rendered GAPDH highly resistant to free radical-induced aggregation. Molecular dynamics simulations suggest that oxidation of methionine 46 triggers a local increase in the conformational plasticity of GAPDH that likely promotes further oxidation and eventual aggregation. Hence, methionine 46 represents a “linchpin” whereby its oxidation is a primary event permissive for the subsequent misfolding, aggregation, and disulfide cross-linking of GAPDH. A critical role for linchpin residues in nucleocytoplasmic coagulation and other forms of free radical-induced protein misfolding should now be investigated. Furthermore, because disulfide-cross-linked aggregates of GAPDH arise in many disorders and because methionine 46 is irrelevant to native GAPDH function, mutation of methionine 46 in models of disease should allow the unequivocal assessment of whether GAPDH aggregation influences disease progression. PMID:25086035
Vaiphei, S Thangminlal; Keppen, Joshua; Nongrum, Saibadaiahun; Chaubey, R C; Kma, L; Sharan, R N
2015-01-01
In gene expression studies, it is critical to normalize data using a stably expressed endogenous control gene in order to obtain accurate and reliable results. However, we currently do not have a universally applied endogenous control gene for normalization of data for gene expression studies, particularly those involving (60)Co γ-ray-exposed human blood samples. In this study, a comparative assessment of the gene expression of six widely used housekeeping endogenous control genes, namely 18S, ACTB, B2M, GAPDH, MT-ATP6 and CDKN1A, was undertaken for a range of (60)Co γ-ray doses (0.5, 1.0, 2.0 and 4.0 Gy) at 8.4 Gy min(-1) at 0 and 24 h post-irradiation time intervals. Using the NormFinder algorithm, real-time PCR data obtained from six individuals (three males and three females) were analyzed with respect to the threshold cycle (Ct) value and abundance, ΔCt pair-wise comparison, intra- and inter-group variability assessments, etc. GAPDH, either alone or in combination with 18S, was found to be the most suitable endogenous control gene and should be used in gene expression studies, especially those involving qPCR of γ-ray-exposed human blood samples. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.
Barinova, K V; Serebryakova, M V; Muronetz, V I; Schmalhausen, E V
2017-12-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic protein involved in numerous non-glycolytic functions. S-glutathionylated GAPDH was revealed in plant and animal tissues. The role of GAPDH S-glutathionylation is not fully understood. Rabbit muscle GAPDH was S-glutathionylated in the presence of H 2 O 2 and reduced glutathione (GSH). The modified protein was assayed by MALDI-MS analysis, differential scanning calorimetry, dynamic light scattering, and ultracentrifugation. Incubation of GAPDH in the presence of H 2 O 2 together with GSH resulted in the complete inactivation of the enzyme. In contrast to irreversible oxidation of GAPDH by H 2 O 2 , this modification could be reversed in the excess of GSH or dithiothreitol. By data of MALDI-MS analysis, the modified protein contained both mixed disulfide between Cys150 and GSH and the intrasubunit disulfide bond between Cys150 and Cys154 (different subunits of tetrameric GAPDH may contain different products). S-glutathionylation results in loosening of the tertiary structure of GAPDH, decreases its affinity to NAD + and thermal stability. The mixed disulfide between Cys150 and GSH is an intermediate product of S-glutathionylation: its subsequent reaction with Cys154 results in the intrasubunit disulfide bond in the active site of GAPDH. The mixed disulfide and the C150-C154 disulfide bond protect GAPDH from irreversible oxidation and can be reduced in the excess of thiols. Conformational changes that were observed in S-glutathionylated GAPDH may affect interactions between GAPDH and other proteins (ligands), suggesting the role of S-glutathionylation in the redox signaling. The manuscript considers one of the possible mechanisms of redox regulation of cell functions. Copyright © 2017 Elsevier B.V. All rights reserved.
Sinha, Pallavi; Singh, Vikas K.; Suryanarayana, V.; Krishnamurthy, L.; Saxena, Rachit K.; Varshney, Rajeev K.
2015-01-01
Gene expression analysis using quantitative real-time PCR (qRT-PCR) is a very sensitive technique and its sensitivity depends on the stable performance of reference gene(s) used in the study. A number of housekeeping genes have been used in various expression studies in many crops however, their expression were found to be inconsistent under different stress conditions. As a result, species specific housekeeping genes have been recommended for different expression studies in several crop species. However, such specific housekeeping genes have not been reported in the case of pigeonpea (Cajanus cajan) despite the fact that genome sequence has become available for the crop. To identify the stable housekeeping genes in pigeonpea for expression analysis under drought stress conditions, the relative expression variations of 10 commonly used housekeeping genes (EF1α, UBQ10, GAPDH, 18SrRNA, 25SrRNA, TUB6, ACT1, IF4α, UBC and HSP90) were studied on root, stem and leaves tissues of Asha (ICPL 87119). Three statistical algorithms geNorm, NormFinder and BestKeeper were used to define the stability of candidate genes. geNorm analysis identified IF4α and TUB6 as the most stable housekeeping genes however, NormFinder analysis determined IF4α and HSP90 as the most stable housekeeping genes under drought stress conditions. Subsequently validation of the identified candidate genes was undertaken in qRT-PCR based gene expression analysis of uspA gene which plays an important role for drought stress conditions in pigeonpea. The relative quantification of the uspA gene varied according to the internal controls (stable and least stable genes), thus highlighting the importance of the choice of as well as validation of internal controls in such experiments. The identified stable and validated housekeeping genes will facilitate gene expression studies in pigeonpea especially under drought stress conditions. PMID:25849964
Sinha, Pallavi; Singh, Vikas K; Suryanarayana, V; Krishnamurthy, L; Saxena, Rachit K; Varshney, Rajeev K
2015-01-01
Gene expression analysis using quantitative real-time PCR (qRT-PCR) is a very sensitive technique and its sensitivity depends on the stable performance of reference gene(s) used in the study. A number of housekeeping genes have been used in various expression studies in many crops however, their expression were found to be inconsistent under different stress conditions. As a result, species specific housekeeping genes have been recommended for different expression studies in several crop species. However, such specific housekeeping genes have not been reported in the case of pigeonpea (Cajanus cajan) despite the fact that genome sequence has become available for the crop. To identify the stable housekeeping genes in pigeonpea for expression analysis under drought stress conditions, the relative expression variations of 10 commonly used housekeeping genes (EF1α, UBQ10, GAPDH, 18SrRNA, 25SrRNA, TUB6, ACT1, IF4α, UBC and HSP90) were studied on root, stem and leaves tissues of Asha (ICPL 87119). Three statistical algorithms geNorm, NormFinder and BestKeeper were used to define the stability of candidate genes. geNorm analysis identified IF4α and TUB6 as the most stable housekeeping genes however, NormFinder analysis determined IF4α and HSP90 as the most stable housekeeping genes under drought stress conditions. Subsequently validation of the identified candidate genes was undertaken in qRT-PCR based gene expression analysis of uspA gene which plays an important role for drought stress conditions in pigeonpea. The relative quantification of the uspA gene varied according to the internal controls (stable and least stable genes), thus highlighting the importance of the choice of as well as validation of internal controls in such experiments. The identified stable and validated housekeeping genes will facilitate gene expression studies in pigeonpea especially under drought stress conditions.
Validation of Endogenous Internal Real-Time PCR Controls in Renal Tissues
Cui, Xiangqin; Zhou, Juling; Qiu, Jing; Johnson, Martin R.; Mrug, Michal
2009-01-01
Background Endogenous internal controls (‘reference’ or ‘housekeeping’ genes) are widely used in real-time PCR (RT-PCR) analyses. Their use relies on the premise of consistently stable expression across studied experimental conditions. Unfortunately, none of these controls fulfills this premise across a wide range of experimental conditions; consequently, none of them can be recommended for universal use. Methods To determine which endogenous RT-PCR controls are suitable for analyses of renal tissues altered by kidney disease, we studied the expression of 16 commonly used ‘reference genes’ in 7 mildly and 7 severely affected whole kidney tissues from a well-characterized cystic kidney disease model. Expression levels of these 16 genes, determined by TaqMan® RT-PCR analyses and Affymetrix GeneChip® arrays, were normalized and tested for overall variance and equivalence of the means. Results Both statistical approaches and both TaqMan- and GeneChip-based methods converged on 3 out of the 4 top-ranked genes (Ppia, Gapdh and Pgk1) that had the most constant expression levels across the studied phenotypes. Conclusion A combination of the top-ranked genes will provide a suitable endogenous internal control for similar studies of kidney tissues across a wide range of disease severity. PMID:19729889
Martínez, Irene; Zhu, Jiangfeng; Lin, Henry; Bennett, George N; San, Ka-Yiu
2008-11-01
Reactions requiring reducing equivalents, NAD(P)H, are of enormous importance for the synthesis of industrially valuable compounds such as carotenoids, polymers, antibiotics and chiral alcohols among others. The use of whole-cell biocatalysis can reduce process cost by acting as catalyst and cofactor regenerator at the same time; however, product yields might be limited by cofactor availability within the cell. Thus, our study focussed on the genetic manipulation of a whole-cell system by modifying metabolic pathways and enzymes to improve the overall production process. In the present work, we genetically engineered an Escherichia coli strain to increase NADPH availability to improve the productivity of products that require NADPH in its biosynthesis. The approach involved an alteration of the glycolysis step where glyceraldehyde-3-phosphate (GAP) is oxidized to 1,3 bisphophoglycerate (1,3-BPG). This reaction is catalyzed by NAD-dependent endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) encoded by the gapA gene. We constructed a recombinant E. coli strain by replacing the native NAD-dependent gapA gene with a NADP-dependent GAPDH from Clostridium acetobutylicum, encoded by the gene gapC. The beauty of this approach is that the recombinant E. coli strain produces 2 mol of NADPH, instead of NADH, per mole of glucose consumed. Metabolic flux analysis showed that the flux through the pentose phosphate (PP) pathway, one of the main pathways that produce NADPH, was reduced significantly in the recombinant strain when compared to that of the parent strain. The effectiveness of the NADPH enhancing system was tested using the production of lycopene and epsilon-caprolactone as model systems using two different background strains. The recombinant strains, with increased NADPH availability, consistently showed significant higher productivity than the parent strains.
Hu, Yue; Zhang, Erhong; Huang, Lisi; Li, Wenfang; Liang, Pei; Wang, Xiaoyun; Xu, Jin; Huang, Yan; Yu, Xinbing
2014-12-01
Globally, 15-20 million people are infected with Clonorchis sinensis (C. sinensis) which results in clonorchiasis. In China, clonorchiasis is considered to be one of the fastest-growing food-borne parasitic diseases. That more key molecules of C. sinensis are characterized will be helpful to understand biology and pathogenesis of the carcinogenic liver fluke. Glyceraldehyde-3-phosphate dehydrogenases (GAPDHs) from many species have functions other than their catalytic role in glycolysis. In the present study, we analyzed the sequence and structure of GAPDH from C. sinensis (CsGAPDH) by using bioinformatics tools and obtained its recombinant protein by prokaryotic expression system, to learn its expression profiles and molecular property. CsGAPDH could bind to human intrahepatic biliary epithelial cell in vivo and in vitro by the method of immunofluorescence assays. CsGAPDH also disturbed in lumen of biliary tract near to the parasite in the liver of infected rat. Western blotting analysis together with immunofluorescence assay indicated that CsGAPDH was a component of excretory/secretory proteins (CsESPs) and a surface-localized protein of C. sinensis. Quantitative real-time PCR (Q-PCR) and Western blotting demonstrated that CsGAPDHs are expressed at the life stages of adult worm, metacercaria, and egg, but the expression levels were different from each other. Recombinant CsGAPDH (rCsGAPDH) was confirmed to have the capacity to catalyze the conversion of glyceraldehyde 3-phosphate to D-glycerate 1,3-bisphosphate which was inhibited by AMP in a dose-dependent manner. In addition, rCsGAPDH was able to interact with human plasminogen in a dose-dependent manner by ELISA. The interaction could be inhibited by lysine. The plasminogen binding capacity of rCsGAPDH along with the distribution of CsGAPDH in vivo and in the liver of C. sinensis-infected rat hinted that surface-localized CsGAPDH might play an important role in host invasion of the worm besides its glycolytic activity. Our work will be a cornerstone for getting more messages about CsGAPDH and its role in biology and parasitism of C. sinensis.
2012-01-01
Background Host proteins are incorporated inside human immunodeficiency virus type 1 (HIV-1) virions during assembly and can either positively or negatively regulate HIV-1 infection. Although the identification efficiency of host proteins is improved by mass spectrometry, how those host proteins affect HIV-1 replication has not yet been fully clarified. Results In this study, we show that virion-associated glyceraldehyde 3-phosphate dehydrogenase (GAPDH) does not allosterically inactivate HIV-1 reverse transcriptase (RT) but decreases the efficiency of reverse transcription reactions by decreasing the packaging efficiency of lysyl-tRNA synthetase (LysRS) and tRNALys3 into HIV-1 virions. Two-dimensional (2D) gel electrophoresis demonstrated that some isozymes of GAPDH with different isoelectric points were expressed in HIV-1-producing CEM/LAV-1 cells, and a proportion of GAPDH was selectively incorporated into the virions. Suppression of GAPDH expression by RNA interference in CEM/LAV-1 cells resulted in decreased GAPDH packaging inside the virions, and the GAPDH-packaging-defective virus maintained at least control levels of viral production but increased the infectivity. Quantitative analysis of reverse transcription products indicated that the levels of early cDNA products of the GAPDH-packaging-defective virus were higher than those of the control virus owing to the higher packaging efficiencies of LysRS and tRNALys3 into the virions rather than the GAPDH-dependent negative allosteric modulation for RT. Furthermore, immunoprecipitation assay using an anti-GAPDH antibody showed that GAPDH directly interacted with Pr55gag and p160gag-pol and the overexpression of LysRS in HIV-1-producing cells resulted in a decrease in the efficiency of GAPDH packaging in HIV particles. In contrast, the viruses produced from cells expressing a high level of GAPDH showed decreased infectivity in TZM-bl cells and reverse transcription efficiency in TZM-bl cells and peripheral blood mononuclear cells (PBMCs). Conclusions These findings indicate that GAPDH negatively regulates HIV-1 infection and provide insights into a novel function of GAPDH in the HIV-1 life cycle and a new host defense mechanism against HIV-1 infection. PMID:23237566
Butterfield, D Allan; Hardas, Sarita S; Lange, Miranda L Bader
2010-01-01
Recently, the oxidoreductase, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), has become a subject of interest as more and more studies reveal a surfeit of diverse GAPDH functions, extending beyond traditional aerobic metabolism of glucose. As a result of multiple isoforms and cellular locales, GAPDH is able to come in contact with a variety of small molecules, proteins, membranes, etc., that play important roles in normal and pathologic cell function. Specifically, GAPDH has been shown to interact with neurodegenerative disease-associated proteins, including the amyloid-beta protein precursor (AbetaPP). Studies from our laboratory have shown significant inhibition of GAPDH dehydrogenase activity in Alzheimer's disease (AD) brain due to oxidative modification. Although oxidative stress and damage is a common phenomenon in the AD brain, it would seem that inhibition of glycolytic enzyme activity is merely one avenue in which AD pathology affects neuronal cell development and survival, as oxidative modification can also impart a toxic gain-of-function to many proteins, including GAPDH. In this review, we examine the many functions of GAPDH with respect to AD brain; in particular, the apparent role(s) of GAPDH in AD-related apoptotic cell death is emphasized.
Del Giudice, Alessandra; Pavel, Nicolae Viorel; Galantini, Luciano; Falini, Giuseppe; Trost, Paolo; Fermani, Simona; Sparla, Francesca
2015-12-01
Oxygenic photosynthetic organisms produce sugars through the Calvin-Benson cycle, a metabolism that is tightly linked to the light reactions of photosynthesis and is regulated by different mechanisms, including the formation of protein complexes. Two enzymes of the cycle, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK), form a supramolecular complex with the regulatory protein CP12 with the formula (GAPDH-CP122-PRK)2, in which both enzyme activities are transiently inhibited during the night. Small-angle X-ray scattering analysis performed on both the GAPDH-CP12-PRK complex and its components, GAPDH-CP12 and PRK, from Arabidopsis thaliana showed that (i) PRK has an elongated, bent and screwed shape, (ii) the oxidized N-terminal region of CP12 that is not embedded in the GAPDH-CP12 complex prefers a compact conformation and (iii) the interaction of PRK with the N-terminal region of CP12 favours the approach of two GAPDH tetramers. The interaction between the GAPDH tetramers may contribute to the overall stabilization of the GAPDH-CP12-PRK complex, the structure of which is presented here for the first time.
Sahu, Shriya; Philip, Finly; Scarlata, Suzanne
2014-01-01
C3PO plays a key role in promoting RNA-induced gene silencing. C3PO consists of two subunits of the endonuclease translin-associated factor X (TRAX) and six subunits of the nucleotide-binding protein translin. We have found that TRAX binds strongly to phospholipase Cβ (PLCβ), which transmits G protein signals from many hormones and sensory inputs. The association between PLCβ and TRAX is thought to underlie the ability of PLCβ to reverse gene silencing by small interfering RNAs. However, this reversal only occurs for some genes (e.g. GAPDH and LDH) but not others (e.g. Hsp90 and cyclophilin A). To understand this specificity, we carried out studies using fluorescence-based methods. In cells, we find that PLCβ, TRAX, and their complexes are identically distributed through the cytosol suggesting that selectivity is not due to large scale sequestration of either the free or complexed proteins. Using purified proteins, we find that PLCβ binds ∼5-fold more weakly to translin than to TRAX but ∼2-fold more strongly to C3PO. PLCβ does not alter TRAX-translin assembly to C3PO, and brightness studies suggest one PLCβ binds to one C3PO octamer without a change in the number of TRAX/translin molecules suggesting that PLCβ binds to an external site. Functionally, we find that C3PO hydrolyzes siRNA(GAPDH) at a faster rate than siRNA(Hsp90). However, when PLCβ is bound to C3PO, the hydrolysis rate of siRNA(GAPDH) becomes comparable with siRNA(Hsp90). Our results show that the selectivity of PLCβ toward certain genes lies in the rate at which the RNA is hydrolyzed by C3PO. PMID:24338081
Chang, Chunmei; Su, Hua; Zhang, Danhong; Wang, Yusha; Shen, Qiuhong; Liu, Bo; Huang, Rui; Zhou, Tianhua; Peng, Chao; Wong, Catherine C L; Shen, Han-Ming; Lippincott-Schwartz, Jennifer; Liu, Wei
2015-12-17
Eukaryotes initiate autophagy to cope with the lack of external nutrients, which requires the activation of the nicotinamide adenine dinucleotide (NAD(+))-dependent deacetylase Sirtuin 1 (Sirt1). However, the mechanisms underlying the starvation-induced Sirt1 activation for autophagy initiation remain unclear. Here, we demonstrate that glyceraldehyde 3-phosphate dehydrogenase (GAPDH), a conventional glycolytic enzyme, is a critical mediator of AMP-activated protein kinase (AMPK)-driven Sirt1 activation. Under glucose starvation, but not amino acid starvation, cytoplasmic GAPDH is phosphorylated on Ser122 by activated AMPK. This causes GAPDH to redistribute into the nucleus. Inside the nucleus, GAPDH interacts directly with Sirt1, displacing Sirt1's repressor and causing Sirt1 to become activated. Preventing this shift of GAPDH abolishes Sirt1 activation and autophagy, while enhancing it, through overexpression of nuclear-localized GAPDH, increases Sirt1 activation and autophagy. GAPDH is thus a pivotal and central regulator of autophagy under glucose deficiency, undergoing AMPK-dependent phosphorylation and nuclear translocation to activate Sirt1 deacetylase activity. Copyright © 2015 Elsevier Inc. All rights reserved.
Li, Zhenyu; Xu, Xiaoshuang; Peng, Bing; Qin, Xuemei; Du, Guanhua
2014-01-01
Background The dried root of Polygala tenuifolia, named Radix Polygalae, is a well-known traditional Chinese medicine. Triterpenoid saponins are some of the most important components of Radix Polygalae extracts and are widely studied because of their valuable pharmacological properties. However, the relationship between gene expression and triterpenoid saponin biosynthesis in P. tenuifolia is unclear. Methodology/Findings In this study, ultra-performance liquid chromatography (UPLC) coupled with quadrupole time-of-flight mass spectrometry (Q-TOF MS)-based metabolomic analysis was performed to identify and quantify the different chemical constituents of the roots, stems, leaves, and seeds of P. tenuifolia. A total of 22 marker compounds (VIP>1) were explored, and significant differences in all 7 triterpenoid saponins among the different tissues were found. We also observed an efficient reference gene GAPDH for different tissues in this plant and determined the expression level of some genes in the triterpenoid saponin biosynthetic pathway. Results showed that MVA pathway has more important functions in the triterpenoid saponin biosynthesis of P. tenuifolia. The expression levels of squalene synthase (SQS), squalene monooxygenase (SQE), and beta-amyrin synthase (β-AS) were highly correlated with the peak area intensity of triterpenoid saponins compared with data from UPLC/Q-TOF MS-based metabolomic analysis. Conclusions/Significance This finding suggested that a combination of UPLC/Q-TOF MS-based metabolomics and gene expression analysis can effectively elucidate the mechanism of triterpenoid saponin biosynthesis and can provide useful information on gene discovery. These findings can serve as a reference for using the overexpression of genes encoding for SQS, SQE, and/or β-AS to increase the triterpenoid saponin production of P. tenuifolia. PMID:25148032
Zhang, Fusheng; Li, Xiaowei; Li, Zhenyu; Xu, Xiaoshuang; Peng, Bing; Qin, Xuemei; Du, Guanhua
2014-01-01
The dried root of Polygala tenuifolia, named Radix Polygalae, is a well-known traditional Chinese medicine. Triterpenoid saponins are some of the most important components of Radix Polygalae extracts and are widely studied because of their valuable pharmacological properties. However, the relationship between gene expression and triterpenoid saponin biosynthesis in P. tenuifolia is unclear. In this study, ultra-performance liquid chromatography (UPLC) coupled with quadrupole time-of-flight mass spectrometry (Q-TOF MS)-based metabolomic analysis was performed to identify and quantify the different chemical constituents of the roots, stems, leaves, and seeds of P. tenuifolia. A total of 22 marker compounds (VIP>1) were explored, and significant differences in all 7 triterpenoid saponins among the different tissues were found. We also observed an efficient reference gene GAPDH for different tissues in this plant and determined the expression level of some genes in the triterpenoid saponin biosynthetic pathway. Results showed that MVA pathway has more important functions in the triterpenoid saponin biosynthesis of P. tenuifolia. The expression levels of squalene synthase (SQS), squalene monooxygenase (SQE), and beta-amyrin synthase (β-AS) were highly correlated with the peak area intensity of triterpenoid saponins compared with data from UPLC/Q-TOF MS-based metabolomic analysis. This finding suggested that a combination of UPLC/Q-TOF MS-based metabolomics and gene expression analysis can effectively elucidate the mechanism of triterpenoid saponin biosynthesis and can provide useful information on gene discovery. These findings can serve as a reference for using the overexpression of genes encoding for SQS, SQE, and/or β-AS to increase the triterpenoid saponin production of P. tenuifolia.
Ávila, César L; Torres-Bugeau, Clarisa M; Barbosa, Leandro R S; Sales, Elisa Morandé; Ouidja, Mohand O; Socías, Sergio B; Celej, M Soledad; Raisman-Vozari, Rita; Papy-Garcia, Dulce; Itri, Rosangela; Chehín, Rosana N
2014-05-16
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a multifunctional enzyme that has been associated with neurodegenerative diseases. GAPDH colocalizes with α-synuclein in amyloid aggregates in post-mortem tissue of patients with sporadic Parkinson disease and promotes the formation of Lewy body-like inclusions in cell culture. In a previous work, we showed that glycosaminoglycan-induced GAPDH prefibrillar species accelerate the conversion of α-synuclein to fibrils. However, it remains to be determined whether the interplay among glycosaminoglycans, GAPDH, and α-synuclein has a role in pathological states. Here, we demonstrate that the toxic effect exerted by α-synuclein oligomers in dopaminergic cell culture is abolished in the presence of GAPDH prefibrillar species. Structural analysis of prefibrillar GAPDH performed by small angle x-ray scattering showed a particle compatible with a protofibril. This protofibril is shaped as a cylinder 22 nm long and a cross-section diameter of 12 nm. Using biocomputational techniques, we obtained the first all-atom model of the GAPDH protofibril, which was validated by cross-linking coupled to mass spectrometry experiments. Because GAPDH can be secreted outside the cell where glycosaminoglycans are present, it seems plausible that GAPDH protofibrils could be assembled in the extracellular space kidnapping α-synuclein toxic oligomers. Thus, the role of GAPDH protofibrils in neuronal proteostasis must be considered. The data reported here could open alternative ways in the development of therapeutic strategies against synucleinopathies like Parkinson disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Fokina, K V; Dainyak, M B; Nagradova, N K; Muronetz, V I
1997-09-15
The ability of D-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzing the reaction of 1,3-diphosphoglycerate synthesis in human erythrocytes to form complexes with enzymes which use this metabolite as substrate (3-phosphoglycerate kinase (3-PGK) or 2,3-diphosphoglycerate mutase (2,3-DPGM)) was studied. It was found that highly active 2,3-DPGM can be extracted from human erythrocyte hemolysates in a complex with GAPDH adsorbed on Sepharose-bound anti-GAPDH antibodies at pH 6.5, the molar ratio being one 2,3-GPGM subunit per subunit of GAPDH. No complexation was, however, detected at pH 8.0. The opposite was true for the interaction between GAPDH and 3-PGK, which could be observed at pH 8.0. In experiments carried out at pH 7.4, both GAPDH x 2,3-DPGM and GAPGH x 3-PGK complexes were detected. The Kd values of the complexes determined with purified enzyme preparations were in the range 2.40-2.48 microM for both the GAPDH x 2,3-DPGM and GAPGH x 3-PGK enzyme pairs, when titrations of GAPDH covalently bound to CNBr-activated Sepharose were performed by the soluble 2,3-DPGM or 3-PGK. If, however, GAPDH adsorbed on the specific antibodies covalently bound to Sepharose was used in the titration experiments, the Kd for the GAPDH x 2,3-DPGM complex was found to be 0.54 microM, and the Kd for the GAPDH x 3-PGK complex was 0.49 microM. The concentration of 2,3-diphosphoglycerate determined after 1 h of incubation of erythrocytes in the presence of glucose was found to increase 1.5-fold if the incubation was carried out at pH 6.5, but did not change upon incubation at pH 8.0. On the other hand, the concentration of 3-phosphoglycerate after incubation at pH 8.0 was twice as large as that found after incubation at pH 6.5. The results are interpreted on the hypothesis that specific protein-protein interactions between GAPDH and 2,3-DPGM or between GAPDH and 3-PGK may play a role in determining the fate of 1,3-diphosphoglycerate produced in the GAPDH-catalyzed reaction.
TPD52: A Novel Vaccine Target for Prostate Cancer
2009-09-01
Headquarters Services , Directorate for Information Operations and Reports (0704-0188), 1215 Jefferson Davis Highway, Suite 1204, Arlington, VA 22202- 4302...3T3 and 3T3.V (transfected with empty vector) served as negative controls. GAPDH expression served as an internal reference control. B. Western blot... internal reference control. Representative of three separate experiments. Murine TPD52–Induced Metastasis Mol Cancer Res 2007;5(2). February 2007 135 To
Gu, Y R; Li, M Z; Zhang, K; Chen, L; Jiang, A A; Wang, J Y; Li, X W
2011-08-01
To normalize a set of quantitative real-time PCR (q-PCR) data, it is essential to determine an optimal number/set of housekeeping genes, as the abundance of housekeeping genes can vary across tissues or cells during different developmental stages, or even under certain environmental conditions. In this study, of the 20 commonly used endogenous control genes, 13, 18 and 17 genes exhibited credible stability in 56 different tissues, 10 types of adipose tissue and five types of muscle tissue, respectively. Our analysis clearly showed that three optimal housekeeping genes are adequate for an accurate normalization, which correlated well with the theoretical optimal number (r ≥ 0.94). In terms of economical and experimental feasibility, we recommend the use of the three most stable housekeeping genes for calculating the normalization factor. Based on our results, the three most stable housekeeping genes in all analysed samples (TOP2B, HSPCB and YWHAZ) are recommended for accurate normalization of q-PCR data. We also suggest that two different sets of housekeeping genes are appropriate for 10 types of adipose tissue (the HSPCB, ALDOA and GAPDH genes) and five types of muscle tissue (the TOP2B, HSPCB and YWHAZ genes), respectively. Our report will serve as a valuable reference for other studies aimed at measuring tissue-specific mRNA abundance in porcine samples. © 2011 Blackwell Verlag GmbH.
Lloyd, Julie C.; Raines, Christine A.
2011-01-01
In darkened leaves the Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) form a regulatory multi-enzyme complex with the small chloroplast protein CP12. GAPDH also forms a high molecular weight regulatory mono-enzyme complex. Given that there are different reports as to the number and subunit composition of these complexes and that enzyme regulatory mechanisms are known to vary between species, it was reasoned that protein–protein interactions may also vary between species. Here, this variation is investigated. This study shows that two different tetramers of GAPDH (an A2B2 heterotetramer and an A4 homotetramer) have the capacity to form part of the PRK/GAPDH/CP12 complex. The role of the PRK/GAPDH/CP12 complex is not simply to regulate the ‘non-regulatory’ A4 GAPDH tetramer. This study also demonstrates that the abundance and nature of PRK/GAPDH/CP12 interactions are not equal in all species and that whilst NAD enhances complex formation in some species, this is not sufficient for complex formation in others. Furthermore, it is shown that the GAPDH mono-enzyme complex is more abundant as a 2(A2B2) complex, rather than the larger 4(A2B2) complex. This smaller complex is sensitive to cellular metabolites indicating that it is an important regulatory isoform of GAPDH. This comparative study has highlighted considerable heterogeneity in PRK and GAPDH protein interactions between closely related species and the possible underlying physiological basis for this is discussed. PMID:21498632
Howard, Thomas P; Lloyd, Julie C; Raines, Christine A
2011-07-01
In darkened leaves the Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) form a regulatory multi-enzyme complex with the small chloroplast protein CP12. GAPDH also forms a high molecular weight regulatory mono-enzyme complex. Given that there are different reports as to the number and subunit composition of these complexes and that enzyme regulatory mechanisms are known to vary between species, it was reasoned that protein-protein interactions may also vary between species. Here, this variation is investigated. This study shows that two different tetramers of GAPDH (an A2B2 heterotetramer and an A4 homotetramer) have the capacity to form part of the PRK/GAPDH/CP12 complex. The role of the PRK/GAPDH/CP12 complex is not simply to regulate the 'non-regulatory' A4 GAPDH tetramer. This study also demonstrates that the abundance and nature of PRK/GAPDH/CP12 interactions are not equal in all species and that whilst NAD enhances complex formation in some species, this is not sufficient for complex formation in others. Furthermore, it is shown that the GAPDH mono-enzyme complex is more abundant as a 2(A2B2) complex, rather than the larger 4(A2B2) complex. This smaller complex is sensitive to cellular metabolites indicating that it is an important regulatory isoform of GAPDH. This comparative study has highlighted considerable heterogeneity in PRK and GAPDH protein interactions between closely related species and the possible underlying physiological basis for this is discussed.
Tang, Zhenjie; Yuan, Shuqiang; Hu, Yumin; Zhang, Hui; Wu, Wenjing; Zeng, Zhaolei; Yang, Jing; Yun, Jingping; Xu, Ruihua; Huang, Peng
2012-02-01
It has long been observed that many cancer cells exhibit increased aerobic glycolysis and rely more on this pathway to generate ATP and metabolic intermediates for cell proliferation. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme in glycolysis and has been known as a housekeeping molecule. In the present study, we found that GAPDH expression was significantly up-regulated in human colorectal carcinoma tissues compared to the adjacent normal tissues, and also increased in colon cancer cell lines compared to the non-tumor colon mucosa cells in culture. The expression of GAPDH was further elevated in the liver metastatic tissues compared to the original colon cancer tissue of the same patients, suggesting that high expression of GAPDH might play an important role in colon cancer development and metastasis. Importantly, we found that 3-bromopyruvate propyl ester (3-BrOP) preferentially inhibited GAPDH and exhibited potent activity in inducing colon cancer cell death by causing severe depletion of ATP. 3-BrOP at low concentrations (1-10 μM) inhibited GAPDH and a much higher concentration (300 μM) was required to inhibit hexokinase-2. The cytotoxic effect of 3-BrOP was associated with its inhibition of GAPDH, and colon cancer cells with loss of p53 were more sensitive to this compound. Our study suggests that GAPDH may be a potential target for colon cancer therapy.
Wu, Yonghong; Wu, Min; He, Guowei; Zhang, Xiao; Li, Weiguang; Gao, Yan; Li, Zhihui; Wang, Zhaoyan; Zhang, Chenggang
2012-04-01
In the current study, we examined the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein in a number of organisms and the stability of GAPDH under various conditions. Our results revealed that GAPDH is present in multiple Escherichia coli strains, the yeast strain GS115, Caenorhabditis elegans, rat PC12 cells, and both mouse and rat brain. Furthermore, GAPDH was stably expressed under different concentrations of inducer and at different times of induction in E. coli (BL21) cells and yeast GS115 cells. Stable expression of GAPDH protein was also observed in C.elegans and PC12 cells that were treated with different concentrations of paraquat or sodium sulfite, respectively. In addition, we were able to detect and identify the endogenous gapA protein in E.coli via immunoprecipitation and MALDI-TOF-MS analysis. Endogenous gapA protein and exogenously expressed (subcloned) GAPDH proteins were detected in E. coli BL21 but not for gapC. With the exception of gapC in E. coli, the various isoforms of GAPDH possessed enzymatic activity. Finally, sequence analysis revealed that the GAPDH proteins were 76% identical, with the exception of E. coli gapC. Taken together, our results indicate that GAPDH could be universally used as an internal control for the Western blot analysis of prokaryotic and eukaryotic samples. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.
Seabra, Amedea B; Ouellet, Marc; Antonic, Marija; Chrétien, Michelle N; English, Ann M
2013-11-30
Vascular relaxation to nitroglycerin (glyceryl trinitrate; GTN) requires its bioactivation by mechanisms that remain controversial. We report here that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzes the release of nitrite from GTN. In assays containing dithiothreitol (DTT) and NAD(+), the GTN reductase activity of purified GAPDH produces nitrite and 1,2-GDN as the major products. A vmax of 2.6nmolmin(-)(1)mg(-)(1) was measured for nitrite production by GAPDH from rabbit muscle and a GTN KM of 1.2mM. Reductive denitration of GTN in the absence of DTT results in dose- and time-dependent inhibition of GAPDH dehydrogenase activity. Disulfiram, a thiol-modifying drug, inhibits both the dehydrogenase and GTN reductase activity of GAPDH, while DTT or tris(2-carboxyethyl)phosphine reverse the GTN-induced inhibition. Incubation of intact human erythrocytes or hemolysates with 2mM GTN for 60min results in 50% inhibition of GAPDH's dehydrogenase activity, indicating that GTN is taken up by these cells and that the dehydrogenase is a target of GTN. Thus, erythrocyte GAPDH may contribute to GTN bioactivation. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.
Danshina, Polina V.; Qu, Weidong; Temple, Brenda R.; Rojas, Rafael J.; Miley, Michael J.; Machius, Mischa; Betts, Laurie; O'Brien, Deborah A.
2016-01-01
STUDY HYPOTHESIS Detailed structural comparisons of sperm-specific glyceraldehyde 3-phosphate dehydrogenase, spermatogenic (GAPDHS) and the somatic glyceraldehyde 3-phosphate dehydrogenase (GAPDH) isozyme should facilitate the identification of selective GAPDHS inhibitors for contraceptive development. STUDY FINDING This study identified a small-molecule GAPDHS inhibitor with micromolar potency and >10-fold selectivity that exerts the expected inhibitory effects on sperm glycolysis and motility. WHAT IS KNOWN ALREADY Glycolytic ATP production is required for sperm motility and male fertility in many mammalian species. Selective inhibition of GAPDHS, one of the glycolytic isozymes with restricted expression during spermatogenesis, is a potential strategy for the development of a non-hormonal contraceptive that directly blocks sperm function. STUDY DESIGN, SAMPLES/MATERIALS, METHODS Homology modeling and x-ray crystallography were used to identify structural features that are conserved in GAPDHS orthologs in mouse and human sperm, but distinct from the GAPDH orthologs present in somatic tissues. We identified three binding pockets surrounding the substrate and cofactor in these isozymes and conducted a virtual screen to identify small-molecule compounds predicted to bind more tightly to GAPDHS than to GAPDH. Following the production of recombinant human and mouse GAPDHS, candidate compounds were tested in dose–response enzyme assays to identify inhibitors that blocked the activity of GAPDHS more effectively than GAPDH. The effects of a selective inhibitor on the motility of mouse and human sperm were monitored by computer-assisted sperm analysis, and sperm lactate production was measured to assess inhibition of glycolysis in the target cell. MAIN RESULTS AND THE ROLE OF CHANCE Our studies produced the first apoenzyme crystal structures for human and mouse GAPDHS and a 1.73 Å crystal structure for NAD+-bound human GAPDHS, facilitating the identification of unique structural features of this sperm isozyme. In dose–response assays T0501_7749 inhibited human GAPDHS with an IC50 of 1.2 μM compared with an IC50 of 38.5 μM for the somatic isozyme. This compound caused significant reductions in mouse sperm lactate production (P= 0.017 for 100 μM T0501_7749 versus control) and in the percentage of motile mouse and human sperm (P values from <0.05 to <0.0001, depending on incubation conditions). LIMITATIONS, REASONS FOR CAUTION The chemical properties of T0501_7749, including limited solubility and nonspecific protein binding, are not optimal for drug development. WIDER IMPLICATIONS OF THE FINDINGS This study provides proof-of-principle evidence that GAPDHS can be selectively inhibited, causing significant reductions in sperm glycolysis and motility. These results highlight the utility of structure-based drug design and support further exploration of GAPDHS, and perhaps other sperm-specific isozymes in the glycolytic pathway, as contraceptive targets. LARGE SCALE DATA None. Coordinates and data files for three GAPDHS crystal structures were deposited in the RCSB Protein Data Bank (http://www.rcsb.org). STUDY FUNDING AND COMPETING INTEREST(S) This work was supported by grants from the National Institutes of Health (NIH), USA, including U01 HD060481 and cooperative agreement U54 HD35041 as part of the Specialized Cooperative Centers Program in Reproduction and Infertility Research from the Eunice Kennedy Shriver National Institute of Child Health and Human Development, and TW/HD00627 from the NIH Fogarty International Center. Additional support was provided by subproject CIG-05-109 from CICCR, a program of CONRAD, Eastern Virginia Medical School, USA. There are no conflicts of interest. PMID:26921398
Kishimoto, Naoki; Onitsuka-Kishimoto, Ayano; Iga, Nozomi; Takamune, Nobutoki; Shoji, Shozo; Misumi, Shogo
2016-12-01
Human immunodeficiency virus type-1 (HIV-1) requires the packaging of human tRNA Lys3 as a primer for effective viral reverse transcription. Previously, we reported that glyceraldehyde 3-phosphate dehydrogenase (GAPDH) suppresses the packaging efficiency of tRNA Lys3 . Although the binding of GAPDH to Pr55 gag is important for the suppression mechanism, it remains unclear which domain of GAPDH is responsible for the interaction with Pr55 gag . In this study, we show that Asp 256 , Lys 260 , Lys 263 and Glu 267 of GAPDH are important for the suppression of tRNA Lys3 packaging. Yeast two-hybrid analysis demonstrated that the C -terminal domain of GAPDH (151-335) interacts with both the matrix region (MA; 1-132) and capsid N -terminal domain (CA-NTD; 133-282). The D256R, K263E or E267R mutation of GAPDH led to the loss of the ability to bind to wild-type (WT) MA, and the D256R/K260E double mutation of GAPDH resulted in the loss of detectable binding activity to WT CA-NTD. In contrast, R58E, Q59A or Q63A of MA, and E76R or R82E of CA-NTD abrogated the interaction with the C -terminal domain of GAPDH. Multiple-substituted GAPDH mutant (D256R/K260E/K263E/E267R) retained the oligomeric formation with WT GAPDH in HIV-1 producing cells, but the incorporation level of the hetero-oligomer was decreased in viral particles. Furthermore, the viruses produced from cells expressing the D256R/K260E/K263E/E267R mutant restored tRNA Lys3 packaging efficiency because the mutant exerted a dominant negative effect by preventing WT GAPDH from binding to MA and CA-NTD and improved the reverse transcription. These findings indicate that the amino acids Asp 256 , Lys 260 , Lys 263 and Glu 267 of GAPDH is essential for the mechanism of tRNA Lys3 -packaging suppression and the D256R/K260E/K263E/E267R mutant of GAPDH acts in a dominant negative manner to suppress tRNA Lys3 packaging.
Heme binding properties of glyceraldehyde-3-phosphate dehydrogenase.
Hannibal, Luciana; Collins, Daniel; Brassard, Julie; Chakravarti, Ritu; Vempati, Rajesh; Dorlet, Pierre; Santolini, Jérôme; Dawson, John H; Stuehr, Dennis J
2012-10-30
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic enzyme that also functions in transcriptional regulation, oxidative stress, vesicular trafficking, and apoptosis. Because GAPDH is required for the insertion of cellular heme into inducible nitric oxide synthase [Chakravarti, R., et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 18004-18009], we extensively characterized the heme binding properties of GAPDH. Substoichiometric amounts of ferric heme bound to GAPDH (one heme per GAPDH tetramer) to form a low-spin complex with UV-visible maxima at 362, 418, and 537 nm and when reduced to ferrous gave maxima at 424, 527, and 559 nm. Ferric heme association and dissociation rate constants at 10 °C were as follows: k(on) = 17800 M(-1) s(-1), k(off1) = 7.0 × 10(-3) s(-1), and k(off2) = 3.3 × 10(-4) s(-1) (giving approximate affinities of 19-390 nM). Ferrous heme bound more poorly to GAPDH and dissociated with a k(off) of 4.2 × 10(-3) s(-1). Magnetic circular dichroism, resonance Raman, and electron paramagnetic resonance spectroscopic data on the ferric, ferrous, and ferrous-CO complexes of GAPDH showed that the heme is bis-ligated with His as the proximal ligand. The distal ligand in the ferric complex was not displaced by CN(-) or N(3)(-) but in the ferrous complex could be displaced by CO at a rate of 1.75 s(-1) (for >0.2 mM CO). Studies with heme analogues revealed selectivity toward the coordinating metal and porphyrin ring structure. The GAPDH-heme complex was isolated from bacteria induced to express rabbit GAPDH in the presence of δ-aminolevulinic acid. Our finding of heme binding to GAPDH expands the protein's potential roles. The strength, selectivity, reversibility, and redox sensitivity of heme binding to GAPDH are consistent with it performing heme sensing or heme chaperone-like functions in cells.
THE HEME BINDING PROPERTIES OF GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE
Hannibal, Luciana; Collins, Daniel; Brassard, Julie; Chakravarti, Ritu; Vempati, Rajesh; Dorlet, Pierre; Santolini, Jérôme; Dawson, John H.; Stuehr, Dennis J.
2012-01-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic enzyme that also functions in transcriptional regulation, oxidative stress, vesicular trafficking, and apoptosis. Because GAPDH is required for cellular heme insertion into inducible nitric oxide synthase (Chakravarti et al, PNAS 2010, 107(42):18004-9), we extensively characterized the heme binding properties of GAPDH. Substoichiometric amounts of ferric heme bound to GAPDH (1 heme per GAPDH tetramer) to form a low-spin complex with UV-visible maxima at 362, 418 and 537 nm, and when reduced to ferrous gave maxima at 424, 527 and 559 nm. Ferric heme association and dissociation rate constants at 10 °C were kon =17,800 M−1s−1 and koff1 = 7.0 × 10−3 s−1; koff2 = 3.3 × 10−4 s−1 respectively, giving approximate affinities of 19–390 nM. Ferrous heme bound more poorly to GAPDH and dissociated with a koff = 4.2 × 10−3 s−1. Magnetic circular dichroism (MCD), resonance Raman (rR) and EPR spectroscopic data on the ferric, ferrous, and ferrous-CO complexes of GAPDH showed that the heme is bis-ligated with His as the proximal ligand. The distal ligand in ferric complex was not displaced by CN− or N3− but in ferrous complex was displaceable by CO at a rate of 1.75 s−1 (for [CO]>0.2 mM). Studies with heme analogs revealed selectivity toward the coordinating metal and porphyrin ring structure. GAPDH-heme was isolated from bacteria induced to express rabbit GAPDH in the presence of δ-amino levulinic acid. Our finding of heme binding to GAPDH expands the protein’s potential roles. The strength, selectivity, reversibility, and redox sensitivity of heme binding to GAPDH is consistent with it performing heme sensing or heme chaperone-like functions in cells. PMID:22957700
Ma, Rui; Xu, Sheng; Zhao, Yucheng; Xia, Bing; Wang, Ren
2016-01-01
Lycoris aurea (L' Hér.) Herb, a perennial grass species, produces a unique variety of pharmacologically active Amaryllidaceae alkaloids. However, the key enzymes and their expression pattern involved in the biosynthesis of Amaryllidaceae alkaloids (especially for galanthamine) are far from being fully understood. Quantitative real-time polymerase chain reaction (qRT-PCR), a commonly used method for quantifying gene expression, requires stable reference genes to normalize its data. In this study, to choose the appropriate reference genes under different experimental conditions, 14 genes including YLS8 (mitosis protein YLS8), CYP2 (Cyclophilin 2), CYP 1 (Cyclophilin 1), TIP41 (TIP41-like protein), EXP2 (Expressed protein 2), PTBP1 (Polypyrimidine tract-binding protein 1), EXP1 (Expressed protein 1), PP2A (Serine/threonine-protein phosphatase 2A), β-TUB (β-tubulin), α-TUB (α-tubulin), EF1-α (Elongation factor 1-α), UBC (Ubiquitin-conjugating enzyme), ACT (Actin) and GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) were selected from the transcriptome datasets of L. aurea. And then, expressions of these genes were assessed by qRT-PCR in various tissues and the roots under different treatments. The expression stability of the 14 candidates was analyzed by three commonly used software programs (geNorm, NormFinder, and BestKeeper), and their results were further integrated into a comprehensive ranking based on the geometric mean. The results show the relatively stable genes for each subset as follows: (1) EXP1 and TIP41 for all samples; (2) UBC and EXP1 for NaCl stress; (3) PTBP1 and EXP1 for heat stress, polyethylene glycol (PEG) stress and ABA treatment; (4) UBC and CYP2 for cold stress; (5) PTBP1 and PP2A for sodium nitroprusside (SNP) treatment; (6) CYP1 and TIP41 for methyl jasmonate (MeJA) treatment; and (7) EXP1 and TIP41 for various tissues. The reliability of these results was further enhanced through comparison between part qRT-PCR result and RNA sequencing (RNA-seq) data. In summary, our results identified appropriate reference genes for qRT-PCR in L. aurea, and will facilitate gene expression studies under these conditions. PMID:27200013
Tang, Zhenjie; Yuan, Shuqiang; Hu, Yumin; Zhang, Hui; Wu, Wenjing; Zeng, Zhaolei; Yang, Jing; Yun, Jingping
2012-01-01
It has long been observed that many cancer cells exhibit increased aerobic glycolysis and rely more on this pathway to generate ATP and metabolic intermediates for cell proliferation. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme in glycolysis and has been known as a housekeeping molecule. In the present study, we found that GAPDH expression was significantly up-regulated in human colorectal carcinoma tissues compared to the adjacent normal tissues, and also increased in colon cancer cell lines compared to the non-tumor colon mucosa cells in culture. The expression of GAPDH was further elevated in the liver meta-static tissues compared to the original colon cancer tissue of the same patients, suggesting that high expression of GAPDH might play an important role in colon cancer development and metastasis. Importantly, we found that 3-bromopyruvate propyl ester (3-BrOP) preferentially inhibited GAPDH and exhibited potent activity in inducing colon cancer cell death by causing severe depletion of ATP. 3-BrOP at low concentrations (1–10 μM) inhibited GAPDH and a much higher concentration (300 μM) was required to inhibit hexokinase-2. The cytotoxic effect of 3-BrOP was associated with its inhibition of GAPDH, and colon cancer cells with loss of p53 were more sensitive to this compound. Our study suggests that GAPDH may be a potential target for colon cancer therapy. PMID:22350014
Human GAPDH Is a Target of Aspirin’s Primary Metabolite Salicylic Acid and Its Derivatives
Manohar, Murli; Harraz, Maged M.; Park, Sang-Wook; Schroeder, Frank C.; Snyder, Solomon H.; Klessig, Daniel F.
2015-01-01
The plant hormone salicylic acid (SA) controls several physiological processes and is a key regulator of multiple levels of plant immunity. To decipher the mechanisms through which SA’s multiple physiological effects are mediated, particularly in immunity, two high-throughput screens were developed to identify SA-binding proteins (SABPs). Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) from plants (Arabidopsis thaliana) was identified in these screens. Similar screens and subsequent analyses using SA analogs, in conjunction with either a photoaffinity labeling technique or surface plasmon resonance-based technology, established that human GAPDH (HsGAPDH) also binds SA. In addition to its central role in glycolysis, HsGAPDH participates in several pathological processes, including viral replication and neuronal cell death. The anti-Parkinson’s drug deprenyl has been shown to suppress nuclear translocation of HsGAPDH, an early step in cell death and the resulting cell death induced by the DNA alkylating agent N-methyl-N’-nitro-N-nitrosoguanidine. Here, we demonstrate that SA, which is the primary metabolite of aspirin (acetyl SA) and is likely responsible for many of its pharmacological effects, also suppresses nuclear translocation of HsGAPDH and cell death. Analysis of two synthetic SA derivatives and two classes of compounds from the Chinese medicinal herb Glycyrrhiza foetida (licorice), glycyrrhizin and the SA-derivatives amorfrutins, revealed that they not only appear to bind HsGAPDH more tightly than SA, but also exhibit a greater ability to suppress translocation of HsGAPDH to the nucleus and cell death. PMID:26606248
Wieczorek, Przemysław; Wrzesińska, Barbara; Obrępalska-Stęplowska, Aleksandra
2013-12-01
Tomato (Solanum lycopersicum L.) is one of the most important vegetables of great worldwide economic value. The scientific importance of the vegetable results from the fact that the genome of S. lycopersicum has been sequenced. This allows researchers to study fundamental mechanisms playing an essential role during tomato development and response to environmental factors contributing significantly to cell metabolism alterations. Parallel with the development of contemporary genetics and the constant increase in sequencing data, progress has to be aligned with improvement of experimental methods used for studying genes functions and gene expression levels, of which the quantitative polymerase chain reaction (qPCR) is still the most reliable. As well as with other nucleic acid-based methods used for comparison of the abundance of specific RNAs, the RT-qPCR data have to be normalised to the levels of RNAs represented stably in a cell. To achieve the goal, the so-called housekeeping genes (i.e., RNAs encoding, for instance, proteins playing an important role in the cell metabolism or structure maintenance), are used for normalisation of the target gene expression data. However, a number of studies have indicated the transcriptional instability of commonly used reference genes analysed in different situations or conditions; for instance, the origin of cells, tissue types, or environmental or other experimental conditions. The expression of ten common housekeeping genes of S. lycopersicum, namely EF1α, TUB, CAC, EXP, RPL8, GAPDH, TBP, ACT, SAND and 18S rRNA were examined during viral infections of tomato. Changes in the expression levels of the genes were estimated by comparison of the non-inoculated tomato plants with those infected with commonly known tomato viral pathogens, Tomato torrado virus, Cucumber mosaic virus, Tobacco mosaic virus and Pepino mosaic virus, inducing a diverse range of disease symptoms on the common host, ranging from mild leaves chlorosis to very severe stem necrosis. It is emphasised that despite the wide range of diverse disease symptoms it is concluded that ACT, CAC and EF1α could be used as the most suitable reference genes in studies of host-virus interactions in tomato. Copyright © 2013 Elsevier B.V. All rights reserved.
Chong, Isaac K W; Ho, Wing S
2013-09-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is known to interact with different biomolecules and was implicated in many novel cellular activities including programmed cell death, nuclear RNA transport unrelated to the commonly known carbohydrate metabolism. We reported here the purification of GAPDH from Chironomidae larvae (Insecta, Diptera) that showed different biologic activity towards heavy metals. It was inhibited by copper, cobalt nickel, iron and lead but was activated by zinc. The GAPDH was purified by ammonium sulphate fractionation and Chelating Sepharose CL-6B chromatography followed by Blue Sepharose CL-6B chromatography. The 150-kDa tetrameric GAPDH showed optimal activity at pH 8.5 and 37°C. The multiple alignment of sequence of the Chironomidae GAPDH with other known species showed 78 - 88% identity to the conserved regions of the GADPH. Bioinformatic analysis unveils substantial N-terminal sequence similarity of GAPDH of Chironomidae larvae to mammalian GADPHs. However, the GADPH of Chironomidae larvae showed different biologic activities and cytotoxicity towards heavy metals. The GAPDH enzyme would undergo adaptive molecular changes through binding at the active site leading to higher tolerance to heavy metals.
Mogollon, Catherin Marin; van Pul, Fiona J A; Imai, Takashi; Ramesar, Jai; Chevalley-Maurel, Séverine; de Roo, Guido M; Veld, Sabrina A J; Kroeze, Hans; Franke-Fayard, Blandine M D; Janse, Chris J; Khan, Shahid M
2016-01-01
The CRISPR/Cas9 system is a powerful genome editing technique employed in a wide variety of organisms including recently the human malaria parasite, P. falciparum. Here we report on further improvements to the CRISPR/Cas9 transfection constructs and selection protocol to more rapidly modify the P. falciparum genome and to introduce transgenes into the parasite genome without the inclusion of drug-selectable marker genes. This method was used to stably integrate the gene encoding GFP into the P. falciparum genome under the control of promoters of three different Plasmodium genes (calmodulin, gapdh and hsp70). These genes were selected as they are highly transcribed in blood stages. We show that the three reporter parasite lines generated in this study (GFP@cam, GFP@gapdh and GFP@hsp70) have in vitro blood stage growth kinetics and drug-sensitivity profiles comparable to the parental P. falciparum (NF54) wild-type line. Both asexual and sexual blood stages of the three reporter lines expressed GFP-fluorescence with GFP@hsp70 having the highest fluorescent intensity in schizont stages as shown by flow cytometry analysis of GFP-fluorescence intensity. The improved CRISPR/Cas9 constructs/protocol will aid in the rapid generation of transgenic and modified P. falciparum parasites, including those expressing different reporters proteins under different (stage specific) promoters.
Mogollon, Catherin Marin; van Pul, Fiona J. A.; Imai, Takashi; Ramesar, Jai; Chevalley-Maurel, Séverine; de Roo, Guido M.; Veld, Sabrina A. J.; Kroeze, Hans; Franke-Fayard, Blandine M. D.; Janse, Chris J.
2016-01-01
The CRISPR/Cas9 system is a powerful genome editing technique employed in a wide variety of organisms including recently the human malaria parasite, P. falciparum. Here we report on further improvements to the CRISPR/Cas9 transfection constructs and selection protocol to more rapidly modify the P. falciparum genome and to introduce transgenes into the parasite genome without the inclusion of drug-selectable marker genes. This method was used to stably integrate the gene encoding GFP into the P. falciparum genome under the control of promoters of three different Plasmodium genes (calmodulin, gapdh and hsp70). These genes were selected as they are highly transcribed in blood stages. We show that the three reporter parasite lines generated in this study (GFP@cam, GFP@gapdh and GFP@hsp70) have in vitro blood stage growth kinetics and drug-sensitivity profiles comparable to the parental P. falciparum (NF54) wild-type line. Both asexual and sexual blood stages of the three reporter lines expressed GFP-fluorescence with GFP@hsp70 having the highest fluorescent intensity in schizont stages as shown by flow cytometry analysis of GFP-fluorescence intensity. The improved CRISPR/Cas9 constructs/protocol will aid in the rapid generation of transgenic and modified P. falciparum parasites, including those expressing different reporters proteins under different (stage specific) promoters. PMID:27997583
Sulfur mustard induced nuclear translocation of glyceraldehyde-3-phosphate-dehydrogenase (GAPDH).
Steinritz, Dirk; Weber, Jana; Balszuweit, Frank; Thiermann, Horst; Schmidt, Annette
2013-12-05
Sulfur Mustard (SM) is a vesicant chemical warfare agent, which is acutely toxic to a variety of organ systems including skin, eyes, respiratory system and bone marrow. The underlying molecular pathomechanism was mainly attributed to the alkylating properties of SM. However, recent studies have revealed that cellular responses to SM exposure are of more complex nature and include increased protein expression and protein modifications that can be used as biomarkers. In order to confirm already known biomarkers, to detect potential new ones and to further elucidate the pathomechanism of SM, we conducted large-scale proteomic experiments based on a human keratinocyte cell line (HaCaT) exposed to SM. Surprisingly, our analysis identified glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) as one of the up-regulated proteins after exposure of HaCaT cells to SM. In this paper we demonstrate the sulfur mustard induced nuclear translocation of GAPDH in HaCaT cells by 2D gel-electrophoresis (2D GE), immunocytochemistry (ICC), Western Blot (WB) and a combination thereof. 2D GE in combination with MALDI-TOF MS/MS analysis identified GAPDH as an up-regulated protein after SM exposure. Immunocytochemistry revealed a distinct nuclear translocation of GAPDH after exposure to 300μM SM. This finding was confirmed by fractionated WB analysis. 2D GE and subsequent immunoblot staining of GAPDH demonstrated two different spot locations of GAPH (pI 7.0 and pI 8.5) that are related to cytosolic or nuclear GAPDH respectively. After exposure to 300μM SM a significant increase of nuclear GAPDH at pI 8.5 occurred. Nuclear GAPDH has been associated with apoptosis, detection of structural DNA alterations, DNA repair and regulation of genomic integrity and telomere structure. The results of our study add new aspects to the pathophysiology of sulfur mustard toxicity, yet further studies will be necessary to reveal the specific function of nuclear GAPDH in the pathomechanism of sulfur mustard. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher
2009-01-01
GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890
Marri, Lucia; Zaffagnini, Mirko; Collin, Valérie; Issakidis-Bourguet, Emmanuelle; Lemaire, Stéphane D; Pupillo, Paolo; Sparla, Francesca; Miginiac-Maslow, Myroslawa; Trost, Paolo
2009-03-01
The Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) can form under oxidizing conditions a supramolecular complex with the regulatory protein CP12. Both GAPDH and PRK activities are inhibited within the complex, but they can be fully restored by reduced thioredoxins (TRXs). We have investigated the interactions of eight different chloroplast thioredoxin isoforms (TRX f1, m1, m2, m3, m4, y1, y2, x) with GAPDH (A(4), B(4), and B(8) isoforms), PRK and CP12 (isoform 2), all from Arabidopsis thaliana. In the complex, both A(4)-GAPDH and PRK were promptly activated by TRX f1, or more slowly by TRXs m1 and m2, but all other TRXs were ineffective. Free PRK was regulated by TRX f1, m1, or m2, while B(4)- and B(8)-GAPDH were absolutely specific for TRX f1. Interestingly, reductive activation of PRK caged in the complex was much faster than reductive activation of free oxidized PRK, and activation of A(4)-GAPDH in the complex was much faster (and less demanding in terms of reducing potential) than activation of free oxidized B(4)- or B(8)-GAPDH. It is proposed that CP12-assembled supramolecular complex may represent a reservoir of inhibited enzymes ready to be released in fully active conformation following reduction and dissociation of the complex by TRXs upon the shift from dark to low light. On the contrary, autonomous redox-modulation of GAPDH (B-containing isoforms) would be more suited to conditions of very active photosynthesis.
Apple juice intervention modulates expression of ARE-dependent genes in rat colon and liver.
Soyalan, Bülent; Minn, Jutta; Schmitz, Hans J; Schrenk, Dieter; Will, Frank; Dietrich, Helmut; Baum, Matthias; Eisenbrand, Gerhard; Janzowski, Christine
2011-03-01
The risk of cancer and other degenerative diseases is inversely correlated with consumption of fruits and vegetables. This beneficial effect is mainly attributed to secondary plant constituents such as polyphenols, supposed to play a major role in protection against ROS (reactive oxygen species)-associated toxicity. To elucidate the potential of differently manufactured apple juices (clear AJ/cloudy AJ/smoothie, in comparison with a polyphenol-free control juice) to modulate expression of ARE-dependent genes. In male Sprague-Dawley rats (n = 8/group; 10d juice intervention, 4d wash-out; 4 treatment cycles), expression of target genes (superoxide dismutase, SOD1/SOD2; glutathione peroxidase, GPX1/GPX2; γ-glutamylcysteine ligase, GCLC/GCLM; glutathione reductase, GSR; catalase, CAT; NAD(P)H:quinone oxidoreductase-1, NQO1 and transcription factor erythroid-derived 2-like-2, Nrf2) was quantified with duplex RT-PCR, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as control. In colon and liver of rats consuming polyphenol-free control juice, rather similar basic expressions were observed (relative GAPDH ratios ranging from 2 to 0.7 and 2.5-0.3, respectively). In the distal colon, apple juice intervention slightly but significantly induced most genes (e.g. GPX2, GSR, CAT, Nrf2; p < 0.001), whereas in the liver only GPX1 and NQO1 mRNA were up-regulated; other hepatic target genes were not affected or down-regulated (SOD1, SOD2, GCLC/M, GSR), concomitant with the absence of Nrf2 induction. Induction of antioxidant gene expression differed with juice type (cloudy AJ > clear AJ ~ smoothie). Taken together, the results underline the potential of polyphenol-rich apple juice to increase the expression of ARE-dependent antioxidant genes.
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is inactivated by S-sulfuration in vitro.
Jarosz, Artur P; Wei, Wanlei; Gauld, James W; Auld, Janeen; Özcan, Filiz; Aslan, Mutay; Mutus, Bulent
2015-12-01
Hydrogen sulfide (H2S) is produced enzymatically by cystathionine β-synthase (CBS) and cystathionine γ-lyase (CSE), as well as other enzymes in mammalian tissues. These discoveries have led to the crowning of H2S as yet another toxic gas that serves as a gasotransmitter like NO and CO. H2S is thought to exert its biological effects through its reaction with cysteine thiols in proteins, yielding sulfurated thiol (-SSH) derivatives. One of the first proteins shown to be modified by H2S was glyceraldehyde 3-phosphate dehydrogenase (GAPDH) [1] where the S-sulfuration of the active site cysteine (Cys 152) resulted in ~7-fold increase in the activity of the enzyme. In the present study we have attempted to reproduce this result with no success. GAPDH in its reduced, or hydrogen peroxide, or glutathione disulfide, or nitrosonium oxidized forms was reacted with sulfide or polysulfides. Sulfide had no effect on reduced GAPDH activity, while polysulfides inhibited GAPDH to ~42% of control. S-sulfuration of GAPDH occurred at Cys 247 after sulfide treatment, Cys 156 and Cys 247 after polysulfide treatment. No evidence of S-sulfuration at active site Cys 152 was discovered. Both sulfide and polysulfide was able to restore the activity of glutathione disulfide oxidized GAPDH, but not to control untreated levels. Treatment of glutathione disulfide oxidized GAPDH with polysulfide also produced S-sulfuration of Cys 156. Treatment of a C156S mutant of GAPDH with sulfide and polysulfide resulted in S-sulfuration of Cys 152, which also caused a decrease and not an increase in enzymatic activity. Computational chemistry shows S-sulfuration of Cys 156 may affect the position of catalytic Cys 152, raising its pKa by 0.5, which may affect the nucleophilicity of Cys 152. The current study raises significant questions about the reported ability of H2S to activate GAPDH by the sulfuration of its active site thiol, and indicates that polysulfide is a stronger protein S-sulfurating agent than sulfide. Copyright © 2015 Elsevier Inc. All rights reserved.
Tsuchiya, Yukihiro; Yamaguchi, Mitsune; Chikuma, Toshiyuki; Hojo, Hiroshi
2005-06-15
Lipid peroxidation products such as 4-hydroxy-2-nonenal (HNE) may be responsible for various pathophysiological events under oxidative stress, since they injure cellular components such as proteins and DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is a key enzyme of glycolysis and has been reported to be a multifunctional enzyme, is one of the enzymes inhibited by HNE. Previous studies showed that GAPDH is degraded when incubated with acetylleucine chloromethyl ketone (ALCK), resulting in the liberation of a 23-kDa fragment. In this study, we examined whether GAPDH incubated with HNE or other aldehydes of lipid peroxidation products are degraded similarly to that with ALCK. The U937 cell extract was incubated with these aldehydes at 37 degrees C and analyzed by Western blotting using anti-GAPDH antibodies. Incubation with HNE or 4-hydroxy-2-hexenal (HHE) decreased GAPDH activity and GAPDH protein level, and increased the 23-kDa fragment, in time- and dose-dependent manners, but that with other aldehydes did not. Gel filtration using the Superose 6 showed that the GAPDH-degrading activity was eluted in higher molecular fractions than proteasome activity. The enzyme activity was detected at the basic range of pH and inhibited by serine protease inhibitors, diisopropyl fluorophosphate and phenylmethylsulfonyl fluoride, but not by other protease inhibitors including a proteasome inhibitor, MG-132, and a tripeptidyl peptidase II (TPP II) inhibitor, AAF-CMK. These results suggest that GAPDH modified by HNE and HHE is degraded by a giant serine protease, releasing the 23-kDa fragment, not by proteasome or TPP II.
Sexton, Jonathan Z; Danshina, Polina V; Lamson, David R; Hughes, Mark; House, Alan J; Yeh, Li-An; O’Brien, Deborah A; Williams, Kevin P
2011-01-01
Glycolytic isozymes that are restricted to the male germline are potential targets for the development of reversible, non-hormonal male contraceptives. GAPDHS, the sperm-specific isoform of glyceraldehyde-3-phosphate dehydrogenase, is an essential enzyme for glycolysis making it an attractive target for rational drug design. Toward this goal, we have optimized and validated a high-throughput spectrophotometric assay for GAPDHS in 384-well format. The assay was stable over time and tolerant to DMSO. Whole plate validation experiments yielded Z’ values >0.8 indicating a robust assay for HTS. Two compounds were identified and confirmed from a test screen of the Prestwick collection. This assay was used to screen a diverse chemical library and identified fourteen small molecules that modulated the activity of recombinant purified GAPDHS with confirmed IC50 values ranging from 1.8 to 42 µM. These compounds may provide useful scaffolds as molecular tools to probe the role of GAPDHS in sperm motility and long term to develop potent and selective GAPDHS inhibitors leading to novel contraceptive agents. PMID:21760877
Improvement of expression level of polysaccharide lyases with new tag GAPDH in E. coli.
Chen, Zhenya; Li, Ye; Sun, Xinxiao; Yuan, Qipeng
2016-10-20
Escherichia coli (E. coli) is widely used to express a variety of heterologous proteins. Efforts have been made to enhance the expression level of the desired protein. However, problems still exist to regulate the level of protein expression and therefore, new strategies are needed to overcome those issues. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) which is properly expressed in E. coli might play a leading role and increase the expression levels of the target proteins. In this study, GAPDH was fused with a target enzyme, ChSase ABC I, an endoeliminase and polysaceharide lyase. Our results confirmed this hypothesis and indicated that GAPDH boosted the expression level of ChSase ABC I with an increase of 2.25 times, while the enzymatic activity with an increase of 2.99 times. The hypothesis were also supported by RT-PCR study and GAPDH was more effective in enhancing the expression level and enzymatic activity as compared to MBP, which is commonly used as fused tag and can improve the soluble expression of target protein. addition, the expression level and enzymatic activity of other polysaceharide lyases were also improved in the presence of GAPDH. The findings of this study prove that GAPDH has a strong effect on enhancing the expression level and enzymatic activity of the target proteins. Copyright © 2016 Elsevier B.V. All rights reserved.
2011-10-01
GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007
Long, Chandler A.; Boloum, Valy; Albadawi, Hassan; Tsai, Shirling; Yoo, Hyung-Jin; Oklu, Rahmi; Goldman, Mitchell H.; Watkins, Michael T.
2013-01-01
Introduction Diabetes is known to increase poly-ADP-ribose-polymerase (PARP) activity and posttranslational poly-ADP-ribosylation of several regulatory proteins involved in inflammation and energy metabolism. These experiments test the hypothesis that PARP inhibition will modulate hind limb ischemia reperfusion (IR) in a mouse model of type-II diabetes; ameliorate the ribosylation and the activity/transnuclear localization of the key glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Methods db/db mice underwent 1.5hrs of hind limb ischemia followed by 1, 7, or 24hrs reperfusion. The treatment group received the PARP inhibitor PJ34 (PJ34) over a 24hrs period; the untreated group received Lactated ringer’s (LR) at the same time points. IR muscles were analyzed for indices of PARP activity, fiber injury, metabolic activity, inflammation, GAPDH activity /intracellular localization and poly-ADP-ribosylation of GAPDH. Results PARP activity was significantly lower in the PJ34 treated groups compared to the LR group at 7 and 24 hours reperfusion. There was significantly less muscle fiber injury in the PJ34 treated group compared to LR treated mice at 24 hrs reperfusion. PJ34 lowered levels of select proinflammatory molecules at 7hrs and 24hrs IR. There were significant increases in metabolic activity only at 24 hours IR in the PJ34 group, which temporally correlated with increase in GAPDH activity, decreased GAPDH poly ADP-ribosylation and nuclear translocation of GAPDH. Conclusions PJ34 reduced PARP activity, GAPDH ribosylation, GAPDH translocation, ameliorated muscle fiber injury, and increased metabolic activity following hind limb IR injury in a murine model of type-II diabetes. PARP inhibition might be a therapeutic strategy following IR in diabetic humans. PMID:23549425
Kim, Min-Sik
2016-01-01
Malaria transmission begins when an infected mosquito delivers Plasmodium sporozoites into the skin. The sporozoite subsequently enters the circulation and infects the liver by preferentially traversing Kupffer cells, a macrophage-like component of the liver sinusoidal lining. By screening a phage display library, we previously identified a peptide designated P39 that binds to CD68 on the surface of Kupffer cells and blocks sporozoite traversal. In this study, we show that the P39 peptide is a structural mimic of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) on the sporozoite surface and that GAPDH directly interacts with CD68 on the Kupffer cell surface. Importantly, an anti-P39 antibody significantly inhibits sporozoite liver invasion without cross-reacting with mammalian GAPDH. Therefore, Plasmodium-specific GAPDH epitopes may provide novel antigens for the development of a prehepatic vaccine. PMID:27551151
Cha, Sung-Jae; Kim, Min-Sik; Pandey, Akhilesh; Jacobs-Lorena, Marcelo
2016-09-19
Malaria transmission begins when an infected mosquito delivers Plasmodium sporozoites into the skin. The sporozoite subsequently enters the circulation and infects the liver by preferentially traversing Kupffer cells, a macrophage-like component of the liver sinusoidal lining. By screening a phage display library, we previously identified a peptide designated P39 that binds to CD68 on the surface of Kupffer cells and blocks sporozoite traversal. In this study, we show that the P39 peptide is a structural mimic of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) on the sporozoite surface and that GAPDH directly interacts with CD68 on the Kupffer cell surface. Importantly, an anti-P39 antibody significantly inhibits sporozoite liver invasion without cross-reacting with mammalian GAPDH. Therefore, Plasmodium-specific GAPDH epitopes may provide novel antigens for the development of a prehepatic vaccine. © 2016 Cha et al.
Petrov, Anja; Beer, Martin; Blome, Sandra
2014-01-01
Dysregulation of cytokine responses plays a major role in the pathogenesis of severe and life-threatening infectious diseases like septicemia or viral hemorrhagic fevers. In pigs, diseases like African and classical swine fever are known to show exaggerated cytokine releases. To study these responses and their impact on disease severity and outcome in detail, reliable, highly specific and sensitive methods are needed. For cytokine research on the molecular level, real-time RT-PCRs have been proven to be suitable. Yet, the currently available and most commonly used SYBR Green I assays or heterogeneous gel-based RT-PCRs for swine show a significant lack of specificity and sensitivity. The latter is however absolutely essential for an accurate quantification of rare cytokine transcripts as well as for detection of small changes in gene expressions. For this reason, a harmonized TaqMan-based triplex real-time RT-PCR protocol for the quantitative detection of normalized gene expression profiles of seven porcine cytokines was designed and validated within the presented study. Cytokines were chosen to represent different immunological pathways and targets known to be involved in the pathogenesis of the above mentioned porcine diseases, namely interleukin (IL)-1β, IL-2, IL-4, IL-6, IL-8, tumor necrosis factor (TNF)-α and interferon (IFN)-α. Beta-Actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as reference genes for normalization. For absolute quantification a synthetic standard plasmid was constructed comprising all target cytokines and reference genes within a single molecule allowing the generation of positive control RNA. The standard as well as positive RNAs from samples, and additionally more than 400 clinical samples, which were collected from animal trials, were included in the validation process to assess analytical sensitivity and applicability under routine conditions. The resulting assay allows the reliable assessment of gene expression profiles and provides a broad applicability to any kind of immunological research in swine.
Identification of erythrocyte membrane proteins interacting with Mycoplasma suis GAPDH and OSGEP.
Song, Qiqi; Song, Weijiao; Zhang, Weijing; He, Lan; Fang, Rui; Zhou, Yanqin; Shen, Bang; Hu, Min; Zhao, Junlong
2018-05-05
Mycoplasma suis (M. suis) is an uncultivable haemotrophic mycoplasma that parasitizes the red blood cells of a wide range of domestic and wild animals. Adhesion of M. suis to host erythrocytes is crucial for its unique RBC-dependent lifecycle. MSG1 protein (now named as GAPDH) with homology to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was the first identified adhesion protein of M. suis. In this study, we found that O-sialoglycoprotein endopeptidase (OSGEP) is another M. suis protein capable of binding porcine erythrocytes. Recombinant OSGEP expressed in E. coli demonstrated surface localization similar to GAPDH. Purified rOSGEP bound to erythrocyte membrane preparations in a dose-dependent manner and this adhesion could be specifically inhibited by anti-rOSGEP antibodies. E. coli transformants expressing OSGEP on their surface were able to adhere to porcine erythrocytes. Furthermore, using far-western and pull-down assays, we determined the host membrane proteins that interacted with OSGEP and GAPDH were Band3 and glycophorin A (GPA). In conclusion, our studies indicated that OSGEP and GAPDH could interact with both Band3 and GPA to mediate adhesion of M. suis to porcine erythrocytes. Copyright © 2018 Elsevier Ltd. All rights reserved.
Treatment Induced Autophagy Associated with Tumor Dormancy and Relapse
2016-07-01
for the autophagy gene , ATG5 (Figure 2A). Figure 2B confirms that autophagy was inhibited based on interference with the degradation of p62/SQSTM1 and...post IR (6Gy) LC.3.B GAPDH Figure 2. Silencing of autophagy in MMC cells. (A) Sh RNA mediated silencing of the autophagy gene , ATG5, in MMC cells...they sleep ? J Pharmacol Exp Ther 2012; 343(3):763-78. 9. Michaud M, Martins I, Sukkurwala AQ, Adjemian S, Ma Y, Pellegatti P, Shen S, Kepp O, Scoazec
Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH.
Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Alvarez-Domínguez, Carmen
2014-01-01
The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189-201 and LLO91-99 and the GAPDH peptide, GAPDH1-22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1-22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91-99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1-22-specific CD4(+) and CD8(+) immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4(+) and CD8(+) epitopes.
Li, Ye; Chen, Zhenya; Zhou, Zhao; Yuan, Qipeng
2016-12-01
Chondroitinases (ChSases) are a family of polysaccharide lyases that can depolymerize high molecular weight chondroitin sulfate (CS) and dermatan sulfate (DS). In this study, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is stably expressed in different cells like normal cells and cancer cells and the expression is relatively insensitive to experimental conditions, was expressed as a fusion protein with ChSase ABC I. Results showed that the expression level and enzyme activity of GAPDH-ChSase ABC I were about 2.2 and 3.0 times higher than those of ChSase ABC I. By optimization of fermentation conditions, higher productivity of ChSase ABC I was achieved as 880 ± 61 IU/g wet cell weight compared with the reported ones. The optimal temperature and pH of GAPDH-ChSase ABC I were 40 °C and 7.5, respectively. GAPDH-ChSase ABC I had a kcat/Km of 131 ± 4.1 L/μmol s and the catalytic efficiency was decreased as compared to ChSase ABC I. The relative activity of GAPDH-ChSase ABC I remained 89% after being incubated at 30 °C for 180 min and the thermostability of ChSase ABC I was enhanced by GAPDH when it was incubated at 30, 35, 40 and 45 °C. Copyright © 2016 Elsevier Inc. All rights reserved.
Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH
Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M. Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L.; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Álvarez-Domínguez, Carmen
2014-01-01
The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189−201 and LLO91−99 and the GAPDH peptide, GAPDH1−22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1−22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91−99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1−22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes. PMID:24600592
NASA Astrophysics Data System (ADS)
Wang, Wenlei; Wu, Xiaojie; Wang, Chao; Jia, Zhaojun; He, Linwen; Wei, Yifan; Niu, Jianfeng; Wang, Guangce
2014-07-01
To screen the stable expression genes related to the stress (strong light, dehydration and temperature shock) we applied Absolute real-time PCR technology to determine the transcription numbers of the selected test genes in P orphyra yezoensis, which has been regarded as a potential model species responding the stress conditions in the intertidal. Absolute real-time PCR technology was applied to determine the transcription numbers of the selected test genes in P orphyra yezoensis, which has been regarded as a potential model species in stress responding. According to the results of photosynthesis parameters, we observed that Y(II) and F v/ F m were significantly affected when stress was imposed on the thalli of P orphyra yezoensis, but underwent almost completely recovered under normal conditions, which were collected for the following experiments. Then three samples, which were treated with different grade stresses combined with salinity, irradiation and temperature, were collected. The transcription numbers of seven constitutive expression genes in above samples were determined after RNA extraction and cDNA synthesis. Finally, a general insight into the selection of internal control genes during stress response was obtained. We found that there were no obvious effects in terms of salinity stress (at salinity 90) on transcription of most genes used in the study. The 18S ribosomal RNA gene had the highest expression level, varying remarkably among different tested groups. RPS8 expression showed a high irregular variance between samples. GAPDH presented comparatively stable expression and could thus be selected as the internal control. EF-1α showed stable expression during the series of multiple-stress tests. Our research provided available references for the selection of internal control genes for transcripts determination of P. yezoensis.
Fu, Shulin; Zhang, Minmin; Ou, Jiwen; Liu, Huazhen; Tan, Chen; Liu, Jinlin; Chen, Huanchun; Bei, Weicheng
2012-11-06
Haemophilus parasuis, the causative agent of swine polyserositis, polyarthritis, and meningitis, is one of the most important bacterial diseases of pigs worldwide. The development of a vaccine against H. parasuis has been impeded due to the lack of induction of reliable cross-serotype protection. In this study the gapA gene that encodes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was shown to be present and highly conserved in various serotypes of H. parasuis and we constructed a novel DNA vaccine encoding GAPDH (pCgap) to evaluate the immune response and protective efficacy against infection with H. parasuis MD0322 serovar 4 or SH0165 serovar 5 in mice. A significant antibody response against GAPDH was generated following pCgap intramuscular immunization; moreover, antibodies to the pCgap DNA vaccine were bactericidal, suggesting that it was expressed in vivo. The gapA transcript was detected in muscle, liver, spleen, and kidney of the mice seven days post-vaccination. The IgG subclass (IgG1 and IgG2a) analysis indicated that the DNA vaccine induced both Th1 and Th2 immune responses, but the IgG1 response was greater than the IgG2a response. Moreover, the groups vaccinated with the pCgap vaccine exhibited 83.3% and 50% protective efficacy against the H. parasuis MD0322 serovar 4 or SH0165 serovar 5 challenges, respectively. The pCgap DNA vaccine provided significantly greater protective efficacy compared to the negative control groups or blank control groups (P<0.05 for both). Taken together, these findings indicate that the pCgap DNA vaccine provides a novel strategy against infection of H. parasuis and offer insight concerning the underlying immune mechanisms of a bacterial DNA vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.
Karataylı, Ersin; Altunoğlu, Yasemin Çelik; Karataylı, Senem Ceren; Yurdaydın, Cihan; Bozdayı, A Mithat
2014-10-01
Internal controls (ICs), are the main components of any real-time PCR based amplification methods, which are co-purified and co-amplified with the actual target. The existence of free circulating nucleic acids in plasma and serum (CNAPS) has been known for many years. The aim of this study was to verify whether CNAPS can be used as ICs in real-time PCR based detection and quantification of DNA or RNA targets in plasma and serum samples. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a housekeeping gene, was chosen at random as CNAPS to serve as an intrinsic internal control in two different real-time PCR based quantification models in plasma and serum. Viral loads of hepatitis B virus (HBV) DNA and hepatitis delta virus (HDV) RNA were quantified as actual targets in parallel to GAPDH as IC in a total of 519 serum or plasma samples including 21 healthy controls, 202 positive chronic hepatitis delta patients, 37 chronic hepatitis C patients, 168 chronic hepatitis B patients, 52 patients with hepatocellular carcinoma, and 39 patients with non-alcoholic steatohepatitis/non-alcoholic fatty liver disease. GAPDH levels did not show significant variance in different patient groups and yielded positive signals in all 519 patients with persistent cycle threshold (CT) values 27.85±1.57 (mean±standard deviation (SD)). Reproducibility of the GAPDH amplification in HDV RNA and HBV DNA quantifications was shown with a SD value of CT ranging from 0.42 to 2.14 (mean SD; 1.18) and 0.24 to 1.75 (mean SD; 1.03), respectively. In conclusion, the freely circulating nucleic acids can clearly be used as internal controls for real-time PCR based detection and quantification of any RNA and mainly DNA targets (pathogens) in serum or plasma and this simply excludes the compulsory external addition of any IC molecules into the reaction. Copyright © 2014 Elsevier B.V. All rights reserved.
FRET analysis of CP12 structural interplay by GAPDH and PRK.
Moparthi, Satish Babu; Thieulin-Pardo, Gabriel; de Torres, Juan; Ghenuche, Petru; Gontero, Brigitte; Wenger, Jérôme
2015-03-13
CP12 is an intrinsically disordered protein playing a key role in the regulation of the Benson-Calvin cycle. Due to the high intrinsic flexibility of CP12, it is essential to consider its structural modulation induced upon binding to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) enzymes. Here, we report for the first time detailed structural modulation about the wild-type CP12 and its site-specific N-terminal and C-terminal disulfide bridge mutants upon interaction with GAPDH and PRK by Förster resonance energy transfer (FRET). Our results indicate an increase in CP12 compactness when the complex is formed with GAPDH or PRK. In addition, the distributions in FRET histograms show the elasticity and conformational flexibility of CP12 in all supra molecular complexes. Contrarily to previous beliefs, our FRET results importantly reveal that both N-terminal and C-terminal site-specific CP12 mutants are able to form the monomeric (GAPDH-CP12-PRK) complex. Copyright © 2015 Elsevier Inc. All rights reserved.
Energy determinants GAPDH and NDPK act as genetic modifiers for hepatocyte inclusion formation
Weerasinghe, Sujith V.W.; Singla, Amika; Leonard, Jessica M.; Hanada, Shinichiro; Andrews, Philip C.; Lok, Anna S.; Omary, M. Bishr
2011-01-01
Genetic factors impact liver injury susceptibility and disease progression. Prominent histological features of some chronic human liver diseases are hepatocyte ballooning and Mallory-Denk bodies. In mice, these features are induced by 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) in a strain-dependent manner, with the C57BL and C3H strains showing high and low susceptibility, respectively. To identify modifiers of DDC-induced liver injury, we compared C57BL and C3H mice using proteomic, biochemical, and cell biological tools. DDC elevated reactive oxygen species (ROS) and oxidative stress enzymes preferentially in C57BL livers and isolated hepatocytes. C57BL livers and hepatocytes also manifested significant down-regulation, aggregation, and nuclear translocation of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). GAPDH knockdown depleted bioenergetic and antioxidant enzymes and elevated hepatocyte ROS, whereas GAPDH overexpression decreased hepatocyte ROS. On the other hand, C3H livers had higher expression and activity of the energy-generating nucleoside-diphosphate kinase (NDPK), and knockdown of hepatocyte NDPK augmented DDC-induced ROS formation. Consistent with these findings, cirrhotic, but not normal, human livers contained GAPDH aggregates and NDPK complexes. We propose that GAPDH and NDPK are genetic modifiers of murine DDC-induced liver injury and potentially human liver disease. PMID:22006949
On the role of GAPDH isoenzymes during pentose fermentation in engineered Saccharomyces cerevisiae.
Linck, Annabell; Vu, Xuan-Khang; Essl, Christine; Hiesl, Charlotte; Boles, Eckhard; Oreb, Mislav
2014-05-01
In the metabolic network of the cell, many intermediary products are shared between different pathways. d-Glyceraldehyde-3-phosphate, a glycolytic intermediate, is a substrate of GAPDH but is also utilized by transaldolase and transketolase in the scrambling reactions of the nonoxidative pentose phosphate pathway. Recent efforts to engineer baker's yeast strains capable of utilizing pentose sugars present in plant biomass rely on increasing the carbon flux through this pathway. However, the competition between transaldolase and GAPDH for d-glyceraldehyde-3-phosphate produced in the first transketolase reaction compromises the carbon balance of the pathway, thereby limiting the product yield. Guided by the hypothesis that reduction in GAPDH activity would increase the availability of d-glyceraldehyde-3-phosphate for transaldolase and thereby improve ethanol production during fermentation of pentoses, we performed a comprehensive characterization of the three GAPDH isoenzymes in baker's yeast, Tdh1, Tdh2, and Tdh3 and analyzed the effect of their deletion on xylose utilization by engineered strains. Our data suggest that overexpression of transaldolase is a more promising strategy than reduction in GAPDH activity to increase the flux through the nonoxidative pentose phosphate pathway. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
GAPDH: the missing link between glycolysis and mitochondrial oxidative phosphorylation?
Ramzan, Rabia; Weber, Petra; Linne, Uwe; Vogt, Sebastian
2013-10-01
The main function of glycolysis and oxidative phosphorylation is to produce cellular energy in the form of ATP. In the present paper we propose a link between both of these energy-regulatory processes in the form of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and CytOx (cytochrome c oxidase). GAPDH is the sixth enzyme of glycolysis, whereas CytOx is the fourth complex of the mitochondrial oxidative phosphorylation system. In MS analysis, GAPDH was found to be associated with a BN-PAGE (blue native PAGE)-isolated complex of CytOx from bovine heart tissue homogenates. Both GAPDH and CytOx are highly regulated under normal energy metabolic conditions, but both of these enzymes are highly deregulated in the presence of oxidative stress. The interaction of GAPDH with CytOx could be the point of interest as it has already been shown that GAPDH protein damage results in a marked decrease in cellular ATP levels. On the other hand, decreasing the ATP/ADP ratio may ultimately result in switching off the allosteric ATP inhibition of CytOx leading to increased ROS (reactive oxygen species), cytochrome c release and apoptosis. Moreover, we have previously reported that allosteric ATP inhibition of CytOx is responsible for keeping the membrane potential at low healthy values, thus avoiding the production of ROS and this allosteric ATP inhibition is switched on at a high ATP/ADP ratio. So, in the present paper, we propose a scheme that could prove to be a link between these two enzymes and their role in the prevalence of diseases.
NASA Astrophysics Data System (ADS)
Shi, Zhenhua; Yu, Hui; Sun, Yongyan; Yang, Chuanjun; Lian, Huiyong; Cai, Peng
2015-02-01
A literal mountain of documentation generated in the past five decades showing unmistakable health hazards associated with extremely low-frequency electromagnetic fields (ELF-EMFs) exposure. However, the relation between energy mechanism and ELF-EMF exposure is poorly understood. In this study, Caenorhabditis elegans was exposed to 50 Hz ELF-EMF at intensities of 0.5, 1, 2, and 3 mT, respectively. Their metabolite variations were analyzed by GC-TOF/MS-based metabolomics. Although minimal metabolic variations and no regular pattern were observed, the contents of energy metabolism-related metabolites such as pyruvic acid, fumaric acid, and L-malic acid were elevated in all the treatments. The expressions of nineteen related genes that encode glycolytic enzymes were analyzed by using quantitative real-time PCR. Only genes encoding GAPDH were significantly upregulated (P < 0.01), and this result was further confirmed by western blot analysis. The enzyme activity of GAPDH was increased (P < 0.01), whereas the total intracellular ATP level was decreased. While no significant difference in lifespan, hatching rate and reproduction, worms exposed to ELF-EMF exhibited less food consumption compared with that of the control (P < 0.01). In conclusion, C. elegans exposed to ELF-EMF have enhanced energy metabolism and restricted dietary, which might contribute to the resistance against exogenous ELF-EMF stress.
McKenzie, S; Doe, W; Buffinton, G
1999-01-01
Background—Reactive oxygen and nitrogen derived species produced by activated neutrophils have been implicated in the damage of mucosal proteins including the inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the active inflammatory lesion in patients with inflammatory bowel disease (IBD). This study investigated the efficacy of currently used IBD therapeutics to prevent injury mediated by reactive oxygen and nitrogen derived species. Methods—GAPDH activity of human colon epithelial cells was used as a sensitive indicator of injury produced by reactive oxygen and nitrogen derived species. HCT116 cells (106/ml phosphate buffered saline; 37°C) were incubated in the presence of 5-aminosalicylic acid (5-ASA), 6-mercaptopurine, methylprednisolone, or metronidazole before exposure to H2O2, HOCl, or NO in vitro. HCT116 cell GAPDH enzyme activity was determined by standard procedures. Cell free reactions between 5-ASA and HOCl were analysed by spectrophotometry and fluorimetry to characterise the mechanism of oxidant scavenging. Results—GAPDH activity of HCT116 cells was inhibited by the oxidants tested: the concentration that produced 50% inhibition (IC50) was 44.5 (2.1) µM for HOCl, 379.8 (21.3) µM for H2O2, and 685.8 (103.8) µM for NO (means (SEM)). 5-ASA was the only therapeutic compound tested to show efficacy (p<0.05) against HOCl mediated inhibition of enzyme activity; however, it was ineffective against H2O2 and NO mediated inhibition of GAPDH. Methylprednisolone, metronidazole, and the thiol-containing 6-mercaptopurine were ineffective against all oxidants. Studies at ratios of HOCl:5-ASA achievable in the mucosa showed direct scavenging to be the mechanism of protection of GAPDH activity. Mixing 5-ASA and HOCl before addition to the cells resulted in significantly greater protection of GAPDH activity than when HOCl was added to cells preincubated with 5-ASA. The addition of 5-ASA after HOCl exposure did not restore GAPDH activity. Conclusions—Therapies based on 5-ASA may play a direct role in scavenging the potent neutrophil oxidant HOCl, thereby protecting mucosal GAPDH from oxidative inhibition. These findings suggest that strategies for the further development of new HOCl scavenging compounds may be useful in the treatment of IBD. Keywords: 5-aminosalicylic acid; 6-mercaptopurine; prednisolone; metronidazole; oxidants; glyceraldehyde-3-phosphate dehydrogenase PMID:9895376
2005-08-01
The neuronal nitric oxide synthase (NOS1) gene target was amplified and sequenced in all samples tested, in addition to HSV1 , HSV2 , or Human Herpes...Triphosphate DNA Deoxyribonucleic acid GAPDH Glyceraldehyde-3 -phosphate dehydrogenase HSV Herpes Simplex Virus HSV1 Herpes Simplex Virus Type 1 HSV2 Herpes... HSV2 ) share 50-70 % homology. HSV1 is primarily associated with oral and ocular lesions, while HSV2 is primarily associated with genital and anal lesions
Fokina, K V; Yazykova, M Y; Danshina, P V; Schmalhausen, E V; Muronetz, V I
2000-04-01
Data are presented concerning the possible participation of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in regulation of the glycolytic pathway and the level of 2,3-diphosphoglycerate in erythrocytes. Experimental support has been obtained for the hypothesis according to which a mild oxidation of GAPDH must result in acceleration of glycolysis and in decrease in the level of 2, 3-diphosphoglycerate due to the acyl phosphatase activity of the mildly oxidized enzyme. Incubation of erythrocytes in the presence of 1 mM hydrogen peroxide decreases 2,3-diphosphoglycerate concentration and causes accumulation of 3-phosphoglycerate. It is assumed that the acceleration of glycolysis in the presence of oxidative agents described previously by a number of authors could be attributed to the acyl phosphatase activity of GAPDH. A pH-dependent complexing of GAPDH and 3-phosphoglycerate kinase or 2, 3-diphosphoglycerate mutase is found to determine the fate of 1,3-diphosphoglycerate that serves as a substrate for the synthesis of 2,3-diphosphoglycerate as well as for the 3-phosphoglycerate kinase reaction in glycolysis. A withdrawal of the two-enzyme complexes from the erythrocyte lysates using Sepharose-bound anti-GAPDH antibodies prevents the pH-dependent accumulation of the metabolites. The role of GAPDH in the regulation of glycolysis and the level of 2,3-diphosphoglycerate in erythrocytes is discussed.
Kawada, Manabu; Inoue, Hiroyuki; Ohba, Shun-ichi; Yoshida, Junjiro; Masuda, Tohru; Yamasaki, Manabu; Usami, Ihomi; Sakamoto, Shuichi; Abe, Hikaru; Watanabe, Takumi; Yamori, Takao; Shibasaki, Masakatsu; Nomoto, Akio
2015-01-01
Fibroblast-like stromal cells modulate cancer cells through secreted factors and adhesion, but those factors are not fully understood. Here, we have identified critical stromal factors that modulate cancer growth positively and negatively. Using a cell co-culture system, we found that gastric stromal cells secreted IL-6 as a growth and survival factor for gastric cancer cells. Moreover, gastric cancer cells secreted PGE2 and TNFα that stimulated IL-6 secretion by the stromal cells. Furthermore, we found that stromal cells secreted glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Extracellular GAPDH, or its N-terminal domain, inhibited gastric cancer cell growth, a finding confirmed in other cell systems. GAPDH bound to E-cadherin and downregulated the mTOR-p70S6 kinase pathway. These results demonstrate that stromal cells could regulate cancer cell growth through the balance of these secreted factors. We propose that negative regulation of cancer growth using GAPDH could be a new anti-cancer strategy. PMID:25785838
Nitric Oxide-GAPDH Transcriptional Signaling Mediates Behavioral Actions of Cocaine.
Harraz, Maged M; Snyder, Solomon H
2015-01-01
Psychotropic actions of cocaine are generally thought to involve its blockade of monoamine transporters leading to increased synaptic levels of monoamines, especially dopamine. Subsequent intracellular events have been less well characterized. We describe a signaling system wherein lower behavioral stimulant doses of cocaine, as well as higher neurotoxic doses, activate a cascade wherein nitric oxide nitrosylates glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to generate a complex with the ubiquitin-E3-ligase Siah1 which translocates to the nucleus. With lower cocaine doses, nuclear GAPDH augments CREB signaling, while at higher doses p53 signaling is enhanced. The drug CGP3466B very potently blocks GAPDH nitrosylation, hindering both signaling cascades and inhibits both behavioral activating and neurotoxic effects of cocaine. This system affords potentially novel approaches to the therapy of cocaine abuse.
Stecyk, Jonathan A W; Couturier, Christine S; Fagernes, Cathrine E; Ellefsen, Stian; Nilsson, Göran E
2012-03-01
The mRNA expression of heat-shock protein 90 (HSP90) and heat-shock cognate 70 (HSC70) was examined in cardiac chambers and telencephalon of warm- (21°C) and cold-acclimated (5°C) turtles (Trachemys scripta) exposed to normoxia, prolonged anoxia or anoxia followed by reoxygenation. Additionally, the suitability of total RNA as well as mRNA from β-actin, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and cyclophilin A (PPIA) for normalizing gene expression data was assessed, as compared to the use of an external RNA control. Measurements of HSP90 and HSC70 mRNA expression revealed that anoxia and reoxygenation have tissue- and gene-specific effects. By and large, the alterations support previous investigations on HSP protein abundance in the anoxic turtle heart and brain, as well as the hypothesized roles of HSP90 and HSC70 during stress and non-stress conditions. However, more prominent was a substantially increased HSP90 and HSC70 mRNA expression in the cardiac chambers with cold acclimation. The finding provides support for the notion that cold temperature induces a number of adaptations in tissues of anoxia-tolerant vertebrates that precondition them for winter anoxia. β-actin, GAPDH and PPIA mRNA expression and total RNA also varied with oxygenation state and acclimation temperature in a tissue- and gene-specific manner, as well as among tissue types, thus disqualifying them as suitable for real-time RT-PCR normalization. Thus, the present data highlights the advantages of normalizing real-time RT-PCR data to an external RNA control, an approach that also allows inter-tissue and potentially inter-species comparisons of target gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.
Pusterla, N; Wilson, W D; Conrad, P A; Barr, B C; Ferraro, G L; Daft, B M; Leutenegger, C M
2006-09-09
This study was designed to determine the relative levels of gene transcription of selected pathogens and cytokines in the brain and spinal cord of 12 horses with equine protozoal myeloencephalitis (EPM), 11 with equine herpesvirus type 1 (EHV-1) myeloencephalopathy, and 12 healthy control horses by applying a real time pcr to the formalin-fixed and paraffin-embedded tissues. Total rna was extracted from each tissue, transcribed to complementary dna (cDNA) and assayed for Sarcocystis neurona, Neospora hughesi, EHV-1, equine GAPDH (housekeeping gene), tumour necrosis factor (TNF)-alpha, interferon (IFN)-gamma, interleukin (IL)-1beta, IL-2, IL-4, IL-6, IL-8, IL-10 AND IL-12 p40. S neurona cdna was detected in the neural tissue from all 12 horses with EPM, and two of them also had amplifiable cDNA of N hughesi. The relative levels of transcription of protozoal cdna ranged from 1 to 461 times baseline (mean 123). All the horses with ehv-1 myeloencephalopathy had positive viral signals by PCR with relative levels of transcription ranging from 1 to 1618 times baseline (mean 275). All the control horses tested negative for S neurona, N hughesi and EHV-1 cdna. The cytokine profiles of each disease indicated a balance between pro- and anti-inflammatory markers. In the horses with epm the pro-inflammatory Th1 cytokines (IL-8, TNF-alpha and IFN-gamma) were commonly expressed but the anti-inflammatory Th2 cytokines (IL-4, IL-6 AND IL-10) were absent or rare. In the horses with ehv-1 the proinflammatory cytokine IL-8 was commonly expressed, but IL-10 and IFN-gamma were not, and TNF-alpha was rare. Tissue from the control horses expressed only the gene GAPDH.
A phylogenetic study of Boletus section Boletus in Europe.
Beugelsdijk, D C M; van der Linde, S; Zuccarello, G C; den Bakker, H C; Draisma, S G A; Noordeloos, M E
2008-06-01
A phylogenetic study of the species in Boletus sect. Boletus was undertaken using the molecular markers ITS1-5.8S-ITS2 and GAPDH. Four well-supported lineages, one comprising Boletus edulis s.l., the others referring to B. aereus, B. reticulatus and B. pinophilus have been distinguished. The ML and MP trees of ITS showed remarkably low resolution within the B. edulis clade, and confirmed earlier published results, despite the use of samples from a wider geographical area and different hosts. The results of GAPDH demonstrate clearly that this low resolution must be ascribed to a low genetic variability with the B. edulis clade, and make clear that morphological and ecological characters have been overestimated within this species complex. Boletus edulis is therefore defined as a variable species with a wide morphological, ecological and geographic range, and includes several specific and subspecific taxa described in the literature (e.g. B. betulicola, B. persoonii, B. quercicola and B. venturii). Three other European species (B. aereus, B. pinophilus and B. reticulatus) are well delimited species based on morphology and our genetic data.
Bil-Lula, Iwona; Krzywonos-Zawadzka, Anna; Sawicki, Grzegorz; Woźniak, Mieczysław
2016-03-01
The primary issue undertaken in this study was to test the hypothesis that preadipocytes would have intrinsically elevated propensity to differentiate into mature adipocytes due to HAdV31 infection. To prove that, the metabolic and molecular mechanisms responsible for HAdV31-induced adipogenesis were examined. 3T3L1 cells (mouse embryonic fibroblast, adipose like cell line) were used as a surrogate model to analyze an increased proliferation, differentiation, and maturation of preadipocytes infected with human adenovirus. An expression of E4orf1, C/EBP-β, PPAR-γ, GAPDH, aP2, LEP, and fatty acid synthase genes, intracellular lipid accumulation as well as cytokine release from the fat cells were assessed. Data showed that HAdV31 increased an expression of C/EBP-β and PPAR-γ genes leading to an enhanced differentiation of preadipocytes into fat cells. Besides, overexpression of GAPDH and fatty acid synthase, and decreased expression of leptin caused an increased accumulation of intracellular lipids. Secretion of TNF-α and IL-6 from HAdV31-infected cells was strongly decreased, leading to unlimited virus replication. The results obtained from this study provided the evidences that HAdV31, likewise previously documented HAdV36, is a subsequent human adenovirus affecting the differentiation and lipid accumulation of 3T3L1 cells. © 2015 Wiley Periodicals, Inc.
Kidney, B A; Ellis, J A; Haines, D M; Jackson, M L
2001-12-01
To determine whether feline vaccine site-associated sarcomas (VSS) contain a higher amount of endogenous FeLV (enFeLV) RNA, compared with feline nonvaccine site-associated sarcomas (non-VSS). Formalin-fixed paraffin-embedded (FFPE) tissues from 50 VSS and 50 cutaneous non-VSS. RNA was extracted from FFPE sections of each tumor, and regions of the long terminal repeat (LTR) and envelope (env) gene of enFeLV were amplified by use of reverse transcriptase-polymerase chain reaction (RT-PCR). The density of each RT-PCR product band for enFeLV was compared with that of a constitutively expressed gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). An integrated density value (IDV) was determined by use of densitometry, and the IDV ratio for enFeLV to GAPDH was calculated for each enFeLV primer set. The median (interquartile range) of the IDV ratio for the enFeLV LTR primer set was 0.52 (0.26 to 1.17) for the VSS group and 0.84 (0.21 to 1.53) for the non-VSS group. The median (interquartile range) of the IDV ratio for the enFeLV env primer set was 0.60 (0.37 to 0.91) for the VSS group and 0.59 (0.36 to 1.09) for the non-VSS group. Because the amount of enFeLV RNA within the LTR and env gene was not significantly different between the VSS and non-VSS groups, enFeLV replication or expression is unlikely to be involved in VSS development.
Margaryan, Hasmik; Dorosh, Andriy; Capkova, Jana; Manaskova-Postlerova, Pavla; Philimonenko, Anatoly; Hozak, Pavel; Peknicova, Jana
2015-03-08
Sperm proteins are important for the sperm cell function in fertilization. Some of them are involved in the binding of sperm to the egg. We characterized the acrosomal sperm protein detected by a monoclonal antibody (MoAb) (Hs-8) that was prepared in our laboratory by immunization of BALB/c mice with human ejaculated sperms and we tested the possible role of this protein in the binding assay. Indirect immunofluorescence and immunogold labelling, gel electrophoresis, Western blotting and protein sequencing were used for Hs-8 antigen characterization. Functional analysis of GAPDHS from the sperm acrosome was performed in the boar model using sperm/zona pellucida binding assay. Monoclonal antibody Hs-8 is an anti-human sperm antibody that cross-reacts with the Hs-8-related protein in spermatozoa of other mammalian species (boar, mouse). In the immunofluorescence test, Hs-8 antibody recognized the protein localized in the acrosomal part of the sperm head and in the principal piece of the sperm flagellum. In immunoblotting test, MoAb Hs-8 labelled a protein of 45 kDa in the extract of human sperm. Sequence analysis identified protein Hs-8 as GAPDHS (glyceraldehyde 3-phosphate dehydrohenase-spermatogenic). For this reason, commercial mouse anti-GAPDHS MoAb was applied in control tests. Both antibodies showed similar staining patterns in immunofluorescence tests, in electron microscopy and in immunoblot analysis. Moreover, both Hs-8 and anti-GAPDHS antibodies blocked sperm/zona pellucida binding. GAPDHS is a sperm-specific glycolytic enzyme involved in energy production during spermatogenesis and sperm motility; its role in the sperm head is unknown. In this study, we identified the antigen with Hs8 antibody and confirmed its localization in the apical part of the sperm head in addition to the principal piece of the flagellum. In an indirect binding assay, we confirmed the potential role of GAPDHS as a binding protein that is involved in the secondary sperm/oocyte binding.
Marimon, José María; Freire, Javier; Salcines-Cuevas, David; Carmen Fariñas, M.; onzalez-Rico, Claudia; Marradi, Marco; Garcia, Isabel; Alkorta-Gurrutxaga, Mirian; San Nicolas-Gomez, Aida; Castañeda-Sampedro, Ana; Yañez-Diaz, Sonsoles; Penades, Soledad; Punzon, Carmen; Gomez-Roman, Javier; Rivera, Fernando; Fresno, Manuel; Alvarez-Dominguez, Carmen
2017-01-01
Clinical cases of neonatal listeriosis are associated with brain disease and fetal loss due to complications in early or late pregnancy, which suggests that microglial function is altered. This is believed to be the first study to link microglial apoptosis with neonatal listeriosis and listeriosis-associated brain disease, and to propose a new nanovaccine formulation that reverses all effects of listeriosis and confers Listeria monocytogenes (LM)-specific immunity. We examined clinical cases of neonatal listeriosis in 2013–2015 and defined two useful prognostic immune biomarkers to design listeriosis vaccines: high anti-GAPDH1-22 titres and tumor necrosis factor (TNF)/interleukin (IL)-6 ratios. Therefore, we developed a nanovaccine with gold glyco-nanoparticles conjugated to LM peptide 1-22 of GAPDH (Lmo2459), GNP-GAPDH1-22 nanovaccinesformulated with a pro-inflammatory Toll-like receptor 2/4-targeted adjuvant. Neonates born to non-vaccinated pregnant mice with listeriosis, showed brain and vascular diseases and significant microglial dysfunction by induction of TNF-α-mediated apoptosis. This programmed TNF-mediated suicide explains LM dissemination in brains and livers and blocks production of early pro-inflammatory cytokines such as IL-1β and interferon-α/β. In contrast, neonates born to GNP-GAPDH1–22-vaccinated mothers before LM infection, did not develop listeriosis or brain diseases and had functional microglia. In nanovaccinated mothers, immune responses shifted towards Th1/IL-12 pro-inflammatory cytokine profiles and high production of anti-GAPDH1–22 antibodies, suggesting good induction of LM-specific memory. PMID:28903312
Calderon-Gonzalez, Ricardo; Frande-Cabanes, Elisabet; Teran-Navarro, Hector; Marimon, José María; Freire, Javier; Salcines-Cuevas, David; Carmen Fariñas, M; Onzalez-Rico, Claudia; Marradi, Marco; Garcia, Isabel; Alkorta-Gurrutxaga, Mirian; San Nicolas-Gomez, Aida; Castañeda-Sampedro, Ana; Yañez-Diaz, Sonsoles; Penades, Soledad; Punzon, Carmen; Gomez-Roman, Javier; Rivera, Fernando; Fresno, Manuel; Alvarez-Dominguez, Carmen
2017-08-15
Clinical cases of neonatal listeriosis are associated with brain disease and fetal loss due to complications in early or late pregnancy, which suggests that microglial function is altered. This is believed to be the first study to link microglial apoptosis with neonatal listeriosis and listeriosis-associated brain disease, and to propose a new nanovaccine formulation that reverses all effects of listeriosis and confers Listeria monocytogenes (LM)-specific immunity. We examined clinical cases of neonatal listeriosis in 2013-2015 and defined two useful prognostic immune biomarkers to design listeriosis vaccines: high anti-GAPDH 1-22 titres and tumor necrosis factor (TNF)/interleukin (IL)-6 ratios. Therefore, we developed a nanovaccine with gold glyco-nanoparticles conjugated to LM peptide 1-22 of GAPDH (Lmo2459), GNP-GAPDH 1-22 nanovaccinesformulated with a pro-inflammatory Toll-like receptor 2/4-targeted adjuvant. Neonates born to non-vaccinated pregnant mice with listeriosis, showed brain and vascular diseases and significant microglial dysfunction by induction of TNF-α-mediated apoptosis. This programmed TNF-mediated suicide explains LM dissemination in brains and livers and blocks production of early pro-inflammatory cytokines such as IL-1β and interferon-α/β. In contrast, neonates born to GNP-GAPDH 1-22 -vaccinated mothers before LM infection, did not develop listeriosis or brain diseases and had functional microglia. In nanovaccinated mothers, immune responses shifted towards Th1/IL-12 pro-inflammatory cytokine profiles and high production of anti-GAPDH 1-22 antibodies, suggesting good induction of LM-specific memory.
Deprenyl Enhances the Teratogenicity of Hydroxyurea in Organogenesis Stage Mouse Embryos
Schlisser, Ava E.; Hales, Barbara F.
2013-01-01
Hydroxyurea, an antineoplastic drug, is a model teratogen. The administration of hydroxyurea to CD1 mice on gestation day 9 induces oxidative stress, increasing the formation of 4-hydroxy-2-nonenal adducts to redox-sensitive proteins such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the caudal region of the embryo. GAPDH catalytic activity is reduced, and its translocation into the nucleus is increased. Because the nuclear translocation of GAPDH is associated with oxidative stress–induced cell death, we hypothesized that this translocation plays a role in mediating the teratogenicity of hydroxyurea. Deprenyl (also known as selegiline), a drug used as a neuroprotectant in Parkinson’s disease, inhibits the nuclear translocation of GAPDH. Hence, timed pregnant CD1 mice were treated with deprenyl (10mg/kg) on gestation day 9 followed by the administration of hydroxyurea (400 or 600mg/kg). Deprenyl treatment significantly decreased the hydroxyurea-induced nuclear translocation of GAPDH in the caudal lumbosacral somites. Deprenyl enhanced hydroxyurea-mediated caudal malformations, inducing specifically limb reduction, digit anomalies, tail defects, and lumbosacral vertebral abnormalities. Deprenyl did not augment the hydroxyurea-induced inhibition of glycolysis or alter the ratio of oxidized to reduced glutathione. However, it did dramatically increase cleaved caspase-3 in embryos. These data suggest that nuclear GAPDH plays an important, region-specific, role in teratogen-exposed embryos. Deprenyl exacerbated the developmental outcome of hydroxyurea exposure by a mechanism that is independent of oxidative stress. Although the administration of deprenyl alone did not affect pregnancy outcome, this drug may have adverse consequences when combined with exposures that increase the risk of malformations. PMID:23696560
Oliveira-Cunha, Melissa; Byers, Richard J; Siriwardena, Ajith K
2010-03-01
There is a need to develop methods of early diagnosis for pancreatic cancer. Pancreatic juice is easily collected by endoscopic retrograde cholangiopancreatography and may facilitate diagnosis using molecular markers. The aim of this work was to explore the feasibility of measurement of gene expression in RNA isolated from ductal juice. Intraoperative sampling of pancreatic juice was undertaken in 27 patients undergoing pancreaticoduodenectomy for suspected tumor. Total RNA was extracted and used as template for poly(adenylic acid) (poly[A]) polymerase chain reaction (PCR) to generate a globally amplified complementary DNA pool representative of all expressed messenger RNAs. Real-time PCR was performed for trefoil factor 2 (TFF2), carboxypeptidase B1 (CPB1), and kallikrein-related peptidase 3 (KLK3) in a subset of samples; all samples were normalized for 3 reference genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH], PSMB6, and beta-2-microglobulin [B2M]). The median volume of the pancreatic juice obtained was 1245 microL (range, 50-5000 microL). The RNA integrity number ranged from 1.9 to 10. Reverse transcriptase PCR was positive for pancreas-specific genes (TFF2 and CPB1) and negative for prostatic-specific antigen in all samples. These results demonstrate that RNA analysis of pancreatic juice is feasible using a combination of poly(A) PCR and real-time PCR. In addition, the poly(A) complementary DNA generated can be probed for multiple genes and is indefinitely renewable, thereby representing a molecular block of importance for future research.
AIRE-induced apoptosis is associated with nuclear translocation of stress sensor protein GAPDH
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liiv, Ingrid, E-mail: ingrid.liiv@ut.ee; Haljasorg, Uku; Kisand, Kai
2012-06-22
Highlights: Black-Right-Pointing-Pointer AIRE induces apoptosis in epithelial cells. Black-Right-Pointing-Pointer CARD domain of AIRE is sufficient for apoptosis induction. Black-Right-Pointing-Pointer AIRE induced apoptosis involves GAPDH translocation to the nuclei. Black-Right-Pointing-Pointer Deprenyl inhibits AIRE induced apoptosis. -- Abstract: AIRE (Autoimmune Regulator) has a central role in the transcriptional regulation of self-antigens in medullary thymic epithelial cells, which is necessary for negative selection of autoreactive T cells. Recent data have shown that AIRE can also induce apoptosis, which may be linked to cross-presentation of these self-antigens. Here we studied AIRE-induced apoptosis using AIRE over-expression in a thymic epithelial cell line as well asmore » doxycycline-inducible HEK293 cells. We show that the HSR/CARD domain in AIRE together with a nuclear localization signal is sufficient to induce apoptosis. In the nuclei of AIRE-positive cells, we also found an increased accumulation of a glycolytic enzyme, glyceraldehyde-3-phosphate (GAPDH) reflecting cellular stress and apoptosis. Additionally, AIRE-induced apoptosis was inhibited with an anti-apoptotic agent deprenyl that blocks GAPDH nitrosylation and nuclear translocation. We propose that the AIRE-induced apoptosis pathway is associated with GAPDH nuclear translocation and induction of NO-induced cellular stress in AIRE-expressing cells.« less
Dad, Azra; Jeong, Clara H; Wagner, Elizabeth D; Plewa, Michael J
2018-02-06
The disinfection of drinking water has been a major public health achievement. However, haloacetic acids (HAAs), generated as byproducts of water disinfection, are cytotoxic, genotoxic, mutagenic, carcinogenic, and teratogenic. Previous studies of monoHAA-induced genotoxicity and cell stress demonstrated that the toxicity was due to inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), leading to disruption of cellular metabolism and energy homeostasis. DiHAAs and triHAAs are also produced during water disinfection, and whether they share mechanisms of action with monoHAAs is unknown. In this study, we evaluated the effects of mono-, di-, and tri-HAAs on cellular GAPDH enzyme kinetics, cellular ATP levels, and pyruvate dehydrogenase complex (PDC) activity. Here, treatments conducted in Chinese hamster ovary (CHO) cells revealed differences among mono-, di-, and triHAAs in their molecular targets. The monoHAAs, iodoacetic acid and bromoacetic acid, were the strongest inhibitors of GAPDH and greatly reduced cellular ATP levels. Chloroacetic acid, diHAAs, and triHAAs were weaker inhibitors of GAPDH and some increased the levels of cellular ATP. HAAs also affected PDC activity, with most HAAs activating PDC. The primary finding of this work is that mono- versus multi-HAAs address different molecular targets, and the results are generally consistent with a model in which monoHAAs activate the PDC through GAPDH inhibition-mediated disruption in cellular metabolites, including altering ATP-to-ADP and NADH-to-NAD ratios. The monoHAA-mediated reduction in cellular metabolites results in accelerated PDC activity by way of metabolite-ratio-dependent PDC regulation. DiHAAs and triHAAs are weaker inhibitors of GAPDH, but many also increase cellular ATP levels, and we suggest that they increase PDC activity by inhibiting pyruvate dehydrogenase kinase.
Yan, Hong; Lou, Marjorie F; Fernando, M Rohan; Harding, John J
2006-10-02
To investigate whether mammalian thioredoxin (Trx) and thioredoxin reductase (TrxR), with or without alpha-crystallin can revive inactivated glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in both the cortex and nucleus of human aged clear and cataract lenses. The lens cortex (including capsule-epithelium) and the nucleus were separated from human aged clear and cataract lenses (grade II and grade IV) with similar average age. The activity of GAPDH in the water-soluble fraction after incubation with or without Trx or/and TrxR for 60 min at 30 degrees C was measured spectrophotometrically. In addition, the effect of a combination of Trx/TrxR and bovine lens alpha-crystallin was investigated. GAPDH activity was lower in the nucleus of clear lenses than in the cortex, and considerably diminished in the cataractous lenses, particularly in the nucleus of cataract lenses grade IV. Trx and TrxR were able to revive the activity of GAPDH markedly in both the cortex and nucleus of the clear and cataract lenses. The percentage increase of activity in the cortex of the clear lenses was less than that of the nucleus in the presence of Trx and TrxR, whereas it was opposite in the cataract lenses. The revival of activity in both the cortex and nucleus from the cataract lenses grade II was higher than that of the grade IV. Moreover, Trx alone, but not TrxR, efficiently enhanced GAPDH activity. The combination of Trx and TrxR had greater effect than that of either alone. In addition, alpha(L)-crystallin enhanced the activity in the cortex of cataract grade II with Trx and TrxR present. However, it failed to provide a statistically significant increase of activity in the nucleus. This is the first evidence to show that mammalian Trx and TrxR are able to revive inactivated GAPDH in human aged clear and cataract lenses, and alpha-crystallin helped this effect. The inactivation of GAPDH during aging and cataract development must be caused in part by disulphide formation and in part by unfolding, and can be recovered by reducing agents and a molecular chaperone.
NASA Astrophysics Data System (ADS)
Carneiro, Agnaldo Silva; Lameira, Jerônimo; Alves, Cláudio Nahum
2011-10-01
The glyceraldehyde-3-phosphate dehydrogenase enzyme (GAPDH) is an important biological target for the development of new chemotherapeutic agents against Chagas disease. In this Letter, the inhibition mechanism of GAPDH involving iodoacetate (IAA) inhibitor was studied using the hybrid quantum mechanical/molecular mechanical (QM/MM) approach and molecular dynamic simulations. Analysis of the potential energy surface and potential of mean force show that the covalent attachment of IAA inhibitor to the active site of the enzyme occurs as a concerted process. In addition, the energy terms decomposition shows that NAD+ plays an important role in stabilization of the reagents and transition state.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Onodera, Yasuhito; Bissell, Mina
Disclosed are methods in which glucose metabolism is correlated to oncogenesis through certain specific pathways; inhibition of certain enzymes is shown to interfere with oncogenic signaling, and measurement of certain enzyme levels is correlated with patient survival. The present methods comprise measuring level of expression of at least one of the enzymes involved in glucose uptake or metabolism, wherein increased expression of the at least one of the enzymes relative to expression in a normal cell correlates with poor prognosis of disease in a patient. Preferably the genes whose expression level is measured include GLUT3, PFKP, GAPDH, ALDOC, LDHA andmore » GFPT2. Also disclosed are embodiments directed towards downregulating the expression of some genes in glucose uptake and metabolism.« less
A genetic overhaul of Saccharomyces cerevisiae 424A(LNH-ST) to improve xylose fermentation.
Bera, Aloke K; Ho, Nancy W Y; Khan, Aftab; Sedlak, Miroslav
2011-05-01
Robust microorganisms are necessary for economical bioethanol production. However, such organisms must be able to effectively ferment both hexose and pentose sugars present in lignocellulosic hydrolysate to ethanol. Wild type Saccharomyces cerevisiae can rapidly ferment hexose, but cannot ferment pentose sugars. Considerable efforts were made to genetically engineer S. cerevisiae to ferment xylose. Our genetically engineered S cerevisiae yeast, 424A(LNH-ST), expresses NADPH/NADH xylose reductase (XR) that prefer NADPH and NAD(+)-dependent xylitol dehydrogenase (XD) from Pichia stipitis, and overexpresses endogenous xylulokinase (XK). This strain is able to ferment glucose and xylose, as well as other hexose sugars, to ethanol. However, the preference for different cofactors by XR and XD might lead to redox imbalance, xylitol excretion, and thus might reduce ethanol yield and productivity. In the present study, genes responsible for the conversion of xylose to xylulose with different cofactor specificity (1) XR from N. crassa (NADPH-dependent) and C. parapsilosis (NADH-dependent), and (2) mutant XD from P. stipitis (containing three mutations D207A/I208R/F209S) were overexpressed in wild type yeast. To increase the NADPH pool, the fungal GAPDH enzyme from Kluyveromyces lactis was overexpressed in the 424A(LNH-ST) strain. Four pentose phosphate pathway (PPP) genes, TKL1, TAL1, RKI1 and RPE1 from S. cerevisiae, were also overexpressed in 424A(LNH-ST). Overexpression of GAPDH lowered xylitol production by more than 40%. However, other strains carrying different combinations of XR and XD, as well as new strains containing the overexpressed PPP genes, did not yield any significant improvement in xylose fermentation.
Li, Hua; Zheng, Xiangtao; Koren, Viktoria; Vashist, Yogesh Kumar; Tsui, Tung Yu
2014-07-20
Small interfering RNAs (siRNAs) delivery remains a bottleneck for RNA interference (RNAi) - based therapies in the clinic. In the present study, a fusion protein with two cell-penetrating peptides (CPP), Hph1-Hph1, and a double-stranded RNA binding domain (dsRBD), was constructed for the siRNA delivery: dsRBD was designed to bind siRNA, and CPP would subsequently transport the dsRBD/siRNA complex into cells. We assessed the efficiency of the fusion protein, Hph1-Hph1-dsRBD, as a siRNA carrier. Calcium-condensed effects were assessed on GAPDH and green fluorescent protein (GFP) genes by western blot, real time polymerase chain reaction (RT-PCR), and flow cytometry analysis in vitro. Evaluations were also made in an in vivo heart transplantation model. The results demonstrated that the fusion protein, Hph1-Hph1-dsRBD, is highly efficient at delivering siRNA in vitro, and exhibits efficiency on GAPDH and GFP genes similar to or greater than lipofectamine. Interestingly, the calcium-condensed effects dramatically enhanced cellular uptake of the protein-siRNA complex. In vivo, Hph1-Hph1-dsRBD transferred and distributed ^ targeted siRNA throughout the whole mouse heart graft. Together, these results indicate that Hph1-Hph1-dsRBD has potential as an siRNA carrier for applications in the clinic or in biomedical research. Copyright © 2014 Elsevier B.V. All rights reserved.
Acosta, Igor da Cunha Lima; da Costa, Andrea Pereira; Nunes, Pablo Henrique; Gondim, Maria Fernanda Naegeli; Gatti, Andressa; Rossi, João Luiz; Gennari, Solange Maria; Marcili, Arlei
2013-12-11
The Lowland tapir (Tapirus terrestris) is the largest Brazilian mammal and despite being distributed in various Brazilian biomes, it is seriously endangered in the Atlantic Rainforest. These hosts were never evaluated for the presence of Trypanosoma parasites. The Lowland tapirs were captured in the Brazilian southeastern Atlantic Rainforest, Espírito Santo state. Trypanosomes were isolated by hemoculture, and the molecular phylogeny based on small subunit rDNA (SSU rDNA) and glycosomal-3-phosphate dehydrogenase (gGAPDH) gene sequences and the ultrastructural features seen via light microscopy and scanning and transmission electron microscopy are described. Phylogenetic trees using combined SSU rDNA and gGAPDH data sets clustered the trypanosomes of Lowland tapirs, which were highly divergent from other trypanosome species. The phylogenetic position and morphological discontinuities, mainly in epimastigote culture forms, made it possible to classify the trypanosomes from Lowland tapirs as a separate species. The isolated trypanosomes from Tapirus terrestris are a new species, Trypanosoma terrestris sp. n., and were positioned in a new Trypanosoma clade, named T. terrestris clade.
2013-01-01
Background The Lowland tapir (Tapirus terrestris) is the largest Brazilian mammal and despite being distributed in various Brazilian biomes, it is seriously endangered in the Atlantic Rainforest. These hosts were never evaluated for the presence of Trypanosoma parasites. Methods The Lowland tapirs were captured in the Brazilian southeastern Atlantic Rainforest, Espírito Santo state. Trypanosomes were isolated by hemoculture, and the molecular phylogeny based on small subunit rDNA (SSU rDNA) and glycosomal-3-phosphate dehydrogenase (gGAPDH) gene sequences and the ultrastructural features seen via light microscopy and scanning and transmission electron microscopy are described. Results Phylogenetic trees using combined SSU rDNA and gGAPDH data sets clustered the trypanosomes of Lowland tapirs, which were highly divergent from other trypanosome species. The phylogenetic position and morphological discontinuities, mainly in epimastigote culture forms, made it possible to classify the trypanosomes from Lowland tapirs as a separate species. Conclusions The isolated trypanosomes from Tapirus terrestris are a new species, Trypanosoma terrestris sp. n., and were positioned in a new Trypanosoma clade, named T. terrestris clade. PMID:24330660
Yang, Haowen; Liu, Ming; Zhou, Bingcong; Deng, Yan; He, Nongyue; Jiang, Hesheng; Guo, Yafen; Lan, Ganqiu; Jiang, Qinyang; Yang, Xiurong; Li, Zhiyang
2016-06-01
Chinese Bama minipigs could be potential donors for the supply of xenografts because they are genetically stable, highly inbred, and inexpensive. However, porcine endogenous retrovirus (PERV) is commonly integrated in pig genomes and could cause a cross-species infection by xenotransplantation. For screening out the pigs with low copy numbers of PERV proviruses, we have developed a novel semiquantitative analysis approach based on magnetic nanoparticles (MNPs) and chemiluminescence (CL) for estimating relative copy numbers (RCNs) of PERV proviruses in Chinese Bama minipigs. The CL intensities of PERV proviruses and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were respectively determined with this method, and the RCNs of PERV proviruses were calculated by the equation: RCN of PERV provirus = CL intensity of PERV provirus/CL intensity of GAPDH. The results showed that PERVs were integrated in the genomes of Bama minipigs at different copy numbers, and the copy numbers of PERV-C subtype were greatly low. Two Bama minipigs with low copy numbers of PERV proviruses were detected out and could be considered as xenograft donor candidates. Although only semiquantitation can be achieved, this approach has potential for screening out safe and suitable pig donors for xenotransplantation.
Ganapathy-Kanniappan, Shanmugasundaram; Geschwind, Jean-Francois H.; Kunjithapatham, Rani; Buijs, Manon; Vossen, Josephina A.; Tchernyshyov, Irina; Cole, Robert N.; Syed, Labiq H.; Rao, Pramod P.; Ota, Shinichi; Vali, Mustafa
2013-01-01
Background The pyruvic acid analog 3-bromopyruvate (3BrPA) is an alkylating agent known to induce cancer cell death by blocking glycolysis. The anti-glycolytic effect of 3BrPA is considered to be the inactivation of glycolytic enzymes. Yet, there is a lack of experimental documentation on the direct interaction of 3BrPA with any of the suggested targets during its anticancer effect. Methods and Results In the current study, using radiolabeled (14C) 3BrPA in multiple cancer cell lines, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was identified as the primary intracellular target of 3BrPA, based on two-dimensional (2D) gel electrophoretic autoradiography, mass spectrometry and immunoprecipitation. Furthermore, in vitro enzyme kinetic studies established that 3BrPA has marked affinity to GAPDH. Finally, Annexin V staining and active caspase-3 immunoblotting demonstrated that apoptosis was induced by 3BrPA. Conclusion GAPDH pyruvylation by 3BrPA affects its enzymatic function and is the primary intracellular target in 3BrPA mediated cancer cell death. PMID:20044597
Ho, L-P; Chang, C-J; Liu, H-C; Yang, H-L; Lin, J H-Y
2014-01-01
Cobia, Rachycentron canadum L., is a very important aquatic fish that faces the risk of infection with the bacterial pathogen Photobacterium damselae ssp. piscicida, and there are few protective approaches available that use multiple antigens. In the present study, potent bivalent antigens from P. damselae ssp. piscicida showed more efficient protection than did single antigens used in isolation. In preparations of three antigens that included recombinant heat shock protein 60 (rHSP60), recombinant α-enolase (rENOLASE) and recombinant glyceraldehyde-3-phosphate dehydrogenase (rGAPDH), we analysed the doses that elicited the best immune responses and found that this occurred at a total of 30 μg of antigen per fish. Subsequently, vaccination of fish with rHSP60, rENOLASE and rGAPDH achieved 46.9, 52 and 25% relative per cent survival (RPS), respectively. In addition, bivalent subunit vaccines--combination I (rHSP60 + rENOLASE), combination II (rENOLASE + rGAPDH) and combination III (rHSP60 + rGAPDH)--were administered and the RPS in these groups (65.6, 64.0 and 48.4%, respectively), was higher than that achieved with single-antigen administration. Finally, in combination IV, the trivalent vaccine rHSP60 + rENOLASE + rGAPDH, the RPS was 1.6%. Taken together, our results suggest that combinations of two antigens may achieve a better efficiency than monovalent or trivalent antigens, and this may provide new insights into pathogen prevention strategies. © 2013 John Wiley & Sons Ltd.
Mohr, S; Stamler, J S; Brüne, B
1994-07-18
Previous studies have suggested that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) undergoes covalent modification of an active site thiol by a NO.-induced [32P]NAD(+)-dependent mechanism. However, the efficacy of GAPDH modification induced by various NO donors was found to be independent of spontaneous rates of NO. release. To further test the validity of this mechanism, we studied the effects of nitrosonium tertrafluoroborate (BF4NO), a strong NO+ donor. BF4NO potently induces GAPDH labeling by the radioactive nucleotide. In this case, the addition of thiol significantly attenuates enzyme modification by competing for the NO moiety in the formation of RS-NO. Peroxynitrite (ONOO-) also induces GAPDH modification in the presence of thiol, consistent with the notion that this species can transfer NO+ (or NO2+) through the intermediacy of RS-NO. However, the efficiency of this reaction is limited by ONOO- -induced oxidation of protein SH groups at the active site. ONOO- generation appears to account for the modification of GAPDH by SIN-1. Thus, S-nitrosylation of the active site thiol is a prequisite for subsequent post-translational modification with NAD+, and emphasizes the role of NO+ transfer in the initial step of this pathway. Our findings thus provide a uniform mechanism by which nitric oxide and related NO donors initiate non-enzymatic ADP-ribosylation (like) reactions. In biological systems, endogenous RS-NO are likely to support the NO group transfer to thiol-containing proteins.
Bommareddy, Rajesh Reddy; Chen, Zhen; Rappert, Sugima; Zeng, An-Ping
2014-09-01
Engineering the cofactor availability is a common strategy of metabolic engineering to improve the production of many industrially important compounds. In this work, a de novo NADPH generation pathway is proposed by altering the coenzyme specificity of a native NAD-dependent glyceraldehyde 3-phosphate dehydrogenase (GAPDH) to NADP, which consequently has the potential to produce additional NADPH in the glycolytic pathway. Specifically, the coenzyme specificity of GAPDH of Corynebacterium glutamicum is systematically manipulated by rational protein design and the effect of the manipulation for cellular metabolism and lysine production is evaluated. By a combinatorial modification of four key residues within the coenzyme binding sites, different GAPDH mutants with varied coenzyme specificity were constructed. While increasing the catalytic efficiency of GAPDH towards NADP enhanced lysine production in all of the tested mutants, the most significant improvement of lysine production (~60%) was achieved with the mutant showing similar preference towards both NAD and NADP. Metabolic flux analysis with (13)C isotope studies confirmed that there was no significant change of flux towards the pentose phosphate pathway and the increased lysine yield was mainly attributed to the NADPH generated by the mutated GAPDH. The present study highlights the importance of protein engineering as a key strategy in de novo pathway design and overproduction of desired products. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
A Reduction in Age-Enhanced Gluconeogenesis Extends Lifespan
Hachinohe, Mayumi; Yamane, Midori; Akazawa, Daiki; Ohsawa, Kazuhiro; Ohno, Mayumi; Terashita, Yuzu; Masumoto, Hiroshi
2013-01-01
The regulation of energy metabolism, such as calorie restriction (CR), is a major determinant of cellular longevity. Although augmented gluconeogenesis is known to occur in aged yeast cells, the role of enhanced gluconeogenesis in aged cells remains undefined. Here, we show that age-enhanced gluconeogenesis is suppressed by the deletion of the tdh2 gene, which encodes glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a protein that is involved in both glycolysis and gluconeogenesis in yeast cells. The deletion of TDH2 restores the chronological lifespan of cells with deletions of both the HST3 and HST4 genes, which encode yeast sirtuins, and represses the activation of gluconeogenesis. Furthermore, the tdh2 gene deletion can extend the replicative lifespan in a CR pathway-dependent manner. These findings demonstrate that the repression of enhanced gluconeogenesis effectively extends the cellular lifespan. PMID:23342062
A reduction in age-enhanced gluconeogenesis extends lifespan.
Hachinohe, Mayumi; Yamane, Midori; Akazawa, Daiki; Ohsawa, Kazuhiro; Ohno, Mayumi; Terashita, Yuzu; Masumoto, Hiroshi
2013-01-01
The regulation of energy metabolism, such as calorie restriction (CR), is a major determinant of cellular longevity. Although augmented gluconeogenesis is known to occur in aged yeast cells, the role of enhanced gluconeogenesis in aged cells remains undefined. Here, we show that age-enhanced gluconeogenesis is suppressed by the deletion of the tdh2 gene, which encodes glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a protein that is involved in both glycolysis and gluconeogenesis in yeast cells. The deletion of TDH2 restores the chronological lifespan of cells with deletions of both the HST3 and HST4 genes, which encode yeast sirtuins, and represses the activation of gluconeogenesis. Furthermore, the tdh2 gene deletion can extend the replicative lifespan in a CR pathway-dependent manner. These findings demonstrate that the repression of enhanced gluconeogenesis effectively extends the cellular lifespan.
Allonso, Diego; Andrade, Iamara S.; Conde, Jonas N.; Coelho, Diego R.; Rocha, Daniele C. P.; da Silva, Manuela L.; Ventura, Gustavo T.
2015-01-01
ABSTRACT Dengue is one of the main public health concerns worldwide. Recent estimates indicate that over 390 million people are infected annually with the dengue virus (DENV), resulting in thousands of deaths. Among the DENV nonstructural proteins, the NS1 protein is the only one whose function during replication is still unknown. NS1 is a 46- to 55-kDa glycoprotein commonly found as both a membrane-associated homodimer and a soluble hexameric barrel-shaped lipoprotein. Despite its role in the pathogenic process, NS1 is essential for proper RNA accumulation and virus production. In the present study, we identified that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) interacts with intracellular NS1. Molecular docking revealed that this interaction occurs through the hydrophobic protrusion of NS1 and the hydrophobic residues located at the opposite side of the catalytic site. Moreover, addition of purified recombinant NS1 enhanced the glycolytic activity of GAPDH in vitro. Interestingly, we observed that DENV infection promoted the relocalization of GAPDH to the perinuclear region, where NS1 is commonly found. Both DENV infection and expression of NS1 itself resulted in increased GAPDH activity. Our findings indicate that the NS1 protein acts to increase glycolytic flux and, consequently, energy production, which is consistent with the recent finding that DENV induces and requires glycolysis for proper replication. This is the first report to propose that NS1 is an important modulator of cellular energy metabolism. The data presented here provide new insights that may be useful for further drug design and the development of alternative antiviral therapies against DENV. IMPORTANCE Dengue represents a serious public health problem worldwide and is caused by infection with dengue virus (DENV). Estimates indicate that half of the global population is at risk of infection, with almost 400 million cases occurring per year. The NS1 glycoprotein is found in both the intracellular and the extracellular milieus. Despite the fact that NS1 has been commonly associated with DENV pathogenesis, it plays a pivotal but unknown role in the replication process. In an effort to understand the role of intracellular NS1, we demonstrate that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) interacts with NS1. Our results indicate that NS1 increases the glycolytic activity of GAPDH in vitro. Interestingly, the GAPDH activity was increased during DENV infection, and NS1 expression alone was sufficient to enhance intracellular GAPDH activity in BHK-21 cells. Overall, our findings suggest that NS1 is an important modulator of cellular energy metabolism by increasing glycolytic flux. PMID:26378175
Allonso, Diego; Andrade, Iamara S; Conde, Jonas N; Coelho, Diego R; Rocha, Daniele C P; da Silva, Manuela L; Ventura, Gustavo T; Silva, Emiliana M; Mohana-Borges, Ronaldo
2015-12-01
Dengue is one of the main public health concerns worldwide. Recent estimates indicate that over 390 million people are infected annually with the dengue virus (DENV), resulting in thousands of deaths. Among the DENV nonstructural proteins, the NS1 protein is the only one whose function during replication is still unknown. NS1 is a 46- to 55-kDa glycoprotein commonly found as both a membrane-associated homodimer and a soluble hexameric barrel-shaped lipoprotein. Despite its role in the pathogenic process, NS1 is essential for proper RNA accumulation and virus production. In the present study, we identified that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) interacts with intracellular NS1. Molecular docking revealed that this interaction occurs through the hydrophobic protrusion of NS1 and the hydrophobic residues located at the opposite side of the catalytic site. Moreover, addition of purified recombinant NS1 enhanced the glycolytic activity of GAPDH in vitro. Interestingly, we observed that DENV infection promoted the relocalization of GAPDH to the perinuclear region, where NS1 is commonly found. Both DENV infection and expression of NS1 itself resulted in increased GAPDH activity. Our findings indicate that the NS1 protein acts to increase glycolytic flux and, consequently, energy production, which is consistent with the recent finding that DENV induces and requires glycolysis for proper replication. This is the first report to propose that NS1 is an important modulator of cellular energy metabolism. The data presented here provide new insights that may be useful for further drug design and the development of alternative antiviral therapies against DENV. Dengue represents a serious public health problem worldwide and is caused by infection with dengue virus (DENV). Estimates indicate that half of the global population is at risk of infection, with almost 400 million cases occurring per year. The NS1 glycoprotein is found in both the intracellular and the extracellular milieus. Despite the fact that NS1 has been commonly associated with DENV pathogenesis, it plays a pivotal but unknown role in the replication process. In an effort to understand the role of intracellular NS1, we demonstrate that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) interacts with NS1. Our results indicate that NS1 increases the glycolytic activity of GAPDH in vitro. Interestingly, the GAPDH activity was increased during DENV infection, and NS1 expression alone was sufficient to enhance intracellular GAPDH activity in BHK-21 cells. Overall, our findings suggest that NS1 is an important modulator of cellular energy metabolism by increasing glycolytic flux. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Mills, Margaret G; Gallagher, Evan P
2017-01-01
Chemical-induced oxidative stress and the biochemical pathways that protect against oxidative damage are of particular interest in the field of toxicology. To rapidly identify oxidative stress-responsive gene expression changes in zebrafish, we developed a targeted panel of antioxidant genes using the Affymetrix QuantiGene Plex (QGP) platform. The genes contained in our panel include eight putative Nrf2 (Nfe2l2a)-dependent antioxidant genes (hmox1a, gstp1, gclc, nqo1, prdx1, gpx1a, sod1, sod2), a stress response gene (hsp70), an inducible DNA damage repair gene (gadd45bb), and three reference genes (actb1, gapdh, hprt1). We tested this platform on larval zebrafish exposed to tert-butyl hydroperoxide (tBHP) and cadmium (Cd), two model oxidative stressors with different modes of action, and compared our results with those obtained using the more common quantitative PCR (qPCR) method. Both methods showed that exposure to tBHP and Cd induced expression of prdx1, gstp1, and hmox1a (2- to 12-fold increase via QGP), indicative of an activated Nrf2 response in larval zebrafish. Both compounds also elicited a general stress response as reflected by elevation of hsp70 and gadd45bb, with Cd being the more potent inducer. Transient changes were observed in sod2 and gpx1a expression, whereas nqo1, an Nrf2-responsive gene in mammalian cells, was minimally affected by either tBHP or Cd chemical exposures. Developmental expression analysis of the target genes by QGP revealed marked upregulation of sod2 between 0-96hpf, and to a lesser extent, of sod1 and gstp1. Once optimized, QGP analysis of these experiments was accomplished more rapidly, using far less tissue, and at lower total costs than qPCR analysis. In summary, the QGP platform as applied to higher-throughput zebrafish studies provides a reasonable cost-effective alternative to qPCR or more comprehensive transcriptomics approaches to rapidly assess the potential for chemicals to elicit oxidative stress as a mechanism of chemical toxicity.
Evidence for Loss of a Partial Flagellar Glycolytic Pathway during Trypanosomatid Evolution
Brown, Robert W. B.; Collingridge, Peter W.; Gull, Keith; Rigden, Daniel J.; Ginger, Michael L.
2014-01-01
Classically viewed as a cytosolic pathway, glycolysis is increasingly recognized as a metabolic pathway exhibiting surprisingly wide-ranging variations in compartmentalization within eukaryotic cells. Trypanosomatid parasites provide an extreme view of glycolytic enzyme compartmentalization as several glycolytic enzymes are found exclusively in peroxisomes. Here, we characterize Trypanosoma brucei flagellar proteins resembling glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoglycerate kinase (PGK): we show the latter associates with the axoneme and the former is a novel paraflagellar rod component. The paraflagellar rod is an essential extra-axonemal structure in trypanosomes and related protists, providing a platform into which metabolic activities can be built. Yet, bioinformatics interrogation and structural modelling indicate neither the trypanosome PGK-like nor the GAPDH-like protein is catalytically active. Orthologs are present in a free-living ancestor of the trypanosomatids, Bodo saltans: the PGK-like protein from B. saltans also lacks key catalytic residues, but its GAPDH-like protein is predicted to be catalytically competent. We discuss the likelihood that the trypanosome GAPDH-like and PGK-like proteins constitute molecular evidence for evolutionary loss of a flagellar glycolytic pathway, either as a consequence of niche adaptation or the re-localization of glycolytic enzymes to peroxisomes and the extensive changes to glycolytic flux regulation that accompanied this re-localization. Evidence indicating loss of localized ATP provision via glycolytic enzymes therefore provides a novel contribution to an emerging theme of hidden diversity with respect to compartmentalization of the ubiquitous glycolytic pathway in eukaryotes. A possibility that trypanosome GAPDH-like protein additionally represents a degenerate example of a moonlighting protein is also discussed. PMID:25050549
Alliinase and cysteine synthase transcription in developing garlic (Allium sativum L.) over time.
Mitrová, Katarina; Svoboda, Pavel; Milella, Luigi; Ovesná, Jaroslava
2018-06-15
Garlic is a valuable source of healthy compounds, including secondary metabolites rich in sulphur such as cysteine sulphoxides (CSOs). Here, we present new qRT-PCR assays analysing the transcription of two genes encoding key enzymes in CSO biosynthetic pathways (cysteine synthase and alliinase) in developing garlic. We also identified a set of genes (ACT I, GAPDH, and TUB) to use as transcription normalisation controls. We showed that the (normalised) transcription of both enzymes was highest during sprouting and decreased significantly in fully developed leaves, which are the major CSO-producing organs. Transcriptional activity further declined at the end of the growing season. Different cultivars show similar sulphur metabolism gene expression when European garlics were compared to Chinese and American genotypes. The qRT-PCR assays presented are also suitable for investigating the effects of agricultural practices on CSO formation in garlic to satisfy consumer demands. Copyright © 2017. Published by Elsevier Ltd.
Ishchuk, Olena P; Voronovsky, Andriy Y; Stasyk, Oleh V; Gayda, Galina Z; Gonchar, Mykhailo V; Abbas, Charles A; Sibirny, Andriy A
2008-11-01
Improvement of xylose fermentation is of great importance to the fuel ethanol industry. The nonconventional thermotolerant yeast Hansenula polymorpha naturally ferments xylose to ethanol at high temperatures (48-50 degrees C). Introduction of a mutation that impairs ethanol reutilization in H. polymorpha led to an increase in ethanol yield from xylose. The native and heterologous (Kluyveromyces lactis) PDC1 genes coding for pyruvate decarboxylase were expressed at high levels in H. polymorpha under the control of the strong constitutive promoter of the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH). This resulted in increased pyruvate decarboxylase activity and improved ethanol production from xylose. The introduction of multiple copies of the H. polymorpha PDC1 gene driven by the strong constitutive promoter led to a 20-fold increase in pyruvate decarboxylase activity and up to a threefold elevation of ethanol production.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish
2009-06-08
The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less
Polymer-based microfluidic chips for isothermal amplification of nucleic acids
NASA Astrophysics Data System (ADS)
Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.
2017-11-01
Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.
GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives.
Kao, Tim; Labonne, Tanya; Niclis, Jonathan C; Chaurasia, Ritu; Lokmic, Zerina; Qian, Elizabeth; Bruveris, Freya F; Howden, Sara E; Motazedian, Ali; Schiesser, Jacqueline V; Costa, Magdaline; Sourris, Koula; Ng, Elizabeth; Anderson, David; Giudice, Antonietta; Farlie, Peter; Cheung, Michael; Lamande, Shireen R; Penington, Anthony J; Parish, Clare L; Thomson, Lachlan H; Rafii, Arash; Elliott, David A; Elefanty, Andrew G; Stanley, Edouard G
2016-09-13
The ability to reliably express fluorescent reporters or other genes of interest is important for using human pluripotent stem cells (hPSCs) as a platform for investigating cell fates and gene function. We describe a simple expression system, designated GAPTrap (GT), in which reporter genes, including GFP, mCherry, mTagBFP2, luc2, Gluc, and lacZ are inserted into the GAPDH locus in hPSCs. Independent clones harboring variations of the GT vectors expressed remarkably consistent levels of the reporter gene. Differentiation experiments showed that reporter expression was reliably maintained in hematopoietic cells, cardiac mesoderm, definitive endoderm, and ventral midbrain dopaminergic neurons. Similarly, analysis of teratomas derived from GT-lacZ hPSCs showed that β-galactosidase expression was maintained in a spectrum of cell types representing derivatives of the three germ layers. Thus, the GAPTrap vectors represent a robust and straightforward tagging system that enables indelible labeling of PSCs and their differentiated derivatives. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Melo, C H; Sousa, F C; Batista, R I P T; Sanchez, D J D; Souza-Fabjan, J M G; Freitas, V J F; Melo, L M; Teixeira, D I A
2015-07-31
The present study aimed to compare laparoscopic (LP) and ultrasound-guided (US) biopsy methods to obtain either liver or splenic tissue samples for ectopic gene expression analysis in transgenic goats. Tissue samples were collected from human granulocyte colony stimulating factor (hG-CSF)-transgenic bucks and submitted to real-time PCR for the endogenous genes (Sp1, Baff, and Gapdh) and the transgene (hG-CSF). Both LP and US biopsy methods were successful in obtaining liver and splenic samples that could be analyzed by PCR (i.e., sufficient sample sizes and RNA yield were obtained). Although the number of attempts made to obtain the tissue samples was similar (P > 0.05), LP procedures took considerably longer than the US method (P = 0.03). Finally, transgene transcripts were not detected in spleen or liver samples. Thus, for the phenotypic characterization of a transgenic goat line, investigation of ectopic gene expression can be made successfully by LP or US biopsy, avoiding the traditional approach of euthanasia.
Liu, Fangling; Tang, Guiting; Zheng, Xiaojuan; Li, Ying; Sun, Xiaofang; Qi, Xiaobo; Zhou, You; Xu, Jing; Chen, Huabao; Chang, Xiaoli; Zhang, Sirong; Gong, Guoshu
2016-01-01
The anthracnose caused by Colletotrichum species is an important disease that primarily causes fruit rot in pepper. Eighty-eight strains representing seven species of Colletotrichum were obtained from rotten pepper fruits in Sichuan Province, China, and characterized according to morphology and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sequence. Fifty-two strains were chosen for identification by phylogenetic analyses of multi-locus sequences, including the nuclear ribosomal internal transcribed spacer (ITS) region and the β-tubulin (TUB2), actin (ACT), calmodulin (CAL) and GAPDH genes. Based on the combined datasets, the 88 strains were identified as Colletotrichum gloeosporioides, C. siamense, C. fructicola, C. truncatum, C. scovillei, and C. brevisporum, and one new species was detected, described as Colletotrichum sichuanensis. Notably, C. siamense and C. scovillei were recorded for the first time as the causes of anthracnose in peppers in China. In addition, with the exception of C. truncatum, this is the first report of all of the other Colletotrichum species studied in pepper from Sichuan. The fungal species were all non-host-specific, as the isolates were able to infect not only Capsicum spp. but also Pyrus pyrifolia in pathogenicity tests. These findings suggest that the fungal species associated with anthracnose in pepper may inoculate other hosts as initial inoculum. PMID:27609555
Liu, Fangling; Tang, Guiting; Zheng, Xiaojuan; Li, Ying; Sun, Xiaofang; Qi, Xiaobo; Zhou, You; Xu, Jing; Chen, Huabao; Chang, Xiaoli; Zhang, Sirong; Gong, Guoshu
2016-09-09
The anthracnose caused by Colletotrichum species is an important disease that primarily causes fruit rot in pepper. Eighty-eight strains representing seven species of Colletotrichum were obtained from rotten pepper fruits in Sichuan Province, China, and characterized according to morphology and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sequence. Fifty-two strains were chosen for identification by phylogenetic analyses of multi-locus sequences, including the nuclear ribosomal internal transcribed spacer (ITS) region and the β-tubulin (TUB2), actin (ACT), calmodulin (CAL) and GAPDH genes. Based on the combined datasets, the 88 strains were identified as Colletotrichum gloeosporioides, C. siamense, C. fructicola, C. truncatum, C. scovillei, and C. brevisporum, and one new species was detected, described as Colletotrichum sichuanensis. Notably, C. siamense and C. scovillei were recorded for the first time as the causes of anthracnose in peppers in China. In addition, with the exception of C. truncatum, this is the first report of all of the other Colletotrichum species studied in pepper from Sichuan. The fungal species were all non-host-specific, as the isolates were able to infect not only Capsicum spp. but also Pyrus pyrifolia in pathogenicity tests. These findings suggest that the fungal species associated with anthracnose in pepper may inoculate other hosts as initial inoculum.
Song, Hao; Dang, Xin; He, Yuan-Qiu; Zhang, Tao; Wang, Hai-Yan
2017-01-01
The veined rapa whelk Rapana venosa is an important commercial shellfish in China and quantitative real-time PCR (qRT-PCR) has become the standard method to study gene expression in R. venosa . For accurate and reliable gene expression results, qRT-PCR assays require housekeeping genes as internal controls, which display highly uniform expression in different tissues or stages of development. However, to date no studies have validated housekeeping genes in R. venosa for use as internal controls for qRT-PCR. In this study, we selected the following 13 candidate genes for suitability as internal controls: elongation factor-1 α ( EF-1α ), α -actin ( ACT ), cytochrome c oxidase subunit 1 ( COX1 ), nicotinamide adenine dinucleotide dehydrogenase (ubiquinone) 1 α subcomplex subunit 7 ( NDUFA7 ), 60S ribosomal protein L5 ( RL5 ), 60S ribosomal protein L28 ( RL28 ), glyceraldehyde 3-phosphate dehydrogenase ( GAPDH ), β -tubulin ( TUBB ), 40S ribosomal protein S25 ( RS25 ), 40S ribosomal protein S8 ( RS8 ), ubiquitin-conjugating enzyme E2 ( UBE2 ), histone H3 ( HH3 ), and peptidyl-prolyl cis-trans isomerase A ( PPIA ). We measured the expression levels of these 13 candidate internal controls in eight different tissues and twelve larvae developmental stages by qRT-PCR. Further analysis of the expression stability of the tested genes was performed using GeNorm and RefFinder algorithms. Of the 13 candidate genes tested, we found that EF-1α was the most stable internal control gene in almost all adult tissue samples investigated with RL5 and RL28 as secondary choices. For the normalization of a single specific tissue, we suggested that EF-1α and NDUFA7 are the best combination in gonad, as well as COX1 and RL28 for intestine, EF-1α and RL5 for kidney, EF-1α and COX1 for gill, EF-1α and RL28 for Leiblein and mantle, EF-1α , RL5 , and NDUFA7 for liver , GAPDH , PPIA , and RL28 for hemocyte. From a developmental perspective, we found that RL28 was the most stable gene in all developmental stages measured, and COX1 and RL5 were appropriate secondary choices. For the specific developmental stage, we recommended the following combination for normalization, PPIA , RS25 , and RL28 for stage 1, RL5 and RL28 for stage 2 and 5, RL28 and NDUFA7 for stage 3, and PPIA and TUBB for stage 4. Our results are instrumental for the selection of appropriately validated housekeeping genes for use as internal controls for gene expression studies in adult tissues or larval development of R. venosa in the future.
Plasmodium glyceraldehyde-3-phosphate dehydrogenase: A potential malaria diagnostic target.
Krause, Robert G E; Hurdayal, Ramona; Choveaux, David; Przyborski, Jude M; Coetzer, Theresa H T; Goldring, J P Dean
2017-08-01
Malaria rapid diagnostic tests (RDTs) are immunochromatographic tests detecting Plasmodial histidine-rich protein 2 (HRP2), lactate dehydrogenase (LDH) and aldolase. HRP2 is only expressed by Plasmodium falciparum parasites and the protein is not expressed in several geographic isolates. LDH-based tests lack sensitivity compared to HRP2 tests. This study explored the potential of the Plasmodial glycolytic enzyme, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), as a new malaria diagnostic biomarker. The P. falciparum and P. yoelii proteins were recombinantly expressed in BL21(DE3) Escherischia coli host cells and affinity purified. Two epitopes (CADGFLLIGEKKVSVFA and CAEKDPSQIPWGKCQV) specific to P. falciparum GAPDH and one common to all mammalian malaria species (CKDDTPIYVMGINH) were identified. Antibodies were raised in chickens against the two recombinant proteins and the three epitopes and affinity purified. The antibodies detected the native protein in parasite lysates as a 38 kDa protein and immunofluorescence verified a parasite cytosolic localization for the native protein. The antibodies suggested a 4-6 fold higher concentration of native PfGAPDH compared to PfLDH in immunoprecipitation and ELISA formats, consistent with published proteomic data. PfGAPDH shows interesting potential as a malaria diagnostic biomarker. Copyright © 2017 Elsevier Inc. All rights reserved.
Loftus, Stacie K.; Baxter, Laura L.; Cronin, Julia C.; Fufa, Temesgen D.; Pavan, William J.
2017-01-01
Summary Hypoxia and HIF1α signaling direct tissue-specific gene responses regulating tumor progression, invasion and metastasis. By integrating HIF1α knockdown and hypoxia-induced gene expression changes, this study identifies a melanocyte-specific, HIF1α-dependent/hypoxia-responsive gene expression signature. Integration of these gene expression changes with HIF1α ChIP-Seq analysis identifies 81 HIF1α direct target genes in melanocytes. The expression levels for ten of the HIF1α direct targets – GAPDH, PKM, PPAT, DARS, DTWD1, SEH1L, ZNF292, RLF, AGTRAP, and GPC6 – are significantly correlated with reduced time of Disease Free Status (DFS) in melanoma by logistic regression (P-value =0.0013) and ROC curve analysis (AUC= 0.826, P-value<0.0001). This HIF1α-regulated profile defines a melanocyte-specific response under hypoxia, and demonstrates the role of HIF1α as an invasive cell state gatekeeper in regulating cellular metabolism, chromatin and transcriptional regulation, vascularization and invasion. PMID:28168807
Mikhed, Yuliya; Görlach, Agnes; Knaus, Ulla G.; Daiber, Andreas
2015-01-01
Reactive oxygen and nitrogen species (e.g. H2O2, nitric oxide) confer redox regulation of essential cellular signaling pathways such as cell differentiation, proliferation, migration and apoptosis. In addition, classical regulation of gene expression or activity, including gene transcription to RNA followed by translation to the protein level, by transcription factors (e.g. NF-κB, HIF-1α) and mRNA binding proteins (e.g. GAPDH, HuR) is subject to redox regulation. This review will give an update of recent discoveries in this field, and specifically highlight the impact of reactive oxygen and nitrogen species on DNA repair systems that contribute to genomic stability. Emphasis will be placed on the emerging role of redox mechanisms regulating epigenetic pathways (e.g. miRNA, DNA methylation and histone modifications). By providing clinical correlations we discuss how oxidative stress can impact on gene regulation/activity and vise versa, how epigenetic processes, other gene regulatory mechanisms and DNA repair can influence the cellular redox state and contribute or prevent development or progression of disease. PMID:26079210
Sartor, Francesco; Jackson, Matthew J; Squillace, Cesare; Shepherd, Anthony; Moore, Jonathan P; Ayer, Donald E; Kubis, Hans-Peter
2013-04-01
Chronic sugar-sweetened beverage (SSB) consumption is associated with obesity and type 2 diabetes mellitus (T2DM). Hyperglycaemia contributes to metabolic alterations observed in T2DM, such as reduced oxidative capacity and elevated glycolytic and lipogenic enzyme expressions in skeletal muscle tissue. We aimed to investigate the metabolic alterations induced by SSB supplementation in healthy individuals and to compare these with the effects of chronic hyperglycaemia on primary muscle cell cultures. Lightly active, healthy, lean subjects (n = 11) with sporadic soft drink consumption underwent a 4-week SSB supplementation (140 ± 15 g/day, ~2 g glucose/kg body weight/day, glucose syrup). Before and after the intervention, body composition, respiratory exchange ratio (RER), insulin sensitivity, muscle metabolic gene and protein expression were assessed. Adaptive responses to hyperglycaemia (7 days, 15 mM) were tested in primary human myotubes. SSB supplementation increased fat mass (+1.0 kg, P < 0.05), fasting RER (+0.12, P < 0.05), fasting glucose (+0.3 mmol/L, P < 0.05) and muscle GAPDH mRNA expressions (+0.94 AU, P < 0.05). PGC1α mRNA was reduced (-0.20 AU, P < 0.05). Trends were found for insulin resistance (+0.16 mU/L, P = 0.09), and MondoA protein levels (+1.58 AU, P = 0.08). Primary myotubes showed elevations in GAPDH, ACC, MondoA and TXNIP protein expressions (P < 0.05). Four weeks of SSB supplementation in healthy individuals shifted substrate metabolism towards carbohydrates, increasing glycolytic and lipogenic gene expression and reducing mitochondrial markers. Glucose-sensing protein MondoA might contribute to this shift, although further in vivo evidence is needed to corroborate this.
Sartor, Francesco; Jackson, Matthew J.; Squillace, Cesare; Shepherd, Anthony; Moore, Jonathan P.; Ayer, Donald E.
2015-01-01
Purpose Chronic sugar-sweetened beverage (SSB) consumption is associated with obesity and type 2 diabetes mellitus (T2DM). Hyperglycaemia contributes to metabolic alterations observed in T2DM, such as reduced oxidative capacity and elevated glycolytic and lipogenic enzyme expressions in skeletal muscle tissue. We aimed to investigate the metabolic alterations induced by SSB supplementation in healthy individuals and to compare these with the effects of chronic hyperglycaemia on primary muscle cell cultures. Methods Lightly active, healthy, lean subjects (n = 11) with sporadic soft drink consumption underwent a 4-week SSB supplementation (140 ± 15 g/day, ∼2 g glucose/kg body weight/day, glucose syrup). Before and after the intervention, body composition, respiratory exchange ratio (RER), insulin sensitivity, muscle metabolic gene and protein expression were assessed. Adaptive responses to hyperglycaemia (7 days, 15 mM) were tested in primary human myotubes. Results SSB supplementation increased fat mass (+1.0 kg, P < 0.05), fasting RER (+0.12, P < 0.05), fasting glucose (+0.3 mmol/L, P < 0.05) and muscle GAPDH mRNA expressions (+0.94 AU, P < 0.05). PGC1a mRNA was reduced (−0.20 AU, P < 0.05). Trends were found for insulin resistance (+0.16 mU/L, P = 0.09), and MondoA protein levels (+1.58 AU, P = 0.08). Primary myotubes showed elevations in GAPDH, ACC, MondoA and TXNIP protein expressions (P < 0.05). Conclusion Four weeks of SSB supplementation in healthy individuals shifted substrate metabolism towards carbohydrates, increasing glycolytic and lipogenic gene expression and reducing mitochondrial markers. Glucose-sensing protein MondoA might contribute to this shift, although further in vivo evidence is needed to corroborate this. PMID:22733000
Zhou, Juhua; Dudley, Mark E.; Rosenberg, Steven A.; Robbins, Paul F.
2007-01-01
Summary The authors recently reported that adoptive immunotherapy with autologous tumor-reactive tumor infiltrating lymphocytes (TILs) immediately following a conditioning nonmyeloablative chemotherapy regimen resulted in an enhanced clinical response rate in patients with metastatic melanoma. These observations led to the current studies, which are focused on a detailed analysis of the T-cell antigen reactivity as well as the in vivo persistence of T cells in melanoma patient 2098, who experienced a complete regression of all metastatic lesions in lungs and soft tissues following therapy. Screening of an autologous tumor cell cDNA library using transferred TILs resulted in the identification of novel mutated growth arrest-specific gene 7 (GAS7) and glyceral-dehyde-3-phosphate dehydrogenase (GAPDH) gene transcripts. Direct sequence analysis of the expressed T-cell receptor beta chain variable regions showed that the transferred TILs contained multiple T-cell clonotypes, at least six of which persisted in peripheral blood for a month or more following transfer. The persistent T cells recognized both the mutated GAS7 and GAPDH. These persistent tumor-reactive T-cell clones were detected in tumor cell samples obtained from the patient following adoptive cell transfer and appeared to be represented at higher levels in the tumor sample obtained 1 month following transfer than in the peripheral blood obtained at the same time. Overall, these results indicate that multiple tumor-reactive T cells can persist in the peripheral blood and at the tumor site for prolonged times following adoptive transfer and thus may be responsible for the complete tumor regression in this patient. PMID:15614045
Tachibana, Masatsugu; Shinagawa, Yasuhiro; Kawamata, Hitoshi; Omotehara, Fumie; Horiuchi, Hideki; Ohkura, Yasuo; Kubota, Keiichi; Imai, Yutaka; Fujibayashi, Takashi; Fujimori, Takahiro
2003-01-01
We present a new approach towards the detection of the mRNAs in formalin-fixed, paraffin-embedded samples using a reverse transcriptase (RT)-polymerase chain reaction (PCR). The total RNAs were extracted from 10-micron-thick sections and were reverse-transcribed, then the RT-products were subjected to PCR amplification of GAPDH mRNA for screening the mRNA degradation. Next, nested PCR was performed for examining the expression of p53-related genes, p21WAF1, MDM2, p33ING1 and p14ARF. GAPDH mRNA expression was detectable in 12 out of 21 oral squamous cell carcinoma (SCC) samples. p21WAF1 mRNA expression was detectable in 5 out of 12 SCC samples, MDM2 mRNA expression was detectable in 5 our of 12 SCC samples and p33ING1 mRNA expression was detectable in 6 out of 12 SCC samples. However, the expression of p14ARF mRNA was not detectable in any of the samples. Seven out of 12 oral SCC samples showed abnormal nuclear accumulation of p53 protein by immunohistochemical staining, whereas 5 out of 12 oral SCCs showed negative staining for p53 protein. Of of p33ING1 mRNA. One of these was a verrucous carcinoma in which the p53 gene products might be inactivated by the oncoprotein E6 of human papilloma virus. Thus, the p53 tumor suppressor pathway was disrupted in most oral SCCs at the cellular levels, due to either an abnormality in p53 itself or loss of expression of p53 regulatory factors. This method would assist in making diagnosis, determining therapeutic strategy and predicting the prognosis of various cancers including oral SCCs.
Saunders, Cassandra Im; Kunde, Dale A; Crawford, Amanda; Geraghty, Dominic P
2007-02-01
The vanilloid receptor family of cation channels includes the capsaicin-sensitive, proton- and heat-activated TRPV1 and noxious heat-activated TRPV2. The present study demonstrates both gene and protein expression of TRPV1 and TRPV2 in human peripheral blood cells (PBCs) using molecular and immunocytochemical techniques. Using reverse-transcription polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR (qRT-PCR), TRPV1 and TRPV2 mRNA was detected in mRNA isolated from human whole peripheral blood. Using qRT-PCR, TRPV2 mRNA was highly expressed in human whole blood isolates (9.33+/-1.19 x 10(4)copies per 10(6)copies of the housekeeping gene GAPDH), whereas TRPV1 message was detected at approximately 150-fold lower levels (638+/-121 copies per 10(6)copies GAPDH). At the protein level, TRPV1 and TRPV2 activity was determined immunocytochemically in a lymphocyte-enriched mononuclear cell preparation (83+/-2% lymphocytes). Cells were labelled with rabbit anti-TRPV1 or goat anti-TRPV2 (1:500) and subsequently labelled with goat Texas red- (TRPV1) or FITC-(TRPV2) conjugated secondary antibodies (1:1000). All cells demonstrated punctate TRPV1-immunoreactivity, which appeared to be on the plasma membrane and in the cytoplasm. In contrast, cells within subjects appeared to express the TRPV1 protein at varying intensities. TRPV2-immunoreactivity appeared diffuse. This is the first study to demonstrate the presence of both TRPV1 and TRPV2 in human peripheral lymphocytes. Further studies need to be undertaken in order to determine the role of TRPV channels in these cells.
Mohr, S; Hallak, H; de Boitte, A; Lapetina, E G; Brüne, B
1999-04-02
S-Nitrosylation of protein thiol groups by nitric oxide (NO) is a widely recognized protein modification. In this study we show that nitrosonium tetrafluoroborate (BF4NO), a NO+ donor, modified the thiol groups of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by S-nitrosylation and caused enzyme inhibition. The resultant protein-S-nitrosothiol was found to be unstable and to decompose spontaneously, thereby restoring enzyme activity. In contrast, the NO-releasing compound S-nitrosoglutathione (GSNO) promoted S-glutathionylation of a thiol group of GAPDH both in vitro and under cellular conditions. The GSH-mixed protein disulfide formed led to a permanent enzyme inhibition, but upon dithiothreitol addition a functional active GAPDH was recovered. This S-glutathionylation is specific for GSNO because GSH itself was unable to produce protein-mixed disulfides. During cellular nitrosative stress, the production of intracellular GSNO might channel signaling responses to form protein-mixed disulfide that can regulate intracellular function.
The Role of Semaphorin 3B (SEMA3B) in the Pathogenesis of Breast Cancer
2006-04-01
apoptotic and anti-proliferative effect on cancer lines it is in part by the inhibition of Akt pathway. In conclusion, we hypothesize that VEGF165...autocrine activity and by inhibiting the Akt pathway. 15. SUBJECT TERMS tumor suppressor gene, breast cancer and apoptosis 16. SECURITY...TGFβ TGFR2 Smad4 M D A M B A 54 9 H 12 99 H el a H 46 0 M C F7 ZR -7 5 H 15 7 2 31 GAPDH TGFR1 B. C 2H 24H 48H 72H SEMA3B SEMA3B
Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio
2002-10-15
Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.
Ito, Akira; Nagai, Momoko; Tajino, Junichi; Yamaguchi, Shoki; Iijima, Hirotaka; Zhang, Xiangkai; Aoyama, Tomoki; Kuroki, Hiroshi
2015-01-01
Cell-based therapy has been explored for articular cartilage regeneration. Autologous chondrocyte implantation is a promising cell-based technique for repairing articular cartilage defects. However, there are several issues such as chondrocyte de-differentiation. While numerous studies have been designed to overcome some of these issues, only a few have focused on the thermal environment that can affect chondrocyte metabolism and phenotype. In this study, the effects of different culture temperatures on human chondrocyte metabolism- and phenotype-related gene expression were investigated in 2D and 3D environments. Human chondrocytes were cultured in a monolayer or in a pellet culture system at three different culture temperatures (32°C, 37°C, and 41°C) for 3 days. The results showed that the total RNA level, normalized to the threshold cycle value of internal reference genes, was higher at lower temperatures in both culture systems. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and citrate synthase (CS), which are involved in glycolysis and the citric acid cycle, respectively, were expressed at similar levels at 32°C and 37°C in pellet cultures, but the levels were significantly lower at 41°C. Expression of the chondrogenic markers, collagen type IIA1 (COL2A1) and aggrecan (ACAN), was higher at 37°C than at 32°C and 41°C in both culture systems. However, this phenomenon did not coincide with SRY (sex-determining region Y)-box 9 (SOX9), which is a fundamental transcription factor for chondrogenesis, indicating that a SOX9-independent pathway might be involved in this phenomenon. In conclusion, the expression of chondrocyte metabolism-related genes at 32°C was maintained or enhanced compared to that at 37°C. However, chondrogenesis-related genes were further induced at 37°C in both culture systems. Therefore, manipulating the culture temperature may be an advantageous approach for regulating human chondrocyte metabolic activity and chondrogenesis.
Development of FQ-PCR method to determine the level of ADD1 expression in fatty and lean pigs.
Cui, J X; Chen, W; Zeng, Y Q
2015-10-30
To determine how adipocyte determination and differentiation factor 1 (ADD1), a gene involved in the determination of pork quality, is regulated in Laiwu and Large pigs, we used TaqMan fluorescence quantitative real-time polymerase chain reaction (FQ-PCR) to detect differential expression in the longissimus muscle of Laiwu (fatty) and Large White (lean) pigs. In this study, the ADD1 and GAPDH cDNA sequences were cloned using a T-A cloning assay, and the clone sequences were consistent with those deposited in GenBank. Thus, the target fragment was successfully recombined into the vector, and its integrity was maintained. The standard curve and regression equation were established through the optimized FQ-PCR protocol. The standard curve of porcine ADD1 and GAPDH cDNA was determined, and its linear range extension could reach seven orders of magnitudes. The results showed that this method was used to quantify ADD1 expression in the longissimus muscle of two breeds of pig, and was found to be accurate, sensitive, and convenient. These results provide information regarding porcine ADD1 mRNA expression and the mechanism of adipocyte differentiation, and this study could help in the effort to meet the demands of consumers interested in the maintenance of health and prevention of obesity. Furthermore, it could lead to new approaches in the prevention and clinical treatment of this disease.
A feeding protocol for delivery of agents to assess development in Varroa mites
2017-01-01
A novel feeding protocol for delivery of bio-active agents to Varroa mites was developed by providing mites with honey bee larva hemolymph supplemented with cultured insect cells and selected materials delivered on a fibrous cotton substrate. Mites were starved, fed on treated hemolymph to deliver selected agents and then returned to bee larvae. Transcript levels of two reference genes, actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), as well as for nine selected genes involved in reproductive processes showed that the starvation and feeding protocol periods did not pose a high level of stress to the mites as transcript levels remained comparable between phoretic mites and those completing the protocol. The feeding protocol was used to deliver molecules such as hormone analogs or plasmids. Mites fed with Tebufenozide, an ecdysone analog, had higher transcript levels of shade than untreated or solvent treated mites. In order to extend this feeding protocol, cultured insect cells were incorporated to a final ratio of 1 part cells and 2 parts hemolymph. Although supplementation with Bombyx mori Bm5 cells increased the amount of hemolymph consumed per mite, there was a significant decrease in the percentage of mites that fed and survived. On the other hand, Drosophila melanogaster S2 cells reduced significantly the percentage of mites that fed and survived as well as the amount of hemolymph consumed. The feeding protocol provides a dynamic platform with which to challenge the Varroa mite to establish efficacy of control agents for this devastating honey bee pest. PMID:28448606
Sustained Local Delivery of siRNA from an Injectable Scaffold
Nelson, Christopher E.; Gupta, Mukesh K.; Adolph, Elizabeth J.; Shannon, Joshua M.; Guelcher, Scott A.; Duvall, Craig L.
2011-01-01
Controlled gene silencing technologies have significant, unrealized potential for use in tissue regeneration applications. The design described herein provides a means to package and protect siRNA within pH-responsive, endosomolytic micellar nanoparticles (si-NPs) that can be incorporated into nontoxic, biodegradable, and injectable polyurethane (PUR) tissue scaffolds. The si-NPs were homogeneously incorporated throughout the porous PUR scaffolds, and they were shown to be released via a diffusion-based mechanism for over three weeks. The siRNA-loaded micelles were larger but retained nano particulate morphology of approximately 100 nm diameter following incorporation into and release from the scaffolds. PUR scaffold releasate collected in vitro in PBS at 37°C for 1–4 days was able to achieve dose-dependent siRNA-mediated silencing with approximately 50% silencing achieved of the model gene GAPDH in NIH3T3 mouse fibroblasts. This promising platform technology provides both a research tool capable of probing the effects of local gene silencing and a potentially high-impact therapeutic approach for sustained, local silencing of deleterious genes within tissue defects. PMID:22061489
Song, Hao; Dang, Xin; He, Yuan-qiu
2017-01-01
Background The veined rapa whelk Rapana venosa is an important commercial shellfish in China and quantitative real-time PCR (qRT-PCR) has become the standard method to study gene expression in R. venosa. For accurate and reliable gene expression results, qRT-PCR assays require housekeeping genes as internal controls, which display highly uniform expression in different tissues or stages of development. However, to date no studies have validated housekeeping genes in R. venosa for use as internal controls for qRT-PCR. Methods In this study, we selected the following 13 candidate genes for suitability as internal controls: elongation factor-1α (EF-1α), α-actin (ACT), cytochrome c oxidase subunit 1 (COX1), nicotinamide adenine dinucleotide dehydrogenase (ubiquinone) 1α subcomplex subunit 7 (NDUFA7), 60S ribosomal protein L5 (RL5), 60S ribosomal protein L28 (RL28), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), β-tubulin (TUBB), 40S ribosomal protein S25 (RS25), 40S ribosomal protein S8 (RS8), ubiquitin-conjugating enzyme E2 (UBE2), histone H3 (HH3), and peptidyl-prolyl cis-trans isomerase A (PPIA). We measured the expression levels of these 13 candidate internal controls in eight different tissues and twelve larvae developmental stages by qRT-PCR. Further analysis of the expression stability of the tested genes was performed using GeNorm and RefFinder algorithms. Results Of the 13 candidate genes tested, we found that EF-1α was the most stable internal control gene in almost all adult tissue samples investigated with RL5 and RL28 as secondary choices. For the normalization of a single specific tissue, we suggested that EF-1α and NDUFA7 are the best combination in gonad, as well as COX1 and RL28 for intestine, EF-1α and RL5 for kidney, EF-1α and COX1 for gill, EF-1α and RL28 for Leiblein and mantle, EF-1α, RL5, and NDUFA7 for liver, GAPDH, PPIA, and RL28 for hemocyte. From a developmental perspective, we found that RL28 was the most stable gene in all developmental stages measured, and COX1 and RL5 were appropriate secondary choices. For the specific developmental stage, we recommended the following combination for normalization, PPIA, RS25, and RL28 for stage 1, RL5 and RL28 for stage 2 and 5, RL28 and NDUFA7 for stage 3, and PPIA and TUBB for stage 4. Discussion Our results are instrumental for the selection of appropriately validated housekeeping genes for use as internal controls for gene expression studies in adult tissues or larval development of R. venosa in the future. PMID:28584723
Glycolysis determines dichotomous regulation of T cell subsets in hypoxia
Xu, Yang; Zhang, Ming; Savoldo, Barbara; Metelitsa, Leonid S.; Rodgers, John; Yustein, Jason T.; Neilson, Joel R.
2016-01-01
Hypoxia occurs in many pathological conditions, including chronic inflammation and tumors, and is considered to be an inhibitor of T cell function. However, robust T cell responses occur at many hypoxic inflammatory sites, suggesting that functions of some subsets are stimulated under low oxygen conditions. Here, we investigated how hypoxic conditions influence human T cell functions and found that, in contrast to naive and central memory T cells (TN and TCM), hypoxia enhances the proliferation, viability, and cytotoxic action of effector memory T cells (TEM). Enhanced TEM expansion in hypoxia corresponded to high hypoxia-inducible factor 1α (HIF1α) expression and glycolytic activity compared with that observed in TN and TCM. We determined that the glycolytic enzyme GAPDH negatively regulates HIF1A expression by binding to adenylate-uridylate–rich elements in the 3′-UTR region of HIF1A mRNA in glycolytically inactive TN and TCM. Conversely, active glycolysis with decreased GAPDH availability in TEM resulted in elevated HIF1α expression. Furthermore, GAPDH overexpression reduced HIF1α expression and impaired proliferation and survival of T cells in hypoxia, indicating that high glycolytic metabolism drives increases in HIF1α to enhance TEM function during hypoxia. This work demonstrates that glycolytic metabolism regulates the translation of HIF1A to determine T cell responses to hypoxia and implicates GAPDH as a potential mechanism for controlling T cell function in peripheral tissue. PMID:27294526
Si, Xu; Zhou, Zhongkai; Strappe, Padraig; Blanchard, Chris
2017-01-25
The anti-obesity effects of two types of resistant starch (RS) in high-fat-diet-induced obese rats were investigated. The serum triglycerides, total cholesterol and malondialdehyde concentrations were significantly reduced, and the total antioxidant capacity, superoxide dismutase levels and glutathione peroxidase activity were increased by RS2 and RS4 consumption compared to the obesity group. A significant reduction in the serum glucose level and elevations in hepatic lipid metabolic enzyme activities were observed only for RS4 administration. Moreover, the expression levels of the fatty acid synthesis associated genes ACC and Fads1, the triglyceride synthesis and metabolism-related gene SREBP-1, the adipocyte differentiation gene PPARγ, the cholesterol synthesis associated gene HMGCR, and the gluconeogenesis associated gene GAPDH were all significantly down-regulated, whilst the lipid oxidation gene Acox1 and the liver function genes Gsta2, Nqo1, and Gclm were up-regulated in both administered groups. Additionally, RS4 performed well in up-regulating the expressions of Gsta2, Gsta3, Nqo1, and Egfr, and down-regulating LXRα, Igfbp1, and Pml. RS4 exhibited great advantages in reducing oxidative stress compared with RS2.
Role of TMS1 Silencing in the Resistance of Breast Cancer Cells to Apoptosis
2006-08-01
USA 93: Kelliher MA, Grimm S, Ishida Y, Kuo F , Stanger BZ, Leder 14486-14491. P. (1998). Immunity 8: 297-303. Stehlik C , Fiorentino L , Dorfleutner A ...Caspase-8 - TMS1.. -. - GAPDH - . B. CuX+ siRNA: CHX TRAIL Lamin A / C + - + - TMS1 + - + Procaspase-8 f t Cleaved Caspase-8 - - 3 TMS1 . 03-tubulin...analysis for caspase-8, TMS 1 and either GAPDH or P3-tubulin as indicated. siRNA: Lamin A / C TMS1 TNFa+CHX - +- - + TRAIL -+ - + PARP -m l PARP p85
Peskin, Alexander V; Midwinter, Robyn G; Harwood, David T; Winterbourn, Christine C
2005-02-01
Hypochlorous acid formed by activated neutrophils reacts with amines to produce chloramines. Chloramines vary in stability, reactivity, and cell permeability. We have examined whether chloramine exchange occurs between physiologically important amines or amino acids and if this affects interactions of chloramines with cells. We have demonstrated transchlorination reactions between histamine, glycine, and taurine chloramines by measuring chloramine decay rates with mixtures as well as by mass spectrometry. Kinetic analysis suggested the formation of an intermediate complex with a high Km. Apparent second-order rate constants, determined for concentrations
Peskin, Alexander V; Midwinter, Robyn G; Harwood, David T; Winterbourn, Christine C
2004-11-15
Hypochlorous acid formed by activated neutrophils reacts with amines to produce chloramines. Chloramines vary in stability, reactivity, and cell permeability. We have examined whether chloramine exchange occurs between physiologically important amines or amino acids and if this affects interactions of chloramines with cells. We have demonstrated transchlorination reactions between histamine, glycine, and taurine chloramines by measuring chloramine decay rates with mixtures as well as by mass spectrometry. Kinetic analysis suggested the formation of an intermediate complex with a high K(m). Apparent second-order rate constants, determined for concentrations
Zhang, Yanfei; Kouril, Theresa; Snoep, Jacky L; Siebers, Bettina; Barberis, Matteo; Westerhoff, Hans V
2017-04-20
Mathematical models are key to systems biology where they typically describe the topology and dynamics of biological networks, listing biochemical entities and their relationships with one another. Some (hyper)thermophilic Archaea contain an enzyme, called non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GAPN), which catalyzes the direct oxidation of glyceraldehyde-3-phosphate to 3-phosphoglycerate omitting adenosine 5'-triphosphate (ATP) formation by substrate-level-phosphorylation via phosphoglycerate kinase. In this study we formulate three hypotheses that could explain functionally why GAPN exists in these Archaea, and then construct and use mathematical models to test these three hypotheses. We used kinetic parameters of enzymes of Sulfolobus solfataricus ( S. solfataricus ) which is a thermo-acidophilic archaeon that grows optimally between 60 and 90 °C and between pH 2 and 4. For comparison, we used a model of Saccharomyces cerevisiae ( S. cerevisiae ), an organism that can live at moderate temperatures. We find that both the first hypothesis, i.e., that the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plus phosphoglycerate kinase (PGK) route (the alternative to GAPN) is thermodynamically too much uphill and the third hypothesis, i.e., that GAPDH plus PGK are required to carry the flux in the gluconeogenic direction, are correct. The second hypothesis, i.e., that the GAPDH plus PGK route delivers less than the 1 ATP per pyruvate that is delivered by the GAPN route, is only correct when GAPDH reaction has a high rate and 1,3- bis -phosphoglycerate (BPG) spontaneously degrades to 3PG at a high rate.
Stroylova, Yulia Y; Semenyuk, Pavel I; Asriyantz, Regina A; Gaillard, Cedric; Haertlé, Thomas; Muronetz, Vladimir I
2014-09-01
The current study describes an approach to creation of catalytically active particles with increased stability from enzymes by N-homocysteinylation, a naturally presented protein modification. Enzymatic activities and properties of two globular tetrameric enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase (LDH) were studied before and after N-homocysteinylation. Modification of these proteins concerns the accessible lysine residues and introduces an average of 2-2,5 homocysteine residues per protein monomer. Formation of a range of aggregates was observed for both enzymes, which assemble via formation of intermolecular noncovalent bonds and by disulfide bonds. It was demonstrated that both studied enzymes retain their catalytic activities on modification and the subsequent formation of oligomeric forms. At low concentrations of homocysteine thiolactone, modification of GAPDH leads not only to prevention of spontaneous inactivation but also increases thermal stability of this enzyme on heating to 80°C. A moderate reduction of the activity of GAPDH observed in case of its crosslinking with 50-fold excess of homocysteine thiolactone per lysine is probably caused by hindered substrate diffusion. Spherical particles of 100 nm and larger diameters were observed by transmission electron microscopy and atomic force microscope techniques after modification of GAPDH with different homocysteine thiolactone concentrations. In case of LDH, branched fibril-like aggregates were observed under the same conditions. Interestingly, crosslinked samples of both proteins were found to have reversible thermal denaturation profiles, indicating that modification with homocysteine thiolactone stabilizes the spatial structure of these enzymes. © 2014 Wiley Periodicals, Inc.
Keshavarz-Pakseresht, Behta; Shandiz, Seyed Ataollah Sadat; Baghbani-arani, Fahimeh
2017-01-01
Aim: The present study investigated the anti-tumor activity of Imatinib mesylate through modulation of NM23 gene expression in human hepatocellular carcinoma (HepG2) cell line. Background: Hepatocellular carcinoma (HCC) is considered to be the third leading cause of cancer related death worldwide. Down regulation of NM23, a metastasis suppressor gene, has been associated with several types of malignant cancer. Recently, effects of Imatinib mesylate, a first member of tyrosine kinases inhibitors, were indicated in research and treatment of different malignant tumors. Methods: Cell viability was quantitated by MTT assay after HepG2 cells exposure to Imatinib mesylate at various concentrations of 0, 1.56, 3.125, 6.25, 12.5, 25,50μM for 24 hours. Also, quantitative real time PCR technique was applied for the detection of NM23 gene expression in HepG2 cell line. Results: There was a dose dependent increase in the cytotoxicity effect of imatinib. The real time PCR results demonstrated that inhibitory effect of Imatinib mesylate on viability via up regulation of NM23 gene expression compared to GAPDH gene (internal control gene) in cancer cells. Conclusion: According to our findings, imatinib can modulate metastasis by enhancing Nm23 gene expression in human hepatocellular carcinoma (HepG2) cell line. PMID:28331561
Haufe, C C; Eismann, U; Deppisch, R M; Stein, G
2001-02-01
Dialysis-related amyloidosis is an important complication of long-term hemodialysis (HD) therapy with several pathogenetic factors. One of them is the influence of the dialyzer membrane type on the synthesis of beta2-microglobulin (beta2m). In vitro results are controversial. Thus, the hypothesis of whether in vivo beta2m generation is induced by the HD procedure and whether this induction depends on the type of the used dialyzer membrane should be tested. The aim of the present study was to investigate the influence of "biocompatible" high-flux versus "bioincompatible" low-flux HD on in vivo beta2m generation as well as the induction of the early activation gene c-fos in peripheral blood cells. Six nondiabetic HD patients [mean age 46 (21 to 69) years; Kt/V> 1.2] were included in a randomized crossover study using either a low-flux (cellulosic/cuprophan) or a high-flux (polyamide) dialyzer membrane. At the end of a four-week run-in period for each membrane, whole blood samples were taken before, immediately at, and four hours after the end of the dialysis session. MRNA was extracted, and after transcription to cDNA, quantitative polymerase chain reaction was performed for the beta2m gene, the early response gene c-fos, and the GAP-DH housekeeping gene. Based on the applied method for detection of specific mRNA, the results were given as ratio of beta2m or c-fos cDNA per GAP-DH cDNA. General cell activation during HD was indicated by increasing mRNA expression of c-fos related to the time course of the dialysis session, whereas beta2m did not change significantly. However, no difference was found when comparing the low-flux and the high-flux dialyzer membranes. Despite the evidence for activation of peripheral blood cells, as indicated by increasing c-fos message, no sign of beta2m mRNA induction during HD procedure with different dialyzer membranes was seen. Our results suggest that there is post-transcriptional regulation of beta2m generation and/or release as well as the influence of the dialyzer membrane type on post-translational processes, that is, advance glycation end products (AGE) or conformational modification of the beta2m protein. Furthermore, our data demonstrate that gene expression patterns during dialysis and/or uremia are not homogenous and need to be investigated further, especially with respect to the proinflammatory role of early leukocyte activation signals.
2013-01-01
Background Bat trypanosomes have been implicated in the evolutionary history of the T. cruzi clade, which comprises species from a wide geographic and host range in South America, Africa and Europe, including bat-restricted species and the generalist agents of human American trypanosomosis T. cruzi and T. rangeli. Methods Trypanosomes from bats (Rhinolophus landeri and Hipposideros caffer) captured in Mozambique, southeast Africa, were isolated by hemoculture. Barcoding was carried out through the V7V8 region of Small Subunit (SSU) rRNA and Fluorescent Fragment Length barcoding (FFLB). Phylogenetic inferences were based on SSU rRNA, glyceraldehyde phosphate dehydrogenase (gGAPDH) and Spliced Leader (SL) genes. Morphological characterization included light, scanning and transmission electron microscopy. Results New trypanosomes from bats clustered together forming a clade basal to a larger assemblage called the T. cruzi clade. Barcoding, phylogenetic analyses and genetic distances based on SSU rRNA and gGAPDH supported these trypanosomes as a new species, which we named Trypanosoma livingstonei n. sp. The large and highly polymorphic SL gene repeats of this species showed a copy of the 5S ribosomal RNA into the intergenic region. Unique morphological (large and broad blood trypomastigotes compatible to species of the subgenus Megatrypanum and cultures showing highly pleomorphic epimastigotes and long and slender trypomastigotes) and ultrastructural (cytostome and reservosomes) features and growth behaviour (when co-cultivated with HeLa cells at 37°C differentiated into trypomastigotes resembling the blood forms and do not invaded the cells) complemented the description of this species. Conclusion Phylogenetic inferences supported the hypothesis that Trypanosoma livingstonei n. sp. diverged from a common ancestral bat trypanosome that evolved exclusively in Chiroptera or switched at independent opportunities to mammals of several orders forming the clade T. cruzi, hence, providing further support for the bat seeding hypothesis to explain the origin of T. cruzi and T. rangeli. PMID:23915781
On the relevance of glycolysis process on brain gliomas.
Kounelakis, M G; Zervakis, M E; Giakos, G C; Postma, G J; Buydens, L M C; Kotsiakis, X
2013-01-01
The proposed analysis considers aspects of both statistical and biological validation of the glycolysis effect on brain gliomas, at both genomic and metabolic level. In particular, two independent datasets are analyzed in parallel, one engaging genomic (Microarray Expression) data and the other metabolomic (Magnetic Resonance Spectroscopy Imaging) data. The aim of this study is twofold. First to show that, apart from the already studied genes (markers), other genes such as those involved in the human cell glycolysis significantly contribute in gliomas discrimination. Second, to demonstrate how the glycolysis process can open new ways towards the design of patient-specific therapeutic protocols. The results of our analysis demonstrate that the combination of genes participating in the glycolytic process (ALDOA, ALDOC, ENO2, GAPDH, HK2, LDHA, LDHB, MDH1, PDHB, PFKM, PGI, PGK1, PGM1 and PKLR) with the already known tumor suppressors (PTEN, Rb, TP53), oncogenes (CDK4, EGFR, PDGF) and HIF-1, enhance the discrimination of low versus high-grade gliomas providing high prediction ability in a cross-validated framework. Following these results and supported by the biological effect of glycolytic genes on cancer cells, we address the study of glycolysis for the development of new treatment protocols.
Comparative analysis of the blood transcriptomes between wolves and dogs.
Yang, X; Zhang, H; Shang, J; Liu, G; Xia, T; Zhao, C; Sun, G; Dou, H
2018-06-28
Dogs were domesticated by human and originated from wolves. Their evolutionary relationships have attracted much scientific interest due to their genetic affinity but different habitats. To identify the differences between dogs and wolves associated with domestication, we analysed the blood transcriptomes of wolves and dogs by RNA-Seq. We obtained a total of 30.87 Gb of raw reads from two dogs and three wolves using RNA-Seq technology. Comparisons of the wolf and dog transcriptomes revealed 524 genes differentially expressed genes between them. We found that some genes related to immune function (DCK, ICAM4, GAPDH and BSG) and aerobic capacity (HBA1, HBA2 and HBB) were more highly expressed in the wolf. Six differentially expressed genes related to the innate immune response (CCL23, TRIM10, DUSP10, RAB27A, CLEC5A and GCH1) were found in the wolf by a Gene Ontology enrichment analysis. Immune system development was also enriched only in the wolf group. The ALAS2, HMBS and FECH genes, shown to be enriched by the Kyoto Encyclopedia of Genes and Genomes analysis, were associated with the higher aerobic capacity and hypoxia endurance of the wolf. The results suggest that the wolf might have greater resistance to pathogens, hypoxia endurance and aerobic capacity than dogs do. © 2018 Stichting International Foundation for Animal Genetics.
Seo, Jung-Kil; Lee, Min Jeong; Go, Hye-Jin; Kim, Yeon Jun; Park, Nam Gyu
2014-02-01
A 3.4 kDa of antimicrobial peptide was purified from an acidified skin extract of skipjack tuna, Katsuwonus pelamis, by preparative acid-urea-polyacrylamide gel electrophoresis and C18 reversed-phase HPLC. A comparison of the N-terminal amino acid sequence of the purified peptide with that of other known polypeptides revealed high sequence homology with the YFGAP (Yellowfin tuna Glyceraldehyde-3-phosphate dehydrogenase-related Antimicrobial Peptide); thus, this peptide was identified as the skipjack tuna GAPDH-related antimicrobial peptide (SJGAP). SJGAP showed potent antimicrobial activity against Gram-positive bacteria, such as Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, and Streptococcus iniae (minimal effective concentrations [MECs], 1.2-17.0 μg/mL), Gram-negative bacteria, such as Aeromonas hydrophila, Escherichia coli D31, and Vibrio parahaemolyticus (MECs, 3.1-12.0 μg/mL), and against Candida albicans (MEC, 16.0 μg/mL) without significant hemolytic activity. Antimicrobial activity of this peptide is heat-stable but salt-sensitive. According to the secondary structural prediction and the homology modeling, this peptide consists of three secondary structural motifs, including one α-helix and two parallel β-strands, and forms an amphipathic structure. This peptide showed neither membrane permeabilization ability nor killing ability, but did display a small degree of leakage ability. These results suggest that SJGAP acts through a bacteriostatic process rather than bactericidal one. SJGAP is another GAPDH-related antimicrobial peptide isolated from skipjack tuna and likely plays an important role for GAPDH in the innate immune defense of tuna fish. Copyright © 2014 Elsevier Ltd. All rights reserved.
Fu, Shulin; Zhang, Minmin; Xu, Juan; Ou, Jiwen; Wang, Yan; Liu, Huazhen; Liu, Jinlin; Chen, Huanchun; Bei, Weicheng
2013-01-02
Haemophilus parasuis (H. parasuis), the causative agent of swine polyserositis, polyarthritis, and meningitis, is one of the most important bacterial diseases of pigs worldwide. Little vaccines currently exist that have a significant effect on infections with all pathogenic serovars of H. parasuis. H. parasuis putative outer membrane proteins (OMPs) are potentially essential components of more effective vaccines. Recently, the genomic sequence of H. parasuis serovar 5 strain SH0165 was completed in our laboratory, which allow us to target OMPs for the development of recombinant vaccines. In this study, we focused on 10 putative OMPs and all the putative OMPs were cloned, expressed and purified as HIS fusion proteins. Primary screening for immunoprotective potential was performed in mice challenged with an LD50 challenge. Out of these 10 OMPs three fusion proteins rGAPDH, rOapA, and rHPS-0675 were found to be protective in a mouse model of H. parasuis infection. We further evaluated the immune responses and protective efficacy of rGAPDH, rOapA, and rHPS-0675 in pig models. All three proteins elicited humoral antibody responses and conferred different levels of protection against challenge with a lethal dose of H. parasuis SH0165 in pig models. In addition, the antisera against the three individual proteins and the synergistic protein efficiently inhibited bacterial growth in a whole blood assay. The data demonstrated that the three proteins showed high value individually and the combination of rGAPDH, rOapA, and rHPS-0675 offered the best protection. Our results indicate that rGAPDH, rOapA, and rHPS-0675 induced protection against H. parasuis SH0165 infection, which may facilitate the development of a multi-component vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.
Xu, Yao; Zheng, Zhi
2016-05-15
We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.
Natural infection of the sand fly Phlebotomus kazeruni by Trypanosoma species in Pakistan
2010-01-01
The natural infection of phlebotomine sand flies by Leishmania parasites was surveyed in a desert area of Pakistan where cutaneous leishmaniasis is endemic. Out of 220 female sand flies dissected, one sand fly, Phlebotomus kazeruni, was positive for flagellates in the hindgut. Analyses of cytochrome b (cyt b), glycosomal glyceraldehyde phosphate dehydrogenase (gGAPDH) and small subunit ribosomal RNA (SSU rRNA) gene sequences identified the parasite as a Trypanosoma species of probably a reptile or amphibian. This is the first report of phlebotomine sand flies naturally infected with a Trypanosoma species in Pakistan. The possible infection of sand flies with Trypanosoma species should be taken into consideration in epidemiological studies of vector species in areas where leishmaniasis is endemic. PMID:20184773
Anticancer efficacy of the metabolic blocker 3-bromopyruvate: specific molecular targeting.
Ganapathy-Kanniappan, Shanmugasundaram; Kunjithapatham, Rani; Geschwind, Jean-Francois
2013-01-01
The anticancer efficacy of the pyruvate analog 3-bromopyruvate has been demonstrated in multiple tumor models. The chief principle underlying the antitumor effects of 3-bromopyruvate is its ability to effectively target the energy metabolism of cancer cells. Biochemically, the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been identified as the primary target of 3-bromopyruvate. Its inhibition results in the depletion of intracellular ATP, causing cell death. Several reports have also demonstrated that in addition to GAPDH inhibition, the induction of cellular stress also contributes to 3-bromopyruvate treatment-dependent apoptosis. Furthermore, recent evidence shows that 3-bromopyruvate is taken up selectively by tumor cells via the monocarboxylate transporters (MCTs) that are frequently overexpressed in cancer cells (for the export of lactate produced during aerobic glycolysis). The preferential uptake of 3-bromopyruvate via MCTs facilitates selective targeting of tumor cells while leaving healthy and non-malignant tissue untouched. Taken together, the specificity of molecular (GAPDH) targeting and selective uptake by tumor cells, underscore the potential of 3-bromopyruvate as a potent and promising anticancer agent. In this review, we highlight the mechanistic characteristics of 3-bromopyruvate and discuss its potential for translation into the clinic.
Kramer, B; Ferrari, D M; Klappa, P; Pöhlmann, N; Söling, H D
2001-01-01
The rat luminal endoplasmic-recticulum calcium-binding proteins 1 and 2 (CaBP1 and CaBP2 respectively) are members of the protein disulphide-isomerase (PDI) family. They contain two and three thioredoxin boxes (Cys-Gly-His-Cys) respectively and, like PDI, may be involved in the folding of nascent proteins. We demonstrate here that CaBP1, similar to PDI and CaBP2, can complement the lethal phenotype of the disrupted Saccharomyces cerevisiae PDI gene, provided that the natural C-terminal Lys-Asp-Glu-Leu sequence is replaced by His-Asp-Glu-Leu. Both the in vitro RNase AIII-re-activation assays and in vivo pro-(carboxypeptidase Y) processing assays using CaBP1 and CaBP2 thioredoxin (trx)-box mutants revealed that, whereas the three trx boxes in CaBP2 seem to be functionally equivalent, the first trx box of CaBP1 is significantly more active than the second trx box. Furthermore, only about 65% re-activation of denatured reduced RNase AIII could be obtained with CaBP1 or CaBP2 compared with PDI, and the yield of PDI-catalysed reactions was significantly reduced in the presence of either CaBP1 or CaBP2. In contrast with PDI, neither CaBP1 nor CaBP2 could catalyse the renaturation of denatured glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is a redox-independent process, and neither protein had any effect on the PDI-catalysed refolding of GAPDH. Furthermore, although PDI can bind peptides via its b' domain, a property it shares with PDIp, the pancreas-specific PDI homologue, and although PDI can bind malfolded proteins such as 'scrambled' ribonuclease, no such interactions could be detected for CaBP2. We conclude that: (1) both CaBP2 and CaBP1 lack peptide-binding activity for GAPDH attributed to the C-terminal region of the a' domain of PDI; (2) CaBP2 lacks the general peptide-binding activity attributed to the b' domain of PDI; (3) interaction of CaBP2 with substrate (RNase AIII) is different from that of PDI and substrate; and (4) both CaBP2 and CaBP1 may promote oxidative folding by different kinetic pathways. PMID:11415439
Elanchezhian, R; Sakthivel, M; Geraldine, P; Thomas, P A
2010-03-30
Differential expression of apoptotic genes has been demonstrated in selenite-induced cataract. Acetyl-l-carnitine (ALCAR) has been shown to prevent selenite cataractogenesis by maintaining lenticular antioxidant enzyme and redox system components at near normal levels and also by inhibiting lenticular calpain activity. The aim of the present experiment was to investigate the possibility that ALCAR also prevents selenite-induced cataractogenesis by regulating the expression of antioxidant (catalase) and apoptotic [caspase-3, early growth response protein-1 (EGR-1) and cytochrome c oxidase subunit I (COX-I)] genes. The experiment was conducted on 9-day-old Wistar rat pups, which were divided into normal, cataract-untreated and cataract-treated groups. Putative changes in gene expression in whole lenses removed from the rats were determined by measuring mRNA transcript levels of the four genes by RT-PCR analysis, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. The expression of lenticular caspase-3 and EGR-1 genes appeared to be upregulated, as inferred by detecting increased mRNA transcript levels, while that of COX-I and catalase genes appeared to be downregulated (lowered mRNA transcript levels) in the lenses of cataract-untreated rats. However, in rats treated with ALCAR, the lenticular mRNA transcript levels were maintained at near normal (control) levels. These results suggest that ALCAR may prevent selenite-induced cataractogenesis by preventing abnormal expression of lenticular genes governing apoptosis.
Almomani, Ensaf Y; Touret, Nicolas; Cordat, Emmanuelle
2018-04-13
Mutations in the gene encoding the kidney anion exchanger 1 (kAE1) can lead to distal renal tubular acidosis (dRTA). dRTA mutations reported within the carboxyl (C)-terminal tail of kAE1 result in apical mis-targeting of the exchanger in polarized renal epithelial cells. As kAE1 physically interacts with the μ subunit of epithelial adaptor protein 1 B (AP-1B), we investigated the role of heterologously expressed μ1B subunit of the AP-1B complex for kAE1 retention to the basolateral membrane in polarized porcine LLC-PK1 renal epithelial cells that are devoid of endogenous AP-1B. We confirmed the interaction and close proximity between kAE1 and μ1B using immunoprecipitation and proximity ligation assay, respectively. Expressing the human μ1B subunit in these cells decreased significantly the amount of cell surface kAE1 at the steady state, but had no significant effect on kAE1 recycling and endocytosis. We show that (i) heterologous expression of μ1B displaces the physical interaction of endogenous GAPDH with kAE1 WT supporting that both AP-1B and GAPDH proteins bind to an overlapping site on kAE1 and (ii) phosphorylation of tyrosine 904 within the potential YDEV interaction motif does not alter the kAE1/AP-1B interaction. We conclude that μ1B subunit is not involved in recycling of kAE1.
Development of a one-step duplex RT-qPCR for the quantification of phocine distemper virus.
Bogomolni, Andrea L; Frasca, Salvatore; Matassa, Keith A; Nielsen, Ole; Rogers, Kara; De Guise, Sylvain
2015-04-01
Worldwide, stranded marine mammals and the network personnel who respond to marine mammal mortality have provided much of the information regarding marine morbillivirus infections. An assay to determine the amount of virus present in tissue samples would be useful to assist in routine surveying of animal health and for monitoring large-scale die-off events. False negatives from poor-quality samples prevent determination of the true extent of infection, while only small amounts of tissue samples or archived RNA may be available at the time of collection for future retrospective analysis. We developed a one-step duplex real-time reverse transcriptase-quantitative-PCR assay (RT-qPCR) based on Taqman probe technology to quantify phocine distemper virus (PDV) isolated from an outbreak in harbor (Phoca vitulina concolor) and gray seals (Halichoerus grypus) along the northeast US coast in 2006. The glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) gene was selected to assess RNA quality. This duplex assay is specific for PDV and sensitive through a range of 10(0) to 10(9) copies ds-plasmid DNA. For the GAPDH target, the reaction in duplex amplified 10(0) to 10(9) copies of ds-plasmid DNA and was detectable in multiple seal species. This assay reduced the likelihood of false negative results due to degradation of tissues and well-to-well variability while providing sensitive and specific detection of PDV, which would be applicable in molecular epidemiologic studies and pathogen detection in field and laboratory investigations involving a variety of seal species.
Vieira, Willie A S; Lima, Waléria G; Nascimento, Eduardo S; Michereff, Sami J; Câmara, Marcos P S; Doyle, Vinson P
2017-01-01
Developing a comprehensive and reliable taxonomy for the Colletotrichum gloeosporioides species complex will require adopting data standards on the basis of an understanding of how methodological choices impact morphological evaluations and phylogenetic inference. We explored the impact of methodological choices in a morphological and molecular evaluation of Colletotrichum species associated with banana in Brazil. The choice of alignment filtering algorithm has a significant impact on topological inference and the retention of phylogenetically informative sites. Similarly, the choice of phylogenetic marker affects the delimitation of species boundaries, particularly if low phylogenetic signal is confounded with strong discordance, and inference of the species tree from multiple-gene trees. According to both phylogenetic informativeness profiling and Bayesian concordance analyses, the most informative loci are DNA lyase (APN2), intergenic spacer (IGS) between DNA lyase and the mating-type locus MAT1-2-1 (APN2/MAT-IGS), calmodulin (CAL), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), glutamine synthetase (GS), β-tubulin (TUB2), and a new marker, the intergenic spacer between GAPDH and an hypothetical protein (GAP2-IGS). Cornmeal agar minimizes the variance in conidial dimensions compared with potato dextrose agar and synthetic nutrient-poor agar, such that species are more readily distinguishable based on phenotypic differences. We apply these insights to investigate the diversity of Colletotrichum species associated with banana anthracnose in Brazil and report C. musae, C. tropicale, C. theobromicola, and C. siamense in association with banana anthracnose. One lineage did not cluster with any previously described species and is described here as C. chrysophilum.
Zika Virus Induces Autophagy in Human Umbilical Vein Endothelial Cells.
Peng, Haoran; Liu, Bin; Yves, Toure Doueu; He, Yanhua; Wang, Shijie; Tang, Hailin; Ren, Hao; Zhao, Ping; Qi, Zhongtian; Qin, Zhaoling
2018-05-15
Autophagy is a common strategy for cell protection; however, some viruses can in turn adopt cellular autophagy to promote viral replication. Zika virus (ZIKV) is the pathogen that causes Zika viral disease, and it is a mosquito-borne virus. However, its pathogenesis, especially the interaction between ZIKV and target cells during the early stages of infection, is still unclear. In this study, we demonstrate that infecting human umbilical vein endothelial cells (HUVEC) with ZIKV triggers cellular autophagy. We observed both an increase in the conversion of LC3-I to LC3-II and increased accumulation of fluorescent cells with LC3 dots, which are considered to be the two key indicators of autophagy. The ratio of LC3-II/GAPDH in each group was significantly increased at different times after ZIKV infection at different MOIs, indicating that the production of lipidated LC3-II increased. Moreover, both the ratio of LC3-II/GAPDH and the expression of viral NS3 protein increased with increasing time of viral infection. The expression level of p62 decreased gradually from 12 h post-infection. Expression profile of double fluorescent protein labelling LC3 indicated that the autophagy induced by ZIKV infection was a complete process. We further investigated the role of autophagy in ZIKV replication. We demonstrated that either the treatment with inhibitors of autophagosomes formation or short hairpin RNA targeting the Beclin-1 gene, which is critical for the formation of autophagosomes, significantly reduced viral production. Taken together, our results indicate that ZIKV infection induces autophagy of HUVEC, and inhibition of ZIKV-induced autophagy restrains viral replication.
Alternaria section Alternaria: Species, formae speciales or pathotypes?
Woudenberg, J.H.C.; Seidl, M.F.; Groenewald, J.Z.; de Vries, M.; Stielow, J.B.; Thomma, B.P.H.J.; Crous, P.W.
2015-01-01
The cosmopolitan fungal genus Alternaria consists of multiple saprophytic and pathogenic species. Based on phylogenetic and morphological studies, the genus is currently divided into 26 sections. Alternaria sect. Alternaria contains most of the small-spored Alternaria species with concatenated conidia, including important plant, human and postharvest pathogens. Species within sect. Alternaria have been mostly described based on morphology and / or host-specificity, yet molecular variation between them is minimal. To investigate whether the described morphospecies within sect. Alternaria are supported by molecular data, whole-genome sequencing of nine Alternaria morphospecies supplemented with transcriptome sequencing of 12 Alternaria morphospecies as well as multi-gene sequencing of 168 Alternaria isolates was performed. The assembled genomes ranged in size from 33.3–35.2 Mb within sect. Alternaria and from 32.0–39.1 Mb for all Alternaria genomes. The number of repetitive sequences differed significantly between the different Alternaria genomes; ranging from 1.4–16.5 %. The repeat content within sect. Alternaria was relatively low with only 1.4–2.7 % of repeats. Whole-genome alignments revealed 96.7–98.2 % genome identity between sect. Alternaria isolates, compared to 85.1–89.3 % genome identity for isolates from other sections to the A. alternata reference genome. Similarly, 1.4–2.8 % and 0.8–1.8 % single nucleotide polymorphisms (SNPs) were observed in genomic and transcriptomic sequences, respectively, between isolates from sect. Alternaria, while the percentage of SNPs found in isolates from different sections compared to the A. alternata reference genome was considerably higher; 8.0–10.3 % and 6.1–8.5 %. The topology of a phylogenetic tree based on the whole-genome and transcriptome reads was congruent with multi-gene phylogenies based on commonly used gene regions. Based on the genome and transcriptome data, a set of core proteins was extracted, and primers were designed on two gene regions with a relatively low degree of conservation within sect. Alternaria (96.8 and 97.3 % conservation). Their potential discriminatory power within sect. Alternaria was tested next to nine commonly used gene regions in sect. Alternaria, namely the SSU, LSU, ITS, gapdh, rpb2, tef1, Alt a 1, endoPG and OPA10-2 gene regions. The phylogenies from the two gene regions with a relatively low conservation, KOG1058 and KOG1077, could not distinguish the described morphospecies within sect. Alternaria more effectively than the phylogenies based on the commonly used gene regions for Alternaria. Based on genome and transcriptome comparisons and molecular phylogenies, Alternaria sect. Alternaria consists of only 11 phylogenetic species and one species complex. Thirty-five morphospecies, which cannot be distinguished based on the multi-gene phylogeny, are synonymised under A. alternata. By providing guidelines for the naming and identification of phylogenetic species in Alternaria sect. Alternaria, this manuscript provides a clear and stable species classification in this section. PMID:26951037
Avci, Cigir Biray; Dodurga, Yavuz; Gundogdu, Gulsah; Caglar, Hasan Onur; Kucukatay, Vural; Gunduz, Cumhur; Satiroglu-Tufan, N Lale
2013-12-01
Neuroblastoma (NB), originating from neural crest cells, is the most common extracranial tumor of childhood. Retinoic acid (RA) which is the biological active form of vitamin A regulates differentiation of NB cells, and RA derivatives have been used for NB treatment. PPARα (peroxisome proliferator-activated receptor) plays an important role in the oxidation of fatty acids, carcinogenesis, and differentiation. URG4/URGCP gene is a proto-oncogene and that overexpression of URG4/URGCP is associated with metastasis and tumor recurrence in osteosarcoma. It has been known that URG4/URGCP gene is an overexpressed gene in hepatocellular carcinoma and gastric cancers. This study aims to detect gene expression patterns of PPARα and URG4/URGCP genes in SH-SY5Y NB cell line after RA treatment. Expressions levels of PPARα and URG4/URGCP genes were analyzed after RA treatment for reducing differentiation in SH-SY5Y NB cell line. To induce differentiation, the cells were treated with 10 μM RA in the dark for 3-10 days. Gene expression of URG4/URGCP and PPARα genes were presented as the yield of polymerase chain reaction (PCR) products from target genes compared with the yield of PCR products from the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene. SH-SY5Y cells possess small processes in an undifferentiated state, and after treatment with RA, the cells developed long neurites, resembling a neuronal phenotype. PPARα gene expression increased in RA-treated groups; URG4/URGCP gene expression decreased in SH-SY5Y cells after RA treatment compared with that in the control cells. NB cell differentiation might associate with PPARα and URG4/URGCP gene expression profile after RA treatment.
Yook, Jang Soo; Shibato, Junko; Rakwal, Randeep; Soya, Hideaki
2015-01-01
Naturally occurring astaxantin (ASX) is one of the noticeable carotenoid and dietary supplement, which has strong antioxidant and anti-inflammatory properties, and neuroprotective effects in the brain through crossing the blood–brain barrier. Specially, we are interested in the role of ASX as a brain food. Although ASX has been suggested to have potential benefit to the brain function, the underlying molecular mechanisms and events mediating such effect remain unknown. Here we examined molecular factors in the hippocampus of adult mouse fed ASX diets (0.1% and 0.5% doses) using DNA microarray (Agilent 4 × 44 K whole mouse genome chip) analysis. In this study, we described in detail our experimental workflow and protocol, and validated quality controls with the housekeeping gene expression (Gapdh and Beta-actin) on the dye-swap based approach to advocate our microarray data, which have been uploaded to Gene Expression Omnibus (accession number GSE62197) as a gene resource for the scientific community. This data will also form an important basis for further detailed experiments and bioinformatics analysis with an aim to unravel the potential molecular pathways or mechanisms underlying the positive effects of ASX supplementation on the brain, in particular the hippocampus. PMID:26981356
Cortés-Castell, Ernesto; Veciana-Galindo, Carmen; Torró-Montell, Luis; Palazón-Bru, Antonio; Sirvent-Segura, Elia; Gil-Guillén, Vicente; Rizo-Baeza, Mercedes
2016-02-16
We evaluated the protective activity of an extract from a by-product such as olive stones, through its ability to inhibit H202 induced apoptosis in the SH-SY5Y human neuroblastoma cell line. To such end, 20,000 cells/well were cultivated and differentiation with retinoic acid was initiated. Once the cells were differentiated, apoptosis was induced with and without H2O2 extract. Finally, cDNA extraction was performed, and pro-apoptotic genes Bax and anti-apoptotic genes Bcl-2 were analyzed. Quantification of the gene expression was performed using the GAPDH gene marker. Cell viability with the extract is 97.6% (SD 5.7) with 10 mg/l and 62.8% (SD 1.2) to 50 mg/l, using 10 mg/l for the biomarker assay. The retinoic acid differentiated SH-S cell line (10 μM) shows a clear apoptosis when treated with H2O2 150 μM, with a Bax/Bcl-2 ratio of 3.75 (SD 0.80) in contrast to the differentiated control cells subjected to H2O2 and with extract, which have the same ratio of 1.02 (SD 0.01-0.03). The olive stone extract shows anti-apoptotic activity in the provoked cell death of SH-SY5Y human neuroblastoma cells in their normal state, defending them from oxidative stress which produces a significant increase in the apoptotic gene ratio in contrast to anti-apoptotic genes (Bax/Bcl-2).
Daily oscillation of gene expression associated with nacreous layer formation
NASA Astrophysics Data System (ADS)
Miyazaki, Yoko; Usui, Tomomi; Kajikawa, Aya; Hishiyama, Hajime; Matsuzawa, Norifumi; Nishida, Takuma; Machii, Akira; Samata, Tetsuro
2008-06-01
Three major organic matrix components, nacrein, MSI60 and N16 have been reported from the nacreous layer of Japanese pearl oyster, Pinctada fucata. Though several in vitro experiments have been carried out to elucidate the functions of these molecules details have not yet been clarified. In this report, we tempt to clarify the gene expression levels encoding the above three proteins between samples of 1) summer and winter seasons and 2) ocean and aquarium environments by using real-time polymerase chain reaction (PCR). It was confirmed that the biomineralization process of P. fucata is mainly influenced by the circatidal rhythm of the ocean environment. The gene expressions coding for N16 and MSI60 increased at the time of high tide, while that of nacrein increased at the time of low tide. The similar tendency observed in N16 and MSI60 showed the possibility that both components are secreted simultaneously, supporting a hypothesis that N16 forms cross-linkage with MSI60 to form the membrane. The expressions of MSI60, N16 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were remarkable in winter season, while no variation was found in the expression level of the nacrein gene in summer and winter season. The study is the first attempt regarding the seasonal and circadian rhythms observed on gene expressions incorporated into molluscan shell formation. The results will give a new insight into the relationship between molluscan physiology and the mechanism of shell formation.
Hanke, Nina; Scheibe, Renate J; Manukjan, Georgi; Ewers, David; Umeda, Patrick K; Chang, Kin-Chow; Kubis, Hans-Peter; Gros, Gerolf; Meissner, Joachim D
2011-03-01
Adaptations in the oxidative capacity of skeletal muscle cells can occur under several physiological or pathological conditions. We investigated the effect of increasing extracellular glucose concentration on the expression of markers of energy metabolism in primary skeletal muscle cells and the C2C12 muscle cell line. Growth of myotubes in 25mM glucose (high glucose, HG) compared with 5.55mM led to increases in the expression and activity of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a marker of glycolytic energy metabolism, while oxidative markers peroxisome proliferator-activated receptor γ coactivator 1α and citrate synthase decreased. HG induced metabolic adaptations as are seen during a slow-to-fast fiber transformation. Furthermore, HG increased fast myosin heavy chain (MHC) IId/x but did not change slow MHCI/β expression. Protein phosphatase 2A (PP2A) was shown to mediate the effects of HG on GAPDH and MHCIId/x. Carbohydrate response element-binding protein (ChREBP), a glucose-dependent transcription factor downstream of PP2A, partially mediated the effects of glucose on metabolic markers. The glucose-induced increase in PP2A activity was associated with an increase in p38 mitogen-activated protein kinase activity, which presumably mediates the increase in MHCIId/x promoter activity. Liver X receptor, another possible mediator of glucose effects, induced only an incomplete metabolic shift, mainly increasing the expression of the glycolytic marker. Taken together, HG induces a partial slow-to-fast transformation comprising metabolic enzymes together with an increased expression of MHCIId/x. This work demonstrates a functional role for ChREBP in determining the metabolic type of muscle fibers and highlights the importance of glucose as a signaling molecule in muscle. Copyright © 2011 Elsevier B.V. All rights reserved.
Zheng, Lei; Roeder, Robert G; Luo, Yan
2003-07-25
We have isolated and functionally characterized a multicomponent Oct-1 coactivator, OCA-S which is essential for S phase-dependent histone H2B transcription. The p38 component of OCA-S binds directly to Oct-1, exhibits potent transactivation potential, is selectively recruited to the H2B promoter in S phase, and is essential for S phase-specific H2B transcription in vivo and in vitro. Surprisingly, p38 represents a nuclear form of glyceraldehyde-3-phosphate dehydrogenase, and binding to Oct-1, as well as OCA-S function, is stimulated by NAD(+) but inhibited by NADH. OCA-S also interacts with NPAT, a cyclin E/cdk2 substrate that is broadly involved in histone gene transcription. These studies thus link the H2B transcriptional machinery to cell cycle regulators, and possibly to cellular metabolic state (redox status), and set the stage for studies of the underlying mechanisms and the basis for coordinated histone gene expression and coupling to DNA replication.
Lima, Luciana; Espinosa-Álvarez, Oneida; Ortiz, Paola A; Trejo-Varón, Javier A; Carranza, Julio C; Pinto, C Miguel; Serrano, Myrna G; Buck, Gregory A; Camargo, Erney P; Teixeira, Marta M G
2015-11-01
Trypanosoma cruzi is a complex of phenotypically and genetically diverse isolates distributed in six discrete typing units (DTUs) designated as TcI-TcVI. Five years ago, T. cruzi isolates from Brazilian bats showing unique patterns of traditional ribosomal and spliced leader PCRs not clustering into any of the six DTUs were designated as the Tcbat genotype. In the present study, phylogenies inferred using SSU rRNA (small subunit of ribosomal rRNA), gGAPDH (glycosomal glyceraldehyde 3-phosphate dehydrogenase) and Cytb (cytochrome b) genes strongly supported Tcbat as a monophyletic lineage prevalent in Brazil, Panama and Colombia. Providing strong support for Tcbat, sequences from 37 of 47 nuclear and 12 mitochondrial genes (retrieved from a draft genome of Tcbat) and reference strains of all DTUs available in databanks corroborated Tcbat as an independent DTU. Consistent with previous studies, multilocus analysis of most nuclear genes corroborated the evolution of T. cruzi from bat trypanosomes its divergence into two main phylogenetic lineages: the basal TcII; and the lineage clustering TcIV, the clade comprising TcIII and the sister groups TcI-Tcbat. Most likely, the common ancestor of Tcbat and TcI was a bat trypanosome. However, the results of the present analysis did not support Tcbat as the ancestor of all DTUs. Despite the insights provided by reports of TcIII, TcIV and TcII in bats, including Amazonian bats harbouring TcII, further studies are necessary to understand the roles played by bats in the diversification of all DTUs. We also demonstrated that in addition to value as molecular markers for DTU assignment, Cytb, ITS rDNA and the spliced leader (SL) polymorphic sequences suggest spatially structured populations of Tcbat. Phylogenetic and phylogeographical analyses, multiple molecular markers specific to Tcbat, and the degrees of sequence divergence between Tcbat and the accepted DTUs strongly support the definitive classification of Tcbat as a new DTU. Copyright © 2015 Elsevier B.V. All rights reserved.
S-nitrosylation in the regulation of gene transcription☆
Sha, Yonggang; Marshall, Harvey E.
2015-01-01
Background Post-translational modification of proteins by S-nitrosylation serves as a major mode of signaling in mammalian cells and a growing body of evidence has shown that transcription factors and their activating pathways are primary targets. S-nitrosylation directly modifies a number of transcription factors, including NF-κB, HIF-1, and AP-1. In addition, S-nitrosylation can indirectly regulate gene transcription by modulating other cell signaling pathways, in particular JNK kinase and ras. Scope of review The evolution of S-nitrosylation as a signaling mechanism in the regulation of gene transcription, physiological advantages of protein S-nitrosylation in the control of gene transcription, and discussion of the many transcriptional proteins modulated by S-nitrosylation is summarized. Major conclusions S-nitrosylation plays a crucial role in the control of mammalian gene transcription with numerous transcription factors regulated by this modification. Many of these proteins serve as immunomodulators, and inducible nitric oxide synthase (iNOS) is regarded as a principal mediatiator of NO-dependent S-nitrosylation. However, additional targets within the nucleus (e.g. histone deacetylases) and alternative mechanisms of S-nitrosylation (e.g. GAPDH-mediated trans-nitrosylation) are thought to play a role in NOS-dependent transcriptional regulation. General significance Derangement of SNO-regulated gene transcription is an important factor in a variety of pathological conditions including neoplasia and sepsis. A better understanding of protein S-nitrosylation as it relates to gene transcription and the physiological mechanisms behind this process is likely to lead to novel therapies for these disorders. This article is part of a Special Issue entitled Regulation of Cellular Processes by S-nitrosylation. PMID:21640163
Chavez, Juan D.; Bisson, William H.
2011-01-01
The site-specific identification of α-aminoadipic semialdehyde (AAS) and γ-glutamic semialdehyde (GGS) residues in proteins is reported. Semialdehydic protein modifications result from the metal-catalyzed oxidation of Lys or Arg and Pro residues, respectively. Most of the analytical methods for the analysis of protein carbonylation measure change to the global level of carbonylation and fail to provide details regarding protein identity, site, and chemical nature of the carbonylation. In this work, we used a targeted approach, which combines chemical labeling, enrichment, and tandem mass spectrometric analysis, for the site-specific identification of AAS and GGS sites in proteins. The approach is applied to in vitro oxidized glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and an untreated biological sample, namely cardiac mitochondrial proteins. The analysis of GAPDH resulted in the site-specific identification of two AAA and four GGS residues. Computational evaluation of the identified AAS and GGS sites in GAPDH indicated that these sites are located in flexible regions, show high solvent accessibility values, and are in proximity with possible metal ion binding sites. The targeted proteomic analysis of semialdehydic modifications in cardiac mitochondria yielded nine AAS modification sites which were unambiguously assigned to distinct lysine residues in the following proteins: ATP/ATP translocase isoforms 1 and 2, ubiquinol cytochrome-c reductase core protein 2, and ATP synthase α-subunit. PMID:20957471
Branco, Patrícia; Albergaria, Helena; Arneborg, Nils; Prista, Catarina
2018-05-01
Saccharomyces cerevisiae secretes antimicrobial peptides (AMPs) derived from glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which induce the death of several non-Saccharomyces yeasts. Previously, we demonstrated that the naturally secreted GAPDH-derived AMPs (i.e. saccharomycin) caused a loss of culturability and decreased the intracellular pH (pHi) of Hanseniaspora guilliermondii cells. In this study, we show that chemically synthesised analogues of saccharomycin also induce a pHi drop and loss of culturability in H. guilliermondii, although to a lesser extent than saccharomycin. To assess the underlying causes of the pHi drop, we evaluated the membrane permeability to H+ cations of H. guilliermondii cells, after being exposed to saccharomycin or its synthetic analogues. Results showed that the H+-efflux decreased by 75.6% and the H+-influx increased by 66.5% in cells exposed to saccharomycin at pH 3.5. Since H+-efflux via H+-ATPase is energy dependent, reduced glucose consumption would decrease ATP production and consequently H+-ATPase activity. However, glucose uptake rates were not affected, suggesting that the AMPs rather than affecting glucose transporters may affect directly the plasma membrane H+-ATPase or increase ATP leakage due to cell membrane disturbance. Thus, our study revealed that both saccharomycin and its synthetic analogues induced cell death of H. guilliermondii by increasing the proton influx and inhibiting the proton efflux.
Dad, Azra; Jeong, Clara H; Pals, Justin A; Wagner, Elizabeth D; Plewa, Michael J
2013-10-01
Monohaloacetic acids (monoHAAs) are a major class of drinking water disinfection by-products (DBPs) and are cytotoxic, genotoxic, mutagenic, and teratogenic. We propose a model of toxic action based on monoHAA-mediated inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a target cytosolic enzyme. This model predicts that GAPDH inhibition by the monoHAAs will lead to a severe reduction of cellular ATP levels and repress the generation of pyruvate. A loss of pyruvate will lead to mitochondrial stress and genomic DNA damage. We found a concentration-dependent reduction of ATP in Chinese hamster ovary cells after monoHAA treatment. ATP reduction per pmol monoHAA followed the pattern of iodoacetic acid (IAA) > bromoacetic acid (BAA) > chloroacetic acid (CAA), which is the pattern of potency observed with many toxicological endpoints. Exogenous supplementation with pyruvate enhanced ATP levels and attenuated monoHAA-induced genomic DNA damage as measured with single cell gel electrophoresis. These data were highly correlated with the SN 2 alkylating potentials of the monoHAAs and with the induction of toxicity. The results from this study strongly support the hypothesis that GAPDH inhibition and the possible subsequent generation of reactive oxygen species is linked with the cytotoxicity, genotoxicity, teratogenicity, and neurotoxicity of these DBPs. Copyright © 2013 Wiley Periodicals, Inc.
Digital quantification of gene expression using emulsion PCR.
Shi, Xiaolong; Tang, Chao; Wang, Wei; Zhou, Dequan; Lu, Zuhong
2010-01-01
Here we describe a single-molecule quantitative assay of mRNA levels based on mRNA mediate-ligation and BEAMing (beads, emulsion, amplification, and magnetics) technique, which allows accurate and parallel measurement of multiple genes from a small amount of cells. In this method, a pair of oligos complementary target mRNA was used to probe transcripts for each gene of interest. The ligated products of oligos pair were clonally amplified on beads in millions of parallel compartmentalized droplets in a water-in-oil emulsion. The levels of each transcript within a sample were measured by counting the number of the correspondingly amplified beads which were immobilized on a glass surface. To demonstrate its utility, this method has been applied to the quantitation of the mRNA levels for two transcription factors, Klf4 and Sox5, and a housekeeping gene, Gapdh, in human leukemia K562 cells before and after induction with phorbol 12-myristate 13-acetate. Interestingly, we found a significant downregulation of the mRNA level of Sox5 after phorbol 12-myristate 13-acetate treatment. The mRNA mediate-ligation and BEAMing technique provides an accurate and sensitive way to quantify the amount of multiple specific mRNA in a very small number of cells, which may be valuable in the studies requiring precise and parallel quantization of multiple mRNA in the defined cell populations.
Pinho, Andreia V; Mawson, Amanda; Gill, Anthony; Arshi, Mehreen; Warmerdam, Max; Giry-Laterriere, Marc; Eling, Nils; Lie, Triyana; Kuster, Evelyne; Camargo, Simone; Biankin, Andrew V; Wu, Jianmin; Rooman, Ilse
2016-11-15
Metabolic reprogramming is a feature of neoplasia and tumor growth. Sirtuin 1 (SIRT1) is a lysine deacetylase of multiple targets including metabolic regulators such as p53. SIRT1 regulates metaplasia in the pancreas. Nevertheless, it is unclear if SIRT1 affects the development of neoplastic lesions and whether metabolic gene expression is altered.To assess neoplastic lesion development, mice with a pancreas-specific loss of Sirt1 (Pdx1-Cre;Sirt1-lox) were bred into a KrasG12D mutant background (KC) that predisposes to the development of pancreatic intra-epithelial neoplasia (PanIN) and ductal adenocarcinoma (PDAC). Similar grade PanIN lesions developed in KC and KC;Sirt1-lox mice but specifically early mucinous PanINs occupied 40% less area in the KC;Sirt1-lox line, attributed to reduced proliferation. This was accompanied by reduced expression of proteins in the glycolysis pathway, such as GLUT1 and GAPDH.The stimulatory effect of SIRT1 on proliferation and glycolysis gene expression was confirmed in a human PDAC cell line. In resected PDAC samples, higher proliferation and expression of glycolysis genes correlated with poor patient survival. SIRT1 expression per se was not prognostic but low expression of Cell Cycle and Apoptosis Regulator 2 (CCAR2), a reported SIRT1 inhibitor, corresponded to poor patient survival.These findings open perspectives for novel targeted therapies in pancreatic cancer.
2013-08-01
CCT G-30; KLK2 F: 50- TGG CTG TGT ACA GTC ATG GA-30; KLK2 R: 50- CCT GTG TCT TCA GGC TCA AA-30; TMPRSS2 F: 50-AGG TGC ATC CGG CTC AGT A-30; TMPRSS2 R...50-GGG TCA AGG TGA TGC ACA GT-30; PCDH11 F: 50-GCG TTT CTG ACT GTG GCT ATC-30; PCDH11 R: 50-GGA AGG GGA ATG GAA TTT TG-30; UGT2B15 F: 50-TCA AATc-Jun...GAPDH F: 50-CTG ACT TCA ACA GCG ACA CC-30; GAPDH R: 50-CCC TGT TGC TGT AGC CAA AT-30; AR F: 50- GTG GAA GCT GCA AGG TCT TC-30; AR R 50-CGA AGA CGA
Lee, H-T; Lin, C-S; Lee, C-S; Tsai, C-Y; Wei, Y-H
2014-04-01
We measured plasma levels of the oxidative DNA damage marker 8-hydroxy-2'-deoxyguanosine (8-OHdG) and leucocyte mRNA expression levels of the genes encoding the 8-OHdG repair enzyme human 8-oxoguanine DNA glycosylase 1 (hOGG1), the anti-oxidant enzymes copper/zinc superoxide dismutase (Cu/ZnSOD), manganese superoxide dismutase (MnSOD), catalase, glutathione peroxidase-1 (GPx-1), GPx-4, glutathione reductase (GR) and glutathione synthetase (GS), the mitochondrial biogenesis-related proteins mtDNA-encoded ND 1 polypeptide (ND1), ND6, ATPase 6, mitochondrial transcription factor A (Tfam), nuclear respiratory factor 1(NRF-1), pyruvate dehydrogenase E1 component alpha subunit (PDHA1), pyruvate dehydrogenase kinase isoenzyme 1 (PDK-1) and hypoxia inducible factor-1α (HIF-1α) and the glycolytic enzymes hexokinase-II (HK-II), glucose 6-phosphate isomerase (GPI), phosphofructokinase (PFK), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase A (LDHa). We analysed their relevance to oxidative damage in 85 systemic lupus erythematosus (SLE) patients, four complicated SLE patients undergoing rituximab treatment and 45 healthy individuals. SLE patients had higher plasma 8-OHdG levels (P < 0·01) but lower leucocyte expression of the genes encoding hOGG1(P < 0·01), anti-oxidant enzymes (P < 0·05), mitochondrial biogenesis-related proteins (P < 0·05) and glycolytic enzymes (P < 0·05) than healthy individuals. The increase in plasma 8-OHdG was correlated positively with the elevation of leucocyte expression of the genes encoding hOGG1 (P < 0·05), anti-oxidant enzymes (P < 0·05), several mitochondrial biogenesis-related proteins (P < 0·05) and glycolytic enzymes (P < 0·05) in lupus patients. The patients, whose leucocyte mtDNA harboured D310 heteroplasmy, exhibited a positive correlation between the mtDNA copy number and expression of ND1, ND6 and ATPase 6 (P < 0·05) and a negative correlation between mtDNA copy number and systemic lupus erythematosus disease activity index (SLEDAI) (P < 0·05), as well as plasma 8-OHdG (P < 0·05). In particular, four complicated SLE patients with increased expression of the genes encoding the anti-oxidant enzymes, GAPDH, Tfam and PDHA1, experienced better therapeutic outcomes after rituximab therapy. In conclusion, higher oxidative damage with suboptimal increases in DNA repair, anti-oxidant capacity, mitochondrial biogenesis and glucose metabolism may be implicated in SLE deterioration, and this impairment might be improved by targeted biological therapy. © 2013 British Society for Immunology.
ABCG2 in peptic ulcer: gene expression and mutation analysis.
Salagacka-Kubiak, Aleksandra; Żebrowska, Marta; Wosiak, Agnieszka; Balcerczak, Mariusz; Mirowski, Marek; Balcerczak, Ewa
2016-08-01
The aim of this study was to evaluate the participation of polymorphism at position C421A and mRNA expression of the ABCG2 gene in the development of peptic ulcers, which is a very common and severe disease. ABCG2, encoded by the ABCG2 gene, has been found inter alia in the gastrointestinal tract, where it plays a protective role eliminating xenobiotics from cells into the extracellular environment. The materials for the study were biopsies of gastric mucosa taken during a routine endoscopy. For genotyping by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at position C421A, DNA was isolated from 201 samples, while for the mRNA expression level by real-time PCR, RNA was isolated from 60 patients. The control group of healthy individuals consisted of 97 blood donors. The dominant genotype in the group of peptic ulcer patients and healthy individuals was homozygous CC. No statistically significant differences between healthy individuals and the whole group of peptic ulcer patients and, likewise, between the subgroups of peptic ulcer patients (infected and uninfected with Helicobacter pylori) were found. ABCG2 expression relative to GAPDH expression was found in 38 of the 60 gastric mucosa samples. The expression level of the gene varies greatly among cases. The statistically significant differences between the intensity (p = 0.0375) of H. pylori infection and ABCG2 gene expression have been shown. It was observed that the more intense the infection, the higher the level of ABCG2 expression.
Yang, Yan-Bei; Wang, Shuai; Wang, Chang; Huang, Quan-Yong; Bai, Jing-Wen; Chen, Jian-Qing; Chen, Xue-Ying; Li, Yan-Hua
2015-12-01
Streptococcus suis (S. suis) is a swine pathogen and also a zoonotic agent. In this study, the effects of subinhibitory concentrations (sub-MICs) of emodin on biofilm formation by S. suis ATCC700794 were evaluated. As quantified by crystal violet staining, biofilm formation by S. suis ATCC700794 was dose-dependently decreased after growth with 1/2 MIC, 1/4 MIC, or 1/8 MIC of emodin. By scanning electron microscopy, the structural architecture of the S. suis ATCC700794 biofilms was examined following growth in culture medium supplemented with 1/2 MIC, 1/4 MIC, 1/8 MIC, or 1/16 MIC of emodin. Scanning electron microscopy analysis revealed the potential effect of emodin on biofilm formation by S. suis ATCC700794. The expression of luxS gene and virulence genes in S. suis ATCC700794 was investigated by quantitative RT-PCR. It was found that sub-MICs of emodin significantly decreased the expression of gapdh, sly, fbps, ef, and luxS. However, it was found that sub-MICs of emodin significantly increased the expression of cps2J, mrp, and gdh. These findings showed that sub-MICs of emodin could cause the difference in the expression level of the virulence genes.
Calderon-Gonzalez, Ricardo; Teran-Navarro, Hector; Marimon, José María; González-Rico, Claudia; Calvo-Montes, Jorge; Frande-Cabanes, Elisabet; Alkorta-Gurrutxaga, Miriam; Fariñas, M. C.; Martínez-Martínez, Luis; Perez-Trallero, Emilio; Alvarez-Dominguez, Carmen
2016-01-01
Two regions of northern Spain, Gipuzkoa, and Cantabria present high annual incidence of listeriosis (1.86 and 1.71 cases per 100,000 inhabitants, respectively). We report that the high annual incidences are a consequence of infection with highly virulent Listeria monocytogenes isolates linked to fatal outcomes in elderly patients with cancer. In addition, listeriosis patients with cancer present low IL-17A/IL-6 ratios and significantly reduced levels of anti-GAPDH1–22 antibodies, identified as two novel biomarkers of poor prognosis. Analysis of these biomarkers may aid in reducing the incidence of listeriosis. Moreover, GAPDH1–22-activated monocyte-derived dendritic cells of listeriosis patients with cancer seem useful tools to prepare clinical vaccines as they produce mainly Th1 cytokines. PMID:27965668
Antidepressant action of ketamine via mTOR is mediated by inhibition of nitrergic Rheb degradation.
Harraz, M M; Tyagi, R; Cortés, P; Snyder, S H
2016-03-01
As traditional antidepressants act only after weeks/months, the discovery that ketamine, an antagonist of glutamate/N-methyl-D-aspartate (NMDA) receptors, elicits antidepressant actions in hours has been transformative. Its mechanism of action has been elusive, though enhanced mammalian target of rapamycin (mTOR) signaling is a major feature. We report a novel signaling pathway wherein NMDA receptor activation stimulates generation of nitric oxide (NO), which S-nitrosylates glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Nitrosylated GAPDH complexes with the ubiquitin-E3-ligase Siah1 and Rheb, a small G protein that activates mTOR. Siah1 degrades Rheb leading to reduced mTOR signaling, while ketamine, conversely, stabilizes Rheb that enhances mTOR signaling. Drugs selectively targeting components of this pathway may offer novel approaches to the treatment of depression.
Malhotra, Himanshu; Sheokand, Navdeep; Kumar, Santosh; Chauhan, Anoop S; Kumar, Manoj; Jakhar, Priyanka; Boradia, Vishant M; Raje, Chaaya I; Raje, Manoj
2016-05-01
Due to their abundant ubiquitous presence, rapid uptake and increased requirement in neoplastic tissue, the delivery of the iron carrier macromolecules transferrin (Tf) and lactoferrin (Lf) into mammalian cells is the subject of intense interest for delivery of drugs and other target molecules into cells. Utilizing exosomes obtained from cells of diverse origin we confirmed the presence of the multifunctional protein glyceraldehyde-3-phosphate dehydrogenase (GAPDH) which has recently been characterized as a Tf and Lf receptor. Using a combination of biochemical, biophysical and imaging based methodologies, we demonstrate that GAPDH present in exosomes captures Tf and Lf and subsequently effectively delivers these proteins into mammalian cells. Exosome vesicles prepared had a size of 51.2 ± 23.7 nm. They were found to be stable in suspension with a zeta potential (ζ-potential) of -28.16 ± 1.15 mV. Loading of Tf/Lf did not significantly affect ζ-potential of the exosomes. The carrier protein loaded exosomes were able to enhance the delivery of Tf/Lf by 2 to 3 fold in a diverse panel of cell types. Ninety percent of the internalized cargo via this route was found to be specifically delivered into late endosome and lysosomes. We also found exosomes to be tunable nano vehicles for cargo delivery by varying the amount of GAPDH associated with exosome. The current study opens a new avenue of research for efficient delivery of these vital iron carriers into cells employing exosomes as a nano delivery vehicle.
He, Xiangjun; Tan, Chunlai; Wang, Feng; Wang, Yaofeng; Zhou, Rui; Cui, Dexuan; You, Wenxing; Zhao, Hui; Ren, Jianwei; Feng, Bo
2016-01-01
CRISPR/Cas9-induced site-specific DNA double-strand breaks (DSBs) can be repaired by homology-directed repair (HDR) or non-homologous end joining (NHEJ) pathways. Extensive efforts have been made to knock-in exogenous DNA to a selected genomic locus in human cells; which, however, has focused on HDR-based strategies and was proven inefficient. Here, we report that NHEJ pathway mediates efficient rejoining of genome and plasmids following CRISPR/Cas9-induced DNA DSBs, and promotes high-efficiency DNA integration in various human cell types. With this homology-independent knock-in strategy, integration of a 4.6 kb promoterless ires-eGFP fragment into the GAPDH locus yielded up to 20% GFP+ cells in somatic LO2 cells, and 1.70% GFP+ cells in human embryonic stem cells (ESCs). Quantitative comparison further demonstrated that the NHEJ-based knock-in is more efficient than HDR-mediated gene targeting in all human cell types examined. These data support that CRISPR/Cas9-induced NHEJ provides a valuable new path for efficient genome editing in human ESCs and somatic cells. PMID:26850641
He, Xiangjun; Tan, Chunlai; Wang, Feng; Wang, Yaofeng; Zhou, Rui; Cui, Dexuan; You, Wenxing; Zhao, Hui; Ren, Jianwei; Feng, Bo
2016-05-19
CRISPR/Cas9-induced site-specific DNA double-strand breaks (DSBs) can be repaired by homology-directed repair (HDR) or non-homologous end joining (NHEJ) pathways. Extensive efforts have been made to knock-in exogenous DNA to a selected genomic locus in human cells; which, however, has focused on HDR-based strategies and was proven inefficient. Here, we report that NHEJ pathway mediates efficient rejoining of genome and plasmids following CRISPR/Cas9-induced DNA DSBs, and promotes high-efficiency DNA integration in various human cell types. With this homology-independent knock-in strategy, integration of a 4.6 kb promoterless ires-eGFP fragment into the GAPDH locus yielded up to 20% GFP+ cells in somatic LO2 cells, and 1.70% GFP+ cells in human embryonic stem cells (ESCs). Quantitative comparison further demonstrated that the NHEJ-based knock-in is more efficient than HDR-mediated gene targeting in all human cell types examined. These data support that CRISPR/Cas9-induced NHEJ provides a valuable new path for efficient genome editing in human ESCs and somatic cells. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Christou, Anastasis; Georgiadou, Egli C; Filippou, Panagiota; Manganaris, George A; Fotopoulos, Vasileios
2014-03-01
Strawberry plant tissues and particularly fruit material are rich in polysaccharides and polyphenolic compounds, thus rendering the isolation of nucleic acids a difficult task. This work describes the successful modification of a total RNA extraction protocol, which enables the isolation of high quantity and quality of total RNA from small amounts of strawberry leaf, root and fruit tissues. Reverse-transcription polymerase chain reaction (RT-PCR) amplification of GAPDH housekeeping gene from isolated RNA further supports the proposed protocol efficiency and its use for downstream molecular applications. This novel procedure was also successfully followed using other fruit tissues, such as olive and kiwifruit. In addition, optional treatment with RNase A following initial nucleic acid extraction can provide sufficient quality and quality of genomic DNA for subsequent PCR analyses, as evidenced from PCR amplification of housekeeping genes using extracted genomic DNA as template. Overall, this optimized protocol allows easy, rapid and economic isolation of high quality RNA from small amounts of an important fruit crop, such as strawberry, with extended applicability to other recalcitrant fruit crops. Copyright © 2013 Elsevier B.V. All rights reserved.
Aly, Hanan F; Rizk, Maha Z; Abo-Elmatty, Dina M; Desoky, M M; Ibrahim, N A; Younis, Eman A
2016-04-01
The present work aims to evaluate the protective and ameliorative effects of two plant-derived proteins obtained from the seeds of Cajanus cajan and Caesalpinia gilliesii(Leguminosae) against the toxic effects of acetaminophen in kidney after chronic dose through determination of certain biochemical markers including total urea, creatinine, and kidney marker enzyme, that is, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). In addition histopathological examination of intoxicated and treated kidney with both proteins was performed. The present results show a significant increase in serum total urea and creatinine, while significant decrease in GAPDH. Improvement in all biochemical parameters studied was demonstrated, which was documented by the amelioration signs in rats kidney architecture. Thus, both plant protein extracts can counteract the nephrotoxic process, minimize damage to the kidney, delay disease progression, and reduce its complications. © The Author(s) 2013.
Ogawa, Kiyohiro; Hirooka, Yoshitaka; Kishi, Takuya; Ide, Tomomi; Sunagawa, Kenji
2013-01-01
Left ventricular (LV) remodeling and activation of sympathetic nervous system (SNS) are cardinal features of heart failure. We previously demonstrated that enhanced central sympathetic outflow is associated with brain toll-like receptor 4 (TLR4) probably mediated by brain angiotensin II type 1 receptor in mice with myocardial infarction (MI)-induced heart failure. The purpose of the present study was to examine whether silencing brain TLR4 could prevent LV remodeling with sympathoinhibition in MI-induced heart failure. MI-induced heart failure model rats were created by ligation of left coronary artery. The expression level of TLR4 in brainstem was significantly higher in MI-induced heart failure treated with intracerebroventricular (ICV) injection of hGAPDH-SiRNA than in sham. TLR4 in brainstem was significantly lower in MI-induced heart failure treated with ICV injection of TLR4-SiRNA than in that treated with ICV injection of hGAPDH-SiRNA. Lung weight, urinary norepinephrine excretion, and LV end-diastolic pressure were significantly lower and LV dimension was significantly smaller in MI-induced heart failure treated with TLR4-SiRNA than in that treated with hGAPDH-SiRNA for 2 weeks. Partially silencing brain TLR4 by ICV injection of TLR4-SiRNA for 2 weeks could in part prevent LV remodeling with sympathoinhibition in rats with MI-induced heart failure. Brain TLR4 has a potential to be a target of the treatment for MI-induced heart failure.
A simple device using magnetic transportation for droplet-based PCR.
Ohashi, Tetsuo; Kuyama, Hiroki; Hanafusa, Nobuhiro; Togawa, Yoshiyuki
2007-10-01
The Polymerase chain reaction (PCR) was successfully and rapidly performed in a simple reaction device devoid of channels, pumps, valves, or other control elements used in conventional lab-on-a-chip technology. The basic concept of this device is the transportation of aqueous droplets containing hydrophilic magnetic beads in a flat-bottomed, tray-type reactor filled with silicone oil. The whole droplets sink to the bottom of the reactor because their specific gravity is greater than that of the silicone oil used here. The droplets follow the movement of a magnet located underneath the reactor. The notable advantage of the droplet-based PCR is the ability to switch rapidly the proposed reaction temperature by moving the droplets to the required temperature zones in the temperature gradient. The droplet-based reciprocative thermal cycling was performed by moving the droplets composed of PCR reaction mixture to the designated temperature zones on a linear temperature gradient from 50 degrees C to 94 degrees C generated on the flat bottom plate of the tray reactor. Using human-derived DNA containing the mitochondria genes as the amplification targets, the droplet-based PCR with magnetic reciprocative thermal cycling successfully provided the five PCR products ranging from 126 to 1,219 bp in 11 min with 30 cycles. More remarkably, the human genomic gene amplification targeting glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was accomplished rapidly in 3.6 min with 40 cycles.
Sardi, Janaina de Cássia Orlandi; Pitangui, Nayla de Souza; Voltan, Aline Raquel; Braz, Jaqueline Derissi; Machado, Marcelo Pelajo; Fusco Almeida, Ana Marisa; Mendes Giannini, Maria Jose Soares
2015-01-01
Paracoccidioides species are dimorphic fungi that initially infect the lungs but can also spread throughout the body. The spreading infection is most likely due to the formation of a biofilm that makes it difficult for the host to eliminate the infection. Biofilm formation is crucial for the development of infections and confines the pathogen to an extracellular matrix. Its presence is associated with antimicrobial resistance and avoidance of host defenses. This current study provides the first description of biofilm formation by Paracoccidioides brasiliensis (Pb18) and an analysis of gene expression, using real-time PCR, associated with 3 adhesins and 2 hydrolytic enzymes that could be associated with the virulence profile. Biofilm formation was analyzed using fluorescence microscopy, scanning electron microscopy (SEM) and confocal laser scanning microscopy (CLSM). Metabolic activity was determined using the XTT reduction assay. P. brasiliensis was able to form mature biofilm in 144 h with a thickness of 100 μm. The presence of a biofilm was found to be associated with an increase in the expression of adhesins and enzymes. GP43, enolase, GAPDH and aspartyl proteinase genes were over-expressed, whereas phospholipase was down-regulated in biofilm. The characterization of biofilm formed by P. brasiliensis may contribute to a better understanding of the pathogenesis of paracoccidioidomycosis as well as the search for new therapeutic alternatives; while improving the effectiveness of treatment.
Máximo, Wesley P. F.; Zanetti, Ronald; Paiva, Luciano V.
2018-01-01
Although several ant species are important targets for the development of molecular control strategies, only a few studies focus on identifying and validating reference genes for quantitative reverse transcription polymerase chain reaction (RT-qPCR) data normalization. We provide here an extensive study to identify and validate suitable reference genes for gene expression analysis in the ant Atta sexdens, a threatening agricultural pest in South America. The optimal number of reference genes varies according to each sample and the result generated by RefFinder differed about which is the most suitable reference gene. Results suggest that the RPS16, NADH and SDHB genes were the best reference genes in the sample pool according to stability values. The SNF7 gene expression pattern was stable in all evaluated sample set. In contrast, when using less stable reference genes for normalization a large variability in SNF7 gene expression was recorded. There is no universal reference gene suitable for all conditions under analysis, since these genes can also participate in different cellular functions, thus requiring a systematic validation of possible reference genes for each specific condition. The choice of reference genes on SNF7 gene normalization confirmed that unstable reference genes might drastically change the expression profile analysis of target candidate genes. PMID:29419794
Characterization of the immunological response to Dermanyssus gallinae infestation in domestic fowl.
Harrington, D; Robinson, K; Guy, J; Sparagano, O
2010-04-01
Dermanyssus gallinae is a haematophagous ectoparasite of birds, which adversely affects both production and welfare of commercial poultry. Poultry in commercial production systems chronically exposed to D. gallinae do not appear to develop immunity to the mite. The objective of the current study was to determine the initial immune response of domestic fowl following exposure to D. gallinae. Two groups of birds (11 birds/group) had mite chambers secured to their backs. Controls received no mites, while infested birds received 200 unfed female D. gallinae on day 0 which were then removed on day 1 or 2. Spleen samples were collected on days -1, 1, 2 and 5. The expression of Th1 (IFNgamma, CXCLi2, IL6 and IL18), Th2 (IL4, IL10 and IL13) cytokines/chemokines normalized against a reference gene, GAPDH, were determined by semi-quantitative RT-PCR. Although there were no significant differences between treatments, numerical trends were observed. Th2 cytokine expression was not detected in any birds on any day. IL6, CXCLi2, IFNgamma and IL18 expression was increased on day 1 in the infested group, while on day 2 CXCLi2 and IFNgamma were lower and IL6 and IL18 levels were similar between treatments. The IL18 expression was similar between treatments on day 5, while IL6 and IFNgamma levels were increased and CXCLi2 expression was decreased in the infested group. Data suggest that D. gallinae feeding stimulates Th1 and pro-inflammatory cytokines/chemokines initially (day 1) followed by their subsequent down regulation. This study is the first report of the characterization of the immunological response of the domestic fowl to controlled numbers of D. gallinae.
31P magnetization transfer measurements of Pi→ATP flux in exercising human muscle
Savage, David B.; Williams, Guy B.; Porter, David; Carpenter, T. Adrian; Brindle, Kevin M.; Kemp, Graham J.
2016-01-01
Fundamental criticisms have been made over the use of 31P magnetic resonance spectroscopy (MRS) magnetization transfer estimates of inorganic phosphate (Pi)→ATP flux (VPi-ATP) in human resting skeletal muscle for assessing mitochondrial function. Although the discrepancy in the magnitude of VPi-ATP is now acknowledged, little is known about its metabolic determinants. Here we use a novel protocol to measure VPi-ATP in human exercising muscle for the first time. Steady-state VPi-ATP was measured at rest and over a range of exercise intensities and compared with suprabasal oxidative ATP synthesis rates estimated from the initial rates of postexercise phosphocreatine resynthesis (VATP). We define a surplus Pi→ATP flux as the difference between VPi-ATP and VATP. The coupled reactions catalyzed by the glycolytic enzymes GAPDH and phosphoglycerate kinase (PGK) have been shown to catalyze measurable exchange between ATP and Pi in some systems and have been suggested to be responsible for this surplus flux. Surplus VPi-ATP did not change between rest and exercise, even though the concentrations of Pi and ADP, which are substrates for GAPDH and PGK, respectively, increased as expected. However, involvement of these enzymes is suggested by correlations between absolute and surplus Pi→ATP flux, both at rest and during exercise, and the intensity of the phosphomonoester peak in the 31P NMR spectrum. This peak includes contributions from sugar phosphates in the glycolytic pathway, and changes in its intensity may indicate changes in downstream glycolytic intermediates, including 3-phosphoglycerate, which has been shown to influence the exchange between ATP and Pi catalyzed by GAPDH and PGK. PMID:26744504
31P magnetization transfer measurements of Pi→ATP flux in exercising human muscle.
Sleigh, Alison; Savage, David B; Williams, Guy B; Porter, David; Carpenter, T Adrian; Brindle, Kevin M; Kemp, Graham J
2016-03-15
Fundamental criticisms have been made over the use of (31)P magnetic resonance spectroscopy (MRS) magnetization transfer estimates of inorganic phosphate (Pi)→ATP flux (VPi-ATP) in human resting skeletal muscle for assessing mitochondrial function. Although the discrepancy in the magnitude of VPi-ATP is now acknowledged, little is known about its metabolic determinants. Here we use a novel protocol to measure VPi-ATP in human exercising muscle for the first time. Steady-state VPi-ATP was measured at rest and over a range of exercise intensities and compared with suprabasal oxidative ATP synthesis rates estimated from the initial rates of postexercise phosphocreatine resynthesis (VATP). We define a surplus Pi→ATP flux as the difference between VPi-ATP and VATP. The coupled reactions catalyzed by the glycolytic enzymes GAPDH and phosphoglycerate kinase (PGK) have been shown to catalyze measurable exchange between ATP and Pi in some systems and have been suggested to be responsible for this surplus flux. Surplus VPi-ATP did not change between rest and exercise, even though the concentrations of Pi and ADP, which are substrates for GAPDH and PGK, respectively, increased as expected. However, involvement of these enzymes is suggested by correlations between absolute and surplus Pi→ATP flux, both at rest and during exercise, and the intensity of the phosphomonoester peak in the (31)P NMR spectrum. This peak includes contributions from sugar phosphates in the glycolytic pathway, and changes in its intensity may indicate changes in downstream glycolytic intermediates, including 3-phosphoglycerate, which has been shown to influence the exchange between ATP and Pi catalyzed by GAPDH and PGK. Copyright © 2016 the American Physiological Society.
Howard, Thomas P.; Fryer, Michael J.; Singh, Prashant; Metodiev, Metodi; Lytovchenko, Anna; Obata, Toshihiro; Fernie, Alisdair R.; Kruger, Nicholas J.; Quick, W. Paul; Lloyd, Julie C.; Raines, Christine A.
2011-01-01
The thioredoxin-regulated chloroplast protein CP12 forms a multienzyme complex with the Calvin-Benson cycle enzymes phosphoribulokinase (PRK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). PRK and GAPDH are inactivated when present in this complex, a process shown in vitro to be dependent upon oxidized CP12. The importance of CP12 in vivo in higher plants, however, has not been investigated. Here, antisense suppression of CP12 in tobacco (Nicotiana tabacum) was observed to impact on NAD-induced PRK and GAPDH complex formation but had little effect on enzyme activity. Additionally, only minor changes in photosynthetic carbon fixation were observed. Despite this, antisense plants displayed changes in growth rates and morphology, including dwarfism and reduced apical dominance. The hypothesis that CP12 is essential to separate oxidative pentose phosphate pathway activity from Calvin-Benson cycle activity, as proposed in cyanobacteria, was tested. No evidence was found to support this role in tobacco. Evidence was seen, however, for a restriction to malate valve capacity, with decreases in NADP-malate dehydrogenase activity (but not protein levels) and pyridine nucleotide content. Antisense repression of CP12 also led to significant changes in carbon partitioning, with increased carbon allocation to the cell wall and the organic acids malate and fumarate and decreased allocation to starch and soluble carbohydrates. Severe decreases were also seen in 2-oxoglutarate content, a key indicator of cellular carbon sufficiency. The data presented here indicate that in tobacco, CP12 has a role in redox-mediated regulation of carbon partitioning from the chloroplast and provides strong in vivo evidence that CP12 is required for normal growth and development in plants. PMID:21865489
Habte-Tsion, Habte-Michael; Ren, Mingchun; Liu, Bo; Ge, Xianping; Xie, Jun; Chen, Ruli
2016-04-01
A 9-week feeding trial was conducted to investigate the effects of graded dietary threonine (Thr) levels (0.58-2.58%) on the hematological parameters, immune response, antioxidant status and hepatopancreatic gene expression of antioxidant enzymes and antioxidant-immune-cytokine-related signaling molecules in juvenile blunt snout bream. For this purpose, 3 tanks were randomly arranged and assigned to each experimental diet. Fish were fed with their respective diet to apparent satiation 4 times daily. The results indicated that white blood cell, red blood cell and haemoglobin significantly responded to graded dietary Thr levels, while hematocrit didn't. Complement components (C3 and C4), total iron-binding capacity (TIBC), immunoglobulin M (IgM), superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT) increased with increasing dietary Thr levels up to 1.58-2.08% and thereafter tended to decrease. Dietary Thr regulated the gene expressions of Cu/Zn-SOD, Mn-SOD and CAT, GPx1, glutathione S-transferase mu (GST), nuclear factor erythroid 2-related factor 2 (Nrf2), heat shock protein-70 (Hsp70), tumor necrosis factor-alpha (TNF-α), apolipoprotein A-I (ApoA1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and fructose-bisphosphate aldolase B (ALDOB); while the gene expression of peroxiredoxin II (PrxII) was not significantly modified by graded Thr levels. These genes are involved in different functions including antioxidant, immune, and defense responses, energy metabolism and protein synthesis. Therefore, this study could provide a new molecular tool for studies in fish immunonutrition and shed light on the regulatory mechanisms that dietary Thr improved the antioxidant and immune capacities of fish. Copyright © 2015 Elsevier Ltd. All rights reserved.
RT-PCR analysis of RNA extracted from Bouin-fixed and paraffin-embedded lymphoid tissues.
Gloghini, Annunziata; Canal, Barbara; Klein, Ulf; Dal Maso, Luigino; Perin, Tiziana; Dalla-Favera, Riccardo; Carbone, Antonino
2004-11-01
In the present study, we have investigated whether RNA can be efficiently isolated from Bouin-fixed or formalin-fixed, paraffin-embedded lymphoid tissue specimens. To this aim, we applied a new and simple method that includes the combination of proteinase K digestion and column purification. By this method, we demonstrated that the amplification of long fragments could be accomplished after a pre-heating step before cDNA synthesis associated with the use of enzymes that work at high temperature. By means of PCR using different primers for two examined genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH]- and CD40), we amplified segments of cDNA obtained by reverse transcription of the isolated RNA extracted from Bouin-fixed or formalin-fixed paraffin-embedded tissues. Amplified fragments of the expected sizes were obtained for both genes tested indicating that this method is suitable for the isolation of high-quality RNA. To explore the possibility for giving accurate real time quantitative RT-PCR results, cDNA obtained from matched frozen, Bouin-fixed and formalin-fixed neoplastic samples (two diffuse large cell lymphomas, one plasmacytoma) was tested for the following target genes: CD40, Aquaporin-3, BLIMP1, IRF4, Syndecan-1. Delta threshold cycle (DeltaC(T)) values for Bouin-fixed and formalin-fixed paraffin-embedded tissues and their correlation with those for frozen samples showed an extremely high correlation (r > 0.90) for all of the tested genes. These results show that the method of RNA extraction we propose is suitable for giving accurate real time quantitative RT-PCR results.
Figueredo, Diego de Siqueira; Barbosa, Mayara Rodrigues; Coimbra, Daniel Gomes; Dos Santos, José Luiz Araújo; Costa, Ellyda Fernanda Lopes; Koike, Bruna Del Vechio; Alexandre Moreira, Magna Suzana; de Andrade, Tiago Gomes
2018-03-01
Recent studies have shown that transcriptomes from different tissues present circadian oscillations. Therefore, the endogenous variation of total RNA should be considered as a potential bias in circadian studies of gene expression. However, normalization strategies generally include the equalization of total RNA concentration between samples prior to cDNA synthesis. Moreover, endogenous housekeeping genes (HKGs) frequently used for data normalization may exhibit circadian variation and distort experimental results if not detected or considered. In this study, we controlled experimental conditions from the amount of initial brain tissue samples through extraction steps, cDNA synthesis, and quantitative real time PCR (qPCR) to demonstrate a circadian oscillation of total RNA concentration. We also identified that the normalization of the RNA's yield affected the rhythmic profiles of different genes, including Per1-2 and Bmal1. Five widely used HKGs (Actb, Eif2a, Gapdh, Hprt1, and B2m) also presented rhythmic variations not detected by geNorm algorithm. In addition, the analysis of exogenous microRNAs (Cel-miR-54 and Cel-miR-39) spiked during RNA extraction suggests that the yield was affected by total RNA concentration, which may impact circadian studies of small RNAs. The results indicate that the approach of tissue normalization without total RNA equalization prior to cDNA synthesis can avoid bias from endogenous broad variations in transcript levels. Also, the circadian analysis of 2 -Cycle threshold (Ct) data, without HKGs, may be an alternative for chronobiological studies under controlled experimental conditions.
Korbakis, Dimitrios; Fragoulis, Emmanuel G; Scorilas, Andreas
2013-03-01
3,4-Dihydroxy-L-phenylalanine decarboxylase (DDC) is an enzyme implicated in the biosynthetic pathways of the neurotransmitters dopamine and probably serotonin. DDC gene expression has been studied in numerous malignancies and the corresponding data have shown remarkable alterations in the mRNA and/or protein levels encoded by the gene. The aim of this study was to examine any modulations in the DDC mRNA levels in gastric cancer cells after their treatment with the chemotherapeutic agents 5-fluorouracil, leucovorin, irinotecan, etoposide, cisplatin, and taxol. The sensitivity of the AGS gastric adenocarcinoma cells to the antineoplastic drugs was evaluated using the MTT assay. Total RNA was extracted and reverse transcribed into cDNA. A highly sensitive quantitative real-time PCR methodology was developed for the quantification of DDC mRNA. GAPDH was used as a housekeeping gene. Relative quantification analysis was carried out using the comparative C T method ((Equation is included in full-text article.)). The treatment of AGS cells with several concentrations of various broadly used anticancer drugs resulted in significant modulations of the DDC mRNA levels compared with those in the untreated cells in a time-specific and drug-specific manner. Generally, DDC expression levels appeared to decrease after three time periods of exposure to the selected chemotherapeutic agents, suggesting a characteristic DDC mRNA expression profile that is possibly related to the mechanism of each drug. Our experimental data show that the DDC gene might serve as a new potential molecular biomarker predicting treatment response in gastric cancer cells.
Takamochi, Kazuya; Mogushi, Kaoru; Kawaji, Hideya; Imashimizu, Kota; Fukui, Mariko; Oh, Shiaki; Itoh, Masayoshi; Hayashizaki, Yoshihide; Ko, Weijey; Akeboshi, Masao; Suzuki, Kenji
2017-01-01
18F-fluoro-2-deoxy-glucose (18F-FDG) positron emission tomography (PET) is a functional imaging modality based on glucose metabolism. The correlation between EGFR or KRAS mutation status and the standardized uptake value (SUV) of 18F-FDG PET scanning has not been fully elucidated. Correlations between EGFR or KRAS mutation status and clinicopathological factors including SUVmax were statistically analyzed in 734 surgically resected lung adenocarcinoma patients. Molecular causal relationships between EGFR or KRAS mutation status and glucose metabolism were then elucidated in 62 lung adenocarcinomas using cap analysis of gene expression (CAGE), a method to determine and quantify the transcription initiation activities of mRNA across the genome. EGFR and KRAS mutations were detected in 334 (46%) and 83 (11%) of the 734 lung adenocarcinomas, respectively. The remaining 317 (43%) patients had wild-type tumors for both genes. EGFR mutations were more frequent in tumors with lower SUVmax. In contrast, no relationship was noted between KRAS mutation status and SUVmax. CAGE revealed that 4 genes associated with glucose metabolism (GPI, G6PD, PKM2, and GAPDH) and 5 associated with the cell cycle (ANLN, PTTG1, CIT, KPNA2, and CDC25A) were positively correlated with SUVmax, although expression levels were lower in EGFR-mutated than in wild-type tumors. No similar relationships were noted with KRAS mutations. EGFR-mutated adenocarcinomas are biologically indolent with potentially lower levels of glucose metabolism than wild-type tumors. Several genes associated with glucose metabolism and the cell cycle were specifically down-regulated in EGFR-mutated adenocarcinomas.
Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi
2005-09-01
1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.
Ridge, Justin P; Dodd, Peter R
2009-10-01
Real-time RT-PCR normalized to GAPDH was used to assay N-methyl-D-aspartate (NMDA) receptor NR1, NR2A and NR2B subunit mRNA in human autopsy cortex tissue from chronic alcoholics with and without comorbid cirrhosis of the liver and matched controls. Subunit expression was influenced by the subject's genotype. The TaqIA polymorphism selectively modulated NMDA receptor mean transcript expression in cirrhotic-alcoholic superior frontal cortex, in diametrically opposite ways in male and female subjects. Genetic make-up may differentially influence vulnerability to brain damage by altering the excitation: inhibition balance, particularly in alcoholics with comorbid cirrhosis of the liver. The TaqIA polymorphism occurs within the poorly characterised ankyrin-repeat containing kinase 1 (ANKK1) gene. Using PCR, ANKK1 mRNA transcript was detected in inferior temporal, occipital, superior frontal and primary motor cortex of control human brain. ANKK1 expression may mediate the influence of the TaqIA polymorphism on phenotype.
Wang, Lirui; Li, Yuhua; Fu, Jieli; Zhen, Linqing; Zhao, Na; Yang, Qiangzhen; Li, Sisi; Li, Xinhong
2016-08-01
Cadmium (Cd) has been reported to impair male fertility, primarily by disrupting sperm motility, but the underlying molecular mechanism remains unclear. Here we investigated the effects of Cd on sperm motility, tyrosine phosphorylation, AMP-activated protein kinase (AMPK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) activity, and ATP levels in vitro. Our results demonstrated that Cd inhibited sperm motility, GAPDH activity, AMPK activity and ATP production, and induced tyrosine phosphorylation of 55-57KDa proteins. Importantly, all the parameters affected by Cd were restored to normal levels when incubated with 10μM Cd in the presence of 30μM ethylene diamine tetraacetic acid (EDTA). Interestingly, changes of tyrosine phosphorylation levels of 55-57KDa proteins are completely contrary to that of other parameters. These results suggest that Cd-induced tyrosine phosphorylation of 55-57KDa proteins might act as an engine to block intracellular energy metabolism and thus decrease sperm motility. Copyright © 2016 Elsevier Inc. All rights reserved.
Posttranscriptional Control of T Cell Effector Function by Aerobic Glycolysis
Chang, Chih-Hao; Curtis, Jonathan D.; Maggi, Leonard B.; Faubert, Brandon; Villarino, Alejandro V.; O’Sullivan, David; Huang, Stanley Ching-Cheng; van der Windt, Gerritje J.W.; Blagih, Julianna; Qiu, Jing; Weber, Jason D.; Pearce, Edward J.; Jones, Russell G.; Pearce, Erika L.
2013-01-01
SUMMARY A “switch” from oxidative phosphorylation (OXPHOS) to aerobic glycolysis is a hallmark of T cell activation and is thought to be required to meet the metabolic demands of proliferation. However, why proliferating cells adopt this less efficient metabolism, especially in an oxygen-replete environment, remains incompletely understood. We show here that aerobic glycolysis is specifically required for effector function in T cells but that this pathway is not necessary for proliferation or survival. When activated T cells are provided with costimulation and growth factors but are blocked from engaging glycolysis, their ability to produce IFN-γ is markedly compromised. This defect is translational and is regulated by the binding of the glycolysis enzyme GAPDH to AU-rich elements within the 3′ UTR of IFN-γ mRNA. GAPDH, by engaging/disengaging glycolysis and through fluctuations in its expression, controls effector cytokine production. Thus, aerobic glycolysis is a metabolically regulated signaling mechanism needed to control cellular function. PMID:23746840
Validation of reference genes for quantitative gene expression analysis in experimental epilepsy.
Sadangi, Chinmaya; Rosenow, Felix; Norwood, Braxton A
2017-12-01
To grasp the molecular mechanisms and pathophysiology underlying epilepsy development (epileptogenesis) and epilepsy itself, it is important to understand the gene expression changes that occur during these phases. Quantitative real-time polymerase chain reaction (qPCR) is a technique that rapidly and accurately determines gene expression changes. It is crucial, however, that stable reference genes are selected for each experimental condition to ensure that accurate values are obtained for genes of interest. If reference genes are unstably expressed, this can lead to inaccurate data and erroneous conclusions. To date, epilepsy studies have used mostly single, nonvalidated reference genes. This is the first study to systematically evaluate reference genes in male Sprague-Dawley rat models of epilepsy. We assessed 15 potential reference genes in hippocampal tissue obtained from 2 different models during epileptogenesis, 1 model during chronic epilepsy, and a model of noninjurious seizures. Reference gene ranking varied between models and also differed between epileptogenesis and chronic epilepsy time points. There was also some variance between the four mathematical models used to rank reference genes. Notably, we found novel reference genes to be more stably expressed than those most often used in experimental epilepsy studies. The consequence of these findings is that reference genes suitable for one epilepsy model may not be appropriate for others and that reference genes can change over time. It is, therefore, critically important to validate potential reference genes before using them as normalizing factors in expression analysis in order to ensure accurate, valid results. © 2017 Wiley Periodicals, Inc.
Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan
2017-01-01
The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.
Kudo, Toru; Sasaki, Yohei; Terashima, Shin; Matsuda-Imai, Noriko; Takano, Tomoyuki; Saito, Misa; Kanno, Maasa; Ozaki, Soichi; Suwabe, Keita; Suzuki, Go; Watanabe, Masao; Matsuoka, Makoto; Takayama, Seiji; Yano, Kentaro
2016-10-13
In quantitative gene expression analysis, normalization using a reference gene as an internal control is frequently performed for appropriate interpretation of the results. Efforts have been devoted to exploring superior novel reference genes using microarray transcriptomic data and to evaluating commonly used reference genes by targeting analysis. However, because the number of specifically detectable genes is totally dependent on probe design in the microarray analysis, exploration using microarray data may miss some of the best choices for the reference genes. Recently emerging RNA sequencing (RNA-seq) provides an ideal resource for comprehensive exploration of reference genes since this method is capable of detecting all expressed genes, in principle including even unknown genes. We report the results of a comprehensive exploration of reference genes using public RNA-seq data from plants such as Arabidopsis thaliana (Arabidopsis), Glycine max (soybean), Solanum lycopersicum (tomato) and Oryza sativa (rice). To select reference genes suitable for the broadest experimental conditions possible, candidates were surveyed by the following four steps: (1) evaluation of the basal expression level of each gene in each experiment; (2) evaluation of the expression stability of each gene in each experiment; (3) evaluation of the expression stability of each gene across the experiments; and (4) selection of top-ranked genes, after ranking according to the number of experiments in which the gene was expressed stably. Employing this procedure, 13, 10, 12 and 21 top candidates for reference genes were proposed in Arabidopsis, soybean, tomato and rice, respectively. Microarray expression data confirmed that the expression of the proposed reference genes under broad experimental conditions was more stable than that of commonly used reference genes. These novel reference genes will be useful for analyzing gene expression profiles across experiments carried out under various experimental conditions.
Gao, Mengmeng; Liu, Yaping; Ma, Xiao; Shuai, Qin; Gai, Junyi; Li, Yan
2017-01-01
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used to analyze the relative gene expression level, however, the accuracy of qRT-PCR is greatly affected by the stability of reference genes, which is tissue- and environment- dependent. Therefore, choosing the most stable reference gene in a specific tissue and environment is critical to interpret gene expression patterns. Aluminum (Al), cadmium (Cd), and heat stresses are three important abiotic factors limiting soybean (Glycine max) production in southern China. To identify the suitable reference genes for normalizing the expression levels of target genes by qRT-PCR in soybean response to Al, Cd and heat stresses, we studied the expression stability of ten commonly used housekeeping genes in soybean roots and leaves under these three abiotic stresses, using five approaches, BestKeeper, Delta Ct, geNorm, NormFinder and RefFinder. We found TUA4 is the most stable reference gene in soybean root tips under Al stress. Under Cd stress, Fbox and UKN2 are the most stable reference genes in roots and leaves, respectively, while 60S is the most suitable reference gene when analyzing both roots and leaves together. For heat stress, TUA4 and UKN2 are the most stable housekeeping genes in roots and leaves, respectively, and UKN2 is the best reference gene for analysis of roots and leaves together. To validate the reference genes, we quantified the relative expression levels of six target genes that were involved in soybean response to Al, Cd or heat stresses, respectively. The expression patterns of these target genes differed between using the most and least stable reference genes, suggesting the selection of a suitable reference gene is critical for gene expression studies.
Gene expression studies of reference genes for quantitative real-time PCR: an overview in insects.
Shakeel, Muhammad; Rodriguez, Alicia; Tahir, Urfa Bin; Jin, Fengliang
2018-02-01
Whenever gene expression is being examined, it is essential that a normalization process is carried out to eliminate non-biological variations. The use of reference genes, such as glyceraldehyde-3-phosphate dehydrogenase, actin, and ribosomal protein genes, is the usual method of choice for normalizing gene expression. Although reference genes are used to normalize target gene expression, a major problem is that the stability of these genes differs among tissues, developmental stages, species, and responses to abiotic factors. Therefore, the use and validation of multiple reference genes are required. This review discusses the reasons that why RT-qPCR has become the preferred method for validating results of gene expression profiles, the use of specific and non-specific dyes and the importance of use of primers and probes for qPCR as well as to discuss several statistical algorithms developed to help the validation of potential reference genes. The conflicts arising in the use of classical reference genes in gene normalization and their replacement with novel references are also discussed by citing the high stability and low stability of classical and novel reference genes under various biotic and abiotic experimental conditions by employing various methods applied for the reference genes amplification.
NASA Astrophysics Data System (ADS)
Feldmann, Daniel P.; Xie, Yuran; Jones, Steven K.; Yu, Dongyue; Moszczynska, Anna; Merkel, Olivia M.
2017-06-01
The triblock copolymer polyethylenimine-polycaprolactone-polyethylene glycol (PEI-PCL-PEG) has been shown to spontaneously assemble into nano-sized particulate carriers capable of complexing with nucleic acids for gene delivery. The objective of this study was to investigate micelleplex characteristics, their in vitro and in vivo fate following microfluidic preparation of siRNA nanoparticles compared to the routinely used batch reactor mixing technique. Herein, PEI-PCL-PEG nanoparticles were prepared with batch reactor or microfluidic mixing techniques and characterized by various biochemical assays and in cell culture. Microfluidic nanoparticles showed a reduction of overall particle size as well as a more uniform size distribution when compared to batch reactor pipette mixing. Confocal microscopy, flow cytometry and qRT-PCR displayed the subcellular delivery of the microfluidic formulation and confirmed the ability to achieve mRNA knockdown. Intratracheal instillation of microfluidic formulation resulted in a significantly more efficient (p < 0.05) knockdown of GAPDH compared to treatment with the batch reactor formulation. The use of microfluidic mixing techniques yields an overall smaller and more uniform PEG-PCL-PEI nanoparticle that is able to more efficiently deliver siRNA in vivo. This preparation method may prove to be useful when a scaled up production of well-defined polyplexes is required.
Yeo, In-Seok; Shim, Woo-Yong; Kim, Jung Hoe
2018-05-20
For the biological production of l-ribulose, conversion by enzymes or resting cells has been investigated. However, expensive or concentrated substrates, an additional purification step to remove borate and the requirement for cell cultivation and harvest steps before utilization of resting cells make the production process complex and unfavorable. Microbial fermentation may help overcome these limitations. In this study, we constructed a genetically engineered Candida tropicalis strain to produce l-ribulose by fermentation with a glucose/l-arabinose mixture. For the uptake of l-arabinose as a substrate and conversion of l-arabinose to l-ribulose, two heterologous genes coding for l-arabinose transporter and l-arabinose isomerase, were constitutively expressed in C. tropicalis under the GAPDH promoter. The Arabidopsis thaliana-originated l-arabinose transporter gene (STP2)-expressing strain exhibited a high l-arabinose uptake rate of 0.103 g/g cell/h and the expression of l-arabinose isomerase from Lactobacillus sakei 23 K showed 30% of conversion (9 g/L) from 30 g/L of l-arabinose. This genetically engineered strain can be used for l-ribulose production by fermentation using mixed sugars of glucose and l-arabinose. Copyright © 2018 Elsevier B.V. All rights reserved.
Whelan, Christopher; Crocitto, Laura; Kawachi, Mark; Chan, Kevin; Smith, David; Wilson, Timothy; Smith, Steven
2013-02-01
In patients with prostate cancer, luminal prostate-specific antigen (PSA) enters the circulation because the basement membrane and glandular epithelium are damaged. Given that excess mobilization of prostate cells during prostatic massage can influence normalization in diagnostic testing, we studied PSA mRNA levels in expressed prostatic secretions (EPS) from patients undergoing biopsy for prostate cancer to determine if prostate cells are preferentially mobilized from patients with prostate cancer during prostatic massage. Quantitative Reverse-Transcription PCR (qRT-PCR) was used to measure the RNA levels of GAPDH, PSA, TMPRSS2:ERG and PCA3 in EPS specimens obtained from patients undergoing biopsy for prostate cancer. The level of PSA mRNA is significantly elevated in EPS specimens obtained from patients with a subsequent diagnosis of prostate cancer. This correlation influenced diagnostic testing results from EPS in two ways. First, when used as an exclusion parameter it appears to improve the diagnostic performance of TMPRSS2:ERG in EPS. Second, when used as a normalization parameter it appears to decrease the performance of these same tests. When comparing the results of mRNA based prostate cancer diagnostics in EPS it will be essential to consider PSA mRNA as a prostate specific gene and not a housekeeping gene.
Ram, Chet; Koramutla, Murali Krishna; Bhattacharya, Ramcharan
2017-07-01
Brassica juncea is a chief oil yielding crop in many parts of the world including India. With advancement of molecular techniques, RT-qPCR based study of gene-expression has become an integral part of experimentations in crop breeding. In RT-qPCR, use of appropriate reference gene(s) is pivotal. The virtue of the reference genes, being constant in expression throughout the experimental treatments, needs to be validated case by case. Appropriate reference gene(s) for normalization of gene-expression data in B. juncea during the biotic stress of aphid infestation is not known. In the present investigation, 11 reference genes identified from microarray database of Arabidopsis-aphid interaction at a cut off FDR ≤0.1, along with two known reference genes of B. juncea, were analyzed for their expression stability upon aphid infestation. These included 6 frequently used and 5 newly identified reference genes. Ranking orders of the reference genes in terms of expression stability were calculated using advanced statistical approaches such as geNorm, NormFinder, delta Ct and BestKeeper. The analysis suggested CAC, TUA and DUF179 as the most suitable reference genes. Further, normalization of the gene-expression data of STP4 and PR1 by the most and the least stable reference gene, respectively has demonstrated importance and applicability of the recommended reference genes in aphid infested samples of B. juncea. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Chen, Jingchao; Huang, Zhaofeng; Huang, Hongjuan; Wei, Shouhui; Liu, Yan; Jiang, Cuilan; Zhang, Jie; Zhang, Chaoxian
2017-04-21
Goosegrass (Eleusine indica) is one of the most serious annual grassy weeds worldwide, and its evolved herbicide-resistant populations are more difficult to control. Quantitative real-time PCR (qPCR) is a common technique for investigating the resistance mechanism; however, there is as yet no report on the systematic selection of stable reference genes for goosegrass. This study proposed to test the expression stability of 9 candidate reference genes in goosegrass in different tissues and developmental stages and under stress from three types of herbicide. The results show that for different developmental stages and organs (control), eukaryotic initiation factor 4 A (eIF-4) is the most stable reference gene. Chloroplast acetolactate synthase (ALS) is the most stable reference gene under glyphosate stress. Under glufosinate stress, eIF-4 is the best reference gene. Ubiquitin-conjugating enzyme (UCE) is the most stable reference gene under quizalofop-p-ethyl stress. The gene eIF-4 is the recommended reference gene for goosegrass under the stress of all three herbicides. Moreover, pairwise analysis showed that seven reference genes were sufficient to normalize the gene expression data under three herbicides treatment. This study provides a list of reliable reference genes for transcript normalization in goosegrass, which will facilitate resistance mechanism studies in this weed species.
Gao, Lingyun; Zhao, Shuang; Jiang, Wei; Huang, Yuan; Bie, Zhilong
2014-01-01
Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT–PCR) is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT–PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT–PCR analyses involving watermelon. PMID:24587403
Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Zhao, Shuang; Jiang, Wei; Huang, Yuan; Bie, Zhilong
2014-01-01
Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR) is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.
Reference genes for measuring mRNA expression.
Dundas, Jitesh; Ling, Maurice
2012-12-01
The aim of this review is to find answers to some of the questions surrounding reference genes and their reliability for quantitative experiments. Reference genes are assumed to be at a constant expression level, over a range of conditions such as temperature. These genes, such as GADPH and beta-actin, are used extensively for gene expression studies using techniques like quantitative PCR. There have been several studies carried out on identifying reference genes. However, a lot of evidence indicates issues to the general suitability of these genes. Recent studies had shown that different factors, including the environment and methods, play an important role in changing the expression levels of the reference genes. Thus, we conclude that there is no reference gene that can deemed suitable for all the experimental conditions. In addition, we believe that every experiment will require the scientific evaluation and selection of the best candidate gene for use as a reference gene to obtain reliable scientific results.
Predominant mucosal expression of 5-HT4(+h) receptor splice variants in pig stomach and colon
Priem, Evelien KV; De Maeyer, Joris H; Vandewoestyne, Mado; Deforce, Dieter; Lefebvre, Romain A
2013-01-01
AIM: To investigate cellular 5-HT4(-h/+h) receptor distribution, particularly in the epithelial layer, by laser microdissection and polymerase chain reaction (PCR) in porcine gastrointestinal (GI) tissues. METHODS: A stepwise approach was used to evaluate RNA quality and to study cell-specific 5-HT4 receptor mRNA expression in the porcine gastric fundus and colon descendens. After freezing, staining and laser microdissection and pressure catapulting (LMPC), RNA quality was evaluated by the Experion automated electrophoresis system. 5-HT4 receptor and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expressions were examined by endpoint reverse transcription (RT)-PCR in mucosal and muscle-myenteric plexus (MMP) tissue fractions, in mucosal and MMP parts of hematoxylin and eosin (HE) stained tissue sections and in microdissected patches of the epithelial and circular smooth muscle cell layer in these sections. Pig gastric fundus tissue sections were also stained immunohistochemically (IHC) for enterochromaffin cells (EC cells; MAB352); these cells were isolated by LMPC and examined by endpoint RT-PCR. RESULTS: After HE staining, the epithelial and circular smooth muscle cell layer of pig colon descendens and the epithelial cell layer of gastric fundus were identified morphologically and isolated by LMPC. EC cells of pig gastric fundus were successfully stained by IHC and isolated by LMPC. Freezing, HE and IHC staining, and LMPC had no influence on RNA quality. 5-HT4 receptor and GAPDH mRNA expressions were detected in mucosa and MMP tissue fractions, and in mucosal and MMP parts of HE stained tissue sections of pig colon descendens and gastric fundus. In the mucosa tissue fractions of both GI regions, the expression of h-exon containing receptor [5-HT4(+h) receptor] mRNA was significantly higher (P < 0.01) compared to 5-HT4(-h) receptor expression, and a similar trend was obtained in the mucosal part of HE stained tissue sections. Large microdissected patches of the epithelial and circular smooth muscle cell layer of pig colon descendens and of the epithelial cell layer of pig gastric fundus, also showed 5-HT4 receptor and GAPDH mRNA expression. No 5-HT4 receptor mRNA expression was detected in gastric LMPC-isolated EC cells from IHC stained tissues, which cells were positive for GAPDH. CONCLUSION: Porcine GI mucosa predominantly expresses 5-HT4(+h) receptor splice variants, suggesting their contribution to the 5-HT4 receptor-mediated mucosal effects of 5-HT. PMID:23840113
Wu, Jia; Xu, Guoqiang; Jin, Yangyang; Sun, Cong; Zhou, Li; Lin, Guodong; Xu, Rong; Wei, Ling; Fei, Hui; Wang, Dan; Chen, Jianqing; Lv, Zhengbing; Liu, Kuancheng
2018-05-22
The abuse of antibiotics and following rapidly increasing of antibiotic-resistant pathogens is the serious threat to our society. Natural products from microorganism are regarded as the important substitution antimicrobial agents of antibiotics. We isolated a new strain, Bacillus sp. GFP-2, from the Chiloscyllium plagiosum (Whitespotted bamboo shark) intestine, which showed great inhibitory effects on the growth of both Gram-positive and Gram-negative bacteria. Additionally, the growth of salmon was effectively promoted when fed with inactivated strain GFP-2 as the inhibition agent of pathogenic bacteria. The genes encoding antimicrobial peptides like LCI, YFGAP and hGAPDH and gene clusters for secondary metabolites and bacteriocins, such as difficidin, bacillibactin, bacilysin, surfactin, butirosin, macrolactin, bacillaene, fengycin, lanthipeptides and LCI, were predicted in the genome of Bacillus sp. GFP-2, which might be expressed and contribute to the antimicrobial activities of this strain. The gene encoding β-1,3-1,4-glucanase was successfully cloned from the genome and this protein was detected in the culture supernatant of Bacillus sp. GFP-2 by the antibody produced in rabbit immunized with the recombinant β-1,3-1,4-glucanase, indicating that this strain could express β-1,3-1,4-glucanase, which might partially contribute to its antimicrobial activities. This study can enhance a better understanding of the mechanism of antimicrobial activities in genus Bacillus and provide a useful material for the biotechnology study in antimicrobial agent development.
Tsai, Pei-Chien; Breen, Matthew
2012-09-01
To identify suitable reference genes for normalization of real-time quantitative PCR (RT-qPCR) assay data for common tumors of dogs. Malignant lymph node (n = 8), appendicular osteosarcoma (9), and histiocytic sarcoma (12) samples and control samples of various nonneoplastic canine tissues. Array-based comparative genomic hybridization (aCGH) data were used to guide selection of 9 candidate reference genes. Expression stability of candidate reference genes and 4 commonly used reference genes was determined for tumor samples with RT-qPCR assays and 3 software programs. LOC611555 was the candidate reference gene with the highest expression stability among the 3 tumor types. Of the commonly used reference genes, expression stability of HPRT was high in histiocytic sarcoma samples, and expression stability of Ubi and RPL32 was high in osteosarcoma samples. Some of the candidate reference genes had higher expression stability than did the commonly used reference genes. Data for constitutively expressed genes with high expression stability are required for normalization of RT-qPCR assay results. Without such data, accurate quantification of gene expression in tumor tissue samples is difficult. Results of the present study indicated LOC611555 may be a useful RT-qPCR assay reference gene for multiple tissue types. Some commonly used reference genes may be suitable for normalization of gene expression data for tumors of dogs, such as lymphomas, osteosarcomas, or histiocytic sarcomas.
Li, Qing; Fan, Cheng-Ming; Zhang, Xiao-Mei; Fu, Yong-Fu
2012-10-01
Most of traditional reference genes chosen for real-time quantitative PCR normalization were assumed to be ubiquitously and constitutively expressed in vegetative tissues. However, seeds show distinct transcriptomes compared with the vegetative tissues. Therefore, there is a need for re-validation of reference genes in samples of seed development and germination, especially for soybean seeds. In this study, we aimed at identifying reference genes suitable for the quantification of gene expression level in soybean seeds. In order to identify the best reference genes for soybean seeds, 18 putative reference genes were tested with various methods in different seed samples. We combined the outputs of both geNorm and NormFinder to assess the expression stability of these genes. The reference genes identified as optimums for seed development were TUA5 and UKN2, whereas for seed germination they were novel reference genes Glyma05g37470 and Glyma08g28550. Furthermore, for total seed samples it was necessary to combine four genes of Glyma05g37470, Glyma08g28550, Glyma18g04130 and UKN2 [corrected] for normalization. Key message We identified several reference genes that stably expressed in soybean seed developmental and germinating processes.
Lee, Won-Jae; Jeon, Ryoung-Hoon; Jang, Si-Jung; Park, Ji-Sung; Lee, Seung-Chan; Baregundi Subbarao, Raghavendra; Lee, Sung-Lim; Park, Bong-Wook; King, William Allan; Rho, Gyu-Jin
2015-01-01
The identification of stable reference genes is a prerequisite for ensuring accurate validation of gene expression, yet too little is known about stable reference genes of porcine MSCs. The present study was, therefore, conducted to assess the stability of reference genes in porcine MSCs derived from bone marrow (BMSCs), adipose (AMSCs), and skin (SMSCs) with their in vitro differentiated cells into mesenchymal lineages such as adipocytes, osteocytes, and chondrocytes. Twelve commonly used reference genes were investigated for their threshold cycle (Ct) values by qRT-PCR. The Ct values of candidate reference genes were analyzed by geNorm software to clarify stable expression regardless of experimental conditions. Thus, Pearson's correlation was applied to determine correlation between the three most stable reference genes (NF3) and optimal number of reference genes (NFopt). In assessment of stability of reference gene across experimental conditions by geNorm analysis, undifferentiated MSCs and each differentiated status into mesenchymal lineages showed slightly different results but similar patterns about more or less stable rankings. Furthermore, Pearson's correlation revealed high correlation (r > 0.9) between NF3 and NFopt. Overall, the present study showed that HMBS, YWHAZ, SDHA, and TBP are suitable reference genes for qRT-PCR in porcine MSCs. PMID:25972899
Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin
2015-01-01
Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.
Chen, Jingchao; Huang, Zhaofeng; Huang, Hongjuan; Wei, Shouhui; Liu, Yan; Jiang, Cuilan; Zhang, Jie; Zhang, Chaoxian
2017-01-01
Goosegrass (Eleusine indica) is one of the most serious annual grassy weeds worldwide, and its evolved herbicide-resistant populations are more difficult to control. Quantitative real-time PCR (qPCR) is a common technique for investigating the resistance mechanism; however, there is as yet no report on the systematic selection of stable reference genes for goosegrass. This study proposed to test the expression stability of 9 candidate reference genes in goosegrass in different tissues and developmental stages and under stress from three types of herbicide. The results show that for different developmental stages and organs (control), eukaryotic initiation factor 4 A (eIF-4) is the most stable reference gene. Chloroplast acetolactate synthase (ALS) is the most stable reference gene under glyphosate stress. Under glufosinate stress, eIF-4 is the best reference gene. Ubiquitin-conjugating enzyme (UCE) is the most stable reference gene under quizalofop-p-ethyl stress. The gene eIF-4 is the recommended reference gene for goosegrass under the stress of all three herbicides. Moreover, pairwise analysis showed that seven reference genes were sufficient to normalize the gene expression data under three herbicides treatment. This study provides a list of reliable reference genes for transcript normalization in goosegrass, which will facilitate resistance mechanism studies in this weed species. PMID:28429727
Early Detection of Breast Cancer Using Molecular Beacons
2005-09-01
and Truica, CI Challenges in the development of anti-epidermal growth factor receptor therapies in breast cancer. Semin Oncol, 2004; 31(1 Suppl 3): 3...forward, 5’-AAAGACCTGTA CGCCAACACAGTGCTGTCTGG-3’, and P-actin reverse, 5’- CGTCA - Results TACTCCTGCTTGCTGATCCACATCTGC-3’, and for GAPDH were forward 5
USDA-ARS?s Scientific Manuscript database
CP12 is a small intrinsically unstructured protein that forms a multiprotein complex with two Calvin Cycle enzymes, phosphoribulokinase (PRK) and NAD(P)-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The complex can be reconstituted in vitro from recombinant proteins under conditions t...
Johansen, Ilona; Andreassen, Rune
2014-12-23
MicroRNAs (miRNAs) are an abundant class of endogenous small RNA molecules that downregulate gene expression at the post-transcriptional level. They play important roles by regulating genes that control multiple biological processes, and recent years there has been an increased interest in studying miRNA genes and miRNA gene expression. The most common method applied to study gene expression of single genes is quantitative PCR (qPCR). However, before expression of mature miRNAs can be studied robust qPCR methods (miRNA-qPCR) must be developed. This includes identification and validation of suitable reference genes. We are particularly interested in Atlantic salmon (Salmo salar). This is an economically important aquaculture species, but no reference genes dedicated for use in miRNA-qPCR methods has been validated for this species. Our aim was, therefore, to identify suitable reference genes for miRNA-qPCR methods in Salmo salar. We used a systematic approach where we utilized similar studies in other species, some biological criteria, results from deep sequencing of small RNAs and, finally, experimental validation of candidate reference genes by qPCR to identify the most suitable reference genes. Ssa-miR-25-3p was identified as most suitable single reference gene. The best combinations of two reference genes were ssa-miR-25-3p and ssa-miR-455-5p. These two genes were constitutively and stably expressed across many different tissues. Furthermore, infectious salmon anaemia did not seem to affect their expression levels. These genes were amplified with high specificity, good efficiency and the qPCR assays showed a good linearity when applying a simple cybergreen miRNA-PCR method using miRNA gene specific forward primers. We have identified suitable reference genes for miRNA-qPCR in Atlantic salmon. These results will greatly facilitate further studies on miRNA genes in this species. The reference genes identified are conserved genes that are identical in their mature sequence in many aquaculture species. Therefore, they may also be suitable as reference genes in other teleosts. Finally, the systematic approach used in our study successfully identified suitable reference genes, suggesting that this may be a useful strategy to apply in similar validation studies in other aquaculture species.
Niu, Xiaoping; Qi, Jianmin; Zhang, Gaoyang; Xu, Jiantang; Tao, Aifen; Fang, Pingping; Su, Jianguang
2015-01-01
To accurately measure gene expression using quantitative reverse transcription PCR (qRT-PCR), reliable reference gene(s) are required for data normalization. Corchorus capsularis, an annual herbaceous fiber crop with predominant biodegradability and renewability, has not been investigated for the stability of reference genes with qRT-PCR. In this study, 11 candidate reference genes were selected and their expression levels were assessed using qRT-PCR. To account for the influence of experimental approach and tissue type, 22 different jute samples were selected from abiotic and biotic stress conditions as well as three different tissue types. The stability of the candidate reference genes was evaluated using geNorm, NormFinder, and BestKeeper programs, and the comprehensive rankings of gene stability were generated by aggregate analysis. For the biotic stress and NaCl stress subsets, ACT7 and RAN were suitable as stable reference genes for gene expression normalization. For the PEG stress subset, UBC, and DnaJ were sufficient for accurate normalization. For the tissues subset, four reference genes TUBβ, UBI, EF1α, and RAN were sufficient for accurate normalization. The selected genes were further validated by comparing expression profiles of WRKY15 in various samples, and two stable reference genes were recommended for accurate normalization of qRT-PCR data. Our results provide researchers with appropriate reference genes for qRT-PCR in C. capsularis, and will facilitate gene expression study under these conditions. PMID:26528312
Wen, Shuxiang; Chen, Xiaoling; Xu, Fuzhou; Sun, Huiling
2016-01-01
Real-time quantitative reverse transcription PCR (qRT-PCR) offers a robust method for measurement of gene expression levels. Selection of reliable reference gene(s) for gene expression study is conducive to reduce variations derived from different amounts of RNA and cDNA, the efficiency of the reverse transcriptase or polymerase enzymes. Until now reference genes identified for other members of the family Pasteurellaceae have not been validated for Avibacterium paragallinarum. The aim of this study was to validate nine reference genes of serovars A, B, and C strains of A. paragallinarum in different growth phase by qRT-PCR. Three of the most widely used statistical algorithms, geNorm, NormFinder and ΔCT method were used to evaluate the expression stability of reference genes. Data analyzed by overall rankings showed that in exponential and stationary phase of serovar A, the most stable reference genes were gyrA and atpD respectively; in exponential and stationary phase of serovar B, the most stable reference genes were atpD and recN respectively; in exponential and stationary phase of serovar C, the most stable reference genes were rpoB and recN respectively. This study provides recommendations for stable endogenous control genes for use in further studies involving measurement of gene expression levels.
Using RNA-seq data to select reference genes for normalizing gene expression in apple roots.
Zhou, Zhe; Cong, Peihua; Tian, Yi; Zhu, Yanmin
2017-01-01
Gene expression in apple roots in response to various stress conditions is a less-explored research subject. Reliable reference genes for normalizing quantitative gene expression data have not been carefully investigated. In this study, the suitability of a set of 15 apple genes were evaluated for their potential use as reliable reference genes. These genes were selected based on their low variance of gene expression in apple root tissues from a recent RNA-seq data set, and a few previously reported apple reference genes for other tissue types. Four methods, Delta Ct, geNorm, NormFinder and BestKeeper, were used to evaluate their stability in apple root tissues of various genotypes and under different experimental conditions. A small panel of stably expressed genes, MDP0000095375, MDP0000147424, MDP0000233640, MDP0000326399 and MDP0000173025 were recommended for normalizing quantitative gene expression data in apple roots under various abiotic or biotic stresses. When the most stable and least stable reference genes were used for data normalization, significant differences were observed on the expression patterns of two target genes, MdLecRLK5 (MDP0000228426, a gene encoding a lectin receptor like kinase) and MdMAPK3 (MDP0000187103, a gene encoding a mitogen-activated protein kinase). Our data also indicated that for those carefully validated reference genes, a single reference gene is sufficient for reliable normalization of the quantitative gene expression. Depending on the experimental conditions, the most suitable reference genes can be specific to the sample of interest for more reliable RT-qPCR data normalization.
Using RNA-seq data to select reference genes for normalizing gene expression in apple roots
Zhou, Zhe; Cong, Peihua; Tian, Yi
2017-01-01
Gene expression in apple roots in response to various stress conditions is a less-explored research subject. Reliable reference genes for normalizing quantitative gene expression data have not been carefully investigated. In this study, the suitability of a set of 15 apple genes were evaluated for their potential use as reliable reference genes. These genes were selected based on their low variance of gene expression in apple root tissues from a recent RNA-seq data set, and a few previously reported apple reference genes for other tissue types. Four methods, Delta Ct, geNorm, NormFinder and BestKeeper, were used to evaluate their stability in apple root tissues of various genotypes and under different experimental conditions. A small panel of stably expressed genes, MDP0000095375, MDP0000147424, MDP0000233640, MDP0000326399 and MDP0000173025 were recommended for normalizing quantitative gene expression data in apple roots under various abiotic or biotic stresses. When the most stable and least stable reference genes were used for data normalization, significant differences were observed on the expression patterns of two target genes, MdLecRLK5 (MDP0000228426, a gene encoding a lectin receptor like kinase) and MdMAPK3 (MDP0000187103, a gene encoding a mitogen-activated protein kinase). Our data also indicated that for those carefully validated reference genes, a single reference gene is sufficient for reliable normalization of the quantitative gene expression. Depending on the experimental conditions, the most suitable reference genes can be specific to the sample of interest for more reliable RT-qPCR data normalization. PMID:28934340
Karlsson, Tobias E.; Wellfelt, Katrin; Olson, Lars
2017-01-01
Inhibition of nerve growth and plasticity in the CNS is to a large part mediated by Nogo-like signaling, now encompassing a plethora of ligands, receptors, co-receptors and modulators. Here we describe the distribution and levels of mRNA encoding 11 key genes involved in Nogo-like signaling (Nogo-A, Oligodendrocyte-Myelin glycoprotein (OMgp), Nogo receptor 1 (NgR1), NgR2, NgR3, Lingo-1, TNF receptor orphan Y (Troy), Olfactomedin, Lateral olfactory tract usher substance (Lotus) and membrane-type matrix metalloproteinase-3 (MT3-MPP)), as well as BDNF and GAPDH. Expression was analyzed in nine different brain areas before, and at eight time points during the first 3 days after a strong neuroexcitatory stimulation, caused by one kainic acid injection. A temporo-spatial pattern of orderly transcriptional regulations emerges that strengthens the role of Nogo-signaling mechanisms for synaptic plasticity in synchrony with transcriptional increases of BDNF mRNA. For most Nogo-type signaling genes, the largest alterations of mRNA levels occur in the dentate gyrus, with marked alterations also in the CA1 region. Changes occurred somewhat later in several areas of the cerebral cortex. The detailed spatio-temporal pattern of mRNA presence and kainic acid-induced transcriptional response is gene-specific. We reveal that several different gene alterations combine to decrease (and later increase) Nogo-like signaling, as expected to allow structural plasticity responses. Other genes are altered in the opposite direction, suggesting that the system prepares in advance in order to rapidly restore balance. However, the fact that Lingo-1 shows a seemingly opposite, plasticity inhibiting response to kainic acid (strong increase of mRNA in the dentate gyrus), may instead suggest a plasticity-enhancing intracellular function of this presumed NgR1 co-receptor. PMID:28442990
Fitzgerald, Kathleen A; Guo, Jianfeng; Raftery, Rosanne M; Castaño, Irene Mencía; Curtin, Caroline M; Gooding, Matt; Darcy, Raphael; O' Brien, Fergal J; O' Driscoll, Caitriona M
2016-09-25
siRNA has emerged as a potential therapeutic for the treatment of prostate cancer but effective delivery remains a major barrier to its clinical application. This study aimed to develop and characterise a 3D in vitro co-culture model to simulate prostate cancer bone metastasis and to assess the ability of the model to investigate nanoparticle-mediated siRNA delivery and gene knockdown. PC3 or LNCaP prostate cancer cells were co-cultured with hFOB 1.19 osteoblast cells in 2D on plastic tissue culture plates and in 3D on collagen scaffolds mimicking the bone microenvironment. To characterise the co-culture model, cell proliferation, enzyme secretion and the utility of two different gene delivery vectors to mediate siRNA uptake and gene knockdown were assessed. Cell proliferation was reduced by∼50% by day 7 in the co-culture system relative to monoculture (PC3 and LNCaP co-cultures, in 2D and 3D) and an enhanced level of MMP9 (a marker of bone metastasis) was secreted into the media (1.2-4-fold increase depending on the co-culture system). A cationic cyclodextrin gene delivery vector proved significantly less toxic in the co-culture system relative to the commercially available vector Lipofectamine 2000(®). In addition, knockdown of both the GAPDH gene (minimum 15%) and RelA subunit of the NF-κB transcription factor (minimum 20%) was achieved in 2D and 3D cell co-cultures. Results indicate that the prostate cancer-osteoblast in vitro co-culture model was more physiologically relevant vs the monoculture. This model has the potential to help improve the design and efficacy of gene delivery formulations, to more accurately predict in vivo performance and, therefore, to reduce the risk of product failure in late-stage clinical development. Copyright © 2016 Elsevier B.V. All rights reserved.
Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A
2015-12-01
Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.
Demeke, Tigst; Eng, Monika
2018-05-01
Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.
Effect of storage time on gene expression data acquired from unfrozen archived newborn blood spots.
Ho, Nhan T; Busik, Julia V; Resau, James H; Paneth, Nigel; Khoo, Sok Kean
2016-11-01
Unfrozen archived newborn blood spots (NBS) have been shown to retain sufficient messenger RNA (mRNA) for gene expression profiling. However, the effect of storage time at ambient temperature for NBS samples in relation to the quality of gene expression data is relatively unknown. Here, we evaluated mRNA expression from quantitative real-time PCR (qRT-PCR) and microarray data obtained from NBS samples stored at ambient temperature to determine the effect of storage time on the quality of gene expression. These data were generated in a previous case-control study examining NBS in 53 children with cerebral palsy (CP) and 53 matched controls. NBS sample storage period ranged from 3 to 16years at ambient temperature. We found persistently low RNA integrity numbers (RIN=2.3±0.71) and 28S/18S rRNA ratios (~0) across NBS samples for all storage periods. In both qRT-PCR and microarray data, the expression of three common housekeeping genes-beta cytoskeletal actin (ACTB), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and peptidylprolyl isomerase A (PPIA)-decreased with increased storage time. Median values of each microarray probe intensity at log 2 scale also decreased over time. After eight years of storage, probe intensity values were largely reduced to background intensity levels. Of 21,500 genes tested, 89% significantly decreased in signal intensity, with 13,551, 10,730, and 9925 genes detected within 5years, > 5 to <10years, and >10years of storage, respectively. We also examined the expression of two gender-specific genes (X inactivation-specific transcript, XIST and lysine-specific demethylase 5D, KDM5D) and seven gene sets representing the inflammatory, hypoxic, coagulative, and thyroidal pathways hypothesized to be related to CP risk to determine the effect of storage time on the detection of these biologically relevant genes. We found the gender-specific genes and CP-related gene sets detectable in all storage periods, but exhibited differential expression (between male vs. female or CP vs. control) only within the first six years of storage. We concluded that gene expression data quality deteriorates in unfrozen archived NBS over time and that differential gene expression profiling and analysis is recommended for those NBS samples collected and stored within six years at ambient temperature. Copyright © 2016 Elsevier Inc. All rights reserved.
Beaver, Laura M.; Kuintzle, Rachael; Buchanan, Alex; Wiley, Michelle W.; Glasser, Sarah T.; Wong, Carmen P.; Johnson, Gavin S.; Chang, Jeff H.; Löhr, Christiane V.; Williams, David E.; Dashwood, Roderick H.; Hendrix, David A.; Ho, Emily
2017-01-01
Long non-coding RNAs (lncRNAs) have emerged as important in cancer development and progression. The impact of diet on lncRNA expression is largely unknown. Sulforaphane (SFN), obtained from vegetables like broccoli, can prevent and suppress cancer formation. Here we tested the hypothesis that SFN attenuates the expression of cancer-associated lncRNAs. We analyzed whole genome RNA-sequencing data of normal human prostate epithelial cells and prostate cancer cells treated with 15 μM SFN or DMSO. SFN significantly altered expression of ~100 lncRNAs in each cell type, and normalized the expression of some lncRNAs that were differentially expressed in cancer cells. SFN-mediated alterations in lncRNA expression correlated with genes that regulate cell cycle, signal transduction, and metabolism. LINC01116 was functionally investigated because it was overexpressed in several cancers, and was transcriptionally repressed after SFN treatment. Knockdown of LINC01116 with siRNA decreased proliferation of prostate cancer cells, and significantly upregulated several genes including GAPDH (regulates glycolysis), MAP1LC3B2 (autophagy) and H2AFY (chromatin structure). A 4-fold decrease in the ability of the cancer cells to form colonies was found when the LINC01116 gene was disrupted through a CRISPR/CAS9 method, further supporting an oncogenic function for LINC01116 in PC-3 cells.. We identified a novel isoform of LINC01116 and bioinformatically investigated the possibility that LINC01116 could interact with target genes via ssRNA:dsDNA triplexes. Our data reveal that chemicals from the diet can influence the expression of functionally important lncRNAs, and suggest a novel mechanism by which SFN may prevent and suppress prostate cancer. PMID:28131897
Autophagy-related prognostic signature for breast cancer.
Gu, Yunyan; Li, Pengfei; Peng, Fuduan; Zhang, Mengmeng; Zhang, Yuanyuan; Liang, Haihai; Zhao, Wenyuan; Qi, Lishuang; Wang, Hongwei; Wang, Chenguang; Guo, Zheng
2016-03-01
Autophagy is a process that degrades intracellular constituents, such as long-lived or damaged proteins and organelles, to buffer metabolic stress under starvation conditions. Deregulation of autophagy is involved in the progression of cancer. However, the predictive value of autophagy for breast cancer prognosis remains unclear. First, based on gene expression profiling, we found that autophagy genes were implicated in breast cancer. Then, using the Cox proportional hazard regression model, we detected autophagy prognostic signature for breast cancer in a training dataset. We identified a set of eight autophagy genes (BCL2, BIRC5, EIF4EBP1, ERO1L, FOS, GAPDH, ITPR1 and VEGFA) that were significantly associated with overall survival in breast cancer. The eight autophagy genes were assigned as a autophagy-related prognostic signature for breast cancer. Based on the autophagy-related signature, the training dataset GSE21653 could be classified into high-risk and low-risk subgroups with significantly different survival times (HR = 2.72, 95% CI = (1.91, 3.87); P = 1.37 × 10(-5)). Inactivation of autophagy was associated with shortened survival of breast cancer patients. The prognostic value of the autophagy-related signature was confirmed in the testing dataset GSE3494 (HR = 2.12, 95% CI = (1.48, 3.03); P = 1.65 × 10(-3)) and GSE7390 (HR = 1.76, 95% CI = (1.22, 2.54); P = 9.95 × 10(-4)). Further analysis revealed that the prognostic value of the autophagy signature was independent of known clinical prognostic factors, including age, tumor size, grade, estrogen receptor status, progesterone receptor status, ERBB2 status, lymph node status and TP53 mutation status. Finally, we demonstrated that the autophagy signature could also predict distant metastasis-free survival for breast cancer. © 2015 Wiley Periodicals, Inc.
Beaver, Laura M; Kuintzle, Rachael; Buchanan, Alex; Wiley, Michelle W; Glasser, Sarah T; Wong, Carmen P; Johnson, Gavin S; Chang, Jeff H; Löhr, Christiane V; Williams, David E; Dashwood, Roderick H; Hendrix, David A; Ho, Emily
2017-04-01
Long noncoding RNAs (lncRNAs) have emerged as important in cancer development and progression. The impact of diet on lncRNA expression is largely unknown. Sulforaphane (SFN), obtained from vegetables like broccoli, can prevent and suppress cancer formation. Here we tested the hypothesis that SFN attenuates the expression of cancer-associated lncRNAs. We analyzed whole-genome RNA-sequencing data of normal human prostate epithelial cells and prostate cancer cells treated with 15 μM SFN or dimethylsulfoxide. SFN significantly altered expression of ~100 lncRNAs in each cell type and normalized the expression of some lncRNAs that were differentially expressed in cancer cells. SFN-mediated alterations in lncRNA expression correlated with genes that regulate cell cycle, signal transduction and metabolism. LINC01116 was functionally investigated because it was overexpressed in several cancers, and was transcriptionally repressed after SFN treatment. Knockdown of LINC01116 with siRNA decreased proliferation of prostate cancer cells and significantly up-regulated several genes including GAPDH (regulates glycolysis), MAP1LC3B2 (autophagy) and H2AFY (chromatin structure). A four-fold decrease in the ability of the cancer cells to form colonies was found when the LINC01116 gene was disrupted through a CRISPR/CAS9 method, further supporting an oncogenic function for LINC01116 in PC-3 cells. We identified a novel isoform of LINC01116 and bioinformatically investigated the possibility that LINC01116 could interact with target genes via ssRNA:dsDNA triplexes. Our data reveal that chemicals from the diet can influence the expression of functionally important lncRNAs, and suggest a novel mechanism by which SFN may prevent and suppress prostate cancer. Published by Elsevier Inc.
Kuuskeri, Jaana; Mäkelä, Miia R; Isotalo, Jarkko; Oksanen, Ilona; Lundell, Taina
2015-10-19
The fungal genus Phlebia consists of a number of species that are significant in wood decay. Biotechnological potential of a few species for enzyme production and degradation of lignin and pollutants has been previously studied, when most of the species of this genus are unknown. Therefore, we carried out a wider study on biochemistry and systematics of Phlebia species. Isolates belonging to the genus Phlebia were subjected to four-gene sequence analysis in order to clarify their phylogenetic placement at species level and evolutionary relationships of the genus among phlebioid Polyporales. rRNA-encoding (5.8S, partial LSU) and two protein-encoding gene (gapdh, rpb2) sequences were adopted for the evolutionary analysis, and ITS sequences (ITS1+5.8S+ITS2) were aligned for in-depth species-level phylogeny. The 49 fungal isolates were cultivated on semi-solid milled spruce wood medium for 21 days in order to follow their production of extracellular lignocellulose-converting oxidoreductases and carbohydrate active enzymes. Four-gene phylogenetic analysis confirmed the polyphyletic nature of the genus Phlebia. Ten species-level subgroups were formed, and their lignocellulose-converting enzyme activity profiles coincided with the phylogenetic grouping. The highest enzyme activities for lignin modification (manganese peroxidase activity) were obtained for Phlebia radiata group, which supports our previous studies on the enzymology and gene expression of this species on lignocellulosic substrates. Our study implies that there is a species-level connection of molecular systematics (genotype) to the efficiency in production of both lignocellulose-converting carbohydrate active enzymes and oxidoreductases (enzyme phenotype) on spruce wood. Thus, we may propose a similar phylogrouping approach for prediction of lignocellulose-converting enzyme phenotypes in new fungal species or genetically and biochemically less-studied isolates of the wood-decay Polyporales.
[Selection of reference genes of Siraitia grosvenorii by real-time PCR].
Tu, Dong-ping; Mo, Chang-ming; Ma, Xiao-jun; Zhao, Huan; Tang, Qi; Huang, Jie; Pan, Li-mei; Wei, Rong-chang
2015-01-01
Siraitia grosvenorii is a traditional Chinese medicine also as edible food. This study selected six candidate reference genes by real-time quantitative PCR, the expression stability of the candidate reference genes in the different samples was analyzed by using the software and methods of geNorm, NormFinder, BestKeeper, Delta CT method and RefFinder, reference genes for S. grosvenorii were selected for the first time. The results showed that 18SrRNA expressed most stable in all samples, was the best reference gene in the genetic analysis. The study has a guiding role for the analysis of gene expression using qRT-PCR methods, providing a suitable reference genes to ensure the results in the study on differential expressed gene in synthesis and biological pathways, also other genes of S. grosvenorii.
Chao, Jinquan; Yang, Shuguang; Chen, Yueyi; Tian, Wei-Min
2016-01-01
Latex exploitation-caused latex flow is effective in enhancing latex regeneration in laticifer cells of rubber tree. It should be suitable for screening appropriate reference gene for analysis of the expression of latex regeneration-related genes by quantitative real-time PCR (qRT-PCR). In the present study, the expression stability of 23 candidate reference genes was evaluated on the basis of latex flow by using geNorm and NormFinder algorithms. Ubiquitin-protein ligase 2a (UBC2a) and ubiquitin-protein ligase 2b (UBC2b) were the two most stable genes among the selected candidate references in rubber tree clones with differential duration of latex flow. The two genes were also high-ranked in previous reference gene screening across different tissues and experimental conditions. By contrast, the transcripts of latex regeneration-related genes fluctuated significantly during latex flow. The results suggest that screening reference gene during latex flow should be an efficient and effective clue for selection of reference genes in qRT-PCR. PMID:27524995
Hao, Xinyuan; Horvath, David P.; Chao, Wun S.; Yang, Yajun; Wang, Xinchao; Xiao, Bin
2014-01-01
Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a crucial step in qRT-PCR normalization. To date, only a few housekeeping genes have been identified and used as reference genes in tea plant. The validity of those reference genes are not clear since their expression stabilities have not been rigorously examined. To identify more appropriate reference genes for qRT-PCR studies on tea plant, we examined the expression stability of 11 candidate reference genes from three different sources: the orthologs of Arabidopsis traditional reference genes and stably expressed genes identified from whole-genome GeneChip studies, together with three housekeeping gene commonly used in tea plant research. We evaluated the transcript levels of these genes in 94 experimental samples. The expression stabilities of these 11 genes were ranked using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ∆CT method. Results showed that the three commonly used housekeeping genes of CsTUBULIN1, CsACINT1 and Cs18S rRNA1 together with CsUBQ1 were the most unstable genes in all sample ranking order. However, CsPTB1, CsEF1, CsSAND1, CsCLATHRIN1 and CsUBC1 were the top five appropriate reference genes for qRT-PCR analysis in complex experimental conditions. PMID:25474086
Uterine-Specific Knockout of Tsc-2: A Mouse Model for Lymphangioleiomyomatosis
2013-10-01
Burlingame, Califor- nia ), anti-phospho-S6 (Ser 235/236), anti-S6 and 1:5000 anti- glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Cell Sig- naling...Olson S, Nguyen TA. Hydronephrosis and urine retention in estrogen-implanted athymic nude mice. Vet Pathol. 2009;46(3): 505 –508. 40. Leavitt WW, Takeda
Pérez-Pérez, Rafael; López, Juan A.; García-Santos, Eva; Camafeita, Emilio; Gómez-Serrano, María; Ortega-Delgado, Francisco J.; Ricart, Wifredo; Fernández-Real, José M.; Peral, Belén
2012-01-01
Background Protein expression studies based on the two major intra-abdominal human fat depots, the subcutaneous and the omental fat, can shed light into the mechanisms involved in obesity and its co-morbidities. Here we address, for the first time, the identification and validation of reference proteins for data standardization, which are essential for accurate comparison of protein levels in expression studies based on fat from obese and non-obese individuals. Methodology and Findings To uncover adipose tissue proteins equally expressed either in omental and subcutaneous fat depots (study 1) or in omental fat from non-obese and obese individuals (study 2), we have reanalyzed our previously published data based on two-dimensional fluorescence difference gel electrophoresis. Twenty-four proteins (12 in study 1 and 12 in study 2) with similar expression levels in all conditions tested were selected and identified by mass spectrometry. Immunoblotting analysis was used to confirm in adipose tissue the expression pattern of the potential reference proteins and three proteins were validated: PARK7, ENOA and FAA. Western Blot analysis was also used to test customary loading control proteins. ENOA, PARK7 and the customary loading control protein Beta-actin showed steady expression profiles in fat from non-obese and obese individuals, whilst FAA maintained steady expression levels across paired omental and subcutaneous fat samples. Conclusions ENOA, PARK7 and Beta-actin are proper reference standards in obesity studies based on omental fat, whilst FAA is the best loading control for the comparative analysis of omental and subcutaneous adipose tissues either in obese and non-obese subjects. Neither customary loading control proteins GAPDH and TBB5 nor CALX are adequate standards in differential expression studies on adipose tissue. The use of the proposed reference proteins will facilitate the adequate analysis of proteins differentially expressed in the context of obesity, an aim difficult to achieve before this study. PMID:22272336
Komati Reddy, Gajendar; Lindner, Steffen N; Wendisch, Volker F
2015-03-01
Corynebacterium glutamicum uses the Embden-Meyerhof-Parnas pathway of glycolysis and gains 2 mol of ATP per mol of glucose by substrate-level phosphorylation (SLP). To engineer glycolysis without net ATP formation by SLP, endogenous phosphorylating NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was replaced by nonphosphorylating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (GapN) from Clostridium acetobutylicum, which irreversibly converts glyceraldehyde-3-phosphate (GAP) to 3-phosphoglycerate (3-PG) without generating ATP. As shown recently (S. Takeno, R. Murata, R. Kobayashi, S. Mitsuhashi, and M. Ikeda, Appl Environ Microbiol 76:7154-7160, 2010, http://dx.doi.org/10.1128/AEM.01464-10), this ATP-neutral, NADPH-generating glycolytic pathway did not allow for the growth of Corynebacterium glutamicum with glucose as the sole carbon source unless hitherto unknown suppressor mutations occurred; however, these mutations were not disclosed. In the present study, a suppressor mutation was identified, and it was shown that heterologous expression of udhA encoding soluble transhydrogenase from Escherichia coli partly restored growth, suggesting that growth was inhibited by NADPH accumulation. Moreover, genome sequence analysis of second-site suppressor mutants that were able to grow faster with glucose revealed a single point mutation in the gene of non-proton-pumping NADH:ubiquinone oxidoreductase (NDH-II) leading to the amino acid change D213G, which was shared by these suppressor mutants. Since related NDH-II enzymes accepting NADPH as the substrate possess asparagine or glutamine residues at this position, D213G, D213N, and D213Q variants of C. glutamicum NDH-II were constructed and were shown to oxidize NADPH in addition to NADH. Taking these findings together, ATP-neutral glycolysis by the replacement of endogenous NAD-dependent GAPDH with NADP-dependent GapN became possible via oxidation of NADPH formed in this pathway by mutant NADPH-accepting NDH-II(D213G) and thus by coupling to electron transport phosphorylation (ETP). Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Femtosecond UV-laser pulses to unveil protein-protein interactions in living cells.
Itri, Francesco; Monti, Daria M; Della Ventura, Bartolomeo; Vinciguerra, Roberto; Chino, Marco; Gesuele, Felice; Lombardi, Angelina; Velotta, Raffaele; Altucci, Carlo; Birolo, Leila; Piccoli, Renata; Arciello, Angela
2016-02-01
A hallmark to decipher bioprocesses is to characterize protein-protein interactions in living cells. To do this, the development of innovative methodologies, which do not alter proteins and their natural environment, is particularly needed. Here, we report a method (LUCK, Laser UV Cross-linKing) to in vivo cross-link proteins by UV-laser irradiation of living cells. Upon irradiation of HeLa cells under controlled conditions, cross-linked products of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were detected, whose yield was found to be a linear function of the total irradiation energy. We demonstrated that stable dimers of GAPDH were formed through intersubunit cross-linking, as also observed when the pure protein was irradiated by UV-laser in vitro. We proposed a defined patch of aromatic residues located at the enzyme subunit interface as the cross-linking sites involved in dimer formation. Hence, by this technique, UV-laser is able to photofix protein surfaces that come in direct contact. Due to the ultra-short time scale of UV-laser-induced cross-linking, this technique could be extended to weld even transient protein interactions in their native context.
Bénit, Paule; Pelhaître, Alice; Saunier, Elise; Bortoli, Sylvie; Coulibaly, Assetou; Rak, Malgorzata; Schiff, Manuel; Kroemer, Guido; Zeviani, Massimo; Rustin, Pierre
2017-03-01
Mice with the hypomorphic AIF-Harlequin mutation exhibit a highly heterogeneous mitochondriopathy that mostly affects respiratory chain complex I, causing a cerebral pathology that resembles that found in patients with AIF loss-of-function mutations. Here we describe that the antidiabetic drug pioglitazone (PIO) can improve the phenotype of a mouse Harlequin (Hq) subgroup, presumably due to an inhibition of glycolysis that causes an increase in blood glucose levels. This glycolysis-inhibitory PIO effect was observed in cultured astrocytes from Hq mice, as well as in human skin fibroblasts from patients with AIF mutation. Glycolysis inhibition by PIO resulted from direct competitive inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Moreover, GAPDH protein levels were reduced in the cerebellum and in the muscle from Hq mice that exhibited an improved phenotype upon PIO treatment. Altogether, our results suggest that excessive glycolysis participates to the pathogenesis of mitochondriopathies and that pharmacological inhibition of glycolysis may have beneficial effects in this condition. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Ribeiro, Mariana Antunes; dos Reis, Mariana Bisarro; de Moraes, Leonardo Nazário; Briton-Jones, Christine; Rainho, Cláudia Aparecida; Scarano, Wellerson Rodrigo
2014-11-01
Quantitative real-time RT-PCR (qPCR) has proven to be a valuable molecular technique to quantify gene expression. There are few studies in the literature that describe suitable reference genes to normalize gene expression data. Studies of transcriptionally disruptive toxins, like tetrachlorodibenzo-p-dioxin (TCDD), require careful consideration of reference genes. The present study was designed to validate potential reference genes in human Sertoli cells after exposure to TCDD. 32 candidate reference genes were analyzed to determine their applicability. geNorm and NormFinder softwares were used to obtain an estimation of the expression stability of the 32 genes and to identify the most suitable genes for qPCR data normalization.
Marini, N; Bevilacqua, C B; Büttow, M V; Raseira, M C B; Bonow, S
2017-05-25
Selecting and validating reference genes are the first steps in studying gene expression by reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR). The present study aimed to evaluate the stability of five reference genes for the purpose of normalization when studying gene expression in various cultivars of Prunus persica with different chilling requirements. Flower bud tissues of nine peach genotypes from Embrapa's peach breeding program with different chilling requirements were used, and five candidate reference genes based on the RT-qPCR that were useful for studying the relative quantitative gene expression and stability were evaluated using geNorm, NormFinder, and bestKeeper software packages. The results indicated that among the genes tested, the most stable genes to be used as reference genes are Act and UBQ10. This study is the first survey of the stability of reference genes in peaches under chilling stress and provides guidelines for more accurate RT-qPCR results.
Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun
2013-01-01
Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612
Cankorur-Cetinkaya, Ayca; Dereli, Elif; Eraslan, Serpil; Karabekmez, Erkan; Dikicioglu, Duygu; Kirdar, Betul
2012-01-01
Background Understanding the dynamic mechanism behind the transcriptional organization of genes in response to varying environmental conditions requires time-dependent data. The dynamic transcriptional response obtained by real-time RT-qPCR experiments could only be correctly interpreted if suitable reference genes are used in the analysis. The lack of available studies on the identification of candidate reference genes in dynamic gene expression studies necessitates the identification and the verification of a suitable gene set for the analysis of transient gene expression response. Principal Findings In this study, a candidate reference gene set for RT-qPCR analysis of dynamic transcriptional changes in Saccharomyces cerevisiae was determined using 31 different publicly available time series transcriptome datasets. Ten of the twelve candidates (TPI1, FBA1, CCW12, CDC19, ADH1, PGK1, GCN4, PDC1, RPS26A and ARF1) we identified were not previously reported as potential reference genes. Our method also identified the commonly used reference genes ACT1 and TDH3. The most stable reference genes from this pool were determined as TPI1, FBA1, CDC19 and ACT1 in response to a perturbation in the amount of available glucose and as FBA1, TDH3, CCW12 and ACT1 in response to a perturbation in the amount of available ammonium. The use of these newly proposed gene sets outperformed the use of common reference genes in the determination of dynamic transcriptional response of the target genes, HAP4 and MEP2, in response to relaxation from glucose and ammonium limitations, respectively. Conclusions A candidate reference gene set to be used in dynamic real-time RT-qPCR expression profiling in yeast was proposed for the first time in the present study. Suitable pools of stable reference genes to be used under different experimental conditions could be selected from this candidate set in order to successfully determine the expression profiles for the genes of interest. PMID:22675547
Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda
2016-02-01
Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.
Wang, Genhong; Chen, Yanfei; Zhang, Xiaoying; Bai, Bingchuan; Yan, Hao; Qin, Daoyuan; Xia, Qingyou
2018-06-01
The silkworm, Bombyx mori, is one of the world's most economically important insect. Surveying variations in gene expression among multiple tissue/organ samples will provide clues for gene function assignments and will be helpful for identifying genes related to economic traits or specific cellular processes. To ensure their accuracy, commonly used gene expression quantification methods require a set of stable reference genes for data normalization. In this study, 24 candidate reference genes were assessed in 10 tissue/organ samples of day 3 fifth-instar B. mori larvae using geNorm and NormFinder. The results revealed that, using the combination of the expression of BGIBMGA003186 and BGIBMGA008209 was the optimum choice for normalizing the expression data of the B. mori tissue/organ samples. The most stable gene, BGIBMGA003186, is recommended if just one reference gene is used. Moreover, the commonly used reference gene encoding cytoplasmic actin was the least appropriate reference gene of the samples investigated. The reliability of the selected reference genes was further confirmed by evaluating the expression profiles of two cathepsin genes. Our results may be useful for future studies involving the quantification of relative gene expression levels of different tissue/organ samples in B. mori. © 2018 Wiley Periodicals, Inc.
Wu, Zhen-Yong; Chen, Jing-Li; Huang, Shu; Zhang, Hui; Wang, Fang; Wang, Yan; Bi, Xiao-Yun; Guo, Zi-Kuan
2015-12-01
To investigate whether the progesterone can promote fibronection (FN) synthesis by human bone marrow mesenchymal stem cells (MSCs) and to explore the potential underlying mechanism. The human bone marrow MSCs were cultured in a serum-free medium with progesterone for 72 hours, the MTT test was performed to observe the proliferation status and adhension ability of the treated cells. Western blot was used to detect the content of FN in MSDs with GAPDH as the internal reference, the phosphorylation of ERK1/2, as well as the FN content in MSC treated by PD98059, a specific inhibitor of ERK1/2. The progesterone at a range of certain doses not effect on the proliferation of human bone marrow MSCs. Progesterone (25 µg/L) treatment enhanced the FN expression and adherent ability of marrow MSCs. Progesterone could induce prompt phosphorylation of ERK 1/2 and its promoting effects on FN synthesis was reversed by PD98059. The progesterone can promote FN synthesis by human bone marrow MSCs via ERK 1/2 pathway, and it might be used to culture MSCs in serum-free medium.
Wang, Cheng; Cui, Hong-Mi; Huang, Tian-Hong; Liu, Tong-Kun; Hou, Xi-Lin; Li, Ying
2016-01-01
Non-heading Chinese cabbage (Brassica rapa ssp. chinensis Makino) is an important vegetable member of Brassica rapa crops. It exhibits a typical sporophytic self-incompatibility (SI) system and is an ideal model plant to explore the mechanism of SI. Gene expression research are frequently used to unravel the complex genetic mechanism and in such studies appropriate reference selection is vital. Validation of reference genes have neither been conducted in Brassica rapa flowers nor in SI trait. In this study, 13 candidate reference genes were selected and examined systematically in 96 non-heading Chinese cabbage flower samples that represent four strategic groups in compatible and self-incompatible lines of non-heading Chinese cabbage. Two RT-qPCR analysis software, geNorm and NormFinder, were used to evaluate the expression stability of these genes systematically. Results revealed that best-ranked references genes should be selected according to specific sample subsets. DNAJ, UKN1, and PP2A were identified as the most stable reference genes among all samples. Moreover, our research further revealed that the widely used reference genes, CYP and ACP, were the least suitable reference genes in most non-heading Chinese cabbage flower sample sets. To further validate the suitability of the reference genes identified in this study, the expression level of SRK and Exo70A1 genes which play important roles in regulating interaction between pollen and stigma were studied. Our study presented the first systematic study of reference gene(s) selection for SI study and provided guidelines to obtain more accurate RT-qPCR results in non-heading Chinese cabbage. PMID:27375663
Wan, Qiao; Chen, Shuilian; Shan, Zhihui; Yang, Zhonglu; Chen, Limiao; Zhang, Chanjuan; Yuan, Songli; Hao, Qinnan; Zhang, Xiaojuan; Qiu, Dezhen; Chen, Haifeng; Zhou, Xinan
2017-01-01
Real-time quantitative reverse transcription PCR is a sensitive and widely used technique to quantify gene expression. To achieve a reliable result, appropriate reference genes are highly required for normalization of transcripts in different samples. In this study, 9 previously published reference genes (60S, Fbox, ELF1A, ELF1B, ACT11, TUA5, UBC4, G6PD, CYP2) of soybean [Glycine max (L.) Merr.] were selected. The expression stability of the 9 genes was evaluated under conditions of biotic stress caused by infection with soybean mosaic virus, nitrogen stress, across different cultivars and developmental stages. ΔCt and geNorm algorithms were used to evaluate and rank the expression stability of the 9 reference genes. Results obtained from two algorithms showed high consistency. Moreover, results of pairwise variation showed that two reference genes were sufficient to normalize the expression levels of target genes under each experimental setting. For virus infection, ELF1A and ELF1B were the most stable reference genes for accurate normalization. For different developmental stages, Fbox and G6PD had the highest expression stability between two soybean cultivars (Tanlong No. 1 and Tanlong No. 2). ELF1B and ACT11 were identified as the most stably expressed reference genes both under nitrogen stress and among different cultivars. The results showed that none of the candidate reference genes were uniformly expressed at different conditions, and selecting appropriate reference genes was pivotal for gene expression studies with particular condition and tissue. The most stable combination of genes identified in this study will help to achieve more accurate and reliable results in a wide variety of samples in soybean.
Huang, Xuena; Gao, Yangchun; Jiang, Bei; Zhou, Zunchun; Zhan, Aibin
2016-01-15
As invasive species have successfully colonized a wide range of dramatically different local environments, they offer a good opportunity to study interactions between species and rapidly changing environments. Gene expression represents one of the primary and crucial mechanisms for rapid adaptation to local environments. Here, we aim to select reference genes for quantitative gene expression analysis based on quantitative Real-Time PCR (qRT-PCR) for a model invasive ascidian, Ciona savignyi. We analyzed the stability of ten candidate reference genes in three tissues (siphon, pharynx and intestine) under two key environmental stresses (temperature and salinity) in the marine realm based on three programs (geNorm, NormFinder and delta Ct method). Our results demonstrated only minor difference for stability rankings among the three methods. The use of different single reference gene might influence the data interpretation, while multiple reference genes could minimize possible errors. Therefore, reference gene combinations were recommended for different tissues - the optimal reference gene combination for siphon was RPS15 and RPL17 under temperature stress, and RPL17, UBQ and TubA under salinity treatment; for pharynx, TubB, TubA and RPL17 were the most stable genes under temperature stress, while TubB, TubA and UBQ were the best under salinity stress; for intestine, UBQ, RPS15 and RPL17 were the most reliable reference genes under both treatments. Our results suggest that the necessity of selection and test of reference genes for different tissues under varying environmental stresses. The results obtained here are expected to reveal mechanisms of gene expression-mediated invasion success using C. savignyi as a model species. Copyright © 2015 Elsevier B.V. All rights reserved.
Bacterial reference genes for gene expression studies by RT-qPCR: survey and analysis.
Rocha, Danilo J P; Santos, Carolina S; Pacheco, Luis G C
2015-09-01
The appropriate choice of reference genes is essential for accurate normalization of gene expression data obtained by the method of reverse transcription quantitative real-time PCR (RT-qPCR). In 2009, a guideline called the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) highlighted the importance of the selection and validation of more than one suitable reference gene for obtaining reliable RT-qPCR results. Herein, we searched the recent literature in order to identify the bacterial reference genes that have been most commonly validated in gene expression studies by RT-qPCR (in the first 5 years following publication of the MIQE guidelines). Through a combination of different search parameters with the text mining tool MedlineRanker, we identified 145 unique bacterial genes that were recently tested as candidate reference genes. Of these, 45 genes were experimentally validated and, in most of the cases, their expression stabilities were verified using the software tools geNorm and NormFinder. It is noteworthy that only 10 of these reference genes had been validated in two or more of the studies evaluated. An enrichment analysis using Gene Ontology classifications demonstrated that genes belonging to the functional categories of DNA Replication (GO: 0006260) and Transcription (GO: 0006351) rendered a proportionally higher number of validated reference genes. Three genes in the former functional class were also among the top five most stable genes identified through an analysis of gene expression data obtained from the Pathosystems Resource Integration Center. These results may provide a guideline for the initial selection of candidate reference genes for RT-qPCR studies in several different bacterial species.
Reference Gene Selection for qPCR Normalization of Kosteletzkya virginica under Salt Stress
Tang, Xiaoli; Wang, Hongyan; Shao, Chuyang; Shao, Hongbo
2015-01-01
Kosteletzkya virginica (L.) is a newly introduced perennial halophytic plant. Presently, reverse transcription quantitative real-time PCR (qPCR) is regarded as the best choice for analyzing gene expression and its accuracy mainly depends on the reference genes which are used for gene expression normalization. In this study, we employed qPCR to select the most stable reference gene in K. virginica which showed stable expression profiles under our experimental conditions. The candidate reference genes were 18S ribosomal RNA (18SrRNA), β-actin (ACT), α-tubulin (TUA), and elongation factor (EF). We tracked the gene expression profiles of the candidate genes and analyzed their stabilities through BestKeeper, geNorm, and NormFinder software programs. The results of the three programs were identical and 18SrRNA was assessed to be the most stable reference gene in this study. However, TUA was identified to be the most unstable. Our study proved again that the traditional reference genes indeed displayed a certain degree of variations under given experimental conditions. Importantly, our research also provides guidance for selecting most suitable reference genes and lays the foundation for further studies in K. virginica. PMID:26581422
Expression of NF-kappaB dependent genes in human cells in response to heavy ion beams
NASA Astrophysics Data System (ADS)
Hellweg, Christine; Baumstark-Khan, Christa; Ruland, Rebecca; Schmitz, Claudia; Lau, Patrick; Testard, Isabelle; Reitz, Guenther
Space radiation is a primary concern for manned spaceflight and is a potentially limiting factor for long term orbital and interplanetary missions. Understanding of the cellular and molecular processes underlying cell death and transformation related events by space radiation may allow better risk estimation and development of appropriate countermeasures. The pathway leading to activation of the transcription factor nuclear factor κB (NF-κB) and increased transcription of its target gene might modulate cellular radiation response. Previous studies suggest a linear energy transfer (LET) dependency of transcription factor nuclear factor κB (NF-κB) activation: high LET radiation activates NF-κB more efficiently than low LET radiation. In this work, the relative expressions of several NF-κB regulated genes (Gadd45β, NFKBIA encoding the NF-κB inhibitor IκBα, and the anti-apoptotic genes XIAP, bcl-2, and bcl-xL) were examined by quantitative real-time Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR). Human embryonic cells with neuronal differentiation potential (HEK/293) were exposed to accelerated heavy ions or to X-rays (200 kV) or incubated in presence of the strong NF-κB activator tumor necrosis factor α (TNF-α). Target gene expression data were normalized to the expression index of several unregulated reference genes (B2M, GAPDH, PBGD, HPRT). NFKBIA expression is enhanced for 24 h after TNF-α treatment, while Gadd45β expression was only temporarily up-regulated. High doses of X-rays (8 and 16 Gy) and of 13 C ions (75 MeV/n, LET 33 keV/µm, 4.7 Gy) up-regulate NFKBIA and Gadd45β expression temporarily. 13 C ion with higher LET (35 MeV/n, 73 keV/µm) enhance NFKBIA expression already after 1 Gy, and a passing up-regulation of Bcl-2, bcl-xL and XIAP expression was observed 2 h after 0.5 Gy. 20 Ne (95 MeV/A, 80 keV/µm) and 36 Ar ions (95 MeV/A, 271 keV/µm) were the strongest inducers of Gadd45β, NFKBIA, and XIAP with doses from 0.5 to 3.8 Gy. 58 Ni (75 MeV/A, 906 keV/µm) and 208 Pb ion exposure (29 MeV/A, 9764 keV/µm) reduced the expression of Gadd45β. NFKBIA expression was enhanced after 58 Ni ion exposure, but down-regulated after 208 Pb ion exposure. Bcl-2 and Bcl-xL were mostly unaffected by the tested irradiation conditions or only transitorily up-regulated. In conclusion, genes involved in cell cycle regulation (Gadd45β), in inhibition of apoptosis (XIAP, bcl-2, and bcl-xL) and in control of the NF-κB pathway (NFKBIA) show a differentiated expression profile after exposure of human cells to heavy ions of different LET. This might be a step towards understanding of the previously observed LET dependency of cell survival and cell cycle arrest.
Pal-Bhowmick, Ipsita; Andersen, John; Srinivasan, Prakash; Narum, David L; Bosch, Jürgen; Miller, Louis H
2012-01-01
Invasion of erythrocytes by Plasmodium falciparum requires a connection between the cytoplasmic tail of the parasite's ligands for its erythrocyte receptors and the actin-myosin motor of the parasite. For the thromobospondin-related anonymous protein (TRAP) ligand on Plasmodium sporozoites, aldolase forms this connection and requires tryptophan and negatively charged amino acids in the ligand's cytoplasmic tail. Because of the importance of the Duffy binding-like (DBL) and the reticulocyte homology (RH) ligand families in erythrocyte binding and merozoite invasion, we characterized the ability of their cytoplasmic tails to bind aldolase and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), both of which bind actin. We tested the binding of the cytoplasmic peptides of the two ligand families to aldolase and GAPDH. Only the cytoplasmic peptides of some RH ligands showed strong binding to aldolase, and the binding depended on the presence of an aromatic amino acid (phenylalanine or tyrosine), rather than tryptophan, in the context of negatively charged amino acids. The binding was confirmed by surface plasmon resonance analysis and was found to represent affinity similar to that seen with TRAP. An X-ray crystal structure of aldolase at 2.5 Å in the presence of RH2b peptide suggested that the binding site location was near the TRAP-binding site. GAPDH bound to some of the cytoplasmic tails of certain RH and DBL ligands in an aromatic amino acid-dependent manner. Thus, the connection between Plasmodium merozoite ligands and erythrocyte receptors and the actin motor can be achieved through the activity of either aldolase or GAPDH by mechanisms that do not require tryptophan but, rather, other aromatic amino acids. IMPORTANCE The invasion of the Plasmodium merozoite into erythrocytes is a critical element in malaria pathogenesis. It is important to understand the molecular details of this process, as this machinery can be a target for both vaccine and drug development. In Plasmodium sporozoites and Toxoplasma tachyzoites, invasion involves a glycolytic enzyme aldolase, linking the cytoplasmic tail domains of the parasite ligands to the actin-myosin motor that drives invasion. This binding requires a tryptophan that cannot be replaced by other aromatic residues. Here we show that aldolase binds the cytoplasmic tails of some P. falciparum merozoite erythrocyte-binding ligands but that the binding involves aromatic residues other than tryptophan. The biological relevance of aldolase binding to cytoplasmic tails of parasite ligands in invasion is demonstrated by our observation that RH2b but not RH2a binds to aldolase and, as previously shown, that RH2b but not RH2a is required for P. falciparum invasion of erythrocytes.
Cosmeceutical Effects of Galactomannan Fraction from Arenga pinnata Fruits In vitro
Yanti; Madriena; Ali, Soegianto
2017-01-01
Background: Cosmeceuticals refer to natural cosmetics with medical-like benefits due to their bioactive contents. Sugar palm fruit (Arenga pinnata) extract has been claimed for its anti-aging effect in vitro. However, its active compounds for cosmeceuticals is still unclear. Objective: This study was aimed to extract galactomannan from A. pinnata fruits and test its efficacy for tyrosinase inhibition, antioxidant, and anti-photoaging activities in vitro. Materials and Methods: Galactomannan from A. pinnata fruits was extracted by freeze drying and identified for its chemical compounds by using pyrolysis gas chromatography-mass spectrometry (py-GC/MS). Galactomannan was tested for its tyrosinase inhibition in both cell-based (melanocytes) and enzymatic assays, antioxidant activity using ferrous ion chelating assay (FCA) assay, and anti-photoaging activity for inhibiting the gene expression of matrix metalloproteinase-1 (MMP-1) and MMP-13 in macrophages using quantitative real-time polymerase chain reaction (qRT-PCR) analysis. Results: Identification of galactomannan fraction from A. pinnata fruits by py-GC/MS mainly consisted of oxonium ion and glucosides. For cellular assay, galactomannan at 5 μg/mL inhibited >50% of tyrosinase activity in melanocytes induced by phorbol myristate acetate. At the enzymatic level, galactomannan at similar concentration showed less tyrosinase activity inhibition (~20%). FCA results showed that galactomannan at 10 μg/mL exerted >50% of antioxidant activity. The qRT-PCR data indicated that galactomannan at 5 μg/mL inhibited >50% of MMP-1 and MMP-13 gene expressions in ultraviolet B-treated macrophages. Conclusion: Galactomannan fraction from A. pinnata fruits has efficacy for enlightening effect, antioxidant, and anti-photoaging activity in the dose-independent pattern, indicating its cosmeceutical effects for skin healthcare. SUMMARY A. pinnata fruit containing galactomannan has cosmeceutical potentials through enlightening effect, antioxidant, and anti-photoaging activity in vitro.Galactomannan fraction has inhibitory effect on tyrosinase activity in both cellular melanocytes and enzymatic systems.Galactomannan fraction has strong protection against UVB-irradiation effect by inhibiting collagenase genes (MMP-1 and MMP-13) in macrophages. Abbreviations Used: Py-GC/MS: Pyrolysis-Gas Chromatography-Mass Spectrometry; FCA: Ferrous chelating activity; MMP: Matrix metalloproteinase; qRT-PCR: Quantitative Real-Time Polymerase Chain Reaction; PMA: Phorbol myristate acetate; UV: Ultraviolet; RPMI: Roswell Park Memorial Institute; DMEM: Dulbecco's modified eagle media; FBS: Fetal bovine serum; PBS: Phosphate buffered saline; MTT: 3-(4,5-diethylthiazol-2-yl)-2,5-dipheniltetrazolium bromide; L-DOPA: L-3,4-dihydroxyphenylalanine; EDTA: Ethylenediaminetetraacetic acid; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; DPPH: 1,1-diphenyl-2-picryl-hydrazyl; SPF: Sun protection factor PMID:28250652
Marconcini, Simone; Covani, Ugo; Barone, Antonio; Vittorio, Orazio; Curcio, Michele; Barbuti, Serena; Scatena, Fabrizio; Felli, Lamberto; Nicolini, Claudio
2011-07-01
Periodontitis is a complex multifactorial disease and is typically polygenic in origin. Genes play a fundamental part in each biologic process forming complex networks of interactions. However, only some genes have a high number of interactions with other genes in the network and may, therefore, be considered to play an important role. In a preliminary bioinformatic analysis, five genes that showed a higher number of interactions were identified and termed leader genes. In the present study, we use real-time quantitative polymerase chain reaction (PCR) technology to evaluate the expression levels of leader genes in the leukocytes of 10 patients with refractory chronic periodontitis and compare the expression levels with those of the same genes in 24 healthy patients. Blood was collected from 24 healthy human subjects and 10 patients with refractory chronic periodontitis and placed into heparinized blood collection tubes by personnel trained in phlebotomy using a sterile technique. Blood leukocyte cells were immediately lysed by using a kit for total RNA purification from human whole blood. Complementary DNA (cDNA) synthesis was obtained from total RNA and then real-time quantitative PCR was performed. PCR efficiencies were calculated with a relative standard curve derived from a five cDNA dilution series in triplicate that gave regression coefficients >0.98 and efficiencies >96%. The standard curves were obtained using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and growth factor receptor binding protein 2 (GRB2), casitas B-lineage lymphoma (CBL), nuclear factor-KB1 (NFKB1), and REL-A (gene for transcription factor p65) gene primers and amplified with 1.6, 8, 40, 200, and 1,000 ng/μL total cDNA. Curves obtained for each sample showed a linear relationship between RNA concentrations and the cycle threshold value of real-time quantitative PCR for all genes. Data were expressed as mean ± SE (SEM). The groups were compared to the analysis of variance. A probability value <0.01 was considered statistically significant. The present study agrees with the preliminary bioinformatics analysis. In our experiments, the association of pathology with the genes was statistically significant for GRB2 and CBL (P <0.01), and it was not statistically significant for REL-A and NFKB1. This article lends support to our preliminary hypothesis that assigned an important role in refractory aggressive periodontitis to leader genes.
Cui, Bintao; Smooker, Peter M; Rouch, Duncan A; Deighton, Margaret A
2016-08-01
Accurate and reproducible measurement of gene transcription requires appropriate reference genes, which are stably expressed under different experimental conditions to provide normalization. Staphylococcus capitis is a human pathogen that produces biofilm under stress, such as imposed by antimicrobial agents. In this study, a set of five commonly used staphylococcal reference genes (gyrB, sodA, recA, tuf and rpoB) were systematically evaluated in two clinical isolates of Staphylococcus capitis (S. capitis subspecies urealyticus and capitis, respectively) under erythromycin stress in mid-log and stationary phases. Two public software programs (geNorm and NormFinder) and two manual calculation methods, reference residue normalization (RRN) and relative quantitative (RQ), were applied. The potential reference genes selected by the four algorithms were further validated by comparing the expression of a well-studied biofilm gene (icaA) with phenotypic biofilm formation in S. capitis under four different experimental conditions. The four methods differed considerably in their ability to predict the most suitable reference gene or gene combination for comparing icaA expression under different conditions. Under the conditions used here, the RQ method provided better selection of reference genes than the other three algorithms; however, this finding needs to be confirmed with a larger number of isolates. This study reinforces the need to assess the stability of reference genes for analysis of target gene expression under different conditions and the use of more than one algorithm in such studies. Although this work was conducted using a specific human pathogen, it emphasizes the importance of selecting suitable reference genes for accurate normalization of gene expression more generally.
Jiang, Xin; Xue, Yang; Zhou, Hongzhi; Li, Shouhong; Zhang, Zongmin; Hou, Rui; Ding, Yuxiang; Hu, Kaijin
2015-10-01
Reference genes are commonly used as a reliable approach to normalize the results of quantitative polymerase chain reaction (qPCR), and to reduce errors in the relative quantification of gene expression. Suitable reference genes belonging to numerous functional classes have been identified for various types of species and tissue. However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. Sheep are important for the study of human bone diseases, particularly for temporomandibular diseases. The present study aimed to identify a set of reference genes suitable for the normalization of qPCR data from the mandibular condyle of sheep. A total of 12 reference genes belonging to various functional classes were selected, and the expression stability of the reference genes was determined in both the normal and fractured area of the sheep mandibular condyle. RefFinder, which integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, was used to compare and rank the candidate reference genes. The results obtained from the four methods demonstrated a similar trend: RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle. As determined by RefFinder comprehensive analysis, the results of the present study suggested that RPL19 is the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 may be considered suitable alternatives.
Protein CoAlation and antioxidant function of Coenzyme A in prokaryotic cells.
Tsuchiya, Yugo; Zhyvoloup, Alexander; Bakovic, Jovana; Thomas, Naam; Yi Kun Yu, Bess; Das, Sayoni; Orengo, Christine; Newell, Clare; Ward, John; Saladino, Giorgio; Comitani, Federico; Gervasio, Francesco L; Malanchuk, Oksana M; Khoruzhenko, Antonina I; Filonenko, Valeriy; Peak-Chew, Sew Yeu; Skehel, Mark; Gout, Ivan
2018-04-06
In all living organisms, Coenzyme A (CoA) is an essential cofactor with a unique design allowing it to function as an acyl group carrier and a carbonyl-activating group in diverse biochemical reactions. It is synthesized in a highly conserved process in prokaryotes and eukaryotes that requires pantothenic acid (vitamin B5), cysteine and ATP. CoA and its thioester derivatives are involved in major metabolic pathways, allosteric interactions and the regulation of gene expression. A novel unconventional function of CoA in redox regulation has been recently discovered in mammalian cells and termed protein CoAlation. Here, we report for the first time that protein CoAlation occurs at a background level in exponentially growing bacteria and is strongly induced in response to oxidizing agents and metabolic stress. Over 12% of S. aureus gene products were shown to be CoAlated in response to diamide-induced stress . In vitro CoAlation of S. aureus glyceraldehyde-3-phosphate dehydrogenase (SaGAPDH) was found to inhibit its enzymatic activity and to protect the catalytic cysteine 151 from overoxidation by hydrogen peroxide (H 2 O 2 ). These findings suggest that in exponentially growing bacteria CoA functions to generate metabolically active thioesters, while it also has the potential to act as a low molecular weight antioxidant in response to oxidative and metabolic stress. ©2018 The Author(s).
Elena López-Calcagno, Patricia; Omar Abuzaid, Amani; Lawson, Tracy
2017-01-01
Abstract CP12 is a small, redox-sensitive protein, the most detailed understanding of which is the thioredoxin-mediated regulation of the Calvin–Benson cycle, where it facilitates the formation of a complex between glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) in response to changes in light intensity. In most organisms, CP12 proteins are encoded by small multigene families, where the importance of each individual CP12 gene in vivo has not yet been reported. We used Arabidopsis thaliana T-DNA mutants and RNAi transgenic lines with reduced levels of CP12 transcript to determine the relative importance of each of the CP12 genes. We found that single cp12-1, cp12-2, and cp12-3 mutants do not develop a severe photosynthetic or growth phenotype. In contrast, reductions of both CP12-1 and CP12-2 transcripts lead to reductions in photosynthetic capacity and to slower growth and reduced seed yield. No clear phenotype for CP12-3 was evident. Additionally, the levels of PRK protein are reduced in the cp12-1, cp12-1/2, and multiple mutants. Our results suggest that there is functional redundancy between CP12-1 and CP12-2 in Arabidopsis where these proteins have a role in determining the level of PRK in mature leaves and hence photosynthetic capacity. PMID:28430985
Jacob, Francis; Guertler, Rea; Naim, Stephanie; Nixdorf, Sheri; Fedier, André; Hacker, Neville F.; Heinzelmann-Schwarz, Viola
2013-01-01
Reverse Transcription - quantitative Polymerase Chain Reaction (RT-qPCR) is a standard technique in most laboratories. The selection of reference genes is essential for data normalization and the selection of suitable reference genes remains critical. Our aim was to 1) review the literature since implementation of the MIQE guidelines in order to identify the degree of acceptance; 2) compare various algorithms in their expression stability; 3) identify a set of suitable and most reliable reference genes for a variety of human cancer cell lines. A PubMed database review was performed and publications since 2009 were selected. Twelve putative reference genes were profiled in normal and various cancer cell lines (n = 25) using 2-step RT-qPCR. Investigated reference genes were ranked according to their expression stability by five algorithms (geNorm, Normfinder, BestKeeper, comparative ΔCt, and RefFinder). Our review revealed 37 publications, with two thirds patient samples and one third cell lines. qPCR efficiency was given in 68.4% of all publications, but only 28.9% of all studies provided RNA/cDNA amount and standard curves. GeNorm and Normfinder algorithms were used in 60.5% in combination. In our selection of 25 cancer cell lines, we identified HSPCB, RRN18S, and RPS13 as the most stable expressed reference genes. In the subset of ovarian cancer cell lines, the reference genes were PPIA, RPS13 and SDHA, clearly demonstrating the necessity to select genes depending on the research focus. Moreover, a cohort of at least three suitable reference genes needs to be established in advance to the experiments, according to the guidelines. For establishing a set of reference genes for gene normalization we recommend the use of ideally three reference genes selected by at least three stability algorithms. The unfortunate lack of compliance to the MIQE guidelines reflects that these need to be further established in the research community. PMID:23554992
Validation of Reference Genes in mRNA Expression Analysis Applied to the Study of Asthma.
Segundo-Val, Ignacio San; Sanz-Lozano, Catalina S
2016-01-01
The quantitative Polymerase Chain Reaction is the most used technique for the study of gene expression. To correct putative experimental errors of this technique is necessary normalizing the expression results of the gene of interest with the obtained for reference genes. Here, we describe an example of the process to select reference genes. In this particular case, we select reference genes for expression studies in the peripheral blood mononuclear cells of asthmatic patients.
Sabeh, Michael; Duceppe, Marc-Olivier; St-Arnaud, Marc; Mimee, Benjamin
2018-01-01
Relative gene expression analyses by qRT-PCR (quantitative reverse transcription PCR) require an internal control to normalize the expression data of genes of interest and eliminate the unwanted variation introduced by sample preparation. A perfect reference gene should have a constant expression level under all the experimental conditions. However, the same few housekeeping genes selected from the literature or successfully used in previous unrelated experiments are often routinely used in new conditions without proper validation of their stability across treatments. The advent of RNA-Seq and the availability of public datasets for numerous organisms are opening the way to finding better reference genes for expression studies. Globodera rostochiensis is a plant-parasitic nematode that is particularly yield-limiting for potato. The aim of our study was to identify a reliable set of reference genes to study G. rostochiensis gene expression. Gene expression levels from an RNA-Seq database were used to identify putative reference genes and were validated with qRT-PCR analysis. Three genes, GR, PMP-3, and aaRS, were found to be very stable within the experimental conditions of this study and are proposed as reference genes for future work.
Bhattarai, Shanta Raj; Muthuswamy, Elayaraja; Wani, Amit; Brichacek, Michal; Castañeda, Antonio L.; Brock, Stephanie L.
2014-01-01
Purpose To prepare mesoporous silica-based delivery systems capable of simultaneous delivery of drugs and nucleic acids. Methods The surface of mesoporous silica nanoparticles (MSN) was modified with poly(ethylene glycol) (PEG) and poly(2-(dimethylamino)ethylmethacrylate) (PDMAEMA) or poly (2-(diethylamino)ethylmethacrylate) (PDEAEMA). The particles were then loaded with a lysosomotropic agent chloroquine (CQ) and complexed with plasmid DNA or siRNA. The ability of the synthesized particles to deliver combinations of CQ and nucleic acids was evaluated using luciferase plasmid DNA and siRNA targeting luciferase and GAPDH. Results The results show a slow partial MSN dissolution to form hollow silica nanoparticles in aqueous solution. The biological studies show that polycation-modified MSN are able to simultaneously deliver CQ with DNA and siRNA. The co-delivery of CQ and the nucleic acids leads to a significantly increased transfection and silencing activity of the complexes compared with MSN not loaded with CQ. Conclusion PEGylated MSN modified with polycations are promising delivery vectors for combination drug/nucleic acid therapies. PMID:20730557
Ju, Huai-Qiang; Ying, Haoqiang; Tian, Tian; Ling, Jianhua; Fu, Jie; Lu, Yu; Wu, Min; Yang, Lifeng; Achreja, Abhinav; Chen, Gang; Zhuang, Zhuonan; Wang, Huamin; Nagrath, Deepak; Yao, Jun; Hung, Mien-Chie; DePinho, Ronald A.; Huang, Peng; Xu, Rui-Hua; Chiao, Paul J.
2017-01-01
Kras activation and p16 inactivation are required to develop pancreatic ductal adenocarcinoma (PDAC). However, the biochemical mechanisms underlying these double alterations remain unclear. Here we discover that NAD(P)H oxidase 4 (NOX4), an enzyme known to catalyse the oxidation of NAD(P)H, is upregulated when p16 is inactivated by looking at gene expression profiling studies. Activation of NOX4 requires catalytic subunit p22phox, which is upregulated following Kras activation. Both alterations are also detectable in PDAC cell lines and patient specimens. Furthermore, we show that elevated NOX4 activity accelerates oxidation of NADH and supports increased glycolysis by generating NAD+, a substrate for GAPDH-mediated glycolytic reaction, promoting PDAC cell growth. Mechanistically, NOX4 was induced through p16-Rb-regulated E2F and p22phox was induced by KrasG12V-activated NF-κB. In conclusion, we provide a biochemical explanation for the cooperation between p16 inactivation and Kras activation in PDAC development and suggest that NOX4 is a potential therapeutic target for PDAC. PMID:28232723
2012-10-01
ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1
Validation of reference genes for gene expression studies in soybean aphid, Aphis glycines Matsumura
USDA-ARS?s Scientific Manuscript database
Quantitative real-time PCR (qRT-PCR) is a common tool for quantifying mRNA transcripts. To normalize results, a reference gene is mandatory. Aphis glycines is a significant soybean pest, yet gene expression and functional genomics studies are hindered by a lack of stable reference genes. We evalu...
Alves, Livia A; Harth-Chu, Erika N; Palma, Thais H; Stipp, Rafael N; Mariano, Flávia S; Höfling, José F; Abranches, Jacqueline; Mattos-Graner, Renata O
2017-10-01
Streptococcus mutans, a dental caries pathogen, can promote systemic infections upon reaching the bloodstream. The two-component system (TCS) VicRK Sm of S. mutans regulates the synthesis of and interaction with sucrose-derived exopolysaccharides (EPS), processes associated with oral and systemic virulence. In this study, we investigated the mechanisms by which VicRK Sm affects S. mutans susceptibility to blood-mediated immunity. Compared with parent strain UA159, the vicK Sm isogenic mutant (UAvic) showed reduced susceptibility to deposition of C3b of complement, low binding to serum immunoglobulin G (IgG), and low frequency of C3b/IgG-mediated opsonophagocytosis by polymorphonuclear cells in a sucrose-independent way (P<.05). Reverse transcriptase quantitative polymerase chain reaction analysis comparing gene expression in UA159 and UAvic revealed that genes encoding putative peptidases of the complement (pepO and smu.399) were upregulated in UAvic in the presence of serum, although genes encoding murein hydrolases (SmaA and Smu.2146c) or metabolic/surface proteins involved in bacterial interactions with host components (enolase, GAPDH) were mostly affected in a serum-independent way. Among vicK Sm -downstream genes (smaA, smu.2146c, lysM, atlA, pepO, smu.399), only pepO and smu.399 were associated with UAvic phenotypes; deletion of both genes in UA159 significantly enhanced levels of C3b deposition and opsonophagocytosis (P<.05). Moreover, consistent with the fibronectin-binding function of PepO orthologues, UAvic showed increased binding to fibronectin. Reduced susceptibility to opsonophagocytosis was insufficient to enhance ex vivo persistence of UAvic in blood, which was associated with growth defects of this mutant under limited nutrient conditions. Our findings revealed that S. mutans employs mechanisms of complement evasion through peptidases, which are controlled by VicRK Sm. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Wahlberg, Niklas; Weingartner, Elisabet; Warren, Andrew D; Nylin, Sören
2009-01-01
Background Major conflict between mitochondrial and nuclear genes in estimating species relationships is an increasingly common finding in animals. Usually this is attributed to incomplete lineage sorting, but recently the possibility has been raised that hybridization is important in generating such phylogenetic patterns. Just how widespread ancient and/or recent hybridization is in animals and how it affects estimates of species relationships is still not well-known. Results We investigate the species relationships and their evolutionary history over time in the genus Polygonia using DNA sequences from two mitochondrial gene regions (COI and ND1, total 1931 bp) and four nuclear gene regions (EF-1α, wingless, GAPDH and RpS5, total 2948 bp). We found clear, strongly supported conflict between mitochondrial and nuclear DNA sequences in estimating species relationships in the genus Polygonia. Nodes at which there was no conflict tended to have diverged at the same time when analyzed separately, while nodes at which conflict was present diverged at different times. We find that two species create most of the conflict, and attribute the conflict found in Polygonia satyrus to ancient hybridization and conflict found in Polygonia oreas to recent or ongoing hybridization. In both examples, the nuclear gene regions tended to give the phylogenetic relationships of the species supported by morphology and biology. Conclusion Studies inferring species-level relationships using molecular data should never be based on a single locus. Here we show that the phylogenetic hypothesis generated using mitochondrial DNA gives a very different interpretation of the evolutionary history of Polygonia species compared to that generated from nuclear DNA. We show that possible cases of hybridization in Polygonia are not limited to sister species, but may be inferred further back in time. Furthermore, we provide more evidence that Haldane's effect might not be as strong a process in preventing hybridization in butterflies as has been previously thought. PMID:19422691
Hu, Meizhen; Hu, Wenbin; Xia, Zhiqiang; Zhou, Xincheng; Wang, Wenquan
2016-01-01
Reverse transcription quantitative real-time polymerase chain reaction (real-time PCR, also referred to as quantitative RT-PCR or RT-qPCR) is a highly sensitive and high-throughput method used to study gene expression. Despite the numerous advantages of RT-qPCR, its accuracy is strongly influenced by the stability of internal reference genes used for normalizations. To date, few studies on the identification of reference genes have been performed on cassava (Manihot esculenta Crantz). Therefore, we selected 26 candidate reference genes mainly via the three following channels: reference genes used in previous studies on cassava, the orthologs of the most stable Arabidopsis genes, and the sequences obtained from 32 cassava transcriptome sequence data. Then, we employed ABI 7900 HT and SYBR Green PCR mix to assess the expression of these genes in 21 materials obtained from various cassava samples under different developmental and environmental conditions. The stability of gene expression was analyzed using two statistical algorithms, namely geNorm and NormFinder. geNorm software suggests the combination of cassava4.1_017977 and cassava4.1_006391 as sufficient reference genes for major cassava samples, the union of cassava4.1_014335 and cassava4.1_006884 as best choice for drought stressed samples, and the association of cassava4.1_012496 and cassava4.1_006391 as optimal choice for normally grown samples. NormFinder software recommends cassava4.1_006884 or cassava4.1_006776 as superior reference for qPCR analysis of different materials and organs of drought stressed or normally grown cassava, respectively. Results provide an important resource for cassava reference genes under specific conditions. The limitations of these findings were also discussed. Furthermore, we suggested some strategies that may be used to select candidate reference genes. PMID:27242878
Superior Cross-Species Reference Genes: A Blueberry Case Study
Die, Jose V.; Rowland, Lisa J.
2013-01-01
The advent of affordable Next Generation Sequencing technologies has had major impact on studies of many crop species, where access to genomic technologies and genome-scale data sets has been extremely limited until now. The recent development of genomic resources in blueberry will enable the application of high throughput gene expression approaches that should relatively quickly increase our understanding of blueberry physiology. These studies, however, require a highly accurate and robust workflow and make necessary the identification of reference genes with high expression stability for correct target gene normalization. To create a set of superior reference genes for blueberry expression analyses, we mined a publicly available transcriptome data set from blueberry for orthologs to a set of Arabidopsis genes that showed the most stable expression in a developmental series. In total, the expression stability of 13 putative reference genes was evaluated by qPCR and a set of new references with high stability values across a developmental series in fruits and floral buds of blueberry were identified. We also demonstrated the need to use at least two, preferably three, reference genes to avoid inconsistencies in results, even when superior reference genes are used. The new references identified here provide a valuable resource for accurate normalization of gene expression in Vaccinium spp. and may be useful for other members of the Ericaceae family as well. PMID:24058469
Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples
2010-01-01
Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system. PMID:20492695
Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.
Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha
2010-05-21
Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.
Czechowski, Tomasz; Stitt, Mark; Altmann, Thomas; Udvardi, Michael K.; Scheible, Wolf-Rüdiger
2005-01-01
Gene transcripts with invariant abundance during development and in the face of environmental stimuli are essential reference points for accurate gene expression analyses, such as RNA gel-blot analysis or quantitative reverse transcription-polymerase chain reaction (PCR). An exceptionally large set of data from Affymetrix ATH1 whole-genome GeneChip studies provided the means to identify a new generation of reference genes with very stable expression levels in the model plant species Arabidopsis (Arabidopsis thaliana). Hundreds of Arabidopsis genes were found that outperform traditional reference genes in terms of expression stability throughout development and under a range of environmental conditions. Most of these were expressed at much lower levels than traditional reference genes, making them very suitable for normalization of gene expression over a wide range of transcript levels. Specific and efficient primers were developed for 22 genes and tested on a diverse set of 20 cDNA samples. Quantitative reverse transcription-PCR confirmed superior expression stability and lower absolute expression levels for many of these genes, including genes encoding a protein phosphatase 2A subunit, a coatomer subunit, and an ubiquitin-conjugating enzyme. The developed PCR primers or hybridization probes for the novel reference genes will enable better normalization and quantification of transcript levels in Arabidopsis in the future. PMID:16166256
Herrero, Óscar; Aquilino, Mónica; Sánchez-Argüello, Paloma; Planelló, Rosario
2018-01-01
Bisphenol S (BPS) is an industrial alternative to the endocrine disruptor bisphenol A (BPA), and can be found in many products labeled "BPA-free". Its use has grown in recent years, and presently it is considered a ubiquitous emerging pollutant. To date there is a lack of information on the effects of BPS on invertebrates, although they represent more than 95% of known species in the animal kingdom and are crucial for the structure and proper function of ecosystems. In this study, real-time RT-PCR was used to determine the early detrimental effects of BPS on the transcriptional rate of genes in the model species Chironomus riparius, specifically those related to the ecdysone pathway (EcR, ERR, E74, Vtg, cyp18a1) crucial for insect development and metamorphosis, stress and biotransformation mechanisms (hsp70, hsp40, cyp4g, GPx, GSTd3) that regulate adaptive responses and determine survival, and ribosome biogenesis (its2, rpL4, rpL13) which is essential for protein synthesis and homeostasis. While 24-hour exposure to 0.5, 5, 50, and 500 μg/L BPS had no effect on larval survival, almost all the studied genes were upregulated following a non-monotonic dose-response curve. Genes with the greatest increases in transcriptional activity (fold change relative to control) were EcR (3.8), ERR (2), E74 (2.4), cyp18a1 (2.5), hsp70 (1.7), hsp40 (2.5), cyp4g (6.4), GPx (1.8), and GST (2.1), while others including Vtg, GAPDH, and selected ribosomal genes remained stable. We also measured the transcriptional activity of these genes 24 hours after BPS withdrawal and a general downregulation compared to controls was observed, though not significant in most cases. Our findings showed that BPS exposure altered the transcriptional profile of these genes, which may have consequences for the hormone system and several metabolic pathways. Although further research is needed to elucidate its mode of action, these results raise new concerns about the safety of BPA alternatives.
Song, Liang; Li, Tong; Fan, Li; Shen, Xiao-Ye; Hou, Cheng-Lin
2016-04-01
The stability of reference genes plays a vital role in real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis, which is generally regarded as a convenient and sensitive tool for the analysis of gene expression. A well-known medicinal fungus, Shiraia bambusicola, has great potential in the pharmaceutical, agricultural and food industries, but its suitable reference genes have not yet been determined. In the present study, 11 candidate reference genes in S. bambusicola were first evaluated and validated comprehensively. To identify the suitable reference genes for qRT-PCR analysis, three software-based algorithms, geNorm, NormFinder and Best Keeper, were applied to rank the tested genes. RNA samples were collected from seven fermentation stages using different media (potato dextrose or Czapek medium) and under different light conditions (12-h light/12-h dark and all-dark). The three most appropriate reference genes, ubi, tfc and ags, were able to normalize the qRT-PCR results under the culturing conditions of 12-h light/12-h dark, whereas the other three genes, vac, gke and acyl, performed better in the culturing conditions of all-dark growth. Therefore, under different light conditions, at least two reference genes (ubi and vac) could be employed to assure the reliability of qRT-PCR results. For both the natural culture medium (the most appropriate genes of this group: ubi, tfc and ags) and the chemically defined synthetic medium (the most stable genes of this group: tfc, vac and ef), the tfc gene remained the best gene used for normalizing the gene expression found with qRT-PCR. It is anticipated that these results would improve the selection of suitable reference genes for qRT-PCR assays and lay the foundation for an accurate analysis of gene expression in S. bambusicola.
Du, Yishuai; Zhang, Linlin; Xu, Fei; Huang, Baoyu; Zhang, Guofan; Li, Li
2013-03-01
Hatchery-reared larvae of the Pacific oyster (Crassostrea gigas) often suffer from massive mortality induced by Ostreid herpesvirus 1 (OsHV-1) infection, indicating the importance of better understanding of oyster immune defense systems. The accuracy of measurements of gene expression levels based on quantitative real-time PCR assays relies on the use of housekeeping genes as internal controls; however, few studies have focused on the selection of such internal controls. In this study, we conducted a comprehensive investigation of internal control genes during oyster development in virus-infected and uninfected samples. Transcriptome data for 38 developmental stages were downloaded and the gene expression patterns were classified into 30 clusters. A total of 317 orthologs of classical housekeeping genes in the oyster genome were annotated. After combining the expression profiles and oyster housekeeping gene dataset, 14 candidate internal controls were selected for further investigation: Elongation factor-1α (EF-1α), 18S rRNA (18S), 28S rRNA (28S), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), β-actin (ACT), Ribosomal protein L7 (RL7), Ribosomal protein L27 (RL27), Ribosomal protein L36 (RL36), Ribosomal protein S18 (RS18), Heterogeneous nuclear ribonucleoprotein A2/B1 (RO21), Eukaryotic translation elongation factor 2 (EF2), Ubiquitin-conjugating enzyme E2D2 (UBCD1), S-phase kinase-associated protein 1 (SKP1) and Heterogeneous nuclear ribonucleoprotein Q (HNRPQ). RNA was extracted from oyster larvae infected with OsHV-1 (group A; GA), and OsHV-1 free larvae (group B; GB). The expression levels of the 14 candidate internal controls were studied in GA and GB larvae by real-time PCR. Their expression stabilities were further analyzed using the GeNorm program. RL7 and RS18 were the most stable genes in both OsHV-1 infected (GA) and uninfected (GB) larvae. These results suggest that RL7 and RS18 could be used as internal controls for studying gene expression in normal growing oyster larvae and in OsHV-1 infected larvae. These high quality internal controls will be a valuable resource in future studies of oyster larval mortality. Copyright © 2012 Elsevier Ltd. All rights reserved.
Reddy, Palakolanu Sudhakar; Sri Cindhuri, Katamreddy; Sivaji Ganesh, Adusumalli; Sharma, Kiran Kumar
2016-01-01
Quantitative Real-Time PCR (qPCR) is a preferred and reliable method for accurate quantification of gene expression to understand precise gene functions. A total of 25 candidate reference genes including traditional and new generation reference genes were selected and evaluated in a diverse set of chickpea samples. The samples used in this study included nine chickpea genotypes (Cicer spp.) comprising of cultivated and wild species, six abiotic stress treatments (drought, salinity, high vapor pressure deficit, abscisic acid, cold and heat shock), and five diverse tissues (leaf, root, flower, seedlings and seed). The geNorm, NormFinder and RefFinder algorithms used to identify stably expressed genes in four sample sets revealed stable expression of UCP and G6PD genes across genotypes, while TIP41 and CAC were highly stable under abiotic stress conditions. While PP2A and ABCT genes were ranked as best for different tissues, ABCT, UCP and CAC were most stable across all samples. This study demonstrated the usefulness of new generation reference genes for more accurate qPCR based gene expression quantification in cultivated as well as wild chickpea species. Validation of the best reference genes was carried out by studying their impact on normalization of aquaporin genes PIP1;4 and TIP3;1, in three contrasting chickpea genotypes under high vapor pressure deficit (VPD) treatment. The chickpea TIP3;1 gene got significantly up regulated under high VPD conditions with higher relative expression in the drought susceptible genotype, confirming the suitability of the selected reference genes for expression analysis. This is the first comprehensive study on the stability of the new generation reference genes for qPCR studies in chickpea across species, different tissues and abiotic stresses. PMID:26863232
Reddy, Dumbala Srinivas; Bhatnagar-Mathur, Pooja; Reddy, Palakolanu Sudhakar; Sri Cindhuri, Katamreddy; Sivaji Ganesh, Adusumalli; Sharma, Kiran Kumar
2016-01-01
Quantitative Real-Time PCR (qPCR) is a preferred and reliable method for accurate quantification of gene expression to understand precise gene functions. A total of 25 candidate reference genes including traditional and new generation reference genes were selected and evaluated in a diverse set of chickpea samples. The samples used in this study included nine chickpea genotypes (Cicer spp.) comprising of cultivated and wild species, six abiotic stress treatments (drought, salinity, high vapor pressure deficit, abscisic acid, cold and heat shock), and five diverse tissues (leaf, root, flower, seedlings and seed). The geNorm, NormFinder and RefFinder algorithms used to identify stably expressed genes in four sample sets revealed stable expression of UCP and G6PD genes across genotypes, while TIP41 and CAC were highly stable under abiotic stress conditions. While PP2A and ABCT genes were ranked as best for different tissues, ABCT, UCP and CAC were most stable across all samples. This study demonstrated the usefulness of new generation reference genes for more accurate qPCR based gene expression quantification in cultivated as well as wild chickpea species. Validation of the best reference genes was carried out by studying their impact on normalization of aquaporin genes PIP1;4 and TIP3;1, in three contrasting chickpea genotypes under high vapor pressure deficit (VPD) treatment. The chickpea TIP3;1 gene got significantly up regulated under high VPD conditions with higher relative expression in the drought susceptible genotype, confirming the suitability of the selected reference genes for expression analysis. This is the first comprehensive study on the stability of the new generation reference genes for qPCR studies in chickpea across species, different tissues and abiotic stresses.
Yang, Chunxiao; Li, Hui; Pan, Huipeng; Ma, Yabin; Zhang, Deyong; Liu, Yong; Zhang, Zhanhong; Zheng, Changying; Chu, Dong
2015-01-01
Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for measuring and evaluating gene expression during variable biological processes. To facilitate gene expression studies, normalization of genes of interest relative to stable reference genes is crucial. The western flower thrips Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae), the main vector of tomato spotted wilt virus (TSWV), is a destructive invasive species. In this study, the expression profiles of 11 candidate reference genes from nonviruliferous and viruliferous F. occidentalis were investigated. Five distinct algorithms, geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder, were used to determine the performance of these genes. geNorm, NormFinder, BestKeeper, and RefFinder identified heat shock protein 70 (HSP70), heat shock protein 60 (HSP60), elongation factor 1 α, and ribosomal protein l32 (RPL32) as the most stable reference genes, and the ΔCt method identified HSP60, HSP70, RPL32, and heat shock protein 90 as the most stable reference genes. Additionally, two reference genes were sufficient for reliable normalization in nonviruliferous and viruliferous F. occidentalis. This work provides a foundation for investigating the molecular mechanisms of TSWV and F. occidentalis interactions.
Chen, Chun; Xie, Tingna; Ye, Sudan; Jensen, Annette Bruun; Eilenberg, Jørgen
2016-01-01
The selection of suitable reference genes is crucial for accurate quantification of gene expression and can add to our understanding of host-pathogen interactions. To identify suitable reference genes in Pandora neoaphidis, an obligate aphid pathogenic fungus, the expression of three traditional candidate genes including 18S rRNA(18S), 28S rRNA(28S) and elongation factor 1 alpha-like protein (EF1), were measured by quantitative polymerase chain reaction at different developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae), and under different nutritional conditions. We calculated the expression stability of candidate reference genes using four algorithms including geNorm, NormFinder, BestKeeper and Delta Ct. The analysis results revealed that the comprehensive ranking of candidate reference genes from the most stable to the least stable was 18S (1.189), 28S (1.414) and EF1 (3). The 18S was, therefore, the most suitable reference gene for real-time RT-PCR analysis of gene expression under all conditions. These results will support further studies on gene expression in P. neoaphidis. Copyright © 2015 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Cheng, Jason X; Chen, Li; Li, Yuan; Cloe, Adam; Yue, Ming; Wei, Jiangbo; Watanabe, Kenneth A; Shammo, Jamile M; Anastasi, John; Shen, Qingxi J; Larson, Richard A; He, Chuan; Le Beau, Michelle M; Vardiman, James W
2018-06-06
In the originally published version of this Article, the GAPDH loading control blot in Fig. 1a was inadvertently replaced with a duplicate of the DNMT2 blot in the same panel during assembly of the figure. This has now been corrected in both the PDF and HTML versions of the Article.
2015-10-01
LNCaP-CRPC cells expressed AR protein and its 4 targets, i.e., PSA, FKBP5, PAP (prostate alkaline phosphatase), and PSMA (prostate-specific membrane...LNCaP GAPDH FKBP5 PSA 75 - 50 - PAP AR *** 100 - 75 - AR-V7100 -75 - PSMA 100 - 250 - 150 - 37 - 25 - 50 - 36 - A B C CDSS CDSS+Bica Re lat ive m
Relationship between Porcine Sperm Motility and Sperm Enzymatic Activity using Paper-based Devices
NASA Astrophysics Data System (ADS)
Matsuura, Koji; Huang, Han-Wei; Chen, Ming-Cheng; Chen, Yu; Cheng, Chao-Min
2017-04-01
Mammalian sperm motility has traditionally been analyzed to determine fertility using computer-assisted semen analysis (CASA) systems. To develop low-cost and robust male fertility diagnostics, we created a paper-based MTT assay and used it to estimate motile sperm concentration. When porcine sperm motility was inhibited using sperm enzyme inhibitors for sperm enzymes related to mitochondrial activity and glycolysis, we simultaneously recorded sperm motility and enzymatic reactivity using a portable motility analysis system (iSperm) and a paper-based MTT assay, respectively. When using our paper-based MTT-assay, we calculated the area mean value signal intensity (AMV) to evaluate enzymatic reactivity. Both sperm motility and AMV decreased following treatment with iodoacetamide (IODO) and 3-bromopyruvic acid (3BP), both of which are inhibitors of glycolytic enzymes including glyceraldehyde-3-phosphate dehydrogenase (GAPDH). We found a correlation between recorded motility using iSperm and AMV from our paper-based assay (P < 0.05), suggesting that a sperm-related enzymatic reaction is involved in sperm motility. Under this protocol, MTT reduction was coupled with catalysis of GAPDH and was promoted by electron transfer from NADH. Based on this inhibitor study, sperm motility can be estimated using our paper-based MTT-assay.
Schliep, M.; Pernice, M.; Sinutok, S.; Bryant, C. V.; York, P. H.; Rasheed, M. A.; Ralph, P. J.
2015-01-01
Seagrass meadows are threatened by coastal development and global change. In the face of these pressures, molecular techniques such as reverse transcription quantitative real-time PCR (RT-qPCR) have great potential to improve management of these ecosystems by allowing early detection of chronic stress. In RT-qPCR, the expression levels of target genes are estimated on the basis of reference genes, in order to control for RNA variations. Although determination of suitable reference genes is critical for RT-qPCR studies, reports on the evaluation of reference genes are still absent for the major Australian species Zostera muelleri subsp. capricorni (Z. muelleri). Here, we used three different software (geNorm, NormFinder and Bestkeeper) to evaluate ten widely used reference genes according to their expression stability in Z. muelleri exposed to light limitation. We then combined results from different software and used a consensus rank of four best reference genes to validate regulation in Photosystem I reaction center subunit IV B and Heat Stress Transcription factor A- gene expression in Z. muelleri under light limitation. This study provides the first comprehensive list of reference genes in Z. muelleri and demonstrates RT-qPCR as an effective tool to identify early responses to light limitation in seagrass. PMID:26592440
Paten, A M; Pain, S J; Peterson, S W; Blair, H T; Kenyon, P R; Dearden, P K; Duncan, E J
2014-08-01
The mammary gland is a complex tissue consisting of multiple cell types which, over the lifetime of an animal, go through repeated cycles of development associated with pregnancy, lactation and involution. The mammary gland is also known to be sensitive to maternal programming by environmental stimuli such as nutrition. The molecular basis of these adaptations is of significant interest, but requires robust methods to measure gene expression. Reverse-transcription quantitative PCR (RT-qPCR) is commonly used to measure gene expression, and is currently the method of choice for validating genome-wide expression studies. RT-qPCR requires the selection of reference genes that are stably expressed over physiological states and treatments. In this study we identify suitable reference genes to normalize RT-qPCR data for the ovine mammary gland in two physiological states; late pregnancy and lactation. Biopsies were collected from offspring of ewes that had been subjected to different nutritional paradigms during pregnancy to examine effects of maternal programming on the mammary gland of the offspring. We evaluated eight candidate reference genes and found that two reference genes (PRPF3 and CUL1) are required for normalising RT-qPCR data from pooled RNA samples, but five reference genes are required for analyzing gene expression in individual animals (SENP2, EIF6, MRPL39, ATP1A1, CUL1). Using these stable reference genes, we showed that TET1, a key regulator of DNA methylation, is responsive to maternal programming and physiological state. The identification of these novel reference genes will be of utility to future studies of gene expression in the ovine mammary gland. Copyright © 2014 the American Physiological Society.
Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis
2015-01-01
Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference--ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)--along with two novel candidates--HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest.
Selection of Reliable Reference Genes for Gene Expression Studies on Rhododendron molle G. Don.
Xiao, Zheng; Sun, Xiaobo; Liu, Xiaoqing; Li, Chang; He, Lisi; Chen, Shangping; Su, Jiale
2016-01-01
The quantitative real-time polymerase chain reaction (qRT-PCR) approach has become a widely used method to analyze expression patterns of target genes. The selection of an optimal reference gene is a prerequisite for the accurate normalization of gene expression in qRT-PCR. The present study constitutes the first systematic evaluation of potential reference genes in Rhododendron molle G. Don. Eleven candidate reference genes in different tissues and flowers at different developmental stages of R. molle were assessed using the following three software packages: GeNorm, NormFinder, and BestKeeper. The results showed that EF1- α (elongation factor 1-alpha), 18S (18s ribosomal RNA), and RPL3 (ribosomal protein L3) were the most stable reference genes in developing rhododendron flowers and, thus, in all of the tested samples, while tublin ( TUB ) was the least stable. ACT5 (actin), RPL3 , 18S , and EF1- α were found to be the top four choices for different tissues, whereas TUB was not found to favor qRT-PCR normalization in these tissues. Three stable reference genes are recommended for the normalization of qRT-PCR data in R. molle . Furthermore, the expression profiles of RmPSY (phytoene synthase) and RmPDS (phytoene dehydrogenase) were assessed using EF1- α, 18S , ACT5 , RPL3 , and their combination as internals. Similar trends were found, but these trends varied when the least stable reference gene TUB was used. The results further prove that it is necessary to validate the stability of reference genes prior to their use for normalization under different experimental conditions. This study provides useful information for reliable qRT-PCR data normalization in gene studies of R. molle .
Identification and evaluation of reference genes for qRT-PCR normalization in Ganoderma lucidum.
Xu, Jiang; Xu, ZhiChao; Zhu, YingJie; Luo, HongMei; Qian, Jun; Ji, AiJia; Hu, YuanLei; Sun, Wei; Wang, Bo; Song, JingYuan; Sun, Chao; Chen, ShiLin
2014-01-01
Quantitative real-time reverse transcription PCR (qRT-PCR) is a rapid, sensitive, and reliable technique for gene expression studies. The accuracy and reliability of qRT-PCR results depend on the stability of the reference genes used for gene normalization. Therefore, a systematic process of reference gene evaluation is needed. Ganoderma lucidum is a famous medicinal mushroom in East Asia. In the current study, 10 potential reference genes were selected from the G. lucidum genomic data. The sequences of these genes were manually curated, and primers were designed following strict criteria. The experiment was conducted using qRT-PCR, and the stability of each candidate gene was assessed using four commonly used statistical programs-geNorm, NormFinder, BestKeeper, and RefFinder. According to our results, PP2A was expressed at the most stable levels under different fermentation conditions, and RPL4 was the most stably expressed gene in different tissues. RPL4, PP2A, and β-tubulin are the most commonly recommended reference genes for normalizing gene expression in the entire sample set. The current study provides a foundation for the further use of qRT-PCR in G. lucidum gene analysis.
Lin, Liyuan; Han, Xiaojiao; Chen, Yicun; Wu, Qingke; Wang, Yangdong
2013-12-01
Quantitative real-time PCR has emerged as a highly sensitive and widely used method for detection of gene expression profiles, via which accurate detection depends on reliable normalization. Since no single control is appropriate for all experimental treatments, it is generally advocated to select suitable internal controls prior to use for normalization. This study reported the evaluation of the expression stability of twelve potential reference genes in different tissue/organs and six fruit developmental stages of Litsea cubeba in order to screen the superior internal reference genes for data normalization. Two softwares-geNorm, and NormFinder-were used to identify stability of these candidate genes. The cycle threshold difference and coefficient of variance were also calculated to evaluate the expression stability of candidate genes. F-BOX, EF1α, UBC, and TUA were selected as the most stable reference genes across 11 sample pools. F-BOX, EF1α, and EIF4α exhibited the highest expression stability in different tissue/organs and different fruit developmental stages. Besides, a combination of two stable reference genes would be sufficient for gene expression normalization in different fruit developmental stages. In addition, the relative expression profiles of DXS and DXR were evaluated by EF1α, UBC, and SAMDC. The results further validated the reliability of stable reference genes and also highlighted the importance of selecting suitable internal controls for L. cubeba. These reference genes will be of great importance for transcript normalization in future gene expression studies on L. cubeba.
Elasmobranch qPCR reference genes: a case study of hypoxia preconditioned epaulette sharks
2010-01-01
Background Elasmobranch fishes are an ancient group of vertebrates which have high potential as model species for research into evolutionary physiology and genomics. However, no comparative studies have established suitable reference genes for quantitative PCR (qPCR) in elasmobranchs for any physiological conditions. Oxygen availability has been a major force shaping the physiological evolution of vertebrates, especially fishes. Here we examined the suitability of 9 reference candidates from various functional categories after a single hypoxic insult or after hypoxia preconditioning in epaulette shark (Hemiscyllium ocellatum). Results Epaulette sharks were caught and exposed to hypoxia. Tissues were collected from 10 controls, 10 individuals with single hypoxic insult and 10 individuals with hypoxia preconditioning (8 hypoxic insults, 12 hours apart). We produced sequence information for reference gene candidates and monitored mRNA expression levels in four tissues: cerebellum, heart, gill and eye. The stability of the genes was examined with analysis of variance, geNorm and NormFinder. The best ranking genes in our study were eukaryotic translation elongation factor 1 beta (eef1b), ubiquitin (ubq) and polymerase (RNA) II (DNA directed) polypeptide F (polr2f). The performance of the ribosomal protein L6 (rpl6) was tissue-dependent. Notably, in one tissue the analysis of variance indicated statistically significant differences between treatments for genes that were ranked as the most stable candidates by reference gene software. Conclusions Our results indicate that eef1b and ubq are generally the most suitable reference genes for the conditions and tissues in the present epaulette shark studies. These genes could also be potential reference gene candidates for other physiological studies examining stress in elasmobranchs. The results emphasise the importance of inter-group variation in reference gene evaluation. PMID:20416043
Teste, Marie-Ange; Duquenne, Manon; François, Jean M; Parrou, Jean-Luc
2009-01-01
Background Real-time RT-PCR is the recommended method for quantitative gene expression analysis. A compulsory step is the selection of good reference genes for normalization. A few genes often referred to as HouseKeeping Genes (HSK), such as ACT1, RDN18 or PDA1 are among the most commonly used, as their expression is assumed to remain unchanged over a wide range of conditions. Since this assumption is very unlikely, a geometric averaging of multiple, carefully selected internal control genes is now strongly recommended for normalization to avoid this problem of expression variation of single reference genes. The aim of this work was to search for a set of reference genes for reliable gene expression analysis in Saccharomyces cerevisiae. Results From public microarray datasets, we selected potential reference genes whose expression remained apparently invariable during long-term growth on glucose. Using the algorithm geNorm, ALG9, TAF10, TFC1 and UBC6 turned out to be genes whose expression remained stable, independent of the growth conditions and the strain backgrounds tested in this study. We then showed that the geometric averaging of any subset of three genes among the six most stable genes resulted in very similar normalized data, which contrasted with inconsistent results among various biological samples when the normalization was performed with ACT1. Normalization with multiple selected genes was therefore applied to transcriptional analysis of genes involved in glycogen metabolism. We determined an induction ratio of 100-fold for GPH1 and 20-fold for GSY2 between the exponential phase and the diauxic shift on glucose. There was no induction of these two genes at this transition phase on galactose, although in both cases, the kinetics of glycogen accumulation was similar. In contrast, SGA1 expression was independent of the carbon source and increased by 3-fold in stationary phase. Conclusion In this work, we provided a set of genes that are suitable reference genes for quantitative gene expression analysis by real-time RT-PCR in yeast biological samples covering a large panel of physiological states. In contrast, we invalidated and discourage the use of ACT1 as well as other commonly used reference genes (PDA1, TDH3, RDN18, etc) as internal controls for quantitative gene expression analysis in yeast. PMID:19874630
Teste, Marie-Ange; Duquenne, Manon; François, Jean M; Parrou, Jean-Luc
2009-10-30
Real-time RT-PCR is the recommended method for quantitative gene expression analysis. A compulsory step is the selection of good reference genes for normalization. A few genes often referred to as HouseKeeping Genes (HSK), such as ACT1, RDN18 or PDA1 are among the most commonly used, as their expression is assumed to remain unchanged over a wide range of conditions. Since this assumption is very unlikely, a geometric averaging of multiple, carefully selected internal control genes is now strongly recommended for normalization to avoid this problem of expression variation of single reference genes. The aim of this work was to search for a set of reference genes for reliable gene expression analysis in Saccharomyces cerevisiae. From public microarray datasets, we selected potential reference genes whose expression remained apparently invariable during long-term growth on glucose. Using the algorithm geNorm, ALG9, TAF10, TFC1 and UBC6 turned out to be genes whose expression remained stable, independent of the growth conditions and the strain backgrounds tested in this study. We then showed that the geometric averaging of any subset of three genes among the six most stable genes resulted in very similar normalized data, which contrasted with inconsistent results among various biological samples when the normalization was performed with ACT1. Normalization with multiple selected genes was therefore applied to transcriptional analysis of genes involved in glycogen metabolism. We determined an induction ratio of 100-fold for GPH1 and 20-fold for GSY2 between the exponential phase and the diauxic shift on glucose. There was no induction of these two genes at this transition phase on galactose, although in both cases, the kinetics of glycogen accumulation was similar. In contrast, SGA1 expression was independent of the carbon source and increased by 3-fold in stationary phase. In this work, we provided a set of genes that are suitable reference genes for quantitative gene expression analysis by real-time RT-PCR in yeast biological samples covering a large panel of physiological states. In contrast, we invalidated and discourage the use of ACT1 as well as other commonly used reference genes (PDA1, TDH3, RDN18, etc) as internal controls for quantitative gene expression analysis in yeast.
Pan, Huipeng; Ma, Yabin; Zhang, Deyong; Liu, Yong; Zhang, Zhanhong; Zheng, Changying; Chu, Dong
2015-01-01
Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for measuring and evaluating gene expression during variable biological processes. To facilitate gene expression studies, normalization of genes of interest relative to stable reference genes is crucial. The western flower thrips Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae), the main vector of tomato spotted wilt virus (TSWV), is a destructive invasive species. In this study, the expression profiles of 11 candidate reference genes from nonviruliferous and viruliferous F. occidentalis were investigated. Five distinct algorithms, geNorm, NormFinder, BestKeeper, the ΔC t method, and RefFinder, were used to determine the performance of these genes. geNorm, NormFinder, BestKeeper, and RefFinder identified heat shock protein 70 (HSP70), heat shock protein 60 (HSP60), elongation factor 1 α, and ribosomal protein l32 (RPL32) as the most stable reference genes, and the ΔC t method identified HSP60, HSP70, RPL32, and heat shock protein 90 as the most stable reference genes. Additionally, two reference genes were sufficient for reliable normalization in nonviruliferous and viruliferous F. occidentalis. This work provides a foundation for investigating the molecular mechanisms of TSWV and F. occidentalis interactions. PMID:26244556
Wan, Pin-Jun; Tang, Yao-Hua; Yuan, San-Yue; He, Jia-Chun; Wang, Wei-Xia; Lai, Feng-Xiang; Fu, Qiang
2017-01-01
Nilaparvata lugens (Stål) (Hemiptera: Delphacidae) is a major rice pest that harbors an endosymbiont ascomycete fungus, Entomomyces delphacidicola str. NLU (also known as yeast-like symbiont, YLS). Driving by demand of novel population management tactics (e.g. RNAi), the importance of YLS has been studied and revealed, which greatly boosts the interest of molecular level studies related to YLS. The current study focuses on reference genes for RT-qPCR studies related to YLS. Eight previously unreported YLS genes were cloned, and their expressions were evaluated for N. lugens samples of different developmental stages and sexes, and under different nutritional conditions and temperatures. Expression stabilities were analyzed by BestKeeper, geNorm, NormFinder, ΔCt method and RefFinder. Furthermore, the selected reference genes for RT-qPCR of YLS genes were validated using targeted YLS genes that respond to different nutritional conditions (amino acid deprivation) and RNAi. The results suggest that ylsRPS15p/ylsACT are the most suitable reference genes for temporal gene expression profiling, while ylsTUB/ylsACT and ylsRPS15e/ylsGADPH are the most suitable reference gene choices for evaluating nutrition and temperature effects. Validation studies demonstrated the advantage of using endogenous YLS reference genes for YLS studies. PMID:28198810
Hamilton, P B; Stevens, J R; Gidley, J; Holz, P; Gibson, W C
2005-04-01
Little is known about the trypanosomes of indigenous Australian vertebrates and their vectors. We surveyed a range of vertebrates and blood-feeding invertebrates for trypanosomes by parasitological and PCR-based methods using primers specific to the small subunit ribosomal RNA (SSU rRNA) gene of genus Trypanosoma. Trypanosome isolates were obtained in culture from two common wombats, one swamp wallaby and an Australian bird (Strepera sp.). By PCR, blood samples from three wombats, one brush-tailed wallaby, three platypuses and a frog were positive for trypanosome DNA. All the blood-sucking invertebrates screened were negative for trypanosomes both by microscopy and PCR, except for specimens of terrestrial leeches (Haemadipsidae). Of the latter, two Micobdella sp. specimens from Victoria and 18 Philaemon sp. specimens from Queensland were positive by PCR. Four Haemadipsa zeylanica specimens from Sri Lanka and three Leiobdella jawarerensis specimens from Papua New Guinea were also PCR positive for trypanosome DNA. We sequenced the SSU rRNA and glycosomal glyceraldehyde phosphate dehydrogenase (gGAPDH) genes in order to determine the phylogenetic positions of the new vertebrate and terrestrial leech trypanosomes. In trees based on these genes, Australian vertebrate trypanosomes fell in several distinct clades, for the most part being more closely related to trypanosomes outside Australia than to each other. Two previously undescribed wallaby trypanosomes fell in a clade with Trypanosoma theileri, the cosmopolitan bovid trypanosome, and Trypanosoma cyclops from a Malaysian primate. The terrestrial leech trypanosomes were closely related to the wallaby trypanosomes, T. cyclops and a trypanosome from an Australian frog. We suggest that haemadipsid leeches may be significant and widespread vectors of trypanosomes in Australia and Asia.
Antibiotic modulation of the plasminogen binding ability of viridans group streptococci.
Teles, Cristina; Smith, Andrew; Lang, Sue
2012-01-01
The ability of viridans group streptococci to bind human plasminogen and its subsequent activation into plasmin may contribute to the pathogenesis of infective endocarditis (IE) by leading to a decreased stability of the streptococcal vegetation and facilitating dehiscence of emboli. At levels greater than or equal to their MICs, penicillin, vancomycin, and linezolid are efficacious in the treatment of streptococcal endocarditis. However, at sub-MICs, antibiotics can modulate the expression of bacterial genes, including virulence-associated genes, which can have counterproductive effects on the treatment of endocarditis. The effects of 1/8× and 1/4× MICs of penicillin, vancomycin, and linezolid on the plasminogen binding ability of IE isolates Streptococcus mitis 881/956, Streptococcus oralis 12601, and Streptococcus sanguinis 12403 were assessed phenotypically and the expression of plasminogen receptors α-enolase and glyceraldehyde 3-phosphate dehydrogenase of S. oralis 12601 when exposed to 1/4× MIC of penicillin, was analyzed through quantitative reverse transcription (qRT)-PCR. The plasminogen binding ability of S. mitis 881/956 and S. sanguinis 12403 remained unaffected by exposure to sub-MICs of all of the antibiotics tested, while that of S. oralis 12601 was significantly enhanced by all of the antibiotics tested at sub-MICs. qRT-PCR analysis of S. oralis 12601 demonstrated an upregulation of the eno and gapdh genes, indicating an overexpression of plasminogen receptors. These findings suggest that for some endocarditis isolates, the effect of antibiotic sub-MICs, in addition to a reduced antibacterial effect, may influence the clinical response to nonsurgical therapy. It remains difficult to accurately predict isolate responses to sub-MIC antimicrobials since there appears to be interspecies variation.
Oxygen dependency of germinating Brassica seeds
NASA Astrophysics Data System (ADS)
Park, Myoung Ryoul; Hasenstein, Karl H.
2016-02-01
Establishing plants in space, Moon or Mars requires adaptation to altered conditions, including reduced pressure and composition of atmospheres. To determine the oxygen requirements for seed germination, we imbibed Brassica rapa seeds under varying oxygen concentrations and profiled the transcription patterns of genes related to early metabolism such as starch degradation, glycolysis, and fermentation. We also analyzed the activity of lactate dehydrogenase (LDH) and alcohol dehydrogenase (ADH), and measured starch degradation. Partial oxygen pressure (pO2) greater than 10% resulted in normal germination (i.e., protrusion of radicle about 18 hours after imbibition) but lower pO2 delayed and reduced germination. Imbibition in an oxygen-free atmosphere for three days resulted in no germination but subsequent transfer to air initiated germination in 75% of the seeds and the root growth rate was transiently greater than in roots germinated under ambient pO2. In hypoxic seeds soluble sugars degraded faster but the content of starch after 24 h was higher than at ambient oxygen. Transcription of genes related to starch degradation, α-amylase (AMY) and Sucrose Synthase (SUS), was higher under ambient O2 than under hypoxia. Glycolysis and fermentation pathway-related genes, glucose phosphate isomerase (GPI), 6-phosphofructokinase (PFK), fructose 1,6-bisphosphate aldolase (ALD), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), pyruvate decarboxylase (PDC), LDH, and ADH, were induced by low pO2. The activity of LDH and ADH was the highest in anoxic seeds. Germination under low O2 conditions initiated ethanolic fermentation. Therefore, sufficient oxygen availability is important for germination before photosynthesis provides necessary oxygen and the determination of an oxygen carrying capacity is important for uniform growth in space conditions.
de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G
2010-09-20
Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression profile obtained using the genes suggested by the algorithms, H2B and TUA were considered as the most suitable reference genes for expression studies in E. globulus adventitious rooting. UBI and 18S were unsuitable for use as controls in qPCR related to this process. These findings will enable more accurate and reliable normalization of qPCR results for gene expression studies in this economically important woody plant, particularly related to rooting and clonal propagation.
2010-01-01
Background Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. Results By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs indentified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Conclusion Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression profile obtained using the genes suggested by the algorithms, H2B and TUA were considered as the most suitable reference genes for expression studies in E. globulus adventitious rooting. UBI and 18S were unsuitable for use as controls in qPCR related to this process. These findings will enable more accurate and reliable normalization of qPCR results for gene expression studies in this economically important woody plant, particularly related to rooting and clonal propagation. PMID:20854682
Evaluation of RNA from human trabecular bone and identification of stable reference genes.
Cepollaro, Simona; Della Bella, Elena; de Biase, Dario; Visani, Michela; Fini, Milena
2018-06-01
The isolation of good quality RNA from tissues is an essential prerequisite for gene expression analysis to study pathophysiological processes. This study evaluated the RNA isolated from human trabecular bone and defined a set of stable reference genes. After pulverization, RNA was extracted with a phenol/chloroform method and then purified using silica columns. The A260/280 ratio, A260/230 ratio, RIN, and ribosomal ratio were measured to evaluate RNA quality and integrity. Moreover, the expression of six candidates was analyzed by qPCR and different algorithms were applied to assess reference gene stability. A good purity and quality of RNA was achieved according to A260/280 and A260/230 ratios, and RIN values. TBP, YWHAZ, and PGK1 were the most stable reference genes that should be used for gene expression analysis. In summary, the method proposed is suitable for gene expression evaluation in human bone and a set of reliable reference genes has been identified. © 2017 Wiley Periodicals, Inc.
Lyu, Yuping; Wu, Xiaoqing; Ren, He; Zhou, Fangyuan; Zhou, Hongzi; Zhang, Xinjian; Yang, Hetong
2017-10-01
An appropriate reference gene is required to get reliable results from gene expression analysis by quantitative real-time reverse transcription PCR (qRT-PCR). In order to identify stable and reliable reference genes in Trichoderma afroharzianum under oxalic acid (OA) stress, six commonly used housekeeping genes, i.e., elongation factor 1, ubiquitin, ubiquitin-conjugating enzyme, glyceraldehyde-3-phosphate dehydrogenase, α-tubulin, actin, from the effective biocontrol isolate T. afroharzianum strain LTR-2 were tested for their expression during growth in liquid culture amended with OA. Four in silico programs (comparative ΔCt, NormFinder, geNorm and BestKeeper) were used to evaluate the expression stabilities of six candidate reference genes. The elongation factor 1 gene EF-1 was identified as the most stably expressed reference gene, and was used as the normalizer to quantify the expression level of the oxalate decarboxylase coding gene OXDC in T. afroharzianum strain LTR-2 under OA stress. The result showed that the expression of OXDC was significantly up-regulated as expected. This study provides an effective method to quantify expression changes of target genes in T. afroharzianum under OA stress. Copyright © 2017 Elsevier B.V. All rights reserved.
Brulle, Franck; Bernard, Fabien; Vandenbulcke, Franck; Cuny, Damien; Dumez, Sylvain
2014-04-01
Real-time quantitative PCR is nowadays a standard method to study gene expression variations in various samples and experimental conditions. However, to interpret results accurately, data normalization with appropriate reference genes appears to be crucial. The present study describes the identification and the validation of suitable reference genes in Brassica oleracea leaves. Expression stability of eight candidates was tested following drought and cold abiotic stresses by using three different softwares (BestKeeper, NormFinder and geNorm). Four genes (BolC.TUB6, BolC.SAND1, BolC.UBQ2 and BolC.TBP1) emerged as the most stable across the tested conditions. Further gene expression analysis of a drought- and a cold-responsive gene (BolC.DREB2A and BolC.ELIP, respectively), confirmed the stability and the reliability of the identified reference genes when used for normalization in the leaves of B. oleracea. These four genes were finally tested upon a benzene exposure and all appeared to be useful reference genes along this toxicological condition. These results provide a good starting point for future studies involving gene expression measurement on leaves of B. oleracea exposed to environmental modifications.
A Versatile Panel of Reference Gene Assays for the Measurement of Chicken mRNA by Quantitative PCR
Maier, Helena J.; Van Borm, Steven; Young, John R.; Fife, Mark
2016-01-01
Quantitative real-time PCR assays are widely used for the quantification of mRNA within avian experimental samples. Multiple stably-expressed reference genes, selected for the lowest variation in representative samples, can be used to control random technical variation. Reference gene assays must be reliable, have high amplification specificity and efficiency, and not produce signals from contaminating DNA. Whilst recent research papers identify specific genes that are stable in particular tissues and experimental treatments, here we describe a panel of ten avian gene primer and probe sets that can be used to identify suitable reference genes in many experimental contexts. The panel was tested with TaqMan and SYBR Green systems in two experimental scenarios: a tissue collection and virus infection of cultured fibroblasts. GeNorm and NormFinder algorithms were able to select appropriate reference gene sets in each case. We show the effects of using the selected genes on the detection of statistically significant differences in expression. The results are compared with those obtained using 28s ribosomal RNA, the present most widely accepted reference gene in chicken work, identifying circumstances where its use might provide misleading results. Methods for eliminating DNA contamination of RNA reduced, but did not completely remove, detectable DNA. We therefore attached special importance to testing each qPCR assay for absence of signal using DNA template. The assays and analyses developed here provide a useful resource for selecting reference genes for investigations of avian biology. PMID:27537060
Bioenergetics of Stromal Cells as a Predictor of Aggressive Prostate Cancer
2016-11-01
complex tissue preparations (human prostate and prostatic adenoma) and rat ventral prostate cells it was reported to exhibit high aerobic glycolysis [19...pyruvate dehydrogenase kinase), 2DG (inhibitor of hexokinase), or metformin (inhibitor of mitochondrial complex I) [41] as a therapeutic approach to... cyanide 4-(trifluoromethoxy) phenylhydrazone; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; GlyST, Glycolytic stress test; HPV, human papilloma virus
Lin, Guiting; Fandel, Thomas M; Shindel, Alan W; Wang, Guifang; Banie, Lia; Ning, Hongxiu; Lue, Tom F; Lin, Ching-Shwun
2011-07-01
To assess and compare the expression and activity of myosin light-chain kinase (MLCK) and MLC phosphatase (MLCP) in rat bladder and urethra. Bladder and urethral smooth muscles were obtained from 2-month-old female Sprague-Dawley rats. They were analysed by real-time polymerase chain reaction for the mRNA expression of MLCK and myosin phosphatase-targeting subunit of protein phosphatase type 1 (MYPT1, a subunit of MLCP). Levels of MLCK and MYPT1 mRNA expression were determined as a ratio to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The tissues were also analysed by Western blotting for MLCK and MYPT1 protein expression as a ratio to the expression of β-actin. A two-step enzymatic activity assay using phosphorylated and dephosphorylated smooth muscle myosin was used to assess MLCK and MLCP activity. MLCK mRNA expression was higher in the bladder than in the urethra [mean (sd) ratio to GAPDH: 0.26 (0.17) vs 0.14 (0.12); P = 0.09]. MYPT1 mRNA expression was significantly higher in the bladder than in the urethra [mean (sd) ratio to GAPDH: 2.31 (1.04) vs 0.56 (0.36); P = 0.001]. Expression of both MLCK and MYPT1 protein was significantly higher in the bladder compared with the urethra [mean (sd) ratio to β-actin: 1.63 (0.25) vs 0.91 (0.29) and 0.97 (0.10) vs 0.37 (0.29), respectively; both P < 0.001]. Enzymatic assay identified significantly greater MLCK activity in the bladder than in the urethra. While, MLCP activity was lower in the bladder than in the urethra. In healthy young female rats, MLCK activity is higher and MLCP activity is lower in the bladder relative to the urethra. These differences probably play a role in modulating the functional differences between bladder and urethral smooth muscle tone. © 2010 THE AUTHORS. BJU INTERNATIONAL © 2010 BJU INTERNATIONAL.
USDA-ARS?s Scientific Manuscript database
Gene transcript expression analysis is a useful tool for correlating gene activity with plant phenotype. For these studies, an appropriate reference gene is necessary to quantify the expression of target genes. Classic housekeeping genes have often been used for this purpose, but may not be consis...
Farnell, Yuhua Z; Ing, Nancy H
2003-03-01
The purpose of this study was to identify an endometrial cell line that maintained the E2 up-regulation of estrogen receptor (ER) mRNA by enhanced message stability and to assess its dependence on ER protein. Estradiol (E2) effects on gene expression were measured in three cell lines: one immortalized from sheep endometrial stroma (ST) and two from human endometrial adenocarcinomas (Ishikawa and ECC-1). E2 up-regulated ER mRNA levels in ST and Ishikawa cells, but down-regulated ER mRNA levels in ECC-1 cells. E2 up-regulated progesterone receptor (PR), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and transforming growth factor-alpha (TGF-alpha) in both Ishikawa and ECC-1 cells. The selective estrogen receptor modulator ICI 182,780 antagonized the E2-induced up-regulation of ER and/or PR mRNA levels in all three cells, while another, GW 5638, antagonized the up-regulation of PR mRNA in Ishikawa and ECC-1 cells. In mechanistic studies, E2 had no effect on ER mRNA stability in ST cells and it destabilized ER mRNA in ECC-1 cells. Thus, Ishikawa cells appear to be the most physiologically relevant cell line in which to study the up-regulation of ER mRNA levels by enhanced mRNA stability. Its antagonism by ICI 182,780 reveals that ER protein is involved in this E2 response.
Nho, Seong Won; Hikima, Jun-ichi; Cha, In Seok; Park, Seong Bin; Jang, Ho Bin; del Castillo, Carmelo S.; Kondo, Hidehiro; Hirono, Ikuo; Aoki, Takashi; Jung, Tae Sung
2011-01-01
Although Streptococcus parauberis is known as a bacterial pathogen associated with bovine udder mastitis, it has recently become one of the major causative agents of olive flounder (Paralichthys olivaceus) streptococcosis in northeast Asia, causing massive mortality resulting in severe economic losses. S. parauberis contains two serotypes, and it is likely that capsular polysaccharide antigens serve to differentiate the serotypes. In the present study, the complete genome sequence of S. parauberis (serotype I) was determined using the GS-FLX system to investigate its phylogeny, virulence factors, and antigenic proteins. S. parauberis possesses a single chromosome of 2,143,887 bp containing 1,868 predicted coding sequences (CDSs), with an average GC content of 35.6%. Whole-genome dot plot analysis and phylogenetic analysis of a 60-kDa chaperonin-encoding gene and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-encoding gene showed that the strain was evolutionarily closely related to Streptococcus uberis. S. parauberis antigenic proteins were analyzed using an immunoproteomic technique. Twenty-one antigenic protein spots were identified in S. parauberis, by reaction with an antiserum obtained from S. parauberis-challenged olive flounder. This work provides the foundation needed to understand more clearly the relationship between pathogen and host and develops new approaches toward prophylactic and therapeutic strategies to deal with streptococcosis in fish. The work also provides a better understanding of the physiology and evolution of a significant representative of the Streptococcaceae. PMID:21531805
Li, Xueling; Zhu, Min; Brasier, Allan R; Kudlicki, Andrzej S
2015-04-01
How different pathways lead to the activation of a specific transcription factor (TF) with specific effects is not fully understood. We model context-specific transcriptional regulation as a modulatory network: triplets composed of a TF, target gene, and modulator. Modulators usually affect the activity of a specific TF at the posttranscriptional level in a target gene-specific action mode. This action may be classified as enhancement, attenuation, or inversion of either activation or inhibition. As a case study, we inferred, from a large collection of expression profiles, all potential modulations of NF-κB/RelA. The predicted modulators include many proteins previously not reported as physically binding to RelA but with relevant functions, such as RNA processing, cell cycle, mitochondrion, ubiquitin-dependent proteolysis, and chromatin modification. Modulators from different processes exert specific prevalent action modes on distinct pathways. Modulators from noncoding RNA, RNA-binding proteins, TFs, and kinases modulate the NF-κB/RelA activity with specific action modes consistent with their molecular functions and modulation level. The modulatory networks of NF-κB/RelA in the context epithelial-mesenchymal transition (EMT) and burn injury have different modulators, including those involved in extracellular matrix (FBN1), cytoskeletal regulation (ACTN1), and metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), a long intergenic nonprotein coding RNA, and tumor suppression (FOXP1) for EMT, and TXNIP, GAPDH, PKM2, IFIT5, LDHA, NID1, and TPP1 for burn injury.
USDA-ARS?s Scientific Manuscript database
Gene expression analysis requires the use of reference genes in the target species. The long yellow daylily is rich in beneficial secondary metabolites and is considered as a functional vegetable. It is widely cultivated and consumed in East Asia. However, reference genes for use in RT-qPCR in this ...
Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis
2015-01-01
Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference—ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)—along with two novel candidates—HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest. PMID:25774904
Niu, Longjian; Tao, Yan-Bin; Chen, Mao-Sheng; Fu, Qiantang; Li, Chaoqiong; Dong, Yuling; Wang, Xiulan; He, Huiying; Xu, Zeng-Fu
2015-06-03
Real-time quantitative PCR (RT-qPCR) is a reliable and widely used method for gene expression analysis. The accuracy of the determination of a target gene expression level by RT-qPCR demands the use of appropriate reference genes to normalize the mRNA levels among different samples. However, suitable reference genes for RT-qPCR have not been identified in Sacha inchi (Plukenetia volubilis), a promising oilseed crop known for its polyunsaturated fatty acid (PUFA)-rich seeds. In this study, using RT-qPCR, twelve candidate reference genes were examined in seedlings and adult plants, during flower and seed development and for the entire growth cycle of Sacha inchi. Four statistical algorithms (delta cycle threshold (ΔCt), BestKeeper, geNorm, and NormFinder) were used to assess the expression stabilities of the candidate genes. The results showed that ubiquitin-conjugating enzyme (UCE), actin (ACT) and phospholipase A22 (PLA) were the most stable genes in Sacha inchi seedlings. For roots, stems, leaves, flowers, and seeds from adult plants, 30S ribosomal protein S13 (RPS13), cyclophilin (CYC) and elongation factor-1alpha (EF1α) were recommended as reference genes for RT-qPCR. During the development of reproductive organs, PLA, ACT and UCE were the optimal reference genes for flower development, whereas UCE, RPS13 and RNA polymerase II subunit (RPII) were optimal for seed development. Considering the entire growth cycle of Sacha inchi, UCE, ACT and EF1α were sufficient for the purpose of normalization. Our results provide useful guidelines for the selection of reliable reference genes for the normalization of RT-qPCR data for seedlings and adult plants, for reproductive organs, and for the entire growth cycle of Sacha inchi.
Li, Tao; Wang, Jing; Lu, Miao; Zhang, Tianyi; Qu, Xinyun; Wang, Zhezhi
2017-01-01
Due to its sensitivity and specificity, real-time quantitative PCR (qRT-PCR) is a popular technique for investigating gene expression levels in plants. Based on the Minimum Information for Publication of Real-Time Quantitative PCR Experiments (MIQE) guidelines, it is necessary to select and validate putative appropriate reference genes for qRT-PCR normalization. In the current study, three algorithms, geNorm, NormFinder, and BestKeeper, were applied to assess the expression stability of 10 candidate reference genes across five different tissues and three different abiotic stresses in Isatis indigotica Fort. Additionally, the IiYUC6 gene associated with IAA biosynthesis was applied to validate the candidate reference genes. The analysis results of the geNorm, NormFinder, and BestKeeper algorithms indicated certain differences for the different sample sets and different experiment conditions. Considering all of the algorithms, PP2A-4 and TUB4 were recommended as the most stable reference genes for total and different tissue samples, respectively. Moreover, RPL15 and PP2A-4 were considered to be the most suitable reference genes for abiotic stress treatments. The obtained experimental results might contribute to improved accuracy and credibility for the expression levels of target genes by qRT-PCR normalization in I. indigotica. PMID:28702046
Artico, Sinara; Nardeli, Sarah M; Brilhante, Osmundo; Grossi-de-Sa, Maria Fátima; Alves-Ferreira, Marcio
2010-03-21
Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1alpha5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhbetaTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in different cotton plant organs; GhACT4 and GhUBQ14 for flower development, GhACT4 and GhFBX6 for the floral organs and GhMZA and GhPTB for fruit development. We also provide the primer sequences whose performance in qPCR experiments is demonstrated. These genes will enable more accurate and reliable normalization of qPCR results for gene expression studies in this important crop, the major source of natural fiber and also an important source of edible oil. The use of bona fide reference genes allowed a detailed and accurate characterization of the temporal and spatial expression pattern of two MADS-box genes in cotton.
2010-01-01
Background Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. Results By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1α5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhβTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. Conclusion We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in different cotton plant organs; GhACT4 and GhUBQ14 for flower development, GhACT4 and GhFBX6 for the floral organs and GhMZA and GhPTB for fruit development. We also provide the primer sequences whose performance in qPCR experiments is demonstrated. These genes will enable more accurate and reliable normalization of qPCR results for gene expression studies in this important crop, the major source of natural fiber and also an important source of edible oil. The use of bona fide reference genes allowed a detailed and accurate characterization of the temporal and spatial expression pattern of two MADS-box genes in cotton. PMID:20302670
Taylor, Candy M; Jost, Ricarda; Erskine, William; Nelson, Matthew N
2016-01-01
Quantitative Reverse Transcription PCR (qRT-PCR) is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop) using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC), Helicase (HEL), and Polypyrimidine tract-binding protein (PTB)] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots) encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other potentially more suitable reference genes will be identified for this species in future.
Erskine, William; Nelson, Matthew N.
2016-01-01
Quantitative Reverse Transcription PCR (qRT-PCR) is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop) using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC), Helicase (HEL), and Polypyrimidine tract-binding protein (PTB)] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots) encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other potentially more suitable reference genes will be identified for this species in future. PMID:26872362
Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao
2013-01-01
Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.
Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao
2013-01-01
Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat. PMID:24098735
Identification of suitable reference genes in bone marrow stromal cells from osteoarthritic donors.
Schildberg, Theresa; Rauh, Juliane; Bretschneider, Henriette; Stiehler, Maik
2013-11-01
Bone marrow stromal cells (BMSCs) are key cellular components for musculoskeletal tissue engineering strategies. Furthermore, recent data suggest that BMSCs are involved in the development of Osteoarthritis (OA) being a frequently occurring degenerative joint disease. Reliable reference genes for the molecular evaluation of BMSCs derived from donors exhibiting OA as a primary co-morbidity have not been reported on yet. Hence, the aim of the study was to identify reference genes suitable for comparative gene expression analyses using OA-BMSCs. Passage 1 bone marrow derived BMSCs were isolated from n=13 patients with advanced stage idiopathic hip osteoarthritis and n=15 age-matched healthy donors. The expression of 31 putative reference genes was analyzed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using a commercially available TaqMan(®) assay. Calculating the coefficient of variation (CV), mRNA expression stability was determined and afterwards validated using geNorm and NormFinder algorithms. Importin 8 (IPO8), TATA box binding protein (TBP), and cancer susceptibility candidate 3 (CASC3) were identified as the most stable reference genes. Notably, commonly used reference genes, e.g. beta-actin (ACTB) and beta-2-microglobulin (B2M) were among the most unstable genes. For normalization of gene expression data of OA-BMSCs the combined use of IPO8, TBP, and CASC3 gene is recommended. © 2013.
Reference genes for quantitative PCR in the adipose tissue of mice with metabolic disease.
Almeida-Oliveira, Fernanda; Leandro, João G B; Ausina, Priscila; Sola-Penna, Mauro; Majerowicz, David
2017-04-01
Obesity and diabetes are metabolic diseases and they are increasing in prevalence. The dynamics of gene expression associated with these diseases is fundamental to identifying genes involved in related biological processes. qPCR is a sensitive technique for mRNA quantification and the most commonly used method in gene-expression studies. However, the reliability of these results is directly influenced by data normalization. As reference genes are the major normalization method used, this work aims to identify reference genes for qPCR in adipose tissues of mice with type-I diabetes or obesity. We selected 12 genes that are commonly used as reference genes. The expression of these genes in the adipose tissues of mice was analyzed in the context of three different experimental protocols: 1) untreated animals; 2) high-fat-diet animals; and 3) streptozotocin-treated animals. Gene-expression stability was analyzed using four different algorithms. Our data indicate that TATA-binding protein is stably expressed across adipose tissues in control animals. This gene was also a useful reference when the brown adipose tissues of control and obese mice were analyzed. The mitochondrial ATP synthase F1 complex gene exhibits stable expression in subcutaneous and perigonadal adipose tissue from control and obese mice. Moreover, this gene is the best reference for qPCR normalization in adipose tissue from streptozotocin-treated animals. These results show that there is no perfect stable gene suited for use under all experimental conditions. In conclusion, the selection of appropriate genes is a prerequisite to ensure qPCR reliability and must be performed separately for different experimental protocols. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Validating internal controls for quantitative plant gene expression studies.
Brunner, Amy M; Yakovlev, Igor A; Strauss, Steven H
2004-08-18
Real-time reverse transcription PCR (RT-PCR) has greatly improved the ease and sensitivity of quantitative gene expression studies. However, accurate measurement of gene expression with this method relies on the choice of a valid reference for data normalization. Studies rarely verify that gene expression levels for reference genes are adequately consistent among the samples used, nor compare alternative genes to assess which are most reliable for the experimental conditions analyzed. Using real-time RT-PCR to study the expression of 10 poplar (genus Populus) housekeeping genes, we demonstrate a simple method for determining the degree of stability of gene expression over a set of experimental conditions. Based on a traditional method for analyzing the stability of varieties in plant breeding, it defines measures of gene expression stability from analysis of variance (ANOVA) and linear regression. We found that the potential internal control genes differed widely in their expression stability over the different tissues, developmental stages and environmental conditions studied. Our results support that quantitative comparisons of candidate reference genes are an important part of real-time RT-PCR studies that seek to precisely evaluate variation in gene expression. The method we demonstrated facilitates statistical and graphical evaluation of gene expression stability. Selection of the best reference gene for a given set of experimental conditions should enable detection of biologically significant changes in gene expression that are too small to be revealed by less precise methods, or when highly variable reference genes are unknowingly used in real-time RT-PCR experiments.
Ermolinsky, Boris; Pacheco Otalora, Luis F.; Arshadmansab, Massoud F.; Zarei, Masoud; Garrido-Sanabria, Emilio R.
2008-01-01
Group II metabotropic glutamate (mGlu II) receptors subtype 2 and 3 (mGlu2 and mGlu3) are subtle regulators of neuronal excitability and synaptic plasticity in the hippocampus. In recent years, researchers have investigated the potential neuroprotective and anticonvulsant effects of compounds acting on mGlu II receptors. However, abnormal expression and function of mGlu2 and mGlu3 have been reported in temporal lobe epilepsy, a phenomena that may limit the therapeutic effectiveness of these potentially new antiepileptic drugs. Here, we investigated seizure-induced changes in mGlu2 and mGlu3 mRNA following pilocarpine-inducted status epilepticus (SE) and subsequent epileptogenesis. Relative changes in gene expression were assessed by comparative analysis of quantitative real-time PCR (qrtPCR) by the delta-delta CT method. Pilocarpine-treated and control rats were sacrificed at different periods (24h, 10 days, one month and more than two months) following SE. Total RNA was isolated from microdissected dentate gyrus and processed for RT-PCR and qrtPCR using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an endogenous control gene. Analysis of relative quantification (RQ) ratios of mGlu2 and mGlu3 mRNA expression revealed a significant down-regulation of both targets at 24h after SE. Gene expression partially recovered at 10 days following SE reaching control levels at one month after SE. Two month after SE, mGlu2 mRNA expression was significantly down-regulated to ~41% of control expression whereas mGlu3 mRNA was comparable to control levels. Our data indicate that mGlu2 and mGlu3 expression is dynamically down-regulated or selectively enhanced during critical periods of epileptogenesis. Seizure-induced differential dysregulation of mGlu2 and mGlu3 receptors may affect the availability of these molecular targets for therapeutic compounds in epilepsy. PMID:18585369