Sample records for region dna sequence

  1. Correlation approach to identify coding regions in DNA sequences

    NASA Technical Reports Server (NTRS)

    Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.


    Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

  2. Correlation approach to identify coding regions in DNA sequences

    NASA Technical Reports Server (NTRS)

    Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.


    Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

  3. A Fast Algorithm for Exonic Regions Prediction in DNA Sequences

    PubMed Central

    Saberkari, Hamidreza; Shamsi, Mousa; Heravi, Hamed; Sedaaghi, Mohammad Hossein


    The main purpose of this paper is to introduce a fast method for gene prediction in DNA sequences based on the period-3 property in exons. First, the symbolic DNA sequences were converted to digital signal using the electron ion interaction potential method. Then, to reduce the effect of background noise in the period-3 spectrum, we used the discrete wavelet transform at three levels and applied it on the input digital signal. Finally, the Goertzel algorithm was used to extract period-3 components in the filtered DNA sequence. The proposed algorithm leads to decrease the computational complexity and hence, increases the speed of the process. Detection of small size exons in DNA sequences, exactly, is another advantage of the algorithm. The proposed algorithm ability in exon prediction was compared with several existing methods at the nucleotide level using: (i) specificity - sensitivity values; (ii) receiver operating curves (ROC); and (iii) area under ROC curve. Simulation results confirmed that the proposed method can be used as a promising tool for exon prediction in DNA sequences. PMID:24672762

  4. Homogeneity in mitochondrial DNA control region sequences in Swedish subpopulations.


    Tillmar, Andreas O; Coble, Michael D; Wallerström, Thomas; Holmlund, Gunilla


    In order to promote mitochondrial DNA (mtDNA) testing in Sweden we have typed 296 Swedish males, which will serve as a Swedish mtDNA frequency database. The tested males were taken from seven geographically different regions representing the contemporary Swedish population. The complete mtDNA control region was typed and the Swedish population was shown to have high haplotype diversity with a random match probability of 0.5%. Almost 47% of the tested samples belonged to haplogroup H and further haplogroup comparison with worldwide populations clustered the Swedish mtDNA data together with other European populations. AMOVA analysis of the seven Swedish subregions displayed no significant maternal substructure in Sweden (F (ST) = 0.002). Our conclusion from this study is that the typed Swedish individuals serve as good representatives for a Swedish forensic mtDNA database. Some caution should, however, be taken for individuals from the northernmost part of Sweden (provinces of Norrbotten and Lapland) due to specific demographic conditions. Furthermore, our analysis of a small sample set of a Swedish Saami population confirmed earlier findings that the Swedish Saami population is an outlier among European populations.

  5. Dna Sequencing


    Tabor, Stanley; Richardson, Charles C.


    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  6. Agrobacterium T-DNA integration in Arabidopsis is correlated with DNA sequence compositions that occur frequently in gene promoter regions.


    Schneeberger, Richard G; Zhang, Ke; Tatarinova, Tatiana; Troukhan, Max; Kwok, Shing F; Drais, Josh; Klinger, Kevin; Orejudos, Francis; Macy, Kimberly; Bhakta, Amit; Burns, James; Subramanian, Gopal; Donson, Jonathan; Flavell, Richard; Feldmann, Kenneth A


    Mobile insertion elements such as transposons and T-DNA generate useful genetic variation and are important tools for functional genomics studies in plants and animals. The spectrum of mutations obtained in different systems can be highly influenced by target site preferences inherent in the mechanism of DNA integration. We investigated the target site preferences of Agrobacterium T-DNA insertions in the chromosomes of the model plant Arabidopsis thaliana. The relative frequencies of insertions in genic and intergenic regions of the genome were calculated and DNA composition features associated with the insertion site flanking sequences were identified. Insertion frequencies across the genome indicate that T-strand integration is suppressed near centromeres and rDNA loci, progressively increases towards telomeres, and is highly correlated with gene density. At the gene level, T-DNA integration events show a statistically significant preference for insertion in the 5' and 3' flanking regions of protein coding sequences as well as the promoter region of RNA polymerase I transcribed rRNA gene repeats. The increased insertion frequencies in 5' upstream regions compared to coding sequences are positively correlated with gene expression activity and DNA sequence composition. Analysis of the relationship between DNA sequence composition and gene activity further demonstrates that DNA sequences with high CG-skew ratios are consistently correlated with T-DNA insertion site preference and high gene expression. The results demonstrate genomic and gene-specific preferences for T-strand integration and suggest that DNA sequences with a pronounced transition in CG- and AT-skew ratios are preferred targets for T-DNA integration.

  7. Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations.


    Berger, C; Berger, B; Parson, W


    In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

  8. Role of DNA sequence in chromatin remodeling and the formation of nucleosome-free regions.


    Lorch, Yahli; Maier-Davis, Barbara; Kornberg, Roger D


    AT-rich DNA is concentrated in the nucleosome-free regions (NFRs) associated with transcription start sites of most genes. We tested the hypothesis that AT-rich DNA engenders NFR formation by virtue of its rigidity and consequent exclusion of nucleosomes. We found that the AT-rich sequences present in many NFRs have little effect on the stability of nucleosomes. Rather, these sequences facilitate the removal of nucleosomes by the RSC chromatin remodeling complex. RSC activity is stimulated by AT-rich sequences in nucleosomes and inhibited by competition with AT-rich DNA. RSC may remove NFR nucleosomes without effect on adjacent ORF nucleosomes. Our findings suggest that many NFRs are formed and maintained by an active mechanism involving the ATP-dependent removal of nucleosomes rather than a passive mechanism due to the intrinsic instability of nucleosomes on AT-rich DNA sequences. © 2014 Lorch et al.; Published by Cold Spring Harbor Laboratory Press.

  9. Bar-coded, multiplexed sequencing of targeted DNA regions using the Illumina Genome Analyzer.


    Szelinger, Szabolcs; Kurdoglu, Ahmet; Craig, David W


    To date, genome-wide association (GWA) studies, in which thousands of markers throughout the genome are simultaneously genotyped, have identified hundreds of loci underlying disease susceptibility. These regions typically span 5-100 kb, and resequencing efforts to identify potential functional variants within these loci represent the next logical step in the genetic characterization pipeline. Next-generation DNA sequencing technologies are, in principle, well-suited for this task, yet despite the massive sequencing capability afforded by these platforms, the present-day reality is that it remains difficult, time-consuming, and expensive to resequence large numbers of samples across moderately sized genomic regions. To address this obstacle, we developed a generalized framework for multiplexed resequencing of targeted regions of the human genome on the Illumina Genome Analyzer using degenerate, indexed DNA sequence barcodes ligated to fragmented DNA prior to sequencing. Using this method, the DNA of multiple individuals can be simultaneously sequenced at several regions. We find that achieving adequate coverage is one of the most important factors in the design of an experiment, but other key considerations include whether the objective is to discover genetic variants for genotyping later by a separate method, to genotype all identified variants by sequencing, or to exhaustively identify all common and rare variants in the region. Given the massive bandwidth of next-generation sequencing technologies and their low inherent throughput in terms of sequencing arrays per week, multiplexed sequencing using the barcoding approach offers a clear mechanism for focusing bandwidth to a smaller region across many more individuals or samples.

  10. Correcting sequencing errors in DNA coding regions using a dynamic programming approach.


    Xu, Y; Mural, R J; Uberbacher, E C


    This paper presents an algorithm for detecting and 'correcting' sequencing errors that occur in DNA coding regions. The types of sequencing errors addressed are insertions and deletions (indels) of DNA bases. The goal is to provide a capability which makes single-pass or low-redundancy sequence data more informative, reducing the need for high-redundancy sequencing for gene identification and characterization purposes. This would permit improved sequencing efficiency and reduce genome sequencing costs. The algorithm detects sequencing errors by discovering changes in the statistically preferred reading frame within a putative coding region and then inserts a number of 'neutral' bases at a perceived reading frame transition point to make the putative exon candidate frame consistent. We have implemented the algorithm as a front-end subsystem of the GRAIL DNA sequence analysis system to construct a version which is very error tolerant and also intend to use this as a testbed for further development of sequencing error-correction technology. Preliminary test results have shown the usefulness of this algorithm and also exhibited some of its weakness, providing possible directions for further improvement. On a test set consisting of 68 human DNA sequences with 1% randomly generated indels in coding regions, the algorithm detected and corrected 76% of the indels. The average distance between the position of an indel and the predicted one was 9.4 bases. With this subsystem in place, GRAIL correctly predicted 89% of the coding messages with 10% false message on the 'corrected' sequences, compared to 69% correctly predicted coding messages and 11% falsely predicted messages on the 'corrupted' sequences using standard GRAIL II method (version 1.2).(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Repetitive sequences in Eurasian lynx (Lynx lynx L.) mitochondrial DNA control region.


    Sindičić, Magda; Gomerčić, Tomislav; Galov, Ana; Polanc, Primož; Huber, Duro; Slavica, Alen


    Mitochondrial DNA (mtDNA) control region (CR) of numerous species is known to include up to five different repetitive sequences (RS1-RS5) that are found at various locations, involving motifs of different length and extensive length heteroplasmy. Two repetitive sequences (RS2 and RS3) on opposite sides of mtDNA central conserved region have been described in domestic cat (Felis catus) and some other felid species. However, the presence of repetitive sequence RS3 has not been detected in Eurasian lynx (Lynx lynx) yet. We analyzed mtDNA CR of 35 Eurasian lynx (L. lynx L.) samples to characterize repetitive sequences and to compare them with those found in other felid species. We confirmed the presence of 80 base pairs (bp) repetitive sequence (RS2) at the 5' end of the Eurasian lynx mtDNA CR L strand and for the first time we described RS3 repetitive sequence at its 3' end, consisting of an array of tandem repeats five to ten bp long. We found that felid species share similar RS3 repetitive pattern and fundamental repeat motif TACAC.

  12. Intraspecific nucleotide sequence differences in the major noncoding region of human mitochondrial DNA.

    PubMed Central

    Horai, S; Hayasaka, K


    Nucleotide sequences of the major noncoding region of human mitochondrial DNA (mtDNA) from 95 human placentas have been determined. These sequences include at least a 482-bp-long region encompassing most of the D-loop-forming region. Comparisons of these sequences with those previously determined have revealed remarkable features of nucleotide substitutions and insertion/deletion events. The nucleotide diversity among the sequences is estimated as 1.45%, which is three- to fourfold higher than the corresponding value estimated from restriction-enzyme analysis of whole mtDNA genome. A hypervariable region has also been defined. In this 14-bp region, 17 different sequences were detected. More than 97% of the base changes are transitions. A significantly nonrandom distribution of nucleotide substitutions and sequence length variations were also noted. The phylogenetic analysis indicates that diversity among the negroids is much larger than that among the caucasoids or the mongoloids. In fact, part of the negroids first diverged from other humans in the phylogenetic tree. A striking finding in the phylogenetic analysis is that the mongoloids can be separated into two distinct groups. Divergence of part of the mongoloids follows the earliest divergence of part of the negroids. The remainder of the mongoloids subsequently diverged together with the caucasoids. This observation confirmed our earlier study, which clearly demonstrated, by the restriction-enzyme analysis, existence of two distinct groups in the Japanese. Images Figure 3 PMID:2316527

  13. Correcting sequencing errors in DNA coding regions using a dynamic programming approach

    SciTech Connect

    Xu, Y.; Mural, R.J.; Uberbacher, E.C.


    This paper presents an algorithm for detecting and ``correcting`` sequencing errors that occur in DNA coding regions. The types of sequencing error addressed include insertions and deletions (indels) of DNA bases. The goal is to provide a capability which makes single-pass or low-redundancy sequence data more informative, reducing the need for high-redundancy sequencing for gene identification and characterization purposes. The algorithm detects sequencing errors by discovering changes in the statistically preferred reading frame within a putative coding region and then inserts a number of ``neutral`` bases at a perceived reading frame transition point to make the putative exon candidate frame consistent. The authors have implemented the algorithm as a front-end subsystem of the GRAIL DNA sequence analysis system to construct a version which is very error tolerant and also intend to use this as a testbed for further development of sequencing error-correction technology. On a test set consisting of 68 Human DNA sequences with 1% randomly generated indels in coding regions, the algorithm detected and corrected 76% of the indels. The average distance between the position of an indel and the predicted one was 9.4 bases. With this subsystem in place, GRAIL correctly predicted 89% of the coding messages with 10% false message on the ``corrected`` sequences, compared to 69% correctly predicted coding messages and 11% falsely predicted messages on the ``corrupted`` sequences using standard GRAIL II method. The method uses a dynamic programming algorithm, and runs in time and space linear to the size of the input sequence.

  14. Repetitive sequences in the ITS1 region of ribosomal DNA in congeneric microphallid species (Trematoda: Digenea).


    Warberg, Rikke; Jensen, K Thomas; Frydenberg, Jane


    In searching for species-specific DNA sequences of microphallid species (Digenea, Trematoda) we examined the ribosomal internal transcribed spacer regions (ITS) of three closely related species (Levinseniella group) hosted by mud snails (first intermediate host) and marine crustaceans (second intermediate host). In the ITS1 region we found consistent patterns of repeating sequences of 130 bp. Within each main repeat there was a varying number of subrepeats specific for each of the species. All repeats including subrepeats were identified by a similar starting sequence: 5'-CCTGTGG-3'. As this sequence has close resemblance to the chi sequence 5'-GCTGGTGG-3' found in phage lambda we speculate if it serves the same function as a recombination hotspot. Alternatively but less likely, it could be an inactive, mutational relic of a sequence that once served this purpose.

  15. Regions of the polytene chromosomes of Drosophila virilis carrying multiple dispersed p Dv 111 DNA sequences

    SciTech Connect

    Gubenko, I.S.; Evgen'ev, M.B.


    The cloned sequences of p Dv 111 DNA hybridized in situ with more than 170 regions of Drosophila virilis salivary gland chromosomes. Comparative autoradiography of in situ hybridization and the nature of pulse /sup 3/H-thymidine and /sup 3/H-deoxycytidine incorporation into the polytene chromosomes of D. virilis at the puparium formation stage showed that the hybridization sites of p Dv 111 are distributed not only in the heterochromatic regions but also in the euchromatic regions of the chromosomes that are not late replicating. Two distinct bands of hybridization of p Dv 111 /sup 3/H-DNA were observed in the region of the heat shock puff 20CD. The regions of the distal end of chromosome 2, in which breaks appeared during radiation-induced chromosomal rearrangements, hybridized with the p Dv 111 DNA.

  16. Genomic shotgun array: a procedure linking large-scale DNA sequencing with regional transcript mapping.


    Li, Ling-Hui; Li, Jian-Chiuan; Lin, Yung-Feng; Lin, Chung-Yen; Chen, Chung-Yung; Tsai, Shih-Feng


    To facilitate transcript mapping and to investigate alterations in genomic structure and gene expression in a defined genomic target, we developed a novel microarray-based method to detect transcriptional activity of the human chromosome 4q22-24 region. Loss of heterozygosity of human 4q22-24 is frequently observed in hepatocellular carcinoma (HCC). One hundred and eighteen well-characterized genes have been identified from this region. We took previously sequenced shotgun subclones as templates to amplify overlapping sequences for the genomic segment and constructed a chromosome-region-specific microarray. Using genomic DNA fragments as probes, we detected transcriptional activity from within this region among five different tissues. The hybridization results indicate that there are new transcripts that have not yet been identified by other methods. The existence of new transcripts encoded by genes in this region was confirmed by PCR cloning or cDNA library screening. The procedure reported here allows coupling of shotgun sequencing with transcript mapping and, potentially, detailed analysis of gene expression and chromosomal copy of the genomic sequence for the putative HCC tumor suppressor gene(s) in the 4q candidate region.

  17. Sequence polymorphism in a novel noncoding region of Pacific oyster mitochondrial DNA.


    Aranishi, Futoshi; Okimoto, Takane


    Nucleotide sequence polymorphism in a 641-bp novel major noncoding region of mitochondrial DNA (mtDNA-NC) of the Pacific oyster Crassostrea gigas was analysed for 29 cultured individuals within the Goseong population. A total of 30 variable sites were detected, and the relative frequency of nucleotide alteration was determined to be 4.68. Alterations were mostly single nucleotide substitutions. Transition, transversion, both transition and transversion, and both transversion and nucleotide deletion were observed at 18, 9, 2 and 1 sites, respectively. Among 29 specimens, 22 haplotypes were identified, and pairwise genetic diversity of haplotypes was calculated to be 0.988 from multiple sequence substitutions using the two-parameter model. A phylogenetic tree, obtained for haplotypes by the neighbor-joining method, showed a single cluster of linkages. The cluster comprised 11 haplotypes associating with 14 specimens, while the other 11 haplotypes associating with 15 specimens were scattered. This mtDNA-NC presenting a high nucleotide sequence polymorphism is a potential mtDNA control region. It therefore can serve as a genetic marker for intraspecies phylogenetic analysis of the Pacific oyster and is more useful than the less polymorphic mtDNA coding genes.

  18. Investigation of control region sequences of mtDNA in a Chinese Maonan population.


    Meng, Jing-Hua; Yao, Jun; Xing, Jia-Xin; Xuan, Jin-Feng; Wang, Bao-Jie; Ding, Mei


    DNA sequences in the control region of mitochondrial DNA (mtDNA) were investigated in 206 unrelated individuals living in Huanjiang Maonan Autonomous County in the People's Republic of China. DNA was extracted from blood-stained filter papers. Hypervariable regions, including HVI and HVII, were amplified and sequenced and sequences aligned and compared with the revised Cambridge sequence (rCRS). One hundred and seventy-two polymorphic sites were identified that defined 170 haplotypes. Of these, 143 were unique and 27 were shared by more than one individual. Genetic diversity was estimated to be 0.9977 (± 0.0008), and the random match probability was 0.71%. The proportions of macro-haplogroups R*, M*, N*, D, U, R0, L3*, and L* were 50.49%, 26.21%, 11.17%, 3.88%, 3.88%, 2.43%, 1.46%, and 0.49%, respectively. Additionally, phylogenetic comparison and principal component analysis (PCA) demonstrated that Chinese Maonans shared a close genetic relationship with the Gelao ethnic community in Laos and China. These results may be useful in future human genetic studies and forensic examinations.

  19. DNA sequence variation in the mitochondrial control region of red-backed voles (Clethrionomys).


    Matson, C W; Baker, R J


    The complete mitochondrial DNA (mtDNA) control region was sequenced for 71 individuals from five species of the rodent genus Clethrionomys both to understand patterns of variation and to explore the existence of previously described domains and other elements. Among species, the control region ranged from 942 to 971 bp in length. Our data were compatible with the proposal of three domains (extended terminal associated sequences [ETAS], central, conserved sequence blocks [CSB]) within the control region. The most conserved region in the control region was the central domain (12% of nucleotide positions variable), whereas in the ETAS and CSB domains, 22% and 40% of nucleotide positions were variable, respectively. Tandem repeats were encountered only in the ETAS domain of Clethrionomys rufocanus. This tandem repeat found in C. rufocanus was 24 bp in length and was located at the 5' end of the control region. Only two of the proposed CSB and ETAS elements appeared to be supported by our data; however, a "CSB1-like" element was also documented in the ETAS domain.

  20. Regional localization of DNA sequences on chromosome 21 using somatic cell hybrids.

    PubMed Central

    Van Keuren, M L; Watkins, P C; Drabkin, H A; Jabs, E W; Gusella, J F; Patterson, D


    We have used a panel of Chinese hamster X human somatic cell hybrids, each containing various portions of chromosome 21 as the only detectable human chromosome component, for regional mapping of cloned, chromosome 21-derived DNA sequences. Thirty unique and very low-repeat sequences were mapped to the short arm and three sections of the long arm. Three unique sequences map to the proximal part of the terminal band 21q22.3, and five to the distal part of this band. Some of these may represent parts of gene sequences that may be relevant to the pathogenesis of Down syndrome, as 21q22 is the area required to be present in triplicate for the full clinical picture. Images Fig. 1 PMID:3014865

  1. Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene.


    Cabral, D F; Santos, A; Ribeiro, M L; Mesquita, J C; Carvalho-Salles, A B; Hackel, C


    The human androgen receptor (AR) gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR) may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T) in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

  2. Identifications of captive and wild tilapia species existing in Hawaii by mitochondrial DNA control region sequence.


    Wu, Liang; Yang, Jinzeng


    The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species identification. The suspected tilapia hybrids that consist of O. niloticus

  3. Identifications of Captive and Wild Tilapia Species Existing in Hawaii by Mitochondrial DNA Control Region Sequence

    PubMed Central

    Wu, Liang; Yang, Jinzeng


    Background The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. Methodology/Principal Findings In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. Conclusions/Significance This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species

  4. Evolution of Repeated Sequence Arrays in the D-Loop Region of Bat Mitochondrial DNA

    PubMed Central

    Wilkinson, G. S.; Mayer, F.; Kerth, G.; Petri, B.


    Analysis of mitochondrial DNA control region sequences from 41 species of bats representing 11 families revealed that repeated sequence arrays near the tRNA-Pro gene are present in all vespertilionine bats. Across 18 species tandem repeats varied in size from 78 to 85 bp and contained two to nine repeats. Heteroplasmy ranged from 15% to 63%. Fewer repeats among heteroplasmic than homoplasmic individuals in a species with up to nine repeats indicates selection may act against long arrays. A lower limit of two repeats and more repeats among heteroplasmic than homoplasmic individuals in two species with few repeats suggests length mutations are biased. Significant regressions of heteroplasmy, θ and π, on repeat number further suggest that repeat duplication rate increases with repeat number. Comparison of vespertilionine bat consensus repeats to mammal control region sequences revealed that tandem repeats of similar size, sequence and number also occur in shrews, cats and bighorn sheep. The presence of two conserved protein-binding sequences in all repeat units indicates that convergent evolution has occurred by duplication of functional units. We speculate that D-loop region tandem repeats may provide signal redundancy and a primitive repair mechanism in the event of somatic mutations to these binding sites. PMID:9215906

  5. Mitochondrial DNA hypervariable region-1 sequence variation and phylogeny of the concolor gibbons, Nomascus.


    Monda, Keri; Simmons, Rachel E; Kressirer, Philipp; Su, Bing; Woodruff, David S


    The still little known concolor gibbons are represented by 14 taxa (five species, nine subspecies) distributed parapatrically in China, Myanmar, Vietnam, Laos and Cambodia. To set the stage for a phylogeographic study of the genus we examined DNA sequences from the highly variable mitochondrial hypervariable region-1 (HVR-1 or control region) in 51 animals, mostly of unknown geographic provenance. We developed gibbon-specific primers to amplify mtDNA noninvasively and obtained >477 bp sequences from 38 gibbons in North American and European zoos and >159 bp sequences from ten Chinese museum skins. In hindsight, we believe these animals represent eight of the nine nominal subspecies and four of the five nominal species. Bayesian, maximum likelihood and maximum parsimony haplotype network analyses gave concordant results and show Nomascus to be monophyletic. Significant intraspecific variation within N. leucogenys (17 haplotypes) is comparable with that reported earlier in Hylobates lar and less than half the known interspecific pairwise distances in gibbons. Sequence data support the recognition of five species (concolor, leucogenys, nasutus, gabriellae and probably hainanus) and suggest that nasutus is the oldest and leucogenys, the youngest taxon. In contrast, the subspecies N. c. furvogaster, N. c. jingdongensis, and N. leucogenys siki, are not recognizable at this otherwise informative genetic locus. These results show that HVR-1 sequence is variable enough to define evolutionarily significant units in Nomascus and, if coupled with multilocus microsatellite or SNP genotyping, more than adequate to characterize their phylogeographic history. There is an urgent need to obtain DNA from gibbons of known geographic provenance before they are extirpated to facilitate the conservation genetic management of the surviving animals.

  6. Genetic structure of Florida green turtle rookeries as indicated by mitochondrial DNA control region sequences

    USGS Publications Warehouse

    Shamblin, Brian M.; Bagley, Dean A.; Ehrhart, Llewellyn M.; Desjardin, Nicole A.; Martin, R. Erik; Hart, Kristen M.; Naro-Maciel, Eugenia; Rusenko, Kirt; Stiner, John C.; Sobel, Debra; Johnson, Chris; Wilmers, Thomas; Wright, Laura J.; Nairn, Campbell J.


    Green turtle (Chelonia mydas) nesting has increased dramatically in Florida over the past two decades, ranking the Florida nesting aggregation among the largest in the Greater Caribbean region. Individual beaches that comprise several hundred kilometers of Florida’s east coast and Keys support tens to thousands of nests annually. These beaches encompass natural to highly developed habitats, and the degree of demographic partitioning among rookeries was previously unresolved. We characterized the genetic structure of ten Florida rookeries from Cape Canaveral to the Dry Tortugas through analysis of 817 base pair mitochondrial DNA (mtDNA) control region sequences from 485 nesting turtles. Two common haplotypes, CM-A1.1 and CM-A3.1, accounted for 87 % of samples, and the haplotype frequencies were strongly partitioned by latitude along Florida’s Atlantic coast. Most genetic structure occurred between rookeries on either side of an apparent genetic break in the vicinity of the St. Lucie Inlet that separates Hutchinson Island and Jupiter Island, representing the finest scale at which mtDNA structure has been documented in marine turtle rookeries. Florida and Caribbean scale analyses of population structure support recognition of at least two management units: central eastern Florida and southern Florida. More thorough sampling and deeper sequencing are necessary to better characterize connectivity among Florida green turtle rookeries as well as between the Florida nesting aggregation and others in the Greater Caribbean region.

  7. Characterization of EBV Promoters and Coding Regions by Sequencing PCR-Amplified DNA Fragments.


    Szenthe, Kalman; Bánáti, Ferenc


    DNA sequencing approaches originally developed in two directions, the chemical degradation method and the chain-termination method. The latter one became more widespread and a huge amount of sequencing data including whole genome sequences accumulated, based on the use of capillary sequencer systems and the application of a modified chain-termination method which proved to be relatively easy, fast, and reliable. In addition, relatively long, up to 1000 bp sequences could be obtained with a single read with high per-base accuracy. Although the recent appearance of next-generation DNA sequencing (NGS) technologies enabled high-throughput and low cost analysis of DNA, the modified chain-terminating methods are often applied in research until now. In the following, we shall present the application of capillary sequencing for the sequence characterization of viral genomes in case of partial and whole genome sequencing, and demonstrate it on the BARF1 promoter of Epstein Barr virus (EBV).

  8. The next generation of target capture technologies - large DNA fragment enrichment and sequencing determines regional genomic variation of high complexity.


    Dapprich, Johannes; Ferriola, Deborah; Mackiewicz, Kate; Clark, Peter M; Rappaport, Eric; D'Arcy, Monica; Sasson, Ariella; Gai, Xiaowu; Schug, Jonathan; Kaestner, Klaus H; Monos, Dimitri


    The ability to capture and sequence large contiguous DNA fragments represents a significant advancement towards the comprehensive characterization of complex genomic regions. While emerging sequencing platforms are capable of producing several kilobases-long reads, the fragment sizes generated by current DNA target enrichment technologies remain a limiting factor, producing DNA fragments generally shorter than 1 kbp. The DNA enrichment methodology described herein, Region-Specific Extraction (RSE), produces DNA segments in excess of 20 kbp in length. Coupling this enrichment method to appropriate sequencing platforms will significantly enhance the ability to generate complete and accurate sequence characterization of any genomic region without the need for reference-based assembly. RSE is a long-range DNA target capture methodology that relies on the specific hybridization of short (20-25 base) oligonucleotide primers to selected sequence motifs within the DNA target region. These capture primers are then enzymatically extended on the 3'-end, incorporating biotinylated nucleotides into the DNA. Streptavidin-coated beads are subsequently used to pull-down the original, long DNA template molecules via the newly synthesized, biotinylated DNA that is bound to them. We demonstrate the accuracy, simplicity and utility of the RSE method by capturing and sequencing a 4 Mbp stretch of the major histocompatibility complex (MHC). Our results show an average depth of coverage of 164X for the entire MHC. This depth of coverage contributes significantly to a 99.94 % total coverage of the targeted region and to an accuracy that is over 99.99 %. RSE represents a cost-effective target enrichment method capable of producing sequencing templates in excess of 20 kbp in length. The utility of our method has been proven to generate superior coverage across the MHC as compared to other commercially available methodologies, with the added advantage of producing longer sequencing

  9. Isolation and identification of a novel tandemly repeated DNA sequence in the centromeric region of human chromosome 8.


    Lin, C C; Sasi, R; Lee, C; Fan, Y S; Court, D


    EcoRI subclones, designated as 50E1 and 50E4, were independently obtained from a cosmid clone previously mapped to the centromeric region of human chromosome 8. Southern blot hybridization analyses suggested that both subclones contain repetitive DNA sequences different from the chromosome 8 specific alphoid DNA. DNA sequence analysis of the 704 bp insert of 50E1 and the 1,962 bp insert of 50E4 revealed that both inserts contained tandemly repeated units of approximately 220 bp. Fluorescence in situ hybridization studies confirmed these two subclones to be specifically located on the centromeric region of chromosome 8. A 220 bp consensus sequence, derived from nine monomeric repeats, showed no significant homology to alphoid consensus sequences or to other currently known human centromeric DNA sequence. Furthermore, no significant homology was found with any other DNA sequence deposited in the EMBL or GenBank databases, indicating that this chromosome 8 specific repetitive DNA sequence is novel. From slot blot experiments it was estimated that 0.013% of the human genome comprises 1,750 of these monomeric repeats, residing on the centromeric region of chromosome 8 in tandem array(s).

  10. Sequence analysis of the mitochondrial DNA control region of ciscoes (genus Coregonus): taxonomic implications for the Great Lakes species flock.


    Reed, K M; Dorschner, M O; Todd, T N; Phillips, R B


    Sequence variation in the control region (D-loop) of the mitochondrial DNA (mtDNA) was examined to assess the genetic distinctiveness of the shortjaw cisco (Coregonus zenithicus). Individuals from within the Great Lakes Basin as well as inland lakes outside the basin were sampled. DNA fragments containing the entire D-loop were amplified by PCR from specimens of C. zenithicus and the related species C. artedi, C. hoyi, C. kiyi, and C. clupeaformis. DNA sequence analysis revealed high similarity within and among species and shared polymorphism for length variants. Based on this analysis, the shortjaw cisco is not genetically distinct from other cisco species.

  11. DNA sequence of the mat2,3 region of Schizosaccharomyces kambucha shares high homology with the corresponding sequence from Sz. pombe.


    Singh, Gurjeet; Klar, Amar J S


    To define conserved sequences for mat1 imprinting and silencing of the mat2,3 region of Schizosaccharomyces pombe, we determined the DNA sequence of the cognate region (mat2,3 region) of another fission yeast, Sz. kambucha, a yeast species isolated from Kambucha tea mix. The entire mat2,3 region shows more than 98% identity between the two species. Sequence similarity is even higher (99.3%) for mating-type cassettes; deduced amino acid sequences of three of the four Mat peptides (Pi, Pc and Mi) are identical between the two species, while the fourth (Mc) has a single amino acid polymorphism. Comparison of the sequence motif of the imprint site essential for mat1 switching shows that mat-P of Sz. kambucha has a sequence identical to the conserved motif present in Sz. pombe. However, this sequence motif of nine bases differs by one base for mat-M of Sz. kambucha. The sequence of the K region shows about 98% identity between the two species, with the cenH region showing 98.3% homology. Thus, the arrangement of the mat2,3 region in both yeasts is conserved and shows 1-2% nucleotide sequence variation throughout the region. The DNA sequence of the mat2,3 region from Sz. kambucha has been submitted to GenBank under Accession No. AY271822. Copyright 2003 John Wiley & Sons, Ltd.

  12. Population Genetic Analysis of Lobelia rhynchopetalum Hemsl. (Campanulaceae) Using DNA Sequences from ITS and Eight Chloroplast DNA Regions

    PubMed Central

    Geleta, Mulatu; Bryngelsson, Tomas


    DNA sequence data from the internal transcribed spacer of nuclear ribosomal DNA and eight chloroplast DNA regions were used to investigate haplotypic variation and population genetic structure of the Afroalpine giant lobelia, Lobelia rhynchopetalum. The study was based on eight populations sampled from two mountain systems in Ethiopia. A total of 20 variable sites were obtained, which resulted in 13 unique haplotypes and an overall nucleotide diversity (ND) of 0.281 ± 0.15 and gene diversity (GD) of 0.85 ± 0.04. Analysis of molecular variance (AMOVA) revealed a highly significant variation (P < 0.001) among populations (FST), and phylogenetic analysis revealed that populations from the two mountain systems formed their own distinct clade with >90% bootstrap support. Each population should be regarded as a significant unit for conservation of this species. The primers designed for this study can be applied to any Lobelia and other closely related species for population genetics and phylogenetic studies. PMID:22272170

  13. Sequence analysis of mtDNA COI barcode region revealed three haplotypes within Culex pipiens assemblage.


    Koosha, Mona; Oshaghi, Mohammad Ali; Sedaghat, Mohammad Mehdi; Vatandoost, Hassan; Azari-Hamidian, Shahyad; Abai, Mohammad Reza; Hanafi-Bojd, Ahmad Ali; Mohtarami, Fatemeh


    Members of the Culex (Culex) pipiens assemblage are known vectors of deadly encephalitides, periodic filariasis, and West Nile virus throughout the world. However, members of this assemblage are morphologically indistinguishable or hard to distinguish and play distinct roles in transmission of the diseases. The current study aimed to provide further evidence on utility of the two most popular nuclear (ITS2-rDNA) and mitochondrial (COI barcode region) genetic markers to identify members of the assemblage. Culex pipiens assemblage specimens from different climate zones of Iran were collected and identified to species level based on morphological characteristics. Nucleotide sequences of the loci for the specimens plus available data in the GenBank were analyzed to find species specific genetic structures useful for diagnosis purposes. ITS2 region was highly divergent within species or populations suggesting lack of consistency as a reliable molecular marker. In contrast, sequence analysis of 710 bp of COI gene revealed three fixed haplotypes named here "C, T, H" within the assemblage which can be distinguished by HaeIII and AluI enzymes. There were a correlation between the haplotypes and the world climate regions, where the haplotypes H/T and C are present mainly in temperate and tropical regions of the world, respectively. In the New world, Australia, and Japan only haplotype H is found. In conjunction between tropical and temperate regions such Iran, China, and Turkey, a mix of C/H or C/H/T are present. Although, the haplotypes are not strictly species-specific, however, Cx. quinquefasciatus was mainly of haplotype C. Due to the lack of mating barrier and questionable taxonomic situation of the complex members, the mentioned haplotypes in combination with other morphological and molecular characters might be used to address the genetic structure of the studied populations. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Population genetics of shortnose sturgeon Acipenser brevirostrum based on mitochondrial DNA control region sequences.


    Grunwald, C; Stabile, J; Waldman, J R; Gross, R; Wirgin, I


    Shortnose sturgeon is an anadromous North American acipenserid that since 1973 has been designated as federally endangered in US waters. Historically, shortnose sturgeon occurred in as many as 19 rivers from the St. John River, NB, to the St. Johns River, FL, and these populations ranged in census size from 10(1) to 10(4), but little is known of their population structure or levels of gene flow. We used the polymerase chain reaction (PCR) and direct sequence analysis of a 440 bp portion of the mitochondrial DNA (mtDNA) control region to address these issues and to compare haplotype diversity with population size. Twenty-nine mtDNA nucleotide-substitution haplotypes were revealed among 275 specimens from 11 rivers and estuaries. Additionally, mtDNA length variation (6 haplotypes) and heteroplasmy (2-5 haplotypes for some individuals) were found. Significant genetic differentiation (P < 0.05) of mtDNA nucleotide-substitution haplotypes and length-variant haplotypes was observed among populations from all rivers and estuaries surveyed with the exception of the Delaware River and Chesapeake Bay collections. Significant haplotype differentiation was even observed between samples from two rivers (Kennebec and Androscoggin) within the Kennebec River drainage. The absence of haplotype frequency differences between samples from the Delaware River and Chesapeake Bay reflects a probable current absence of spawning within the Chesapeake Bay system and immigration of fish from the adjoining Delaware River. Haplotypic diversity indices ranged between 0.817 and 0.641; no relationship (P > 0.05) was found between haplotype diversity and census size. Gene flow estimates among populations were often low (< 2.0), but were generally higher at the latitudinal extremes of their distribution. A moderate level of haplotype diversity and a high percentage (37.9%) of haplotypes unique to the northern, once-glaciated region suggests that northern populations survived the Pleistocene in a

  15. Minimal intraspecific variation in the sequence of the transcribed spacer regions of the ribosomal DNA of lake trout (Salvelinus namaycush).


    Zhuo, L; Sajdak, S L; Phillips, R B


    Intraspecific variation in the sequence of the transcribed spacer regions of the ribosomal DNA (rDNA) in lake trout was examined by restriction mapping and sequencing of these regions amplified by the polymerase chain reaction. The length of the first internal transcribed spacer region (ITS-1) was 566 bases and the second internal transcribed spacer region (ITS-2) was 368 bases in lake trout. When the 1.4-kb region including the ITS-1, the 5.8S coding region, and the ITS-2 was amplified from 12 individuals from four populations and digested with eight different enzymes only one intraindividual polymorphism was found that occurred in each population. When the amplified ITS-1 region was sequenced from an additional 10 individuals from five populations, no interindividual variation was found in the sequence. A 6-kb portion of the rDNA repeat unit including 1.6 kb of the 18S coding region, the 5' external spacer region (5' ETS), and part of the adjacent intergenic spacer was cloned and a restriction map was prepared for these regions in lake trout. No intraspecific variation was found in the region adjacent to the 18S rDNA, which includes the 5' ETS, although intraspecific and intraindividual length variation was found in the intergenic spacer region 3-6 kb from the 18S. Sequencing of a 609-b segment of the 5' ETS adjacent to the 18S coding region revealed the presence of two 41-b repeats. The 198-b sequence between the repeats had some similarity to the 18S coding region of other fishes. Primers were designed for amplification of 559 b of the 5' ETS using the polymerase chain reaction.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. The InDeVal insertion/deletion evaluation tool: a program for finding target regions in DNA sequences and for aiding in sequence comparison.


    Stoneberg Holt, Sierra D; Holt, Jason A


    The program InDeVal was originally developed to help researchers find known regions of insertion/deletion activity (with the exception of isolated single-base indels) in newly determined Poaceae trnL-F sequences and compare them with 533 previously determined sequences. It is supplied with input files designed for this purpose. More broadly, the program is applicable for finding specific target regions (referred to as "variable regions") in DNA sequence. A variable region is any specific sequence fragment of interest, such as an indel region, a codon or codons, or sequence coding for a particular RNA secondary structure. InDeVal input is DNA sequence and a template file (sequence flanking each variable region). Additional files contain the variable regions and user-defined messages about the sequence found within them (e.g., taxa sharing each of the different indel patterns).Variable regions are found by determining the position of flanking sequence (referred to as "conserved regions") using the LPAM (Length-Preserving Alignment Method) algorithm. This algorithm was designed for InDeVal and is described here for the first time. InDeVal output is an interactive display of the analyzed sequence, broken into user-defined units. Once the user is satisfied with the organization of the display, the information can be exported to an annotated text file. InDeVal can find multiple variable regions simultaneously (28 indel regions in the Poaceae trnL-F files) and display user-selected messages specific to the sequence variants found. InDeVal output is designed to facilitate comparison between the analyzed sequence and previously evaluated sequence. The program's sensitivity to different levels of nucleotide and/or length variation in conserved regions can be adjusted. InDeVal is currently available for Windows in Additional file 1 or from

  17. The InDeVal insertion/deletion evaluation tool: a program for finding target regions in DNA sequences and for aiding in sequence comparison

    PubMed Central

    Stoneberg Holt, Sierra D; Holt, Jason A


    Background The program InDeVal was originally developed to help researchers find known regions of insertion/deletion activity (with the exception of isolated single-base indels) in newly determined Poaceae trnL-F sequences and compare them with 533 previously determined sequences. It is supplied with input files designed for this purpose. More broadly, the program is applicable for finding specific target regions (referred to as "variable regions") in DNA sequence. A variable region is any specific sequence fragment of interest, such as an indel region, a codon or codons, or sequence coding for a particular RNA secondary structure. Results InDeVal input is DNA sequence and a template file (sequence flanking each variable region). Additional files contain the variable regions and user-defined messages about the sequence found within them (e.g., taxa sharing each of the different indel patterns). Variable regions are found by determining the position of flanking sequence (referred to as "conserved regions") using the LPAM (Length-Preserving Alignment Method) algorithm. This algorithm was designed for InDeVal and is described here for the first time. InDeVal output is an interactive display of the analyzed sequence, broken into user-defined units. Once the user is satisfied with the organization of the display, the information can be exported to an annotated text file. Conclusions InDeVal can find multiple variable regions simultaneously (28 indel regions in the Poaceae trnL-F files) and display user-selected messages specific to the sequence variants found. InDeVal output is designed to facilitate comparison between the analyzed sequence and previously evaluated sequence. The program's sensitivity to different levels of nucleotide and/or length variation in conserved regions can be adjusted. InDeVal is currently available for Windows in Additional file 1 or from . PMID:15516260

  18. Molecular phylogenetic analysis of Indonesia Solanaceae based on DNA sequences of internal transcribed spacer region

    NASA Astrophysics Data System (ADS)

    Hidayat, Topik; Priyandoko, Didik; Islami, Dina Karina; Wardiny, Putri Yunitha


    Solanaceae is one of largest family in Angiosperm group with highly diverse in morphological character. In Indonesia, this group of plant is very popular due to its usefulness as food, ornamental and medicinal plants. However, investigation on phylogenetic relationship among the member of this family in Indonesia remains less attention. The purpose of this study was to evaluate the phylogenetics relationship of the family especially distributed in Indonesia. DNA sequences of Internal Transcribed Spacer (ITS) region of 19 species of Solanaceae and three species of outgroup, which belongs to family Convolvulaceae, Apocynaceae, and Plantaginaceae, were isolated, amplified, and sequenced. Phylogenetic tree analysis based on parsimony method was conducted with using data derived from the ITS-1, 5.8S, and ITS-2, separately, and the combination of all. Results indicated that the phylogenetic tree derived from the combined data established better pattern of relationship than separate data. Thus, three major groups were revealed. Group 1 consists of tribe Datureae, Cestreae, and Petunieae, whereas group 2 is member of tribe Physaleae. Group 3 belongs to tribe Solaneae. The use of the ITS region as a molecular markers, in general, support the global Solanaceae relationship that has been previously reported.

  19. In search of coding and non-coding regions of DNA sequences based on balanced estimation of diffusion entropy.


    Zhang, Jin; Zhang, Wenqing; Yang, Huijie


    Identification of coding regions in DNA sequences remains challenging. Various methods have been proposed, but these are limited by species-dependence and the need for adequate training sets. The elements in DNA coding regions are known to be distributed in a quasi-random way, while those in non-coding regions have typical similar structures. For short sequences, these statistical characteristics cannot be extracted correctly and cannot even be detected. This paper introduces a new way to solve the problem: balanced estimation of diffusion entropy (BEDE).

  20. Primers are designed for amplification and direct sequencing of ITS region of rDNA from Myxomycetes.


    Martín, María P; Lado, Carlos; Johansen, Steinar


    Four new primers were designed, based on comparison of Physarum polycephalum sequences retrieved from Genbank (primers PHYS-5 and PHYS-4) and our own sequences (primers PHYS-3 and PHYS-2), to amplify the ITS regions of rDNA, including the 5.8S gene segment from Lamproderma species. Sequencing analysis shows that Lamproderma contains ITS1-5.8S-ITS2 regions of approximately 900 bp, which is similar in size to most eukaryotes. However, the corresponding region in another common myxomycete, Fuligo septica, is more than 2000 bp due to the presence of large direct-repeat motifs in ITS1. Myxomycete rDNA ITS regions are interesting both as phylogenetic markers in taxonomic studies and as model sequences for molecular evolution.

  1. Phylogenetic relationships in subfamily Tillandsioideae (Bromeliaceae) based on DNA sequence data from seven plastid regions.


    Barfuss, Michael H J; Samuel, Rosabelle; Till, Walter; Stuessy, Tod F


    Molecular phylogenetic studies of seven plastid DNA regions were used to resolve circumscriptions at generic and infrageneric levels in subfamily Tillandsioideae of Bromeliaceae. One hundred and ten tillandsioid samples were analyzed, encompassing 10 genera, 104 species, and two cultivars. Two species of Bromelioideae, eight species of the polymorphic Pitcairnioideae, and two species of Rapateaceae were selected as outgroups. Parsimony analysis was based on sequence variation of five noncoding (partial 5' and 3' trnK intron, rps16 intron, trnL intron, trnL-trnF intergenic spacer, atpB-rbcL intergenic spacer) and two coding plastid regions (rbcL and matK). Phylogenetic analyses of individual regions produced congruent, but mostly weakly supported or unresolved clades. Results of the combined data set, however, clearly show that subfamily Tillandsioideae is monophyletic. The earliest divergence separates a lineage comprised of Glomeropitcairnia and Catopsis from the "core" tillandsioids. In their present circumscriptions, genera Vriesea and Tillandsia, and their subgenera or sections, as well as Guzmania and Mezobromelia, are poly- and/or paraphyletic. Genera Alcantarea, Werauhia, Racinaea, and Viridantha appear monophyletic, but separation of these from Vriesea and Tillandsia makes the remainder paraphyletic. Nevertheless, Tillandsioideae separates into four main clades, which are proposed as tribes, viz., Catopsideae, Glomeropitcairnieae, Vrieseeae, and Tillandsieae.

  2. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E


    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  3. Haplogroup Classification of Korean Cattle Breeds Based on Sequence Variations of mtDNA Control Region.


    Kim, Jae-Hwan; Lee, Seong-Su; Kim, Seung Chang; Choi, Seong-Bok; Kim, Su-Hyun; Lee, Chang Woo; Jung, Kyoung-Sub; Kim, Eun Sung; Choi, Young-Sun; Kim, Sung-Bok; Kim, Woo Hyun; Cho, Chang-Yeon


    Many studies have reported the frequency and distribution of haplogroups among various cattle breeds for verification of their origins and genetic diversity. In this study, 318 complete sequences of the mtDNA control region from four Korean cattle breeds were used for haplogroup classification. 71 polymorphic sites and 66 haplotypes were found in these sequences. Consistent with the genetic patterns in previous reports, four haplogroups (T1, T2, T3, and T4) were identified in Korean cattle breeds. In addition, T1a, T3a, and T3b sub-haplogroups were classified. In the phylogenetic tree, each haplogroup formed an independent cluster. The frequencies of T3, T4, T1 (containing T1a), and T2 were 66%, 16%, 10%, and 8%, respectively. Especially, the T1 haplogroup contained only one haplotype and a sample. All four haplogroups were found in Chikso, Jeju black and Hanwoo. However, only the T3 and T4 haplogroups appeared in Heugu, and most Chikso populations showed a partial of four haplogroups. These results will be useful for stable conservation and efficient management of Korean cattle breeds.

  4. Nucleotide sequence of the transforming early region E1b of adenovirus type 12 DNA: structure and gene organization, and comparison with those of adenovirus type 5 DNA.

    PubMed Central

    Kimura, T; Sawada, Y; Shinawawa, M; Shimizu, Y; Shiroki, K; Shimojo, H; Sugisaki, H; Takanami, M; Uemizu, Y; Fujinaga, K


    The nucleotide sequence of the entire transforming early region of E1b of the highly oncogenic adenovirus type 12 (Ad12) DNA has been determined. The total sequence (3860 base pairs) encompasses the entire transforming early region E1 of Ad12 DNA. From the sequence for the E1b region of Ad12, and the transcription map of the E1b region (1, 2, 3, and this paper) the structure and gene organization of the early region E1b of Ad12 DNA were analyzed and compared with those of the E1b region in the non-oncogenic Ad5 DNA (4, 5). Most of the sequences in the E1b region of Ad12 was highly homologous to that of Ad5. It is predicted that the Ad12 region E1b codes for polypeptides of 53.9, 19.1, and 8.9 kd. This situation is identical with that of the Ad5 region E1b which codes for polypeptides of 54.9, 20.6, and 8.3 kd. The function of these predicted polypeptides encoded by the E1b regions in cell transformation is discussed. PMID:6275367

  5. Interpretation guidelines of mtDNA control region sequence electropherograms in forensic genetics.


    Marquez, Manuel Crespillo


    Forensic mitochondrial DNA (mtDNA) analysis is a complementary technique to forensic nuclear DNA (nDNA) and trace evidence analysis. Its use has been accepted by the vast majority of courts of law around the world. However for the forensic community it is crucial to employ standardized methods and procedures to guaranty the quality of the results obtained in court. In this chapter, we describe the most important aspects regarding the interpretation and assessment of mtDNA analysis, and offer a simple guide which places particular emphasis on those aspects that can impact the final interpretation of the results. These include the criteria for authenticating a sequence excluding the contaminant origin, defining the quality of a sequence, editing procedure, alignment criteria for searching the databases, and the statistical evaluation of matches. It is not easy to establish a single guide to interpretation for mtDNA analysis; however, it is important to understand all variables that may in some way affect the final conclusion in the context of a forensic case. As a general rule, laboratories should be cautious before issuing the final conclusion of an mtDNA analysis, and consider any significant limitations regarding current understanding of specific aspects of the mtDNA molecule.

  6. Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.


    Nagar, Anurag; Hahsler, Michael


    Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to

  7. High-quality mtDNA control region sequences from 680 individuals sampled across the Netherlands to establish a national forensic mtDNA reference database.


    Chaitanya, Lakshmi; van Oven, Mannis; Brauer, Silke; Zimmermann, Bettina; Huber, Gabriela; Xavier, Catarina; Parson, Walther; de Knijff, Peter; Kayser, Manfred


    The use of mitochondrial DNA (mtDNA) for maternal lineage identification often marks the last resort when investigating forensic and missing-person cases involving highly degraded biological materials. As with all comparative DNA testing, a match between evidence and reference sample requires a statistical interpretation, for which high-quality mtDNA population frequency data are crucial. Here, we determined, under high quality standards, the complete mtDNA control-region sequences of 680 individuals from across the Netherlands sampled at 54 sites, covering the entire country with 10 geographic sub-regions. The complete mtDNA control region (nucleotide positions 16,024-16,569 and 1-576) was amplified with two PCR primers and sequenced with ten different sequencing primers using the EMPOP protocol. Haplotype diversity of the entire sample set was very high at 99.63% and, accordingly, the random-match probability was 0.37%. No population substructure within the Netherlands was detected with our dataset. Phylogenetic analyses were performed to determine mtDNA haplogroups. Inclusion of these high-quality data in the EMPOP database (accession number: EMP00666) will improve its overall data content and geographic coverage in the interest of all EMPOP users worldwide. Moreover, this dataset will serve as (the start of) a national reference database for mtDNA applications in forensic and missing person casework in the Netherlands. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Evaluation of Protein A Gene Polymorphic Region DNA Sequencing for Typing of Staphylococcus aureus Strains

    PubMed Central

    Shopsin, B.; Gomez, M.; Montgomery, S. O.; Smith, D. H.; Waddington, M.; Dodge, D. E.; Bost, D. A.; Riehman, M.; Naidich, S.; Kreiswirth, B. N.


    Three hundred and twenty isolates of Staphylococcus aureus were typed by DNA sequence analysis of the X region of the protein A gene (spa). spa typing was compared to both phenotypic and molecular techniques for the ability to differentiate and categorize S. aureus strains into groups that correlate with epidemiological information. Two previously characterized study populations were examined. A collection of 59 isolates (F. C. Tenover, R. Arbeit, G. Archer, J. Biddle, S. Byrne, R. Goering, G. Hancock, G. A. Hébert, B. Hill, R. Hollis, W. R. Jarvis, B. Kreiswirth, W. Eisner, J. Maslow, L. K. McDougal, J. M. Miller, M. Mulligan, and M. A. Pfaller, J. Clin. Microbiol. 32:407–415, 1994) from the Centers for Disease Control and Prevention (CDC) was used to test for the ability to discriminate outbreak from epidemiologically unrelated strains. A separate collection of 261 isolates form a multicenter study (R. B. Roberts, A. de Lencastre, W. Eisner, E. P. Severina, B. Shopsin, B. N. Kreiswirth, and A. Tomasz, J. Infect. Dis. 178:164–171, 1998) of methicillin-resistant S. aureus in New York City (NYC) was used to compare the ability of spa typing to group strains along clonal lines to that of the combination of pulsed-field gel electrophoresis and Southern hybridization. In the 320 isolates studied, spa typing identified 24 distinct repeat types and 33 different strain types. spa typing distinguished 27 of 29 related strains and did not provide a unique fingerprint for 4 unrelated strains from the four outbreaks of the CDC collection. In the NYC collection, spa typing provided a clonal assignment for 185 of 195 strains within the five major groups previously described. spa sequencing appears to be a highly effective rapid typing tool for S. aureus that, despite some expense of specificity, has significant advantages in terms of speed, ease of use, ease of interpretation, and standardization among laboratories. PMID:10523551

  9. Characterization and Sequence Variation in the rDNA Region of Six Nematode Species of the Genus Longidorus (Nematoda)

    PubMed Central

    De Luca, F.; Reyes, A.; Grunder, J.; Kunz, P.; Agostinelli, A.; De Giorgi, C.; Lamberti, F.


    Total DNA was isolated from individual nematodes of the species Longidorus helveticus, L. macrosoma, L. arthensis, L. profundorum, L. elongatus, and L. raskii collected in Switzerland. The ITS region and D1-D2 expansion segments of the 26S rDNA were amplified and cloned. The sequences obtained were aligned in order to investigate sequence diversity and to infer the phylogenetic relationships among the six Longidorus species. D1-D2 sequences were more conserved than the ITS sequences that varied widely in primary structure and length, and no consensus was observed. Phylogenetic analyses using the neighbor-joining, maximum parsimony and maximum likelihood methods were performed with three different sequence data sets: ITS1-ITS2, 5.8S-D1-D2, and combining ITS1-ITS2+5.8S-D1-D2 sequences. All multiple alignments yielded similar basic trees supporting the existence of the six species established using morphological characters. These sequence data also provided evidence that the different regions of the rDNA are characterized by different evolution rates and by different factors associated with the generation of extreme size variation. PMID:19262800

  10. DNA sequencing conference, 2

    SciTech Connect

    Cook-Deegan, R.M.; Venter, J.C.; Gilbert, W.; Mulligan, J.; Mansfield, B.K.


    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  11. Massively parallel sequencing of the entire control region and targeted coding region SNPs of degraded mtDNA using a simplified library preparation method.


    Lee, Eun Young; Lee, Hwan Young; Oh, Se Yoon; Jung, Sang-Eun; Yang, In Seok; Lee, Yang-Han; Yang, Woo Ick; Shin, Kyoung-Jin


    The application of next-generation sequencing (NGS) to forensic genetics is being explored by an increasing number of laboratories because of the potential of high-throughput sequencing for recovering genetic information from multiple markers and multiple individuals in a single run. A cumbersome and technically challenging library construction process is required for NGS. In this study, we propose a simplified library preparation method for mitochondrial DNA (mtDNA) analysis that involves two rounds of PCR amplification. In the first-round of multiplex PCR, six fragments covering the entire mtDNA control region and 22 fragments covering interspersed single nucleotide polymorphisms (SNPs) in the coding region that can be used to determine global haplogroups and East Asian haplogroups were amplified using template-specific primers with read sequences. In the following step, indices and platform-specific sequences for the MiSeq(®) system (Illumina) were added by PCR. The barcoded library produced using this simplified workflow was successfully sequenced on the MiSeq system using the MiSeq Reagent Nano Kit v2. A total of 0.4 GB of sequences, 80.6% with base quality of >Q30, were obtained from 12 degraded DNA samples and mapped to the revised Cambridge Reference Sequence (rCRS). A relatively even read count was obtained for all amplicons, with an average coverage of 5200 × and a less than three-fold read count difference between amplicons per sample. Control region sequences were successfully determined, and all samples were assigned to the relevant haplogroups. In addition, enhanced discrimination was observed by adding coding region SNPs to the control region in in silico analysis. Because the developed multiplex PCR system amplifies small-sized amplicons (<250 bp), NGS analysis using the library preparation method described here allows mtDNA analysis using highly degraded DNA samples. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Sequence-specific binding of glucocorticoid receptor to MTV DNA at sites within and upstream of the transcribed region.


    Payvar, F; DeFranco, D; Firestone, G L; Edgar, B; Wrange, O; Okret, S; Gustafsson, J A; Yamamoto, K R


    Glucocorticoid receptor protein stimulates transcription initiation within murine mammary tumor virus (MTV) DNA sequences in vivo, and interacts selectively with MTV DNA in vitro. We mapped and compared five regions of MTV DNA that are bound specifically by purified receptor; one resides upstream of the transcription start site, and the others are distributed within transcribed sequences between 4 and 8 kb from the initiation site. Each region contains at least two strong binding sites for receptor, which itself appears to be a tetramer of 94,000 dalton hormone-binding subunits. Three of the five binding regions contain nine nuclease footprints that lack extensive homology, although a family of related octanucleotides can be discerned. Receptor interacts with the different regions with similar efficiencies, suggesting that receptor affinity for upstream and internal regions may differ by less than one order of magnitude. Moreover, each region appears to be bound independent of the others. A restriction fragment containing four footprint sequences from one of the regions has previously been shown to act in vivo as a receptor-dependent transcriptional enhancer element, implying that the binding sites detected in vitro may be biologically functional.

  13. Sequence analysis of the mitochondrial DNA control region of ciscoes (genus Coregonus): Taxonomic implications for the Great Lakes species flock

    USGS Publications Warehouse

    Reed, Kent M.; Dorschner, Michael O.; Todd, Thomas N.; Phillips, Ruth B.


    Sequence variation in the control region (D-loop) of the mitochondrial DNA (mtDNA) was examined to assess the genetic distinctiveness of the shortjaw cisco (Coregonus zenithicus). Individuals from within the Great Lakes Basin as well as inland lakes outside the basin were sampled. DNA fragments containing the entire D-loop were amplified by PCR from specimens ofC. zenithicus and the related species C. artedi, C. hoyi, C. kiyi, and C. clupeaformis. DNA sequence analysis revealed high similarity within and among species and shared polymorphism for length variants. Based on this analysis, the shortjaw cisco is not genetically distinct from other cisco species.

  14. Chromosome specific repetitive DNA sequences


    Moyzis, Robert K.; Meyne, Julianne


    A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

  15. Automated DNA Sequencing System

    SciTech Connect

    Armstrong, G.A.; Ekkebus, C.P.; Hauser, L.J.; Kress, R.L.; Mural, R.J.


    Oak Ridge National Laboratory (ORNL) is developing a core DNA sequencing facility to support biological research endeavors at ORNL and to conduct basic sequencing automation research. This facility is novel because its development is based on existing standard biology laboratory equipment; thus, the development process is of interest to the many small laboratories trying to use automation to control costs and increase throughput. Before automation, biology Laboratory personnel purified DNA, completed cycle sequencing, and prepared 96-well sample plates with commercially available hardware designed specifically for each step in the process. Following purification and thermal cycling, an automated sequencing machine was used for the sequencing. A technician handled all movement of the 96-well sample plates between machines. To automate the process, ORNL is adding a CRS Robotics A- 465 arm, ABI 377 sequencing machine, automated centrifuge, automated refrigerator, and possibly an automated SpeedVac. The entire system will be integrated with one central controller that will direct each machine and the robot. The goal of this system is to completely automate the sequencing procedure from bacterial cell samples through ready-to-be-sequenced DNA and ultimately to completed sequence. The system will be flexible and will accommodate different chemistries than existing automated sequencing lines. The system will be expanded in the future to include colony picking and/or actual sequencing. This discrete event, DNA sequencing system will demonstrate that smaller sequencing labs can achieve cost-effective the laboratory grow.

  16. Polymorphism in the bovine BOLA-DRB3 upstream regulatory regions detected through PCR-SSCP and DNA sequencing.


    Ripoli, M V; Peral-García, P; Dulout, F N; Giovambattista, G


    In the present work, we describe through polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing the polymorphism within the URR-BoLA-DRB3 in 15 cattle breeds. In total, seven PCR-SSCP defined alleles were detected. The alignment of studied sequences showed six polymorphic sites (four transitions, one transversion and one deletion) in the interconsensus regions of the BoLA-DRB3 upstream regulatory region (URR), while the consensus boxes were invariant. Five out of six detected polymorphic sites were of one nucleotide substitution in the interconsensus regions. It is expected that these mutations do not affect significantly the level of expression. In contrast, the deletion observed in the sequence between CCAAT and TATA boxes could have some effect on affinity interactions between the promoter region and the transcription factors. The URR-BoLA-DRB3 DNA analyzed sequences showed moderate level of nucleotide diversity, high level of identity among them and were grouped in the same clade in the phylogenetic tree. In addition, the phylogenetic tree, the similarity analysis and the sequence structure confirmed that the fragment analyzed in this study corresponds to the URR-BoLA-DRB3. The functional role of the observed polymorphic sites among the regulatory motifs in bovine needs to be analyzed and confirmed by means of gene expression assays.

  17. The 5'-flanking regions of three pea legumin genes: comparison of the DNA sequences.

    PubMed Central

    Lycett, G W; Croy, R R; Shirsat, A H; Richards, D M; Boulter, D


    Approximately 1200 nucleotides of sequence data from the promoter and 5'-flanking regions of each of three pea (Pisum sativum L.) legumin genes (legA, legB and legC) are presented. The promoter regions of all three genes were found to be identical including the "TATA box", and "CAAT box', and sequences showing homology to the SV40 enhancers. The legA sequence begins to diverge from the others about 300bp from the start codon, whereas the other two genes remain identical for another 550bp. The regions of partial homology exhibit deletions or insertions and some short, comparatively well conserved sequences. The significance of these features is discussed in terms of evolutionary mechanisms and their possible functional roles. The legC gene contains a region that may potentially form either of two mutually exclusive stem-loop structures, one of which has a stem 42bp long, which suggests that it could be fairly stable. We suggest that a mechanism of switching between such alternative structures may play some role in gene control or may represent the insertion of a transposable element. PMID:2997721

  18. Repetitive sequences in the ITS1 region of the ribosomal DNA of Tunga penetrans and other flea species (Insecta, Siphonaptera).


    Gamerschlag, Sara; Mehlhorn, Heinz; Heukelbach, Jörg; Feldmeier, Hermann; D'Haese, Jochen


    Different Tunga penetrans isolates from various hosts obtained from South America (Fortaleza. Brazil) have been studied by nucleotide sequence comparison of the first and the second internal transcribed spacer (ITS1, ITS2) of the ribosomal deoxyribonucleic acid (rDNA) and part of the mitochondrial 16S rDNA. Results show no significant host-dependent sequence differences. No indication for intraindividual and intraspecific polymorphisms could be detected. Comparing the ITS1 spacer region of T. penetrans from South America with that from Africa (Togo, Cameroon), distinct length variations have been observed caused by a repetitive sequence motif of 99 bp. The ITS1 from the South American T. penetrans contain two tandemly repeated copies, whereas four of these units are present in the spacer of the African T. penetrans. The absence of homogenization of these units indicates a recent separation of both populations. However, the different number of repetitions together with two base substitutions put the evolutionary distance of only 135 years as postulated for the transfer of T. penetrans from South America to Africa into question. Repetitive sequences could also be detected within the ITS1 rDNA region of other flea species Ctenocephalides felis, Echidnophaga gallinacea, Pulex irritans, Spilopsyllus cuniculi, and Xenopsylla cheopis. The repeat units with lengths from 10 to 99 bp are arranged in pure tandem or interspersed. The repetitive elements observed in the ITS1 of various flea species may serve as a valuable tool for phylogeographic studies.

  19. Associations between sequence variations in the mitochondrial DNA D-loop region and outcome of hepatocellular carcinoma

    PubMed Central



    The association between mitochondrial DNA (mtDNA) polymorphisms or mutations and the prognoses of cancer have been investigated previously, but the results have been ambiguous. In the present study, the associations between sequence variations in the mtDNA D-loop region and the outcomes of patients with hepatocellular carcinoma (HCC) were analysed. A total of 140 patients with HCC (123 males and 17 females), who were hospitalised to undergo radical resection, were studied. Polymerase chain reaction and direct sequencing were performed to detect the sequence variations in the mtDNA D-loop region. Multivariate and univariate analyses were conducted to determine important factors in the prognosis of HCC. A total of 150 point sequence variations were observed in the 140 cases (13 point mutations, 8 insertions, 20 deletions and 116 polymorphisms). The variation rate was 13.4% (150/1, 122). mtDNA nucleotide 150 (C/T) was an independent factor in the logistic regression for early/late recurrence of HCC. Patients with 150T appeared to have later recurrences. In a Cox proportional hazards regression model, hepatitis B virus DNA, Child-Pugh class, differentiation degree, tumour-node-metastasis (TNM) stage, nucleotide 16263 (T/C) and nucleotide 315 (N/insertion C) were independent factors for tumour-free survival time. Patients with the 16263T allele had a greater tumour-free survival time than patients with the 16263C allele. Similarly, patients with 315 insertion C had a superior tumour-free survival time when compared with patients with 315 N (normal). In the Cox proportional hazards regression model, recurrence type (early/late), Child-Pugh class, TNM stage and adjuvant treatment after tumour recurrence (none or one/more than one treatment) were independent factors for overall survival. None of the mtDNA variations served as independent factors. Patients with late recurrence, Child-Pugh class A, and low TNM stages and/or those who received more than one adjuvant treatment

  20. DNA Sequencing apparatus


    Tabor, Stanley; Richardson, Charles C.


    An automated DNA sequencing apparatus having a reactor for providing at least two series of DNA products formed from a single primer and a DNA strand, each DNA product of a series differing in molecular weight and having a chain terminating agent at one end; separating means for separating the DNA products to form a series bands, the intensity of substantially all nearby bands in a different series being different, band reading means for determining the position an This invention was made with government support including a grant from the U.S. Public Health Service, contract number AI-06045. The U.S. government has certain rights in the invention.

  1. Tumorigenic poxviruses: genomic organization and DNA sequence of the telomeric region of the Shope fibroma virus genome.


    Upton, C; DeLange, A M; McFadden, G


    Shope fibroma virus (SFV), a tumorigenic poxvirus, has a 160-kb linear double-stranded DNA genome and possesses terminal inverted repeats (TIRs) of 12.4 kb. The DNA sequence of the terminal 5.5 kb of the viral genome is presented and together with previously published sequences completes the entire sequence of the SFV TIR. The terminal 400-bp region contains no major open reading frames (ORFs) but does possess five related imperfect palindromes. The remaining 5.1 kb of the sequence contains seven tightly clustered and tandemly oriented ORFs, four larger than 100 amino acids in length (T1, T2, T4, and T5) and three smaller ORFs (T3A, T3B, and T3C). All are transcribed toward the viral hairpin and almost all possess the consensus sequence TTTTTNT near their 3' ends which has been implicated for the transcription termination of vaccinia virus early genes. Searches of the published DNA database revealed no sequences with significant homology with this region of the SFV genome but when the protein database was searched with the translation products of ORFs T1-T5 it was found that the N-terminus of the putative T4 polypeptide is closely related to the signal sequence of the hemagglutinin precursor from influenza A virus, suggesting that the T4 polypeptide may be secreted from SFV-infected cells. Examination of other SFV ORFs shows that T1 and T2 also possess signal-like hydrophobic amino acid stretches close to their N-termini. The protein database search also revealed that the putative T2 protein has significant homology to the insulin family of polypeptides. In terms of sequence repetitions, seven tandemly repeated copies of the hexanucleotide ATTGTT and three flanking regions of dyad symmetry were detected, all in ORF T3C. A search for palindromic sequences also revealed two clusters, one in ORF T3A/B and a second in ORF T2. ORF T2 harbors five short sequence domains, each of which consists of a 6-bp short palindrome and a 10- to 18-bp larger palindrome. The

  2. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.


    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  3. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.


    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  4. Allopolyploidy in Fragariinae (Rosaceae): comparing four DNA sequence regions, with comments on classification.


    Lundberg, Magnus; Töpel, Mats; Eriksen, Bente; Nylander, Johan A A; Eriksson, Torsten


    Potential events of allopolyploidy may be indicated by incongruences between separate phylogenies based on plastid and nuclear gene sequences. We sequenced two plastid regions and two nuclear ribosomal regions for 34 ingroup taxa in Fragariinae (Rosaceae), and six outgroup taxa. We found five well supported incongruences that might indicate allopolyploidy events. The incongruences involved Aphanes arvensis, Potentilla miyabei, Potentilla cuneata, Fragaria vesca/moschata, and the Drymocallis clade. We evaluated the strength of conflict and conclude that allopolyploidy may be hypothesised in the four first cases. Phylogenies were estimated using Bayesian inference and analyses were evaluated using convergence diagnostics. Taxonomic implications are discussed for genera such as Alchemilla, Sibbaldianthe, Chamaerhodos, Drymocallis and Fragaria, and for the monospecific Sibbaldiopsis and Potaninia that are nested inside other genera. Two orphan Potentilla species, P. miyabei and P. cuneata are placed in Fragariinae. However, due to unresolved topological incongruences they are not reclassified in any genus.

  5. Investigation of mtDNA control region sequences in a Tibetan population sample from China.


    Wang, Yun-Ke; Yao, Jun; Han, Xuan; Ding, Mei; Pang, Hao; Wang, Bao-Jie; Zhang, Zhi-Qiang


    Mitochondrial hypervariable region sequences including HVI and HVII (15,751-520) were investigated from 174 unrelated Tibetan individuals living in Tibet Autonomous Region in People's Republic of China. The resulted sequences were aligned and compared with revised Cambridge sequence (rCRS). This sequence variability rendered a high gene diversity value (0.9940 ± 0.0021) and a high random match probability (0.0118) was determined with PIC of 0.9882. Among a total of 174 samples, 217 polymorphic sites were identified, which defined 135 haplotypes. A total of 135 different haplotypes were detected, 113 of them were unique and 22 were shared. The most common haplogroup was M9a1a1c1b1 (16.09%), followed by A11 (6.32%), A (5.17%), R (4.60%), A15 (4.60%), and G3a1 (3.45). The proportions of macro-haplogroups M, N, and L were 54.60%, 42.53%, and 2.87%, respectively. By principal component analysis (PCA), there was no special cluster between Tibetans and other populations except that the structure of Tibetans closely resembled that of Uygur in component 2.

  6. Electrophoretic analysis of sequence variability in three mitochondrial DNA regions for ascaridoid parasites of human and animal health significance.


    Li, Ming-Wei; Lin, Rui-Qing; Song, Hui-Qun; Sani, Rehana A; Wu, Xiang-Yun; Zhu, Xing-Quan


    Sequence variability in three mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunits 1 and 4 (nad1 and nad4), among and within Toxocara canis, T. cati, T. malaysiensis, T. vitulorum and Toxascaris leonina from different geographical origins was examined by a mutation-scanning approach. A portion of the cox1 gene (pcox1), a portion of the nad1 and nad4 genes (pnad1 and pnad4) were amplified separately from individual ascaridoid nematodes by polymerase chain reaction and the amplicons analyzed by single-strand conformation polymorphism (SSCP). Representative samples displaying sequence variation in SSCP profiles were subjected to sequencing in order to define genetic markers for their specific identification and differentiation. While the intra-specific sequence variations within each of the five ascaridoid species were 0.2-3.7% for pcox1, 0-2.8% for pnad1 and 0-2.3% for pnad4, the inter-specific sequence differences were significantly higher, being 7.9-12.9% for pcox1, 10.7-21.1% for pnad1 and 12.9-21.7% for pnad4, respectively. Phylogenetic analyses based on the combined sequences of pcox1, pnad1 and pnad4 revealed that the recently described species T. malaysiensis was more closely related to T. cati than to T. canis. These findings provided mtDNA evidence for the validity of T. malaysiensis and also demonstrated clearly the usefulness and attributes of the mutation-scanning sequencing approach for studying the population genetic structures of these and other nematodes of socio-economic importance.

  7. Molecular typing of isolates of Rickettsia rickettsii by use of DNA sequencing of variable intergenic regions.


    Karpathy, Sandor E; Dasch, Gregory A; Eremeeva, Marina E


    Rickettsia rickettsii, the causative agent of Rocky Mountain spotted fever, is found throughout the Americas, where it is associated with different animal reservoirs and tick vectors. No molecular typing system currently exists to allow for the robust differentiation of isolates of R. rickettsii. Analysis of eight completed genome sequences of rickettsial species revealed a high degree of sequence conservation within the coding regions of chromosomes in the genus. Intergenic regions between coding sequences should be under less selective pressure to maintain this conservation and thus should exhibit greater nucleotide polymorphisms. Utilizing these polymorphisms, we developed a molecular typing system that allows for the genetic differentiation of isolates of R. rickettsii. This typing system was applied to a collection of 38 different isolates collected from humans, animals, and tick vectors from different geographic locations. Serotypes 364D, from Dermacentor occidentalis ticks, and Hlp, from Haemaphysalis leporispalustris ticks, appear to be distinct genotypes that may not belong to the species R. rickettsii. We were also able to differentiate 36 historical isolates of R. rickettsii into three different phylogenetic clades containing seven different genotypes. This differentiation correlated well, but not perfectly, with the geographic origin and likely tick vectors associated with the isolates. The few apparent typing discrepancies found suggest that the molecular ecology of R. rickettsii needs more investigation.

  8. Localised sequence regions possessing high melting temperatures prevent the amplification of a DNA mimic in competitive PCR.


    McDowell, D G; Burns, N A; Parkes, H C


    The polymerase chain reaction is an immensely powerful technique for identification and detection purposes. Increasingly, competitive PCR is being used as the basis for quantification. However, sequence length, melting temperature and primary sequence have all been shown to influence the efficiency of amplification in PCR systems and may therefore compromise the required equivalent co-amplification of target and mimic in competitive PCR. The work discussed here not only illustrates the need to balance length and melting temperature when designing a competitive PCR assay, but also emphasises the importance of careful examination of sequences for GC-rich domains and other sequences giving rise to stable secondary structures which could reduce the efficiency of amplification by serving as pause or termination sites. We present data confirming that under particular circumstances such localised sequence, high melting temperature regions can act as permanent termination sites, and offer an explanation for the severity of this effect which results in prevention of amplification of a DNA mimic in competitive PCR. It is also demonstrated that when Taq DNA polymerase is used in the presence of betaine or a proof reading enzyme, the effect may be reduced or eliminated.

  9. Localised sequence regions possessing high melting temperatures prevent the amplification of a DNA mimic in competitive PCR.

    PubMed Central

    McDowell, D G; Burns, N A; Parkes, H C


    The polymerase chain reaction is an immensely powerful technique for identification and detection purposes. Increasingly, competitive PCR is being used as the basis for quantification. However, sequence length, melting temperature and primary sequence have all been shown to influence the efficiency of amplification in PCR systems and may therefore compromise the required equivalent co-amplification of target and mimic in competitive PCR. The work discussed here not only illustrates the need to balance length and melting temperature when designing a competitive PCR assay, but also emphasises the importance of careful examination of sequences for GC-rich domains and other sequences giving rise to stable secondary structures which could reduce the efficiency of amplification by serving as pause or termination sites. We present data confirming that under particular circumstances such localised sequence, high melting temperature regions can act as permanent termination sites, and offer an explanation for the severity of this effect which results in prevention of amplification of a DNA mimic in competitive PCR. It is also demonstrated that when Taq DNA polymerase is used in the presence of betaine or a proof reading enzyme, the effect may be reduced or eliminated. PMID:9649616

  10. East Asian mtDNA haplogroup determination in Koreans: haplogroup-level coding region SNP analysis and subhaplogroup-level control region sequence analysis.


    Lee, Hwan Young; Yoo, Ji-Eun; Park, Myung Jin; Chung, Ukhee; Kim, Chong-Youl; Shin, Kyoung-Jin


    The present study analyzed 21 coding region SNP markers and one deletion motif for the determination of East Asian mitochondrial DNA (mtDNA) haplogroups by designing three multiplex systems which apply single base extension methods. Using two multiplex systems, all 593 Korean mtDNAs were allocated into 15 haplogroups: M, D, D4, D5, G, M7, M8, M9, M10, M11, R, R9, B, A, and N9. As the D4 haplotypes occurred most frequently in Koreans, the third multiplex system was used to further define D4 subhaplogroups: D4a, D4b, D4e, D4g, D4h, and D4j. This method allowed the complementation of coding region information with control region mutation motifs and the resultant findings also suggest reliable control region mutation motifs for the assignment of East Asian mtDNA haplogroups. These three multiplex systems produce good results in degraded samples as they contain small PCR products (101-154 bp) for single base extension reactions. SNP scoring was performed in 101 old skeletal remains using these three systems to prove their utility in degraded samples. The sequence analysis of mtDNA control region with high incidence of haplogroup-specific mutations and the selective scoring of highly informative coding region SNPs using the three multiplex systems are useful tools for most applications involving East Asian mtDNA haplogroup determination and haplogroup-directed stringent quality control.

  11. Phylogeny and Biogeography of Cedrus (Pinaceae) Inferred from Sequences of Seven Paternal Chloroplast and Maternal Mitochondrial DNA Regions

    PubMed Central

    Qiao, Cai-Yuan; Ran, Jin-Hua; Li, Yan; Wang, Xiao-Quan


    Background and Aims Cedrus (true cedars) is a very important horticultural plant group. It has a disjunct distribution in the Mediterranean region and western Himalaya. Its evolution and biogeography are of great interest to botanists. This study aims to investigate the phylogeny and biogeography of Cedrus based on sequence analyses of seven cytoplasmic DNA fragments. Methods The methods used were PCR amplification and sequencing of seven paternal cpDNA and maternal mtDNA fragments, parsimony and maximum likelihood analyses of the DNA dataset, and molecular clock estimate of divergence times of Cedrus species. Key Results Phylogenies of Cedrus constructed from cpDNA, mtDNA and the combined cp- and mt-DNA dataset are identical in topology. It was found that the Himalayan cedar C. deodara diverged first, and then the North African species C. atlantica separated from the common ancestor of C. libani and C. brevifolia, two species from the eastern Mediterranean area. Molecular clock estimates suggest that the divergence between C. atlantica and the eastern Mediterranean clade at 23·49 ± 3·55 to 18·81 ± 1·25 Myr and the split between C. libani and C. brevifolia at 7·83 ± 2·79 to 6·56 ± 1·20 Myr. Conclusions The results, combined with palaeogeographical and palaeoecological information, indicate that Cedrus could have an origin in the high latitude area of Eurasia, and its present distribution might result from vicariance of southerly migrated populations during climatic oscillations in the Tertiary and further fragmentation and dispersal of these populations. It is very likely that Cedrus migrated into North Africa in the very late Tertiary, while its arrival in the Himalayas would not have been before the Miocene, after which the phased or fast uplift of the Tibetan plateau happened. PMID:17611189

  12. Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

    SciTech Connect

    Miyamoto, M.M.; Slightom, J.L.; Goodman, M.


    Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.

  13. Minding the gap: Frequency of indels in mtDNA control region sequence data and influence on population genetic analyses

    USGS Publications Warehouse

    Pearce, J.M.


    Insertions and deletions (indels) result in sequences of various lengths when homologous gene regions are compared among individuals or species. Although indels are typically phylogenetically informative, occurrence and incorporation of these characters as gaps in intraspecific population genetic data sets are rarely discussed. Moreover, the impact of gaps on estimates of fixation indices, such as FST, has not been reviewed. Here, I summarize the occurrence and population genetic signal of indels among 60 published studies that involved alignments of multiple sequences from the mitochondrial DNA (mtDNA) control region of vertebrate taxa. Among 30 studies observing indels, an average of 12% of both variable and parsimony-informative sites were composed of these sites. There was no consistent trend between levels of population differentiation and the number of gap characters in a data block. Across all studies, the average influence on estimates of ??ST was small, explaining only an additional 1.8% of among population variance (range 0.0-8.0%). Studies most likely to observe an increase in ??ST with the inclusion of gap characters were those with < 20 variable sites, but a near equal number of studies with few variable sites did not show an increase. In contrast to studies at interspecific levels, the influence of indels for intraspecific population genetic analyses of control region DNA appears small, dependent upon total number of variable sites in the data block, and related to species-specific characteristics and the spatial distribution of mtDNA lineages that contain indels. ?? 2006 Blackwell Publishing Ltd.

  14. DNA sequences of the cysK regions of Salmonella typhimurium and Escherichia coli and linkage of the cysK regions to ptsH.

    PubMed Central

    Byrne, C R; Monroe, R S; Ward, K A; Kredich, N M


    Nucleotide sequences of the cysK regions of Salmonella typhimurium and Escherichia coli have been determined. A total of 3,812 and 2,595 nucleotides were sequenced from S. typhimurium and E. coli, respectively. Open reading frames of 323 codons were found in both species and were identified as those of cysK by comparison of deduced amino acid sequences with amino- and carboxyl-terminal amino acid analyses of the S. typhimurium cysK gene product O-acetylserine (thiol)-lyase A. The two cysK DNA sequences were 85% identical, and the deduced amino acid sequences were 96% identical. The major transcription initiation sites for cysK were found to be virtually identical in the two organisms, by using primer extension and S1 nuclease protection techniques. The -35 region corresponding to the major transcription start site was TTCCCC in S. typhimurium and TTCCGC in E. coli. The deviation of these sequences from the consensus sequence TTGACA may reflect the fact that cysK is subject to positive control and requires the cysB regulatory protein for expression. Sequences downstream of cysK were found to include ptsH and a portion of ptsI, thus establishing the exact relationship of cysK with these two genes. A 290-codon open reading frame, which may represent the cysZ gene, was identified upstream of cysK. Images PMID:3290198

  15. Population structure of the salamander Hynobius retardatus inferred from a partial sequence of the mitochondrial DNA control region.


    Azuma, Noriko; Hangui, Jun-ichi; Wakahara, Masami; Michimae, Hirofumi


    We investigated population structure of the salamander Hynobius retardatus in Hokkaido, Japan using partial sequences of the mitochondrial DNA control region (490 bp) from 105 individuals. The salamanders were collected from 28 localities representing the entire regional distribution of this species. Twenty different haplotypes distributed across three haplotype groups were identified. Group 1 was widely distributed in central, northern, and eastern Hokkaido, except Erimo; Groups 2 and 3 appeared exclusively in Erimo and southern Hokkaido, respectively. The genetic distance between the three groups was not very large, but the distributions of the groups never overlapped spatially, indicating a hierarchical population structure comprising three regional groups, which was also supported by analysis of molecular variance. The results suggest that the present population structure is affected by current genetic barriers, as well as by historical transitions of climate and landscape.

  16. Transposon facilitated DNA sequencing

    SciTech Connect

    Berg, D.E.; Berg, C.M.; Huang, H.V.


    The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses, and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.

  17. Genetic identification of istiophorid larvae from the Gulf of Mexico based on the analysis of mitochondrial DNA control region sequences.


    McKenzie, J L; Alvarado Bremer, J R


    Assigning relative importance of spawning and nursery habitats for threatened and endangered teleosts, such as those seen in the Gulf of Mexico (GoM), relies on the proper identification of the early life-history stages of the species of concern. Here, sequencing a portion of the mitochondrial DNA (mtDNA) control region (CR) I as barcodes is recommended to identify istiophorid (billfish) larvae in the Atlantic Ocean because of its high resolution and the intrinsic value of the levels of genetic variation that can be extracted from these data. The universality of the primers employed here demonstrates their utility for not only the positive identification of istiophorids in the GoM, but for any larval teleost occurring in areas recognized as larval hotspots worldwide. © 2016 The Fisheries Society of the British Isles.

  18. Nucleotide sequences at the boundaries between gene and insertion regions in the rDNA of Drosophilia melanogaster.


    Dawid, I B; Rebbert, M L


    Ribosomal RNA genes interrupted by type 1 insertions of 1 kb and 0.5 kb have been sequenced through the insertion region and compared with an uninterrupted gene. The 0.5 kb insertion is flanked by a duplication of a 14 bp segment that is present once in the uninterrupted gene; the 1 kb insertion is flanked by a duplication of 11 of these 14 bp. Short insertions are identical in their entire length to downstream regions of long insertions. No internal repeats occur in the insertion. The presence of target site duplications suggests that type 1 insertions arose by the introduction of transposable elements into rDNA. Short sequence homologies between the upstream ends of the insertions and the 28S' boundaries of the rRNA coding region suggest that short type 1 insertions may have arisen by recombination from longer insertions. We have sequenced both boundaries of two molecules containing type 2 insertions and the upstream boundary of a third; the points of interruption at the upstream boundary (28S' site) differ from each other in steps of 2 bp. Between the boundary in the 0.5 kb type 1 insertion and the type 2 boundaries there are distances of 74, 76, and 78 bp. At the downstream boundary (28S'' site) the two sequenced type 2 insertions are identical. The rRNA coding region of one molecule extends across the insertion without deletion or duplication, but a 2 bp deletion in the RNA coding region is present in the second molecule. Stretches of 13 or 22 adenine residues occur at the downstream (28S'') end of the two type 2 insertions.

  19. Potential Symbiosis-Specific Genes Uncovered by Sequencing a 410-Kilobase DNA Region of the Bradyrhizobium japonicum Chromosome

    PubMed Central

    Göttfert, Michael; Röthlisberger, Sandra; Kündig, Christoph; Beck, Christoph; Marty, Roger; Hennecke, Hauke


    The physical and genetic map of the Bradyrhizobium japonicum chromosome revealed that nitrogen fixation and nodulation genes are clustered. Because of the complex interactions between the bacterium and the plant, we expected this chromosomal sector to contain additional genes that are involved in the maintenance of an efficient symbiosis. Therefore, we determined the nucleotide sequence of a 410-kb region. The overall G+C nucleotide content was 59.1%. Using a minimum gene length of 150 nucleotides, 388 open reading frames (ORFs) were selected as coding regions. Thirty-five percent of the predicted proteins showed similarity to proteins of rhizobia. Sixteen percent were similar only to proteins of other bacteria. No database match was found for 29%. Repetitive DNA sequence-derived ORFs accounted for the rest. The sequenced region contained all nitrogen fixation genes and, apart from nodM, all nodulation genes that were known to exist in B. japonicum. We found several genes that seem to encode transport systems for ferric citrate, molybdate, or carbon sources. Some of them are preceded by −24/−12 promoter elements. A number of putative outer membrane proteins and cell wall-modifying enzymes as well as a type III secretion system might be involved in the interaction with the host. PMID:11157954

  20. c-Myc quadruplex-forming sequence Pu-27 induces extensive damage in both telomeric and nontelomeric regions of DNA.


    Islam, Md Ashraful; Thomas, Shelia D; Murty, Vundavalli V; Sedoris, Kara J; Miller, Donald M


    Quadruplex-forming DNA sequences are present throughout the eukaryotic genome, including in telomeric DNA. We have shown that the c-Myc promoter quadruplex-forming sequence Pu-27 selectively kills transformed cells (Sedoris, K. C., Thomas, S. D., Clarkson, C. R., Muench, D., Islam, A., Singh, R., and Miller, D. M. (2012) Genomic c-Myc quadruplex DNA selectively kills leukemia. Mol. Cancer Ther. 11, 66-76). In this study, we show that Pu-27 induces profound DNA damage, resulting in striking chromosomal abnormalities in the form of chromatid or chromosomal breaks, radial formation, and telomeric DNA loss, which induces γ-H2AX in U937 cells. Pu-27 down-regulates telomeric shelterin proteins, DNA damage response mediators (RAD17 and RAD50), double-stranded break repair molecule 53BP1, G2 checkpoint regulators (CHK1 and CHK2), and anti-apoptosis gene survivin. Interestingly, there are no changes of DNA repair molecules H2AX, BRCA1, and the telomere maintenance gene, hTERT. ΔB-U937, where U937 cells stably transfected with deleted basic domain of TRF2 is partially sensitive to Pu-27 but exhibits no changes in expression of shelterin proteins. However, there is an up-regulation of CHK1, CHK2, H2AX, BRCA1, and survivin. Telomere dysfunction-induced foci assay revealed co-association of TRF1with γ-H2AX in ATM deficient cells, which are differentially sensitive to Pu-27 than ATM proficient cells. Alt (alternating lengthening of telomere) cells are relatively resistant to Pu-27, but there are no significant changes of telomerase activity in both Alt and non-Alt cells. Lastly, we show that this Pu-27-mediated sensitivity is p53-independent. The data therefore support two conclusions. First, Pu-27 induces DNA damage within both telomeric and nontelomeric regions of the genome. Second, Pu-27-mediated telomeric damage is due, at least in part, to compromise of the telomeric shelterin protein complex.

  1. Comparison of mitochondrial DNA control region sequence and microsatellite DNA analyses in estimating population structure and gene flow rates in Atlantic sturgeon Acipenser oxyrinchus

    USGS Publications Warehouse

    Wirgin, I.; Waldman, J.; Stabile, J.; Lubinski, B.; King, T.


    Atlantic sturgeon Acipenser oxyrinchus is large, long-lived, and anadromous with subspecies distributed along the Atlantic (A. oxyrinchus oxyrinchus) and Gulf of Mexico (A. o. desotoi) coasts of North America. Although it is not certain if extirpation of some population units has occurred, because of anthropogenic influences abundances of all populations are low compared with historical levels. Informed management of A. oxyrinchus demands a detailed knowledge of its population structure, levels of genetic diversity, and likelihood to home to natal rivers. We compared the use of mitochondrial DNA (mtDNA) control region sequence and microsatellite nuclear DNA (nDNA) analyses in identifying the stock structure and homing fidelity of Atlantic and Gulf coast populations of A. oxyrinchus. The approaches were concordant in that they revealed moderate to high levels of genetic diversity and suggested that populations of Atlantic sturgeon are highly structured. At least six genetically distinct management units were detected using the two approaches among the rivers surveyed. Mitochondrial DNA sequences revealed a significant cline in haplotype diversity along the Atlantic coast with monomorphism observed in Canadian populations. High levels of nDNA diversity were also observed among populations along the Atlantic coast, including the two Canadian populations, probably resulting from the more rapid rate of mutational and evolutionary change at microsatellite loci. Estimates of gene flow among populations were similar between both approaches with the exception that because of mtDNA monomorphism in Canadian populations, gene flow estimates between them were unobtainable. Analyses of both genomes provided high resolution and confidence in characterizing the population structure of Atlantic sturgeon. Microsatellite analysis was particularly informative in delineating population structure in rivers that were recently glaciated and may prove diagnostic in rivers that are

  2. {open_quotes}Feature{close_quotes} mapping of the HLA-C linked DNA region: Construction by sequencing from nested deletions

    SciTech Connect

    Krishnan, B.R.; Chaplin, D.D. |


    The HLA complex located on chromosome 6p spans {approximately}4 Mb and is gene dense. To enable systematic analysis of less well-characterized portions of HLA, we are defining significant {open_quotes}features{close_quotes} of these DNA regions: locations of putative genes (prediction of exons by GRAIL analysis) and Alu elements, regions with homology to the database, and regions of evolutionarily conserved DNA sequence. Initially, we cloned a 35 kb DNA segment adjacent to HLA-C into a transposon {gamma}{delta}-based cosmid vector designed for generating nested deletions in vivo. Over 70 informative nested deletions were obtained and sequenced by fluorescent-automated technology. Islands of DNA sequences were obtained and used to construct a feature map of the 35 kb HLA segment. Our data (i) defined the organization of the previously identified keratinocyte-specific S gene, (ii) generated the DNA sequence of two evolutionarily conserved DNA segments, and (iii) located otherwise undefined putative exons and Alu elements. The construction of such feature maps of large DNA segments using the nested deletion-sequencing approach provides an efficient means to identify DNA segments meriting systematic and detailed analysis.

  3. Phylogeny and Biogeography of the Genus Ainsliaea (Asteraceae) in the Sino-Japanese Region based on Nuclear rDNA and Plastid DNA Sequence Data

    PubMed Central

    Mitsui, Yuki; Chen, Shao-Tien; Zhou, Zhe-Kun; Peng, Ching-I.; Deng, Yun-Fei; Setoguchi, Hiroaki


    Background and Aims The flora of the Sino-Japanese plant region of eastern Asia is distinctively rich compared with other floristic regions in the world. However, knowledge of its floristic evolution is fairly limited. The genus Ainsliaea is endemic to and distributed throughout the Sino-Japanese region. Its interspecific phylogenetic relationships have not been resolved. The aim is to provide insight into floristic evolution in eastern Asia on the basis of a molecular phylogenetic analysis of Ainsliaea species. Methods Cladistic analyses of the sequences of two nuclear (ITS, ETS) and one plastid (ndhF) regions were carried out individually and using the combined data from the three markers. Key Results Phylogenetic analyses of three DNA regions confirmed that Ainsliaea is composed of three major clades that correspond to species distributions. Evolution of the three lineages was estimated to have occurred around 1·1 MYA during the early Pleistocene. Conclusions The results suggest that Ainsliaea species evolved allopatrically and that the descendants were isolated in the eastern (between SE China and Japan, through Taiwan and the Ryukyu Islands) and western (Yunnan Province and its surrounding areas, including the Himalayas, the temperate region of Southeast Asia, and Sichuan Province) sides of the Sino-Japanese region. The results suggest that two distinct lineages of Ainsliaea have independently evolved in environmentally heterogeneous regions within the Sino-Japanese region. These regions have maintained rich and original floras due to their diverse climates and topographies. PMID:17981878

  4. Phylogenetic relationships in the Gesnerioideae (Gesneriaceae) based on nrDNA ITS and cpDNA trnL-F and trnE-T spacer region sequences.


    Zimmer, Elizabeth A; Roalson, Eric H; Skog, Laurence E; Boggan, John K; Idnurm, Alexander


    The Gesnerioideae includes most of the New World members of the Gesneriaceae family and is currently considered to include five tribes: Beslerieae, Episcieae, Gesnerieae, Gloxinieae, and Napeantheae. This study presents maximum parsimony and maximum likelihood phylogenetic analyses of nuclear ribosomal DNA internal transcribed spacer regions (ITS), and the chloroplast DNA trnL intron, trnL-trnF intergenic spacer region, and trnE-trnT intergenic spacer region sequences. The ITS and cpDNA data sets strongly support the monophyly of a Beslerieae/Napeantheae clade; an Episcieae clade; a Gesnerieae clade; a Gloxinieae clade minus Sinningia, Sinningia relatives, and Gloxinia sarmentiana; and a Sinningia/Paliavana/Vanhouttea clade. This is the first study to provide strong statistical support for these tribes/clades. These analyses suggest that Sinningia and relatives should be considered as a separate tribe. Additionally, generic relationships are explored, including the apparent polyphyly of Gloxinia. Chromosome number changes are minimized on the proposed phylogeny, with the exception of the n = 11 taxa of the Gloxinieae. Scaly rhizomes appear to have been derived once in the Gloxinieae sensu stricto. The number of derivations of the inferior ovary is unclear: either there was one derivation with a reversal to a superior ovary in the Episcieae, or there were multiple independent derivations of the inferior ovary.

  5. Rice pseudomolecule-anchored cross-species DNA sequence alignments indicate regional genomic variation in expressed sequence conservation

    PubMed Central

    Armstead, Ian; Huang, Lin; King, Julie; Ougham, Helen; Thomas, Howard; King, Ian


    Background Various methods have been developed to explore inter-genomic relationships among plant species. Here, we present a sequence similarity analysis based upon comparison of transcript-assembly and methylation-filtered databases from five plant species and physically anchored rice coding sequences. Results A comparison of the frequency of sequence alignments, determined by MegaBLAST, between rice coding sequences in TIGR pseudomolecules and annotations vs 4.0 and comprehensive transcript-assembly and methylation-filtered databases from Lolium perenne (ryegrass), Zea mays (maize), Hordeum vulgare (barley), Glycine max (soybean) and Arabidopsis thaliana (thale cress) was undertaken. Each rice pseudomolecule was divided into 10 segments, each containing 10% of the functionally annotated, expressed genes. This indicated a correlation between relative segment position in the rice genome and numbers of alignments with all the queried monocot and dicot plant databases. Colour-coded moving windows of 100 functionally annotated, expressed genes along each pseudomolecule were used to generate 'heat-maps'. These revealed consistent intra- and inter-pseudomolecule variation in the relative concentrations of significant alignments with the tested plant databases. Analysis of the annotations and derived putative expression patterns of rice genes from 'hot-spots' and 'cold-spots' within the heat maps indicated possible functional differences. A similar comparison relating to ancestral duplications of the rice genome indicated that duplications were often associated with 'hot-spots'. Conclusion Physical positions of expressed genes in the rice genome are correlated with the degree of conservation of similar sequences in the transcriptomes of other plant species. This relative conservation is associated with the distribution of different sized gene families and segmentally duplicated loci and may have functional and evolutionary implications. PMID:17708759

  6. DNA sequences encoding osteoinductive products

    SciTech Connect

    Wang, E.A.; Wozney, J.M.; Rosen, V.


    This patent describes an isolated DNA sequence encoding an osteoinductive protein the DNA sequence comprising a coding sequence. It comprises: nucleotide No.1 through nucleotide No.387, nucleotide No.356 through nucleotide No.1543, nucleotide $402 through nucleotide No.1626, naturally occurring allelic sequences and equivalent degenerative codon sequences and sequences which hybridize to any of sequences under stringent hybridization conditions; and encode a protein characterized by the ability to induce the formation of bone and/or cartilage.

  7. Towards single molecule DNA sequencing

    NASA Astrophysics Data System (ADS)

    Liu, Hao

    Single molecule DNA Sequencing technology has been a hot research topic in the recent decades because it holds the promise to sequence a human genome in a fast and affordable way, which will eventually make personalized medicine possible. Single molecule differentiation and DNA translocation control are the two main challenges in all single molecule DNA sequencing methods. In this thesis, I will first introduce DNA sequencing technology development and its application, and then explain the performance and limitation of prior art in detail. Following that, I will show a single molecule DNA base differentiation result obtained in recognition tunneling experiments. Furthermore, I will explain the assembly of a nanofluidic platform for single strand DNA translocation, which holds the promised to be integrated into a single molecule DNA sequencing instrument for DNA translocation control. Taken together, my dissertation research demonstrated the potential of using recognition tunneling techniques to serve as a general readout system for single molecule DNA sequencing application.

  8. Dynamics and phylogenetic implications of MtDNA control region sequences in New World Jays (Aves: Corvidae).


    Saunders, M A; Edwards, S V


    To study the evolution of mtDNA and the intergeneric relationships of New World Jays (Aves: Corvidae), we sequenced the entire mitochondrial DNA control region (CR) from 21 species representing all genera of New World jays, an Old World jay, crows, and a magpie. Using maximum likelihood methods, we found that both the transition/transversion ratio (kappa) and among site rate variation (alpha) were higher in flanking domains I and II than in the conserved central domain and that the frequency of indels was highest in domain II. Estimates of kappa and alpha were much more influenced by the density of taxon sampling than by alternative optimal tree topologies. We implemented a successive approximation method incorporating these parameters into phylogenetic analysis. In addition we compared our study in detail to a previous study using cytochrome b and morphology to examine the effect of taxon sampling, evolutionary rates of genes, and combined data on tree resolution. We found that the particular weighting scheme used had no effect on tree topology and little effect on tree robustness. Taxon sampling had a significant effect on tree robustness but little effect on the topology of the best tree. The CR data set differed nonsignificantly from the tree derived from the cytochrome b/morphological data set primarily in the placement of the genus Gymnorhinus, which is near the base of the CR tree. However, contrary to conventional taxonomy, the CR data set suggested that blue and black jays (Cyanocorax sensu lato) might be paraphyletic and that the brown jay Psilorhinus (=Cyanocorax) morio is the sister group to magpie jays (Calocitta), a phylogenetic hypothesis that is likely as parsimonious with regard to nonmolecular characters as monophyly of Cyanocorax. The CR tree also suggests that the common ancestor of NWJs was likely a cooperative breeder. Consistent with recent systematic theory, our data suggest that DNA sequences with high substitution rates such as the CR may

  9. Sequence variation in two mitochondrial DNA regions and internal transcribed spacer among isolates of the nematode Oesophagostomum asperum originating from goats in Hunan Province, China.


    Li, F; Hu, T; Duan, N C; Li, W Y; Teng, Q; Li, H; Liu, W; Liu, Y; Cheng, T Y


    The present study examined sequence variability in two mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1) and NADH dehydrogenase subunit 1 (nad1), and internal transcribed spacer (ITS) of nuclear ribosomal DNA (rDNA) among Oesophagostomum asperum isolates from goats in Hunan Province, China. A portion of the cox1 (pcox1), nad1 (pnad1) genes and the ITS (ITS1+5.8S rDNA+ITS2) rDNA were amplified by polymerase chain reaction (PCR) separately from adult O. asperum individuals and the representative amplicons were subjected to sequencing from both directions. The lengths of pcox1, pnad1 and ITS rDNA were 366 bp, 681 bp and 785 bp, respectively. The A+T contents of gene sequences were 71.5-72% for pcox1, 73.7-74.2% for pnad1 and 58-58.8% for ITS rDNA. Intra-specific sequence variations within O. asperum were 0-1.6% for pcox1, 0-1.9% for pnad1 and 0-1.7% for ITS rDNA, while inter-specific sequence differences among members of the genus Oesophagostomum were significantly higher, being 11.1-12.5%, 13.3-17.7% and 8.5-18.6% for pcox1, pnad1 and ITS rDNA, respectively. Phylogenetic analyses using combined sequences of pcox1 and pnad1, with three different computational algorithms (Bayesian inference, maximum likelihood and maximum parsimony), revealed distinct groups with high statistical support. These findings demonstrated the existence of intra-specific variation in mtDNA and rDNA sequences among O. asperum isolates from goats in Hunan Province, China, and have implications for studying molecular epidemiology and population genetics of O. asperum.

  10. [Genetic variation of Manchurian pheasant (Phasianus colchicus pallasi Rotshild, 1903) inferred from mitochondrial DNA control region sequences].


    Kozyrenko, M M; Fisenko, P V; Zhuravlev, Iu N


    Sequence variation of the mitochondrial DNA control region was studied in Manchurian pheasants (Phasianus colchicus pallasi Rotshild, 1903) representing three geographic populations from the southern part of the Russian Far East. Extremely low population genetic differentiation (F(ST) = 0.0003) pointed to a very high gene exchange between the populations. Combination of such characters as high haplotype diversity (0.884 to 0.913), low nucleotide diversity (0.0016 to 0.0022), low R2 values (0.1235 to 0.1337), certain patterns of pairwise-difference distributions, and the absence of phylogenetic structure suggested that the phylogenetic history of Ph. C. pallasi included passing through a bottleneck with further expansion in the postglacial period. According to the data obtained, it was suggested that differentiation between the mitochondrial lineages started approximately 100 000 years ago.

  11. Nucleotide sequence of a Proteus mirabilis DNA fragment homologous to the 60K-rnpA-rpmH-dnaA-dnaN-recF-gyrB region of Escherichia coli.


    Skovgaard, O


    A 6.5-kb DNA fragment from Proteus mirabilis hybridized to the Escherichia coli dnaA gene. This DNA fragment was cloned and the nucleotide (nt) sequence determined. The fragment is homologous to a region of the E. coli chromosome containing a part of the gene encoding a 60-kDa membrane-associated protein (60K), the rnpA-rpmH-dnaA-dnaN-recF genes, and the N-terminal part of the gyrB gene. The degree of homology is variable: the amino-acid (aa) sequence of a part of the 60K protein and a part of the DnaA protein is only minimally conserved, whereas the C-terminal 148 aa of DnaA are identical in the two species. The conservation of the nt sequence between the rnpA gene and the gene encoding the 60K protein suggests that this region encodes a hitherto unrecognized protein. The ORF for this protein partially overlaps the 3' end of the rnpA structural gene, and the degree of conservation suggests that this gene is important for these bacteria.

  12. [Discrimination of psychoactive fungi (commonly called "magic mushrooms") based on the DNA sequence of the internal transcribed spacer region].


    Maruyama, Takuro; Shirota, Osamu; Kawahara, Nobuo; Yokoyama, Kazumasa; Makino, Yukiko; Goda, Yukihiro


    'Magic mushrooms' (MMs) are psychoactive fungi containing the hallucinogenic compounds, psilocin (1) and psilocybin (2). Since June 6, 2002, these fungi have been regulated by the Narcotics and Psychotropics Control Law in Japan. Because there are many kinds of MMs and they are sold even as dry powders in local markets, it is very difficult to identify the original species of the MMs by morphological observation. Therefore, we investigated the internal transcribed spacer (ITS) region in the ribosomal RNA gene of MMs obtained in Japanese markets to classify them by a genetic approach. Based on the size and nucleotide sequence of the ITS region amplified by PCR, tested MMs were classified into 6 groups. Furthermore, a comparison of the DNA sequences of the MMs with those of authentic samples or with those found in the databases (GenBank, EMBL and DDBJ) made it possible to identify the species of tested MMs. Analysis by LC revealed that psilocin (1) was contained at the highest level in Panaeolus cyanescens among the MMs, but was absent in the Amanita species.

  13. Plant DNA sequencing for phylogenetic analyses: from plants to sequences.


    Neves, Susana S; Forrest, Laura L


    DNA sequences are important sources of data for phylogenetic analysis. Nowadays, DNA sequencing is a routine technique in molecular biology laboratories. However, there are specific questions associated with project design and sequencing of plant samples for phylogenetic analysis, which may not be familiar to researchers starting in the field. This chapter gives an overview of methods and protocols involved in the sequencing of plant samples, including general recommendations on the selection of species/taxa and DNA regions to be sequenced, and field collection of plant samples. Protocols of plant sample preparation, DNA extraction, PCR and cloning, which are critical to the success of molecular phylogenetic projects, are described in detail. Common problems of sequencing (using the Sanger method) are also addressed. Possible applications of second-generation sequencing techniques in plant phylogenetics are briefly discussed. Finally, orientation on the preparation of sequence data for phylogenetic analyses and submission to public databases is also given.

  14. Rapid and direct detection of clostridium chauvoei by PCR of the 16S-23S rDNA spacer region and partial 23S rDNA sequences.


    Sasaki, Y; Yamamoto, K; Kojima, A; Tetsuka, Y; Norimatsu, M; Tamura, Y


    Clostridium chauvoei causes blackleg, which is difficult to distinguish from the causative clostridia of malignant edema. Therefore, a single-step PCR system was developed for specific detection of C. chauvoei DNA using primers derived from the 16S-23S rDNA spacer region and partial 23S rDNA sequences. The specificity of the single-step PCR system was demonstrated by testing 37 strains of clostridia and 3 strains of other genera. A 509 bp PCR product, which is a C. choauvoei-specific PCR product, could be amplified from all of the C. chauvoei strains tested, but not from the other strains. Moreover, this single-step PCR system specifically detected C. chauvoei DNA in samples of muscle from mice 24 hr after inoculation with 100 spores of C. chauvoei, and in clinical materials from a cow affected with blackleg. These results suggest that our single-step PCR system may be useful for direct detection of C. chauvoei in culture and in clinical materials from animals affected with blackleg.

  15. Characterization and DNA sequence of the mobilization region of pLV22a from Bacteroides fragilis.


    Novicki, T J; Hecht, D W


    A 4.2-kb plasmid (pLV22a) native to Bacteroides fragilis LV22 became fused to a transfer-deficient Bacteroides spp.-Escherichia coli shuttle vector by an inverse transposition event, resulting in a transferrable phenotype. The transfer phenotype was attributable to pLV22a, which was also capable of mobilization within E. coli when coresident with the IncP beta R751 plasmid. Transposon mutagenesis with Tn1000 localized the mobilization region to a 1.5-kb DNA segment in pLV22a. The mobilization region has been sequenced, and five open reading frames have been identified. Mutants carrying disruptions in any of the three genes designated mbpA, mbpB, and mbpC and coding for deduced products of 11.3, 30.4, and 17.1 kDa, respectively, cannot be mobilized when coresident with R751. Mutations in all three genes can be complemented in the presence of the respective wild-type genes, indicating that the products of mbpA, mbpB, and mbpC have roles in the mobilization process and function in trans. The deduced 30.4-kDa MbpB protein contains a 14-amino-acid conserved motif that is also found in the DNA relaxases of a variety of conjugal and mobilizable plasmids and the conjugative transposon Tn4399. Deletion analysis and complementation experiments have localized a cis-acting region of pLV22a within mbpA.

  16. Characterization and DNA sequence of the mobilization region of pLV22a from Bacteroides fragilis.

    PubMed Central

    Novicki, T J; Hecht, D W


    A 4.2-kb plasmid (pLV22a) native to Bacteroides fragilis LV22 became fused to a transfer-deficient Bacteroides spp.-Escherichia coli shuttle vector by an inverse transposition event, resulting in a transferrable phenotype. The transfer phenotype was attributable to pLV22a, which was also capable of mobilization within E. coli when coresident with the IncP beta R751 plasmid. Transposon mutagenesis with Tn1000 localized the mobilization region to a 1.5-kb DNA segment in pLV22a. The mobilization region has been sequenced, and five open reading frames have been identified. Mutants carrying disruptions in any of the three genes designated mbpA, mbpB, and mbpC and coding for deduced products of 11.3, 30.4, and 17.1 kDa, respectively, cannot be mobilized when coresident with R751. Mutations in all three genes can be complemented in the presence of the respective wild-type genes, indicating that the products of mbpA, mbpB, and mbpC have roles in the mobilization process and function in trans. The deduced 30.4-kDa MbpB protein contains a 14-amino-acid conserved motif that is also found in the DNA relaxases of a variety of conjugal and mobilizable plasmids and the conjugative transposon Tn4399. Deletion analysis and complementation experiments have localized a cis-acting region of pLV22a within mbpA. PMID:7635830

  17. cDNA sequence, genomic organization, and evolutionary conservation of a novel gene from the WAGR region

    SciTech Connect

    Schwartz, F.; Eisenman, R.; Knoll, J.; Bruns, G.


    A new gene (239FB) with predominant and differential expression in fetal brain has recently been isolated from a chromosome 11p13-p14 boundary area near FSHB. The corresponding mRNA has an open reading frame of 294 amino acids, a 3` untranslated region of 1247 nucleotides, and a highly GC-rich 5` untranslated region. The coding and 3` UT sequence is specified by 6 exons within nearly 87 kb of isolated genomic locus. The 5` end region of the transcript maps adjacent to the only genomically defined CpG island in a chromosomal subregion that may be associated with part of the mental retardation of some WAGR (Wilms tumor, aniridia, genitourinary anomalies, and mental retardation) syndrome patients. In addition to nucleotide and amino acid similarity to an EST from a normalized infant brain cDNA library, the predicted protein has extensive similarity to Caenorhbditis elegans polypeptides of, as yet, unknown function. The 239FB locus is, therefore, likely part of a family of genes with two members expressed in human brain. The extensive conservation of the predicted protein suggests a fundamental function of the gene product and will enable evaluation of the role of the 239FB gene in neurogenesis in model organisms. 48 refs., 4 figs., 1 tab.

  18. Sox2 regulatory region 2 sequence works as a DNA nuclear targeting sequence enhancing the efficiency of an exogenous gene expression in ES cells.


    Funabashi, Hisakage; Takatsu, Makoto; Saito, Mikako; Matsuoka, Hideaki


    In this report, the effects of two DNA nuclear targeting sequence (DTS) candidates on the gene expression efficiency in ES cells were investigated. Reporter plasmids containing the simian virus 40 (SV40) promoter/enhancer sequence (SV40-DTS), a DTS for various types of cells but not being reported yet for ES cells, and the 81 base pairs of Sox2 regulatory region 2 (SRR2) where two transcriptional factors in ES cells, Oct3/4 and Sox2, are bound (SRR2-DTS), were introduced into cytoplasm in living cells by femtoinjection. The gene expression efficiencies of each plasmid in mouse insulinoma cell line MIN6 cells and mouse ES cells were then evaluated. Plasmids including SV40-DTS and SRR2-DTS exhibited higher gene expression efficiency comparing to plasmids without these DTSs, and thus it was concluded that both sequences work as a DTS in ES cells. In addition, it was suggested that SRR2-DTS works as an ES cell-specific DTS. To the best of our knowledge, this is the first report to confirm the function of DTSs in ES cells.

  19. Comparative phylogeography between the ermine Mustela erminea and the least weasel M. nivalis of Palaearctic and Nearctic regions, based on analysis of mitochondrial DNA control region sequences.


    Kurose, Naoko; Abramov, Alexei V; Masuda, Ryuichi


    Phylogeography of the ermine Mustela erminea and the least weasel M. nivalis from Palaearctic and Nearctic regions were investigated based on mitochondrial DNA control region sequences. Mustela erminea exhibited a very low level of genetic variation, and geographic structures among populations were unclear. This may indicate that M. erminea recently reoccupied a wide territory in Eurasia following the last glacial retreat. In comparison with M. erminea, genetic variations within and among populations of M. nivalis were much greater. Molecular phylogenetic relationships showed that two lineages of M. nivalis occurred in the Holarctic region: one spread from the Eurasian region to North America, and the other occurred in south-eastern Europe, the Caucasus and Central Asia. The results suggest either mitochondrial DNA introgression among populations of south-eastern Europe, the Caucasus and Central Asia, or ancestral polymorphisms remaining in those populations. Contrastive phylogeographic patterns between the two mustelid species could reflect differences of their migration histories in Eurasia after the last glacial age.

  20. Comparison of orthologous and paralogous DNA flanking the wheat high molecular weight glutenin genes: sequence conservation and divergence, transposon distribution, and matrix-attachment regions.


    Anderson, O D; Larka, L; Christoffers, M J; McCue, K F; Gustafson, J P


    Extended flanking DNA sequences were characterized for five members of the wheat high molecular weight (HMW) glutenin gene family to understand more of the structure, control, and evolution of these genes. Analysis revealed more sequence conservation among orthologous regions than between paralogous regions, with differences mainly owing to transposition events involving putative retrotransposons and several miniature inverted transposable elements (MITEs). Both gyspy-like long terminal repeat (LTR) and non-LTR retrotransposon sequences are represented in the flanking DNAs. One of the MITEs is a novel class, but another MITE is related to the maize Stowaway family and is widely represented in Triticeae express sequence tags (ESTs). Flanking DNA of the longest sequence, a 20 425-bp fragment including and surrounding the HMW-glutenin Bx7 gene, showed additional cereal gene-like sequences both immediately 5' and 3' to the HMW-glutenin coding region. The transcriptional activities of sequences related to these flanking putative genes and the retrotransposon-related regions were indicated by matches to wheat and other Triticeae ESTs. Predictive analysis of matrix-attachment regions (MARs) of the HMW glutenin and several alpha-, gamma-, and omega-gliadin flanking DNAs indicate potential MARs immediately flanking each of the genes. Matrix binding activity in the predicted regions was confirmed for two of the HMW-glutenin genes.

  1. The Dynamics of DNA Sequencing.

    ERIC Educational Resources Information Center

    Morvillo, Nancy


    Describes a paper-and-pencil activity that helps students understand DNA sequencing and expands student understanding of DNA structure, replication, and gel electrophoresis. Appropriate for advanced biology students who are familiar with the Sanger method. (DDR)

  2. Biosensors for DNA sequence detection

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; Akeson, Mark


    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  3. Biosensors for DNA sequence detection

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; Akeson, Mark


    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  4. Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes.


    Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C


    DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. [Comparative Analysis of DNA Sequences of Regions of X-Chromosome Attachment to the Nuclear Envelope of Nurse Cells Anopheles messeae Fall].


    Artemov, G N; Vasil'eva, O Yu; Stegniy, V N


    Polytene chromosomes of ovarian nurse cells of Anopheles mosquitoes form strong contacts with the nuclear envelope. The presence of contacts, their position at nurse cell chromosomes, and their morphological features are species-specific in malaria mosquitoes. It is important to determine the nature of these interspecies differences in the nuclear architecture, both to understand the function of the nucleus and to assess the role of the spatial organization of chromosomes in evolution. Using dot-blot hybridization, we compared DNA sequences of the clone library from the X-chromosome attachment region to the nuclear envelope of ovarian nurse cells of Anopheles messeae with DNA-probes: (1) of the X-chromosome attachment region of An. atroparvus, (2) of the 3R chromosome attachment region ofAn. messeae, and (3) of the chromosome 2 pericentromeric region of An. messeae, without expressed contacts with the nuclear envelope. It has been shown that the chromosome attachment regions have a significantly higher number of homologous DNA sequences as compared with the pericentromeric region of chromosome 2. Sequences that are common for attachment regions are largely potentially able to participate in the formation of chromatin loop domains and to interact with some nucleus frameworks, according to the analysis in the ChrClass program. The obtained results support the important role of DNA in the formation of strong chromosomal attachments to the nuclear envelope in nurse cells of Anopheles mosquitoes.

  6. Sequence analysis of the ITS region and 5.8S rDNA of Porphyra haitanensis

    NASA Astrophysics Data System (ADS)

    Li, Yanyan; Shen, Songdong; He, Lihong; Xu, Pu; Wang, Guangce


    The sequences of the ITS (internal transcribed spacer) and 5.8S rDNA of three cultivated strains of Porphyra haitanensis thalli (NB, PT and ST) were amplified, sequenced and analyzed. In addition, the phylogenic relationships of the sequences identified in this study with those of other Porphyra retrieved from GenBank were evaluated. The results are as follows: the sequences of the ITS and 5.8S rDNA were essentially identical among the three strains. The sequences of ITS1 were 331 bp to 334 bp, while those of the 5.8S rDNA were 158 bp and the sequences of ITS2 ranged from 673 bp to 681 bp. The sequences of the ITS had a high level of homology (up to 99.5%) with that of P. haitanensis (DQ662228) retrieved from GenBank, but were only approximately 50% homologous with those of other species of Porphyra. The results obtained when a phylogenetic tree was constructed coincided with the results of the homology analysis. These results suggest that the three cultivated strains of P. haitanensis evolved conservatively and that the ITS showed evolutionary consistency. However, the sequences of the ITS and 5.8S rDNA of different Porphyra species showed great variations. Therefore, the relationship of Porphyra interspecies phyletic evolution could be judged, which provides the proof for Porphyra identification study. However, proper classifications of the subspecies and the populations of Porphyra should be determined through the use of other molecular techniques to determine the genetic variability and rational phylogenetic relationships.

  7. DNA sequence analysis suggests that cytb-nd1 PCR-RFLP may not be applicable to sandfly species identification throughout the Mediterranean region.


    Llanes-Acevedo, Ivonne Pamela; Arcones, Carolina; Gálvez, Rosa; Martin, Oihane; Checa, Rocío; Montoya, Ana; Chicharro, Carmen; Cruz, Susana; Miró, Guadalupe; Cruz, Israel


    Molecular methods are increasingly used for both species identification of sandflies and assessment of their population structure. In general, they are based on DNA sequence analysis of targets previously amplified by PCR. However, this approach requires access to DNA sequence facilities, and in some circumstances, it is time-consuming. Though DNA sequencing provides the most reliable information, other downstream PCR applications are explored to assist in species identification. Thus, it has been recently proposed that the amplification of a DNA region encompassing partially both the cytochrome-B (cytb) and the NADH dehydrogenase 1 (nd1) genes followed by RFLP analysis with the restriction enzyme Ase I allows the rapid identification of the most prevalent species of phlebotomine sandflies in the Mediterranean region. In order to confirm the suitability of this method, we collected, processed, and molecularly analyzed a total of 155 sandflies belonging to four species including Phlebotomus ariasi, P. papatasi, P. perniciosus, and Sergentomyia minuta from different regions in Spain. This data set was completed with DNA sequences available at the GenBank for species prevalent in the Mediterranean basin and the Middle East. Additionally, DNA sequences from 13 different phlebotomine species (P. ariasi, P. balcanicus, P. caucasicus, P. chabaudi, P. chadlii, P. longicuspis, P. neglectus, P. papatasi, P. perfiliewi, P. perniciosus, P. riouxi, P. sergenti, and S. minuta), from 19 countries, were added to the data set. Overall, our molecular data revealed that this PCR-RFLP method does not provide a unique and specific profile for each phlebotomine species tested. Intraspecific variability and similar RFLP patterns were frequently observed among the species tested. Our data suggest that this method may not be applicable throughout the Mediterranean region as previously proposed. Other molecular approaches like DNA barcoding or phylogenetic analyses would allow a more

  8. Sequence of a cDNA encoding nitrite reductase from the tree Betula pendula and identification of conserved protein regions.


    Friemann, A; Brinkmann, K; Hachtel, W


    The sequence of an mRNA encoding nitrite reductase (NiR, EC from the tree Betula pendula was determined. A cDNA library constructed from leaf poly(A)+ mRNA was screened with an oligonucleotide probe deduced from NiR sequences from spinach and maize. A 2.5 kb cDNA was isolated that hybridized to an mRNA, the steady-state level of which increased markedly upon induction with nitrate. The nucleotide sequence of the cDNA contains a reading frame encoding a protein of 583 amino acids that reveals 79% identity with NiR from spinach. The transit peptide of the NiR precursor from birch was determined to be 22 amino acids in size by sequence comparison with NiR from spinach and maize and is the shortest transit peptide reported so far. A graphical evaluation of identities found in the NiR sequence alignment revealed nine well conserved sections each exceeding ten amino acids in size. Sequence comparisons with related redox proteins identified essential residues involved in cofactor binding. A putative binding site for ferredoxin was found in the N-terminal half of the protein.

  9. Graphene nanodevices for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Heerema, Stephanie J.; Dekker, Cees


    Fast, cheap, and reliable DNA sequencing could be one of the most disruptive innovations of this decade, as it will pave the way for personalized medicine. In pursuit of such technology, a variety of nanotechnology-based approaches have been explored and established, including sequencing with nanopores. Owing to its unique structure and properties, graphene provides interesting opportunities for the development of a new sequencing technology. In recent years, a wide range of creative ideas for graphene sequencers have been theoretically proposed and the first experimental demonstrations have begun to appear. Here, we review the different approaches to using graphene nanodevices for DNA sequencing, which involve DNA passing through graphene nanopores, nanogaps, and nanoribbons, and the physisorption of DNA on graphene nanostructures. We discuss the advantages and problems of each of these key techniques, and provide a perspective on the use of graphene in future DNA sequencing technology.

  10. Phylogenetics of Bonamia parasites based on small subunit and internal transcribed spacer region ribosomal DNA sequence data.


    Hill, Kristina M; Stokes, Nancy A; Webb, Stephen C; Hine, P Mike; Kroeck, Marina A; Moore, James D; Morley, Margaret S; Reece, Kimberly S; Burreson, Eugene M; Carnegie, Ryan B


    The genus Bonamia (Haplosporidia) includes economically significant oyster parasites. Described species were thought to have fairly circumscribed host and geographic ranges: B. ostreae infecting Ostrea edulis in Europe and North America, B. exitiosa infecting O. chilensis in New Zealand, and B. roughleyi infecting Saccostrea glomerata in Australia. The discovery of B. exitiosa-like parasites in new locations and the observation of a novel species, B. perspora, in non-commercial O. stentina altered this perception and prompted our wider evaluation of the global diversity of Bonamia parasites. Samples of 13 oyster species from 21 locations were screened for Bonamia spp. by PCR, and small subunit and internal transcribed spacer regions of Bonamia sp. ribosomal DNA were sequenced from PCR-positive individuals. Infections were confirmed histologically. Phylogenetic analyses using parsimony and Bayesian methods revealed one species, B. exitiosa, to be widely distributed, infecting 7 oyster species from Australia, New Zealand, Argentina, eastern and western USA, and Tunisia. More limited host and geographic distributions of B. ostreae and B. perspora were confirmed, but nothing genetically identifiable as B. roughleyi was found in Australia or elsewhere. Newly discovered diversity included a Bonamia sp. in Dendostrea sandvicensis from Hawaii, USA, that is basal to the other Bonamia species and a Bonamia sp. in O. edulis from Tomales Bay, California, USA, that is closely related to both B. exitiosa and the previously observed Bonamia sp. from O. chilensis in Chile.

  11. Sequencing Intractable DNA to Close Microbial Genomes

    SciTech Connect

    Hurt, Jr., Richard Ashley; Brown, Steven D; Podar, Mircea; Palumbo, Anthony Vito; Elias, Dwayne A


    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  12. Nucleotide sequence of the internal transcribed spacers and 5.8S region of ribosomal DNA in Pinus pinea L.


    Marrocco, R; Gelati, M T; Maggini, F


    The nucleotide sequence of the first internal transcribed spacer (ITS1) belonging to different ribosomal RNA genes from Pinus pinea are reported. The analyzed ITS1 can be distinguished on the basis of their length, being one 2631 bp and the other 271 bp long. Nucleotide comparison of these regions did not show appreciable sequence homology. The larger ITS1 contains five tandem arranged subrepeats with size ranging between 219 bp and 237 bp. The nucleotide sequence of the 5.8S and the ITS2 regions belonging to the larger ribosomal RNA gene are also reported.

  13. Characterization of a DNA sequence family in the Prader-Willi/Angelman syndrome chromosome region in 15q11-q13

    SciTech Connect

    Dittrich, B.; Knoblauch, H.; Buiting, K.; Horsthemke, B. )


    IR4-3R (D15S11) is an anonymous DNA sequence from human chromosome 15. Using YAC cloning and restriction enzyme analysis, the authors have found that IR4-3R detects five related DNA sequences, which are spread over 700 kb within the Prader-Willi/Angelman syndrome chromosome region in 15q11-q 13. The RsaI and StyI polymorphisms, which were described previously, are associated with the most proximal copy of IR4-3R and are in strong linkage disequilibrium. IR4-3R represents the third DNA sequence family that has been identified in 15q11-q13. 14 refs., 2 figs., 1 tab.

  14. Sequence independent amplification of DNA


    Bohlander, Stefan K.


    The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei.

  15. Sequence independent amplification of DNA


    Bohlander, S.K.


    The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example, the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei. 25 figs.

  16. Nucleotide sequencing and analysis of 16S rDNA and 16S-23S rDNA internal spacer region (ISR) of Taylorella equigenitalis, as an important pathogen for contagious equine metritis (CEM).


    Kagawa, S; Nagano, Y; Tazumi, A; Murayama, O; Millar, B C; Moore, J E; Matsuda, M


    The primer set for 16S rDNA amplified an amplicon of about 1500 bp in length for three strains of Taylorella equigenitalis (NCTC11184(T), Kentucky188 and EQ59). Sequence differences of the 16S rDNA among the six sequences, including three reference sequences, occurred at only a few nucleotide positions and thus, an extremely high sequence similarity of the 16S rDNA was first demonstrated among the six sequences. In addition, the primer set for 16S-23S rDNA internal spacer region (ISR) amplified two amplicons about 1300 bp and 1200 bp in length for the three strains. The ISRs were estimated to be about 920 bp in length for large ISR-A and about 830 bp for small ISR-B. Sequence alignment of the ISR-A and ISR-B demonstrated about 10 base differences between NCTC11184(T) and EQ59 and between Kentucky188 and EQ59. However, only minor sequence differences were demonstrated between the ISR-A and ISR-B from NCTC11184(T) and Kentucky188, respectively. A typical order of the intercistronic tRNAs with the 29 nucleotide spacer of 5'-16S rDNA-tRNA(Ile)-tRNA(Ala)-23S rDNA-3' was demonstrated in the all ISRs. The ISRs may be useful for the discrimination amongst isolates of T. equigenitalis if sequencing is employed.

  17. Nucleotide sequence of murine PCNA: interspecies comparison of the cDNA and the 5' flanking region of the gene.


    Shipman-Appasamy, P M; Cohen, K S; Prystowsky, M B


    Proliferating cell nuclear antigen (PCNA) RNA levels are regulated by transcription as well as changes in stability, in growing cells. We have cloned the murine PCNA cDNA and a fragment of the murine PCNA gene flanking the transcription initiation site. Comparison of the murine deduced amino acid sequence with the PCNA sequence from rat, human, Drosophila, Saccharomyces cerevisiae, and higher plants, reveals extensive homology between species. The homology is likely to be related to the fundamental role of PCNA as an auxiliary protein for DNA replication. Consensus sequences for transcriptional regulatory factors identified within 520 bp 5' of the cap site of the murine PCNA gene include: an inverted CCAAT site, an enhancer core element (EBP-1), three cAMP-response elements (CRE-BP), one AP-2 site, three Sp1 sites, and two octamer sequences. The first 20 bp of the transcriptional unit are homologous to an initiator element, which may direct transcription from RNA polymerase II in the absence of a TATAA box. The consensus elements in the murine PCNA gene are similar in sequence and/or location to elements identified in the genes for human, Drosophilia, and yeast PCNA.

  18. Stepping stones in DNA sequencing

    PubMed Central

    Stranneheim, Henrik; Lundeberg, Joakim


    In recent years there have been tremendous advances in our ability to rapidly and cost-effectively sequence DNA. This has revolutionized the fields of genetics and biology, leading to a deeper understanding of the molecular events in life processes. The rapid technological advances have enormously expanded sequencing opportunities and applications, but also imposed strains and challenges on steps prior to sequencing and in the downstream process of handling and analysis of these massive amounts of sequence data. Traditionally, sequencing has been limited to small DNA fragments of approximately one thousand bases (derived from the organism's genome) due to issues in maintaining a high sequence quality and accuracy for longer read lengths. Although many technological breakthroughs have been made, currently the commercially available massively parallel sequencing methods have not been able to resolve this issue. However, recent announcements in nanopore sequencing hold the promise of removing this read-length limitation, enabling sequencing of larger intact DNA fragments. The ability to sequence longer intact DNA with high accuracy is a major stepping stone towards greatly simplifying the downstream analysis and increasing the power of sequencing compared to today. This review covers some of the technical advances in sequencing that have opened up new frontiers in genomics. PMID:22887891

  19. DNA Sequence Variants in the Five Prime Untranslated Region of the Cyclooxygenase-2 Gene Are Commonly Found in Healthy Dogs and Gray Wolves.


    Safra, Noa; Hayward, Louisa J; Aguilar, Miriam; Sacks, Benjamin N; Westropp, Jodi L; Mohr, F Charles; Mellersh, Cathryn S; Bannasch, Danika L


    The aim of this study was to investigate the frequency of regional DNA variants upstream to the translation initiation site of the canine Cyclooxygenase-2 (Cox-2) gene in healthy dogs. Cox-2 plays a role in various disease conditions such as acute and chronic inflammation, osteoarthritis and malignancy. A role for Cox-2 DNA variants in genetic predisposition to canine renal dysplasia has been proposed and dog breeders have been encouraged to select against these DNA variants. We sequenced 272-422 bases in 152 dogs unaffected by renal dysplasia and found 19 different haplotypes including 11 genetic variants which had not been described previously. We genotyped 7 gray wolves to ascertain the wildtype variant and found that the wolves we analyzed had predominantly the second most common DNA variant found in dogs. Our results demonstrate an elevated level of regional polymorphism that appears to be a feature of healthy domesticated dogs.

  20. DNA Sequence Variants in the Five Prime Untranslated Region of the Cyclooxygenase-2 Gene Are Commonly Found in Healthy Dogs and Gray Wolves

    PubMed Central

    Safra, Noa; Hayward, Louisa J.; Aguilar, Miriam; Sacks, Benjamin N.; Westropp, Jodi L.; Mohr, F. Charles; Mellersh, Cathryn S.; Bannasch, Danika L.


    The aim of this study was to investigate the frequency of regional DNA variants upstream to the translation initiation site of the canine Cyclooxygenase-2 (Cox-2) gene in healthy dogs. Cox-2 plays a role in various disease conditions such as acute and chronic inflammation, osteoarthritis and malignancy. A role for Cox-2 DNA variants in genetic predisposition to canine renal dysplasia has been proposed and dog breeders have been encouraged to select against these DNA variants. We sequenced 272–422 bases in 152 dogs unaffected by renal dysplasia and found 19 different haplotypes including 11 genetic variants which had not been described previously. We genotyped 7 gray wolves to ascertain the wildtype variant and found that the wolves we analyzed had predominantly the second most common DNA variant found in dogs. Our results demonstrate an elevated level of regional polymorphism that appears to be a feature of healthy domesticated dogs. PMID:26244515

  1. The Nucleotide Capture Region of Alpha Hemolysin: Insights into Nanopore Design for DNA Sequencing from Molecular Dynamics Simulations.


    Manara, Richard M A; Tomasio, Susana; Khalid, Syma


    Nanopore technology for DNA sequencing is constantly being refined and improved. In strand sequencing a single strand of DNA is fed through a nanopore and subsequent fluctuations in the current are measured. A major hurdle is that the DNA is translocated through the pore at a rate that is too fast for the current measurement systems. An alternative approach is "exonuclease sequencing", in which an exonuclease is attached to the nanopore that is able to process the strand, cleaving off one base at a time. The bases then flow through the nanopore and the current is measured. This method has the advantage of potentially solving the translocation rate problem, as the speed is controlled by the exonuclease. Here we consider the practical details of exonuclease attachment to the protein alpha hemolysin. We employ molecular dynamics simulations to determine the ideal (a) distance from alpha-hemolysin, and (b) the orientation of the monophosphate nucleotides upon release from the exonuclease such that they will enter the protein. Our results indicate an almost linear decrease in the probability of entry into the protein with increasing distance of nucleotide release. The nucleotide orientation is less significant for entry into the protein.

  2. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting

    PubMed Central

    Vlijm, Rifka; v.d. Torre, Jaco; Dekker, Cees


    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, have determined that AT-rich sequences have a lower binding energy than GC-rich sequences. In cells, however, the double-stranded backbone of DNA is destabilized by negative supercoiling, and not by temperature. To investigate what the effect of GC content is on DNA melting induced by negative supercoiling, we studied DNA molecules with a GC content ranging from 38% to 77%, using single-molecule magnetic tweezer measurements in which the length of a single DNA molecule is measured as a function of applied stretching force and supercoiling density. At low force (<0.5pN), supercoiling results into twisting of the dsDNA backbone and loop formation (plectonemes), without inducing any DNA melting. This process was not influenced by the DNA sequence. When negative supercoiling is introduced at increasing force, local melting of DNA is introduced. We measured for the different DNA molecules a characteristic force Fchar, at which negative supercoiling induces local melting of the dsDNA. Surprisingly, GC-rich sequences melt at lower forces than AT-rich sequences: Fchar = 0.56pN for 77% GC but 0.73pN for 38% GC. An explanation for this counterintuitive effect is provided by the realization that supercoiling densities of a few percent only induce melting of a few percent of the base pairs. As a consequence, denaturation bubbles occur in local AT-rich regions and the sequence-dependent effect arises from an increased DNA bending/torsional energy associated with the plectonemes. This new insight indicates that an increased GC-content adjacent to AT-rich DNA regions will enhance local opening of the double-stranded DNA helix. PMID:26513573

  3. Variation in number and formation of repeat sequences in the rDNA ITS2 region of five sibling species in the Anopheles barbirostris complex in Thailand.


    Otsuka, Yasushi


    Repeat sequences of approximately 100 base pairs in length were found in the rDNA ITS2 region of Anopheles barbirostris van der Wulp (Diptera: Culicidae) species A1, A2, A3, A4, and An. campestris-like in the An. barbirostris complex. Variation in the number of repeats was observed among the five sibling species. Specifically, 10 repeats were observed in A1, eight in A2, A4, and campestris-like, and three in A3. Based on similarities in the sequences of the repeats, related repeats were classified into nine groups. Although A2, A4, and the campestris-like species had the same number of repeats, the ITS2 region of the three species contained different groups of repeats. Excluding the repeat sequences facilitated good alignment of the ITS2 region in the five sibling species. Phylogenetic analyses of the 95 isolines were compared with results obtained from mitochondrial genes (COI and COII). The results revealed marked differences among the five sibling species, particularly regarding the ITS2 region of A3, which was more distinct from the other four species than COI and COIL Repeat sequences in the ITS2 region of other Anopheles species retrieved from GenBank also were analyzed. New repeat sequences were found in An. beklemishevi Stegnii and Kabanova, An. crucians Wiedemann and An. funestus Giles, suggesting that the occurrence of repeat sequences in the ITS2 region are not rare in anopheline mosquitoes.

  4. Quantitative analysis of dinoflagellates and diatoms community via Miseq sequencing of actin gene and v9 region of 18S rDNA

    PubMed Central

    Guo, Liliang; Sui, Zhenghong; Liu, Yuan


    Miseq sequencing and data analysis for the actin gene and v9 region of 18S rDNA of 7 simulated samples consisting of different mixture of dinoflagellates and diatoms were carried out. Not all the species were detectable in all the 18S v9 samples, and sequence percent in all the v9 samples were not consistent with the corresponding cell percent which may suggest that 18S rDNA copy number in different cells of these species differed greatly which result in the large deviation of the amplification. And 18S rDNA amplification of the microalgae was prone to be contaminated by fungus. The amplification of actin gene all was from the dinoflagellates because of its targeted degenerate primers. All the actin sequences of dinoflagellates were detected in the act samples except act4, and sequence percentage of the dinoflagellates in the act samples was not completely consistent with the dinoflagellates percentage of cell samples, but with certain amplification deviations. Indexes of alpha diversity of actin gene sequencing may be better reflection of community structure, and beta diversity analysis could cluster the dinoflagellates samples with identical or similar composition together and was distinguishable with blooming simulating samples at the generic level. Hence, actin gene was more proper than rDNA as the molecular marker for the community analysis of the dinoflagellates. PMID:27721499

  5. Procerain B, a cysteine protease from Calotropis procera, requires N-terminus pro-region for activity: cDNA cloning and expression with pro-sequence.


    Nandana, Vidhyadhar; Singh, Sushant; Singh, Abhay Narayan; Dubey, Vikash Kumar


    We have previously reported isolation and characterization of a novel plant cysteine protease, Procerain B, from the latex of Calotropis procera. Our initial attempts for active recombinant Procerain B in Escherichiacoli expression system was not successful. The reason for inactive enzyme production was attributed to the absence of 5' pro-region in the Procerain B cDNA that may be involved in proper folding and production of mature active protein. The current manuscript reports the cloning of full length Procerain B for the production of the active protein. The complete cDNA sequence of Procerain B with pro-region sequence was obtained by using RNA ligase mediated rapid amplification of 5' cDNA ends (RLM-RACE). The N-terminus pro-sequence region consists of 127 amino acids and characterized as the member of inhibitory I29 family. Further the three dimensional structure of full length Procerain B was modelled by homology modelling using X-ray crystal structure of procaricain (PDB ID: 1PCI). N-terminus pro-sequence of full length Procerain B runs along the active site cleft. Full length Procerain B was expressed in prokaryotic system and activated in vitro at pH 4.0. This is the first study reporting the production of active recombinant cysteine protease from C.procera. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Genetic diversity in captive and wild Matschie's tree kangaroo (Dendrolagus matschiei) from Huon Peninsula, Papua New Guinea, based on mtDNA control region sequences.


    McGreevy, Thomas J; Dabek, Lisa; Gomez-Chiarri, Marta; Husband, Thomas P


    The Association of Zoos and Aquariums (AZA) Matschie's tree kangaroo (Dendrolagus matschiei) population is at a critical point for assessing long-term viability. This population, established from 19 genetically uncharacterized D. matschiei, has endured a founder effect because only four individuals contributed the majority of offspring. The highly variable mitochondrial DNA (mtDNA) control region was sequenced for five of the female-founders by examining extant representatives of their maternal lineage and compared with wild (n = 13) and captive (n = 18) D. matschiei from Papua New Guinea (PNG). AZA female-founder D. matschiei control region haplotype diversity was low, compared with captive D. matschiei held in PNG. AZA D. matschiei have only two control region haplotypes because four out of five AZA female-founder D. matschiei had an identical sequence. Both AZA haplotypes were identified among the 17 wild and captive D. matschiei haplotypes from PNG. Genomic DNA extracted from wild D. matschiei fecal samples was a reliable source of mtDNA that could be used for a larger scale study. We recommend a nuclear DNA genetic analysis to more fully characterize AZA D. matschiei genetic diversity and to assist their Species Survival Plan((R)). An improved understanding of D. matschiei genetics will contribute substantially to the conservation of these unique animals both in captivity and the wild.

  7. Thermoelectric method for sequencing DNA.


    Nestorova, Gergana G; Guilbeau, Eric J


    This study describes a novel, thermoelectric method for DNA sequencing in a microfluidic device. The method measures the heat released when DNA polymerase inserts a deoxyribonucleoside triphosphate into a primed DNA template. The study describes the principle of operation of a laminar flow microfluidic chip with a reaction zone that contains DNA template/primer complex immobilized to the inner surface of the device's lower channel wall. A thin-film thermopile attached to the external surface of the lower channel wall measures the dynamic change in temperature that results when Klenow polymerase inserts a deoxyribonucleoside triphosphate into the DNA template. The intrinsic rejection of common-mode thermal signals by the thermopile in combination with hydrodynamic focused flow allows for the measurement of temperature changes on the order of 10(-4) K without control of ambient temperature. To demonstrate the method, we report the sequencing of a model oligonucleotide containing 12 bases. Results demonstrate that it is feasible to sequence DNA by measuring the heat released during nucleotide incorporation. This thermoelectric method for sequencing DNA may offer a novel new method of DNA sequencing for personalized medicine applications. © The Royal Society of Chemistry 2011

  8. The Nucleotide Capture Region of Alpha Hemolysin: Insights into Nanopore Design for DNA Sequencing from Molecular Dynamics Simulations

    PubMed Central

    Manara, Richard M. A.; Tomasio, Susana; Khalid, Syma


    Nanopore technology for DNA sequencing is constantly being refined and improved. In strand sequencing a single strand of DNA is fed through a nanopore and subsequent fluctuations in the current are measured. A major hurdle is that the DNA is translocated through the pore at a rate that is too fast for the current measurement systems. An alternative approach is “exonuclease sequencing”, in which an exonuclease is attached to the nanopore that is able to process the strand, cleaving off one base at a time. The bases then flow through the nanopore and the current is measured. This method has the advantage of potentially solving the translocation rate problem, as the speed is controlled by the exonuclease. Here we consider the practical details of exonuclease attachment to the protein alpha hemolysin. We employ molecular dynamics simulations to determine the ideal (a) distance from alpha-hemolysin, and (b) the orientation of the monophosphate nucleotides upon release from the exonuclease such that they will enter the protein. Our results indicate an almost linear decrease in the probability of entry into the protein with increasing distance of nucleotide release. The nucleotide orientation is less significant for entry into the protein.

  9. Statistical and linguistic features of DNA sequences

    NASA Technical Reports Server (NTRS)

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.


    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  10. Statistical and linguistic features of DNA sequences

    NASA Technical Reports Server (NTRS)

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.


    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  11. Biotools: Patenting DNA sequences

    SciTech Connect

    Yablonsky, M.D.; Hone, W.J.


    The decision, known as In re Deuel{sup 2}, rejects the PTO`s interpretation of a previous decision of the Federal Circuit and makes it more possible that a {open_quotes}nucleic acid of a particular sequence{close_quotes} - commonly known as a gene sequence - may be patentable. 15 refs.

  12. Phylogenetic relationships of Empetraceae inferred from sequences of chloroplast gene matK and nuclear ribosomal DNA ITS region.


    Li, Jianhua; Alexander, John; Ward, Tom; Del Tredici, Peter; Nicholson, Rob


    We used sequences of nrDNA ITS and chloroplast gene matK to evaluate the monophyly of Empetrum and Corema and to examine phylogenetic relationships of the Empetraceae. Sequences of these two DNA markers were obtained for 11 plant samples, representing species of Empetrum from both the Southern and Northern Hemispheres, species and subspecies of Corema, and the monotypic Ceratiola. Sequences of four species of Rhododendron were used for rooting purposes. Our results show that species of Empetrum form a clade sister to the clade containing both Corema and Ceratiola. These two clades are strongly supported in both the matK and ITS trees, suggesting that Ceratiola is more closely related to Corema than to Empetrum, and is not of a hybrid origin between the ancestors of the latter two genera. In the matK tree, Corema conradii is more closely related to Ceratiola than to Corema album and C. album subsp. azoricum, whereas in the ITS tree, Ceratiola is allied with Corema album and C. album subsp. azoricum. This suggests that C. conradii might be a hybrid between ancestral populations of Ceratiola and C. album. The monophyly of Empetrum rejects the hypothesis of its independent origin in the two Hemispheres. Our trees also suggest the fact that the modern amphitropical distribution of Empetrum is the result of long distance dispersal, not of the vicarious events. Copyright 2002 Elsevier Science (USA)

  13. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    USDA-ARS?s Scientific Manuscript database

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  14. Location of functional regions of the Escherichia coli RecA protein by DNA sequence analysis of RecA protease-constitutive mutants.

    PubMed Central

    Wang, W B; Tessman, E S


    In previous work (E. S. Tessman and P. K. Peterson, J. Bacteriol. 163:677-687 and 688-695, 1985), we isolated many novel protease-constitutive (Prtc) recA mutants, i.e., mutants in which the RecA protein was always in the protease state without the usual need for DNA damage to activate it. Most Prtc mutants were recombinase positive and were designated Prtc Rec+; only a few Prtc mutants were recombinase negative, and those were designated Prtc Rec-. We report changes in DNA sequence of the recA gene for several of these mutants. The mutational changes clustered at three regions on the linear RecA polypeptide. Region 1 includes amino acid residues 25 through 39, region 2 includes amino acid residues 157 through 184, and region 3 includes amino acid residues 298 through 301. The in vivo response of these Prtc mutants to different effectors suggests that the RecA effector-binding sites have been altered. In particular we propose that the mutations may define single-stranded DNA- and nucleoside triphosphate-binding domains of RecA, that polypeptide regions 1 and 3 comprise part of the single-stranded DNA-binding domain, and that polypeptide regions 2 and 3 comprise part of the nucleoside triphosphate-binding domain. The overlapping of single-stranded DNA- and nucleoside triphosphate-binding domains in region 3 can explain previously known complex allosteric effects. Each of four Prtc Rec- mutants sequenced was found to contain a single amino acid change, showing that the change of just one amino acid can affect both the protease and recombinase activities and indicating that the functional domains for these two activities of RecA overlap. A recA promoter-down mutation was isolated by its ability to suppress the RecA protease activity of one of our strong Prtc mutants. PMID:3536864

  15. Sequence variation of the ribosomal DNA second internal transcribed spacer region in two spatially-distinct populations of Amblyomma americanum (L.) (Acari: Ixodidae).


    Reichard, M V; Kocan, A A; Van Den Bussche, R A; Barker, R W; Wyckoff, J H; Ewing, S A


    Sequence analysis of the ribosomal DNA second internal transcribed spacer (ITS 2) region in 2 spatially distinct populations of Amblyomma americanum (L.) revealed intraspecific variation. Nucleotide sequences from multiple DNA extractions and several polymerase chain reaction amplifications of eggs from mixed-parentage samples from both populations of ticks revealed that 12 of 1,145 (1.0%) sites varied. Three of the 12 sites of variation were distinct between the 2 A. americanum populations, which corresponded to a rate of 0.26%. Phylogenetic analysis based on ITS 2 sequences provided strong support (i.e., bootstrap value of 80%) that wild A. americanum clustered into a distinguishable group separate from those derived from colony ticks.

  16. Inferring ethnicity from mitochondrial DNA sequence

    PubMed Central


    Background The assignment of DNA samples to coarse population groups can be a useful but difficult task. One such example is the inference of coarse ethnic groupings for forensic applications. Ethnicity plays an important role in forensic investigation and can be inferred with the help of genetic markers. Being maternally inherited, of high copy number, and robust persistence in degraded samples, mitochondrial DNA may be useful for inferring coarse ethnicity. In this study, we compare the performance of methods for inferring ethnicity from the sequence of the hypervariable region of the mitochondrial genome. Results We present the results of comprehensive experiments conducted on datasets extracted from the mtDNA population database, showing that ethnicity inference based on support vector machines (SVM) achieves an overall accuracy of 80-90%, consistently outperforming nearest neighbor and discriminant analysis methods previously proposed in the literature. We also evaluate methods of handling missing data and characterize the most informative segments of the hypervariable region of the mitochondrial genome. Conclusions Support vector machines can be used to infer coarse ethnicity from a small region of mitochondrial DNA sequence with surprisingly high accuracy. In the presence of missing data, utilizing only the regions common to the training sequences and a test sequence proves to be the best strategy. Given these results, SVM algorithms are likely to also be useful in other DNA sequence classification applications. PMID:21554759

  17. In silico discrimination of single nucleotide polymorphisms and pathological mutations in human gene promoter regions by means of local DNA sequence context and regularity.


    Khan, Imtiaz A; Mort, Matthew; Buckland, Paul R; O'Donovan, Michael C; Cooper, David N; Chuzhanova, Nadia A


    DNA sequence features were sought that could be used for the in silico ascertainment of the likely functional consequences of single nucleotide changes in human gene promoter regions. To identify relevant features of the local DNA sequence context, we transformed into consensus tables the nucleotide composition of sequences flanking 101 promoter SNPs of type C<-->T or A<-->G, defined empirically as being either 'functional' or 'non-functional' on the basis of a standardised reporter gene assay. The similarity of a given sequence to these consensus tables was then measured by means of the Shapiro-Senapathy score. A decision rule with the potential to discriminate between empirically ascertained functional and non-functional SNPs was proposed that potentiated discrimination between functional and non-functional SNPs with a sensitivity of 80% and a specificity of 20%. Two further datasets (viz. disease-associated SNPs of types A<-->G and C<-->T (N = 75) and pathological promoter mutations (transitions, N = 114)) were retrieved from the Human Gene Mutation Database (HGMD; and analyzed using consensus tables derived from the functional and non-functional promoter SNPs; approximately 70% were correctly recognized as being of probable functional significance. Complexity analysis was also used to quantify the regularity of the local DNA sequence environment. Functional SNPs/mutations of type C<-->T were found to occur in DNA regions characterized by lower average sequence complexity as measured with respect to symmetric elements; complexity values increased gradually from functional SNPs and pathological mutations to functional disease-associated SNPs and non-functional SNPs. This may reflect the internal axial symmetry that frequently characterizes transcription factor binding sites.

  18. Duplication in DNA Sequences

    NASA Astrophysics Data System (ADS)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  19. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.


    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E


    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described.

  20. Pericentromeric regions containing 1.688 satellite DNA sequences show anti-kinetochore antibody staining in prometaphase chromosomes of Drosophila melanogaster.


    Abad, J P; Agudo, M; Molina, I; Losada, A; Ripoll, P; Villasante, A


    A striking characteristic of the centromeric heterochromatin of Drosophila melanogaster is that each chromosome carries different satellite DNA sequences. Here we show that while the major component of the 1.688 satellite DNA family expands across the centromere of the X chromosome the rest of the minor variants are located at pericentromeric positions in the large autosomes. Immunostaining of prometaphase chromosomes with the kinetocore-specific anti-BUB1 antibody reveals the transient presence of this centromeric protein in all the regions containing the 1.688 satellite.

  1. ITS all right mama: investigating the formation of chimeric sequences in the ITS2 region by DNA metabarcoding analyses of fungal mock communities of different complexities.


    Bjørnsgaard Aas, Anders; Davey, Marie Louise; Kauserud, Håvard


    The formation of chimeric sequences can create significant methodological bias in PCR-based DNA metabarcoding analyses. During mixed-template amplification of barcoding regions, chimera formation is frequent and well documented. However, profiling of fungal communities typically uses the more variable rDNA region ITS. Due to a larger research community, tools for chimera detection have been developed mainly for the 16S/18S markers. However, these tools are widely applied to the ITS region without verification of their performance. We examined the rate of chimera formation during amplification and 454 sequencing of the ITS2 region from fungal mock communities of different complexities. We evaluated the chimera detecting ability of two common chimera-checking algorithms: perseus and uchime. Large proportions of the chimeras reported were false positives. No false negatives were found in the data set. Verified chimeras accounted for only 0.2% of the total ITS2 reads, which is considerably less than what is typically reported in 16S and 18S metabarcoding analyses. Verified chimeric 'parent sequences' had significantly higher per cent identity to one another than to random members of the mock communities. Community complexity increased the rate of chimera formation. GC content was higher around the verified chimeric break points, potentially facilitating chimera formation through base pair mismatching in the neighbouring regions of high similarity in the chimeric region. We conclude that the hypervariable nature of the ITS region seems to buffer the rate of chimera formation in comparison with other, less variable barcoding regions, due to shorter regions of high sequence similarity. © 2016 John Wiley & Sons Ltd.

  2. Analysis of the Escherichia coli genome VI: DNA sequence of the region from 92.8 through 100 minutes.

    PubMed Central

    Burland, V; Plunkett, G; Sofia, H J; Daniels, D L; Blattner, F R


    The 338.5 kb of the Escherichia coli genome described here together with previously described segments bring the total of contiguous finished sequence of this genome to > 1 Mb. Of 319 open reading frames (ORFs) found in this 338.5 kb segment, 147 (46%) are potential new genes. The positions of several genes which had been previously located here by mapping or partial sequencing have been confirmed. Several ORFs have functions suggested by similarities to other characterised genes but cannot be assigned with certainty. Fifteen of the ORFs of unknown function had been previously sequenced. Eight transfer RNAs are encoded in the region and there are two grey holes in which no features were found. The attachment site for phage P4 and three insertion sequences were located. The region was also analysed for chi sites, bend sites, REP elements and other repeats. A computer search identified potential promoters and tentative transcription units were assigned. The occurrence of the rare tetramer CTAG was analysed in 1.6 Mb of contiguous E.coli sequence. Hypotheses addressing the rarity and distribution of CTAG are discussed. PMID:7610040

  3. DNA sequencing with pyrophosphatase


    Tabor, Stanley; Richardson, Charles C.


    A kit or solution for use in extension of an oligonucleotide primer having a first single-stranded region on a template molecule having a second single-stranded region homologous to the first single-stranded region, comprising a first agent able to cause extension of the first single-stranded region of the primer on the second single-stranded region of the template in a reaction mixture, and a second agent able to reduce the amount of pyrophosphate in the reaction mixture below the amount produced during the extension in the absence of the second agent.

  4. DNA sequencing with pyrophosphatase


    Tabor, S.; Richardson, C.C.


    A kit or solution is disclosed for use in extension of an oligonucleotide primer having a first single-stranded region on a template molecule and having a second single-stranded region homologous to the first single-stranded region. The first agent is able to cause extension of the first single-stranded region of the primer on the second single-stranded region of the template in a reaction mixture. The second agent is able to reduce the amount of pyrophosphate in the reaction mixture below the amount produced during the extension in the absence of the second agent.

  5. The sequence of sequencers: The history of sequencing DNA.


    Heather, James M; Chain, Benjamin


    Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way.

  6. Image analysis for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Palaniappan, Kannappan; Huang, Thomas S.


    There is a great deal of interest in automating the process of DNA (deoxyribonucleic acid) sequencing to support the analysis of genomic DNA such as the Human and Mouse Genome projects. In one class of gel-based sequencing protocols autoradiograph images are generated in the final step and usually require manual interpretation to reconstruct the DNA sequence represented by the image. The need to handle a large volume of sequence information necessitates automation of the manual autoradiograph reading step through image analysis in order to reduce the length of time required to obtain sequence data and reduce transcription errors. Various adaptive image enhancement, segmentation and alignment methods were applied to autoradiograph images. The methods are adaptive to the local characteristics of the image such as noise, background signal, or presence of edges. Once the two-dimensional data is converted to a set of aligned one-dimensional profiles waveform analysis is used to determine the location of each band which represents one nucleotide in the sequence. Different classification strategies including a rule-based approach are investigated to map the profile signals, augmented with the original two-dimensional image data as necessary, to textual DNA sequence information.

  7. The rDNA ITS region in the lessepsian marine angiosperm Halophila stipulacea (Forssk.) Aschers. (Hydrocharitaceae): intragenomic variability and putative pseudogenic sequences.


    Ruggiero, Maria Valeria; Procaccini, Gabriele


    Halophila stipulacea is a dioecious marine angiosperm, widely distributed along the western coasts of the Indian Ocean and the Red Sea. This species is thought to be a Lessepsian immigrant that entered the Mediterranean Sea from the Red Sea after the opening of the Suez Canal (1869). Previous studies have revealed both high phenotypic and genetic variability in Halophila stipulacea populations from the western Mediterranean basin. In order to test the hypothesis of a Lessepsian introduction, we compare genetic polymorphism between putative native (Red Sea) and introduced (Mediterranean) populations through rDNA ITS region (ITS1-5.8S-ITS2) sequence analysis. A high degree of intraindividual variability of ITS sequences was found. Most of the intragenomic polymorphism was due to pseudogenic sequences, present in almost all individuals. Features of ITS functional sequences and pseudogenes are described. Possible causes for the lack of homogenization of ITS paralogues within individuals are discussed.

  8. DNA sequence variation in the mitochondrial control region of subterranean mole rats, Spalax ehrenbergi superspecies, in Israel.


    Reyes, Aurelio; Nevo, Eviatar; Saccone, Cecilia


    The complete mitochondrial control region was sequenced for 60 individuals representing different populations for each of the four species of the subterranean mole rat Spalax ehrenbergi superspecies in Israel: Spalax galili (2n = 52), S. golani (2n = 54), S. carmeli (2n = 58), and S. judaei (2n = 60). The control region of all species and populations is very similar both in length (979 to 983 bp) and in base composition. As in agreement with previous surveys on mitochondrial control regions on mammals, the mole rat control region can be divided into a central domain and two flanking domains, ETAS (extended termination associated sequences) and CSB (conserved sequence blocks). Along with the common conserved blocks found in these domains (ETAS1, ETAS2, CSB1, CSB2, and CSB3), we have also detected in all individuals an ETAS1-like and a CSB1-like element, both in the ETAS domain. The most conserved region was the central domain, followed by the CSB and ETAS domains, showing important differences in the four species analyzed. Phylogenetic analysis supported the existence of two clades. One clade contained individuals belonging to Spalax galili (2n = 52) and S. golani (2n = 54), separated in two different branches depending on the species. The other clade contained individuals belonging to S. carmeli (2n = 58) and S. judaei (2n = 60) mixed together, suggesting a more recent event of speciation. Within species we have observed a southward trend of increasing variability. These results have been explained as a consequence of the adaptation of the species to ecological factors such as aridity and temperature stresses.

  9. Sequence of a cDNA encoding the bi-specific NAD(P)H-nitrate reductase from the tree Betula pendula and identification of conserved protein regions.


    Friemann, A; Brinkmann, K; Hachtel, W


    Nitrate reductase (NR) assays revealed a bispecific NAD(P)H-NR (EC to be the only nitrate-reducing enzyme in leaves of hydroponically grown birches. To obtain the primary structure of the NAD(P)H-NR, leaf poly(A)+ mRNA was used to construct a cDNA library in the lambda gt11 phage. Recombinant clones were screened with heterologous gene probes encoding NADH-NR from tobacco and squash. A 3.0 kb cDNA was isolated which hybridized to a 3.2 kb mRNA whose level was significantly higher in plants grown on nitrate than in those grown on ammonia. The nucleotide sequence of the cDNA comprises a reading frame encoding a protein of 898 amino acids which reveals 67%-77% identity with NADH-nitrate reductase sequences from higher plants. To identify conserved and variable regions of the multicentre electron-transfer protein a graphical evaluation of identities found in NR sequence alignments was carried out. Thirteen well-conserved sections exceeding a size of 10 amino acids were found in higher plant nitrate reductases. Sequence comparisons with related redox proteins indicate that about half of the conserved NR regions are involved in cofactor binding. The most striking difference in the birch NAD(P)H-NR sequence in comparison to NADH-NR sequences was found at the putative pyridine nucleotide binding site. Southern analysis indicates that the bi-specific NR is encoded by a single copy gene in birch.

  10. Genetic diversity of Histoplasma capsulatum strains isolated from Argentina based on nucleotide sequence variations in the internal transcribed spacer regions of rDNA.


    Landaburu, Fernanda; Cuestas, María Luján; Rubio, Andrea; Elías, Nahuel Alejandro; Daneri, Gabriela Lopez; Veciño, Cecilia; Iovannitti, Cristina A; Mujica, María Teresa


    The internal transcribed spacer (ITS) regions of rDNA genes of 49 Histoplasma capsulatum (48 from clinical samples and one from soil) isolates were examined. Nucleotide sequence heterogeneity within this region was useful for phylogenetic classification of H. capsulatum and species identification. Thus, in 45 of 49 isolates we observed higher percentages of identity in the nucleotide sequences of ITS regions when the isolates studied herein were compared with those reported in our country in the South America B clade. Phylogenetic analyses of rDNA sequences corresponding to the 537 bp of the ITS region obtained from H. capsulatum isolates assigned South America type B clade (45 isolates), North America type 1 and Asia clade (2 isolates each one). H. capsulatum strains isolated from soil and from patients living in Argentina (45 of 49) clustered together with the H. capsulatum isolates of the South America B clade. The high level of genetic similarity among our isolates suggests that almost one genetic population is present in the microenvironment. Isolates described as H. capsulatum var. capsulatum or var. farciminosum (2 isolates) did not form a monophyletic group and were found in the Asia clade. Subsequent studies are needed to properly identify these isolates.

  11. DNA Sequencing Sensors: An Overview

    PubMed Central

    Garrido-Cardenas, Jose Antonio; Garcia-Maroto, Federico; Alvarez-Bermejo, Jose Antonio; Manzano-Agugliaro, Francisco


    The first sequencing of a complete genome was published forty years ago by the double Nobel Prize in Chemistry winner Frederick Sanger. That corresponded to the small sized genome of a bacteriophage, but since then there have been many complex organisms whose DNA have been sequenced. This was possible thanks to continuous advances in the fields of biochemistry and molecular genetics, but also in other areas such as nanotechnology and computing. Nowadays, sequencing sensors based on genetic material have little to do with those used by Sanger. The emergence of mass sequencing sensors, or new generation sequencing (NGS) meant a quantitative leap both in the volume of genetic material that was able to be sequenced in each trial, as well as in the time per run and its cost. One can envisage that incoming technologies, already known as fourth generation sequencing, will continue to cheapen the trials by increasing DNA reading lengths in each run. All of this would be impossible without sensors and detection systems becoming smaller and more precise. This article provides a comprehensive overview on sensors for DNA sequencing developed within the last 40 years. PMID:28335417

  12. Mining poly-regions in DNA.


    Papapetrou, Panagiotis; Benson, Gary; Kollios, George


    We study the problem of mining poly-regions in DNA. A poly-region is defined as a bursty DNA area, i.e., area of elevated frequency of a DNA pattern. We introduce a general formulation that covers a range of meaningful types of poly-regions and develop three efficient detection methods. The first applies recursive segmentation and is entropy-based. The second uses a set of sliding windows that summarize each sequence segment using several statistics. Finally, the third employs a technique based on majority vote. The proposed algorithms are tested on DNA sequences of four different organisms in terms of recall and runtime.

  13. Quadruplex DNA: sequence, topology and structure

    PubMed Central

    Burge, Sarah; Parkinson, Gary N.; Hazel, Pascale; Todd, Alan K.; Neidle, Stephen


    G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and biological validation of these structures is starting to be explored, and there is particular interest in them as targets for therapeutic intervention. This survey focuses on the folding and structural features on quadruplexes formed from telomeric and non-telomeric DNA sequences, and examines fundamental aspects of topology and the emerging relationships with sequence. Emphasis is placed on information from the high-resolution methods of X-ray crystallography and NMR, and their scope and current limitations are discussed. Such information, together with biological insights, will be important for the discovery of drugs targeting quadruplexes from particular genes. PMID:17012276

  14. Helena, the hidden beauty: Resolving the most common West Eurasian mtDNA control region haplotype by massively parallel sequencing an Italian population sample.


    Bodner, Martin; Iuvaro, Alessandra; Strobl, Christina; Nagl, Simone; Huber, Gabriela; Pelotti, Susi; Pettener, Davide; Luiselli, Donata; Parson, Walther


    The analysis of mitochondrial (mt)DNA is a powerful tool in forensic genetics when nuclear markers fail to give results or maternal relatedness is investigated. The mtDNA control region (CR) contains highly condensed variation and is therefore routinely typed. Some samples exhibit an identical haplotype in this restricted range. Thus, they convey only weak evidence in forensic queries and limited phylogenetic information. However, a CR match does not imply that also the mtDNA coding regions are identical or samples belong to the same phylogenetic lineage. This is especially the case for the most frequent West Eurasian CR haplotype 263G 315.1C 16519C, which is observed in various clades within haplogroup H and occurs at a frequency of 3-4% in many European populations. In this study, we investigated the power of massively parallel complete mtGenome sequencing in 29 Italian samples displaying the most common West Eurasian CR haplotype - and found an unexpected high diversity. Twenty-eight different haplotypes falling into 19 described sub-clades of haplogroup H were revealed in the samples with identical CR sequences. This study demonstrates the benefit of complete mtGenome sequencing for forensic applications to enforce maximum discrimination, more comprehensive heteroplasmy detection, as well as highest phylogenetic resolution.

  15. The human clotting factor VIII cDNA contains an autonomously replicating sequence consensus- and matrix attachment region-like sequence that binds a nuclear factor, represses heterologous gene expression, and mediates the transcriptional effects of sodium butyrate.

    PubMed Central

    Fallaux, F J; Hoeben, R C; Cramer, S J; van den Wollenberg, D J; Briët, E; van Ormondt, H; van Der Eb, A J


    Expression of the human blood-clotting factor VIII (FVIII) cDNA is hampered by the presence of sequences located in the coding region that repress transcription. We have previously identified a 305-bp fragment within the FVIII cDNA that is involved in the repression (R.C. Hoeben, F.J. Fallaux, S.J. Cramer, D.J.M. van den Wollenberg, H. van Ormondt, E. Briet, and A.J. van der Eb, Blood 85:2447-2454, 1995). Here, we show that this 305-bp region of FVIII cDNA contains sequences that resemble the yeast (Saccharomyces cerevisiae) autonomously replicating sequence consensus. Two of these DNA elements coincide with AT-rich sequences that are often found in matrix attachment regions or scaffold-attached regions. One of these elements, consisting of nucleotides 1569 to 1600 of the FVIII cDNA (nucleotide numbering is according to the system of Wood et al. (W.I. Wood, D.J. Capon, C.C. Simonsen, D.L. Eaton, J. Gitschier, D. Keyt, P.H. Seeburg, D.H. Smith, P. Hollingshead, K.L. Wion, et al., Nature [London] 312:330-337,1984), binds a nuclear factor in vitro but loses this capacity after four of its base pairs have been changed. A synthetic heptamer of this segment can repress the expression of a chloramphenicol acetyltransferase (CAT) reporter gene and also loses this capacity upon mutation. Furthermore, we demonstrate that repression by FVIII sequences can be relieved by sodium butyrate. We demonstrate that the synthetic heptamer (FVIII nucleotides 1569 to 1600), when placed upstream of the Moloney murine leukemia virus long terminal repeat promoter that drives the CAT reporter, can render the CAT reporter inducible by butyrate. This effect was absent when the same element was mutated. The stimulatory effect of butyrate could not be attributed to butyrate-responsive elements in the studied long terminal repeat promoters. Our data provide a functional characterization of the sequences that repress expression of the FVIII cDNA. These data also suggest a link between

  16. DNA sequence of a mutation in the leader region of the yeast iso-1-cytochrome c mRNA

    SciTech Connect

    Stiles, J.I.; Szostak, J.W.; Young, A.T.; Wu, R.; Consaul, S.; Sherman, F.


    A plasmid was constructed that selectively integrates adjacent to the CYC1 locus, which determines iso-1-cytochrome c in the yeast Saccharomyces cerevisiae. Different CYC1 alleles can be conveniently recovered by digestion of total DNA from transformed strains with BgI II, a restriction endouclease that does not cut the vector or the CYC1 gene, followed by transformation of Escherichia coli, selecting the ampicillin resistance gene carried on the original vector. This procedure was used to clone the cyc1-362 gene, which contains an alteration in front of the AUG initiation codon. The cyc1-362 mutation causes a deficiency of the iso-1-cytochrome c protein but still allows transcription of the iso-1-cytochrome c mRNA. DNA sequence analysis showed that the cyc1-362 mutation consisted of two single-base-pair substitutions, producing an A ..-->.. G change 18 nucleotides and a G ..-->.. A change 30 nucleotides in front of the AUG initiation codon in the mRNA. The A ..-->.. G change at position -18 resulted in the creation of an AUG triplet, which is proximal to the normal initiation site and out of phase with the normal reading frame. The deficiency of iso-1-cytochrome c is most simply explained by assuming that translation initiates at the more proximal abnormal AUG site but not at the normal AUG site.

  17. Complete mitochondrial DNA sequence of the sea-firefly, Vargula hilgendorfii (Crustacea, Ostracoda) with duplicate control regions.


    Ogoh, Katsunori; Ohmiya, Yoshihiro


    The primary structure of the mitochondrial genome of the bioluminescent crustacean, Vargula hilgendorfii, the sea-firefly (Arthropoda, Crustacea, Ostracoda), has sequenced using the transposon Tn5. The genome (15,923 bp) contains the same 37 genes (two ribosomal RNAs, 22 transfer RNAs, and 13 protein-coding genes) found in other Arthropoda. Interestingly, duplicate control regions (fragments of 778 and 855 bp) and triplicate short repeat sequences (fragments of 49 bp) occur. The AT composition of the protein-coding genes is lower than the published complete mitochondrial genomes within the Arthropoda. For gene arrangement, 13 transfer RNA genes and two protein-coding genes have moved and inserted directly or inversely relative to the typical Arthropoda order.

  18. Genetic variation between two Tibetan macaque (Macaca thibetana) populations in the eastern China based on mitochondrial DNA control region sequences.


    Yao, Yongfang; Zhong, Lijing; Liu, Bofeng; Li, Jiayi; Ni, Qingyong; Xu, Huailiang


    Tibetan macaque (Macaca thibetana) is a threatened primate species endemic to China. Population genetic and phylogenetic analyses were conducted in 66 Tibetan individuals from Sichuan (SC), Huangshan (HS), and Fujian (FJ) based on a 477-bp fragment of mitochondrial DNA control region. Four new haplotypes were defined, and a relatively high level of genetic diversity was first observed in FJ populations (Hd = 0.7661). Notably, a continuous approximately 10 bp-fragment deletion was observed near the 5' end of the mtDNA control region of both HS and FJ populations when compared with that of SC population, and a sharing haplotype was found between the two populations, revealing a closer genetic relationship. However, significant genetic differentiation (FST = 0.8700) and more poor gene exchange (Nm < 1) had occurred among three populations. This study mainly provide a further insight into the genetic relationship between HS and FJ Tibetan macaque populations, but it may be necessary to carry out further study with extra samples from other locations in the geographic coverage of the two subspecies (M. thibetana pullus and M. thibetana huangshanensis).

  19. Sequences of conserved region in the A subunit of DNA gyrase from nine species of the genus Mycobacterium: phylogenetic analysis and implication for intrinsic susceptibility to quinolones.


    Guillemin, I; Cambau, E; Jarlier, V


    The sequences of a conserved region in the A subunit of DNA gyrase corresponding to the quinolone resistance-determining region were determined for nine mycobacterial species and were compared. Although the nucleotide sequences were highly conserved, they clearly differentiated one species from another. The results of the phylogenetic analysis based on the sequences of the quinolone resistance-determining regions were compared with those provided by the 16S rRNA sequences. Deduced amino acid sequences were identical within the nine species except for amino acid 83, which was frequently involved in acquired resistance to quinolones in many genera, including mycobacteria. The presence at position 83 of an alanine for seven mycobacterial species (M. tuberculosis, M. bovis BCG, M. leprae, M. avium, M. kansasii, M. chelonae, and M. smegmatis) and of a serine for the two remaining mycobacterial species (M. fortuitum and M. aurum) correlated well with the MICs of ofloxacin for both groups of species, suggesting the role of this residue in intrinsic susceptibility to quinolones in mycobacteria.

  20. Sequencing of the intergenic 16S-23S rRNA spacer (ITS) region of Mollicutes species and their identification using microarray-based assay and DNA sequencing.


    Volokhov, Dmitriy V; George, Joseph; Liu, Sue X; Ikonomi, Pranvera; Anderson, Christine; Chizhikov, Vladimir


    We have completed sequencing the 16S-23S rRNA intergenic transcribed spacer (ITS) region of most known Mycoplasma , Acholeplasma , Ureaplasma , Mesoplasma , and Spiroplasma species. Analysis of the sequence data revealed a significant interspecies variability and low intraspecies polymorphism of the ITS region among Mollicutes . This finding enabled the application of a combined polymerase chain reaction-microarray technology for identifying Mollicutes species. The microarray included individual species-specific oligonucleotide probes for characterizing human Mollicutes species and other species known to be common cell line contaminants. Evaluation of the microarray was conducted using multiple, previously characterized, Mollicutes species. The microarray analysis of the samples used demonstrated a highly specific assay, which is capable of rapid and accurate discrimination among Mollicutes species.

  1. Nanogrid rolling circle DNA sequencing


    Church, George M.; Porreca, Gregory J.; Shendure, Jay; Rosenbaum, Abraham Meir


    The present invention relates to methods for sequencing a polynucleotide immobilized on an array having a plurality of specific regions each having a defined diameter size, including synthesizing a concatemer of a polynucleotide by rolling circle amplification, wherein the concatemer has a cross-sectional diameter greater than the diameter of a specific region, immobilizing the concatemer to the specific region to make an immobilized concatemer, and sequencing the immobilized concatemer.

  2. Structural Complexity of DNA Sequence

    PubMed Central

    Liou, Cheng-Yuan; Cheng, Wei-Chen; Tsai, Huai-Ying


    In modern bioinformatics, finding an efficient way to allocate sequence fragments with biological functions is an important issue. This paper presents a structural approach based on context-free grammars extracted from original DNA or protein sequences. This approach is radically different from all those statistical methods. Furthermore, this approach is compared with a topological entropy-based method for consistency and difference of the complexity results. PMID:23662161

  3. A highly basic sequence at the N-terminal region is essential for targeting the DNA replication protein ORC1 to the nucleus in Leishmania donovani.


    Kumar, Devanand; Kumar, Diwakar; Saha, Swati


    The conserved eukaryotic DNA replication protein ORC1 is one of the constituents of pre-replication complexes that assemble at or very near origins prior to replication initiation. ORC1 has been shown to be constitutively nuclear in Leishmania major. This study investigates the sequences involved in nuclear localization of ORC1 in Leishmania donovani, the causative agent of visceral leishmaniasis. Nuclear localization signals (NLSs) have been reported in only a few Leishmania proteins. Functional analyses have delineated NLSs to regions of ~60 amino acids in length in the tyrosyl DNA phosphodiesterase I and type II DNA topoisomerase of L. donovani, and in the L. major kinesin KIN13-1. Using a panel of site-directed mutations we have identified a sequence essential for nuclear import of LdORC1. This sequence at the N terminus of the protein comprises residues 2-5 (KRSR), with K2, R3 and R5 being crucial. Independent mutation of the K2 residue causes exclusion of the protein from the nucleus, while mutating the R5 residue leads to diffusion of the protein throughout the cell. This sequence, however, is insufficient for targeting a heterologous protein (β-galactosidase) to the nucleus. Analysis of additional ORC1 mutations and reporter constructs reveals that while the highly basic tetra-amino acid sequence at the N terminus is essential for nuclear localization, the ORC1 NLS in its entirety is more complex, and of a distributive character. Our results suggest that nuclear localization signalling sequences in Leishmania nuclear proteins are more complex than what is typically seen in higher eukaryotes.

  4. Sequencing mitochondrial DNA polymorphisms by hybridization

    SciTech Connect

    Chee, M.S.; Lockhart, D.J.; Hubbell, E.


    We have investigated the use of DNA chips for genetic analysis, using human mitochondrial DNA (mtDNA) as a model. The DNA chips are made up of ordered arrays of DNA oligonucleotide probes, synthesized on a glass substrate using photolithographic techniques. The synthesis site for each different probe is specifically addressed by illumination of the substrate through a photolithographic mask, achieving selective deprotection Nucleoside phosphoramidites bearing photolabile protecting groups are coupled only to exposed sites. Repeated cycles of deprotection and coupling generate all the probes in parallel. The set of 4{sup N} N-mer probes can be synthesized in only 4N steps. Any subset can be synthesized in 4N steps. Any subset can be synthesized in 4N or fewer steps. Sequences amplified from the D-loop region of human mitochondrial DNA (mtDNA) were fluorescently labelled and hybridized to DNA chips containing probes specific for mtDNA. Each nucleotide of a 1.3 kb region spanning the D loop is represented by four probes on the chip. Each probe has a different base at the position of interest: together they comprise a set of A, C, G and T probes which are otherwise identical. In principle, only one probe-target hybrid will be a perfect match. The other three will be single base mismatches. Fluorescence imaging of the hybridized chip allows quantification of hybridization signals. Heterozygous mixtures of sequences can also be characterized. We have developed software to quantitate and interpret the hybridization signals, and to call the sequence automatically. Results of sequence analysis of human mtDNAs will be presented.

  5. DNA Sequencing by Capillary Electrophoresis

    PubMed Central

    Karger, Barry L.; Guttman, Andras


    Sequencing of human and other genomes has been at the center of interest in the biomedical field over the past several decades and is now leading toward an era of personalized medicine. During this time, DNA sequencing methods have evolved from the labor intensive slab gel electrophoresis, through automated multicapillary electrophoresis systems using fluorophore labeling with multispectral imaging, to the “next generation” technologies of cyclic array, hybridization based, nanopore and single molecule sequencing. Deciphering the genetic blueprint and follow-up confirmatory sequencing of Homo sapiens and other genomes was only possible by the advent of modern sequencing technologies that was a result of step by step advances with a contribution of academics, medical personnel and instrument companies. While next generation sequencing is moving ahead at break-neck speed, the multicapillary electrophoretic systems played an essential role in the sequencing of the Human Genome, the foundation of the field of genomics. In this prospective, we wish to overview the role of capillary electrophoresis in DNA sequencing based in part of several of our articles in this journal. PMID:19517496

  6. A Demonstration of Automated DNA Sequencing.

    ERIC Educational Resources Information Center

    Latourelle, Sandra; Seidel-Rogol, Bonnie


    Details a simulation that employs a paper-and-pencil model to demonstrate the principles behind automated DNA sequencing. Discusses the advantages of automated sequencing as well as the chemistry of automated DNA sequencing. (DDR)

  7. Identification and Typing of Malassezia Species by Amplified Fragment Length Polymorphism and Sequence Analyses of the Internal Transcribed Spacer and Large-Subunit Regions of Ribosomal DNA

    PubMed Central

    Gupta, Aditya K.; Boekhout, Teun; Theelen, Bart; Summerbell, Richard; Batra, Roma


    Malassezia yeasts are associated with several dermatological disorders. The conventional identification of Malassezia species by phenotypic methods is complicated and time-consuming, and the results based on culture methods are difficult to interpret. A comparative molecular approach based on the use of three molecular techniques, namely, amplified fragment length polymorphism (AFLP) analysis, sequencing of the internal transcribed spacer, and sequencing of the D1 and D2 domains of the large-subunit ribosomal DNA region, was applied for the identification of Malassezia species. All species could be correctly identified by means of these methods. The results of AFLP analysis and sequencing were in complete agreement with each other. However, some discrepancies were noted when the molecular methods were compared with the phenotypic method of identification. Specific genotypes were distinguished within a collection of Malassezia furfur isolates from Canadian sources. AFLP analysis revealed significant geographical differences between the North American and European M. furfur strains. PMID:15365020

  8. Genomic organization of the human PAX 3 gene: DNA sequence analysis of the region disrupted in alveolar rhabdomyosarcoma

    SciTech Connect

    Macina, R.A.; Galili, N.; Riethman, H.C.


    Mutations in the human PAX3 gene have previously been associated with two distinct diseases, Waardenburg syndrome and alveolar rhabdomyosarcoma. In this report the authors establish that the normal human PAX3 gene is encoded by 8 exons. Intron-exon boundary sequences were obtained for PAX 3 exons 5, 6, 7, and 8 and together with previous work provide the complete genomic sequence organization for PAX3. Difficulties in obtaining overlapping genomic clone coverage of PAX3 were circumvented in part by RARE cleavage mapping, which showed that the entire PAX3 gene spans 100 kb of chromosome 2. Sequence analysis of the last intron of PAX3, which contains the previously mapped t(2;13)(q35;q14) translocation breakpoints of alveolar rhabdomyosarcoma, revealed the presence of a pair of inverted Alu repeats and a pair of inverted (GT){sub n}-rich microsatellite repeats with in a 5k-kb region. This work establishes the complete structure of PAX 3 and will permit high-resolution analyses of this locus for mutations associated with Waardenburg syndrome, alveolar rhabdomyosarcoma, and other phenotypes for which PAX3 may be a candidate locus.31 refs., 5 figs., 1 tab.

  9. mtDNA control-region sequence variation suggests multiple independent origins of an "Asian-specific" 9-bp deletion in sub-Saharan Africans.

    PubMed Central

    Soodyall, H.; Vigilant, L.; Hill, A. V.; Stoneking, M.; Jenkins, T.


    The intergenic COII/tRNA(Lys) 9-bp deletion in human mtDNA, which is found at varying frequencies in Asia, Southeast Asia, Polynesia, and the New World, was also found in 81 of 919 sub-Saharan Africans. Using mtDNA control-region sequence data from a subset of 41 individuals with the deletion, we identified 22 unique mtDNA types associated with the deletion in Africa. A comparison of the unique mtDNA types from sub-Saharan Africans and Asians with the 9-bp deletion revealed that sub-Saharan Africans and Asians have sequence profiles that differ in the locations and frequencies of variant sites. Both phylogenetic and mismatch-distribution analysis suggest that 9-bp deletion arose independently in sub-Saharan Africa and Asia and that the deletion has arisen more than once in Africa. Within Africa, the deletion was not found among Khoisan peoples and was rare to absent in western and southwestern African populations, but it did occur in Pygmy and Negroid populations from central Africa and in Malawi and southern African Bantu-speakers. The distribution of the 9-bp deletion in Africa suggests that the deletion could have arisen in central Africa and was then introduced to southern Africa via the recent "Bantu expansion." PMID:8644719

  10. The Complete Sequence of 340 kb of DNA around the Rice Adh1–Adh2 Region Reveals Interrupted Colinearity with Maize Chromosome 4

    PubMed Central

    Tarchini, Renato; Biddle, Phyllis; Wineland, Robin; Tingey, Scott; Rafalski, Antoni


    A 2.3-centimorgan (cM) segment of rice chromosome 11 consisting of 340 kb of DNA sequence around the alcohol dehydrogenase Adh1 and Adh2 loci was completely sequenced, revealing the presence of 33 putative genes, including several apparently involved in disease resistance. Fourteen of the genes were confirmed by identifying the corresponding transcripts. Five genes, spanning 1.9 cM of the region, cross-hybridized with maize genomic DNA and were genetically mapped in maize, revealing a stretch of colinearity with maize chromosome 4. The Adh1 gene marked one significant interruption. This gene mapped to maize chromosome 1, indicating a possible translocation of Adh1 after the evolutionary divergence leading to maize and sorghum. Several other genes, most notably genes similar to known disease resistance genes, showed no cross-hybridization with maize genomic DNA, suggesting sequence divergence or absence of these sequences in maize, which is in contrast to several other well-conserved genes, including Adh1 and Adh2. These findings indicate that the use of rice as the model system for other cereals may sometimes be complicated by the presence of rapidly evolving gene families and microtranslocations. Seven retrotransposons and eight transposons were identified in this rice segment, including a Tc1/Mariner–like element, which is new to rice. In contrast to maize, retroelements are less frequent in rice. Only 14.4% of this genome segment consist of retroelements. Miniature inverted repeat transposable elements were found to be the most frequently occurring class of repetitive elements, accounting for 18.8% of the total repetitive DNA. PMID:10715324

  11. Apparatus for improved DNA sequencing


    Douthart, Richard J.; Crowell, Shannon L.


    This invention is a means for the rapid sequencing of DNA samples. More specifically, it consists of a new design direct blotting electrophoresis unit. The DNA sequence is deposited on a membrane attached to a rotating drum. Initial data compaction is facilitated by the use of a machined multi-channeled plate called a ribbon channel plate. Each channel is an isolated mini gel system much like a gel filled capillary. The system as a whole, however, is in a slab gel like format with the advantages of uniformity and easy reusability. The system can be used in different embodiments. The drum system is unique in that after deposition the drum rotates the deposited DNA into a large non-buffer open space where processing and detection can occur. The drum can also be removed in toto to special workstations for downstream processing, multiplexing and detection.

  12. Apparatus for improved DNA sequencing


    Douthart, R.J.; Crowell, S.L.


    This invention is a means for the rapid sequencing of DNA samples. More specifically, it consists of a new design direct blotting electrophoresis unit. The DNA sequence is deposited on a membrane attached to a rotating drum. Initial data compaction is facilitated by the use of a machined multi-channeled plate called a ribbon channel plate. Each channel is an isolated mini gel system much like a gel filled capillary. The system as a whole, however, is in a slab gel like format with the advantages of uniformity and easy reusability. The system can be used in different embodiments. The drum system is unique in that after deposition the drum rotates the deposited DNA into a large non-buffer open space where processing and detection can occur. The drum can also be removed in toto to special workstations for downstream processing, multiplexing and detection. 18 figs.

  13. Molecular phylogeny for marine turtles based on sequences of the ND4-leucine tRNA and control regions of mitochondrial DNA.


    Dutton, P H; Davis, S K; Guerra, T; Owens, D


    Marine turtles are divided into two families, the Dermochelyidae and the Cheloniidae. The majority of species are currently placed within the two tribes of the Cheloniidae, the Chelonini and the Carettini, but debate continues over generic and tribal affinities as well as species boundaries. We used nucleotide sequences (907 bp) from the ND4-LEU tRNA region and the control region (526 bp) of mitochondrial DNA to resolve areas of uncertainty in marine turtle (Chelonioidae) systematics. The ND4-LEU tRNA fragment was more conserved than the fragment from the control region, with sequence divergences ranging from 0.026 to 0.148 and 0.067 to 0.267, respectively. Parsimony analysis based only on the ND4-LEU tRNA data suggests that the hawksbill, Eretmochelys imbricata, lies within the tribe Carettni and is closely related to the genus Caretta, but could not resolve the position of the flatback, Natator depressus. A similar analysis based only on the control region sequence data suggested that N. depressus is affiliated with the Chelonini, but failed to resolve the position of E. imbricata and the loggerhead, Caretta caretta. In contrast to these results, the combination of both data sets with published cytochrome b data produced a phylogeny based on 1924 bp of sequence data which resolves the position of E. imbricata relative to Caretta and Lepidochelys and joins N. depressus as sister to the Carettini. Based on the molecular data, the Chelonini contains the Chelonia species, while the Carettini contains the remaining species of Cheloniidae. The control region sequence divergence between Pacific and Atlantic populations of the leatherback, Dermochelys coriacea, was relatively low (0.0081) when compared with the green turtle, Chelonia mydas (0.071-0.074). Atlantic and Pacific populations of Ch. mydas were found to be paraphyletic with respect to the black turtle, Ch. agassizi, suggesting that the current taxonomic designations within the Pacific Chelonia are questionable

  14. Nucleotide sequence of Marchantia polymorpha chloroplast DNA: a region possibly encoding three tRNAs and three proteins including a homologue of E. coli ribosomal protein S14.

    PubMed Central

    Umesono, K; Inokuchi, H; Ohyama, K; Ozeki, H


    The nucleotide sequence of a region of Marchantia polymorpha chloroplast DNA was determined. On this DNA sequence (3.38kb), three open reading frames (ORFs) and three putative tRNA genes were detected in the following order: -ORF701-tRNASer(UGA)-ORF702-tRNAGly(GCC)-initiator tRNAMet(CAU)-ORF703-. The ORF703 is composed of 100 codons in which those for lysine (15%) and arginine (11%) are abundant, and could be accounted for as a counterpart of E. coli ribosomal protein S14 since they share 45% homology in the amino acid sequences. The ORF701 appears to code for a membrane protein, showing a periodic appearance of seven clusters of hydrophobic amino acids. Although the mechanisms remain unknown, the ORF701 causes a streptomycin-sensitive phenotype in resistant mutants of E. coli. The ORFs and tRNA genes are separated from each other by extremely AT-rich spacers containing sequences of dyad symmetry. The third letter positions of the codons in the ORFs are also rich in A and T residues. PMID:6393057

  15. The sequence of sequencers: The history of sequencing DNA

    PubMed Central

    Heather, James M.; Chain, Benjamin


    Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way. PMID:26554401

  16. Host selectivity and genetic variation of Discula umbrinella isolates from two oak species: analyses of intergenic spacer region sequences of ribosomal DNA.


    Cohen, Susan D


    Discula umbrinella, a fungal endophyte of oak species, colonizes and reproduces on leaves of Quercus alba and Q. rubra in forest ecosystems. Twenty-nine isolates collected from leaves of both oak species (16 from Q. alba and 13 from Q. rubra) were assayed for oak species preference and genetic variation based on primer-specific polymerase chain reactions for the intergenic spacer region (IGS) of ribosomal DNA. DNA sequencing of the polymerase chain reaction products revealed a 10-bp insertion (237-247 bp) at the 3' end of the IGS region present in nine isolates and absent in 20 of the isolates. Phylogenetic analysis of the IGS region using the neighbor-joining method identified IGS groups (groups I-V) based on single nucleotide sequence differences. Host selectivity and geographic origin of isolates were correlated in some instances with the IGS groups. Isolates within each IGS group were further analyzed for nucleotide polymorphisms to confirm genotype identity and genotype diversity. Ten different genotypes (Va-Vj) were identified among the isolates analyzed. Genotype diversity was greatest in IGS groups I, IV, and V. Seventy percent of the genotypes (Vc, Vd, Ve, Vf, Vg,Vi, and Vj) contained isolates with single tree species preferences.

  17. Non-random DNA fragmentation in next-generation sequencing

    NASA Astrophysics Data System (ADS)

    Poptsova, Maria S.; Il'Icheva, Irina A.; Nechipurenko, Dmitry Yu.; Panchenko, Larisa A.; Khodikov, Mingian V.; Oparina, Nina Y.; Polozov, Robert V.; Nechipurenko, Yury D.; Grokhovsky, Sergei L.


    Next Generation Sequencing (NGS) technology is based on cutting DNA into small fragments, and their massive parallel sequencing. The multiple overlapping segments termed ``reads'' are assembled into a contiguous sequence. To reduce sequencing errors, every genome region should be sequenced several dozen times. This sequencing approach is based on the assumption that genomic DNA breaks are random and sequence-independent. However, previously we showed that for the sonicated restriction DNA fragments the rates of double-stranded breaks depend on the nucleotide sequence. In this work we analyzed genomic reads from NGS data and discovered that fragmentation methods based on the action of the hydrodynamic forces on DNA, produce similar bias. Consideration of this non-random DNA fragmentation may allow one to unravel what factors and to what extent influence the non-uniform coverage of various genomic regions.

  18. Post-glacial recolonization of the Great Lakes region by the common gartersnake (Thamnophis sirtalis) inferred from mtDNA sequences.


    Placyk, John S; Burghardt, Gordon M; Small, Randall L; King, Richard B; Casper, Gary S; Robinson, Jace W


    Pleistocene events played an important role in the differentiation of North American vertebrate populations. Michigan, in particular, and the Great Lakes region, in general, were greatly influenced by the last glaciation. While several hypotheses regarding the recolonization of this region have been advanced, none have been strongly supported. We generated 148 complete ND2 mitochondrial DNA (mtDNA) sequences from common gartersnake (Thamnophis sirtalis) populations throughout the Great Lakes region to evaluate phylogeographic patterns and population structure and to determine whether the distribution of haplotypic variants is related to the post-Pleistocene retreat of the Wisconsinan glacier. The common gartersnake was utilized, as it is believed to have been one of the primary vertebrate invaders of the Great Lakes region following the most recent period of glacial retreat and because it has been a model species for a variety of evolutionary, ecological, behavioral, and physiological studies. Several genetically distinct evolutionary lineages were supported by both genealogical and molecular population genetic analyses, although to different degrees. The geographic distribution of the majority of these lineages is interpreted as reflecting post-glacial recolonization dynamics during the late Pleistocene. These findings generally support previous hypotheses of range expansion in this region.

  19. Genetic relationships among some subspecies of the Peregrine Falcon (Falco peregrinus L.), inferred from mitochondrial DNA control-region sequences

    USGS Publications Warehouse

    White, Clayton M.; Sonsthagen, Sarah A.; Sage, George K.; Anderson, Clifford; Talbot, Sandra L.


    The ability to successfully colonize and persist in diverse environments likely requires broad morphological and behavioral plasticity and adaptability, and this may partly explain why the Peregrine Falcon (Falco peregrinus) exhibits a large range of morphological characteristics across their global distribution. Regional and local differences within Peregrine Falcons were sufficiently variable that ∼75 subspecies have been described; many were subsumed, and currently 19 are generally recognized. We used sequence information from the control region of the mitochondrial genome to test for concordance between genetic structure and representatives of 12 current subspecies and from two areas where subspecies distributions overlap. Haplotypes were broadly shared among subspecies, and all geographic locales shared a widely distributed common haplotype (FalconCR2). Haplotypes were distributed in a star-like phylogeny, consistent with rapid expansion of a recently derived species, with observed genetic patterns congruent with incomplete lineage sorting and/or differential rates of evolution on morphology and neutral genetic characters. Hierarchical analyses of molecular variance did not uncover genetic partitioning at the continental level, despite strong population-level structure (FST = 0.228). Similar analyses found weak partitioning, albeit significant, among subspecies (FCT = 0.138). All reconstructions placed the hierofalcons' (Gyrfalcon [F. rusticolus] and Saker Falcon [F. cherrug]) haplotypes in a well-supported clade either basal or unresolved with respect to the Peregrine Falcon. In addition, haplotypes representing Taita Falcon (F. fasciinucha) were placed within the Peregrine Falcon clade.

  20. Mitochondrial DNA control region sequence variation suggests an independent origin of an {open_quotes}Asian-specific{close_quotes} 9-bp deletion in Africans

    SciTech Connect

    Soodyall, H.; Redd, A.; Vigilant


    The intergenic noncoding region between the cytochrome oxidase II and lysyl tRNA genes of human mitochondrial DNA (mtDNA) is associated with two tandemly arranged copies of a 9-bp sequence. A deletion of one of these repeats has been found at varying frequencies in populations of Asian descent, and is commonly referred to as an {open_quotes}Asian-specific{close_quotes} marker. We report here that the 9-bp deletion is also found at a frequency of 10.2% (66/649) in some indigenous African populations, with frequencies of 28.6% (20/70) in Pygmies, 26.6% (12/45) in Malawians and 15.4% (31/199) in southeastern Bantu-speaking populations. The deletion was not found in 123 Khoisan individuals nor in 209 western Bantu-speaking individuals, with the exception of 3 individuals from one group that was admixed with Pygmies. Sequence analysis of the two hypervariable segments of the mtDNA control region reveals that the types associated with the African 9-bp deletion are different from those found in Asian-derived populations with the deletion. Phylogenetic analysis separates the {open_quotes}African{close_quotes} and {open_quotes}Asian{close_quotes} 9-bp deletion types into two different clusters which are statistically supported. Mismatch distributions based on the number of differences between pairs of mtDNA types are consistent with this separation. These findings strongly support the view that the 9-bp deletion originated independently in Africa and in Asia.

  1. Classification and phylogeny of sika deer (Cervus nippon) subspecies based on the mitochondrial control region DNA sequence using an extended sample set.


    Ba, Hengxing; Yang, Fuhe; Xing, Xiumei; Li, Chunyi


    To further refine the classification and phylogeny of sika deer subspecies, the well-annotated sequences of the complete mitochondrial DNA (mtDNA) control region of 13 sika deer subspecies from GenBank were downloaded, aligned and analyzed in this study. By reconstructing the phylogenetic tree with an extended sample set, the results revealed a split between Northern and Southern Mainland Asia/Taiwan lineages, and moreover, two subspecies, C.n.mantchuricus and C.n.hortulorum, were existed in Northern Mainland Asia. Unexpectedly, Dybowskii's sika deer that was thought to originate from Northern Mainland Asia joins the Southern Mainland Asia/Taiwan lineage. The genetic divergences were ranged from 2.1% to 4.7% between Dybowskii's sika deer and all the other established subspecies at the mtDNA sequence level, which suggests that the maternal lineage of uncertain sika subspecies in Europe had been maintained until today. This study also provides a better understanding for the classification, phylogeny and phylogeographic history of sika deer subspecies.

  2. Intraspecific variation in Radopholus similis isolates assessed with restriction fragment length polymorphism and DNA sequencing of the internal transcribed spacer region of the ribosomal RNA cistron.


    Elbadri, Gamal A A; De Ley, Paul; Waeyenberge, Lieven; Vierstraete, Andy; Moens, Maurice; Vanfleteren, Jacques


    Restriction fragment length polymorphism and direct sequencing of the internal transcribed spacer rDNA region of 19 isolates of Radopholus similis yielded significant diversity, both among isolates and within some individuals. Restriction fragment length polymorphism with HaeIII, AluI and Tru9I yielded two sets of patterns. Digestion with RsaI revealed one or two supernumerary bands in single nematodes from five isolates, and sequencing confirmed microheterogeneity in four of these. Phylogenetic analysis grouped most isolates closely together, except for the five isolates with additional bands for RsaI. Our data reveal more population structure than previously found and lend further support to the synonymy of R. similis and 'Radopholus citrophilus'.

  3. Cloning, characterization, and DNA sequence of the rfaLK region for lipopolysaccharide synthesis in Salmonella typhimurium LT2.

    PubMed Central

    MacLachlan, P R; Kadam, S K; Sanderson, K E


    We have cloned and sequenced the rfaL and rfaK genes for lipopolysaccharide synthesis in Salmonella typhimurium LT2 on a 4.28-kb HindIII fragment from the previously described R' factor pKZ3 (S. K. Kadam, A. Rehemtulla, and K. E. Sanderson, J. Bacteriol. 161:277-284, 1985). rfaL is thought to encode a component of the O-antigen ligase, and rfaK is believed to encode the N-acetylglucosamine transferase. The genes were identified by the loss of complementation of prototype rfaL and rfaK mutations after Tn1000 mutagenesis. Translation of the nucleotide sequence predicted sizes of 45.9 and 43.1 kDa for the rfaL and rfaK gene products, respectively. Hydropathy analysis of the rfaL product suggested that it was an integral membrane protein. A third gene, rfaZ, was found to be an 808-bp open reading frame on the pyrE side of rfaK. Insertions into rfaZ reduced rfaK complementation, suggesting cotranscription in the pyrE-cysE direction. The rfaL gene is transcribed in the opposite direction in a separate operon which may also include rfaC. An incomplete open reading frame with homology to an Escherichia coli gene in the same region, rfaY, was found on the pyrE side of rfaZ. Complementation studies with Tn1000 insertions in rfaL showed that rfaL446 and rfaL447 are allelic. With the cloning of the rfaL and -K genes, the order of genes within the rfa cluster at 79 units on the linkage map was found to be cysE-rfaDFCLKZYJIBG-pyrE. Images FIG. 3 PMID:1657881

  4. Channel plate for DNA sequencing


    Douthart, Richard J.; Crowell, Shannon L.


    This invention is a channel plate that facilitates data compaction in DNA sequencing. The channel plate has a length, a width and a thickness, and further has a plurality of channels that are parallel. Each channel has a depth partially through the thickness of the channel plate. Additionally an interface edge permits electrical communication across an interface through a buffer to a deposition membrane surface.

  5. Channel plate for DNA sequencing


    Douthart, R.J.; Crowell, S.L.


    This invention is a channel plate that facilitates data compaction in DNA sequencing. The channel plate has a length, a width and a thickness, and further has a plurality of channels that are parallel. Each channel has a depth partially through the thickness of the channel plate. Additionally an interface edge permits electrical communication across an interface through a buffer to a deposition membrane surface. 15 figs.

  6. DNA Sequencing Using capillary Electrophoresis

    SciTech Connect

    Dr. Barry Karger


    The overall goal of this program was to develop capillary electrophoresis as the tool to be used to sequence for the first time the Human Genome. Our program was part of the Human Genome Project. In this work, we were highly successful and the replaceable polymer we developed, linear polyacrylamide, was used by the DOE sequencing lab in California to sequence a significant portion of the human genome using the MegaBase multiple capillary array electrophoresis instrument. In this final report, we summarize our efforts and success. We began our work by separating by capillary electrophoresis double strand oligonucleotides using cross-linked polyacrylamide gels in fused silica capillaries. This work showed the potential of the methodology. However, preparation of such cross-linked gel capillaries was difficult with poor reproducibility, and even more important, the columns were not very stable. We improved stability by using non-cross linked linear polyacrylamide. Here, the entangled linear chains could move when osmotic pressure (e.g. sample injection) was imposed on the polymer matrix. This relaxation of the polymer dissipated the stress in the column. Our next advance was to use significantly lower concentrations of the linear polyacrylamide that the polymer could be automatically blown out after each run and replaced with fresh linear polymer solution. In this way, a new column was available for each analytical run. Finally, while testing many linear polymers, we selected linear polyacrylamide as the best matrix as it was the most hydrophilic polymer available. Under our DOE program, we demonstrated initially the success of the linear polyacrylamide to separate double strand DNA. We note that the method is used even today to assay purity of double stranded DNA fragments. Our focus, of course, was on the separation of single stranded DNA for sequencing purposes. In one paper, we demonstrated the success of our approach in sequencing up to 500 bases. Other

  7. Sequencing Complex Genomic Regions

    SciTech Connect

    Eichler, Evan


    Evan Eichler, Howard Hughes Medical Investigator at the University of Washington, gives the May 28, 2009 keynote speech at the "Sequencing, Finishing, Analysis in the Future" meeting in Santa Fe, NM. Part 1 of 2

  8. Sequencing Complex Genomic Regions

    SciTech Connect

    Eichler, Evan


    Evan Eichler, Howard Hughes Medical Investigator at the University of Washington, gives the May 28, 2009 keynote speech at the "Sequencing, Finishing, Analysis in the Future" meeting in Santa Fe, NM. Part 2 of 2

  9. Phylogenetic analysis of the genus Sorghum based on combined sequence data from cpDNA regions and ITS generate well-supported trees with two major lineages

    PubMed Central

    Ng'uni, Dickson; Geleta, Mulatu; Fatih, Moneim; Bryngelsson, Tomas


    Background and Aims Wild Sorghum species provide novel traits for both biotic and abiotic stress resistance and yield for the improvement of cultivated sorghum. A better understanding of the phylogeny in the genus Sorghum will enhance use of the valuable agronomic traits found in wild sorghum. Methods Four regions of chloroplast DNA (cpDNA; psbZ-trnG, trnY-trnD, trnY-psbM and trnT-trnL) and the internal transcribed spacer (ITS) of nuclear ribosomal DNA were used to analyse the phylogeny of sorghum based on maximum-parsimony analyses. Key Results Parsimony analyses of the ITS and cpDNA regions as separate or combined sequence datasets formed trees with strong bootstrap support with two lineages: the Eu-sorghum species S. laxiflorum and S. macrospermum in one and Stiposorghum and Para-sorghum in the other. Within Eu-sorghum, S. bicolor-3, -11 and -14 originating from southern Africa form a distinct clade. S. bicolor-2, originally from Yemen, is distantly related to other S. bicolor accessions. Conclusions Eu-sorghum species are more closely related to S. macrospermum and S. laxiflorum than to any other Australian wild Sorghum species. S. macrospermum and S. laxiflorum are so closely related that it is inappropriate to classify them in separate sections. S. almum is closely associated with S. bicolor, suggesting that the latter is the maternal parent of the former given that cpDNA is maternally inherited in angiosperms. S. bicolor-3, -11 and -14, from southern Africa, are closely related to each other but distantly related to S. bicolor-2. PMID:20061309

  10. COLD-PCR amplification of bisulfite-converted DNA allows the enrichment and sequencing of rare un-methylated genomic regions.


    Castellanos-Rizaldos, Elena; Milbury, Coren A; Karatza, Elli; Chen, Clark C; Makrigiorgos, G Mike; Merewood, Anne


    Aberrant hypo-methylation of DNA is evident in a range of human diseases including cancer and diabetes. Development of sensitive assays capable of detecting traces of un-methylated DNA within methylated samples can be useful in several situations. Here we describe a new approach, fast-COLD-MS-PCR, which amplifies preferentially un-methylated DNA sequences. By employing an appropriate denaturation temperature during PCR of bi-sulfite converted DNA, fast-COLD-MS-PCR enriches un-methylated DNA and enables differential melting analysis or bisulfite sequencing. Using methylation on the MGMT gene promoter as a model, it is shown that serial dilutions of controlled methylation samples lead to the reliable sequencing of un-methylated sequences down to 0.05% un-methylated-to-methylated DNA. Screening of clinical glioma tumor and infant blood samples demonstrated that the degree of enrichment of un-methylated over methylated DNA can be modulated by the choice of denaturation temperature, providing a convenient method for analysis of partially methylated DNA or for revealing and sequencing traces of un-methylated DNA. Fast-COLD-MS-PCR can be useful for the detection of loss of methylation/imprinting in cancer, diabetes or diet-related methylation changes.

  11. Nanopore DNA sequencing with MspA.


    Derrington, Ian M; Butler, Tom Z; Collins, Marcus D; Manrao, Elizabeth; Pavlenok, Mikhail; Niederweis, Michael; Gundlach, Jens H


    Nanopore sequencing has the potential to become a direct, fast, and inexpensive DNA sequencing technology. The simplest form of nanopore DNA sequencing utilizes the hypothesis that individual nucleotides of single-stranded DNA passing through a nanopore will uniquely modulate an ionic current flowing through the pore, allowing the record of the current to yield the DNA sequence. We demonstrate that the ionic current through the engineered Mycobacterium smegmatis porin A, MspA, has the ability to distinguish all four DNA nucleotides and resolve single-nucleotides in single-stranded DNA when double-stranded DNA temporarily holds the nucleotides in the pore constriction. Passing DNA with a series of double-stranded sections through MspA provides proof of principle of a simple DNA sequencing method using a nanopore. These findings highlight the importance of MspA in the future of nanopore sequencing.

  12. Nanopore DNA sequencing with MspA

    PubMed Central

    Derrington, Ian M.; Butler, Tom Z.; Collins, Marcus D.; Manrao, Elizabeth; Pavlenok, Mikhail; Niederweis, Michael; Gundlach, Jens H.


    Nanopore sequencing has the potential to become a direct, fast, and inexpensive DNA sequencing technology. The simplest form of nanopore DNA sequencing utilizes the hypothesis that individual nucleotides of single-stranded DNA passing through a nanopore will uniquely modulate an ionic current flowing through the pore, allowing the record of the current to yield the DNA sequence. We demonstrate that the ionic current through the engineered Mycobacterium smegmatis porin A, MspA, has the ability to distinguish all four DNA nucleotides and resolve single-nucleotides in single-stranded DNA when double-stranded DNA temporarily holds the nucleotides in the pore constriction. Passing DNA with a series of double-stranded sections through MspA provides proof of principle of a simple DNA sequencing method using a nanopore. These findings highlight the importance of MspA in the future of nanopore sequencing. PMID:20798343

  13. The Historical Demography and Genetic Variation of the Endangered Cycas multipinnata (Cycadaceae) in the Red River Region, Examined by Chloroplast DNA Sequences and Microsatellite Markers

    PubMed Central

    Gong, Yi-Qing; Zhan, Qing-Qing; Nguyen, Khang Sinh; Nguyen, Hiep Tien; Wang, Yue-Hua; Gong, Xun


    Cycas multipinnata C.J. Chen & S.Y. Yang is a cycad endemic to the Red River drainage region that occurs under evergreen forest on steep limestone slopes in Southwest China and northern Vietnam. It is listed as endangered due to habitat loss and over-collecting for the ornamental plant trade, and only several populations remain. In this study, we assess the genetic variation, population structure, and phylogeography of C. multipinnata populations to help develop strategies for the conservation of the species. 60 individuals from six populations were used for chloroplast DNA (cpDNA) sequencing and 100 individuals from five populations were genotyped using 17 nuclear microsatellites. High genetic differentiation among populations was detected, suggesting that pollen or seed dispersal was restricted within populations. Two main genetic clusters were observed in both the cpDNA and microsatellite loci, corresponding to Yunnan China and northern Vietnam. These clusters indicated low levels of gene flow between the regions since their divergence in the late Pleistocene, which was inferred from both Bayesian and coalescent analysis. In addition, the result of a Bayesian skyline plot based on cpDNA portrayed a long history of constant population size followed by a decline in the last 50,000 years of C. multipinnata that was perhaps affected by the Quaternary glaciations, a finding that was also supported by the Garza-Williamson index calculated from the microsatellite data. The genetic consequences produced by climatic oscillations and anthropogenic disturbances are considered key pressures on C. multipinnata. To establish a conservation management plan, each population of C. multipinnata should be recognized as a Management Unit (MU). In situ and ex situ actions, such as controlling overexploitation and creating a germplasm bank with high genetic diversity, should be urgently implemented to preserve this species. PMID:25689828

  14. Evaluation of the effects of intrapartum antibiotic prophylaxis on newborn intestinal microbiota using a sequencing approach targeted to multi hypervariable 16S rDNA regions.


    Aloisio, Irene; Quagliariello, Andrea; De Fanti, Sara; Luiselli, Donata; De Filippo, Carlotta; Albanese, Davide; Corvaglia, Luigi Tommaso; Faldella, Giacomo; Di Gioia, Diana


    Different factors are known to influence the early gut colonization in newborns, among them the perinatal use of antibiotics. On the other hand, the effect on the baby of the administration of antibiotics to the mother during labor, referred to as intrapartum antibiotic prophylaxis (IAP), has received less attention, although routinely used in group B Streptococcus positive women to prevent the infection in newborns. In this work, the fecal microbiota of neonates born to mothers receiving IAP and of control subjects were compared taking advantage for the first time of high-throughput DNA sequencing technology. Seven different 16S rDNA hypervariable regions (V2, V3, V4, V6 + V7, V8, and V9) were amplified and sequenced using the Ion Torrent Personal Genome Machine. The results obtained showed significant differences in the microbial composition of newborns born to mothers who had received IAP, with a lower abundance of Actinobacteria and Bacteroidetes as well as an overrepresentation of Proteobacteria. Considering that the seven hypervariable regions showed different discriminant ability in the taxonomic identification, further analyses were performed on the V4 region evidencing in IAP infants a reduced microbial richness and biodiversity, as well as a lower number of bacterial families with a predominance of Enterobacteriaceae members. In addition, this analysis pointed out a significant reduction in Bifidobacterium spp. strains. The reduced abundance of these beneficial microorganisms, together with the increased amount of potentially pathogenic bacteria, may suggest that IAP infants are more exposed to gastrointestinal or generally health disorders later in age.

  15. Particle sizer and DNA sequencer


    Olivares, Jose A.; Stark, Peter C.


    An electrophoretic device separates and detects particles such as DNA fragments, proteins, and the like. The device has a capillary which is coated with a coating with a low refractive index such as Teflon.RTM. AF. A sample of particles is fluorescently labeled and injected into the capillary. The capillary is filled with an electrolyte buffer solution. An electrical field is applied across the capillary causing the particles to migrate from a first end of the capillary to a second end of the capillary. A detector light beam is then scanned along the length of the capillary to detect the location of the separated particles. The device is amenable to a high throughput system by providing additional capillaries. The device can also be used to determine the actual size of the particles and for DNA sequencing.

  16. Genetic mapping and DNA sequencing

    SciTech Connect

    Speed, T.; Waterman, M.S.


    The Human Genome Initiative has as its primary objective the characterization of the human genome. High-resolution linkage maps of genetic markers will play an important role in completing the human genome project. This is one of two volumes based on the proceedings of the 1994 IMA Summer Program on Molecular Biology and comprises Weeks 1 and 2 of the four-week program. This volume focuses on genetic mapping and DNA sequencing. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database.

  17. Investigating the Prehistory of Tungusic Peoples of Siberia and the Amur-Ussuri Region with Complete mtDNA Genome Sequences and Y-chromosomal Markers

    PubMed Central

    Duggan, Ana T.; Whitten, Mark; Wiebe, Victor; Crawford, Michael; Butthof, Anne; Spitsyn, Victor; Makarov, Sergey; Novgorodov, Innokentiy; Osakovsky, Vladimir; Pakendorf, Brigitte


    Evenks and Evens, Tungusic-speaking reindeer herders and hunter-gatherers, are spread over a wide area of northern Asia, whereas their linguistic relatives the Udegey, sedentary fishermen and hunter-gatherers, are settled to the south of the lower Amur River. The prehistory and relationships of these Tungusic peoples are as yet poorly investigated, especially with respect to their interactions with neighbouring populations. In this study, we analyse over 500 complete mtDNA genome sequences from nine different Evenk and even subgroups as well as their geographic neighbours from Siberia and their linguistic relatives the Udegey from the Amur-Ussuri region in order to investigate the prehistory of the Tungusic populations. These data are supplemented with analyses of Y-chromosomal haplogroups and STR haplotypes in the Evenks, Evens, and neighbouring Siberian populations. We demonstrate that whereas the North Tungusic Evenks and Evens show evidence of shared ancestry both in the maternal and in the paternal line, this signal has been attenuated by genetic drift and differential gene flow with neighbouring populations, with isolation by distance further shaping the maternal genepool of the Evens. The Udegey, in contrast, appear quite divergent from their linguistic relatives in the maternal line, with a mtDNA haplogroup composition characteristic of populations of the Amur-Ussuri region. Nevertheless, they show affinities with the Evenks, indicating that they might be the result of admixture between local Amur-Ussuri populations and Tungusic populations from the north. PMID:24349531

  18. Chloroplast DNA analysis of Tunisian cork oak populations (Quercus suber L.): sequence variations and molecular evolution of the trnL (UAA)-trnF (GAA) region.


    Abdessamad, A; Baraket, G; Sakka, H; Ammari, Y; Ksontini, M; Hannachi, A Salhi


    Sequences of the trnL-trnF spacer and combined trnL-trnF region in chloroplast DNA of cork oak (Quercus suber L.) were analyzed to detect polymorphisms and to elucidate molecular evolution and demographic history. The aligned sequences varied in length and nucleotide composition. The overall ratio of transition/transversion (ti/tv) of 0.724 for the intergenic spacer and 0.258 for the pooled sequences were estimated, and indicated that transversions are more frequent than transitions. The molecular evolution and demographic history of Q. suber were investigated. Neutrality tests (Tajima's D and Fu and Li) ruled out the null hypothesis of a strictly neutral model, and Fu's Fs and Ramos-Onsins and Rozas' R2 confirmed the recent expansion of cork oak trees, validating its persistency in North Africa since the last glaciation during the Quaternary. The observed uni-modal mismatch distribution and the Harpending's raggedness index confirmed the demographic history model for cork oak. A phylogenetic dendrogram showed that the distribution of Q. suber trees occurs independently of geographical origin, the relief of the population site, and the bioclimatic stages. The molecular history and cytoplasmic diversity suggest that in situ and ex situ conservation strategies can be recommended for preserving landscape value and facing predictable future climatic changes.

  19. Sequence and molecular characterization of a DNA region encoding the dibenzothiophene desulfurization operon of Rhodococcus sp. strain IGTS8.


    Piddington, C S; Kovacevich, B R; Rambosek, J


    Dibenzothiophene (DBT), a model compound for sulfur-containing organic molecules found in fossil fuels, can be desulfurized to 2-hydroxybiphenyl (2-HBP) by Rhodococcus sp. strain IGTS8. Complementation of a desulfurization (dsz) mutant provided the genes from Rhodococcus sp. strain IGTS8 responsible for desulfurization. A 6.7-kb TaqI fragment cloned in Escherichia coli-Rhodococcus shuttle vector pRR-6 was found to both complement this mutation and confer desulfurization to Rhodococcus fascians, which normally is not able to desulfurize DBT. Expression of this fragment in E. coli also conferred the ability to desulfurize DBT. A molecular analysis of the cloned fragment revealed a single operon containing three open reading frames involved in the conversion of DBT to 2-HBP. The three genes were designated dszA, dszB, and dszC. Neither the nucleotide sequences nor the deduced amino acid sequences of the enzymes exhibited significant similarity to sequences obtained from the GenBank, EMBL, and Swiss-Prot databases, indicating that these enzymes are novel enzymes. Subclone analyses revealed that the gene product of dszC converts DBT directly to DBT-sulfone and that the gene products of dszA and dszB act in concert to convert DBT-sulfone to 2-HBP.

  20. Yeast DNA sequences initiating gene expression in Escherichia coli.


    Lewin, Astrid; Tran, Thi Tuyen; Jacob, Daniela; Mayer, Martin; Freytag, Barbara; Appel, Bernd


    DNA transfer between pro- and eukaryotes occurs either during natural horizontal gene transfer or as a result of the employment of gene technology. We analysed the capacity of DNA sequences from a eukaryotic donor organism (Saccharomyces cerevisiae) to serve as promoter region in a prokaryotic recipient (Escherichia coli) by creating fusions between promoterless luxAB genes from Vibrio harveyi and random DNA sequences from S. cerevisiae and measuring the luminescence of transformed E. coli. Fifty-four out of 100 randomly analysed S. cerevisiae DNA sequences caused considerable gene expression in E. coli. Determination of transcription start sites within six selected yeast sequences in E. coli confirmed the existence of bacterial -10 and -35 consensus sequences at appropriate distances upstream from transcription initiation sites. Our results demonstrate that the probability of transcription of transferred eukaryotic DNA in bacteria is extremely high and does not require the insertion of the transferred DNA behind a promoter of the recipient genome.

  1. Spectral entropy criteria for structural segmentation in genomic DNA sequences

    NASA Astrophysics Data System (ADS)

    Chechetkin, V. R.; Lobzin, V. V.


    The spectral entropy is calculated with Fourier structure factors and characterizes the level of structural ordering in a sequence of symbols. It may efficiently be applied to the assessment and reconstruction of the modular structure in genomic DNA sequences. We present the relevant spectral entropy criteria for the local and non-local structural segmentation in DNA sequences. The results are illustrated with the model examples and analysis of intervening exon-intron segments in the protein-coding regions.

  2. Complete sequence of Euglena gracilis chloroplast DNA.

    PubMed Central

    Hallick, R B; Hong, L; Drager, R G; Favreau, M R; Monfort, A; Orsat, B; Spielmann, A; Stutz, E


    We report the complete DNA sequence of the Euglena gracilis, Pringsheim strain Z chloroplast genome. This circular DNA is 143,170 bp, counting only one copy of a 54 bp tandem repeat sequence that is present in variable copy number within a single culture. The overall organization of the genome involves a tandem array of three complete and one partial ribosomal RNA operons, and a large single copy region. There are genes for the 16S, 5S, and 23S rRNAs of the 70S chloroplast ribosomes, 27 different tRNA species, 21 ribosomal proteins plus the gene for elongation factor EF-Tu, three RNA polymerase subunits, and 27 known photosynthesis-related polypeptides. Several putative genes of unknown function have also been identified, including five within large introns, and five with amino acid sequence similarity to genes in other organisms. This genome contains at least 149 introns. There are 72 individual group II introns, 46 individual group III introns, 10 group II introns and 18 group III introns that are components of twintrons (introns-within-introns), and three additional introns suspected to be twintrons composed of multiple group II and/or group III introns, but not yet characterized. At least 54,804 bp, or 38.3% of the total DNA content is represented by introns. PMID:8346031

  3. The Value of DNA Sequencing - TCGA

    DNA sequencing: what it tells us about DNA changes in cancer, how looking across many tumors will help to identify meaningful changes and potential drug targets, and how genomics is changing the way we think about cancer.

  4. Method for sequencing DNA base pairs


    Sessler, Andrew M.; Dawson, John


    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  5. DNA sequence from Cretaceous period bone fragments.


    Woodward, S R; Weyand, N J; Bunnell, M


    DNA was extracted from 80-million-year-old bone fragments found in strata of the Upper Cretaceous Blackhawk Formation in the roof of an underground coal mine in eastern Utah. This DNA was used as the template in a polymerase chain reaction that amplified and sequenced a portion of the gene encoding mitochondrial cytochrome b. These sequences differ from all other cytochrome b sequences investigated, including those in the GenBank and European Molecular Biology Laboratory databases. DNA isolated from these bone fragments and the resulting gene sequences demonstrate that small fragments of DNA may survive in bone for millions of years.

  6. Highly conserved repetitive DNA sequences are present at human centromeres.

    PubMed Central

    Grady, D L; Ratliff, R L; Robinson, D L; McCanlies, E C; Meyne, J; Moyzis, R K


    Highly conserved repetitive DNA sequence clones, largely consisting of (GGAAT)n repeats, have been isolated from a human recombinant repetitive DNA library by high-stringency hybridization with rodent repetitive DNA. This sequence, the predominant repetitive sequence in human satellites II and III, is similar to the essential core DNA of the Saccharomyces cerevisiae centromere, centromere DNA element (CDE) III. In situ hybridization to human telophase and Drosophila polytene chromosomes shows localization of the (GGAAT)n sequence to centromeric regions. Hyperchromicity studies indicate that the (GGAAT)n sequence exhibits unusual hydrogen bonding properties. The purine-rich strand alone has the same thermal stability as the duplex. Hyperchromicity studies of synthetic DNA variants indicate that all sequences with the composition (AATGN)n exhibit this unusual thermal stability. DNA-mobility-shift assays indicate that specific HeLa-cell nuclear proteins recognize this sequence with a relative affinity greater than 10(5). The extreme evolutionary conservation of this DNA sequence, its centromeric location, its unusual hydrogen bonding properties, its high affinity for specific nuclear proteins, and its similarity to functional centromeres isolated from yeast suggest that this sequence may be a component of the functional human centromere. Images PMID:1542662

  7. Phylogenetic Analysis of a 'Jewel Orchid' Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions.


    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen


    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1) Goodyera is not monophyletic; 2) Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3) sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection.

  8. Haplogrouping mitochondrial DNA sequences in Legal Medicine/Forensic Genetics.


    Bandelt, Hans-Jürgen; van Oven, Mannis; Salas, Antonio


    Haplogrouping refers to the classification of (partial) mitochondrial DNA (mtDNA) sequences into haplogroups using the current knowledge of the worldwide mtDNA phylogeny. Haplogroup assignment of mtDNA control-region sequences assists in the focused comparison with closely related complete mtDNA sequences and thus serves two main goals in forensic genetics: first is the a posteriori quality analysis of sequencing results and second is the prediction of relevant coding-region sites for confirmation or further refinement of haplogroup status. The latter may be important in forensic casework where discrimination power needs to be as high as possible. However, most articles published in forensic genetics perform haplogrouping only in a rudimentary or incorrect way. The present study features PhyloTree as the key tool for assigning control-region sequences to haplogroups and elaborates on additional Web-based searches for finding near-matches with complete mtDNA genomes in the databases. In contrast, none of the automated haplogrouping tools available can yet compete with manual haplogrouping using PhyloTree plus additional Web-based searches, especially when confronted with artificial recombinants still present in forensic mtDNA datasets. We review and classify the various attempts at haplogrouping by using a multiplex approach or relying on automated haplogrouping. Furthermore, we re-examine a few articles in forensic journals providing mtDNA population data where appropriate haplogrouping following PhyloTree immediately highlights several kinds of sequence errors.

  9. Detection of DNA Methylation by Whole-Genome Bisulfite Sequencing.


    Li, Qing; Hermanson, Peter J; Springer, Nathan M


    DNA methylation plays an important role in the regulation of the expression of transposons and genes. Various methods have been developed to assay DNA methylation levels. Bisulfite sequencing is considered to be the "gold standard" for single-base resolution measurement of DNA methylation levels. Coupled with next-generation sequencing, whole-genome bisulfite sequencing (WGBS) allows DNA methylation to be evaluated at a genome-wide scale. Here, we described a protocol for WGBS in plant species with large genomes. This protocol has been successfully applied to assay genome-wide DNA methylation levels in maize and barley. This protocol has also been successfully coupled with sequence capture technology to assay DNA methylation levels in a targeted set of genomic regions.

  10. Fibonacci Sequence and Supramolecular Structure of DNA.


    Shabalkin, I P; Grigor'eva, E Yu; Gudkova, M V; Shabalkin, P I


    We proposed a new model of supramolecular DNA structure. Similar to the previously developed by us model of primary DNA structure [11-15], 3D structure of DNA molecule is assembled in accordance to a mathematic rule known as Fibonacci sequence. Unlike primary DNA structure, supramolecular 3D structure is assembled from complex moieties including a regular tetrahedron and a regular octahedron consisting of monomers, elements of the primary DNA structure. The moieties of the supramolecular DNA structure forming fragments of regular spatial lattice are bound via linker (joint) sequences of the DNA chain. The lattice perceives and transmits information signals over a considerable distance without acoustic aberrations. Linker sequences expand conformational space between lattice segments allowing their sliding relative to each other under the action of external forces. In this case, sliding is provided by stretching of the stacked linker sequences.

  11. PCR detection and DNA sequence analysis of the regulatory region of lymphotropic papovavirus in peripheral blood mononuclear cells of an immunocompromised rhesus macaque

    NASA Technical Reports Server (NTRS)

    Lednicky, John A.; Halvorson, Steven J.; Butel, Janet S.


    A lymphotropic papovavirus (LPV) archetypal regulatory region was amplified from DNA from the blood of an immunocompromised rhesus monkey. We believe this is the first nonserological evidence of LPV infection in rhesus monkeys.

  12. PCR detection and DNA sequence analysis of the regulatory region of lymphotropic papovavirus in peripheral blood mononuclear cells of an immunocompromised rhesus macaque

    NASA Technical Reports Server (NTRS)

    Lednicky, John A.; Halvorson, Steven J.; Butel, Janet S.


    A lymphotropic papovavirus (LPV) archetypal regulatory region was amplified from DNA from the blood of an immunocompromised rhesus monkey. We believe this is the first nonserological evidence of LPV infection in rhesus monkeys.

  13. Sequence and Structure Dependent DNA-DNA Interactions

    NASA Astrophysics Data System (ADS)

    Kopchick, Benjamin; Qiu, Xiangyun

    Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.

  14. Interaction of two sequence-specific single-stranded DNA-binding proteins with an essential region of the beta-casein gene promoter is regulated by lactogenic hormones.

    PubMed Central

    Altiok, S; Groner, B


    Transcription of the beta-casein gene in mammary epithelial cells is regulated by the lactogenic hormones insulin, glucocorticoids, and prolactin. The DNA sequence elements in the promoter which confer the action of the hormones on the transcriptional machinery and the nuclear proteins binding to this region have been investigated. We found that 221 nucleotides of promoter sequence 5' of the RNA start site are sufficient to mediate the induction of a chloramphenicol acetyltransferase reporter gene in transfected HC11 mammary epithelial cells. Deletion of 5' sequences to position -183 results in a construct with enhanced basal activity which still retains inducibility. A -170 beta-casein promoter-chloramphenicol acetyltransferase construct has very low transcriptional activity, which indicates the presence of a negative regulatory in the region between -221 and -183 and a positive regulatory element between -183 and -170. Band shift analysis showed that the promoter region between -194 and -163 specifically binds two nuclear proteins. The proteins are sequence-specific, single-stranded DNA-binding proteins which exclusively recognize the upper DNA strand and most likely play a repressing role in transcription. DNA binding activity of these nuclear proteins was observed only in nuclear extracts from mammary glands of mice in late pregnancy and postlactation, not during lactation. Hormonal control of the DNA binding activity of these proteins was also observed in the mammary epithelial cell line HC11. Mixing experiments showed that extracts from mammary tissue of lactating mice and from lactogenic hormone-treated HC11 cells contain an activity which can suppress the DNA binding of the single-stranded DNA-binding proteins.2+ identical specificity to the single-stranded DNA. Images PMID:8246951

  15. Using DNA looping to measure sequence dependent DNA elasticity

    NASA Astrophysics Data System (ADS)

    Kandinov, Alan; Raghunathan, Krishnan; Meiners, Jens-Christian


    We are using tethered particle motion (TPM) microscopy to observe protein-mediated DNA looping in the lactose repressor system in DNA constructs with varying AT / CG content. We use these data to determine the persistence length of the DNA as a function of its sequence content and compare the data to direct micromechanical measurements with constant-force axial optical tweezers. The data from the TPM experiments show a much smaller sequence effect on the persistence length than the optical tweezers experiments.

  16. Molecular phylogeny of the subgenus Ceratotropis (genus Vigna, Leguminosae) reveals three eco-geographical groups and Late Pliocene-Pleistocene diversification: evidence from four plastid DNA region sequences.


    Javadi, Firouzeh; Tun, Ye Tun; Kawase, Makoto; Guan, Kaiyun; Yamaguchi, Hirofumi


    The subgenus Ceratotropis in the genus Vigna is widely distributed from the Himalayan highlands to South, Southeast and East Asia. However, the interspecific and geographical relationships of its members are poorly understood. This study investigates the phylogeny and biogeography of the subgenus Ceratotropis using chloroplast DNA sequence data. Sequence data from four intergenic spacer regions (petA-psbJ, psbD-trnT, trnT-trnE and trnT-trnL) of chloroplast DNA, alone and in combination, were analysed using Bayesian and parsimony methods. Divergence times for major clades were estimated with penalized likelihood. Character evolution was examined by means of parsimony optimization and MacClade. Parsimony and Bayesian phylogenetic analyses on the combined data demonstrated well-resolved species relationships in which 18 Vigna species were divided into two major geographical clades: the East Asia-Southeast Asian clade and the Indian subcontinent clade. Within these two clades, three well-supported eco-geographical groups, temperate and subtropical (the East Asia-Southeast Asian clade) and tropical (the Indian subcontinent clade), are recognized. The temperate group consists of V. minima, V. nepalensis and V. angularis. The subtropical group comprises the V. nakashimae-V. riukiuensis-V. minima subgroup and the V. hirtella-V. exilis-V. umbellata subgroup. The tropical group contains two subgroups: the V. trinervia-V. reflexo-pilosa-V. trilobata subgroup and the V. mungo-V. grandiflora subgroup. An evolutionary rate analysis estimated the divergence time between the East Asia-Southeast Asia clade and the Indian subcontinent clade as 3·62 ± 0·3 million years, and that between the temperate and subtropical groups as 2·0 ± 0·2 million years. The findings provide an improved understanding of the interspecific relationships, and ecological and geographical phylogenetic structure of the subgenus Ceratotropis. The quaternary diversification of the subgenus Ceratotropis

  17. Molecular phylogeny of the subgenus Ceratotropis (genus Vigna, Leguminosae) reveals three eco-geographical groups and Late Pliocene–Pleistocene diversification: evidence from four plastid DNA region sequences

    PubMed Central

    Javadi, Firouzeh; Tun, Ye Tun; Kawase, Makoto; Guan, Kaiyun; Yamaguchi, Hirofumi


    Background and Aims The subgenus Ceratotropis in the genus Vigna is widely distributed from the Himalayan highlands to South, Southeast and East Asia. However, the interspecific and geographical relationships of its members are poorly understood. This study investigates the phylogeny and biogeography of the subgenus Ceratotropis using chloroplast DNA sequence data. Methods Sequence data from four intergenic spacer regions (petA-psbJ, psbD-trnT, trnT-trnE and trnT-trnL) of chloroplast DNA, alone and in combination, were analysed using Bayesian and parsimony methods. Divergence times for major clades were estimated with penalized likelihood. Character evolution was examined by means of parsimony optimization and MacClade. Key Results Parsimony and Bayesian phylogenetic analyses on the combined data demonstrated well-resolved species relationships in which 18 Vigna species were divided into two major geographical clades: the East Asia–Southeast Asian clade and the Indian subcontinent clade. Within these two clades, three well-supported eco-geographical groups, temperate and subtropical (the East Asia–Southeast Asian clade) and tropical (the Indian subcontinent clade), are recognized. The temperate group consists of V. minima, V. nepalensis and V. angularis. The subtropical group comprises the V. nakashimae–V. riukiuensis–V. minima subgroup and the V. hirtella–V. exilis–V. umbellata subgroup. The tropical group contains two subgroups: the V. trinervia–V. reflexo-pilosa–V. trilobata subgroup and the V. mungo–V. grandiflora subgroup. An evolutionary rate analysis estimated the divergence time between the East Asia–Southeast Asia clade and the Indian subcontinent clade as 3·62 ± 0·3 million years, and that between the temperate and subtropical groups as 2·0 ± 0·2 million years. Conclusions The findings provide an improved understanding of the interspecific relationships, and ecological and geographical phylogenetic structure of the subgenus

  18. Multiple tag labeling method for DNA sequencing


    Mathies, Richard A.; Huang, Xiaohua C.; Quesada, Mark A.


    A DNA sequencing method described which uses single lane or channel electrophoresis. Sequencing fragments are separated in said lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radio-isotope labels.

  19. Multiple tag labeling method for DNA sequencing


    Mathies, R.A.; Huang, X.C.; Quesada, M.A.


    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  20. DNA authentication of Plantago Herb based on nucleotide sequences of 18S-28S rRNA internal transcribed spacer region.


    Sahin, Fatma Pinar; Yamashita, Hiromi; Guo, Yahong; Terasaka, Kazuyoshi; Kondo, Toshiya; Yamamoto, Yutaka; Shimada, Hiroshi; Fujita, Masao; Kawasaki, Takeshi; Sakai, Eiji; Tanaka, Toshihiro; Goda, Yukihiro; Mizukami, Hajime


    Internal transcribed spacer (ITS) regions of nuclear ribosomal RNA gene were amplified from 23 plant- and herbarium specimens belonging to eight Plantago species (P. asiatica, P. depressa, P. major, P. erosa, P. hostifolia, P. camtschatica, P. virginica and P. lanceolata). Sequence comparison indicated that these Plantago species could be identified based on the sequence type of the ITS locus. Sequence analysis of the ITS regions amplified from the crude drug Plantago Herb obtained in the markets indicated that all the drugs from Japan were derived from P. asiatica whereas the samples obtained in China were originated from various Plantago species including P. asiatica, P. depressa, P. major and P. erosa.

  1. Sequence of figwort mosaic virus DNA (caulimovirus group).

    PubMed Central

    Richins, R D; Scholthof, H B; Shepherd, R J


    The nucleotide sequence of an infectious clone of figwort mosaic virus (FMV) was determined using the dideoxynucleotide chain termination method. The double-stranded DNA genome (7743 base pairs) contained eight open reading frames (ORFs), seven of which corresponded approximately in size and location to the ORFs found in the genome of cauliflower mosaic virus (CaMV) and carnation etched ring virus (CERV). ORFs I and V of FMV demonstrated the highest degrees of nucleotide and amino acid sequence homology with the equivalent coding regions of CaMV and CERV. Regions II, III and IV showed somewhat less homology with the analogous regions of CaMV and CERV, and ORF VI showed homology with the corresponding gene of CaMV and CERV in only a short segment near the middle of the putative gene product. A 16 nucleotide sequence, complementary to the 3' terminus of methionine initiator tRNA (tRNAimet) and presumed to be the primer binding site for initiation of reverse transcription to produce minus strand DNA, was found in the FMV genome near the discontinuity in the minus strand. Sequences near the three interruptions in the plus strand of FMV DNA bear strong resemblance to similarly located sequences of 3 other caulimoviruses and are inferred to be initiation sites for second strand DNA synthesis. Additional conserved sequences in the small and large intergenic regions are pointed out including a highly conserved 35 bp sequence that occurs in the latter region. PMID:3671088

  2. Sequence of figwort mosaic virus DNA (caulimovirus group).


    Richins, R D; Scholthof, H B; Shepherd, R J


    The nucleotide sequence of an infectious clone of figwort mosaic virus (FMV) was determined using the dideoxynucleotide chain termination method. The double-stranded DNA genome (7743 base pairs) contained eight open reading frames (ORFs), seven of which corresponded approximately in size and location to the ORFs found in the genome of cauliflower mosaic virus (CaMV) and carnation etched ring virus (CERV). ORFs I and V of FMV demonstrated the highest degrees of nucleotide and amino acid sequence homology with the equivalent coding regions of CaMV and CERV. Regions II, III and IV showed somewhat less homology with the analogous regions of CaMV and CERV, and ORF VI showed homology with the corresponding gene of CaMV and CERV in only a short segment near the middle of the putative gene product. A 16 nucleotide sequence, complementary to the 3' terminus of methionine initiator tRNA (tRNAimet) and presumed to be the primer binding site for initiation of reverse transcription to produce minus strand DNA, was found in the FMV genome near the discontinuity in the minus strand. Sequences near the three interruptions in the plus strand of FMV DNA bear strong resemblance to similarly located sequences of 3 other caulimoviruses and are inferred to be initiation sites for second strand DNA synthesis. Additional conserved sequences in the small and large intergenic regions are pointed out including a highly conserved 35 bp sequence that occurs in the latter region.

  3. Fractal analysis of DNA sequence data

    SciTech Connect

    Berthelsen, C.L.


    DNA sequence databases are growing at an almost exponential rate. New analysis methods are needed to extract knowledge about the organization of nucleotides from this vast amount of data. Fractal analysis is a new scientific paradigm that has been used successfully in many domains including the biological and physical sciences. Biological growth is a nonlinear dynamic process and some have suggested that to consider fractal geometry as a biological design principle may be most productive. This research is an exploratory study of the application of fractal analysis to DNA sequence data. A simple random fractal, the random walk, is used to represent DNA sequences. The fractal dimension of these walks is then estimated using the [open quote]sandbox method[close quote]. Analysis of 164 human DNA sequences compared to three types of control sequences (random, base-content matched, and dimer-content matched) reveals that long-range correlations are present in DNA that are not explained by base or dimer frequencies. The study also revealed that the fractal dimension of coding sequences was significantly lower than sequences that were primarily noncoding, indicating the presence of longer-range correlations in functional sequences. The multifractal spectrum is used to analyze fractals that are heterogeneous and have a different fractal dimension for subsets with different scalings. The multifractal spectrum of the random walks of twelve mitochondrial genome sequences was estimated. Eight vertebrate mtDNA sequences had uniformly lower spectra values than did four invertebrate mtDNA sequences. Thus, vertebrate mitochondria show significantly longer-range correlations than to invertebrate mitochondria. The higher multifractal spectra values for invertebrate mitochondria suggest a more random organization of the sequences. This research also includes considerable theoretical work on the effects of finite size, embedding dimension, and scaling ranges.

  4. Alignment method for spectrograms of DNA sequences.


    Bucur, Anca; van Leeuwen, Jasper; Dimitrova, Nevenka; Mittal, Chetan


    DNA spectrograms express the periodicities of each of the four nucleotides A, T, C, and G in one or several genomic sequences to be analyzed. DNA spectral analysis can be applied to systematically investigate DNA patterns, which may correspond to relevant biological features. As opposed to looking at nucleotide sequences, spectrogram analysis may detect structural characteristics in very long sequences that are not identifiable by sequence alignment. Alignment of DNA spectrograms can be used to facilitate analysis of very long sequences or entire genomes at different resolutions. Standard clustering algorithms have been used in spectral analysis to find strong patterns in spectra. However, as they use a global distance metric, these algorithms can only detect strong patterns coexisting in several frequencies. In this paper, we propose a new method and several algorithms for aligning spectra suitable for efficient spectral analysis and allowing for the easy detection of strong patterns in both single frequencies and multiple frequencies.

  5. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    USGS Publications Warehouse

    Hoy, Marshal S.; Rodriguez, Rusty J.


    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  6. DNA sequencing: bench to bedside and beyond†

    PubMed Central

    Hutchison, Clyde A.


    Fifteen years elapsed between the discovery of the double helix (1953) and the first DNA sequencing (1968). Modern DNA sequencing began in 1977, with development of the chemical method of Maxam and Gilbert and the dideoxy method of Sanger, Nicklen and Coulson, and with the first complete DNA sequence (phage ϕX174), which demonstrated that sequence could give profound insights into genetic organization. Incremental improvements allowed sequencing of molecules >200 kb (human cytomegalovirus) leading to an avalanche of data that demanded computational analysis and spawned the field of bioinformatics. The US Human Genome Project spurred sequencing activity. By 1992 the first ‘sequencing factory’ was established, and others soon followed. The first complete cellular genome sequences, from bacteria, appeared in 1995 and other eubacterial, archaebacterial and eukaryotic genomes were soon sequenced. Competition between the public Human Genome Project and Celera Genomics produced working drafts of the human genome sequence, published in 2001, but refinement and analysis of the human genome sequence will continue for the foreseeable future. New ‘massively parallel’ sequencing methods are greatly increasing sequencing capacity, but further innovations are needed to achieve the ‘thousand dollar genome’ that many feel is prerequisite to personalized genomic medicine. These advances will also allow new approaches to a variety of problems in biology, evolution and the environment. PMID:17855400

  7. Nucleotide capacitance calculation for DNA sequencing

    SciTech Connect

    Lu, Jun-Qiang; Zhang, Xiaoguang


    Using a first-principles linear response theory, the capacitance of the DNA nucleotides, adenine, cytosine, guanine and thymine, are calculated. The difference in the capacitance between the nucleotides is studied with respect to conformational distortion. The result suggests that although an alternate current capacitance measurement of a single-stranded DNA chain threaded through a nano-gap electrodes may not sufficient to be used as a stand alone method for rapid DNA sequencing, the capacitance of the nucleotides should be taken into consideration in any GHz-frequency electric measurements and may also serve as an additional criterion for identifying the DNA sequence.

  8. Visible periodicity of strong nucleosome DNA sequences.


    Salih, Bilal; Tripathi, Vijay; Trifonov, Edward N


    Fifteen years ago, Lowary and Widom assembled nucleosomes on synthetic random sequence DNA molecules, selected the strongest nucleosomes and discovered that the TA dinucleotides in these strong nucleosome sequences often appear at 10-11 bases from one another or at distances which are multiples of this period. We repeated this experiment computationally, on large ensembles of natural genomic sequences, by selecting the strongest nucleosomes--i.e. those with such distances between like-named dinucleotides, multiples of 10.4 bases, the structural and sequence period of nucleosome DNA. The analysis confirmed the periodicity of TA dinucleotides in the strong nucleosomes, and revealed as well other periodic sequence elements, notably classical AA and TT dinucleotides. The matrices of DNA bendability and their simple linear forms--nucleosome positioning motifs--are calculated from the strong nucleosome DNA sequences. The motifs are in full accord with nucleosome positioning sequences derived earlier, thus confirming that the new technique, indeed, detects strong nucleosomes. Species- and isochore-specific variations of the matrices and of the positioning motifs are demonstrated. The strong nucleosome DNA sequences manifest the highest hitherto nucleosome positioning sequence signals, showing the dinucleotide periodicities in directly observable rather than in hidden form.

  9. The use of primed in situ synthesis (PRINS) to analyze nucleolar organizer regions (NORs) and telomeric DNA sequences in the domestic chicken genome.


    Bugno-Poniewierska, Monika; Potocki, Leszek; Bładek, Beata; Pawlina, Klaudia; Wnuk, Maciej; Pietras, Mariusz; Słota, Ewa


    One of the most often analyzed avian genomes is the domestic chicken genome (Gallus domesticus) whose diploid number is 2n = 78. In the chicken karyotype, similarly to other birds, there is a group of microchromosomes for which the determination of morphology and banding pattern is impossible using classic cytogenetics methods. The aim of this study was to evaluate telomeric and rDNA repetitive sequences in the chicken genome by the PRINS technique as an alternative method to fluorescence in situ hybridization. This is the first report on the application of the PRINS method to locate these repetitive sequences in the chicken nuclei and metaphase chromosomes.

  10. Coupled amplification and sequencing of genomic DNA.

    PubMed Central

    Ruano, G; Kidd, K K


    Addition of dideoxyribonucleotides during the exponential phase of the PCR should result in the synthesis of two complementary sequence ladders. We have explored this hypothesis to develop coupled amplification and sequencing of genomic DNA. Coupled amplification and sequencing is a biphasic method for sequencing both strands of template as they are amplified. Stage I selects and amplifies a single target from the genomic DNA sample. Stage II accomplishes the sequencing as well as additional amplification of the target using aliquots from the stage I reaction mixed with end-labeled primer and dideoxynucleotides. We have successfully applied coupled amplification and sequencing to a 300-base-pair fragment 4 kilobases upstream from HOX2B directly from human whole genomic DNA. Images PMID:1672768

  11. Applications of mass spectrometry to DNA fingerprinting and DNA sequencing

    SciTech Connect

    Jacobson, K.B.; Buchanan, M.V.; Chen, C.H.; Doktycz, M.J.; McLuckey, S.A.; Arlinghaus, H.F.


    DNA fingerprinting and sequencing rely on polyacrylamide gel electrophoresis to determine the sizes of the DNA fragments. Innovative altematives to polyacrylamide gel electrophoresis are under investigation for characterization of such fingerprinting and sequencing. One method uses stable isotopes of tin and other elements to label the DNAwhereas other procedures do not require labels. The detectors in each case are mass spectrometers that detect either the stable isotopes or the DNA fragments themselves. If successful, these methods will speed up the rate of DNA analysis by one or two orders of magnitude.

  12. Applications of mass spectrometry to DNA fingerprinting and DNA sequencing

    SciTech Connect

    Jacobson, K.B.; Buchanan, M.V.; Chen, C.H.; Doktycz, M.J.; McLuckey, S.A. ); Arlinghaus, H.F. )


    DNA fingerprinting and sequencing rely on polyacrylamide gel electrophoresis to determine the sizes of the DNA fragments. Innovative altematives to polyacrylamide gel electrophoresis are under investigation for characterization of such fingerprinting and sequencing. One method uses stable isotopes of tin and other elements to label the DNAwhereas other procedures do not require labels. The detectors in each case are mass spectrometers that detect either the stable isotopes or the DNA fragments themselves. If successful, these methods will speed up the rate of DNA analysis by one or two orders of magnitude.

  13. DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.


    Sucher, Nikolaus J; Hennell, James R; Carles, Maria C


    DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

  14. Data structures for DNA sequence manipulation.

    PubMed Central

    Lawrence, C B


    Two data structures designated Fragment and Construct are described. The Fragment data structure defines a continuous nucleic acid sequence from a unique genetic origin. The Construct defines a continuous sequence composed of sequences from multiple genetic origins. These data structures are manipulated by a set of software tools to simulate the construction of mosaic recombinant DNA molecules. They are also used as an interface between sequence data banks and analytical programs. PMID:3753765

  15. T-DNA integration into the Arabidopsis genome depends on sequences of pre-insertion sites

    PubMed Central

    Brunaud, Véronique; Balzergue, Sandrine; Dubreucq, Bertrand; Aubourg, Sébastien; Samson, Franck; Chauvin, Stéphanie; Bechtold, Nicole; Cruaud, Corinne; DeRose, Richard; Pelletier, Georges; Lepiniec, Loïc; Caboche, Michel; Lecharny, Alain


    A statistical analysis of 9000 flanking sequence tags characterizing transferred DNA (T-DNA) transformants in Arabidopsis sheds new light on T-DNA insertion by illegitimate recombination. T-DNA integration is favoured in plant DNA regions with an A-T-rich content. The formation of a short DNA duplex between the host DNA and the left end of the T-DNA sets the frame for the recombination. The sequence immediately downstream of the plant A-T-rich region is the master element for setting up the DNA duplex, and deletions into the left end of the integrated T-DNA depend on the location of a complementary sequence on the T-DNA. Recombination at the right end of the T-DNA with the host DNA involves another DNA duplex, 2–3 base pairs long, that preferentially includes a G close to the right end of the T-DNA. PMID:12446565

  16. EGNAS: an exhaustive DNA sequence design algorithm

    PubMed Central


    Background The molecular recognition based on the complementary base pairing of deoxyribonucleic acid (DNA) is the fundamental principle in the fields of genetics, DNA nanotechnology and DNA computing. We present an exhaustive DNA sequence design algorithm that allows to generate sets containing a maximum number of sequences with defined properties. EGNAS (Exhaustive Generation of Nucleic Acid Sequences) offers the possibility of controlling both interstrand and intrastrand properties. The guanine-cytosine content can be adjusted. Sequences can be forced to start and end with guanine or cytosine. This option reduces the risk of “fraying” of DNA strands. It is possible to limit cross hybridizations of a defined length, and to adjust the uniqueness of sequences. Self-complementarity and hairpin structures of certain length can be avoided. Sequences and subsequences can optionally be forbidden. Furthermore, sequences can be designed to have minimum interactions with predefined strands and neighboring sequences. Results The algorithm is realized in a C++ program. TAG sequences can be generated and combined with primers for single-base extension reactions, which were described for multiplexed genotyping of single nucleotide polymorphisms. Thereby, possible foldback through intrastrand interaction of TAG-primer pairs can be limited. The design of sequences for specific attachment of molecular constructs to DNA origami is presented. Conclusions We developed a new software tool called EGNAS for the design of unique nucleic acid sequences. The presented exhaustive algorithm allows to generate greater sets of sequences than with previous software and equal constraints. EGNAS is freely available for noncommercial use at PMID:22716030

  17. A region of the polyoma virus genome between the replication origin and late protein coding sequences is required in cis for both early gene expression and viral DNA replication.

    PubMed Central

    Tyndall, C; La Mantia, G; Thacker, C M; Favaloro, J; Kamen, R


    Deletion mutants within the Py DNA region between the replication origin and the beginning of late protein coding sequences have been constructed and analysed for viability, early gene expression and viral DNA replication. Assay of replicative competence was facilitated by the use of Py transformed mouse cells (COP lines) which express functional large T-protein but contain no free viral DNA. Viable mutants defined three new nonessential regions of the genome. Certain deletions spanning the PvuII site at nt 5130 (67.4 mu) were unable to express early genes and had a cis-acting defect in DNA replication. Other mutants had intermediate phenotypes. Relevance of these results to eucaryotic "enhancer" elements is discussed. Images PMID:6275353

  18. DNA sequencing using electrical conductance measurements of a DNA polymerase

    NASA Astrophysics Data System (ADS)

    Chen, Yu-Shiun; Lee, Chia-Hui; Hung, Meng-Yen; Pan, Hsu-An; Chiou, Jin-Chern; Huang, G. Steven


    The development of personalized medicine--in which medical treatment is customized to an individual on the basis of genetic information--requires techniques that can sequence DNA quickly and cheaply. Single-molecule sequencing technologies, such as nanopores, can potentially be used to sequence long strands of DNA without labels or amplification, but a viable technique has yet to be established. Here, we show that single DNA molecules can be sequenced by monitoring the electrical conductance of a phi29 DNA polymerase as it incorporates unlabelled nucleotides into a template strand of DNA. The conductance of the polymerase is measured by attaching it to a protein transistor that consists of an antibody molecule (immunoglobulin G) bound to two gold nanoparticles, which are in turn connected to source and drain electrodes. The electrical conductance of the DNA polymerase exhibits well-separated plateaux that are ~3 pA in height. Each plateau corresponds to an individual base and is formed at a rate of ~22 nucleotides per second. Additional spikes appear on top of the plateaux and can be used to discriminate between the four different nucleotides. We also show that the sequencing platform works with a variety of DNA polymerases and can sequence difficult templates such as homopolymers.

  19. Sequencer-Based Capillary Gel Electrophoresis (SCGE) Targeting the rDNA Internal Transcribed Spacer (ITS) Regions for Accurate Identification of Clinically Important Yeast Species

    PubMed Central

    Chen, Sharon C.-A.; Wang, He; Zhang, Li; Fan, Xin; Xu, Zhi-Peng; Cheng, Jing-Wei; Kong, Fanrong; Zhao, Yu-Pei; Xu, Ying-Chun


    Accurate species identification of Candida, Cryptococcus, Trichosporon and other yeast pathogens is important for clinical management. In the present study, we developed and evaluated a yeast species identification scheme by determining the rDNA internal transcribed spacer (ITS) region length types (LTs) using a sequencer-based capillary gel electrophoresis (SCGE) approach. A total of 156 yeast isolates encompassing 32 species were first used to establish a reference SCGE ITS LT database. Evaluation of the ITS LT database was then performed on (i) a separate set of (n = 97) clinical isolates by SCGE, and (ii) 41 isolates of 41 additional yeast species from GenBank by in silico analysis. Of 156 isolates used to build the reference database, 41 ITS LTs were identified, which correctly identified 29 of the 32 (90.6%) species, with the exception of Trichosporon asahii, Trichosporon japonicum and Trichosporon asteroides. In addition, eight of the 32 species revealed different electropherograms and were subtyped into 2–3 different ITS LTs each. Of the 97 test isolates used to evaluate the ITS LT scheme, 96 (99.0%) were correctly identified to species level, with the remaining isolate having a novel ITS LT. Of the additional 41 isolates for in silico analysis, none was misidentified by the ITS LT database except for Trichosporon mucoides whose ITS LT profile was identical to that of Trichosporon dermatis. In conclusion, yeast identification by the present SCGE ITS LT assay is a fast, reproducible and accurate alternative for the identification of clinically important yeasts with the exception of Trichosporon species. PMID:27105313

  20. Method for sequencing DNA base pairs


    Sessler, A.M.; Dawson, J.


    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

  1. Laser desorption mass spectrometry for DNA analysis and sequencing

    SciTech Connect

    Chen, C.H.; Taranenko, N.I.; Tang, K.; Allman, S.L.


    Laser desorption mass spectrometry has been considered as a potential new method for fast DNA sequencing. Our approach is to use matrix-assisted laser desorption to produce parent ions of DNA segments and a time-of-flight mass spectrometer to identify the sizes of DNA segments. Thus, the approach is similar to gel electrophoresis sequencing using Sanger`s enzymatic method. However, gel, radioactive tagging, and dye labeling are not required. In addition, the sequencing process can possibly be finished within a few hundred microseconds instead of hours and days. In order to use mass spectrometry for fast DNA sequencing, the following three criteria need to be satisfied. They are (1) detection of large DNA segments, (2) sensitivity reaching the femtomole region, and (3) mass resolution good enough to separate DNA segments of a single nucleotide difference. It has been very difficult to detect large DNA segments by mass spectrometry before due to the fragile chemical properties of DNA and low detection sensitivity of DNA ions. We discovered several new matrices to increase the production of DNA ions. By innovative design of a mass spectrometer, we can increase the ion energy up to 45 KeV to enhance the detection sensitivity. Recently, we succeeded in detecting a DNA segment with 500 nucleotides. The sensitivity was 100 femtomole. Thus, we have fulfilled two key criteria for using mass spectrometry for fast DNA sequencing. The major effort in the near future is to improve the resolution. Different approaches are being pursued. When high resolution of mass spectrometry can be achieved and automation of sample preparation is developed, the sequencing speed to reach 500 megabases per year can be feasible.

  2. Nanopore DNA sequencing using kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Ling, Xinsheng

    We propose a method of DNA sequencing by combining the physical method of nanopore electrical measurements and Southern's sequencing-by-hybridization. The new key ingredient, essential to both lowering the costs and increasing the precision, is an asymmetric nanopore sandwich device capable of measuring the DNA hybridization probe twice separated by a designed waiting time. Those incorrect probes appearing only once in nanopore ionic current traces are discriminated from the correct ones that appear twice. This method of discrimination is similar to the principle of kinetic proofreading proposed by Hopfield and Ninio in gene transcription and translation processes. An error analysis is of this nanopore kinetic proofreading (nKP) technique for DNA sequencing is carried out in comparison with the most precise 3' dideoxy termination method developed by Sanger. Nanopore DNA sequencing using kinetic proofreading.

  3. Extracting biological knowledge from DNA sequences

    SciTech Connect

    De La Vega, F.M.; Thieffry, D. |; Collado-Vides, J.


    This session describes the elucidation of information from dna sequences and what challenges computational biologists face in their task of summarizing and deciphering the human genome. Techniques discussed include methods from statistics, information theory, artificial intelligence and linguistics. 1 ref.

  4. gargammel: a sequence simulator for ancient DNA.


    Renaud, Gabriel; Hanghøj, Kristian; Willerslev, Eske; Orlando, Ludovic


    Ancient DNA has emerged as a remarkable tool to infer the history of extinct species and past populations. However, many of its characteristics, such as extensive fragmentation, damage and contamination, can influence downstream analyses. To help investigators measure how these could impact their analyses in silico, we have developed gargammel, a package that simulates ancient DNA fragments given a set of known reference genomes. Our package simulates the entire molecular process from post-mortem DNA fragmentation and DNA damage to experimental sequencing errors, and reproduces most common bias observed in ancient DNA datasets.

  5. Co-infection of Haemonchus contortus and Trichostrongylus spp. among livestock in Malaysia as revealed by amplification and sequencing of the internal transcribed spacer II DNA region

    PubMed Central


    Background Haemonchus contortus and Trichostrongylus spp. are reported to be the most prevalent and highly pathogenic parasites in livestock, particularly in small ruminants. However, the routine conventional tool used in Malaysia could not differentiate the species accurately and therefore limiting the understanding of the co-infections between these two genera among livestock in Malaysia. This study is the first attempt to identify the strongylids of veterinary importance in Malaysia (i.e., H. contortus and Trichostrongylus spp.) by amplification and sequencing of the Internal Transcribed Spacer II DNA region. Results Overall, 118 (cattle: 11 of 98 or 11.2%; deer: 4 of 70 or 5.7%; goats: 99 of 157 or 63.1%; swine: 4 of 91 or 4.4%) out of the 416 collected fecal samples were microscopy positive with strongylid infection. The PCR and sequencing results demonstrated that 93 samples (1 or 25.0% of deer; 92 or 92.9% of goats) contained H. contortus. In addition, Trichostrongylus colubriformis was observed in 75 (75.8% of 99) of strongylid infected goats and Trichostrongylus axei in 4 (4.0%) of 99 goats and 2 (50.0%) of 4 deer. Based on the molecular results, co-infection of H. contortus and Trichostrongylus spp. (H. contortus + T. colubriformis denoted as HTC; H. contortus + T. axei denoted as HTA) were only found in goats. Specifically, HTC co-infections have higher rate (71 or 45.2% of 157) compared to HTA co-infections (3 or 1.9% of 157). Conclusions The present study is the first molecular identification of strongylid species among livestock in Malaysia which is essential towards a better knowledge of the epidemiology of gastro-intestinal parasitic infection among livestock in the country. Furthermore, a more comprehensive or nationwide molecular-based study on gastro-intestinal parasites in livestock should be carried out in the future, given that molecular tools could assist in improving diagnosis of veterinary parasitology in Malaysia due to its high

  6. Compression of Multiple DNA Sequences Using Intra-Sequence and Inter-Sequence Similarities.


    Cheng, Kin-On; Wu, Paula; Law, Ngai-Fong; Siu, Wan-Chi


    Traditionally, intra-sequence similarity is exploited for compressing a single DNA sequence. Recently, remarkable compression performance of individual DNA sequence from the same population is achieved by encoding its difference with a nearly identical reference sequence. Nevertheless, there is lack of general algorithms that also allow less similar reference sequences. In this work, we extend the intra-sequence to the inter-sequence similarity in that approximate matches of subsequences are found between the DNA sequence and a set of reference sequences. Hence, a set of nearly identical DNA sequences from the same population or a set of partially similar DNA sequences like chromosome sequences and DNA sequences of related species can be compressed together. For practical compressors, the compressed size is usually influenced by the compression order of sequences. Fast search algorithms for the optimal compression order are thus developed for multiple sequences compression. Experimental results on artificial and real datasets demonstrate that our proposed multiple sequences compression methods with fast compression order search are able to achieve good compression performance under different levels of similarity in the multiple DNA sequences.

  7. Chimeric DNA methyltransferases target DNA methylation to specific DNA sequences and repress expression of target genes

    PubMed Central

    Li, Fuyang; Papworth, Monika; Minczuk, Michal; Rohde, Christian; Zhang, Yingying; Ragozin, Sergei; Jeltsch, Albert


    Gene silencing by targeted DNA methylation has potential applications in basic research and therapy. To establish targeted methylation in human cell lines, the catalytic domains (CDs) of mouse Dnmt3a and Dnmt3b DNA methyltransferases (MTases) were fused to different DNA binding domains (DBD) of GAL4 and an engineered Cys2His2 zinc finger domain. We demonstrated that (i) Dense DNA methylation can be targeted to specific regions in gene promoters using chimeric DNA MTases. (ii) Site-specific methylation leads to repression of genes controlled by various cellular or viral promoters. (iii) Mutations affecting any of the DBD, MTase or target DNA sequences reduce targeted methylation and gene silencing. (iv) Targeted DNA methylation is effective in repressing Herpes Simplex Virus type 1 (HSV-1) infection in cell culture with the viral titer reduced by at least 18-fold in the presence of an MTase fused to an engineered zinc finger DBD, which binds a single site in the promoter of HSV-1 gene IE175k. In short, we show here that it is possible to direct DNA MTase activity to predetermined sites in DNA, achieve targeted gene silencing in mammalian cell lines and interfere with HSV-1 propagation. PMID:17151075

  8. Affordable hands-on DNA sequencing and genotyping: an exercise for teaching DNA analysis to undergraduates.


    Shah, Kushani; Thomas, Shelby; Stein, Arnold


    In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C Sanger sequencing reactions. They prepare and run the gels, perform Southern blots (which require only 10 min), and detect sequencing ladders using a colorimetric detection system. Students enlarge their sequencing ladders from digital images of their small nylon membranes, and read the sequence manually. They compare their reads with the actual DNA sequence using BLAST2. After mastering the DNA sequencing system, students prepare their own DNA from a cheek swab, polymerase chain reaction-amplify a region of their DNA that encompasses a SNP of interest, and perform sequencing to determine their genotype at the SNP position. A family pedigree can also be constructed. The SNP chosen by the instructor was rs17822931, which is in the ABCC11 gene and is the determinant of human earwax type. Genotypes at the rs178229931 site vary in different ethnic populations. © 2013 by The International Union of Biochemistry and Molecular Biology.

  9. Identifying individuals by sequencing mitochondrial DNA from teeth.


    Ginther, C; Issel-Tarver, L; King, M C


    Mitochondrial DNA (mtDNA) was extracted from teeth stored from 3 months to 20 years, including teeth from the semi-skeletonized remains of a murder victim which had been buried for 10 months. Tooth donors and/or their maternal relatives provided blood or buccal cells, from which mtDNA was also extracted. Enzymatic amplification and direct sequencing of roughly 650 nucleotides from two highly polymorphic regions of mtDNA yielded identical sequences for each comparison of tooth and fresh DNA. Our results suggest that teeth provide an excellent source for high molecular weight mtDNA that can be valuable for extending the time in which decomposed human remains can be genetically identified.

  10. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy


    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  11. A multi-locus analysis of phylogenetic relationships within grass subfamily Pooideae (Poaceae) inferred from sequences of nuclear single copy gene regions compared with plastid DNA.


    Hochbach, Anne; Schneider, Julia; Röser, Martin


    To investigate phylogenetic relationships within the grass subfamily Pooideae we studied about 50 taxa covering all recognized tribes, using one plastid DNA (cpDNA) marker (matK gene-3'trnK exon) and for the first time four nuclear single copy gene loci. DNA sequence information from two parts of the nuclear genes topoisomerase 6 (Topo6) spanning the exons 8-13 and 17-19, the exons 9-13 encoding plastid acetyl-CoA-carboxylase (Acc1) and the partial exon 1 of phytochrome B (PhyB) were generated. Individual and nuclear combined data were evaluated using maximum parsimony, maximum likelihood and Bayesian methods. All of the phylogenetic results show Brachyelytrum and the tribe Nardeae as earliest diverging lineages within the subfamily. The 'core' Pooideae (Hordeeae and the Aveneae/Poeae tribe complex) are also strongly supported, as well as the monophyly of the tribes Brachypodieae, Meliceae and Stipeae (except PhyB). The beak grass tribe Diarrheneae and the tribe Duthieeae are not monophyletic in some of the analyses. However, the combined nuclear DNA (nDNA) tree yields the highest resolution and the best delimitation of the tribes, and provides the following evolutionary hypothesis for the tribes: Brachyelytrum, Nardeae, Duthieeae, Meliceae, Stipeae, Diarrheneae, Brachypodieae and the 'core' Pooideae. Within the individual datasets, the phylogenetic trees obtained from Topo6 exon 8-13 shows the most interesting results. The divergent positions of some clone sequences of Ampelodesmos mauritanicus and Trikeraia pappiformis, for instance, may indicate a hybrid origin of these stipoid taxa. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region

    PubMed Central


    Background Euphorbia mosaic virus (EuMV) is a member of the SLCV clade, a lineage of New World begomoviruses that display distinctive features in their replication-associated protein (Rep) and virion-strand replication origin. The first entirely characterized EuMV isolate is native from Yucatan Peninsula, Mexico; subsequently, EuMV was detected in weeds and pepper plants from another region of Mexico, and partial DNA-A sequences revealed significant differences in their putative replication specificity determinants with respect to EuMV-YP. This study was aimed to investigate the replication compatibility between two EuMV isolates from the same country. Results A new isolate of EuMV was obtained from pepper plants collected at Jalisco, Mexico. Full-length clones of both genomic components of EuMV-Jal were biolistically inoculated into plants of three different species, which developed symptoms indistinguishable from those induced by EuMV-YP. Pseudorecombination experiments with EuMV-Jal and EuMV-YP genomic components demonstrated that these viruses do not form infectious reassortants in Nicotiana benthamiana, presumably because of Rep-iteron incompatibility. Sequence analysis of the EuMV-Jal DNA-B intergenic region (IR) led to the unexpected discovery of a 35-nt-long sequence that is identical to a segment of the rep gene in the cognate viral DNA-A. Similar short rep sequences ranging from 35- to 51-nt in length were identified in all EuMV isolates and in three distinct viruses from South America related to EuMV. These short rep sequences in the DNA-B IR are positioned downstream to a ~160-nt non-coding domain highly similar to the CP promoter of begomoviruses belonging to the SLCV clade. Conclusions EuMV strains are not compatible in replication, indicating that this begomovirus species probably is not a replicating lineage in nature. The genomic analysis of EuMV-Jal led to the discovery of a subgroup of SLCV clade viruses that contain in the non-coding region of

  13. DNA sequencing using fluorescence background electroblotting membrane


    Caldwell, Karin D.; Chu, Tun-Jen; Pitt, William G.


    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

  14. DNA sequencing using fluorescence background electroblotting membrane


    Caldwell, K.D.; Chu, T.J.; Pitt, W.G.


    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

  15. Human gamma X satellite DNA: an X chromosome specific centromeric DNA sequence.


    Lee, C; Li, X; Jabs, E W; Court, D; Lin, C C


    The cosmid clone, CX16-2D12, was previously localized to the centromeric region of the human X chromosome and shown to lack human X-specific alpha satellite DNA. A 1.2 kb EcoRI fragment was subcloned from the CX16-2D12 cosmid and was named 2D12/E2. DNA sequencing revealed that this 1,205 bp fragment consisted of approximately five tandemly repeated DNA monomers of 220 bp. DNA sequence homology between the monomers of 2D12/E2 ranged from 72.8% to 78.6%. Interestingly, DNA sequence analysis of the 2D12/E2 clone displayed a change in monomer unit orientation between nucleotide positions 585-586 from a "tail-to-head" arrangement to a "head-to-tail" configuration. This may reflect the existence of at least one inversion within this repetitive DNA array in the centromeric region of the human X chromosome. The DNA consensus sequence derived from a compilation of these 220 bp monomers had approximately 62% DNA sequence similarity to the previously determined gamma 8 satellite DNA consensus sequence. Comparison of the 2D12/E2 and gamma 8 consensus sequences revealed a 20 bp DNA sequence that was well conserved in both DNA consensus sequences. Slot-blot analysis revealed that this repetitive DNA sequence comprises approximately 0.015% of the human genome, similar to that found with gamma 8 satellite DNA. These observations suggest that this satellite DNA clone is derived from a subfamily of gamma satellite DNA and is thus designated gamma X satellite DNA. When genomic DNA from six unrelated males and two unrelated females was cut with SstI or HpaI and separated by pulsed-field gel electrophoresis, no restriction fragment length polymorphisms were observed for either gamma X (2D12/E2) or gamma 8 (50E4) probes. Fluorescence in situ hybridization localized the 2D12/E2 clone to the lateral sides of the primary constriction specifically on the human X chromosome.

  16. Nucleotide sequence of mouse satellite DNA.

    PubMed Central

    Hörz, W; Altenburger, W


    The nucleotide sequence of uncloned mouse satellite DNA has been determined by analyzing Sau96I restriction fragments that correspond to the repeat unit of the satellite DNA. An unambiguous sequence of 234 bp has been obtained. The sequence of the first 250 bases from dimeric satellite fragments present in Sau96I limit digests corresponds almost exactly to two tandemly arranged monomer sequences including a complete Sau96I site in the center. This is in agreement with the hypothesis that a low level of divergence which cannot be detected in sequence analyses of uncloned DNA is responsible for the appearance of dimeric fragments. Most of the sequence of the 5% fraction of Sau96 monomers that are susceptible to TaqI has also been determined and has been found to agree completely with the prototype sequence. The monomer sequence is internally repetitious being composed of eight diverged subrepeats. The divergence pattern has interesting implications for theories on the evolution of mouse satellite DNA. PMID:6261227

  17. Intranuclear Anchoring of Repetitive DNA Sequences

    PubMed Central

    Weipoltshammer, Klara; Schöfer, Christian; Almeder, Marlene; Philimonenko, Vlada V.; Frei, Klemens; Wachtler, Franz; Hozák, Pavel


    Centromeres, telomeres, and ribosomal gene clusters consist of repetitive DNA sequences. To assess their contributions to the spatial organization of the interphase genome, their interactions with the nucleoskeleton were examined in quiescent and activated human lymphocytes. The nucleoskeletons were prepared using “physiological” conditions. The resulting structures were probed for specific DNA sequences of centromeres, telomeres, and ribosomal genes by in situ hybridization; the electroeluted DNA fractions were examined by blot hybridization. In both nonstimulated and stimulated lymphocytes, centromeric alpha-satellite repeats were almost exclusively found in the eluted fraction, while telomeric sequences remained attached to the nucleoskeleton. Ribosomal genes showed a transcription-dependent attachment pattern: in unstimulated lymphocytes, transcriptionally inactive ribosomal genes located outside the nucleolus were eluted completely. When comparing transcription unit and intergenic spacer, significantly more of the intergenic spacer was removed. In activated lymphocytes, considerable but similar amounts of both rDNA fragments were eluted. The results demonstrate that: (a) the various repetitive DNA sequences differ significantly in their intranuclear anchoring, (b) telomeric rather than centromeric DNA sequences form stable attachments to the nucleoskeleton, and (c) different attachment mechanisms might be responsible for the interaction of ribosomal genes with the nucleoskeleton. PMID:10613900

  18. Nanopore-CMOS Interfaces for DNA Sequencing.


    Magierowski, Sebastian; Huang, Yiyun; Wang, Chengjie; Ghafar-Zadeh, Ebrahim


    DNA sequencers based on nanopore sensors present an opportunity for a significant break from the template-based incumbents of the last forty years. Key advantages ushered by nanopore technology include a simplified chemistry and the ability to interface to CMOS technology. The latter opportunity offers substantial promise for improvement in sequencing speed, size and cost. This paper reviews existing and emerging means of interfacing nanopores to CMOS technology with an emphasis on massively-arrayed structures. It presents this in the context of incumbent DNA sequencing techniques, reviews and quantifies nanopore characteristics and models and presents CMOS circuit methods for the amplification of low-current nanopore signals in such interfaces.

  19. Osmylated DNA, a novel concept for sequencing DNA using nanopores.


    Kanavarioti, Anastassia


    Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. 'Base calling' becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.

  20. Osmylated DNA, a novel concept for sequencing DNA using nanopores

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia


    Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. ‘Base calling’ becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.

  1. Improved algorithm for analysis of DNA sequences using multiresolution transformation.


    Inbamalar, T M; Sivakumar, R


    Bioinformatics and genomic signal processing use computational techniques to solve various biological problems. They aim to study the information allied with genetic materials such as the deoxyribonucleic acid (DNA), the ribonucleic acid (RNA), and the proteins. Fast and precise identification of the protein coding regions in DNA sequence is one of the most important tasks in analysis. Existing digital signal processing (DSP) methods provide less accurate and computationally complex solution with greater background noise. Hence, improvements in accuracy, computational complexity, and reduction in background noise are essential in identification of the protein coding regions in the DNA sequences. In this paper, a new DSP based method is introduced to detect the protein coding regions in DNA sequences. Here, the DNA sequences are converted into numeric sequences using electron ion interaction potential (EIIP) representation. Then discrete wavelet transformation is taken. Absolute value of the energy is found followed by proper threshold. The test is conducted using the data bases available in the National Centre for Biotechnology Information (NCBI) site. The comparative analysis is done and it ensures the efficiency of the proposed system.

  2. Improved Algorithm for Analysis of DNA Sequences Using Multiresolution Transformation

    PubMed Central

    Inbamalar, T. M.; Sivakumar, R.


    Bioinformatics and genomic signal processing use computational techniques to solve various biological problems. They aim to study the information allied with genetic materials such as the deoxyribonucleic acid (DNA), the ribonucleic acid (RNA), and the proteins. Fast and precise identification of the protein coding regions in DNA sequence is one of the most important tasks in analysis. Existing digital signal processing (DSP) methods provide less accurate and computationally complex solution with greater background noise. Hence, improvements in accuracy, computational complexity, and reduction in background noise are essential in identification of the protein coding regions in the DNA sequences. In this paper, a new DSP based method is introduced to detect the protein coding regions in DNA sequences. Here, the DNA sequences are converted into numeric sequences using electron ion interaction potential (EIIP) representation. Then discrete wavelet transformation is taken. Absolute value of the energy is found followed by proper threshold. The test is conducted using the data bases available in the National Centre for Biotechnology Information (NCBI) site. The comparative analysis is done and it ensures the efficiency of the proposed system. PMID:26000337

  3. Bacterial identification and subtyping using DNA microarray and DNA sequencing.


    Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D


    The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

  4. Dynamics and control of DNA sequence amplification

    NASA Astrophysics Data System (ADS)

    Marimuthu, Karthikeyan; Chakrabarti, Raj


    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reaction are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.

  5. Dynamics and control of DNA sequence amplification

    SciTech Connect

    Marimuthu, Karthikeyan; Chakrabarti, Raj E-mail:


    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reaction are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.

  6. Dynamics and control of DNA sequence amplification.


    Marimuthu, Karthikeyan; Chakrabarti, Raj


    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reaction are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.

  7. Female-specific DNA sequences in geese.


    Huang, M C; Lin, W C; Horng, Y M; Rouvier, R; Huang, C W


    1. The OPAE random primers (Operon Technologies, Inc., CA) were used for random amplified polymorphic DNA (RAPD) fingerprinting in Chinese, White Roman and Landaise geese. One of these primers, OPAE-06, produced a 938-bp sex-specific fragment in all females and in no males of Chinese geese only. 2. A novel female-specific DNA sequence in Chinese goose was cloned and sequenced. Two primers, CGSex-F and CGSex-R, were designed in order to amplify a 912-bp sex-specific polymerase chain reaction (PCR) fragment on genomic DNA from female geese. 3. It was shown that a simple and effective PCR-based sexing technique could be used in the three goose breeds studied. 4. Nucleotide sequencing of the sex-specific fragments in White Roman and Landaise geese was performed and sequence differences were observed among these three breeds.

  8. Periodic organisation of foldback sequences in Physarum polycephalum nuclear DNA.


    Hardman, N; Jack, P L


    Nuclear DNA from the slime mould Physarum polycephalum is shown to contain interspersed inverted repeat sequences, such that denatured fragments of DNA containing pairs of these sequences form intra-chain duplexes under appropriate conditions. The organisation and distribution of the nucleotide sequences responsible for the formation of foldback structures in Physarum DNA have been investigated using the electron microscope. The majority of foldback duplexes have sizes ranging up to 800 base pairs, and about 60-80% of DNA molecules 2.2 X 10(4) bases in length contain interspersed foldback elements. The size of individual foldback duplexes, and also the length of the intervening sequences which separate them, are non-random. The results can best be explained by a model in which separate foldback foci in Physarum DNA are spaced periodically at regular intervals. The regions containing foldback foci are thought to contain smaller, tandemly-arranged sequences of discrete sizes, in some cases related to other nucleotide sequences of a similar nature in the same locality in Physarum DNA.

  9. Periodic organisation of foldback sequences in Physarum polycephalum nuclear DNA.

    PubMed Central

    Hardman, N; Jack, P L


    Nuclear DNA from the slime mould Physarum polycephalum is shown to contain interspersed inverted repeat sequences, such that denatured fragments of DNA containing pairs of these sequences form intra-chain duplexes under appropriate conditions. The organisation and distribution of the nucleotide sequences responsible for the formation of foldback structures in Physarum DNA have been investigated using the electron microscope. The majority of foldback duplexes have sizes ranging up to 800 base pairs, and about 60-80% of DNA molecules 2.2 X 10(4) bases in length contain interspersed foldback elements. The size of individual foldback duplexes, and also the length of the intervening sequences which separate them, are non-random. The results can best be explained by a model in which separate foldback foci in Physarum DNA are spaced periodically at regular intervals. The regions containing foldback foci are thought to contain smaller, tandemly-arranged sequences of discrete sizes, in some cases related to other nucleotide sequences of a similar nature in the same locality in Physarum DNA. Images PMID:566909

  10. Nuclear and mitochondrial DNA sequences from two Denisovan individuals

    PubMed Central

    Sawyer, Susanna; Renaud, Gabriel; Viola, Bence; Hublin, Jean-Jacques; Gansauge, Marie-Theres; Shunkov, Michael V.; Derevianko, Anatoly P.; Prüfer, Kay; Pääbo, Svante


    Denisovans, a sister group of Neandertals, have been described on the basis of a nuclear genome sequence from a finger phalanx (Denisova 3) found in Denisova Cave in the Altai Mountains. The only other Denisovan specimen described to date is a molar (Denisova 4) found at the same site. This tooth carries a mtDNA sequence similar to that of Denisova 3. Here we present nuclear DNA sequences from Denisova 4 and a morphological description, as well as mitochondrial and nuclear DNA sequence data, from another molar (Denisova 8) found in Denisova Cave in 2010. This new molar is similar to Denisova 4 in being very large and lacking traits typical of Neandertals and modern humans. Nuclear DNA sequences from the two molars form a clade with Denisova 3. The mtDNA of Denisova 8 is more diverged and has accumulated fewer substitutions than the mtDNAs of the other two specimens, suggesting Denisovans were present in the region over an extended period. The nuclear DNA sequence diversity among the three Denisovans is comparable to that among six Neandertals, but lower than that among present-day humans. PMID:26630009

  11. Sequencing and analysis of the internal transcribed spacers (ITSs) and coding regions in the EcoR I fragment of the ribosomal DNA of the Japanese pond frog Rana nigromaculata.


    Sumida, Masayuki; Kato, Yoji; Kurabayashi, Atsushi


    The rDNA of eukaryotic organisms is transcribed as the 40S-45S rRNA precursor, and this precursor contains the following segments: 5' - ETS - 18S rRNA - ITS 1 - 5.8S rRNA - ITS 2 - 28S rRNA - 3'. In amphibians, the nucleotide sequences of the rRNA precursor have been completely determined in only two species of Xenopus. In the other amphibian species investigated so far, only the short nucleotide sequences of some rDNA fragments have been reported. We obtained a genomic clone containing the rDNA precursor from the Japanese pond frog Rana nigromaculata and analyzed its nucleotide sequence. The cloned genomic fragment was 4,806 bp long and included the 3'-terminus of 18S rRNA, ITS 1, 5.8S rRNA, ITS 2, and a long portion of 28S rRNA. A comparison of nucleotide sequences among Rana, the two species of Xenopus, and human revealed the following: (1) The 3'-terminus of 18S rRNA and the complete 5.8S rRNA were highly conserved among these four taxa. (2) The regions corresponding to the stem and loop of the secondary structure in 28S rRNA were conserved between Xenopus and Rana, but the rate of substitutions in the loop was higher than that in the stem. Many of the human loop regions had large insertions not seen in amphibians. (3) Two ITS regions had highly diverged sequences that made it difficult to compare the sequences not only between human and frogs, but also between Xenopus and Rana. (4) The short tracts in the ITS regions were strictly conserved between the two Xenopus species, and there was a corresponding sequence for Rana. Our data on the nucleotide sequence of the rRNA precursor from the Japanese pond frog Rana nigromaculata were used to examine the potential usefulness of the rRNA genes and ITS regions for evolutionary studies on frogs, because the rRNA precursor contains both highly conserved regions and rapidly evolving regions.

  12. Compressing DNA sequence databases with coil

    PubMed Central

    White, W Timothy J; Hendy, Michael D


    Background Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip) compression – an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. Results We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression – the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST) data. Finally, coil can efficiently encode incremental additions to a sequence database. Conclusion coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work. PMID:18489794

  13. Probe mapping to facilitate transposon-based DNA sequencing

    SciTech Connect

    Strausbaugh, L.D.; Bourke, M.T.; Sommer, M.T.; Coon, M.E.; Berg, C.M. )


    A promising strategy for DNA sequencing exploits transposons to provide mobile sites for the binding of sequencing primers. For such a strategy to be maximally efficient, the location and orientation of the transposon must be readily determined and the insertion sites should be randomly distributed. The authors demonstrate an efficient probe-based method for the localization and orientation of transposon-borne primer sites, which is adaptable to large-scale sequencing strategies. This approach requires no prior restriction enzyme mapping or knowledge of the cloned sequence and eliminates the inefficiency inherent in totally random sequencing methods. To test the efficiency of probe mapping, 49 insertions of the transposon {gamma}{delta} (Tn1000) in a cloned fragment of Drosophila melanogaster DNA were mapped and oriented. In addition, oligonucleotide primers specific for unique subterminal {gamma}{delta} segments were used to prime dideoxynucleotide double-stranded sequencing. These data provided an opportunity to rigorously examine {gamma}{delta} insertion sites. The insertions were quire randomly distributed, even though the target DNA fragment had both A+T-rich and G+C-rich regions; in G+C-rich DNA, the insertions were found in A+T-rich valleys. These data demonstrate that {gamma}{delta} is an excellent choice for supplying mobile primer binding sites to cloned DNA and that transposon-based probe mapping permits the sequences of large cloned segments to be determined without any subcloning.

  14. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant


    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  15. Sequencing of long stretches of repetitive DNA

    PubMed Central

    De Bustos, Alfredo; Cuadrado, Angeles; Jouve, Nicolás


    Repetitive DNA is widespread in eukaryotic genomes, in some cases making up more than 80% of the total. SSRs are a type of repetitive DNA formed by short motifs repeated in tandem arrays. In some species, SSRs may be organized into long stretches, usually associated with the constitutive heterochromatin. Variation in repeats can alter the expression of genes, and changes in the number of repeats have been linked to certain human diseases. Unfortunately, the molecular characterization of these repeats has been hampered by technical limitations related to cloning and sequencing. Indeed, most sequenced genomes contain gaps owing to repetitive DNA-related assembly difficulties. This paper reports an alternative method for sequencing of long stretches of repetitive DNA based on the combined use of 1) a linear vector to stabilize the cloning process, and 2) the use of exonuclease III for obtaining progressive deletions of SSR-rich fragments. This strategy allowed the sequencing of a fragment containing a stretch of 6.2 kb of continuous SSRs. To demonstrate that this procedure can sequence other kinds of repetitive DNA, it was used to examine a 4.5 kb fragment containing a cluster of 15 repeats of the 5S rRNA gene of barley. PMID:27819354

  16. Assessing graphene nanopores for sequencing DNA.


    Wells, David B; Belkin, Maxim; Comer, Jeffrey; Aksimentiev, Aleksei


    Using all-atom molecular dynamics and atomic-resolution Brownian dynamics, we simulate the translocation of single-stranded DNA through graphene nanopores and characterize the ionic current blockades produced by DNA nucleotides. We find that transport of single DNA strands through graphene nanopores may occur in single nucleotide steps. For certain pore geometries, hydrophobic interactions with the graphene membrane lead to a dramatic reduction in the conformational fluctuations of the nucleotides in the nanopores. Furthermore, we show that ionic current blockades produced by different DNA nucleotides are, in general, indicative of the nucleotide type, but very sensitive to the orientation of the nucleotides in the nanopore. Taken together, our simulations suggest that strand sequencing of DNA by measuring the ionic current blockades in graphene nanopores may be possible, given that the conformation of DNA nucleotides in the nanopore can be controlled through precise engineering of the nanopore surface.

  17. DNA sequencing by synthesis based on elongation delay detection

    NASA Astrophysics Data System (ADS)

    Manturov, Alexey O.; Grigoryev, Anton V.


    The one of most important problem in modern genetics, biology and medicine is determination of the primary nucleotide sequence of the DNA of living organisms (DNA sequencing). This paper describes the label-free DNA sequencing approach, based on the observation of a discrete dynamics of DNA sequence elongation phase. The proposed DNA sequencing principle are studied by numerical simulation. The numerical model for proposed label-free DNA sequencing approach is based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) and dynamics of nucleotides incorporation to rising DNA strand. The estimates for number of copied DNA sequences for required probability of nucleotide incorporation event detection and correct DNA sequence determination was obtained. The proposed approach can be applied at all known DNA sequencing devices with "sequencing by synthesis" principle of operation.

  18. Human somatostatin I: sequence of the cDNA.

    PubMed Central

    Shen, L P; Pictet, R L; Rutter, W J


    RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

  19. Applications of recursive segmentation to the analysis of DNA sequences.


    Li, Wentian; Bernaola-Galván, Pedro; Haghighi, Fatameh; Grosse, Ivo


    Recursive segmentation is a procedure that partitions a DNA sequence into domains with a homogeneous composition of the four nucleotides A, C, G and T. This procedure can also be applied to any sequence converted from a DNA sequence, such as to a binary strong(G + C)/weak(A + T) sequence, to a binary sequence indicating the presence or absence of the dinucleotide CpG, or to a sequence indicating both the base and the codon position information. We apply various conversion schemes in order to address the following five DNA sequence analysis problems: isochore mapping, CpG island detection, locating the origin and terminus of replication in bacterial genomes, finding complex repeats in telomere sequences, and delineating coding and noncoding regions. We find that the recursive segmentation procedure can successfully detect isochore borders, CpG islands, and the origin and terminus of replication, but it needs improvement for detecting complex repeats as well as borders between coding and noncoding regions.

  20. Unzipping of DNA with correlated base sequence.


    Allahverdyan, A E; Gevorkian, Zh S; Hu, Chin-Kun; Wu, Ming-Chya


    We consider force-induced unzipping transition for a heterogeneous DNA model with a correlated base sequence. Both finite-range and long-range correlated situations are considered. It is shown that finite-range correlations increase stability of DNA with respect to the external unzipping force. Due to long-range correlations the number of unzipped base pairs displays two widely different scenarios depending on the details of the base sequence: either there is no unzipping phase transition at all, or the transition is realized via a sequence of jumps with magnitude comparable to the size of the system. Both scenarios are different from the behavior of the average number of unzipped base pairs (non-self-averaging). The results can be relevant for explaining the biological purpose of correlated structures in DNA.

  1. Entire Mitochondrial DNA Sequencing on Massively Parallel Sequencing for the Korean Population

    PubMed Central


    Mitochondrial DNA (mtDNA) genome analysis has been a potent tool in forensic practice as well as in the understanding of human phylogeny in the maternal lineage. The traditional mtDNA analysis is focused on the control region, but the introduction of massive parallel sequencing (MPS) has made the typing of the entire mtDNA genome (mtGenome) more accessible for routine analysis. The complete mtDNA information can provide large amounts of novel genetic data for diverse populations as well as improved discrimination power for identification. The genetic diversity of the mtDNA sequence in different ethnic populations has been revealed through MPS analysis, but the Korean population not only has limited MPS data for the entire mtGenome, the existing data is mainly focused on the control region. In this study, the complete mtGenome data for 186 Koreans, obtained using Ion Torrent Personal Genome Machine (PGM) technology and retrieved from rather common mtDNA haplogroups based on the control region sequence, are described. The results showed that 24 haplogroups, determined with hypervariable regions only, branched into 47 subhaplogroups, and point heteroplasmy was more frequent in the coding regions. In addition, sequence variations in the coding regions observed in this study were compared with those presented in other reports on different populations, and there were similar features observed in the sequence variants for the predominant haplogroups among East Asian populations, such as Haplogroup D and macrohaplogroups M9, G, and D. This study is expected to be the trigger for the development of Korean specific mtGenome data followed by numerous future studies. PMID:28244283

  2. Negatively supercoiled simian virus 40 DNA contains Z-DNA segments within transcriptional enhancer sequences

    NASA Technical Reports Server (NTRS)

    Nordheim, A.; Rich, A.


    Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.

  3. Negatively supercoiled simian virus 40 DNA contains Z-DNA segments within transcriptional enhancer sequences

    NASA Technical Reports Server (NTRS)

    Nordheim, A.; Rich, A.


    Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.

  4. A Bioluminometric Method of DNA Sequencing

    NASA Technical Reports Server (NTRS)

    Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)


    Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

  5. A sequence-specific DNA-binding factor (VF1) from Anabaena sp. strain PCC 7120 vegetative cells binds to three adjacent sites in the xisA upstream region.

    PubMed Central

    Chastain, C J; Brusca, J S; Ramasubramanian, T S; Wei, T F; Golden, J W


    A DNA-binding factor (VF1) partially purified from Anabaena sp. strain PCC 7120 vegetative cell extracts by heparin-Sepharose chromatography was found to have affinity for the xisA upstream region. The xisA gene is required for excision of an 11-kilobase element from the nifD gene during heterocyst differentiation. Previous studies of the xisA upstream sequences demonstrated that deletion of this region is required for the expression of xisA from heterologous promoters in vegetative cells. Mobility shift assays with a labeled 250-base-pair fragment containing the binding sites revealed three distinct DNA-protein complexes. Competition experiments showed that VF1 also bound to the upstream sequences of the rbcL and glnA genes, but the rbcL and glnA fragments showed only single complexes in mobility shift assays. The upstream region of the nifH gene formed a weak complex with VF1. DNase footprinting and deletion analysis of the xisA binding site mapped the binding to a 66-base-pair region containing three repeats of the consensus recognition sequence ACATT. Images PMID:2118506


    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...


    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  8. Mitochondrial DNA control region variation in Dubai, United Arab Emirates.


    Alshamali, Farida; Brandstätter, Anita; Zimmermann, Bettina; Parson, Walther


    249 entire mtDNA control region sequences were generated and analyzed in a population sample from Dubai, one of the seven United Arab Emirates. The control region was amplified in one piece and sequenced with different sequencing primers. Sequence evaluation was performed twice and validated by a third senior mtDNA scientist. Phylogenetic analyses were used for quality assurance purposes and for the determination of the haplogroup affiliation of the samples. Upon publication, the population data are going to be available in the EMPOP database (

  9. DNA methylation detection: bisulfite genomic sequencing analysis.


    Li, Yuanyuan; Tollefsbol, Trygve O


    DNA methylation, which most commonly occurs at the C5 position of cytosines within CpG dinucleotides, plays a pivotal role in many biological procedures such as gene expression, embryonic development, cellular proliferation, differentiation, and chromosome stability. Aberrant DNA methylation is often associated with loss of DNA homeostasis and genomic instability leading to the development of human diseases such as cancer. The importance of DNA methylation creates an urgent demand for effective methods with high sensitivity and reliability to explore innovative diagnostic and therapeutic strategies. Bisulfite genomic sequencing developed by Frommer and colleagues was recognized as a revolution in DNA methylation analysis based on conversion of genomic DNA by using sodium bisulfite. Besides various merits of the bisulfite genomic sequencing method such as being highly qualitative and quantitative, it serves as a fundamental principle to many derived methods to better interpret the mystery of DNA methylation. Here, we present a protocol currently frequently used in our laboratory that has proven to yield optimal outcomes. We also discuss the potential technical problems and troubleshooting notes for a variety of applications in this field.

  10. A microchannel electrophoresis DNA sequencing system

    SciTech Connect

    Madabhushi, R S; Warth, T; Balch, J W; Bass, M; Brewer, L R; Copeland, A C; Davidson, J C; Fitch, J P; Kegelmeyer, L M; Kimbrough, J R; McCready, P; Nelson, D; Pastrone, R L; Richardson, P M; Swierkowski, S P; Tarte, L A; Vainer, M


    In order to increase the DNA sequencing throughput of the Joint Genome Institute, we have developed a microchannel electrophoresis system. The critical new and unique elements of this system include 1) a process for the production of arrays of 96 and 384 microchannels on bonded glass substrates up to 14 x 58 cm and 2) new sieving media for high resolution and high speed separations. With custom fabrication apparatus, microchannels are etched in a borosilicate substrate, and then fusion bonded to a top substrate 1.1 mm thick that has access holes formed in it. SEM examination shows a typical microchannel to be 40 micrometers deep x 180 micrometers wide by 46 cm long. This technology offers significant advantages over discrete capillaries or conventional slab-gel approaches. High throughput DNA sequencing with over 550 base pairs resolution has been achieved in roughly half the time of conventional sequencers. In February 1999, we begin a pre-production evaluation protocol for the microchannel and for three glass capillary electrophoresis systems (two from industry and one developed by Lawrence Berkeley National Laboratory for the Joint Genome Institute). In order to utilize these instruments for DNA production sequencing, we have been evaluating and implementing software to convert raw electropherograms into called DNA bases with an associated probability of error. Our original intent was to utilize the DNA base calling software known as Plan and Phred developed by the University of Washington. This software has been outstanding for our slab gel electrophoresis systems currently in the production facility. In our tests and evaluations of this software applied to microchannel data, we observed that the electropherograms are of a different statistical and underlying signal structure compared to slab gels. Even with substantial modifications to the software, base calling performance was not satisfactory for the microchannel data. In this paper, we will present o The

  11. Phylogeography of Chinese bamboo partridge, Bambusicola thoracica thoracica (Aves: Galliformes) in south China: inference from mitochondrial DNA control-region sequences.


    Huang, Zuhao; Liu, Naifa; Liang, Wei; Zhang, Yanyun; Liao, Xinjun; Ruan, Luzhang; Yang, Zhisong


    Chinese bamboo partridge (Bambusicola thoracica thoracica), an endemic subspecies of south China, distributes in mountainous areas that were affected by climate changes throughout the Pleistocene. We investigated the potential impact of cyclical Pleistocene climate changes on phylogeographic patterns using 1140 nucleotides of mitochondrial DNA (mtDNA) control-region from 180 individuals sampled from 13 populations of the partridge. We found 50 haplotypes defined by 39 polymorphic positions. Phylogenetic analyses revealed two robustly supported clades. There was a significant genetic differentiation among the populations with little gene flow. Refugia were identified in the southwestern mountains and Luoxiao Mountains in China, implying that topographic complexity played a substantial role in providing suitable habitats for the partridge during cold periods. Results from the mismatch distribution and neutrality test analysis suggested a range expansion of the two clades. The mtDNA marker suggested the existence of a geographical structure among Chinese bamboo partridge populations, resulting from the synergistic affect of Pleistocene climatic variations. Crown Copyright 2010. Published by Elsevier Inc. All rights reserved.

  12. The DNA sequence specificity of bleomycin cleavage in a systematically altered DNA sequence.


    Gautam, Shweta D; Chen, Jon K; Murray, Vincent


    Bleomycin is an anti-tumour agent that is clinically used to treat several types of cancers. Bleomycin cleaves DNA at specific DNA sequences and recent genome-wide DNA sequencing specificity data indicated that the sequence 5'-RTGT*AY (where T* is the site of bleomycin cleavage, R is G/A and Y is T/C) is preferentially cleaved by bleomycin in human cells. Based on this DNA sequence, we constructed a plasmid clone to explore this bleomycin cleavage preference. By systematic variation of single nucleotides in the 5'-RTGT*AY sequence, we were able to investigate the effect of nucleotide changes on bleomycin cleavage efficiency. We observed that the preferred consensus DNA sequence for bleomycin cleavage in the plasmid clone was 5'-YYGT*AW (where W is A/T). The most highly cleaved sequence was 5'-TCGT*AT and, in fact, the seven most highly cleaved sequences conformed to the consensus sequence 5'-YYGT*AW. A comparison with genome-wide results was also performed and while the core sequence was similar in both environments, the surrounding nucleotides were different.

  13. Fine structure of the 21S ribosomal RNA region on yeast mitochondrial DNA. II. The organization of sequences in petite mitochondrial DNAs carrying genetic markers from the 21S region.


    Heyting, C; Talen, J L; Weijers, P J; Borst, P


    We have investigated the organization of sequences in ten rho- petite mtDNAs by restriction enzyme analysis and electron microscopy. From the comparison of the physical maps of the petite mtDNAs with the physical map of the mtDNA of the parental rho+ strain we conclude that there are at least three different classes of petite mtDNAs: I. Head-to-tail repeats of an (almost) continuous segment of the rho+ mtDNA. II. Head-to-tail repeats of an (almost) continuous segment of the rho+ mtDNA with a terminal inverted duplication. III. Mixed repeats of an (almost) continuous rho+ mtDNA segment. In out petite mtDNAs of the second type, the inverted duplications do not cover the entire conserved rho+ mtDNA segment. We have found that the petite mtDNAs of the third type contain a local inverted duplication at the site where repeating units can insert in two orientations. At least in one case this local inverted duplication must have arisen by mutation. The rearrangements that we have found in the petite mtDNAs do not cluster at specific sites on the rho+ mtDNA map. Large rearrangements or deletions within the conserved rho+ mtDNA segment seem to contribute to the suppressiveness of a petite strain. There is also a positive correlation between the retention of certain segments of the rho+ mtDNA and the suppressiveness of a petite strain. We found no correlation between the suppressiveness of a petite strain and its genetic complexity. The relevance of these findings for the mechanism of petite induction and the usefulness of petite strains for the physical mapping of mitochondrial genetic markers and for DNA sequence analysis are discussed.

  14. New Stopping Criteria for Segmenting DNA Sequences

    NASA Astrophysics Data System (ADS)

    Li, Wentian


    We propose a solution on the stopping criterion in segmenting inhomogeneous DNA sequences with complex statistical patterns. This new stopping criterion is based on Bayesian information criterion in the model selection framework. When this criterion is applied to telomere of S. cerevisiae and the complete sequence of E. coli, borders of biologically meaningful units were identified, and a more reasonable number of domains was obtained. We also introduce a measure called segmentation strength which can be used to control the delineation of large domains. The relationship between the average domain size and the threshold of segmentation strength is determined for several genome sequences.

  15. New Stopping Criteria for Segmenting DNA Sequences

    SciTech Connect

    Li, Wentian


    We propose a solution on the stopping criterion in segmenting inhomogeneous DNA sequences with complex statistical patterns. This new stopping criterion is based on Bayesian information criterion in the model selection framework. When this criterion is applied to telomere of S.cerevisiae and the complete sequence of E.coli, borders of biologically meaningful units were identified, and a more reasonable number of domains was obtained. We also introduce a measure called segmentation strength which can be used to control the delineation of large domains. The relationship between the average domain size and the threshold of segmentation strength is determined for several genome sequences.

  16. DNA Sequence Alignment during Homologous Recombination*

    PubMed Central

    Greene, Eric C.


    Homologous recombination allows for the regulated exchange of genetic information between two different DNA molecules of identical or nearly identical sequence composition, and is a major pathway for the repair of double-stranded DNA breaks. A key facet of homologous recombination is the ability of recombination proteins to perfectly align the damaged DNA with homologous sequence located elsewhere in the genome. This reaction is referred to as the homology search and is akin to the target searches conducted by many different DNA-binding proteins. Here I briefly highlight early investigations into the homology search mechanism, and then describe more recent research. Based on these studies, I summarize a model that includes a combination of intersegmental transfer, short-distance one-dimensional sliding, and length-specific microhomology recognition to efficiently align DNA sequences during the homology search. I also suggest some future directions to help further our understanding of the homology search. Where appropriate, I direct the reader to other recent reviews describing various issues related to homologous recombination. PMID:27129270

  17. DNA Sequence Alignment during Homologous Recombination.


    Greene, Eric C


    Homologous recombination allows for the regulated exchange of genetic information between two different DNA molecules of identical or nearly identical sequence composition, and is a major pathway for the repair of double-stranded DNA breaks. A key facet of homologous recombination is the ability of recombination proteins to perfectly align the damaged DNA with homologous sequence located elsewhere in the genome. This reaction is referred to as the homology search and is akin to the target searches conducted by many different DNA-binding proteins. Here I briefly highlight early investigations into the homology search mechanism, and then describe more recent research. Based on these studies, I summarize a model that includes a combination of intersegmental transfer, short-distance one-dimensional sliding, and length-specific microhomology recognition to efficiently align DNA sequences during the homology search. I also suggest some future directions to help further our understanding of the homology search. Where appropriate, I direct the reader to other recent reviews describing various issues related to homologous recombination. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).


    Berends Sexton, T; Jones, J T; Mullet, J E


    A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

  19. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches


    McCutchen-Maloney, Sandra L.


    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  20. The first determination of DNA sequence of a specific gene.


    Inouye, Masayori


    How and when the first DNA sequence of a gene was determined? In 1977, F. Sanger came up with an innovative technology to sequence DNA by using chain terminators, and determined the entire DNA sequence of the 5375-base genome of bacteriophage φX 174 (Sanger et al., 1977). While this Sanger's achievement has been recognized as the first DNA sequencing of genes, we had determined DNA sequence of a gene, albeit a partial sequence, 11 years before the Sanger's DNA sequence (Okada et al., 1966).

  1. Imaging of DNA sequences with chemiluminescence.

    PubMed Central

    Tizard, R; Cate, R L; Ramachandran, K L; Wysk, M; Voyta, J C; Murphy, O J; Bronstein, I


    We have coupled a chemiluminescent detection method that uses an alkaline phosphatase label to the genomic DNA sequencing protocol of Church and Gilbert [Church, G. M. & Gilbert, W. (1984) Proc. Natl. Acad. Sci. USA 81, 1991-1995]. Images of sequence ladders are obtained on x-ray film with exposure times of less than 30 min, as compared to 40 h required for a similar exposure with a 32P-labeled oligomer. Chemically cleaved DNA from a sequencing gel is transferred to a nylon membrane, and specific sequence ladders are selected by hybridization to DNA oligonucleotides labeled with alkaline phosphatase or with biotin, leading directly or indirectly to deposition of enzyme. If a biotinylated probe is used, an incubation with avidin-alkaline phosphatase conjugate follows. The membrane is soaked in the chemiluminescent substrate (AMPPD) and is exposed to film. Dephosphorylation of AMPPD leads in a two-step pathway to a highly localized emission of visible light. The demonstrated shorter exposure times may improve the efficiency of a serial reprobing strategy such as the multiplex sequencing approach of Church and Kieffer-Higgins [Church, G. M. & Kieffer-Higgins, S. (1988) Science 240, 185-188]. Images PMID:2191292

  2. Mitochondrial DNA Sequence Analysis - Validation and Use for Forensic Casework.


    Holland, M M; Parsons, T J


    With the discovery of the polymerase chain reaction (PCR) in the mid-1980's, the last in a series of critical molecular biology techniques (to include the isolation of DNA from human and non-human biological material, and primary sequence analysis of DNA) had been developed to rapidly analyze minute quantities of mitochondrial DNA (mtDNA). This was especially true for mtDNA isolated from challenged sources, such as ancient or aged skeletal material and hair shafts. One of the beneficiaries of this work has been the forensic community. Over the last decade, a significant amount of research has been conducted to develop PCR-based sequencing assays for the mtDNA control region (CR), which have subsequently been used to further characterize the CR. As a result, the reliability of these assays has been investigated, the limitations of the procedures have been determined, and critical aspects of the analysis process have been identified, so that careful control and monitoring will provide the basis for reliable testing. With the application of these assays to forensic identification casework, mtDNA sequence analysis has been properly validated, and is a reliable procedure for the examination of biological evidence encountered in forensic criminalistic cases. Copyright © 1999 Central Police University.

  3. Ribosomal DNA copy number loss and sequence variation in cancer

    PubMed Central

    Xu, Baoshan; Li, Hua; Perry, John M.; Singh, Vijay Pratap; Yu, Zulin; Zakari, Musinu; Li, Linheng


    Ribosomal DNA is one of the most variable regions in the human genome with respect to copy number. Despite the importance of rDNA for cellular function, we know virtually nothing about what governs its copy number, stability, and sequence in the mammalian genome due to challenges associated with mapping and analysis. We applied computational and droplet digital PCR approaches to measure rDNA copy number in normal and cancer states in human and mouse genomes. We find that copy number and sequence can change in cancer genomes. Counterintuitively, human cancer genomes show a loss of copies, accompanied by global copy number co-variation. The sequence can also be more variable in the cancer genome. Cancer genomes with lower copies have mutational evidence of mTOR hyperactivity. The PTEN phosphatase is a tumor suppressor that is critical for genome stability and a negative regulator of the mTOR kinase pathway. Surprisingly, but consistent with the human cancer genomes, hematopoietic cancer stem cells from a Pten-/- mouse model for leukemia have lower rDNA copy number than normal tissue, despite increased proliferation, rRNA production, and protein synthesis. Loss of copies occurs early and is associated with hypersensitivity to DNA damage. Therefore, copy loss is a recurrent feature in cancers associated with mTOR activation. Ribosomal DNA copy number may be a simple and useful indicator of whether a cancer will be sensitive to DNA damaging treatments. PMID:28640831

  4. Ribosomal DNA copy number loss and sequence variation in cancer.


    Xu, Baoshan; Li, Hua; Perry, John M; Singh, Vijay Pratap; Unruh, Jay; Yu, Zulin; Zakari, Musinu; McDowell, William; Li, Linheng; Gerton, Jennifer L


    Ribosomal DNA is one of the most variable regions in the human genome with respect to copy number. Despite the importance of rDNA for cellular function, we know virtually nothing about what governs its copy number, stability, and sequence in the mammalian genome due to challenges associated with mapping and analysis. We applied computational and droplet digital PCR approaches to measure rDNA copy number in normal and cancer states in human and mouse genomes. We find that copy number and sequence can change in cancer genomes. Counterintuitively, human cancer genomes show a loss of copies, accompanied by global copy number co-variation. The sequence can also be more variable in the cancer genome. Cancer genomes with lower copies have mutational evidence of mTOR hyperactivity. The PTEN phosphatase is a tumor suppressor that is critical for genome stability and a negative regulator of the mTOR kinase pathway. Surprisingly, but consistent with the human cancer genomes, hematopoietic cancer stem cells from a Pten-/- mouse model for leukemia have lower rDNA copy number than normal tissue, despite increased proliferation, rRNA production, and protein synthesis. Loss of copies occurs early and is associated with hypersensitivity to DNA damage. Therefore, copy loss is a recurrent feature in cancers associated with mTOR activation. Ribosomal DNA copy number may be a simple and useful indicator of whether a cancer will be sensitive to DNA damaging treatments.

  5. DNA sequencing by nanopores: advances and challenges

    NASA Astrophysics Data System (ADS)

    Agah, Shaghayegh; Zheng, Ming; Pasquali, Matteo; Kolomeisky, Anatoly B.


    Developing inexpensive and simple DNA sequencing methods capable of detecting entire genomes in short periods of time could revolutionize the world of medicine and technology. It will also lead to major advances in our understanding of fundamental biological processes. It has been shown that nanopores have the ability of single-molecule sensing of various biological molecules rapidly and at a low cost. This has stimulated significant experimental efforts in developing DNA sequencing techniques by utilizing biological and artificial nanopores. In this review, we discuss recent progress in the nanopore sequencing field with a focus on the nature of nanopores and on sensing mechanisms during the translocation. Current challenges and alternative methods are also discussed.

  6. Repetitive DNA sequences in Mycoplasma pneumoniae.

    PubMed Central

    Wenzel, R; Herrmann, R


    Two types of different repetitive DNA sequences called RepMP1 and RepMP2 were identified in the genome of Mycoplasma pneumoniae. The number of these repeated elements, their nucleotide sequence and their localization on a physical map of the M. pneumoniae genome were determined. The results show that RepMP1 appears at least 10 times and RepMP2 at least 8 times in the genome. The repeated elements are dispersed on the chromosome and, in three cases, linked to each other by a homologous DNA sequence of 400 bp. The elements themselves are 300 bp (for RepMP1) and 150 bp (for RepMP2) long showing a high degree of homology. One copy of RepMP2 is a translated part of the gene for the major cytadhesin protein P1 which is responsible for the adsorption of M. pneumoniae to its host cell. Images PMID:3138660

  7. Nanopore-CMOS Interfaces for DNA Sequencing

    PubMed Central

    Magierowski, Sebastian; Huang, Yiyun; Wang, Chengjie; Ghafar-Zadeh, Ebrahim


    DNA sequencers based on nanopore sensors present an opportunity for a significant break from the template-based incumbents of the last forty years. Key advantages ushered by nanopore technology include a simplified chemistry and the ability to interface to CMOS technology. The latter opportunity offers substantial promise for improvement in sequencing speed, size and cost. This paper reviews existing and emerging means of interfacing nanopores to CMOS technology with an emphasis on massively-arrayed structures. It presents this in the context of incumbent DNA sequencing techniques, reviews and quantifies nanopore characteristics and models and presents CMOS circuit methods for the amplification of low-current nanopore signals in such interfaces. PMID:27509529

  8. Sequence-Dependent Persistence Lengths of DNA.


    Mitchell, Jonathan S; Glowacki, Jaroslaw; Grandchamp, Alexandre E; Manning, Robert S; Maddocks, John H


    A Monte Carlo code applied to the cgDNA coarse-grain rigid-base model of B-form double-stranded DNA is used to predict a sequence-averaged persistence length of lF = 53.5 nm in the sense of Flory, and of lp = 160 bp or 53.5 nm in the sense of apparent tangent-tangent correlation decay. These estimates are slightly higher than the consensus experimental values of 150 bp or 50 nm, but we believe the agreement to be good given that the cgDNA model is itself parametrized from molecular dynamics simulations of short fragments of length 10-20 bp, with no explicit fit to persistence length. Our Monte Carlo simulations further predict that there can be substantial dependence of persistence lengths on the specific sequence [Formula: see text] of a fragment. We propose, and confirm the numerical accuracy of, a simple factorization that separates the part of the apparent tangent-tangent correlation decay [Formula: see text] attributable to intrinsic shape, from a part [Formula: see text] attributable purely to stiffness, i.e., a sequence-dependent version of what has been called sequence-averaged dynamic persistence length l̅d (=58.8 nm within the cgDNA model). For ensembles of both random and λ-phage fragments, the apparent persistence length [Formula: see text] has a standard deviation of 4 nm over sequence, whereas our dynamic persistence length [Formula: see text] has a standard deviation of only 1 nm. However, there are notable dynamic persistence length outliers, including poly(A) (exceptionally straight and stiff), poly(TA) (tightly coiled and exceptionally soft), and phased A-tract sequence motifs (exceptionally bent and stiff). The results of our numerical simulations agree reasonably well with both molecular dynamics simulation and diverse experimental data including minicircle cyclization rates and stereo cryo-electron microscopy images.

  9. Compilation and analysis of Escherichia coli promoter DNA sequences.

    PubMed Central

    Hawley, D K; McClure, W R


    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter mutations. Nearly all of the altered base pairs in the mutants conform to the following general rule: down-mutations decrease homology and up-mutations increase homology to the consensus sequence. PMID:6344016

  10. DNA Sequencing Using an Engineered Protein Nanopore

    NASA Astrophysics Data System (ADS)

    Gundlach, Jens H.


    Inexpensive and fast sequencing of DNA is of paramount importance to medicine, the life sciences and to many other applications. Because of the nanometer diameter of DNA a nanometer-scale reader directly interfaced to macroscopic observables seems particularly attractive. We are working on a new single molecule technique based on a biological pore embedded in a lipid bilayer. When a voltage is applied across the bilayer an ion current is measured that flows through the nanometer opening of the pore. Poly-negatively charged single stranded DNA passes through the pore and reduces the ion current with the remaining ion current being indicative of the nucleotide type in the constriction of the pore. The protein pore that we introduced to the field, MspA, has a shape ideally suited to nanopore sequencing, has robustness comparable to solid state devices, is easily reproduced with sub-nanometer level precision and is engineerable using genetic mutations. I will present proof-of-principle data showing that this technique can lead to a direct very inexpensive and fast sequencing technology. The experimental electronic signatures of the DNA translocation process provide an ideal test bed for molecular dynamics simulations, which in turn allows developing intuition and prediction of nanoscale dynamics.

  11. Sequence-specific recognition of DNA nanostructures.


    Rusling, David A; Fox, Keith R


    DNA is the most exploited biopolymer for the programmed self-assembly of objects and devices that exhibit nanoscale-sized features. One of the most useful properties of DNA nanostructures is their ability to be functionalized with additional non-nucleic acid components. The introduction of such a component is often achieved by attaching it to an oligonucleotide that is part of the nanostructure, or hybridizing it to single-stranded overhangs that extend beyond or above the nanostructure surface. However, restrictions in nanostructure design and/or the self-assembly process can limit the suitability of these procedures. An alternative strategy is to couple the component to a DNA recognition agent that is capable of binding to duplex sequences within the nanostructure. This offers the advantage that it requires little, if any, alteration to the nanostructure and can be achieved after structure assembly. In addition, since the molecular recognition of DNA can be controlled by varying pH and ionic conditions, such systems offer tunable properties that are distinct from simple Watson-Crick hybridization. Here, we describe methodology that has been used to exploit and characterize the sequence-specific recognition of DNA nanostructures, with the aim of generating functional assemblies for bionanotechnology and synthetic biology applications.

  12. Compilation of DNA sequences of Escherichia coli

    PubMed Central

    Kröger, Manfred


    We have compiled the DNA sequence data for E.coli K12 available from the GENBANK and EMBO databases and over a period of several years independently from the literature. We have introduced all available genetic map data and have arranged the sequences accordingly. As far as possible the overlaps are deleted and a total of 940,449 individual bp is found to be determined till the beginning of 1989. This corresponds to a total of 19.92% of the entire E.coli chromosome consisting of about 4,720 kbp. This number may actually be higher by some extra 2% derived from the sequence of lysogenic bacteriophage lambda and the various insertion sequences. This compilation may be available in machine readable form from one of the international databanks in some future. PMID:2654890

  13. The 2.1-kb inverted repeat DNA sequences flank the mat2,3 silent region in two species of Schizosaccharomyces and are involved in epigenetic silencing in Schizosaccharomyces pombe.

    PubMed Central

    Singh, Gurjeet; Klar, Amar J S


    The mat2,3 region of the fission yeast Schizosaccharomyces pombe exhibits a phenomenon of transcriptional silencing. This region is flanked by two identical DNA sequence elements, 2.1 kb in length, present in inverted orientation: IRL on the left and IRR on the right of the silent region. The repeats do not encode any ORF. The inverted repeat DNA region is also present in a newly identified related species, which we named S. kambucha. Interestingly, the left and right repeats share perfect identity within a species, but show approximately 2% bases interspecies variation. Deletion of IRL results in variegated expression of markers inserted in the silent region, while deletion of the IRR causes their derepression. When deletions of these repeats were genetically combined with mutations in different trans-acting genes previously shown to cause a partial defect in silencing, only mutations in clr1 and clr3 showed additive defects in silencing with the deletion of IRL. The rate of mat1 switching is also affected by deletion of repeats. The IRL or IRR deletion did not cause significant derepression of the mat2 or mat3 loci. These results implicate repeats for maintaining full repression of the mat2,3 region, for efficient mat1 switching, and further support the notion that multiple pathways cooperate to silence the mat2,3 domain. PMID:12399374

  14. The 2.1-kb inverted repeat DNA sequences flank the mat2,3 silent region in two species of Schizosaccharomyces and are involved in epigenetic silencing in Schizosaccharomyces pombe.


    Singh, Gurjeet; Klar, Amar J S


    The mat2,3 region of the fission yeast Schizosaccharomyces pombe exhibits a phenomenon of transcriptional silencing. This region is flanked by two identical DNA sequence elements, 2.1 kb in length, present in inverted orientation: IRL on the left and IRR on the right of the silent region. The repeats do not encode any ORF. The inverted repeat DNA region is also present in a newly identified related species, which we named S. kambucha. Interestingly, the left and right repeats share perfect identity within a species, but show approximately 2% bases interspecies variation. Deletion of IRL results in variegated expression of markers inserted in the silent region, while deletion of the IRR causes their derepression. When deletions of these repeats were genetically combined with mutations in different trans-acting genes previously shown to cause a partial defect in silencing, only mutations in clr1 and clr3 showed additive defects in silencing with the deletion of IRL. The rate of mat1 switching is also affected by deletion of repeats. The IRL or IRR deletion did not cause significant derepression of the mat2 or mat3 loci. These results implicate repeats for maintaining full repression of the mat2,3 region, for efficient mat1 switching, and further support the notion that multiple pathways cooperate to silence the mat2,3 domain.

  15. Detecting and Analyzing DNA Sequencing Errors: Toward a Higher Quality of the Bacillus subtilis Genome Sequence

    PubMed Central

    Médigue, Claudine; Rose, Matthias; Viari, Alain; Danchin, Antoine


    During the determination of a DNA sequence, the introduction of artifactual frameshifts and/or in-frame stop codons in putative genes can lead to misprediction of gene products. Detection of such errors with a method based on protein similarity matching is only possible when related sequences are available in databases. Here, we present a method to detect frameshift errors in DNA sequences that is based on the intrinsic properties of the coding sequences. It combines the results of two analyses, the search for translational initiation/termination sites and the prediction of coding regions. This method was used to screen the complete Bacillus subtilis genome sequence and the regions flanking putative errors were resequenced for verification. This procedure allowed us to correct the sequence and to analyze in detail the nature of the errors. Interestingly, in several cases in-frame termination codons or frameshifts were not sequencing errors but confirmed to be present in the chromosome, indicating that the genes are either nonfunctional (pseudogenes) or subject to regulatory processes such as programmed translational frameshifts. The method can be used for checking the quality of the sequences produced by any prokaryotic genome sequencing project. PMID:10568751

  16. Fast comparison of DNA sequences by oligonucleotide profiling

    PubMed Central

    Arnau, Vicente; Gallach, Miguel; Marín, Ignacio


    Background The comparison of DNA sequences is a traditional problem in genomics and bioinformatics. Many new opportunities emerge due to the improvement of personal computers, allowing the implementation of novel strategies of analysis. Findings We describe a new program, called UVWORD, which determines the number of times that each DNA word present in a sequence (target) is found in a second sequence (source), a procedure that we have called oligonucleotide profiling. On a standard computer, the user may search for words of a size ranging from k = 1 to k = 14 nucleotides. Average counts for groups of contiguous words may also be established. The rate of analysis on standard computers is from 3.4 (k = 14) to 16 millions of words per second (1 ≤ k ≤ 8). This makes feasible the fast screening of even the longest known DNA molecules. Discussion We show that the combination of the ability of analyzing words of relatively long size, which occur very rarely by chance, and the fast speed of the program allows to perform novel types of screenings, complementary to those provided by standard programs such as BLAST. This method can be used to determine oligonucleotide content, to characterize the distribution of repetitive sequences in chromosomes, to determine the evolutionary conservation of sequences in different species, to establish regions of similar DNA among chromosomes or genomes, etc. PMID:18710530

  17. RNA–DNA sequence differences in Saccharomyces cerevisiae

    PubMed Central

    Wang, Isabel X.; Grunseich, Christopher; Chung, Youree G.; Kwak, Hojoong; Ramrattan, Girish; Zhu, Zhengwei; Cheung, Vivian G.


    Alterations of RNA sequences and structures, such as those from editing and alternative splicing, result in two or more RNA transcripts from a DNA template. It was thought that in yeast, RNA editing only occurs in tRNAs. Here, we found that Saccharomyces cerevisiae have all 12 types of RNA–DNA sequence differences (RDDs) in the mRNA. We showed these sequence differences are propagated to proteins, as we identified peptides encoded by the RNA sequences in addition to those by the DNA sequences at RDD sites. RDDs are significantly enriched at regions with R-loops. A screen of yeast mutants showed that RDD formation is affected by mutations in genes regulating R-loops. Loss-of-function mutations in ribonuclease H, senataxin, and topoisomerase I that resolve RNA–DNA hybrids lead to increases in RDD frequency. Our results demonstrate that RDD is a conserved process that diversifies transcriptomes and proteomes and provide a mechanistic link between R-loops and RDDs. PMID:27638543

  18. [Economical sequencing of DNA with terminators].


    Kraev, A S; Mironov, V N


    We describe several improvements of chain-termination DNA sequencing procedure of Sanger et al. For template preparation we use 0.3 ml cultures of M13 clones, grown in standard 1,5 ml polypropylene tubes. The sequencing experiment differs from the previously described by the use of deoxyNTP, labelled with phosphorus-33 (a low energy isotope with a half-life of 25 days, commercially produced in the USSR), and by a "quasi-end labelling" reaction, preceding the DNA synthesis in the presence of dideoxyNTPs. The combination of the phosphorus-33 and the quasi-end labelling produces very sharp sequencing ladders, that equal or exceed in quality those obtained with sulphur-35, and only an overnight exposure with a conventional X-ray film is required. The use of plastic tubes for bacterial growth and the 60-well microchambers for carrying out sequencing reactions results in substantial saving of time and cost in routine "middle scale" sequencing (both types of plasticware are produced in the USSR).

  19. Targeted deep DNA methylation analysis of circulating cell-free DNA in plasma using massively parallel semiconductor sequencing.


    Vaca-Paniagua, Felipe; Oliver, Javier; Nogueira da Costa, Andre; Merle, Philippe; McKay, James; Herceg, Zdenko; Holmila, Reetta


    To set up a targeted methylation analysis using semiconductor sequencing and evaluate the potential for studying methylation in circulating cell-free DNA (cfDNA). Methylation of VIM, FBLN1, LTBP2, HINT2, h19 and IGF2 was analyzed in plasma cfDNA and white blood cell DNA obtained from eight hepatocellular carcinoma patients and eight controls using Ion Torrent™ PGM sequencer. h19 and IGF2 showed consistent methylation levels and methylation was detected for VIM and FBLN1, whereas LTBP2 and HINT2 did not show methylation for target regions. VIM gene promoter methylation was higher in HCC cfDNA than in cfDNA of controls or white blood cell DNA. Semiconductor sequencing is a suitable method for analyzing methylation profiles in cfDNA. Furthermore, differences in cfDNA methylation can be detected between controls and hepatocellular carcinoma cases, even though due to the small sample set these results need further validation.

  20. Sequencing and Analysis of Neanderthal Genomic DNA

    PubMed Central

    Noonan, James P.; Coop, Graham; Kudaravalli, Sridhar; Smith, Doug; Krause, Johannes; Alessi, Joe; Chen, Feng; Platt, Darren; Pääbo, Svante; Pritchard, Jonathan K.; Rubin, Edward M.


    Our knowledge of Neanderthals is based on a limited number of remains and artifacts from which we must make inferences about their biology, behavior, and relationship to ourselves. Here, we describe the characterization of these extinct hominids from a new perspective, based on the development of a Neanderthal metagenomic library and its high-throughput sequencing and analysis. Several lines of evidence indicate that the 65,250 base pairs of hominid sequence so far identified in the library are of Neanderthal origin, the strongest being the ascertainment of sequence identities between Neanderthal and chimpanzee at sites where the human genomic sequence is different. These results enabled us to calculate the human-Neanderthal divergence time based on multiple randomly distributed autosomal loci. Our analyses suggest that on average the Neanderthal genomic sequence we obtained and the reference human genome sequence share a most recent common ancestor ~706,000 years ago, and that the human and Neanderthal ancestral populations split ~370,000 years ago, before the emergence of anatomically modern humans. Our finding that the Neanderthal and human genomes are at least 99.5% identical led us to develop and successfully implement a targeted method for recovering specific ancient DNA sequences from metagenomic libraries. This initial analysis of the Neanderthal genome advances our understanding of the evolutionary relationship of Homo sapiens and Homo neanderthalensis and signifies the dawn of Neanderthal genomics. PMID:17110569

  1. Genetic algorithms for DNA sequence assembly.


    Parsons, R; Forrest, S; Burks, C


    This paper describes a genetic algorithm application to the DNA sequence assembly problem. The genetic algorithm uses a sorted order representation for representing the orderings of fragments. Two different fitness functions, both based on pairwise overlap strengths between fragments, are tested. The paper concludes that the genetic algorithm is a promising method for fragment assembly problems, achieving usable solutions quickly, but that the current fitness functions are flawed and that other representations might be more appropriate.

  2. Directly repeated sequences associated with pathogenic mitochondrial DNA deletions.

    PubMed Central

    Johns, D R; Rutledge, S L; Stine, O C; Hurko, O


    We determined the nucleotide sequences of junctional regions associated with large deletions of mitochondrial DNA found in four unrelated individuals with a phenotype of chronic progressive external ophthalmoplegia. In each patient, the deletion breakpoint occurred within a directly repeated sequence of 13-18 base pairs, present in different regions of the normal mitochondrial genome-separated by 4.5-7.7 kilobases. In two patients, the deletions were identical. When all four repeated sequences are compared, a consensus sequence of 11 nucleotides emerges, similar to putative recombination signals, suggesting the involvement of a recombinational event. Partially deleted and normal mitochondrial DNAs were found in all tissues examined, but in very different proportions, indicating that these mutations originated before the primary cell layers diverged. Images PMID:2813377


    PubMed Central

    Wiebe, Glenis J.; Pershad, Rashmi; Escobar, Helaman; Hawes, John W.; Hunter, Timothy; Jackson-Machelski, Emily; Knudtson, Kevin L.; Robertson, Margaret; Thannhauser, Theodore W.


    DNA sequencing core facilities serve as centralized resources within both academic and commercial institutions, providing expertise in the area of DNA analysis. The composition and configuration of these facilities continue to evolve in response to new developments in instrumentation and methodology. The goal of the 2003 DNA Sequencing Research Group (DSRG) survey was to identify recent changes in staffing, funding, instrumentation, services, and customer relations. Responses to 58 survey questions from 30 participants are presented to offer a look at the current typical DNA core sequencing facility. The results from this study will serve as a resource for institutions to benchmark their shared core laboratories, and to give facility directors an opportunity to compare and contrast their respective services and experiences.

  4. Random Coding Bounds for DNA Codes Based on Fibonacci Ensembles of DNA Sequences

    DTIC Science & Technology


    COVERED (From - To) 6 Jul 08 – 11 Jul 08 4. TITLE AND SUBTITLE RANDOM CODING BOUNDS FOR DNA CODES BASED ON FIBONACCI ENSEMBLES OF DNA SEQUENCES ... sequences which are generalizations of the Fibonacci sequences . 15. SUBJECT TERMS DNA Codes, Fibonacci Ensembles, DNA Computing, Code Optimization 16...coding bound on the rate of DNA codes is proved. To obtain the bound, we use some ensembles of DNA sequences which are generalizations of the Fibonacci

  5. Organization and partial sequence of a DNA region of the Rhizobium leguminosarum symbiotic plasmid pRL6JI containing the genes fixABC, nifA, nifB and a novel open reading frame.

    PubMed Central

    Grönger, P; Manian, S S; Reiländer, H; O'Connell, M; Priefer, U B; Pühler, A


    By hybridization and heteroduplex studies the fixABC and nifA genes of the Rhizobium leguminosarum symbiotic plasmid pRL6JI have been identified. DNA sequencing of the region containing nifA showed an open reading frame of 1557 bp encoding a protein of 56, 178 D. Based on sequence homology, this ORF was confirmed to correspond to the nifA gene. Comparison of three nifA proteins (Klebsiella pneumoniae, Rhizobium meliloti, Rhizobium leguminosarum) revealed only a weak relationship in their N-terminal regions, whereas the C-terminal parts exhibited strong homology. Sequence analysis also showed that the R. leguminosarum nifA gene is followed by nifB and preceded by fixC with an open reading frame inserted in between. This novel ORF of 294 bp was found to be highly conserved also in R. meliloti. No known promoter and termination signals could be defined on the sequenced R. leguminosarum fragment. Images PMID:3029674

  6. An oligonucleotide hybridization approach to DNA sequencing.


    Khrapko, K R; Lysov YuP; Khorlyn, A A; Shick, V V; Florentiev, V L; Mirzabekov, A D


    We have proposed a DNA sequencing method based on hybridization of a DNA fragment to be sequenced with the complete set of fixed-length oligonucleotides (e.g., 4(8) = 65,536 possible 8-mers) immobilized individually as dots of a 2-D matrix [(1989) Dokl. Akad. Nauk SSSR 303, 1508-1511]. It was shown that the list of hybridizing octanucleotides is sufficient for the computer-assisted reconstruction of the structures for 80% of random-sequence fragments up to 200 bases long, based on the analysis of the octanucleotide overlapping. Here a refinement of the method and some experimental data are presented. We have performed hybridizations with oligonucleotides immobilized on a glass plate, and obtained their dissociation curves down to heptanucleotides. Other approaches, e.g., an additional hybridization of short oligonucleotides which continuously extend duplexes formed between the fragment and immobilized oligonucleotides, should considerably increase either the probability of unambiguous reconstruction, or the length of reconstructed sequences, or decrease the size of immobilized oligonucleotides.

  7. Text mining of DNA sequence homology searches.


    McCallum, John; Ganesh, Siva


    Primary tasks in analysis and annotation of expressed sequence tag (EST) datasets are to identify similarity among sequences by unsupervised clustering and assign putative function based on BLAST homology searches. We investigated the usefulness of text mining as a simple approach for further higher-level clustering of EST datasets using IBM Intelligent Miner for Text v2.3 tools. Agglomerative and k-means clustering tools were used to cluster BLASTx homology search documents from two onion EST datasets and optimised by pre-processing and pruning. Subjective evaluation confirmed that these tools provided biologically useful and complementary views of the two libraries, provided new insights into their composition and revealed clusters previously identified by human experts. We compared BLASTx textual clusters for two gene families with their DNA sequence-based clusters and confirmed that these shared similar morphology.

  8. Pattern of genetic variation of yellow catfish Pelteobagrus fulvidraco Richardso in Huaihe river and the Yangtze river revealed using mitochondrial DNA control region sequences.


    Xiao, Mingsong; Bao, Fangyin; Cui, Feng


    Genetic variability and population genetic structure of the yellow catfish Pelteobagrus fulvidraco Richardso in the Huaihe river and the Yangtze river was examined with a 810-bp of the mitochondrial DNA control region. A total of 70 haplotypes were identified from 145 samples, which were characterized with high haplotype diversity (h = 0.9832 ± 0.0041) but low nucleotide diversity (π = 0.0415 ± 0.0201). The analysis of molecular variance and phylogenetic reconstructions detected significant geographic structure between Huaihe river and Yangtze with FST = 0.1183 (P = 0.0000). Neighbor-joining (NJ) phylogenetic analyses identified two distinct clades (bootstrap support 99 %). The medium joining network drawn using the complete data set was reticulated and also distinctly split the 70 haplotypes into two groups corresponding to those of the NJ tree. Departures from neutrality were not significant for the Huaihe river and the Yangtze river Pelteobagrus fulvidraco, concordant with the observed multimodal mismatch distributions (P > 0.05), which suggested that the effective size of this species has been large and stable for a long period. The question about the existence of significant genetic differentiation for Pelteobagrus fulvidraco in the Yangtze river and Huaihe river basins remains to be further studied with molecular nuclear markers and larger sample sizes from throughout the river basins.

  9. Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region.


    Arif, Chatchanit; Daniels, Camille; Bayer, Till; Banguera-Hinestroza, Eulalia; Barbrook, Adrian; Howe, Christopher J; LaJeunesse, Todd C; Voolstra, Christian R


    The persistence of coral reef ecosystems relies on the symbiotic relationship between scleractinian corals and intracellular, photosynthetic dinoflagellates in the genus Symbiodinium. Genetic evidence indicates that these symbionts are biologically diverse and exhibit discrete patterns of environmental and host distribution. This makes the assessment of Symbiodinium diversity critical to understanding the symbiosis ecology of corals. Here, we applied pyrosequencing to the elucidation of Symbiodinium diversity via analysis of the internal transcribed spacer 2 (ITS2) region, a multicopy genetic marker commonly used to analyse Symbiodinium diversity. Replicated data generated from isoclonal Symbiodinium cultures showed that all genomes contained numerous, yet mostly rare, ITS2 sequence variants. Pyrosequencing data were consistent with more traditional denaturing gradient gel electrophoresis (DGGE) approaches to the screening of ITS2 PCR amplifications, where the most common sequences appeared as the most intense bands. Further, we developed an operational taxonomic unit (OTU)-based pipeline for Symbiodinium ITS2 diversity typing to provisionally resolve ecologically discrete entities from intragenomic variation. A genetic distance cut-off of 0.03 collapsed intragenomic ITS2 variants of isoclonal cultures into single OTUs. When applied to the analysis of field-collected coral samples, our analyses confirm that much of the commonly observed Symbiodinium ITS2 diversity can be attributed to intragenomic variation. We conclude that by analysing Symbiodinium populations in an OTU-based framework, we can improve objectivity, comparability and simplicity when assessing ITS2 diversity in field-based studies. © 2014 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

  10. Generalized Levy-walk model for DNA nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Simons, M.; Stanley, H. E.


    We propose a generalized Levy walk to model fractal landscapes observed in noncoding DNA sequences. We find that this model provides a very close approximation to the empirical data and explains a number of statistical properties of genomic DNA sequences such as the distribution of strand-biased regions (those with an excess of one type of nucleotide) as well as local changes in the slope of the correlation exponent alpha. The generalized Levy-walk model simultaneously accounts for the long-range correlations in noncoding DNA sequences and for the apparently paradoxical finding of long subregions of biased random walks (length lj) within these correlated sequences. In the generalized Levy-walk model, the lj are chosen from a power-law distribution P(lj) varies as lj(-mu). The correlation exponent alpha is related to mu through alpha = 2-mu/2 if 2 < mu < 3. The model is consistent with the finding of "repetitive elements" of variable length interspersed within noncoding DNA.

  11. DNA methylation mapping by tag-modified bisulfite genomic sequencing.


    Han, Weiguo; Cauchi, Stephane; Herman, James G; Spivack, Simon D


    A tag-modified bisulfite genomic sequencing (tBGS) method employing direct cycle sequencing of polymerase chain reaction (PCR) products at kilobase scale, without conventional DNA fragment cloning, was developed for simplified evaluation of DNA methylation sites. The method entails subjecting bisulfite-modified genomic DNA to a second-round PCR amplification employing GC-tagged primers. Qualitative results from tBGS closely correlated with those from conventional BGS (R=0.935, p=0.002). In application, the intertissue and interindividual CpG methylation differences in promoter sequence for two genes, CYP1B1 and GSTP1, were then explored across four human tissue types (peripheral blood cells, exfoliated buccal cells, paired nontumor-tumor lung tissues), and two lung cell types in culture (normal NHBE and malignant A549). Predominantly conserved methylation maps for the two gene promoters were apparent across donors and tissues. At any given CpG site, variation in the degree of methylation could be determined by the relative height of C and T peaks in the sequencing trace. Methylation maps for the GSTP1 promoter diverged between NHBE (unmethylated) and A549 (completely methylated) cells in a previously unexplored upstream region, correlating with a 2.7-fold difference in GSTP1 mRNA expression (p<0.01). The tBGS method simplifies detailed methylation scanning of kilobase-scale genomic DNA, facilitating more ambitious genomic methylation mapping studies.

  12. Analysis of DNA Sequence Variants Detected by High Throughput Sequencing

    PubMed Central

    Adams, David R; Sincan, Murat; Fajardo, Karin Fuentes; Mullikin, James C; Pierson, Tyler M; Toro, Camilo; Boerkoel, Cornelius F; Tifft, Cynthia J; Gahl, William A; Markello, Tom C


    The Undiagnosed Diseases Program at the National Institutes of Health uses High Throughput Sequencing (HTS) to diagnose rare and novel diseases. HTS techniques generate large numbers of DNA sequence variants, which must be analyzed and filtered to find candidates for disease causation. Despite the publication of an increasing number of successful exome-based projects, there has been little formal discussion of the analytic steps applied to HTS variant lists. We present the results of our experience with over 30 families for whom HTS sequencing was used in an attempt to find clinical diagnoses. For each family, exome sequence was augmented with high-density SNP-array data. We present a discussion of the theory and practical application of each analytic step and provide example data to illustrate our approach. The paper is designed to provide an analytic roadmap for variant analysis, thereby enabling a wide range of researchers and clinical genetics practitioners to perform direct analysis of HTS data for their patients and projects. PMID:22290882

  13. cDNA encoding a polypeptide including a hevein sequence


    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  14. Aspects of coverage in medical DNA sequencing

    PubMed Central

    Wendl, Michael C; Wilson, Richard K


    Background DNA sequencing is now emerging as an important component in biomedical studies of diseases like cancer. Short-read, highly parallel sequencing instruments are expected to be used heavily for such projects, but many design specifications have yet to be conclusively established. Perhaps the most fundamental of these is the redundancy required to detect sequence variations, which bears directly upon genomic coverage and the consequent resolving power for discerning somatic mutations. Results We address the medical sequencing coverage problem via an extension of the standard mathematical theory of haploid coverage. The expected diploid multi-fold coverage, as well as its generalization for aneuploidy are derived and these expressions can be readily evaluated for any project. The resulting theory is used as a scaling law to calibrate performance to that of standard BAC sequencing at 8× to 10× redundancy, i.e. for expected coverages that exceed 99% of the unique sequence. A differential strategy is formalized for tumor/normal studies wherein tumor samples are sequenced more deeply than normal ones. In particular, both tumor alleles should be detected at least twice, while both normal alleles are detected at least once. Our theory predicts these requirements can be met for tumor and normal redundancies of approximately 26× and 21×, respectively. We explain why these values do not differ by a factor of 2, as might intuitively be expected. Future technology developments should prompt even deeper sequencing of tumors, but the 21× value for normal samples is essentially a constant. Conclusion Given the assumptions of standard coverage theory, our model gives pragmatic estimates for required redundancy. The differential strategy should be an efficient means of identifying potential somatic mutations for further study. PMID:18485222

  15. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.


    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

  16. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.


    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

  17. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.


    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

  18. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.


    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

  19. CGGBP1 mitigates cytosine methylation at repetitive DNA sequences.


    Agarwal, Prasoon; Collier, Paul; Fritz, Markus Hsi-Yang; Benes, Vladimir; Wiklund, Helena Jernberg; Westermark, Bengt; Singh, Umashankar


    CGGBP1 is a repetitive DNA-binding transcription regulator with target sites at CpG-rich sequences such as CGG repeats and Alu-SINEs and L1-LINEs. The role of CGGBP1 as a possible mediator of CpG methylation however remains unknown. At CpG-rich sequences cytosine methylation is a major mechanism of transcriptional repression. Concordantly, gene-rich regions typically carry lower levels of CpG methylation than the repetitive elements. It is well known that at interspersed repeats Alu-SINEs and L1-LINEs high levels of CpG methylation constitute a transcriptional silencing and retrotransposon inactivating mechanism. Here, we have studied genome-wide CpG methylation with or without CGGBP1-depletion. By high throughput sequencing of bisulfite-treated genomic DNA we have identified CGGBP1 to be a negative regulator of CpG methylation at repetitive DNA sequences. In addition, we have studied CpG methylation alterations on Alu and L1 retrotransposons in CGGBP1-depleted cells using a novel bisulfite-treatment and high throughput sequencing approach. The results clearly show that CGGBP1 is a possible bidirectional regulator of CpG methylation at Alus, and acts as a repressor of methylation at L1 retrotransposons.

  20. DNA Methylation within Transcribed Regions

    PubMed Central

    To, Taiko K.; Saze, Hidetoshi; Kakutani, Tetsuji


    DNA methylation within transcribed genes is commonly found in diverse animals and plants. Here, we provide an overview of recent advances and the remaining mystery regarding intragenic DNA methylation. PMID:26143255

  1. Porcine parvovirus: DNA sequence and genome organization.


    Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I


    We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

  2. Method for priming and DNA sequencing

    SciTech Connect

    Mugasimangalam, R.C.; Ulanovsky, L.E.


    A method is presented for improving the priming specificity of an oligonucleotide primer that is non-unique in a nucleic acid template which includes selecting a continuous stretch of several nucleotides in the template DNA where one of the four bases does not occur in the stretch. This also includes bringing the template DNA in contract with a non-unique primer partially or fully complimentary to the sequence immediately upstream of the selected sequence stretch. This results in polymerase-mediated differential extension of the primer in the presence of a subset of deoxyribonucleotide triphosphates that does not contain the base complementary to the base absent in the selected sequence stretch. These reactions occur at a temperature sufficiently low for allowing the extension of the non-unique primer. The method causes polymerase-mediated extension reactions in the presence of all four natural deoxyribonucleotide triphosphates or modifications. At this high temperature discrimination occurs against priming sites of the non-unique primer where the differential extension has not made the primer sufficiently stable to prime. However, the primer extended at the selected stretch is sufficiently stable to prime.

  3. Detection of regional DNA methylation using DNA-graphene affinity interactions.


    Haque, Md Hakimul; Gopalan, Vinod; Yadav, Sharda; Islam, Md Nazmul; Eftekhari, Ehsan; Li, Qin; Carrascosa, Laura G; Nguyen, Nam-Trung; Lam, Alfred K; Shiddiky, Muhammad J A


    We report a new method for the detection of regional DNA methylation using base-dependent affinity interaction (i.e., adsorption) of DNA with graphene. Due to the strongest adsorption affinity of guanine bases towards graphene, bisulfite-treated guanine-enriched methylated DNA leads to a larger amount of the adsorbed DNA on the graphene-modified electrodes in comparison to the adenine-enriched unmethylated DNA. The level of the methylation is quantified by monitoring the differential pulse voltammetric current as a function of the adsorbed DNA. The assay is sensitive to distinguish methylated and unmethylated DNA sequences at single CpG resolution by differentiating changes in DNA methylation as low as 5%. Furthermore, this method has been used to detect methylation levels in a collection of DNA samples taken from oesophageal cancer tissues. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

    NASA Astrophysics Data System (ADS)

    Chen, C. H. Winston; Taranenko, N. I.; Zhu, Y. F.; Chung, C. N.; Allman, S. L.


    Since laser mass spectrometry has the potential for achieving very fast DNA analysis, we recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Sanger's enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. Our preliminary results indicate laser mass spectrometry can possible be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, we applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

  5. Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

    SciTech Connect

    Winston Chen, C.H.; Taranenko, N.I.; Zhu, Y.F.; Chung, C.N.; Allman, S.L.


    Since laser mass spectrometry has the potential for achieving very fast DNA analysis, the authors recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Snager`s enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. The preliminary results indicate laser mass spectrometry can possibly be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, the authors applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

  6. Characterization of DNA sequences that mediate nuclear protein binding to the regulatory region of the Pisum sativum (pea) chlorophyl a/b binding protein gene AB80: identification of a repeated heptamer motif.


    Argüello, G; García-Hernández, E; Sánchez, M; Gariglio, P; Herrera-Estrella, L; Simpson, J


    Two protein factors binding to the regulatory region of the pea chlorophyl a/b binding protein gene AB80 have been identified. One of these factors is found only in green tissue but not in etiolated or root tissue. The second factor (denominated ABF-2) binds to a DNA sequence element that contains a direct heptamer repeat TCTCAAA. It was found that presence of both of the repeats is essential for binding. ABF-2 is present in both green and etiolated tissue and in roots and factors analogous to ABF-2 are present in several plant species. Computer analysis showed that the TCTCAAA motif is present in the regulatory region of several plant genes.

  7. Mitochondrial DNA Sequencing of Cat Hair: An Informative Forensic Tool*

    PubMed Central

    Tarditi, Christy R.; Grahn, Robert A.; Evans, Jeffrey J.; Kurushima, Jennifer D.; Lyons, Leslie A.


    Approximately 81.7 million cats are in 37.5 million USA households. Shed fur can be criminal evidence due to transfer to victims, suspects, and / or their belongings. To improve cat hairs as forensic evidence, the mtDNA control region from single hairs, with and without root tags, was sequenced. A dataset of a 402 bp CR segment from 174 random-bred cats representing four USA geographic areas was generated to determine the informativeness of the mtDNA region. Thirty-two mtDNA mitotypes were observed ranging in frequencies from 0.6-27%. Four common types occurred in all populations. Low heteroplasmy, 1.7%, was determined. Unique mitotypes were found in 18 individuals, 10.3% of the population studied. The calculated discrimination power implied that 8.3 of 10 randomly selected individuals can be excluded by this region. The genetic characteristics of the region and the generated dataset support the use of this cat mtDNA region in forensic applications. PMID:21077873

  8. Preparation of yeast mitochondrial DNA for direct sequence analysis.


    Valach, Matus; Tomaska, Lubomir; Nosek, Jozef


    We describe two simple protocols for preparation of templates for direct sequencing of yeast mitochondrial DNA (mtDNA) by automatic DNA analyzers. The protocols work with a range of yeast species and yield a sufficient quantity and quality of the template DNA. In combination with primer-walking strategy, they can be used either as an alternative or a complementary approach to shot-gun sequencing of random fragment DNA libraries. We demonstrate that the templates are suitable for re-sequencing of the mtDNA for comparative analyses of intraspecific variability of yeast strains as well as for primary determination of the complete mitochondrial genome sequence.

  9. Prediction of fine-tuned promoter activity from DNA sequence

    PubMed Central

    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael


    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  10. Prediction of fine-tuned promoter activity from DNA sequence.


    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael


    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  11. Methods for sequencing GC-rich and CCT repeat DNA templates


    Robinson, Donna L.


    The present invention is directed to a PCR-based method of cycle sequencing DNA and other polynucleotide sequences having high CG content and regions of high GC content, and includes for example DNA strands with a high Cytosine and/or Guanosine content and repeated motifs such as CCT repeats.

  12. Sequence dependent hole evolution in DNA.


    Lakhno, V D


    The paper examines thedynamical behavior of a radical cation(G(+*)) generated in adouble stranded DNA for differentoligonucleotide sequences. The resonancehole tunneling through an oligonucleotidesequence is studied by the method ofnumerical integration of self-consistentquantum-mechanical equations. The holemotion is considered quantum mechanicallyand nucleotide base oscillations aretreated classically. The results obtaineddemonstrate a strong dependence of chargetransfer on the type of nucleotidesequence. The rates of the hole transferare calculated for different nucleotidesequences and compared with experimentaldata on the transfer from (G(+*))to a GGG unit.

  13. Sequence-specific binding of simian virus 40 A protein to nonorigin and cellular DNA.

    PubMed Central

    Wright, P J; DeLucia, A L; Tegtmeyer, P


    The simian virus 40 A protein (T antigen) recognized and bound to the consensus sequence 5'-GAGGC-3' in DNA from many sources. Sequence-specific binding to single pentanucleotides in randomly chosen DNA predominated over binding to nonspecific sequences. The asymmetric orientation of protein bound to nonorigin recognition sequences also resembled that of protein bound to the origin region of simian virus 40 DNA. Sequence variations in the DNA adjacent to single pentanucleotides influenced binding affinities even though methylation interference and protection studies did not reveal specific interactions outside of pentanucleotides. Thus, potential locations of A protein bound to any DNA can be predicted although the determinants of binding affinity are not yet understood. Sequence-specific binding of A protein to cellular DNA would provide a mechanism for specific alterations of host gene expression that facilitate viral function. Images PMID:6570189

  14. Recent advances in DNA sequencing techniques

    NASA Astrophysics Data System (ADS)

    Singh, Rama Shankar


    Successful mapping of the draft human genome in 2001 and more recent mapping of the human microbiome genome in 2012 have relied heavily on the parallel processing of the second generation/Next Generation Sequencing (NGS) DNA machines at a cost of several millions dollars and long computer processing times. These have been mainly biochemical approaches. Here a system analysis approach is used to review these techniques by identifying the requirements, specifications, test methods, error estimates, repeatability, reliability and trends in the cost reduction. The first generation, NGS and the Third Generation Single Molecule Real Time (SMART) detection sequencing methods are reviewed. Based on the National Human Genome Research Institute (NHGRI) data, the achieved cost reduction of 1.5 times per yr. from Sep. 2001 to July 2007; 7 times per yr., from Oct. 2007 to Apr. 2010; and 2.5 times per yr. from July 2010 to Jan 2012 are discussed.

  15. Redundancy modulation of nuclear DNA sequences in Dasypyrum villosum.


    Frediani, M; Colonna, N; Cremonini, R; De Pace, C; Delre, V; Caccia, R; Cionini, P G


    In order to assess fluid domains in the genome of Dasypyrum villosum, Feulgen/DNA cytophotometric determinations and molecular and cytological DNA-DNA hybridization experiments were carried out in resting embryos and developing seedlings from yellow and brown caryopses belonging to different populations. The cytophotometric data showed that the basic amount of nuclear DNA is, on average, 12% higher in 2-day-old seedlings from yellow caryopses as compared to those from brown caryopses. It increases in each individual during seed germination, to a higher extent in seedlings from yellow caryopses than in those from brown caryopses. DNA content also differs up to 13% between plants within a caryopsis-colour group and up to 40% between populations. Dot-blot hybridization of a 396-bp D. villosum-specific DNA repeat to genomic DNA extracted from embryos in dry seeds, or from seedlings belonging to single progenies of plants from different populations, confirmed the cytophotometric results. The redundancy in the genome of sequences hybridizing to the 396-bp element differs significantly both between populations and between plant progenies within a population. During seed germination these sequences are the more amplified the less they are redundant in the genome of resting embryos, and amplification occurs to a significantly-greater extent in seedlings from yellow caryopses than in those from brown caryopses. (3)H-labelled 396-bp sequences hybridize at or near the telomeres of most chromsome pairs though only to the shorter of the two subtelocentric pairs. The hybridization level is higher in seedlings from yellow caryopses that in those from brown caryopses, and a linear correlation exists between the number of silver grains counted over the labelled regions of each chromosome pair in the two groups of seedlings. Possible control mechanisms of the observed changes in the nuclear genome, and the role of these changes in developmental pregulation and environmental

  16. DNA sequence of the Escherichia coli tonB gene.

    PubMed Central

    Postle, K; Good, R F


    The nucleotide sequence of a cloned section of the Escherichia coli chromosome containing the tonB gene has been determined. Transcription initiation and termination sites for tonB RNA have been determined by S1 nuclease mapping. The tonB promoter and terminator resemble other E. coli promoters and terminators; the sequence of the tonB terminator region suggests that it may function bidirectionally. The DNA sequence specifies an open translation reading frame between the 5' and 3' RNA termini whose location is consistent with the position of previously isolated tonB::IS1 mutations. The DNA sequence predicts a proline-rich protein with a calculated size of 26.1-26.6 kilodaltons (239-244 amino acids), depending on which of three potential initiation codons is utilized. The predicted NH2 terminus of tonB protein resembles the proteolytically cleaved signal sequences of E. coli periplasmic and outer membrane proteins; the overall hydrophilic character of the protein sequence suggests that the bulk of the tonB protein is not embedded within the inner or outer membrane. A significant discrepancy exists between the calculated size of tonB protein and the apparent size of 36 kilodaltons determined by sodium dodecyl sulfate/polyacrylamide gel electrophoresis. Images PMID:6310567

  17. Transverse Electronic Signature of DNA for Electronic Sequencing

    NASA Astrophysics Data System (ADS)

    Xu, Mingsheng; Endres, Robert G.; Arakawa, Yasuhiko

    In recent years, the proliferation of large-scale DNA sequencing projects for applications in clinical medicine and health care has driven the search for new methods that could reduce the time and cost. The commonly used Sanger sequencing method relies on the chemistry to read the bases in DNA and is far too slow and expensive for reading personal genetic codes. There were earlier attempts to sequence DNA by directly visualizing the nucleotide composition of the DNA molecules by scanning tunneling microscopy (STM). However, sequencing DNA based on directly imaging DNA's atomic structure has not yet been successful. In Chap. 9, Xu, Endres, and Arakawa report a potential physical alternative by detecting unique transverse electronic signatures of DNA bases using ultrahigh vacuum STM. Supported by the principles, calculations and statistical analyses, these authors argue that it would be possible to directly sequence DNA by the STM-based technology without any modification of the DNA.

  18. Improving DNA sequencing accuracy and throughput

    SciTech Connect

    Nelson, D.O. |


    LLNL is beginning to explore statistical approaches to the problem of determining the DNA sequence underlying data obtained from fluorescence-based gel electrophoresis. Among the features of this problem that make it interesting to statisticians include: (1) the underlying mechanics of electrophoresis is quite complex and still not completely understood; (2) the yield of fragments of any given size can be quite small and variable; (3) the mobility of fragments of a given size can depend on the terminating base; (4) the data consists of samples from one or more continuous, non-stationary signals; (5) boundaries between segments generated by distinct elements of the underlying sequence are ill-defined or nonexistent in the signal; and (6) the sampling rate of the signal greatly exceeds the rate of evolution of the underlying discrete sequence. Current approaches to base calling address only some of these issues, and usually in a heuristic, ad hoc way. In this article we describe some of our initial efforts towards increasing base calling accuracy and throughput by providing a rational, statistical foundation to the process of deducing sequence from signal. 31 refs., 12 figs.

  19. Image correlation method for DNA sequence alignment.


    Curilem Saldías, Millaray; Villarroel Sassarini, Felipe; Muñoz Poblete, Carlos; Vargas Vásquez, Asticio; Maureira Butler, Iván


    The complexity of searches and the volume of genomic data make sequence alignment one of bioinformatics most active research areas. New alignment approaches have incorporated digital signal processing techniques. Among these, correlation methods are highly sensitive. This paper proposes a novel sequence alignment method based on 2-dimensional images, where each nucleic acid base is represented as a fixed gray intensity pixel. Query and known database sequences are coded to their pixel representation and sequence alignment is handled as object recognition in a scene problem. Query and database become object and scene, respectively. An image correlation process is carried out in order to search for the best match between them. Given that this procedure can be implemented in an optical correlator, the correlation could eventually be accomplished at light speed. This paper shows an initial research stage where results were "digitally" obtained by simulating an optical correlation of DNA sequences represented as images. A total of 303 queries (variable lengths from 50 to 4500 base pairs) and 100 scenes represented by 100 x 100 images each (in total, one million base pair database) were considered for the image correlation analysis. The results showed that correlations reached very high sensitivity (99.01%), specificity (98.99%) and outperformed BLAST when mutation numbers increased. However, digital correlation processes were hundred times slower than BLAST. We are currently starting an initiative to evaluate the correlation speed process of a real experimental optical correlator. By doing this, we expect to fully exploit optical correlation light properties. As the optical correlator works jointly with the computer, digital algorithms should also be optimized. The results presented in this paper are encouraging and support the study of image correlation methods on sequence alignment.

  20. Image Correlation Method for DNA Sequence Alignment

    PubMed Central

    Curilem Saldías, Millaray; Villarroel Sassarini, Felipe; Muñoz Poblete, Carlos; Vargas Vásquez, Asticio; Maureira Butler, Iván


    The complexity of searches and the volume of genomic data make sequence alignment one of bioinformatics most active research areas. New alignment approaches have incorporated digital signal processing techniques. Among these, correlation methods are highly sensitive. This paper proposes a novel sequence alignment method based on 2-dimensional images, where each nucleic acid base is represented as a fixed gray intensity pixel. Query and known database sequences are coded to their pixel representation and sequence alignment is handled as object recognition in a scene problem. Query and database become object and scene, respectively. An image correlation process is carried out in order to search for the best match between them. Given that this procedure can be implemented in an optical correlator, the correlation could eventually be accomplished at light speed. This paper shows an initial research stage where results were “digitally” obtained by simulating an optical correlation of DNA sequences represented as images. A total of 303 queries (variable lengths from 50 to 4500 base pairs) and 100 scenes represented by 100 x 100 images each (in total, one million base pair database) were considered for the image correlation analysis. The results showed that correlations reached very high sensitivity (99.01%), specificity (98.99%) and outperformed BLAST when mutation numbers increased. However, digital correlation processes were hundred times slower than BLAST. We are currently starting an initiative to evaluate the correlation speed process of a real experimental optical correlator. By doing this, we expect to fully exploit optical correlation light properties. As the optical correlator works jointly with the computer, digital algorithms should also be optimized. The results presented in this paper are encouraging and support the study of image correlation methods on sequence alignment. PMID:22761742

  1. Degradation in forensic trace DNA samples explored by massively parallel sequencing.


    Hanssen, Eirik Nataas; Lyle, Robert; Egeland, Thore; Gill, Peter


    Routine forensic analysis using STRs will fail if the DNA is too degraded. The DNA degradation process in biological stain material is not well understood. In this study we sequenced old semen and blood stains by massively parallel sequencing. The sequence data coverage was used to measure degradation across the genome. The results supported the contention that degradation is uniform across the genome, showing no evidence of regions with increased or decreased resistance towards degradation. Thus the lack of genetic regions robust to degradation removes the possibility of using such regions to further optimize analysis performance for degraded DNA.

  2. Structural Analysis of HMGD-DNA Complexes Reveal Influence of Intercalation on Sequence Selectivity and DNA Bending

    PubMed Central

    Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.


    The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069

  3. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches


    McCutchen-Maloney, Sandra L.


    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  4. Next generation sequencing of DNA-launched Chikungunya vaccine virus

    SciTech Connect

    Hidajat, Rachmat; Nickols, Brian; Forrester, Naomi; Tretyakova, Irina; Weaver, Scott; Pushko, Peter


    Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.

  5. Molecular cloning of cDNA for the zeta isoform of the 14-3-3 protein: homologous sequences in the 3'-untranslated region of frog and human zeta isoforms.


    Miura, I; Nakajima, T; Ohtani, H; Kashiwagi, A; Nakamura, M


    14-3-3 proteins constitute a family of well-conserved eukaryotic proteins that possess diverse biochemical activities such as regulation of gene transcription, cell proliferation and activation of protein kinase C. At least 7 subtypes (alpha to theta) of 14-3-3 protein are known, but the zeta subtype of this protein has been cloned only in mammals. We cloned the zeta subtype of 14-3-3 protein (14-3-3 zeta) from the frog, Rana rugosa. The sequence encoded 245 amino acids that share 92% identity with rat and bovine 14-3-3 zeta s, and 92% with human phospholipase A2 (PLA2; 14-3-3 zeta). Northern blot analysis revealed a single band of about 1.8 kb in tadpoles at stage 25. The 14-3-3 zeta mRNA level was high in the brain, lung, spleen and kidney, and low in the heart and testis, as opposed to the mRNA level, which was only faintly detected in the liver, pancreas, ovary and muscle. Furthermore, high similarity in the 3'-untranslated region (3'-UTR) was observed between frog and human 14-3-3 zeta cDNA. The results suggest that 14-3-3 zeta is highly conserved throughout eukaryotic evolution, and that the homologous sequence in the 3'-UTR of 14-3-3 zeta cDNA may be conserved in frogs and humans.

  6. Identification and functional modelling of DNA sequence elements of transcription.


    Werner, T


    Identification of transcriptional elements in large sequences is a very difficult task, as individual transcription elements (eg transcription factor binding sites,TF-sites) are not clearly correlated with regions exerting transcription control. However, elucidation of the molecular organisation of genomic regions responsible for the control of gene expression is an essential part of the efforts to annotate the genomic sequences, especially within the Human Genome Project. The task for bioinformatics in this context is twofold. The first step required is the approximate localisation of regulatory sequences in large anonymous DNA sequences. Once those regions are located, the second task is the identification of individual transcriptional control elements and correlation of a subset of such elements with transcriptional functions. Part of this second task can be achieved by constructing organisational models of regulatory regions like promoters which can reveal elements important for a gene class or the coexpression of a set of genes. Comparative genomics in non-coding regions (eg phylogenetic footprinting) is a very promising approach that allows identification of potential new regulatory elements which may be used in modelling approaches.

  7. Pericentric satellite DNA sequences in Pipistrellus pipistrellus (Vespertilionidae; Chiroptera).


    Barragán, M J L; Martínez, S; Marchal, J A; Fernández, R; Bullejos, M; Díaz de la Guardia, R; Sánchez, A


    This paper reports the molecular and cytogenetic characterization of a HindIII family of satellite DNA in the bat species Pipistrellus pipistrellus. This satellite is organized in tandem repeats of 418 bp monomer units, and represents approximately 3% of the whole genome. The consensus sequence from five cloned monomer units has an A-T content of 62.20%. We have found differences in the ladder pattern of bands between two populations of the same species. These differences are probably because of the absence of the target sites for the HindIII enzyme in most monomer units of one population, but not in the other. Fluorescent in situ hybridization (FISH) localized the satellite DNA in the pericentromeric regions of all autosomes and the X chromosome, but it was absent from the Y chromosome. Digestion of genomic DNAs with HpaII and its isoschizomer MspI demonstrated that these repetitive DNA sequences are not methylated. Other bat species were tested for the presence of this repetitive DNA. It was absent in five Vespertilionidae and one Rhinolophidae species, indicating that it could be a species/genus specific, repetitive DNA family.

  8. Fine mapping and DNA fiber FISH analysis locates the tobamovirus resistance gene L3 of Capsicum chinense in a 400-kb region of R-like genes cluster embedded in highly repetitive sequences.


    Tomita, R; Murai, J; Miura, Y; Ishihara, H; Liu, S; Kubotera, Y; Honda, A; Hatta, R; Kuroda, T; Hamada, H; Sakamoto, M; Munemura, I; Nunomura, O; Ishikawa, K; Genda, Y; Kawasaki, S; Suzuki, K; Meksem, K; Kobayashi, K


    The tobamovirus resistance gene L(3) of Capsicum chinense was mapped using an intra-specific F2 population (2,016 individuals) of Capsicum annuum cultivars, into one of which had been introduced the C. chinense L(3) gene, and an inter-specific F2 population (3,391 individuals) between C. chinense and Capsicum frutescence. Analysis of a BAC library with an AFLP marker closely linked to L(3)-resistance revealed the presence of homologs of the tomato disease resistance gene I2. Partial or full-length coding sequences were cloned by degenerate PCR from 35 different pepper I2 homologs and 17 genetic markers were generated in the inter-specific combination. The L(3) gene was mapped between I2 homolog marker IH1-04 and BAC-end marker 189D23M, and located within a region encompassing two different BAC contigs consisting of four and one clones, respectively. DNA fiber FISH analysis revealed that these two contigs are separated from each other by about 30 kb. DNA fiber FISH results and Southern blotting of the BAC clones suggested that the L(3) locus-containing region is rich in highly repetitive sequences. Southern blot analysis indicated that the two BAC contigs contain more than ten copies of the I2 homologs. In contrast to the inter-specific F2 population, no recombinant progeny were identified to have a crossover point within two BAC contigs consisting of seven and two clones in the intra-specific F2 population. Moreover, distribution of the crossover points differed between the two populations, suggesting linkage disequilibrium in the region containing the L locus.

  9. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.


    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter


    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow.

  10. Determining orientation and direction of DNA sequences


    Goodwin, Edwin H.; Meyne, Julianne


    Determining orientation and direction of DNA sequences. A method by which fluorescence in situ hybridization can be made strand specific is described. Cell cultures are grown in a medium containing a halogenated nucleotide. The analog is partially incorporated in one DNA strand of each chromatid. This substitution takes place in opposite strands of the two sister chromatids. After staining with the fluorescent DNA-binding dye Hoechst 33258, cells are exposed to long-wavelength ultraviolet light which results in numerous strand nicks. These nicks enable the substituted strand to be denatured and solubilized by heat, treatment with high or low pH aqueous solutions, or by immersing the strands in 2.times.SSC (0.3M NaCl+0.03M sodium citrate), to name three procedures. It is unnecessary to enzymatically digest the strands using Exo III or another exonuclease in order to excise and solubilize nucleotides starting at the sites of the nicks. The denaturing/solubilizing process removes most of the substituted strand while leaving the prereplication strand largely intact. Hybridization of a single-stranded probe of a tandem repeat arranged in a head-to-tail orientation will result in hybridization only to the chromatid with the complementary strand present.

  11. cDNA encoding a polypeptide including a hevein sequence


    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  12. cDNA encoding a polypeptide including a hevein sequence


    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  13. cDNA encoding a polypeptide including a hevein sequence


    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  14. cDNA encoding a polypeptide including a hevein sequence

    SciTech Connect

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.


    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  15. Partition enrichment of nucleotide sequences (PINS)--a generally applicable, sequence based method for enrichment of complex DNA samples.


    Kvist, Thomas; Sondt-Marcussen, Line; Mikkelsen, Marie Just


    The dwindling cost of DNA sequencing is driving transformative changes in various biological disciplines including medicine, thus resulting in an increased need for routine sequencing. Preparation of samples suitable for sequencing is the starting point of any practical application, but enrichment of the target sequence over background DNA is often laborious and of limited sensitivity thereby limiting the usefulness of sequencing. The present paper describes a new method, Probability directed Isolation of Nucleic acid Sequences (PINS), for enrichment of DNA, enabling the sequencing of a large DNA region surrounding a small known sequence. A 275,000 fold enrichment of a target DNA sample containing integrated human papilloma virus is demonstrated. Specifically, a sample containing 0.0028 copies of target sequence per ng of total DNA was enriched to 786 copies per ng. The starting concentration of 0.0028 target copies per ng corresponds to one copy of target in a background of 100,000 complete human genomes. The enriched sample was subsequently amplified using rapid genome walking and the resulting DNA sequence revealed not only the sequence of a the truncated virus, but also 1026 base pairs 5' and 50 base pairs 3' to the integration site in chromosome 8. The demonstrated enrichment method is extremely sensitive and selective and requires only minimal knowledge of the sequence to be enriched and will therefore enable sequencing where the target concentration relative to background is too low to allow the use of other sample preparation methods or where significant parts of the target sequence is unknown.

  16. The glucocorticoid receptor dimer interface allosterically transmits sequence-specific DNA signals.


    Watson, Lisa C; Kuchenbecker, Kristopher M; Schiller, Benjamin J; Gross, John D; Pufall, Miles A; Yamamoto, Keith R


    Glucocorticoid receptor (GR) binds to genomic response elements and regulates gene transcription with cell and gene specificity. Within a response element, the precise sequence to which the receptor binds has been implicated in directing its structure and activity. Here, we use NMR chemical-shift difference mapping to show that nonspecific interactions with bases at particular positions in the binding sequence, such as those of the 'spacer', affect the conformation of distinct regions of the rat GR DNA-binding domain. These regions include the DNA-binding surface, the 'lever arm' and the dimerization interface, suggesting an allosteric pathway that signals between the DNA-binding sequence and the associated dimer partner. Disrupting this pathway by mutating the dimer interface alters sequence-specific conformations, DNA-binding kinetics and transcriptional activity. Our study demonstrates that GR dimer partners collaborate to read DNA shape and to direct sequence-specific gene activity.

  17. Phylogenetic inference of Indian malaria vectors from multilocus DNA sequences.


    Dixit, Jyotsana; Srivastava, Hemlata; Sharma, Meenu; Das, Manoj K; Singh, O P; Raghavendra, K; Nanda, Nutan; Dash, Aditya P; Saksena, D N; Das, Aparup


    Inferences on the taxonomic positions, phylogenetic interrelationships and divergence time among closely related species of medical importance is essential to understand evolutionary patterns among species, and based on which, disease control measures could be devised. To this respect, malaria is one of the important mosquito borne diseases of tropical and sub-tropical parts of the globe. Taxonomic status of malaria vectors has been so far documented based on morphological, cytological and few molecular genetic features. However, utilization of multilocus DNA sequences in phylogenetic inferences are still in dearth. India contains one of the richest resources of mosquito species diversity but little molecular taxonomic information is available in Indian malaria vectors. We herewith utilized the whole genome sequence information of An. gambiae to amplify and sequence three orthologous nuclear genetic regions in six Indian malaria vector species (An. culicifacies, An. minimus, An. sundaicus, An. fluviatilis, An. annularis and An. stephensi). Further, we utilized the previously published DNA sequence information on the COII and ITS2 genes in all the six species, making the total number of loci to five. Multilocus molecular phylogenetic study of Indian anophelines and An. gambiae was conducted at each individual genetic region using Neighbour Joining (NJ), Maximum Likelihood (ML), Maximum Parsimony (MP) and Bayesian approaches. Although tree topologies with COII, and ITS2 genes were similar, for no other three genetic regions similar tree topologies were observed. In general, the reconstructed phylogenetic status of Indian malaria vectors follows the pattern based on morphological and cytological classifications that was reconfirmed with COII and ITS2 genetic regions. Further, divergence times based on COII gene sequences were estimated among the seven Anopheles species which corroborate the earlier hypothesis on the radiation of different species of the Anopheles


    EPA Science Inventory

    Using a bead-based method for multiplexed analysis of community DNA, the dynamics of aquatic microbial communities can be assessed. Capture probes, specific for a genus or species of bacteria, are attached to the surface of uniquely labeled, microscopic polystyrene beads. Primers...


    EPA Science Inventory

    Using a bead-based method for multiplexed analysis of community DNA, the dynamics of aquatic microbial communities can be assessed. Capture probes, specific for a genus or species of bacteria, are attached to the surface of uniquely labeled, microscopic polystyrene beads. Primers...

  20. cDNA sequences of two apolipoproteins from lamprey

    SciTech Connect

    Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.


    The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point.

  1. Nucleotide sequence of a preferred maize chloroplast genome template for in vitro DNA synthesis.

    PubMed Central

    Gold, B; Carrillo, N; Tewari, K K; Bogorad, L


    Maize chloroplast DNA sequences representing 94% of the chromosome have been surveyed for their activity as autonomously replicating sequences in yeast and as templates for DNA synthesis in vitro by a partially purified chloroplast DNA polymerase. A maize chloroplast DNA region extending over about 9 kilobase pairs is especially active as a template for the DNA synthesis reaction. Fragments from within this region are much more active than DNA from elsewhere in the chromosome and 50- to 100-fold more active than DNA of the cloning vector pBR322. The smallest of the strongly active subfragments that we have studied, the 1368-base-pair EcoRI fragment x, has been sequenced and found to contain the coding region of chloroplast ribosomal protein L16. EcoRI fragment x shows sequence homology with a portion of the Chlamydomonas reinhardtii chloroplast chromosome that forms a displacement loop [Wang, X.-M., Chang, C.H., Waddell, J. & Wu, M. (1984) Nucleic Acids Res. 12, 3857-3872]. Maize chloroplast DNA fragments that permit autonomous replication of DNA in yeast are not active as templates for DNA synthesis in the in vitro assay. The template active region we have identified may represent one of the origins of replication of maize chloroplast DNA. Images PMID:3025853

  2. Sequencing mitochondrial DNA from a tooth and application to forensic odontology.


    Yamada, Y; Ohira, H; Iwase, H; Takatori, T; Nagao, M; Ohtani, S


    Genetic identification can be complicated by long intervals between the time of death and examination of tissues, and sometimes only bone and teeth may be available for analysis. Several investigators have described the isolation of nuclear DNA from these materials, but all have indicated that the DNA is significantly degraded. Recently, the polymerase chain reaction (PCR) and direct DNA sequencing have enabled rapid and reliable characterization of specific highly polymorphic DNA sequences from different individuals. Above all, mitochondrial DNA sequences offer several unique advantages for the identification of human remains. The isolation of mtDNA from a tooth and the symmetrical PCR amplification and direct DNA sequencing of its most polymorphic regions are reported.

  3. Model System for DNA Replication of a Plasmid DNA Containing the Autonomously Replicating Sequence from Saccharomyces cerevisiae

    NASA Astrophysics Data System (ADS)

    Ishimi, Yukio; Matsumoto, Ken


    A negatively supercoiled plasmid DNA containing autonomously replicating sequence (ARS) 1 from Saccharomyces cerevisiae was replicated with the proteins required for simian virus 40 DNA replication. The proteins included simian virus 40 large tumor antigen as a DNA helicase, DNA polymerase α^\\cdotprimase, and the multisubunit human single-stranded DNA-binding protein from HeLa cells; DNA gyrase from Escherichia coli, which relaxes positive but not negative supercoils, was included as a "swivelase." DNA replication started from the ARS region, proceeded bidirectionally with the synthesis of leading and lagging strands, and resulted in the synthesis of up to 10% of the input DNA in 1 h. The addition of HeLa DNA topoisomerase I, which relaxes both positive and negative supercoils, to this system inhibited DNA replication, suggesting that negative supercoiling of the template DNA is required for initiation. These results suggest that DNA replication starts from the ARS region where the DNA duplex is unwound by torsional stress; this unwound region can be recognized by a DNA helicase with the assistance of the multisubunit human single-stranded DNA-binding protein.

  4. The regions of sequence variation in caulimovirus gene VI.


    Sanger, M; Daubert, S; Goodman, R M


    The sequence of gene VI from figwort mosaic virus (FMV) clone x4 was determined and compared with that previously published for FMV clone DxS. Both clones originated from the same virus isolation, but the virus used to clone DxS was propagated extensively in a host of a different family prior to cloning whereas that used to clone x4 was not. Differences in the amino acid sequence inferred from the DNA sequences occurred in two clusters. An N-terminal conserved region preceded two regions of variation separated by a central conserved region. Variation in cauliflower mosaic virus (CaMV) gene VI sequences, all of which were derived from virus isolates from hosts from one host family, was similar to that seen in the FMV comparison, though the extent of variation was less. Alignment of gene VI domains from FMV and CaMV revealed regions of amino acid sequence identical in both viruses within the conserved regions. The similarity in the pattern of conserved and variable domains of these two viruses suggests common host-interactive functions in caulimovirus gene VI homologues, and possibly an analogy between caulimoviruses and certain animal viruses in the influence of the host on sequence variability of viral genes.

  5. Population structure and genetic diversity of Indian Major Carp, Labeo rohita (Hamilton, 1822) from three phylo-geographically isolated riverine ecosystems of India as revealed by mtDNA cytochrome b region sequences.


    Behera, Bijay Kumar; Baisvar, Vishwamitra Singh; Kunal, Swaraj Priyaranjan; Meena, Dharmendra Kumar; Panda, Debarata; Pakrashi, Sudip; Paria, Prasenjit; Das, Pronob; Bhakta, Dibakar; Debnath, Dipesh; Roy, Suvra; Suresh, V R; Jena, J K


    The population structure and genetic diversity of Rohu (Labeo rohita Hamilton, 1822) was studied by analysis of the partial sequences of mitochondrial DNA cytochrome b region. We examined 133 samples collected from six locations in three geographically isolated rivers of India. Analysis of 11 haplotypes showed low haplotype diversity (0.00150), nucleotide diversity (π) (0.02884) and low heterogeneity value (0.00374). Analysis of molecular variance (AMOVA) revealed the genetic diversity of L. rohita within population is very high than between the populations. The Fst scores (-0.07479 to 0.07022) were the indication of low genetic structure of L. rohita populations of three rivers of India. Conspicuously, Farakka-Bharuch population pair Fst score of 0.0000, although the sampling sites are from different rivers. The phylogenetic reconstruction of unique haplotypes revealed sharing of a single central haplotype (Hap_1) by all the six populations with a point mutations ranging from 1-25 nucleotides.

  6. Detecting selection in noncoding regions of nucleotide sequences.

    PubMed Central

    Wong, Wendy S W; Nielsen, Rasmus


    We present a maximum-likelihood method for examining the selection pressure and detecting positive selection in noncoding regions using multiple aligned DNA sequences. The rate of substitution in noncoding regions relative to the rate of synonymous substitution in coding regions is modeled by a parameter zeta. When a site in a noncoding region is evolving neutrally zeta = 1, while zeta > 1 indicates the action of positive selection, and zeta < 1 suggests negative selection. Using a combined model for the evolution of noncoding and coding regions, we develop two likelihood-ratio tests for the detection of selection in noncoding regions. Data analysis of both simulated and real viral data is presented. Using the new method we show that positive selection in viruses is acting primarily in protein-coding regions and is rare or absent in noncoding regions. PMID:15238543

  7. DNA extraction from vegetative tissue for next-generation sequencing.


    Furtado, Agnelo


    The quality of extracted DNA is crucial for several applications in molecular biology. If the DNA is to be used for next-generation sequencing (NGS), then microgram quantities of good-quality DNA is required. In addition, the DNA must substantially be of high molecular weight so that it can be used for library preparation and NGS sequencing. Contaminating phenol or starch in the isolated DNA can be easily removed by filtration through kit-based cartridges. In this chapter we describe a simple two-reagent DNA extraction protocol which yields a high quality and quantity of DNA which can be used for different applications including NGS.

  8. Considering DNA damage when interpreting mtDNA heteroplasmy in deep sequencing data.


    Rathbun, Molly M; McElhoe, Jennifer A; Parson, Walther; Holland, Mitchell M


    Resolution of mitochondrial (mt) DNA heteroplasmy is now possible when applying a massively parallel sequencing (MPS) approach, including minor components down to 1%. However, reporting thresholds and interpretation criteria will need to be established for calling heteroplasmic variants that address a number of important topics, one of which is DNA damage. We assessed the impact of increasing amounts of DNA damage on the interpretation of minor component sequence variants in the mtDNA control region, including low-level mixed sites. A passive approach was used to evaluate the impact of storage conditions, and an active approach was employed to accelerate the process of hydrolytic damage (for example, replication errors associated with depurination events). The patterns of damage were compared and assessed in relation to damage typically encountered in poor quality samples. As expected, the number of miscoding lesions increased as conditions worsened. Single nucleotide polymorphisms (SNPs) associated with miscoding lesions were indistinguishable from innate heteroplasmy and were most often observed as 1-2% of the total sequencing reads. Numerous examples of miscoding lesions above 2% were identified, including two complete changes in the nucleotide sequence, presenting a challenge when assessing the placement of reporting thresholds for heteroplasmy. To mitigate the impact, replication of miscoding lesions was not observed in stored samples, and was rarely seen in data associated with accelerated hydrolysis. In addition, a significant decrease in the expected transition:transversion ratio was observed, providing a useful tool for predicting the presence of damage-induced lesions. The results of this study directly impact MPS analysis of minor sequence variants from poorly preserved DNA extracts, and when biological samples have been exposed to agents that induce DNA damage. These findings are particularly relevant to clinical and forensic investigations. Copyright

  9. From DNA sequence to transcriptional behaviour: a quantitative approach.


    Segal, Eran; Widom, Jonathan


    Complex transcriptional behaviours are encoded in the DNA sequences of gene regulatory regions. Advances in our understanding of these behaviours have been recently gained through quantitative models that describe how molecules such as transcription factors and nucleosomes interact with genomic sequences. An emerging view is that every regulatory sequence is associated with a unique binding affinity landscape for each molecule and, consequently, with a unique set of molecule-binding configurations and transcriptional outputs. We present a quantitative framework based on existing methods that unifies these ideas. This framework explains many experimental observations regarding the binding patterns of factors and nucleosomes and the dynamics of transcriptional activation. It can also be used to model more complex phenomena such as transcriptional noise and the evolution of transcriptional regulation.

  10. Solid-Phase Purification of Synthetic DNA Sequences.


    Grajkowski, Andrzej; Cieslak, Jacek; Beaucage, Serge L


    Although high-throughput methods for solid-phase synthesis of DNA sequences are currently available for synthetic biology applications and technologies for large-scale production of nucleic acid-based drugs have been exploited for various therapeutic indications, little has been done to develop high-throughput procedures for the purification of synthetic nucleic acid sequences. An efficient process for purification of phosphorothioate and native DNA sequences is described herein. This process consists of functionalizing commercial aminopropylated silica gel with aminooxyalkyl functions to enable capture of DNA sequences carrying a 5'-siloxyl ether linker with a "keto" function through an oximation reaction. Deoxyribonucleoside phosphoramidites functionalized with the 5'-siloxyl ether linker were prepared in yields of 75-83% and incorporated last into the solid-phase assembly of DNA sequences. Capture of nucleobase- and phosphate-deprotected DNA sequences released from the synthesis support is demonstrated to proceed near quantitatively. After shorter than full-length DNA sequences were washed from the capture support, the purified DNA sequences were released from this support upon treatment with tetra-n-butylammonium fluoride in dry DMSO. The purity of released DNA sequences exceeds 98%. The scalability and high-throughput features of the purification process are demonstrated without sacrificing purity of the DNA sequences.

  11. Sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2, and 28S rDNA) of Demodex and phylogenetic analysis of Acari based on 18S and 28S rDNA.


    Zhao, Ya-E; Wu, Li-Ping; Hu, Li; Xu, Yang; Wang, Zheng-Hang; Liu, Wen-Yan


    Due to the difficulty of DNA extraction for Demodex, few studies dealt with the identification and the phyletic evolution of Demodex at molecular level. In this study, we amplified, sequenced, and analyzed a complete (Demodex folliculorum) and an almost complete (D12 missing) (Demodex brevis) ribosomal DNA (rDNA) sequence and also analyzed the primary sequences of divergent domains in small-subunit ribosomal RNA (rRNA) of 51 species and in large-subunit rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea, and Ixodoidea). The results revealed that 18S rDNA sequence was relatively conserved in rDNA-coding regions and was not evolving as rapidly as 28S rDNA sequence. The evolutionary rates of transcribed spacer regions were much higher than those of the coding regions. The maximum parsimony trees of 18S and 28S rDNA appeared to be almost identical, consistent with their morphological classification. Based on the fact that the resolution capability of sequence length and the divergence of the 13 segments (D1-D6, D7a, D7b, and D8-D12) of 28S rDNA were stronger than that of the nine variable regions (V1-V9) of 18S rDNA, we were able to identify Demodex (Cheyletoidea) by the indels occurring in D2, D6, and D8.

  12. What Advances Are Being Made in DNA Sequencing?


    ... of DNA building blocks (nucleotides) in an individual's genetic code, called DNA sequencing, has advanced the study of ... a breakthrough that helped scientists determine the human genetic code, but it is time-consuming and expensive. The ...

  13. Theoretical modelling of epigenetically modified DNA sequences

    PubMed Central

    Carvalho, Alexandra Teresa Pires; Gouveia, Maria Leonor; Raju Kanna, Charan; Wärmländer, Sebastian K. T. S.; Platts, Jamie; Kamerlin, Shina Caroline Lynn


    We report herein a set of calculations designed to examine the effects of epigenetic modifications on the structure of DNA. The incorporation of methyl, hydroxymethyl, formyl and carboxy substituents at the 5-position of cytosine is shown to hardly affect the geometry of CG base pairs, but to result in rather larger changes to hydrogen-bond and stacking binding energies, as predicted by dispersion-corrected density functional theory (DFT) methods. The same modifications within double-stranded GCG and ACA trimers exhibit rather larger structural effects, when including the sugar-phosphate backbone as well as sodium counterions and implicit aqueous solvation. In particular, changes are observed in the buckle and propeller angles within base pairs and the slide and roll values of base pair steps, but these leave the overall helical shape of DNA essentially intact. The structures so obtained are useful as a benchmark of faster methods, including molecular mechanics (MM) and hybrid quantum mechanics/molecular mechanics (QM/MM) methods. We show that previously developed MM parameters satisfactorily reproduce the trimer structures, as do QM/MM calculations which treat bases with dispersion-corrected DFT and the sugar-phosphate backbone with AMBER. The latter are improved by inclusion of all six bases in the QM region, since a truncated model including only the central CG base pair in the QM region is considerably further from the DFT structure. This QM/MM method is then applied to a set of double-stranded DNA heptamers derived from a recent X-ray crystallographic study, whose size puts a DFT study beyond our current computational resources. These data show that still larger structural changes are observed than in base pairs or trimers, leading us to conclude that it is important to model epigenetic modifications within realistic molecular contexts. PMID:26448859

  14. The DNA Sequence-dependence of Nucleosome Positioning in vivo and in vitro

    PubMed Central

    Travers, Andrew; Hiriart, Edwige; Churcher, Mark; Caserta, Micaela; Mauro, Ernesto Di


    The contribution of histone-DNA interactions to nucleosome positioning in vivo is currently a matter of debate. We argue here that certain nucleosome positions, often in promoter regions, in yeast may be, at least in part, specified by the DNA sequence. In contrast other positions may be poorly specified. Positioning thus has both statistical and DNA-determined components. We further argue that the relative affinity of the octamer for different DNA sequences can vary and therefore the interaction of histones with the DNA is a ‘tunable’ property. PMID:20232928

  15. Isolation, characterization and chromosome localization of repetitive DNA sequences in bananas (Musa spp.).


    Valárik, M; Simková, H; Hribová, E; Safár, J; Dolezelová, M; Dolezel, J


    Partial genomic DNA libraries were constructed in Musa acuminata and M. balbisiana and screened for clones carrying repeated sequences, and sequences carrying rDNA. Isolated clones were characterized in terms of copy number, genomic distribution in M. acuminata and M. balbisiana, and sequence similarity to known DNA sequences. Ribosomal RNA genes have been the most abundant sequences recovered. FISH with probes for DNA clones Radkal and Radka7, which carry different fragments of Musa 26S rDNA, and Radka14, for which no homology with known DNA sequences has been found, resulted in clear signals at secondary constrictions. Only one clone carrying 5S rDNA, named Radka2, has been recovered. All remaining DNA clones exhibited more or less pronounced clustering at centromeric regions. The study revealed small differences in genomic distribution of repetitive DNA sequences between M. acuminata and M. balbisiana, the only exception being the 5S rDNA where the two Musa clones under study differed in the number of sites. All repetitive sequences were more abundant in M. acuminata whose genome is about 12% larger than that of M. balbisiana. While, for some sequences, the differences in copy number between the species were relatively small, for some of them, e.g. Radka5, the difference was almost thirty-fold. These observations suggest that repetitive DNA sequences contribute to the difference in genome size between both species, albeit to different extents. Isolation and characterization of new repetitive DNA sequences improves the knowledge of long-range organization of chromosomes in

  16. mtDNAprofiler: a Web application for the nomenclature and comparison of human mitochondrial DNA sequences.


    Yang, In Seok; Lee, Hwan Young; Yang, Woo Ick; Shin, Kyoung-Jin


    Mitochondrial DNA (mtDNA) is a valuable tool in the fields of forensic, population, and medical genetics. However, recording and comparing mtDNA control region or entire genome sequences would be difficult if researchers are not familiar with mtDNA nomenclature conventions. Therefore, mtDNAprofiler, a Web application, was designed for the analysis and comparison of mtDNA sequences in a string format or as a list of mtDNA single-nucleotide polymorphisms (mtSNPs). mtDNAprofiler which comprises four mtDNA sequence-analysis tools (mtDNA nomenclature, mtDNA assembly, mtSNP conversion, and mtSNP concordance-check) supports not only the accurate analysis of mtDNA sequences via an automated nomenclature function, but also consistent management of mtSNP data via direct comparison and validity-check functions. Since mtDNAprofiler consists of four tools that are associated with key steps of mtDNA sequence analysis, mtDNAprofiler will be helpful for researchers working with mtDNA. mtDNAprofiler is freely available at

  17. Next Generation Sequencing of DNA-Launched Chikungunya Vaccine Virus

    PubMed Central

    Hidajat, Rachmat; Nickols, Brian; Forrester, Naomi; Tretyakova, Irina; Weaver, Scott; Pushko, Peter


    Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3’ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. PMID:26855330

  18. Evaluation of nucleic acid sequencing of the D1/D2 region of the large subunit of the 28S rDNA and the internal transcribed spacer region using SmartGene IDNS [corrected] software for identification of filamentous fungi in a clinical laboratory.


    Kwiatkowski, Nicole P; Babiker, Wisal M; Merz, William G; Carroll, Karen C; Zhang, Sean X


    Filamentous fungal infections have recently increased because of the increasing numbers of immunocompromised hosts. In this study, we evaluated DNA sequencing of the D1/D2 region of the large subunit of the 28S ribosomal RNA gene and the internal transcribed spacer (ITS) region using SmartGene (SG; SmartGene Inc., Raleigh, NC) for the identification of a broad range of commonly encountered filamentous fungi. The SG proofreaders were used to upload, align, and edit fragments, and the resultant sequences were interpreted using the quality-controlled SG database. The results were compared with reference identifications using conventional phenotypic methods or ITS DNA sequences obtained from GenBank if phenotypic identifications were inconclusive. A total of 146 clinical isolates were included in this study, representing 49 different genera. The overall agreements of the D1/D2 and the ITS sequencing methods to reference identification were 97.2% (95% CI, 93.1% to 98.9%) and 97.7% (95% CI, 92.8% to 99.4%), respectively. Of the 146 isolates, 18 (12.3%) did not amplify using the ITS universal primers after repeated attempts and, therefore, could not be sequenced using this target. Correct identification was achieved for 100% (95% CI, 97.4% to 100%) of the isolates when applying both the D1/D2 and ITS targets. In summary, DNA sequencing using SG software provides a rapid, accurate, and reliable tool for the identification of filamentous fungi in a clinical laboratory. Copyright © 2012 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  19. Potential use of DNA barcoding for the identification of Salvia based on cpDNA and nrDNA sequences.


    Wang, Meng; Zhao, Hong-Xia; Wang, Long; Wang, Tao; Yang, Rui-Wu; Wang, Xiao-Li; Zhou, Yong-Hong; Ding, Chun-Bang; Zhang, Li


    An effective DNA marker for authenticating the genus Salvia was screened using seven DNA regions (rbcL, matK, trnL-F, and psbA-trnH from the chloroplast genome, and ITS, ITS1, and ITS2 from the nuclear genome) and three combinations (rbcL+matK, psbA-trnH+ITS1, and trnL-F+ITS1). The present study collected 232 sequences from 27 Salvia species through DNA sequencing and 77 sequences within the same taxa from the GenBank. The discriminatory capabilities of these regions were evaluated in terms of PCR amplification success, intraspecific and interspecific divergence, DNA barcoding gaps, and identification efficiency via a tree-based method. ITS1 was superior to the other marker for discriminating between species, with an accuracy of 81.48%. The three combinations did not increase species discrimination. Finally, we found that ITS1 is a powerful barcode for identifying Salvia species, especially Salvia miltiorrhiza.

  20. Nucleotide sequence analysis of a DNA region involved in capsular polysaccharide biosynthesis reveals the molecular basis of the nontypeability of two Actinobacillus pleuropneumoniae isolates.


    Ito, Hiroya; Ogawa, Torata; Fukamizu, Dai; Morinaga, Yuiko; Kusumoto, Masahiro


    The aim of our study was to reveal the molecular basis of the serologic nontypeability of 2 Actinobacillus pleuropneumoniae field isolates. Nine field strains of A. pleuropneumoniae, the causative agent of porcine pleuropneumonia, were isolated from pigs raised on the same farm and sent to our diagnostic laboratory for serotyping. Seven of the 9 strains were identified as serovar 15 strains by immunodiffusion tests. However, 2 strains, designated FH24-2 and FH24-5, could not be serotyped with antiserum prepared against serovars 1-15. Strain FH24-5 showed positive results in 2 serovar 15-specific PCR tests, whereas strain FH24-2 was only positive in 1 of the 2 PCR tests. The nucleotide sequence analysis of gene clusters involved in capsular polysaccharide biosynthesis of the 2 nontypeable strains revealed that both had been rendered nontypeable by the action of ISApl1, a transposable element of A. pleuropneumoniae belonging to the IS30 family. The results showed that ISApl1 of A. pleuropneumoniae can interfere with both the serologic and molecular typing methods, and that nucleotide sequence analysis across the capsular gene clusters is the best means of determining the cause of serologic nontypeability in A. pleuropneumoniae. © 2016 The Author(s).

  1. Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.


    Yin, Changchuan


    To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.

  2. Microfluidic devices for DNA sequencing: sample preparation and electrophoretic analysis.


    Paegel, Brian M; Blazej, Robert G; Mathies, Richard A


    Modern DNA sequencing 'factories' have revolutionized biology by completing the human genome sequence, but in the race to completion we are left with inefficient, cumbersome, and costly macroscale processes and supporting facilities. During the same period, microfabricated DNA sequencing, sample processing and analysis devices have advanced rapidly toward the goal of a 'sequencing lab-on-a-chip'. Integrated microfluidic processing dramatically reduces analysis time and reagent consumption, and eliminates costly and unreliable macroscale robotics and laboratory apparatus. A microfabricated device for high-throughput DNA sequencing that couples clone isolation, template amplification, Sanger extension, purification, and electrophoretic analysis in a single microfluidic circuit is now attainable.

  3. DNA sequence determination by hybridization: A strategy for efficient large-scale sequencing

    SciTech Connect

    Drmanac, R.; Drmanac, S.; Strezoska, Z.; Paunesku, T.; Labat, I.; Zeremski, M.; Snoody, J.; Crkvenjakov, R. ); Funkhouser, W.K.; Koop, B.; Hood, L. )


    The concept of sequencing by hybridization (SBH) makes use of an array of all possible n-nucleotide oligomers (n-mers) to identify n-mers present in an unknown DNA sequence. Computational approaches can then be used to assemble the complete sequence. As a validation of this concept, the sequences of three DNA fragments, 343 base pairs in length, were determined with octamer oligonucleotides. Possible applications of SBH include physical mapping (ordering) of overlapping DNA clones, sequence checking, DNA fingerprinting comparisons of normal and disease-causing genes, and the identification of DNA fragments with particular sequence motifs in complementary DNA and genomic libraries. The SBH techniques may accelerate the mapping and sequencing phases of the human genome project. 22 refs., 3 figs.

  4. DNA Sequence Determination by Hybridization: A Strategy for Efficient Large-Scale Sequencing

    NASA Astrophysics Data System (ADS)

    Drmanac, R.; Drmanac, S.; Strezoska, Z.; Paunesku, T.; Labat, I.; Zeremski, M.; Snoddy, J.; Funkhouser, W. K.; Koop, B.; Hood, L.; Crkvenjakov, R.


    The concept of sequencing by hybridization (SBH) makes use of an array of all possible n-nucleotide oligomers (n-mers) to identify n-mers present in an unknown DNA sequence. Computational approaches can then be used to assemble the complete sequence. As a validation of this concept, the sequences of three DNA fragments, 343 base pairs in length, were determined with octamer oligonucleotides. Possible applications of SBH include physical mapping (ordering) of overlapping DNA clones, sequence checking, DNA fingerprinting comparisons of normal and disease-causing genes, and the identification of DNA fragments with particular sequence motifs in complementary DNA and genomic libraries. The SBH techniques may accelerate the mapping and sequencing phases of the human genome project.

  5. Sequence polymorphism in the HLA-B promoter region

    SciTech Connect

    Yao, Z.; Volgger, A.; Scholz, S.


    Transcription of major histocompatibility complex class I genes is controlled by the class I regulatory complex in the 5{prime} flanked region. To investigate the molecular basis of this region, we studied the polymorphism of the promoter of the HLA-B locus extending from the ATG transcription initiation signal to -284 base pairs (bp) which includes a number of cis-acting elements: interferon response sequence (IRS), enhancer A and enhancer B. Genomic DNA from 35 homozygous cell lines from the 10th International Histocompatibility Workshop and from eight heterozygous panel members was amplified using two primers designed to specifically amplify the HLA-B locus. The double-stranded polymerase chain reaction products were sequenced using the cycle sequencing technique and an ABI 373A automatic sequencer. Promoter sequences of thirty-one different HLA-B alleles were determined in this study. Within the 284 bp upstream of the ATG signal, base substitutions were observed in 23 different nucleotide positions. Our study shows a high degree of polymorphism of the HLA-B promoter region, but conserved sequences of the known cis-acting elements with the exception of enhancer B in which there are two base substitutions for B7 and B42 (position -93 and position -95). The 23 polymorphic sites can be grouped into 12 different HLA-B promoter types (groups A to M) for 31 HLA-B locus alleles. Some of the groups of alleles sharing the same promoter sequence such as, for example, group A with B51, B52, B53, and B35, might have been predicted on the basis of serological similarity and/or exon 2,3 sequence. In other groups, such as G (B18, B37, B27), it could not have been anticipated from serological experience that B18 and B27 carry the same promoter. Several sequencing errors were detected in the HLA-B promoter sequences published previously. 32 refs., 4 tabs.

  6. Rediscovery of historical Vitis vinifera varieties from the South Anatolia region by using amplified fragment length polymorphism and simple sequence repeat DNA fingerprinting methods.


    Yilancioglu, Kaan; Cetiner, Selim


    Anatolia played an important role in the diversification and spread of economically important Vitis vinifera varieties. Although several biodiversity studies have been conducted with local cultivars in different regions of Anatolia, our aim is to gain a better knowledge on the biodiversity of endangered historical V. vinifera varieties in the northern Adana region of southern Anatolia, particularly those potentially displaying viticulture characteristics. We also demonstrate the genetic relatedness in a selected subset of widely cultivated and commercialized V. vinifera collection cultivars, which were obtained from the National Grapevine Germplasm located at the Institute of Viticulture, Turkey. In the present study, microsatellites were used in narrowing the sample size from 72 accessions down to a collection of 27 varieties. Amplified fragment length polymorphisms were then employed to determine genetic relatedness among this collection and local V. vinifera cultivars. The unweighted pair group method with arithmetic mean cluster and principal component analyses revealed that Saimbeyli local cultivars form a distinct group, which is distantly related to a selected subset of V. vinifera collection varieties from all over Turkey. To our knowledge, this is the first study conducted with these cultivars. Further preservation and use of these potential viticultural varieties will be helpful to avoid genetic erosion and to promote continued agriculture in the region.

  7. A novel constraint for thermodynamically designing DNA sequences.


    Zhang, Qiang; Wang, Bin; Wei, Xiaopeng; Zhou, Changjun


    Biotechnological and biomolecular advances have introduced novel uses for DNA such as DNA computing, storage, and encryption. For these applications, DNA sequence design requires maximal desired (and minimal undesired) hybridizations, which are the product of a single new DNA strand from 2 single DNA strands. Here, we propose a novel constraint to design DNA sequences based on thermodynamic properties. Existing constraints for DNA design are based on the Hamming distance, a constraint that does not address the thermodynamic properties of the DNA sequence. Using a unique, improved genetic algorithm, we designed DNA sequence sets which satisfy different distance constraints and employ a free energy gap based on a minimum free energy (MFE) to gauge DNA sequences based on set thermodynamic properties. When compared to the best constraints of the Hamming distance, our method yielded better thermodynamic qualities. We then used our improved genetic algorithm to obtain lower-bound DNA sequence sets. Here, we discuss the effects of novel constraint parameters on the free energy gap.

  8. Amerindian mitochondrial DNA haplogroups predominate in the population of Argentina: towards a first nationwide forensic mitochondrial DNA sequence database.


    Bobillo, Maria Cecilia; Zimmermann, Bettina; Sala, Andrea; Huber, Gabriela; Röck, Alexander; Bandelt, Hans-Jürgen; Corach, Daniel; Parson, Walther


    The study presents South American mitochondrial DNA (mtDNA) data from selected north (N = 98), central (N = 193) and south (N = 47) Argentinean populations. Sequence analysis of the complete mtDNA control region (CR, 16024-576) resulted in 288 unique haplotypes ignoring C-insertions around positions 16193, 309, and 573; the additional analysis of coding region single nucleotide polymorphisms enabled a fine classification of the described lineages. The Amerindian haplogroups were most frequent in the north and south representing more than 60% of the sequences. A slightly different situation was observed in central Argentina where the Amerindian haplogroups represented less than 50%, and the European contribution was more relevant. Particular clades of the Amerindian subhaplogroups turned out to be nearly region-specific. A minor contribution of African lineages was observed throughout the country. This comprehensive admixture of worldwide mtDNA lineages and the regional specificity of certain clades in the Argentinean population underscore the necessity of carefully selecting regional samples in order to develop a nationwide mtDNA database for forensic and anthropological purposes. The mtDNA sequencing and analysis were performed under EMPOP guidelines in order to attain high quality for the mtDNA database.

  9. DNA sequencing by denaturation: principle and thermodynamic simulations.


    Chen, Ying-Ja; Huang, Xiaohua


    We describe a new DNA sequencing method called sequencing by denaturation (SBD). A Sanger dideoxy sequencing reaction is performed on the templates on a solid surface to generate a ladder of DNA fragments randomly terminated by fluorescently labeled dideoxyribonucleotides. The labeled DNA fragments are sequentially denatured from the templates and the process is monitored by measuring the change in fluorescence intensities from the surface. By analyzing the denaturation profiles, the base sequence of the template can be determined. Using thermodynamic principles, we simulated the denaturation profiles of a series of oligonucleotides ranging from 12 to 32 bases and developed a base-calling algorithm to decode the sequences. These simulations demonstrate that DNA molecules up to 20 bases can be sequenced by SBD. Experimental measurements of the melting profiles of DNA fragments in solution confirm that DNA sequences can be determined by SBD. The potential limitations and advantages of SBD are discussed. With SBD, millions of sequencing reactions can be performed on a small area on a surface in parallel with a very small amount of sequencing reagents. Therefore, DNA sequencing by SBD could potentially result in a significant increase in speed and reduction in cost in large-scale genome resequencing.

  10. Engineering the DNA cytosine-5 methyltransferase reaction for sequence-specific labeling of DNA

    PubMed Central

    Lukinavičius, Gražvydas; Lapinaitė, Audronė; Urbanavičiūtė, Giedrė; Gerasimaitė, Rūta; Klimašauskas, Saulius


    DNA methyltransferases catalyse the transfer of a methyl group from the ubiquitous cofactor S-adenosyl-L-methionine (AdoMet) onto specific target sites on DNA and play important roles in organisms from bacteria to humans. AdoMet analogs with extended propargylic side chains have been chemically produced for methyltransferase-directed transfer of activated groups (mTAG) onto DNA, although the efficiency of reactions with synthetic analogs remained low. We performed steric engineering of the cofactor pocket in a model DNA cytosine-5 methyltransferase (C5-MTase), M.HhaI, by systematic replacement of three non-essential positions, located in two conserved sequence motifs and in a variable region, with smaller residues. We found that double and triple replacements lead to a substantial improvement of the transalkylation activity, which manifests itself in a mild increase of cofactor binding affinity and a larger increase of the rate of alkyl transfer. These effects are accompanied with reduction of both the stability of the product DNA–M.HhaI–AdoHcy complex and the rate of methylation, permitting competitive mTAG labeling in the presence of AdoMet. Analogous replacements of two conserved residues in M.HpaII and M2.Eco31I also resulted in improved transalkylation activity attesting a general applicability of the homology-guided engineering to the C5-MTase family and expanding the repertoire of sequence-specific tools for covalent in vitro and ex vivo labeling of DNA. PMID:23042683

  11. Sequence dependence of isothermal DNA amplification via EXPAR

    PubMed Central

    Qian, Jifeng; Ferguson, Tanya M.; Shinde, Deepali N.; Ramírez-Borrero, Alissa J.; Hintze, Arend; Adami, Christoph; Niemz, Angelika


    Isothermal nucleic acid amplification is becoming increasingly important for molecular diagnostics. Therefore, new computational tools are needed to facilitate assay design. In the isothermal EXPonential Amplification Reaction (EXPAR), template sequences with similar thermodynamic characteristics perform very differently. To understand what causes this variability, we characterized the performance of 384 template sequences, and used this data to develop two computational methods to predict EXPAR template performance based on sequence: a position weight matrix approach with support vector machine classifier, and RELIEF attribute evaluation with Naïve Bayes classification. The methods identified well and poorly performing EXPAR templates with 67–70% sensitivity and 77–80% specificity. We combined these methods into a computational tool that can accelerate new assay design by ruling out likely poor performers. Furthermore, our data suggest that variability in template performance is linked to specific sequence motifs. Cytidine, a pyrimidine base, is over-represented in certain positions of well-performing templates. Guanosine and adenosine, both purine bases, are over-represented in similar regions of poorly performing templates, frequently as GA or AG dimers. Since polymerases have a higher affinity for purine oligonucleotides, polymerase binding to GA-rich regions of a single-stranded DNA template may promote non-specific amplification in EXPAR and other nucleic acid amplification reactions. PMID:22416064

  12. Introns and their flanking sequences of Bombyx mori rDNA.

    PubMed Central

    Fujiwara, H; Ogura, T; Takada, N; Miyajima, N; Ishikawa, H; Maekawa, H


    We obtained two different clones (16 kb and 13 kb) of B. mori rDNA with intron sequence within the 28S-rRNA coding region. The sequence surrounding the intron was found to be highly conserved as indicated in several eukaryotes (Tetrahymena, Drosophila and Xenopus). The 28S rRNA-coding sequence of 16 kb and 13 kb clone was interrupted at precisely the same sites as those where the D. melanogaster rDNA interrupted by the type I and type II intron, respectively. The intron sequences of B. mori were different from those of D. melanogaster. In 16 kb clone, the intron was flanked by 14 bp duplication of the junction sequence, which was also present once within the 28S rRNA-coding region of rDNA without intron. This 14 bp sequence was identical with those surrounding the introns of Dipteran rDNAs. PMID:6091041

  13. Nanopores: A journey towards DNA sequencing

    PubMed Central

    Wanunu, Meni


    Much more than ever, nucleic acids are recognized as key building blocks in many of life's processes, and the science of studying these molecular wonders at the single-molecule level is thriving. A new method of doing so has been introduced in the mid 1990's. This method is exceedingly simple: a nanoscale pore that spans across an impermeable thin membrane is placed between two chambers that contain an electrolyte, and voltage is applied across the membrane using two electrodes. These conditions lead to a steady stream of ion flow across the pore. Nucleic acid molecules in solution can be driven through the pore, and structural features of the biomolecules are observed as measurable changes in the trans-membrane ion current. In essence, a nanopore is a high-throughput ion microscope and a single-molecule force apparatus. Nanopores are taking center stage as a tool that promises to read a DNA sequence, and this promise has resulted in overwhelming academic, industrial, and national interest. Regardless of the fate of future nanopore applications, in the process of this 16-year-long exploration, many studies have validated the indispensability of nanopores in the toolkit of single-molecule biophysics. This review surveys past and current studies related to nucleic acid biophysics, and will hopefully provoke a discussion of immediate and future prospects for the field. PMID:22658507

  14. Advances in high throughput DNA sequence data compression.


    Sardaraz, Muhammad; Tahir, Muhammad; Ikram, Ataul Aziz


    Advances in high throughput sequencing technologies and reduction in cost of sequencing have led to exponential growth in high throughput DNA sequence data. This growth has posed challenges such as storage, retrieval, and transmission of sequencing data. Data compression is used to cope with these challenges. Various methods have been developed to compress genomic and sequencing data. In this article, we present a comprehensive review of compression methods for genome and reads compression. Algorithms are categorized as referential or reference free. Experimental results and comparative analysis of various methods for data compression are presented. Finally, key challenges and research directions in DNA sequence data compression are highlighted.

  15. Phylogenetic Analysis of a ‘Jewel Orchid’ Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions

    PubMed Central

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen


    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1) Goodyera is not monophyletic; 2) Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3) sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection. PMID:26927946

  16. Sequence Recognition in the Pairing of DNA Duplexes

    NASA Astrophysics Data System (ADS)

    Kornyshev, A. A.; Leikin, S.


    Pairing of DNA fragments with homologous sequences occurs in gene shuffling, DNA repair, and other vital processes. While chemical individuality of base pairs is hidden inside the double helix, x ray and NMR revealed sequence-dependent modulation of the structure of DNA backbone. Here we show that the resulting modulation of the DNA surface charge pattern enables duplexes longer than ~50 base pairs to recognize sequence homology electrostatically at a distance of up to several water layers. This may explain the local recognition observed in pairing of homologous chromosomes and the observed length dependence of homologous recombination.

  17. Bisulfite sequencing of chromatin immunoprecipitated DNA (BisChIP-seq) directly informs methylation status of histone-modified DNA

    PubMed Central

    Statham, Aaron L.; Robinson, Mark D.; Song, Jenny Z.; Coolen, Marcel W.; Stirzaker, Clare; Clark, Susan J.


    The complex relationship between DNA methylation, chromatin modification, and underlying DNA sequence is often difficult to unravel with existing technologies. Here, we describe a novel technique based on high-throughput sequencing of bisulfite-treated chromatin immunoprecipitated DNA (BisChIP-seq), which can directly interrogate genetic and epigenetic processes that occur in normal and diseased cells. Unlike most previous reports based on correlative techniques, we found using direct bisulfite sequencing of Polycomb H3K27me3-enriched DNA from normal and prostate cancer cells that DNA methylation and H3K27me3-marked histones are not always mutually exclusive, but can co-occur in a genomic region-dependent manner. Notably, in cancer, the co-dependency of marks is largely redistributed with an increase of the dual repressive marks at CpG islands and transcription start sites of silent genes. In contrast, there is a loss of DNA methylation in intergenic H3K27me3-marked regions. Allele-specific methylation status derived from the BisChIP-seq data clearly showed that both methylated and unmethylated alleles can simultaneously be associated with H3K27me3 histones, highlighting that DNA methylation status in these regions is not dependent on Polycomb chromatin status. BisChIP-seq is a novel approach that can be widely applied to directly interrogate the genomic relationship between allele-specific DNA methylation, histone modification, or other important epigenetic regulators. PMID:22466171

  18. ITS1 sequence variabilities correlate with 18S rDNA sequence types in the genus Acanthamoeba (Protozoa: Amoebozoa).


    Köhsler, Martina; Leitner, Brigitte; Blaschitz, Marion; Michel, Rolf; Aspöck, Horst; Walochnik, Julia


    The subgenus classification of the ubiquitously spread and potentially pathogenic acanthamoebae still poses a great challenge. Fifteen 18S rDNA sequence types (T1-T15) have been established, but the vast majority of isolates fall into sequence type T4, and so far, there is no means to reliably differentiate within T4. In this study, the first internal transcribed spacer (ITS1), a more variable region than the 18S rRNA gene, was sequenced, and the sequences of 15 different Acanthamoeba isolates were compared to reveal if ITS1 sequence variability correlates with 18S rDNA sequence typing and if the ITS1 sequencing allows a differentiation within T4. It was shown that the variability in ITS1 is tenfold higher than in the 18S rDNA, and that ITS1 clusters correlate with the 18S rDNA clusters and thus corroborate the Acanthamoeba sequence type system. Moreover, high sequence dissimilarities and distinctive microsatellite patterns could enable a more detailed differentiation within T4.

  19. Laser Desorption Mass Spectrometry for DNA Sequencing and Analysis

    NASA Astrophysics Data System (ADS)

    Chen, C. H. Winston; Taranenko, N. I.; Golovlev, V. V.; Isola, N. R.; Allman, S. L.


    Rapid DNA sequencing and/or analysis is critically important for biomedical research. In the past, gel electrophoresis has been the primary tool to achieve DNA analysis and sequencing. However, gel electrophoresis is a time-consuming and labor-extensive process. Recently, we have developed and used laser desorption mass spectrometry (LDMS) to achieve sequencing of ss-DNA longer than 100 nucleotides. With LDMS, we succeeded in sequencing DNA in seconds instead of hours or days required by gel electrophoresis. In addition to sequencing, we also applied LDMS for the detection of DNA probes for hybridization LDMS was also used to detect short tandem repeats for forensic applications. Clinical applications for disease diagnosis such as cystic fibrosis caused by base deletion and point mutation have also been demonstrated. Experimental details will be presented in the meeting. abstract.

  20. Food Fish Identification from DNA Extraction through Sequence Analysis

    ERIC Educational Resources Information Center

    Hallen-Adams, Heather E.


    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  1. cDNA cloning and sequencing of tarantula hemocyanin subunits.


    Voit, R; Feldmaier-Fuchs, G


    Tarantula heart cDNA libraries were screened with synthetic oligonucleotide probes deduced from the highly conserved amino acid sequences of the two copper-binding sites, copper A and copper B, found in chelicerate hemocyanins. Positive cDNA clones could be obtained and four different cDNA types were characterized.

  2. Scanning probe and nanopore DNA sequencing: core techniques and possibilities.


    Lund, John; Parviz, Babak A


    We provide an overview of the current state of research towards DNA sequencing using nanopore and scanning probe techniques. Additionally, we provide methods for the creation of two key experimental platforms for studies relating to nanopore and scanning probe DNA studies: a synthetic nanopore apparatus and an atomically flat conductive substrate with stretched DNA molecules.

  3. Food Fish Identification from DNA Extraction through Sequence Analysis

    ERIC Educational Resources Information Center

    Hallen-Adams, Heather E.


    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  4. A 28,000 years old Cro-Magnon mtDNA sequence differs from all potentially contaminating modern sequences.


    Caramelli, David; Milani, Lucio; Vai, Stefania; Modi, Alessandra; Pecchioli, Elena; Girardi, Matteo; Pilli, Elena; Lari, Martina; Lippi, Barbara; Ronchitelli, Annamaria; Mallegni, Francesco; Casoli, Antonella; Bertorelle, Giorgio; Barbujani, Guido


    DNA sequences from ancient specimens may in fact result from undetected contamination of the ancient specimens by modern DNA, and the problem is particularly challenging in studies of human fossils. Doubts on the authenticity of the available sequences have so far hampered genetic comparisons between anatomically archaic (Neandertal) and early modern (Cro-Magnoid) Europeans. We typed the mitochondrial DNA (mtDNA) hypervariable region I in a 28,000 years old Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23) and in all the people who had contact with the sample since its discovery in 2003. The Paglicci 23 sequence, determined through the analysis of 152 clones, is the Cambridge reference sequence, and cannot possibly reflect contamination because it differs from all potentially contaminating modern sequences. The Paglicci 23 individual carried a mtDNA sequence that is still common in Europe, and which radically differs from those of the almost contemporary Neandertals, demonstrating a genealogical continuity across 28,000 years, from Cro-Magnoid to modern Europeans. Because all potential sources of modern DNA contamination are known, the Paglicci 23 sample will offer a unique opportunity to get insight for the first time into the nuclear genes of early modern Europeans.

  5. A 4D representation of DNA sequences and its application

    NASA Astrophysics Data System (ADS)

    Liao, Bo; Tan, Mingshu; Ding, Kequan


    A 4D representation of DNA sequences has been derived for mathematical denotation of DNA sequence. The 4D representation also avoids loss of information accompanying alternative 2D and 3D representation. The geometrical centers of the 4D graph of DNA sequences indicate the distribution of base frequencies. A interesting phenomenon is observed for Goat and Gallus β-globin genomes with high G + C content. The examination of similarities/dissimilarities among the coding sequences of the first exon of β-globin gene of different species illustrates the utility of the approach.

  6. DNA sequence mapping by fluorescence in situ hybridization

    SciTech Connect

    Brandriff, B.F.; Gordon, L.A.; Trask, B.J. )


    Various types of DNA probes, such as total genomic DNA, repetitive sequences, unique sequences, and composites of chromosome-specific DNA probes, can be used with fluorescence in situ hybridization (FISH) techniques to address research questions having to do with localization, mapping, and distribution of DNA in situ. FISH involves the formation of a heteroduplex between such DNA probes and chromatin targets on a microscope slide, which can be visualized with fluorescent reporter molecules. Three chromatin targets - metaphase chromosomes, somatic interphases, and zygote interphases - offer increasingly extended states of chromatin which can be strategically selected, individually or in combination, to address specific research questions of interest.

  7. Characteristics of cloned repeated DNA sequences in the barley genome

    SciTech Connect

    Anan'ev, E.V.; Bochkanov, S.S.; Ryzhik, M.V.; Sonina, N.V.; Chernyshev, A.I.; Shchipkova, N.I.; Yakovleva, E.Yu.


    A partial clone library of barley DNA fragments based on plasmid pBR325 was created. The cloned EcoRI-fragments of chromosomal DNA are from 2 to 14 kbp in length. More than 95% of the barley DNA inserts comprise repeated sequences of different complexity and copy number. Certain of these DNA sequences are from families comprising at least 1% of the barley genome. A significant proportion of the clones hybridize with numerous sets of restriction fragments of genome DNA and they are dispersed throughout the barley chromosomes.

  8. Retroviral DNA Sequences as a Means for Determining Ancient Diets

    PubMed Central

    Rivera-Perez, Jessica I.; Cano, Raul J.; Narganes-Storde, Yvonne; Chanlatte-Baik, Luis; Toranzos, Gary A.


    For ages, specialists from varying fields have studied the diets of the primeval inhabitants of our planet, detecting diet remains in archaeological specimens using a range of morphological and biochemical methods. As of recent, metagenomic ancient DNA studies have allowed for the comparison of the fecal and gut microbiomes associated to archaeological specimens from various regions of the world; however the complex dynamics represented in those microbial communities still remain unclear. Theoretically, similar to eukaryote DNA the presence of genes from key microbes or enzymes, as well as the presence of DNA from viruses specific to key organisms, may suggest the ingestion of specific diet components. In this study we demonstrate that ancient virus DNA obtained from coprolites also provides information reconstructing the host’s diet, as inferred from sequences obtained from pre-Columbian coprolites. This depicts a novel and reliable approach to determine new components as well as validate the previously suggested diets of extinct cultures and animals. Furthermore, to our knowledge this represents the first description of the eukaryotic viral diversity found in paleofaeces belonging to pre-Columbian cultures. PMID:26660678

  9. Affordable Hands-On DNA Sequencing and Genotyping: An Exercise for Teaching DNA Analysis to Undergraduates

    ERIC Educational Resources Information Center

    Shah, Kushani; Thomas, Shelby; Stein, Arnold


    In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C…

  10. Affordable Hands-On DNA Sequencing and Genotyping: An Exercise for Teaching DNA Analysis to Undergraduates

    ERIC Educational Resources Information Center

    Shah, Kushani; Thomas, Shelby; Stein, Arnold


    In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C…

  11. Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human

    PubMed Central

    Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai


    DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation. PMID:28212312

  12. DNA polymerases drive DNA sequencing-by-synthesis technologies: both past and present.


    Chen, Cheng-Yao


    Next-generation sequencing (NGS) technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. Escherichia coli DNA polymerase I proteolytic (Klenow) fragment was originally utilized in Sanger's dideoxy chain-terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE) and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ϕ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ϕ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

  13. DNA polymerase having modified nucleotide binding site for DNA sequencing


    Tabor, Stanley; Richardson, Charles


    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  14. DNA polymerase having modified nucleotide binding site for DNA sequencing


    Tabor, S.; Richardson, C.


    A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

  15. Mapping DNA polymerase errors by single-molecule sequencing

    SciTech Connect

    Lee, David F.; Lu, Jenny; Chang, Seungwoo; Loparo, Joseph J.; Xie, Xiaoliang S.


    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replication product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.

  16. Neandertal DNA sequences and the origin of modern humans.


    Krings, M; Stone, A; Schmitz, R W; Krainitzki, H; Stoneking, M; Pääbo, S


    DNA was extracted from the Neandertal-type specimen found in 1856 in western Germany. By sequencing clones from short overlapping PCR products, a hitherto unknown mitochondrial (mt) DNA sequence was determined. Multiple controls indicate that this sequence is endogenous to the fossil. Sequence comparisons with human mtDNA sequences, as well as phylogenetic analyses, show that the Neandertal sequence falls outside the variation of modern humans. Furthermore, the age of the common ancestor of the Neandertal and modern human mtDNAs is estimated to be four times greater than that of the common ancestor of human mtDNAs. This suggests that Neandertals went extinct without contributing mtDNA to modern humans.

  17. Direct Sequencing from the Minimal Number of DNA Molecules Needed to Fill a 454 Picotiterplate

    PubMed Central

    Martínez-Priego, Llúcia; D’Auria, Giussepe; Calafell, Francesc; Moya, Andrés


    The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA), mostly by multiple displacement amplification (MDA) based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS), which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA. PMID:24887077

  18. Deep-Sequencing Technologies and Potential Applications in Forensic DNA Testing.


    Zascavage, R R; Shewale, S J; Planz, J V


    Development of second- and third-generation DNA sequencing technologies have enabled an increasing number of applications in different areas such as molecular diagnostics, gene therapy, monitoring food and pharmaceutical products, biosecurity, and forensics. These technologies are based on different biochemical principles such as monitoring released pyrophosphate upon incorporation of a base (pyrosequencing), fluorescence detection subsequent to reversible incorporation of a fluorescently labeled terminator base, ligation based approach wherein fluorescence of cleaved nucleotide after ligation is measured, measuring the proton released after incorporation of a base (semiconductor-based sequencing), monitoring incorporation of a nucleotide by measuring the fluorescence of the fluorophore attached to the phosphate chain of the nucleotide, and by detecting the altered charge in a protein nanopore due to released nucleotide by exonuclease cleavage of a DNA strand. Analysis of multiple DNA fragments in parallel increases the depth of coverage while decreasing labor, cost, and time, highlighting some major advantages of deep-sequencing technologies. DNA sequencing has been routinely used in the forensic laboratories for mitochondrial DNA analysis. Fragment analysis, however, is the preferred method for Short Tandem Repeat genotyping due to the cumbersome and costly nature of fi rst-generation DNA sequencing methodologies. Deep-sequencing technologies have brought a new perspective to forensic DNA analysis. Studies include STR analysis to reveal hidden variation in the repeat regions, mtDNA sequencing, Single Nucleotide Polymorphism analysis, mixture resolution, and body fluid identification. Recent publications reveal that attempts are being made to expand the capability.

  19. Structure of mitochondrial DNA control region of Pholis fangi and its phylogenetic implication

    NASA Astrophysics Data System (ADS)

    Li, Lin; Zhang, Hui; Sun, Dianrong; Gao, Tianxiang


    In this study, the entire mitochondrial DNA (mtDNA) control region (CR) of Pholis fangi was amplified via polymerase chain reaction followed by direct sequencing. The length of the mtDNA CR consensus sequence of P. fangi was 853 bp in length. In accordance with the recognition sites as were previously reported in fish species, the mtDNA CR sequence of P. fangi can be divided into 3 domains, i.e., the extended terminal associated sequence (ETAS), the central conserved sequence block (CSB), and the CSB domain. In addition, the following structures were identified in the mtDNA CR sequence of P. fangi: 2 ETASs in the ETAS domain (TAS and cTAS), 6 CSBs in the central CSB domain (CSB-F to CSB-A), and 3 CSBs in the CSB domain (CSB-1 to CSB-3). These demonstrated that the structure of the mtDNA CR of P. fangi was substantially different from those of most other fish species. The mtDNA CR sequence of P. fangi contained one conserved region from 656 bp to 815 bp. Similar to most other fish species, P. fangi has no tandem repeat sequences in its mtDNA CR sequence. Phylogenetic analysis based on the complete mtDNA CR sequences showed that there were no genetic differences within P. fangi populations of the same geographical origin and between P. fangi populations of different geographical origins.

  20. Application of 2-D graphical representation of DNA sequence

    NASA Astrophysics Data System (ADS)

    Liao, Bo; Tan, Mingshu; Ding, Kequan


    Recently, we proposed a 2-D graphical representation of DNA sequence [Bo Liao, A 2-D graphical representation of DNA sequence, Chem. Phys. Lett. 401 (2005) 196-199]. Based on this representation, we consider properties of mutations and compute the similarities among 11 mitochondrial sequences belonging to different species. The elements of the similarity matrix are used to construct phylogenic tree. Unlike most existing phylogeny construction methods, the proposed method does not require multiple alignment.

  1. Unusual structure of ribosomal DNA in the copepod Tigriopus californicus: intergenic spacer sequences lack internal subrepeats.


    Burton, R S; Metz, E C; Flowers, J M; Willett, C S


    Eukaryotic nuclear ribosomal DNA (rDNA) is typically arranged as a series of tandem repeats coding for 18S, 5.8S, and 28S ribosomal RNAs. Transcription of rDNA repeats is initiated in the intergenic spacer (IGS) region upstream of the 18S gene. The IGS region itself typically consists of a set of subrepeats that function as transcriptional enhancers. Two important evolutionary forces have been proposed to act on the IGS region: first, selection may favor changes in the number of subrepeats that adaptively adjust rates of rDNA transcription, and second, coevolution of IGS sequence with RNA polymerase I transcription factors may lead to species specificity of the rDNA transcription machinery. To investigate the potential role of these forces on population differentiation and hybrid breakdown in the intertidal copepod Tigriopus californicus, we have characterized the rDNA of five T. californicus populations from the Pacific Coast of North America and one sample of T. brevicornicus from Scotland. Major findings are as follows: (1) the structural genes for 18S and 28S are highly conserved across T. californicus populations, in contrast to other nuclear and mitochondrial DNA (mtDNA) genes previously studied in these populations. (2) There is extensive differentiation among populations in the IGS region; in the extreme, no homology is observed across the IGS sequences (>2 kb) from the two Tigriopus species. (3) None of the Tigriopus IGS sequences have the subrepeat structure common to other eukaryotic IGS regions. (4) Segregation of rDNA in laboratory crosses indicates that rDNA is located on at least two separate chromosomes in T. californicus. These data suggest that although IGS length polymorphism does not appear to play the adaptive role hypothesized in some other eukaryotic systems, sequence divergence in the rDNA promoter region within the IGS could lead to population specificity of transcription in hybrids.

  2. Evolution of a complex minisatellite DNA sequence.


    Barros, Paula; Blanco, Miguel G; Boán, Francisco; Gómez-Márquez, Jaime


    Minisatellites are tandem repeats of short DNA units widely distributed in genomes. However, the information on their dynamics in a phylogenetic context is very limited. Here we have studied the organization of the MsH43 locus in several species of primates and from these data we have reconstructed the evolutionary history of this complex minisatellite. Overall, with the exception of gibbon, MsH43 has an organization that is asymmetric, since the distribution of repeats is distinct between the 5' and 3' halves, and heterogeneous since there are many different repeats, some of them characteristic of each species. Inspection of the MsH43 arrays showed the existence of many duplications and deletions, suggesting the implication of slippage processes in the generation of polymorphism. Concerning the evolutionary history of this minisatellite, we propose that the birth of MsH43 may be situated before the divergence of Old World Monkeys since we found the existence of some MsH43 repeat motifs in prosimians and New World Monkeys. The analysis of MsH43 in apes revealed the existence of an evolutionary breakpoint in the pathway that originated African great apes and humans. Remarkably, human MsH43 is more homologous to orang-utan than to the corresponding sequence in gorilla and chimpanzee. This finding does not comply with the evolutionary paradigm that continuous alterations occur during the course of genome evolution. To adjust our results to the standard phylogeny of primates, we propose the existence of a wandering allele that was maintained almost unaltered during the period that extends between orang-utan and humans.

  3. Statistical properties of DNA sequences revisited: the role of inverse bilateral symmetry in bacterial chromosomes

    NASA Astrophysics Data System (ADS)

    José, Marco V.; Govezensky, Tzipe; Bobadilla, Juan R.


    Herein it is shown that in order to study the statistical properties of DNA sequences in bacterial chromosomes it suffices to consider only one half of the chromosome because they are similar to its corresponding complementary sequence in the other half. This is due to the inverse bilateral symmetry of bacterial chromosomes. Contrary to the classical result that DNA coding regions of bacterial genomes are purely uncorrelated random sequences, here it is shown, via a renormalization group approach, that DNA random fluctuations of single bases are modulated by log-periodic variations. Distance series of triplets display long-range correlations in each half of the intact chromosome and in protein-coding sequences, or both long-range correlations and log-periodic modulations along the whole chromosome. Hence scaling analyses of distance series of DNA sequences have to consider the functional units of bacterial chromosomes.

  4. Statistical analysis of nucleotide runs in coding and noncoding DNA sequences.


    Sprizhitsky YuA; Nechipurenko YuD; Alexandrov, A A; Volkenstein, M V


    A statistical analysis of the occurrence of particular nucleotide runs in DNA sequences of different species has been carried out. There are considerable differences of run distributions in DNA sequences of procaryotes, invertebrates and vertebrates. There is an abundance of short runs (1-2 nucleotides long) in the coding sequences and there is a deficiency of such runs in the noncoding regions. However, some interesting exceptions from this rule exist for the run distribution of adenine in procaryotes and for the arrangement of purine-pyrimidine runs in eucaryotes. The similarity in the distributions of such runs in the coding and noncoding regions may be due to some structural features of the DNA molecule as a whole. Runs of guanine (or cytosine) of three to six nucleotides occur predominantly in noncoding DNA regions in eucaryotes, especially in vertebrates.

  5. Bacterial repetitive extragenic palindromic sequences are DNA targets for Insertion Sequence elements

    PubMed Central

    Tobes, Raquel; Pareja, Eduardo


    Background Mobile elements are involved in genomic rearrangements and virulence acquisition, and hence, are important elements in bacterial genome evolution. The insertion of some specific Insertion Sequences had been associated with repetitive extragenic palindromic (REP) elements. Considering that there are a sufficient number of available genomes with described REPs, and exploiting the advantage of the traceability of transposition events in genomes, we decided to exhaustively analyze the relationship between REP sequences and mobile elements. Results This global multigenome study highlights the importance of repetitive extragenic palindromic elements as target sequences for transposases. The study is based on the analysis of the DNA regions surrounding the 981 instances of Insertion Sequence elements with respect to the positioning of REP sequences in the 19 available annotated microbial genomes corresponding to species of bacteria with reported REP sequences. This analysis has allowed the detection of the specific insertion into REP sequences for ISPsy8 in Pseudomonas syringae DC3000, ISPa11 in P. aeruginosa PA01, ISPpu9 and ISPpu10 in P. putida KT2440, and ISRm22 and ISRm19 in Sinorhizobium meliloti 1021 genome. Preference for insertion in extragenic spaces with REP sequences has also been detected for ISPsy7 in P. syringae DC3000, ISRm5 in S. meliloti and ISNm1106 in Neisseria meningitidis MC58 and Z2491 genomes. Probably, the association with REP elements that we have detected analyzing genomes is only the tip of the iceberg, and this association could be even more frequent in natural isolates. Conclusion Our findings characterize REP elements as hot spots for transposition and reinforce the relationship between REP sequences and genomic plasticity mediated by mobile elements. In addition, this study defines a subset of REP-recognizer transposases with high target selectivity that can be useful in the development of new tools for genome manipulation. PMID

  6. Cross-utilizing hyperchaotic and DNA sequences for image encryption

    NASA Astrophysics Data System (ADS)

    Zhan, Kun; Wei, Dong; Shi, Jinhui; Yu, Jun


    The hyperchaotic sequence and the DNA sequence are utilized jointly for image encryption. A four-dimensional hyperchaotic system is used to generate a pseudorandom sequence. The main idea is to apply the hyperchaotic sequence to almost all steps of the encryption. All intensity values of an input image are converted to a serial binary digit stream, and the bitstream is scrambled globally by the hyperchaotic sequence. DNA algebraic operation and complementation are performed between the hyperchaotic sequence and the DNA sequence to obtain a robust encryption performance. The experiment results demonstrate that the encryption algorithm achieves the performance of the state-of-the-art methods in term of quality, security, and robustness against noise and cropping attack.

  7. An auditory display tool for DNA sequence analysis.


    Temple, Mark D


    DNA Sonification refers to the use of an auditory display to convey the information content of DNA sequence data. Six sonification algorithms are presented that each produce an auditory display. These algorithms are logically designed from the simple through to the more complex. Three of these parse individual nucleotides, nucleotide pairs or codons into musical notes to give rise to 4, 16 or 64 notes, respectively. Codons may also be parsed degenerately into 20 notes with respect to the genetic code. Lastly nucleotide pairs can be parsed as two separate frames or codons can be parsed as three reading frames giving rise to multiple streams of audio. The most informative sonification algorithm reads the DNA sequence as codons in three reading frames to produce three concurrent streams of audio in an auditory display. This approach is advantageous since start and stop codons in either frame have a direct affect to start or stop the audio in that frame, leaving the other frames unaffected. Using these methods, DNA sequences such as open reading frames or repetitive DNA sequences can be distinguished from one another. These sonification tools are available through a webpage interface in which an input DNA sequence can be processed in real time to produce an auditory display playable directly within the browser. The potential of this approach as an analytical tool is discussed with reference to auditory displays derived from test sequences including simple nucleotide sequences, repetitive DNA sequences and coding or non-coding genes. This study presents a proof-of-concept that some properties of a DNA sequence can be identified through sonification alone and argues for their inclusion within the toolkit of DNA sequence browsers as an adjunct to existing visual and analytical tools.

  8. Presence of Bacterial Phage-Like DNA Sequences in Commercial Taq DNA Polymerase Reagents

    PubMed Central

    Newsome, Tamara; Li, Bing-Jie; Zou, Nianxiang; Lo, Shyh-Ching


    Many studies have reported the presence of bacterial DNA contamination in commercial Taq DNA polymerase reagents. This is the first report of the presence of phage-like DNA sequences in certain commercial Taq DNA polymerase reagents. Precautions are needed when using amplification reagents with exogenous DNAs. PMID:15131208

  9. Advanced microinstrumentation for rapid DNA sequencing and large DNA fragment separation

    SciTech Connect

    Balch, J.; Davidson, J.; Brewer, L.; Gingrich, J.; Koo, J.; Mariella, R.; Carrano, A.


    Our efforts to develop novel technology for a rapid DNA sequencer and large fragment analysis system based upon gel electrophoresis are described. We are using microfabrication technology to build dense arrays of high speed micro electrophoresis lanes that will ultimately increase the sequencing rate of DNA by at least 100 times the rate of current sequencers. We have demonstrated high resolution DNA fragment separation needed for sequencing in polyacrylamide microgels formed in glass microchannels. We have built prototype arrays of microchannels having up to 48 channels. Significant progress has also been made in developing a sensitive fluorescence detection system based upon a confocal microscope design that will enable the diagnostics and detection of DNA fragments in ultrathin microchannel gels. Development of a rapid DNA sequencer and fragment analysis system will have a major impact on future DNA instrumentation used in clinical, molecular and forensic analysis of DNA fragments.

  10. Simulations Using Random-Generated DNA and RNA Sequences

    ERIC Educational Resources Information Center

    Bryce, C. F. A.


    Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

  11. DNA Shape versus Sequence Variations in the Protein Binding Process.


    Chen, Chuanying; Pettitt, B Montgomery


    The binding process of a protein with a DNA involves three stages: approach, encounter, and association. It has been known that the complexation of protein and DNA involves mutual conformational changes, especially for a specific sequence association. However, it is still unclear how the conformation and the information in the DNA sequences affects the binding process. What is the extent to which the DNA structure adopted in the complex is induced by protein binding, or is instead intrinsic to the DNA sequence? In this study, we used the multiscale simulation method to explore the binding process of a protein with DNA in terms of DNA sequence, conformation, and interactions. We found that in the approach stage the protein can bind both the major and minor groove of the DNA, but uses different features to locate the binding site. The intrinsic conformational properties of the DNA play a significant role in this binding stage. By comparing the specific DNA with the nonspecific in unbound, intermediate, and associated states, we found that for a specific DNA sequence, ∼40% of the bending in the association forms is intrinsic and that ∼60% is induced by the protein. The protein does not induce appreciable bending of nonspecific DNA. In addition, we proposed that the DNA shape variations induced by protein binding are required in the early stage of the binding process, so that the protein is able to approach, encounter, and form an intermediate at the correct site on DNA. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. Multiplexed Sequence Encoding: A Framework for DNA Communication

    PubMed Central

    Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.


    Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

  13. Recombinant human MDM2 oncoprotein shows sequence composition selectivity for binding to both RNA and DNA.


    Challen, Christine; Anderson, John J; Chrzanowska-Lightowlers, Zofia M A; Lightowlers, Robert N; Lunec, John


    MDM2 is a 90 kDa nucleo-phosphoprotein that binds p53 and other proteins contributing to its oncogenic properties. Its structure includes an amino proximal p53 binding site, a central acidic domain and a carboxy region which incorporates Zinc and Ring Finger domains suggestive of nucleic acid binding or transcription factor function. It has previously been reported that a bacculovirus expressed MDM2 protein binds RNA in a sequence-specific manner through the Ring Finger domain, however, its ability to bind DNA has yet to be examined. We report here that a bacterially expressed human MDM2 protein binds both DNA as well as the previously defined RNA consensus sequence. DNA binding appears selective and involves the carboxy-terminal domain of the molecule. RNA binding is inhibited by an MDM2 specific antibody, which recognises an epitope within the carboxy region of the protein. Selection cloning and sequence analysis of MDM2 DNA binding sequences, unlike RNA binding sequences, revealed no obvious DNA binding consensus sequence, but preferential binding to oligopurine:pyrimidine-rich stretches. Our results suggest that the observed preferential DNA binding may occur through the Zinc Finger or in a charge-charge interaction through the Ring Finger, thereby implying potentially different mechanisms for DNA and RNA MDM2 binding.

  14. [DNA analysis for the post genome-sequencing era].


    Kambara, Hideki


    With the completion of the human genome sequencing, the new post genome-sequencing era has started. The major subjects are clarifying the function of genes to apply this information to medical as well as various industrial fields. Various DNA analysis methods and instruments for gene expression profiling as well as genetic diversity including SNPs typing are required and have been developed. Here, the history and technologies related to DNA analysis including the Wada project in the early 1980's, and the Human genome project from 1990 are described. Various new technologies have developed in this decade. They include a capillary gel array DNA sequencer, DNA chips, bead probe arrays, a new DNA sequencing method using pyrosequencing and an efficient SNP typing method by BAMPER.

  15. A mathematical model and numerical method for thermoelectric DNA sequencing

    NASA Astrophysics Data System (ADS)

    Shi, Liwei; Guilbeau, Eric J.; Nestorova, Gergana; Dai, Weizhong


    Single nucleotide polymorphisms (SNPs) are single base pair variations within the genome that are important indicators of genetic predisposition towards specific diseases. This study explores the feasibility of SNP detection using a thermoelectric sequencing method that measures the heat released when DNA polymerase inserts a deoxyribonucleoside triphosphate into a DNA strand. We propose a three-dimensional mathematical model that governs the DNA sequencing device with a reaction zone that contains DNA template/primer complex immobilized to the surface of the lower channel wall. The model is then solved numerically. Concentrations of reactants and the temperature distribution are obtained. Results indicate that when the nucleoside is complementary to the next base in the DNA template, polymerization occurs lengthening the complementary polymer and releasing thermal energy with a measurable temperature change, implying that the thermoelectric conceptual device for sequencing DNA may be feasible for identifying specific genes in individuals.

  16. DNA Shape Dominates Sequence Affinity in Nucleosome Formation

    NASA Astrophysics Data System (ADS)

    Freeman, Gordon S.; Lequieu, Joshua P.; Hinckley, Daniel M.; Whitmer, Jonathan K.; de Pablo, Juan J.


    Nucleosomes provide the basic unit of compaction in eukaryotic genomes, and the mechanisms that dictate their position at specific locations along a DNA sequence are of central importance to genetics. In this Letter, we employ molecular models of DNA and proteins to elucidate various aspects of nucleosome positioning. In particular, we show how DNA's histone affinity is encoded in its sequence-dependent shape, including subtle deviations from the ideal straight B-DNA form and local variations of minor groove width. By relying on high-precision simulations of the free energy of nucleosome complexes, we also demonstrate that, depending on DNA's intrinsic curvature, histone binding can be dominated by bending interactions or electrostatic interactions. More generally, the results presented here explain how sequence, manifested as the shape of the DNA molecule, dominates molecular recognition in the problem of nucleosome positioning.

  17. Enrichment by hybridisation of long DNA fragments for Nanopore sequencing

    PubMed Central

    Eckert, Sabine E.; Chan, Jackie Z.-M.; Houniet, Darren; Breuer, Judy


    Enrichment of DNA by hybridisation is an important tool which enables users to gather target-focused next-generation sequence data in an economical fashion. Current in-solution methods capture short fragments of around 200–300 nt, potentially missing key structural information such as recombination or translocations often found in viral or bacterial pathogens. The increasing use of long-read third-generation sequencers requires methods and protocols to be adapted for their specific requirements. Here, we present a variation of the traditional bait–capture approach which can selectively enrich large fragments of DNA or cDNA from specific bacterial and viral pathogens, for sequencing on long-read sequencers. We enriched cDNA from cultured influenza virus A, human cytomegalovirus (HCMV) and genomic DNA from two strains of Mycobacterium tuberculosis (M. tb) from a background of cell line or spiked human DNA. We sequenced the enriched samples on the Oxford Nanopore MinION™ and the Illumina MiSeq platform and present an evaluation of the method, together with analysis of the sequence data. We found that unenriched influenza A and HCMV samples had no reads matching the target organism due to the high background of DNA from the cell line used to culture the pathogen. In contrast, enriched samples sequenced on the MinION™ platform had 57 % and 99 % best-quality on-target reads respectively. PMID:28785419

  18. Real-time DNA sequencing from single polymerase molecules.


    Korlach, Jonas; Bjornson, Keith P; Chaudhuri, Bidhan P; Cicero, Ronald L; Flusberg, Benjamin A; Gray, Jeremy J; Holden, David; Saxena, Ravi; Wegener, Jeffrey; Turner, Stephen W


    Pacific Biosciences has developed a method for real-time sequencing of single DNA molecules (Eid et al., 2009), with intrinsic sequencing rates of several bases per second and read lengths into the kilobase range. Conceptually, this sequencing approach is based on eavesdropping on the activity of DNA polymerase carrying out template-directed DNA polymerization. Performed in a highly parallel operational mode, sequential base additions catalyzed by each polymerase are detected with terminal phosphate-linked, fluorescence-labeled nucleotides. This chapter will first outline the principle of this single-molecule, real-time (SMRT) DNA sequencing method, followed by descriptions of its underlying components and typical sequencing run conditions. Two examples are provided which illustrate that, in addition to the DNA sequence, the dynamics of DNA polymerization from each enzyme molecules is directly accessible: the determination of base-specific kinetic parameters from single-molecule sequencing reads, and the characterization of DNA synthesis rate heterogeneities. Copyright 2010 Elsevier Inc. All rights reserved.

  19. The number of reduced alignments between two DNA sequences

    PubMed Central


    Background In this study we consider DNA sequences as mathematical strings. Total and reduced alignments between two DNA sequences have been considered in the literature to measure their similarity. Results for explicit representations of some alignments have been already obtained. Results We present exact, explicit and computable formulas for the number of different possible alignments between two DNA sequences and a new formula for a class of reduced alignments. Conclusions A unified approach for a wide class of alignments between two DNA sequences has been provided. The formula is computable and, if complemented by software development, will provide a deeper insight into the theory of sequence alignment and give rise to new comparison methods. AMS Subject Classification Primary 92B05, 33C20, secondary 39A14, 65Q30 PMID:24684679

  20. An Evolution Based Biosensor Receptor DNA Sequence Generation Algorithm

    PubMed Central

    Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M.; Lee, Jaewan; Zang, Yupeng


    A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements. PMID:22315543

  1. Complementary DNA sequences of the constant regions of T-cell antigen receptors α, β and γ in mandarin fish, Siniperca chuatsi Basilewsky, and their transcriptional changes after stimulation with Flavobacterium columnare.


    Tian, J Y; Qi, Z T; Wu, N; Chang, M X; Nie, P


    In this study, the constant-region genes (Cα, Cβ and Cγ) that encode the T-cell antigen receptor (TCR) α, β and γ chains were cloned from mandarin fish, Siniperca chuatsi Basilewsky, an important freshwater fish species in China. The complementary DNA sequences of Cα, Cβ and Cγ were 843, 716 and 906 base pairs (bp) in length and had a 465-, 289- and 360-bp 3' untranslated region, encoding 125, 142 and 182 amino acids, respectively. The amino-acid sequences of the constant regions of mandarin fish TCR α, β and γ chains (encoded by Cα, Cβ and Cγ, respectively) were most similar to those of their teleost counterparts, showing 60% similarity with pufferfish, 48% similarity with Atlantic salmon and 57% similarity with flounder, respectively. The phylogenetic analysis revealed that the mandarin fish Cα, Cβ and Cγ were clustered, respectively, with their vertebrate counterparts. The mandarin fish Cα, Cβ and Cγ could also be separated into four domains: immunoglobulin; connecting peptide (CP); transmembrane (TM); and cytoplasmic tail. Several conserved features in mammalian TCRs were also found in those of mandarin fish, such as a conserved cysteine residue in the CP domain of Cα, necessary for creating an interchain disulphide bond with the TCR β chain, and a conserved antigen receptor TM motif in Cα and Cβ. Meanwhile, transcripts of Cα, Cβ and Cγ were detectable in all examined organs, with a stronger signal observed in lymphoid organs. In addition, the temporal transcriptional changes for Cα and Cγ were investigated, 1, 2, 3, 4, 5, 6 and 8 weeks after stimulation with Flavobacterium columnare, in head kidney, spleen, blood, thymus, gill and intestine, using real-time polymerase chain reaction. The results demonstrated stimulation-dependent up-regulations in almost all tissues examined, which indicates that T cells may play important roles in preventing mandarin fish from bacterial invasion. In particular, apart from thymus, T cells were

  2. Biological nanopore MspA for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Manrao, Elizabeth A.

    Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore

  3. Microhomology-mediated DNA strand annealing and elongation by human DNA polymerases λ and β on normal and repetitive DNA sequences

    PubMed Central

    Crespan, Emmanuele; Czabany, Tibor; Maga, Giovanni; Hübscher, Ulrich


    ‘Classical’ non-homologous end joining (NHEJ), dependent on the Ku70/80 and the DNA ligase IV/XRCC4 complexes, is essential for the repair of DNA double-strand breaks. Eukaryotic cells possess also an alternative microhomology-mediated end-joining (MMEJ) mechanism, which is independent from Ku and DNA ligase 4/XRCC4. The components of the MMEJ machinery are still largely unknown. Family X DNA polymerases (pols) are involved in the classical NHEJ pathway. We have compared in this work, the ability of human family X DNA pols β, λ and μ, to promote the MMEJ of different model templates with terminal microhomology regions. Our results reveal that DNA pol λ and DNA ligase I are sufficient to promote efficient MMEJ repair of broken DNA ends in vitro, and this in the absence of auxiliary factors. However, DNA pol β, not λ, was more efficient in promoting MMEJ of DNA ends containing the (CAG)n triplet repeat sequence of the human Huntingtin gene, leading to triplet expansion. The checkpoint complex Rad9/Hus1/Rad1 promoted end joining by DNA pol λ on non-repetitive sequences, while it limited triplet expansion by DNA pol β. We propose a possible novel role of DNA pol β in MMEJ, promoting (CAG)n triplet repeats instability. PMID:22373917

  4. An Optimal Seed Based Compression Algorithm for DNA Sequences

    PubMed Central

    Gopalakrishnan, Gopakumar; Karunakaran, Muralikrishnan


    This paper proposes a seed based lossless compression algorithm to compress a DNA sequence which uses a substitution method that is similar to the LempelZiv compression scheme. The proposed method exploits the repetition structures that are inherent in DNA sequences by creating an offline dictionary which contains all such repeats along with the details of mismatches. By ensuring that only promising mismatches are allowed, the method achieves a compression ratio that is at par or better than the existing lossless DNA sequence compression algorithms. PMID:27555868

  5. DNA Methyltransferase Accessibility Protocol for Individual Templates by Deep Sequencing

    PubMed Central

    Darst, Russell P.; Nabilsi, Nancy H.; Pardo, Carolina E.; Riva, Alberto; Kladde, Michael P.


    A single-molecule probe of chromatin structure can uncover dynamic chromatin states and rare epigenetic variants of biological importance that bulk measures of chromatin structure miss. In bisulfite genomic sequencing, each sequenced clone records the methylation status of multiple sites on an individual molecule of DNA. An exogenous DNA methyltransferase can thus be used to image nucleosomes and other protein–DNA complexes. In this chapter, we describe the adaptation of this technique, termed Methylation Accessibility Protocol for individual templates, to modern high-throughput sequencing, which both simplifies the workflow and extends its utility. PMID:22929770

  6. DNA sequence analysis with droplet-based microfluidics

    PubMed Central

    Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.


    Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based assay. Using probes of different sequences, we interrogate a target DNA molecule for polymorphisms. With a larger probe set, additional polymorphisms can be interrogated as well as targets of arbitrary sequence. PMID:24185402

  7. PNA Directed Sequence Addressed Self-Assembly of DNA Nanostructures

    NASA Astrophysics Data System (ADS)

    Nielsen, Peter E.


    Peptide nucleic acids (PNA) can be designed to target duplex DNA with very high sequence specificity and efficiency via various binding modes. We have designed three domain PNA clamps, that bind stably to predefined decameric homopurine targets in large dsDNA molecules and via a third PNA domain sequence specifically recognize another PNA oligomer. We describe how such three domain PNAs have utility for assembling dsDNA grid and clover leaf structures, and in combination with SNAP-tag technology of protein dsDNA structures.

  8. Repetitive sequence analysis and karyotyping reveals centromere-associated DNA sequences in radish (Raphanus sativus L.).


    He, Qunyan; Cai, Zexi; Hu, Tianhua; Liu, Huijun; Bao, Chonglai; Mao, Weihai; Jin, Weiwei


    Radish (Raphanus sativus L., 2n = 2x = 18) is a major root vegetable crop especially in eastern Asia. Radish root contains various nutritions which play an important role in strengthening immunity. Repetitive elements are primary components of the genomic sequence and the most important factors in genome size variations in higher eukaryotes. To date, studies about repetitive elements of radish are still limited. To better understand genome structure of radish, we undertook a study to evaluate the proportion of repetitive elements and their distribution in radish. We conducted genome-wide characterization of repetitive elements in radish with low coverage genome sequencing followed by similarity-based cluster analysis. Results showed that about 31% of the genome was composed of repetitive sequences. Satellite repeats were the most dominating elements of the genome. The distribution pattern of three satellite repeat sequences (CL1, CL25, and CL43) on radish chromosomes was characterized using fluorescence in situ hybridization (FISH). CL1 was predominantly located at the centromeric region of all chromosomes, CL25 located at the subtelomeric region, and CL43 was a telomeric satellite. FISH signals of two satellite repeats, CL1 and CL25, together with 5S rDNA and 45S rDNA, provide useful cytogenetic markers to identify each individual somatic metaphase chromosome. The centromere-specific histone H3 (CENH3) has been used as a marker to identify centromere DNA sequences. One putative CENH3 (RsCENH3) was characterized and cloned from radish. Its deduced amino acid sequence shares high similarities to those of the CENH3s in Brassica species. An antibody against B. rapa CENH3, specifically stained radish centromeres. Immunostaining and chromatin immunoprecipitation (ChIP) tests with anti-BrCENH3 antibody demonstrated that both the centromere-specific retrotransposon (CR-Radish) and satellite repeat (CL1) are directly associated with RsCENH3 in radish. Proportions

  9. Current-voltage characteristics of double-strand DNA sequences

    NASA Astrophysics Data System (ADS)

    Bezerril, L. M.; Moreira, D. A.; Albuquerque, E. L.; Fulco, U. L.; de Oliveira, E. L.; de Sousa, J. S.


    We use a tight-binding formulation to investigate the transmissivity and the current-voltage (I-V) characteristics of sequences of double-strand DNA molecules. In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for the genomic DNA sequence with those of artificial sequences (the long-range correlated Fibonacci and Rudin-Shapiro one) and a random sequence, which is a kind of prototype of a short-range correlated system. The random sequence is presented here with the same first neighbors pair correlations of the human DNA sequence. We found that the long-range character of the correlations is important to the transmissivity spectra, although the I-V curves seem to be mostly influenced by the short-range correlations.

  10. Mylodon darwinii DNA sequences from ancient fecal hair shafts.


    Clack, Andrew A; MacPhee, Ross D E; Poinar, Hendrik N


    Preserved hair has been increasingly used as an ancient DNA source in high throughput sequencing endeavors, and it may actually offer several advantages compared to more traditional ancient DNA substrates like bone. However, cold environments have yielded the most informative ancient hair specimens, while its preservation, and thus utility, in temperate regions is not well documented. Coprolites could represent a previously underutilized preservation substrate for hairs, which, if present therein, represent macroscopic packages of specific cells that are relatively simple to separate, clean and process. In this pilot study, we report amplicons 147-152 base pairs in length (w/primers) from hair shafts preserved in a south Chilean coprolite attributed to Darwin's extinct ground sloth, Mylodon darwinii. Our results suggest that hairs preserved in coprolites from temperate cave environments can serve as an effective source of ancient DNA. This bodes well for potential molecular-based population and phylogeographic studies on sloths, several species of which have been understudied despite leaving numerous coprolites in caves across of the Americas.

  11. Sequence-dependent DNA deformability studied using molecular dynamics simulations

    PubMed Central

    Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori


    Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein–DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein–DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids. PMID:17766249

  12. DNA Sequencing by Hexagonal Boron Nitride Nanopore: A Computational Study

    PubMed Central

    Zhang, Liuyang; Wang, Xianqiao


    The single molecule detection associated with DNA sequencing has motivated intensive efforts to identify single DNA bases. However, little research has been reported utilizing single-layer hexagonal boron nitride (hBN) for DNA sequencing. Here we employ molecular dynamics simulations to explore pathways for single-strand DNA (ssDNA) sequencing by nanopore on the hBN sheet. We first investigate the adhesive strength between nucleobases and the hBN sheet, which provides the foundation for the hBN-base interaction and nanopore sequencing mechanism. Simulation results show that the purine base has a more remarkable energy profile and affinity than the pyrimidine base on the hBN sheet. The threading of ssDNA through the hBN nanopore can be clearly identified due to their different energy profiles and conformations with circular nanopores on the hBN sheet. The sequencing process is orientation dependent when the shape of the hBN nanopore deviates from the circle. Our results open up a promising avenue to explore the capability of DNA sequencing by hBN nanopore.