Science.gov

Sample records for region dna sequence

  1. Correlation approach to identify coding regions in DNA sequences

    NASA Technical Reports Server (NTRS)

    Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1994-01-01

    Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

  2. A Fast Algorithm for Exonic Regions Prediction in DNA Sequences

    PubMed Central

    Saberkari, Hamidreza; Shamsi, Mousa; Heravi, Hamed; Sedaaghi, Mohammad Hossein

    2013-01-01

    The main purpose of this paper is to introduce a fast method for gene prediction in DNA sequences based on the period-3 property in exons. First, the symbolic DNA sequences were converted to digital signal using the electron ion interaction potential method. Then, to reduce the effect of background noise in the period-3 spectrum, we used the discrete wavelet transform at three levels and applied it on the input digital signal. Finally, the Goertzel algorithm was used to extract period-3 components in the filtered DNA sequence. The proposed algorithm leads to decrease the computational complexity and hence, increases the speed of the process. Detection of small size exons in DNA sequences, exactly, is another advantage of the algorithm. The proposed algorithm ability in exon prediction was compared with several existing methods at the nucleotide level using: (i) specificity - sensitivity values; (ii) receiver operating curves (ROC); and (iii) area under ROC curve. Simulation results confirmed that the proposed method can be used as a promising tool for exon prediction in DNA sequences. PMID:24672762

  3. Homogeneity in mitochondrial DNA control region sequences in Swedish subpopulations.

    PubMed

    Tillmar, Andreas O; Coble, Michael D; Wallerström, Thomas; Holmlund, Gunilla

    2010-03-01

    In order to promote mitochondrial DNA (mtDNA) testing in Sweden we have typed 296 Swedish males, which will serve as a Swedish mtDNA frequency database. The tested males were taken from seven geographically different regions representing the contemporary Swedish population. The complete mtDNA control region was typed and the Swedish population was shown to have high haplotype diversity with a random match probability of 0.5%. Almost 47% of the tested samples belonged to haplogroup H and further haplogroup comparison with worldwide populations clustered the Swedish mtDNA data together with other European populations. AMOVA analysis of the seven Swedish subregions displayed no significant maternal substructure in Sweden (F (ST) = 0.002). Our conclusion from this study is that the typed Swedish individuals serve as good representatives for a Swedish forensic mtDNA database. Some caution should, however, be taken for individuals from the northernmost part of Sweden (provinces of Norrbotten and Lapland) due to specific demographic conditions. Furthermore, our analysis of a small sample set of a Swedish Saami population confirmed earlier findings that the Swedish Saami population is an outlier among European populations.

  4. Dna Sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  5. Agrobacterium T-DNA integration in Arabidopsis is correlated with DNA sequence compositions that occur frequently in gene promoter regions.

    PubMed

    Schneeberger, Richard G; Zhang, Ke; Tatarinova, Tatiana; Troukhan, Max; Kwok, Shing F; Drais, Josh; Klinger, Kevin; Orejudos, Francis; Macy, Kimberly; Bhakta, Amit; Burns, James; Subramanian, Gopal; Donson, Jonathan; Flavell, Richard; Feldmann, Kenneth A

    2005-10-01

    Mobile insertion elements such as transposons and T-DNA generate useful genetic variation and are important tools for functional genomics studies in plants and animals. The spectrum of mutations obtained in different systems can be highly influenced by target site preferences inherent in the mechanism of DNA integration. We investigated the target site preferences of Agrobacterium T-DNA insertions in the chromosomes of the model plant Arabidopsis thaliana. The relative frequencies of insertions in genic and intergenic regions of the genome were calculated and DNA composition features associated with the insertion site flanking sequences were identified. Insertion frequencies across the genome indicate that T-strand integration is suppressed near centromeres and rDNA loci, progressively increases towards telomeres, and is highly correlated with gene density. At the gene level, T-DNA integration events show a statistically significant preference for insertion in the 5' and 3' flanking regions of protein coding sequences as well as the promoter region of RNA polymerase I transcribed rRNA gene repeats. The increased insertion frequencies in 5' upstream regions compared to coding sequences are positively correlated with gene expression activity and DNA sequence composition. Analysis of the relationship between DNA sequence composition and gene activity further demonstrates that DNA sequences with high CG-skew ratios are consistently correlated with T-DNA insertion site preference and high gene expression. The results demonstrate genomic and gene-specific preferences for T-strand integration and suggest that DNA sequences with a pronounced transition in CG- and AT-skew ratios are preferred targets for T-DNA integration.

  6. Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations.

    PubMed

    Berger, C; Berger, B; Parson, W

    2012-01-01

    In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

  7. Correcting sequencing errors in DNA coding regions using a dynamic programming approach.

    PubMed

    Xu, Y; Mural, R J; Uberbacher, E C

    1995-04-01

    This paper presents an algorithm for detecting and 'correcting' sequencing errors that occur in DNA coding regions. The types of sequencing errors addressed are insertions and deletions (indels) of DNA bases. The goal is to provide a capability which makes single-pass or low-redundancy sequence data more informative, reducing the need for high-redundancy sequencing for gene identification and characterization purposes. This would permit improved sequencing efficiency and reduce genome sequencing costs. The algorithm detects sequencing errors by discovering changes in the statistically preferred reading frame within a putative coding region and then inserts a number of 'neutral' bases at a perceived reading frame transition point to make the putative exon candidate frame consistent. We have implemented the algorithm as a front-end subsystem of the GRAIL DNA sequence analysis system to construct a version which is very error tolerant and also intend to use this as a testbed for further development of sequencing error-correction technology. Preliminary test results have shown the usefulness of this algorithm and also exhibited some of its weakness, providing possible directions for further improvement. On a test set consisting of 68 human DNA sequences with 1% randomly generated indels in coding regions, the algorithm detected and corrected 76% of the indels. The average distance between the position of an indel and the predicted one was 9.4 bases. With this subsystem in place, GRAIL correctly predicted 89% of the coding messages with 10% false message on the 'corrected' sequences, compared to 69% correctly predicted coding messages and 11% falsely predicted messages on the 'corrupted' sequences using standard GRAIL II method (version 1.2).(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Repetitive sequences in Eurasian lynx (Lynx lynx L.) mitochondrial DNA control region.

    PubMed

    Sindičić, Magda; Gomerčić, Tomislav; Galov, Ana; Polanc, Primož; Huber, Duro; Slavica, Alen

    2012-06-01

    Mitochondrial DNA (mtDNA) control region (CR) of numerous species is known to include up to five different repetitive sequences (RS1-RS5) that are found at various locations, involving motifs of different length and extensive length heteroplasmy. Two repetitive sequences (RS2 and RS3) on opposite sides of mtDNA central conserved region have been described in domestic cat (Felis catus) and some other felid species. However, the presence of repetitive sequence RS3 has not been detected in Eurasian lynx (Lynx lynx) yet. We analyzed mtDNA CR of 35 Eurasian lynx (L. lynx L.) samples to characterize repetitive sequences and to compare them with those found in other felid species. We confirmed the presence of 80 base pairs (bp) repetitive sequence (RS2) at the 5' end of the Eurasian lynx mtDNA CR L strand and for the first time we described RS3 repetitive sequence at its 3' end, consisting of an array of tandem repeats five to ten bp long. We found that felid species share similar RS3 repetitive pattern and fundamental repeat motif TACAC.

  9. Intraspecific nucleotide sequence differences in the major noncoding region of human mitochondrial DNA.

    PubMed Central

    Horai, S; Hayasaka, K

    1990-01-01

    Nucleotide sequences of the major noncoding region of human mitochondrial DNA (mtDNA) from 95 human placentas have been determined. These sequences include at least a 482-bp-long region encompassing most of the D-loop-forming region. Comparisons of these sequences with those previously determined have revealed remarkable features of nucleotide substitutions and insertion/deletion events. The nucleotide diversity among the sequences is estimated as 1.45%, which is three- to fourfold higher than the corresponding value estimated from restriction-enzyme analysis of whole mtDNA genome. A hypervariable region has also been defined. In this 14-bp region, 17 different sequences were detected. More than 97% of the base changes are transitions. A significantly nonrandom distribution of nucleotide substitutions and sequence length variations were also noted. The phylogenetic analysis indicates that diversity among the negroids is much larger than that among the caucasoids or the mongoloids. In fact, part of the negroids first diverged from other humans in the phylogenetic tree. A striking finding in the phylogenetic analysis is that the mongoloids can be separated into two distinct groups. Divergence of part of the mongoloids follows the earliest divergence of part of the negroids. The remainder of the mongoloids subsequently diverged together with the caucasoids. This observation confirmed our earlier study, which clearly demonstrated, by the restriction-enzyme analysis, existence of two distinct groups in the Japanese. Images Figure 3 PMID:2316527

  10. Correcting sequencing errors in DNA coding regions using a dynamic programming approach

    SciTech Connect

    Xu, Y.; Mural, R.J.; Uberbacher, E.C.

    1994-12-01

    This paper presents an algorithm for detecting and ``correcting`` sequencing errors that occur in DNA coding regions. The types of sequencing error addressed include insertions and deletions (indels) of DNA bases. The goal is to provide a capability which makes single-pass or low-redundancy sequence data more informative, reducing the need for high-redundancy sequencing for gene identification and characterization purposes. The algorithm detects sequencing errors by discovering changes in the statistically preferred reading frame within a putative coding region and then inserts a number of ``neutral`` bases at a perceived reading frame transition point to make the putative exon candidate frame consistent. The authors have implemented the algorithm as a front-end subsystem of the GRAIL DNA sequence analysis system to construct a version which is very error tolerant and also intend to use this as a testbed for further development of sequencing error-correction technology. On a test set consisting of 68 Human DNA sequences with 1% randomly generated indels in coding regions, the algorithm detected and corrected 76% of the indels. The average distance between the position of an indel and the predicted one was 9.4 bases. With this subsystem in place, GRAIL correctly predicted 89% of the coding messages with 10% false message on the ``corrected`` sequences, compared to 69% correctly predicted coding messages and 11% falsely predicted messages on the ``corrupted`` sequences using standard GRAIL II method. The method uses a dynamic programming algorithm, and runs in time and space linear to the size of the input sequence.

  11. Repetitive sequences in the ITS1 region of ribosomal DNA in congeneric microphallid species (Trematoda: Digenea).

    PubMed

    Warberg, Rikke; Jensen, K Thomas; Frydenberg, Jane

    2005-11-01

    In searching for species-specific DNA sequences of microphallid species (Digenea, Trematoda) we examined the ribosomal internal transcribed spacer regions (ITS) of three closely related species (Levinseniella group) hosted by mud snails (first intermediate host) and marine crustaceans (second intermediate host). In the ITS1 region we found consistent patterns of repeating sequences of 130 bp. Within each main repeat there was a varying number of subrepeats specific for each of the species. All repeats including subrepeats were identified by a similar starting sequence: 5'-CCTGTGG-3'. As this sequence has close resemblance to the chi sequence 5'-GCTGGTGG-3' found in phage lambda we speculate if it serves the same function as a recombination hotspot. Alternatively but less likely, it could be an inactive, mutational relic of a sequence that once served this purpose.

  12. Genomic shotgun array: a procedure linking large-scale DNA sequencing with regional transcript mapping.

    PubMed

    Li, Ling-Hui; Li, Jian-Chiuan; Lin, Yung-Feng; Lin, Chung-Yen; Chen, Chung-Yung; Tsai, Shih-Feng

    2004-02-11

    To facilitate transcript mapping and to investigate alterations in genomic structure and gene expression in a defined genomic target, we developed a novel microarray-based method to detect transcriptional activity of the human chromosome 4q22-24 region. Loss of heterozygosity of human 4q22-24 is frequently observed in hepatocellular carcinoma (HCC). One hundred and eighteen well-characterized genes have been identified from this region. We took previously sequenced shotgun subclones as templates to amplify overlapping sequences for the genomic segment and constructed a chromosome-region-specific microarray. Using genomic DNA fragments as probes, we detected transcriptional activity from within this region among five different tissues. The hybridization results indicate that there are new transcripts that have not yet been identified by other methods. The existence of new transcripts encoded by genes in this region was confirmed by PCR cloning or cDNA library screening. The procedure reported here allows coupling of shotgun sequencing with transcript mapping and, potentially, detailed analysis of gene expression and chromosomal copy of the genomic sequence for the putative HCC tumor suppressor gene(s) in the 4q candidate region.

  13. Sequence polymorphism in a novel noncoding region of Pacific oyster mitochondrial DNA.

    PubMed

    Aranishi, Futoshi; Okimoto, Takane

    2005-01-01

    Nucleotide sequence polymorphism in a 641-bp novel major noncoding region of mitochondrial DNA (mtDNA-NC) of the Pacific oyster Crassostrea gigas was analysed for 29 cultured individuals within the Goseong population. A total of 30 variable sites were detected, and the relative frequency of nucleotide alteration was determined to be 4.68. Alterations were mostly single nucleotide substitutions. Transition, transversion, both transition and transversion, and both transversion and nucleotide deletion were observed at 18, 9, 2 and 1 sites, respectively. Among 29 specimens, 22 haplotypes were identified, and pairwise genetic diversity of haplotypes was calculated to be 0.988 from multiple sequence substitutions using the two-parameter model. A phylogenetic tree, obtained for haplotypes by the neighbor-joining method, showed a single cluster of linkages. The cluster comprised 11 haplotypes associating with 14 specimens, while the other 11 haplotypes associating with 15 specimens were scattered. This mtDNA-NC presenting a high nucleotide sequence polymorphism is a potential mtDNA control region. It therefore can serve as a genetic marker for intraspecies phylogenetic analysis of the Pacific oyster and is more useful than the less polymorphic mtDNA coding genes.

  14. DNA sequence variation in the mitochondrial control region of red-backed voles (Clethrionomys).

    PubMed

    Matson, C W; Baker, R J

    2001-08-01

    The complete mitochondrial DNA (mtDNA) control region was sequenced for 71 individuals from five species of the rodent genus Clethrionomys both to understand patterns of variation and to explore the existence of previously described domains and other elements. Among species, the control region ranged from 942 to 971 bp in length. Our data were compatible with the proposal of three domains (extended terminal associated sequences [ETAS], central, conserved sequence blocks [CSB]) within the control region. The most conserved region in the control region was the central domain (12% of nucleotide positions variable), whereas in the ETAS and CSB domains, 22% and 40% of nucleotide positions were variable, respectively. Tandem repeats were encountered only in the ETAS domain of Clethrionomys rufocanus. This tandem repeat found in C. rufocanus was 24 bp in length and was located at the 5' end of the control region. Only two of the proposed CSB and ETAS elements appeared to be supported by our data; however, a "CSB1-like" element was also documented in the ETAS domain.

  15. Regional localization of DNA sequences on chromosome 21 using somatic cell hybrids.

    PubMed Central

    Van Keuren, M L; Watkins, P C; Drabkin, H A; Jabs, E W; Gusella, J F; Patterson, D

    1986-01-01

    We have used a panel of Chinese hamster X human somatic cell hybrids, each containing various portions of chromosome 21 as the only detectable human chromosome component, for regional mapping of cloned, chromosome 21-derived DNA sequences. Thirty unique and very low-repeat sequences were mapped to the short arm and three sections of the long arm. Three unique sequences map to the proximal part of the terminal band 21q22.3, and five to the distal part of this band. Some of these may represent parts of gene sequences that may be relevant to the pathogenesis of Down syndrome, as 21q22 is the area required to be present in triplicate for the full clinical picture. Images Fig. 1 PMID:3014865

  16. Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene.

    PubMed

    Cabral, D F; Santos, A; Ribeiro, M L; Mesquita, J C; Carvalho-Salles, A B; Hackel, C

    2004-12-01

    The human androgen receptor (AR) gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR) may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T) in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

  17. Identifications of Captive and Wild Tilapia Species Existing in Hawaii by Mitochondrial DNA Control Region Sequence

    PubMed Central

    Wu, Liang; Yang, Jinzeng

    2012-01-01

    Background The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. Methodology/Principal Findings In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. Conclusions/Significance This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species

  18. Evolution of Repeated Sequence Arrays in the D-Loop Region of Bat Mitochondrial DNA

    PubMed Central

    Wilkinson, G. S.; Mayer, F.; Kerth, G.; Petri, B.

    1997-01-01

    Analysis of mitochondrial DNA control region sequences from 41 species of bats representing 11 families revealed that repeated sequence arrays near the tRNA-Pro gene are present in all vespertilionine bats. Across 18 species tandem repeats varied in size from 78 to 85 bp and contained two to nine repeats. Heteroplasmy ranged from 15% to 63%. Fewer repeats among heteroplasmic than homoplasmic individuals in a species with up to nine repeats indicates selection may act against long arrays. A lower limit of two repeats and more repeats among heteroplasmic than homoplasmic individuals in two species with few repeats suggests length mutations are biased. Significant regressions of heteroplasmy, θ and π, on repeat number further suggest that repeat duplication rate increases with repeat number. Comparison of vespertilionine bat consensus repeats to mammal control region sequences revealed that tandem repeats of similar size, sequence and number also occur in shrews, cats and bighorn sheep. The presence of two conserved protein-binding sequences in all repeat units indicates that convergent evolution has occurred by duplication of functional units. We speculate that D-loop region tandem repeats may provide signal redundancy and a primitive repair mechanism in the event of somatic mutations to these binding sites. PMID:9215906

  19. Genetic structure of Florida green turtle rookeries as indicated by mitochondrial DNA control region sequences

    USGS Publications Warehouse

    Shamblin, Brian M.; Bagley, Dean A.; Ehrhart, Llewellyn M.; Desjardin, Nicole A.; Martin, R. Erik; Hart, Kristen M.; Naro-Maciel, Eugenia; Rusenko, Kirt; Stiner, John C.; Sobel, Debra; Johnson, Chris; Wilmers, Thomas; Wright, Laura J.; Nairn, Campbell J.

    2014-01-01

    Green turtle (Chelonia mydas) nesting has increased dramatically in Florida over the past two decades, ranking the Florida nesting aggregation among the largest in the Greater Caribbean region. Individual beaches that comprise several hundred kilometers of Florida’s east coast and Keys support tens to thousands of nests annually. These beaches encompass natural to highly developed habitats, and the degree of demographic partitioning among rookeries was previously unresolved. We characterized the genetic structure of ten Florida rookeries from Cape Canaveral to the Dry Tortugas through analysis of 817 base pair mitochondrial DNA (mtDNA) control region sequences from 485 nesting turtles. Two common haplotypes, CM-A1.1 and CM-A3.1, accounted for 87 % of samples, and the haplotype frequencies were strongly partitioned by latitude along Florida’s Atlantic coast. Most genetic structure occurred between rookeries on either side of an apparent genetic break in the vicinity of the St. Lucie Inlet that separates Hutchinson Island and Jupiter Island, representing the finest scale at which mtDNA structure has been documented in marine turtle rookeries. Florida and Caribbean scale analyses of population structure support recognition of at least two management units: central eastern Florida and southern Florida. More thorough sampling and deeper sequencing are necessary to better characterize connectivity among Florida green turtle rookeries as well as between the Florida nesting aggregation and others in the Greater Caribbean region.

  20. Characterization of EBV Promoters and Coding Regions by Sequencing PCR-Amplified DNA Fragments.

    PubMed

    Szenthe, Kalman; Bánáti, Ferenc

    2017-01-01

    DNA sequencing approaches originally developed in two directions, the chemical degradation method and the chain-termination method. The latter one became more widespread and a huge amount of sequencing data including whole genome sequences accumulated, based on the use of capillary sequencer systems and the application of a modified chain-termination method which proved to be relatively easy, fast, and reliable. In addition, relatively long, up to 1000 bp sequences could be obtained with a single read with high per-base accuracy. Although the recent appearance of next-generation DNA sequencing (NGS) technologies enabled high-throughput and low cost analysis of DNA, the modified chain-terminating methods are often applied in research until now. In the following, we shall present the application of capillary sequencing for the sequence characterization of viral genomes in case of partial and whole genome sequencing, and demonstrate it on the BARF1 promoter of Epstein Barr virus (EBV).

  1. Isolation and identification of a novel tandemly repeated DNA sequence in the centromeric region of human chromosome 8.

    PubMed

    Lin, C C; Sasi, R; Lee, C; Fan, Y S; Court, D

    1993-05-01

    EcoRI subclones, designated as 50E1 and 50E4, were independently obtained from a cosmid clone previously mapped to the centromeric region of human chromosome 8. Southern blot hybridization analyses suggested that both subclones contain repetitive DNA sequences different from the chromosome 8 specific alphoid DNA. DNA sequence analysis of the 704 bp insert of 50E1 and the 1,962 bp insert of 50E4 revealed that both inserts contained tandemly repeated units of approximately 220 bp. Fluorescence in situ hybridization studies confirmed these two subclones to be specifically located on the centromeric region of chromosome 8. A 220 bp consensus sequence, derived from nine monomeric repeats, showed no significant homology to alphoid consensus sequences or to other currently known human centromeric DNA sequence. Furthermore, no significant homology was found with any other DNA sequence deposited in the EMBL or GenBank databases, indicating that this chromosome 8 specific repetitive DNA sequence is novel. From slot blot experiments it was estimated that 0.013% of the human genome comprises 1,750 of these monomeric repeats, residing on the centromeric region of chromosome 8 in tandem array(s).

  2. Sequence analysis of the mitochondrial DNA control region of ciscoes (genus Coregonus): taxonomic implications for the Great Lakes species flock.

    PubMed

    Reed, K M; Dorschner, M O; Todd, T N; Phillips, R B

    1998-09-01

    Sequence variation in the control region (D-loop) of the mitochondrial DNA (mtDNA) was examined to assess the genetic distinctiveness of the shortjaw cisco (Coregonus zenithicus). Individuals from within the Great Lakes Basin as well as inland lakes outside the basin were sampled. DNA fragments containing the entire D-loop were amplified by PCR from specimens of C. zenithicus and the related species C. artedi, C. hoyi, C. kiyi, and C. clupeaformis. DNA sequence analysis revealed high similarity within and among species and shared polymorphism for length variants. Based on this analysis, the shortjaw cisco is not genetically distinct from other cisco species.

  3. Population Genetic Analysis of Lobelia rhynchopetalum Hemsl. (Campanulaceae) Using DNA Sequences from ITS and Eight Chloroplast DNA Regions

    PubMed Central

    Geleta, Mulatu; Bryngelsson, Tomas

    2012-01-01

    DNA sequence data from the internal transcribed spacer of nuclear ribosomal DNA and eight chloroplast DNA regions were used to investigate haplotypic variation and population genetic structure of the Afroalpine giant lobelia, Lobelia rhynchopetalum. The study was based on eight populations sampled from two mountain systems in Ethiopia. A total of 20 variable sites were obtained, which resulted in 13 unique haplotypes and an overall nucleotide diversity (ND) of 0.281 ± 0.15 and gene diversity (GD) of 0.85 ± 0.04. Analysis of molecular variance (AMOVA) revealed a highly significant variation (P < 0.001) among populations (FST), and phylogenetic analysis revealed that populations from the two mountain systems formed their own distinct clade with >90% bootstrap support. Each population should be regarded as a significant unit for conservation of this species. The primers designed for this study can be applied to any Lobelia and other closely related species for population genetics and phylogenetic studies. PMID:22272170

  4. Molecular phylogenetic analysis of Indonesia Solanaceae based on DNA sequences of internal transcribed spacer region

    NASA Astrophysics Data System (ADS)

    Hidayat, Topik; Priyandoko, Didik; Islami, Dina Karina; Wardiny, Putri Yunitha

    2016-02-01

    Solanaceae is one of largest family in Angiosperm group with highly diverse in morphological character. In Indonesia, this group of plant is very popular due to its usefulness as food, ornamental and medicinal plants. However, investigation on phylogenetic relationship among the member of this family in Indonesia remains less attention. The purpose of this study was to evaluate the phylogenetics relationship of the family especially distributed in Indonesia. DNA sequences of Internal Transcribed Spacer (ITS) region of 19 species of Solanaceae and three species of outgroup, which belongs to family Convolvulaceae, Apocynaceae, and Plantaginaceae, were isolated, amplified, and sequenced. Phylogenetic tree analysis based on parsimony method was conducted with using data derived from the ITS-1, 5.8S, and ITS-2, separately, and the combination of all. Results indicated that the phylogenetic tree derived from the combined data established better pattern of relationship than separate data. Thus, three major groups were revealed. Group 1 consists of tribe Datureae, Cestreae, and Petunieae, whereas group 2 is member of tribe Physaleae. Group 3 belongs to tribe Solaneae. The use of the ITS region as a molecular markers, in general, support the global Solanaceae relationship that has been previously reported.

  5. In search of coding and non-coding regions of DNA sequences based on balanced estimation of diffusion entropy.

    PubMed

    Zhang, Jin; Zhang, Wenqing; Yang, Huijie

    2016-01-01

    Identification of coding regions in DNA sequences remains challenging. Various methods have been proposed, but these are limited by species-dependence and the need for adequate training sets. The elements in DNA coding regions are known to be distributed in a quasi-random way, while those in non-coding regions have typical similar structures. For short sequences, these statistical characteristics cannot be extracted correctly and cannot even be detected. This paper introduces a new way to solve the problem: balanced estimation of diffusion entropy (BEDE).

  6. Phylogenetic relationships in subfamily Tillandsioideae (Bromeliaceae) based on DNA sequence data from seven plastid regions.

    PubMed

    Barfuss, Michael H J; Samuel, Rosabelle; Till, Walter; Stuessy, Tod F

    2005-02-01

    Molecular phylogenetic studies of seven plastid DNA regions were used to resolve circumscriptions at generic and infrageneric levels in subfamily Tillandsioideae of Bromeliaceae. One hundred and ten tillandsioid samples were analyzed, encompassing 10 genera, 104 species, and two cultivars. Two species of Bromelioideae, eight species of the polymorphic Pitcairnioideae, and two species of Rapateaceae were selected as outgroups. Parsimony analysis was based on sequence variation of five noncoding (partial 5' and 3' trnK intron, rps16 intron, trnL intron, trnL-trnF intergenic spacer, atpB-rbcL intergenic spacer) and two coding plastid regions (rbcL and matK). Phylogenetic analyses of individual regions produced congruent, but mostly weakly supported or unresolved clades. Results of the combined data set, however, clearly show that subfamily Tillandsioideae is monophyletic. The earliest divergence separates a lineage comprised of Glomeropitcairnia and Catopsis from the "core" tillandsioids. In their present circumscriptions, genera Vriesea and Tillandsia, and their subgenera or sections, as well as Guzmania and Mezobromelia, are poly- and/or paraphyletic. Genera Alcantarea, Werauhia, Racinaea, and Viridantha appear monophyletic, but separation of these from Vriesea and Tillandsia makes the remainder paraphyletic. Nevertheless, Tillandsioideae separates into four main clades, which are proposed as tribes, viz., Catopsideae, Glomeropitcairnieae, Vrieseeae, and Tillandsieae.

  7. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E

    1986-01-01

    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  8. Nucleotide sequence of the transforming early region E1b of adenovirus type 12 DNA: structure and gene organization, and comparison with those of adenovirus type 5 DNA.

    PubMed Central

    Kimura, T; Sawada, Y; Shinawawa, M; Shimizu, Y; Shiroki, K; Shimojo, H; Sugisaki, H; Takanami, M; Uemizu, Y; Fujinaga, K

    1981-01-01

    The nucleotide sequence of the entire transforming early region of E1b of the highly oncogenic adenovirus type 12 (Ad12) DNA has been determined. The total sequence (3860 base pairs) encompasses the entire transforming early region E1 of Ad12 DNA. From the sequence for the E1b region of Ad12, and the transcription map of the E1b region (1, 2, 3, and this paper) the structure and gene organization of the early region E1b of Ad12 DNA were analyzed and compared with those of the E1b region in the non-oncogenic Ad5 DNA (4, 5). Most of the sequences in the E1b region of Ad12 was highly homologous to that of Ad5. It is predicted that the Ad12 region E1b codes for polypeptides of 53.9, 19.1, and 8.9 kd. This situation is identical with that of the Ad5 region E1b which codes for polypeptides of 54.9, 20.6, and 8.3 kd. The function of these predicted polypeptides encoded by the E1b regions in cell transformation is discussed. PMID:6275367

  9. Interpretation guidelines of mtDNA control region sequence electropherograms in forensic genetics.

    PubMed

    Marquez, Manuel Crespillo

    2012-01-01

    Forensic mitochondrial DNA (mtDNA) analysis is a complementary technique to forensic nuclear DNA (nDNA) and trace evidence analysis. Its use has been accepted by the vast majority of courts of law around the world. However for the forensic community it is crucial to employ standardized methods and procedures to guaranty the quality of the results obtained in court. In this chapter, we describe the most important aspects regarding the interpretation and assessment of mtDNA analysis, and offer a simple guide which places particular emphasis on those aspects that can impact the final interpretation of the results. These include the criteria for authenticating a sequence excluding the contaminant origin, defining the quality of a sequence, editing procedure, alignment criteria for searching the databases, and the statistical evaluation of matches. It is not easy to establish a single guide to interpretation for mtDNA analysis; however, it is important to understand all variables that may in some way affect the final conclusion in the context of a forensic case. As a general rule, laboratories should be cautious before issuing the final conclusion of an mtDNA analysis, and consider any significant limitations regarding current understanding of specific aspects of the mtDNA molecule.

  10. Characterization and Sequence Variation in the rDNA Region of Six Nematode Species of the Genus Longidorus (Nematoda)

    PubMed Central

    De Luca, F.; Reyes, A.; Grunder, J.; Kunz, P.; Agostinelli, A.; De Giorgi, C.; Lamberti, F.

    2004-01-01

    Total DNA was isolated from individual nematodes of the species Longidorus helveticus, L. macrosoma, L. arthensis, L. profundorum, L. elongatus, and L. raskii collected in Switzerland. The ITS region and D1-D2 expansion segments of the 26S rDNA were amplified and cloned. The sequences obtained were aligned in order to investigate sequence diversity and to infer the phylogenetic relationships among the six Longidorus species. D1-D2 sequences were more conserved than the ITS sequences that varied widely in primary structure and length, and no consensus was observed. Phylogenetic analyses using the neighbor-joining, maximum parsimony and maximum likelihood methods were performed with three different sequence data sets: ITS1-ITS2, 5.8S-D1-D2, and combining ITS1-ITS2+5.8S-D1-D2 sequences. All multiple alignments yielded similar basic trees supporting the existence of the six species established using morphological characters. These sequence data also provided evidence that the different regions of the rDNA are characterized by different evolution rates and by different factors associated with the generation of extreme size variation. PMID:19262800

  11. DNA sequencing conference, 2

    SciTech Connect

    Cook-Deegan, R.M.; Venter, J.C.; Gilbert, W.; Mulligan, J.; Mansfield, B.K.

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  12. Sequence-specific binding of glucocorticoid receptor to MTV DNA at sites within and upstream of the transcribed region.

    PubMed

    Payvar, F; DeFranco, D; Firestone, G L; Edgar, B; Wrange, O; Okret, S; Gustafsson, J A; Yamamoto, K R

    1983-12-01

    Glucocorticoid receptor protein stimulates transcription initiation within murine mammary tumor virus (MTV) DNA sequences in vivo, and interacts selectively with MTV DNA in vitro. We mapped and compared five regions of MTV DNA that are bound specifically by purified receptor; one resides upstream of the transcription start site, and the others are distributed within transcribed sequences between 4 and 8 kb from the initiation site. Each region contains at least two strong binding sites for receptor, which itself appears to be a tetramer of 94,000 dalton hormone-binding subunits. Three of the five binding regions contain nine nuclease footprints that lack extensive homology, although a family of related octanucleotides can be discerned. Receptor interacts with the different regions with similar efficiencies, suggesting that receptor affinity for upstream and internal regions may differ by less than one order of magnitude. Moreover, each region appears to be bound independent of the others. A restriction fragment containing four footprint sequences from one of the regions has previously been shown to act in vivo as a receptor-dependent transcriptional enhancer element, implying that the binding sites detected in vitro may be biologically functional.

  13. Sequence analysis of the mitochondrial DNA control region of ciscoes (genus Coregonus): Taxonomic implications for the Great Lakes species flock

    USGS Publications Warehouse

    Reed, Kent M.; Dorschner, Michael O.; Todd, Thomas N.; Phillips, Ruth B.

    1998-01-01

    Sequence variation in the control region (D-loop) of the mitochondrial DNA (mtDNA) was examined to assess the genetic distinctiveness of the shortjaw cisco (Coregonus zenithicus). Individuals from within the Great Lakes Basin as well as inland lakes outside the basin were sampled. DNA fragments containing the entire D-loop were amplified by PCR from specimens ofC. zenithicus and the related species C. artedi, C. hoyi, C. kiyi, and C. clupeaformis. DNA sequence analysis revealed high similarity within and among species and shared polymorphism for length variants. Based on this analysis, the shortjaw cisco is not genetically distinct from other cisco species.

  14. Chromosome specific repetitive DNA sequences

    DOEpatents

    Moyzis, Robert K.; Meyne, Julianne

    1991-01-01

    A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

  15. Automated DNA Sequencing System

    SciTech Connect

    Armstrong, G.A.; Ekkebus, C.P.; Hauser, L.J.; Kress, R.L.; Mural, R.J.

    1999-04-25

    Oak Ridge National Laboratory (ORNL) is developing a core DNA sequencing facility to support biological research endeavors at ORNL and to conduct basic sequencing automation research. This facility is novel because its development is based on existing standard biology laboratory equipment; thus, the development process is of interest to the many small laboratories trying to use automation to control costs and increase throughput. Before automation, biology Laboratory personnel purified DNA, completed cycle sequencing, and prepared 96-well sample plates with commercially available hardware designed specifically for each step in the process. Following purification and thermal cycling, an automated sequencing machine was used for the sequencing. A technician handled all movement of the 96-well sample plates between machines. To automate the process, ORNL is adding a CRS Robotics A- 465 arm, ABI 377 sequencing machine, automated centrifuge, automated refrigerator, and possibly an automated SpeedVac. The entire system will be integrated with one central controller that will direct each machine and the robot. The goal of this system is to completely automate the sequencing procedure from bacterial cell samples through ready-to-be-sequenced DNA and ultimately to completed sequence. The system will be flexible and will accommodate different chemistries than existing automated sequencing lines. The system will be expanded in the future to include colony picking and/or actual sequencing. This discrete event, DNA sequencing system will demonstrate that smaller sequencing labs can achieve cost-effective the laboratory grow.

  16. Polymorphism in the bovine BOLA-DRB3 upstream regulatory regions detected through PCR-SSCP and DNA sequencing.

    PubMed

    Ripoli, M V; Peral-García, P; Dulout, F N; Giovambattista, G

    2004-09-15

    In the present work, we describe through polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing the polymorphism within the URR-BoLA-DRB3 in 15 cattle breeds. In total, seven PCR-SSCP defined alleles were detected. The alignment of studied sequences showed six polymorphic sites (four transitions, one transversion and one deletion) in the interconsensus regions of the BoLA-DRB3 upstream regulatory region (URR), while the consensus boxes were invariant. Five out of six detected polymorphic sites were of one nucleotide substitution in the interconsensus regions. It is expected that these mutations do not affect significantly the level of expression. In contrast, the deletion observed in the sequence between CCAAT and TATA boxes could have some effect on affinity interactions between the promoter region and the transcription factors. The URR-BoLA-DRB3 DNA analyzed sequences showed moderate level of nucleotide diversity, high level of identity among them and were grouped in the same clade in the phylogenetic tree. In addition, the phylogenetic tree, the similarity analysis and the sequence structure confirmed that the fragment analyzed in this study corresponds to the URR-BoLA-DRB3. The functional role of the observed polymorphic sites among the regulatory motifs in bovine needs to be analyzed and confirmed by means of gene expression assays.

  17. The 5'-flanking regions of three pea legumin genes: comparison of the DNA sequences.

    PubMed Central

    Lycett, G W; Croy, R R; Shirsat, A H; Richards, D M; Boulter, D

    1985-01-01

    Approximately 1200 nucleotides of sequence data from the promoter and 5'-flanking regions of each of three pea (Pisum sativum L.) legumin genes (legA, legB and legC) are presented. The promoter regions of all three genes were found to be identical including the "TATA box", and "CAAT box', and sequences showing homology to the SV40 enhancers. The legA sequence begins to diverge from the others about 300bp from the start codon, whereas the other two genes remain identical for another 550bp. The regions of partial homology exhibit deletions or insertions and some short, comparatively well conserved sequences. The significance of these features is discussed in terms of evolutionary mechanisms and their possible functional roles. The legC gene contains a region that may potentially form either of two mutually exclusive stem-loop structures, one of which has a stem 42bp long, which suggests that it could be fairly stable. We suggest that a mechanism of switching between such alternative structures may play some role in gene control or may represent the insertion of a transposable element. PMID:2997721

  18. Repetitive sequences in the ITS1 region of the ribosomal DNA of Tunga penetrans and other flea species (Insecta, Siphonaptera).

    PubMed

    Gamerschlag, Sara; Mehlhorn, Heinz; Heukelbach, Jörg; Feldmeier, Hermann; D'Haese, Jochen

    2008-01-01

    Different Tunga penetrans isolates from various hosts obtained from South America (Fortaleza. Brazil) have been studied by nucleotide sequence comparison of the first and the second internal transcribed spacer (ITS1, ITS2) of the ribosomal deoxyribonucleic acid (rDNA) and part of the mitochondrial 16S rDNA. Results show no significant host-dependent sequence differences. No indication for intraindividual and intraspecific polymorphisms could be detected. Comparing the ITS1 spacer region of T. penetrans from South America with that from Africa (Togo, Cameroon), distinct length variations have been observed caused by a repetitive sequence motif of 99 bp. The ITS1 from the South American T. penetrans contain two tandemly repeated copies, whereas four of these units are present in the spacer of the African T. penetrans. The absence of homogenization of these units indicates a recent separation of both populations. However, the different number of repetitions together with two base substitutions put the evolutionary distance of only 135 years as postulated for the transfer of T. penetrans from South America to Africa into question. Repetitive sequences could also be detected within the ITS1 rDNA region of other flea species Ctenocephalides felis, Echidnophaga gallinacea, Pulex irritans, Spilopsyllus cuniculi, and Xenopsylla cheopis. The repeat units with lengths from 10 to 99 bp are arranged in pure tandem or interspersed. The repetitive elements observed in the ITS1 of various flea species may serve as a valuable tool for phylogeographic studies.

  19. Associations between sequence variations in the mitochondrial DNA D-loop region and outcome of hepatocellular carcinoma

    PubMed Central

    LI, SHILAI; WAN, PEIQI; PENG, TAO; XIAO, KAIYIN; SU, MING; SHANG, LIMING; XU, BANGHAO; SU, ZHIXIONG; YE, XINPING; PENG, NING; QIN, QUANLIN; LI, LEQUN

    2016-01-01

    The association between mitochondrial DNA (mtDNA) polymorphisms or mutations and the prognoses of cancer have been investigated previously, but the results have been ambiguous. In the present study, the associations between sequence variations in the mtDNA D-loop region and the outcomes of patients with hepatocellular carcinoma (HCC) were analysed. A total of 140 patients with HCC (123 males and 17 females), who were hospitalised to undergo radical resection, were studied. Polymerase chain reaction and direct sequencing were performed to detect the sequence variations in the mtDNA D-loop region. Multivariate and univariate analyses were conducted to determine important factors in the prognosis of HCC. A total of 150 point sequence variations were observed in the 140 cases (13 point mutations, 8 insertions, 20 deletions and 116 polymorphisms). The variation rate was 13.4% (150/1, 122). mtDNA nucleotide 150 (C/T) was an independent factor in the logistic regression for early/late recurrence of HCC. Patients with 150T appeared to have later recurrences. In a Cox proportional hazards regression model, hepatitis B virus DNA, Child-Pugh class, differentiation degree, tumour-node-metastasis (TNM) stage, nucleotide 16263 (T/C) and nucleotide 315 (N/insertion C) were independent factors for tumour-free survival time. Patients with the 16263T allele had a greater tumour-free survival time than patients with the 16263C allele. Similarly, patients with 315 insertion C had a superior tumour-free survival time when compared with patients with 315 N (normal). In the Cox proportional hazards regression model, recurrence type (early/late), Child-Pugh class, TNM stage and adjuvant treatment after tumour recurrence (none or one/more than one treatment) were independent factors for overall survival. None of the mtDNA variations served as independent factors. Patients with late recurrence, Child-Pugh class A, and low TNM stages and/or those who received more than one adjuvant treatment

  20. DNA Sequencing apparatus

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1992-01-01

    An automated DNA sequencing apparatus having a reactor for providing at least two series of DNA products formed from a single primer and a DNA strand, each DNA product of a series differing in molecular weight and having a chain terminating agent at one end; separating means for separating the DNA products to form a series bands, the intensity of substantially all nearby bands in a different series being different, band reading means for determining the position an This invention was made with government support including a grant from the U.S. Public Health Service, contract number AI-06045. The U.S. government has certain rights in the invention.

  1. Tumorigenic poxviruses: genomic organization and DNA sequence of the telomeric region of the Shope fibroma virus genome.

    PubMed

    Upton, C; DeLange, A M; McFadden, G

    1987-09-01

    Shope fibroma virus (SFV), a tumorigenic poxvirus, has a 160-kb linear double-stranded DNA genome and possesses terminal inverted repeats (TIRs) of 12.4 kb. The DNA sequence of the terminal 5.5 kb of the viral genome is presented and together with previously published sequences completes the entire sequence of the SFV TIR. The terminal 400-bp region contains no major open reading frames (ORFs) but does possess five related imperfect palindromes. The remaining 5.1 kb of the sequence contains seven tightly clustered and tandemly oriented ORFs, four larger than 100 amino acids in length (T1, T2, T4, and T5) and three smaller ORFs (T3A, T3B, and T3C). All are transcribed toward the viral hairpin and almost all possess the consensus sequence TTTTTNT near their 3' ends which has been implicated for the transcription termination of vaccinia virus early genes. Searches of the published DNA database revealed no sequences with significant homology with this region of the SFV genome but when the protein database was searched with the translation products of ORFs T1-T5 it was found that the N-terminus of the putative T4 polypeptide is closely related to the signal sequence of the hemagglutinin precursor from influenza A virus, suggesting that the T4 polypeptide may be secreted from SFV-infected cells. Examination of other SFV ORFs shows that T1 and T2 also possess signal-like hydrophobic amino acid stretches close to their N-termini. The protein database search also revealed that the putative T2 protein has significant homology to the insulin family of polypeptides. In terms of sequence repetitions, seven tandemly repeated copies of the hexanucleotide ATTGTT and three flanking regions of dyad symmetry were detected, all in ORF T3C. A search for palindromic sequences also revealed two clusters, one in ORF T3A/B and a second in ORF T2. ORF T2 harbors five short sequence domains, each of which consists of a 6-bp short palindrome and a 10- to 18-bp larger palindrome. The

  2. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

    1995-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  3. Allopolyploidy in Fragariinae (Rosaceae): comparing four DNA sequence regions, with comments on classification.

    PubMed

    Lundberg, Magnus; Töpel, Mats; Eriksen, Bente; Nylander, Johan A A; Eriksson, Torsten

    2009-05-01

    Potential events of allopolyploidy may be indicated by incongruences between separate phylogenies based on plastid and nuclear gene sequences. We sequenced two plastid regions and two nuclear ribosomal regions for 34 ingroup taxa in Fragariinae (Rosaceae), and six outgroup taxa. We found five well supported incongruences that might indicate allopolyploidy events. The incongruences involved Aphanes arvensis, Potentilla miyabei, Potentilla cuneata, Fragaria vesca/moschata, and the Drymocallis clade. We evaluated the strength of conflict and conclude that allopolyploidy may be hypothesised in the four first cases. Phylogenies were estimated using Bayesian inference and analyses were evaluated using convergence diagnostics. Taxonomic implications are discussed for genera such as Alchemilla, Sibbaldianthe, Chamaerhodos, Drymocallis and Fragaria, and for the monospecific Sibbaldiopsis and Potaninia that are nested inside other genera. Two orphan Potentilla species, P. miyabei and P. cuneata are placed in Fragariinae. However, due to unresolved topological incongruences they are not reclassified in any genus.

  4. Electrophoretic analysis of sequence variability in three mitochondrial DNA regions for ascaridoid parasites of human and animal health significance.

    PubMed

    Li, Ming-Wei; Lin, Rui-Qing; Song, Hui-Qun; Sani, Rehana A; Wu, Xiang-Yun; Zhu, Xing-Quan

    2008-07-01

    Sequence variability in three mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunits 1 and 4 (nad1 and nad4), among and within Toxocara canis, T. cati, T. malaysiensis, T. vitulorum and Toxascaris leonina from different geographical origins was examined by a mutation-scanning approach. A portion of the cox1 gene (pcox1), a portion of the nad1 and nad4 genes (pnad1 and pnad4) were amplified separately from individual ascaridoid nematodes by polymerase chain reaction and the amplicons analyzed by single-strand conformation polymorphism (SSCP). Representative samples displaying sequence variation in SSCP profiles were subjected to sequencing in order to define genetic markers for their specific identification and differentiation. While the intra-specific sequence variations within each of the five ascaridoid species were 0.2-3.7% for pcox1, 0-2.8% for pnad1 and 0-2.3% for pnad4, the inter-specific sequence differences were significantly higher, being 7.9-12.9% for pcox1, 10.7-21.1% for pnad1 and 12.9-21.7% for pnad4, respectively. Phylogenetic analyses based on the combined sequences of pcox1, pnad1 and pnad4 revealed that the recently described species T. malaysiensis was more closely related to T. cati than to T. canis. These findings provided mtDNA evidence for the validity of T. malaysiensis and also demonstrated clearly the usefulness and attributes of the mutation-scanning sequencing approach for studying the population genetic structures of these and other nematodes of socio-economic importance.

  5. Heavy metal induced DNA changes in aquatic macrophytes: Random amplified polymorphic DNA analysis and identification of sequence characterized amplified region marker.

    PubMed

    Gupta, Meetu; Sarin, Neera Bhalla

    2009-01-01

    Plants have been used as good bio-indicators and genetic toxicity of environmental pollution in recent years. In this study, aquatic plants Hydrilla verticillata and Ceratophyllum demersum treated with 10 micromol/L Cd, 5 micromol/L Hg, and 20 micromol/L Cu for 96 h, showed changes in chlorophyll, protein content, and in DNA profiles. The changes in DNA profiles included variation in band intensity, presence or absence of certain bands and even appearance of new bands. Genomic template stability test performed for the qualitative measurement of changes in randomly amplified polymorphic DNA (RAPD) profiles, showed significant effect at the given concentration of metals. Cloning and sequencing of bands suggested that these markers although may not be homologous to any known gene but its conversion as a sequence characterized amplified region (SCAR) marke is useful in detecting the effects of genotoxin agents.

  6. Molecular typing of isolates of Rickettsia rickettsii by use of DNA sequencing of variable intergenic regions.

    PubMed

    Karpathy, Sandor E; Dasch, Gregory A; Eremeeva, Marina E

    2007-08-01

    Rickettsia rickettsii, the causative agent of Rocky Mountain spotted fever, is found throughout the Americas, where it is associated with different animal reservoirs and tick vectors. No molecular typing system currently exists to allow for the robust differentiation of isolates of R. rickettsii. Analysis of eight completed genome sequences of rickettsial species revealed a high degree of sequence conservation within the coding regions of chromosomes in the genus. Intergenic regions between coding sequences should be under less selective pressure to maintain this conservation and thus should exhibit greater nucleotide polymorphisms. Utilizing these polymorphisms, we developed a molecular typing system that allows for the genetic differentiation of isolates of R. rickettsii. This typing system was applied to a collection of 38 different isolates collected from humans, animals, and tick vectors from different geographic locations. Serotypes 364D, from Dermacentor occidentalis ticks, and Hlp, from Haemaphysalis leporispalustris ticks, appear to be distinct genotypes that may not belong to the species R. rickettsii. We were also able to differentiate 36 historical isolates of R. rickettsii into three different phylogenetic clades containing seven different genotypes. This differentiation correlated well, but not perfectly, with the geographic origin and likely tick vectors associated with the isolates. The few apparent typing discrepancies found suggest that the molecular ecology of R. rickettsii needs more investigation.

  7. Phylogeny and Biogeography of Cedrus (Pinaceae) Inferred from Sequences of Seven Paternal Chloroplast and Maternal Mitochondrial DNA Regions

    PubMed Central

    Qiao, Cai-Yuan; Ran, Jin-Hua; Li, Yan; Wang, Xiao-Quan

    2007-01-01

    Background and Aims Cedrus (true cedars) is a very important horticultural plant group. It has a disjunct distribution in the Mediterranean region and western Himalaya. Its evolution and biogeography are of great interest to botanists. This study aims to investigate the phylogeny and biogeography of Cedrus based on sequence analyses of seven cytoplasmic DNA fragments. Methods The methods used were PCR amplification and sequencing of seven paternal cpDNA and maternal mtDNA fragments, parsimony and maximum likelihood analyses of the DNA dataset, and molecular clock estimate of divergence times of Cedrus species. Key Results Phylogenies of Cedrus constructed from cpDNA, mtDNA and the combined cp- and mt-DNA dataset are identical in topology. It was found that the Himalayan cedar C. deodara diverged first, and then the North African species C. atlantica separated from the common ancestor of C. libani and C. brevifolia, two species from the eastern Mediterranean area. Molecular clock estimates suggest that the divergence between C. atlantica and the eastern Mediterranean clade at 23·49 ± 3·55 to 18·81 ± 1·25 Myr and the split between C. libani and C. brevifolia at 7·83 ± 2·79 to 6·56 ± 1·20 Myr. Conclusions The results, combined with palaeogeographical and palaeoecological information, indicate that Cedrus could have an origin in the high latitude area of Eurasia, and its present distribution might result from vicariance of southerly migrated populations during climatic oscillations in the Tertiary and further fragmentation and dispersal of these populations. It is very likely that Cedrus migrated into North Africa in the very late Tertiary, while its arrival in the Himalayas would not have been before the Miocene, after which the phased or fast uplift of the Tibetan plateau happened. PMID:17611189

  8. Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

    SciTech Connect

    Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

    1987-10-16

    Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.

  9. Minding the gap: Frequency of indels in mtDNA control region sequence data and influence on population genetic analyses

    USGS Publications Warehouse

    Pearce, J.M.

    2006-01-01

    Insertions and deletions (indels) result in sequences of various lengths when homologous gene regions are compared among individuals or species. Although indels are typically phylogenetically informative, occurrence and incorporation of these characters as gaps in intraspecific population genetic data sets are rarely discussed. Moreover, the impact of gaps on estimates of fixation indices, such as FST, has not been reviewed. Here, I summarize the occurrence and population genetic signal of indels among 60 published studies that involved alignments of multiple sequences from the mitochondrial DNA (mtDNA) control region of vertebrate taxa. Among 30 studies observing indels, an average of 12% of both variable and parsimony-informative sites were composed of these sites. There was no consistent trend between levels of population differentiation and the number of gap characters in a data block. Across all studies, the average influence on estimates of ??ST was small, explaining only an additional 1.8% of among population variance (range 0.0-8.0%). Studies most likely to observe an increase in ??ST with the inclusion of gap characters were those with < 20 variable sites, but a near equal number of studies with few variable sites did not show an increase. In contrast to studies at interspecific levels, the influence of indels for intraspecific population genetic analyses of control region DNA appears small, dependent upon total number of variable sites in the data block, and related to species-specific characteristics and the spatial distribution of mtDNA lineages that contain indels. ?? 2006 Blackwell Publishing Ltd.

  10. DNA sequences of the cysK regions of Salmonella typhimurium and Escherichia coli and linkage of the cysK regions to ptsH.

    PubMed Central

    Byrne, C R; Monroe, R S; Ward, K A; Kredich, N M

    1988-01-01

    Nucleotide sequences of the cysK regions of Salmonella typhimurium and Escherichia coli have been determined. A total of 3,812 and 2,595 nucleotides were sequenced from S. typhimurium and E. coli, respectively. Open reading frames of 323 codons were found in both species and were identified as those of cysK by comparison of deduced amino acid sequences with amino- and carboxyl-terminal amino acid analyses of the S. typhimurium cysK gene product O-acetylserine (thiol)-lyase A. The two cysK DNA sequences were 85% identical, and the deduced amino acid sequences were 96% identical. The major transcription initiation sites for cysK were found to be virtually identical in the two organisms, by using primer extension and S1 nuclease protection techniques. The -35 region corresponding to the major transcription start site was TTCCCC in S. typhimurium and TTCCGC in E. coli. The deviation of these sequences from the consensus sequence TTGACA may reflect the fact that cysK is subject to positive control and requires the cysB regulatory protein for expression. Sequences downstream of cysK were found to include ptsH and a portion of ptsI, thus establishing the exact relationship of cysK with these two genes. A 290-codon open reading frame, which may represent the cysZ gene, was identified upstream of cysK. Images PMID:3290198

  11. Transposon facilitated DNA sequencing

    SciTech Connect

    Berg, D.E.; Berg, C.M.; Huang, H.V.

    1990-01-01

    The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses, and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.

  12. Genetic identification of istiophorid larvae from the Gulf of Mexico based on the analysis of mitochondrial DNA control region sequences.

    PubMed

    McKenzie, J L; Alvarado Bremer, J R

    2017-03-01

    Assigning relative importance of spawning and nursery habitats for threatened and endangered teleosts, such as those seen in the Gulf of Mexico (GoM), relies on the proper identification of the early life-history stages of the species of concern. Here, sequencing a portion of the mitochondrial DNA (mtDNA) control region (CR) I as barcodes is recommended to identify istiophorid (billfish) larvae in the Atlantic Ocean because of its high resolution and the intrinsic value of the levels of genetic variation that can be extracted from these data. The universality of the primers employed here demonstrates their utility for not only the positive identification of istiophorids in the GoM, but for any larval teleost occurring in areas recognized as larval hotspots worldwide.

  13. Nucleotide sequences at the boundaries between gene and insertion regions in the rDNA of Drosophilia melanogaster.

    PubMed

    Dawid, I B; Rebbert, M L

    1981-10-10

    Ribosomal RNA genes interrupted by type 1 insertions of 1 kb and 0.5 kb have been sequenced through the insertion region and compared with an uninterrupted gene. The 0.5 kb insertion is flanked by a duplication of a 14 bp segment that is present once in the uninterrupted gene; the 1 kb insertion is flanked by a duplication of 11 of these 14 bp. Short insertions are identical in their entire length to downstream regions of long insertions. No internal repeats occur in the insertion. The presence of target site duplications suggests that type 1 insertions arose by the introduction of transposable elements into rDNA. Short sequence homologies between the upstream ends of the insertions and the 28S' boundaries of the rRNA coding region suggest that short type 1 insertions may have arisen by recombination from longer insertions. We have sequenced both boundaries of two molecules containing type 2 insertions and the upstream boundary of a third; the points of interruption at the upstream boundary (28S' site) differ from each other in steps of 2 bp. Between the boundary in the 0.5 kb type 1 insertion and the type 2 boundaries there are distances of 74, 76, and 78 bp. At the downstream boundary (28S'' site) the two sequenced type 2 insertions are identical. The rRNA coding region of one molecule extends across the insertion without deletion or duplication, but a 2 bp deletion in the RNA coding region is present in the second molecule. Stretches of 13 or 22 adenine residues occur at the downstream (28S'') end of the two type 2 insertions.

  14. Comparison of mitochondrial DNA control region sequence and microsatellite DNA analyses in estimating population structure and gene flow rates in Atlantic sturgeon Acipenser oxyrinchus

    USGS Publications Warehouse

    Wirgin, I.; Waldman, J.; Stabile, J.; Lubinski, B.; King, T.

    2002-01-01

    Atlantic sturgeon Acipenser oxyrinchus is large, long-lived, and anadromous with subspecies distributed along the Atlantic (A. oxyrinchus oxyrinchus) and Gulf of Mexico (A. o. desotoi) coasts of North America. Although it is not certain if extirpation of some population units has occurred, because of anthropogenic influences abundances of all populations are low compared with historical levels. Informed management of A. oxyrinchus demands a detailed knowledge of its population structure, levels of genetic diversity, and likelihood to home to natal rivers. We compared the use of mitochondrial DNA (mtDNA) control region sequence and microsatellite nuclear DNA (nDNA) analyses in identifying the stock structure and homing fidelity of Atlantic and Gulf coast populations of A. oxyrinchus. The approaches were concordant in that they revealed moderate to high levels of genetic diversity and suggested that populations of Atlantic sturgeon are highly structured. At least six genetically distinct management units were detected using the two approaches among the rivers surveyed. Mitochondrial DNA sequences revealed a significant cline in haplotype diversity along the Atlantic coast with monomorphism observed in Canadian populations. High levels of nDNA diversity were also observed among populations along the Atlantic coast, including the two Canadian populations, probably resulting from the more rapid rate of mutational and evolutionary change at microsatellite loci. Estimates of gene flow among populations were similar between both approaches with the exception that because of mtDNA monomorphism in Canadian populations, gene flow estimates between them were unobtainable. Analyses of both genomes provided high resolution and confidence in characterizing the population structure of Atlantic sturgeon. Microsatellite analysis was particularly informative in delineating population structure in rivers that were recently glaciated and may prove diagnostic in rivers that are

  15. DNA sequences encoding osteoinductive products

    SciTech Connect

    Wang, E.A.; Wozney, J.M.; Rosen, V.

    1991-05-07

    This patent describes an isolated DNA sequence encoding an osteoinductive protein the DNA sequence comprising a coding sequence. It comprises: nucleotide No.1 through nucleotide No.387, nucleotide No.356 through nucleotide No.1543, nucleotide $402 through nucleotide No.1626, naturally occurring allelic sequences and equivalent degenerative codon sequences and sequences which hybridize to any of sequences under stringent hybridization conditions; and encode a protein characterized by the ability to induce the formation of bone and/or cartilage.

  16. Rice pseudomolecule-anchored cross-species DNA sequence alignments indicate regional genomic variation in expressed sequence conservation

    PubMed Central

    Armstead, Ian; Huang, Lin; King, Julie; Ougham, Helen; Thomas, Howard; King, Ian

    2007-01-01

    Background Various methods have been developed to explore inter-genomic relationships among plant species. Here, we present a sequence similarity analysis based upon comparison of transcript-assembly and methylation-filtered databases from five plant species and physically anchored rice coding sequences. Results A comparison of the frequency of sequence alignments, determined by MegaBLAST, between rice coding sequences in TIGR pseudomolecules and annotations vs 4.0 and comprehensive transcript-assembly and methylation-filtered databases from Lolium perenne (ryegrass), Zea mays (maize), Hordeum vulgare (barley), Glycine max (soybean) and Arabidopsis thaliana (thale cress) was undertaken. Each rice pseudomolecule was divided into 10 segments, each containing 10% of the functionally annotated, expressed genes. This indicated a correlation between relative segment position in the rice genome and numbers of alignments with all the queried monocot and dicot plant databases. Colour-coded moving windows of 100 functionally annotated, expressed genes along each pseudomolecule were used to generate 'heat-maps'. These revealed consistent intra- and inter-pseudomolecule variation in the relative concentrations of significant alignments with the tested plant databases. Analysis of the annotations and derived putative expression patterns of rice genes from 'hot-spots' and 'cold-spots' within the heat maps indicated possible functional differences. A similar comparison relating to ancestral duplications of the rice genome indicated that duplications were often associated with 'hot-spots'. Conclusion Physical positions of expressed genes in the rice genome are correlated with the degree of conservation of similar sequences in the transcriptomes of other plant species. This relative conservation is associated with the distribution of different sized gene families and segmentally duplicated loci and may have functional and evolutionary implications. PMID:17708759

  17. Dynamics and phylogenetic implications of MtDNA control region sequences in New World Jays (Aves: Corvidae).

    PubMed

    Saunders, M A; Edwards, S V

    2000-08-01

    To study the evolution of mtDNA and the intergeneric relationships of New World Jays (Aves: Corvidae), we sequenced the entire mitochondrial DNA control region (CR) from 21 species representing all genera of New World jays, an Old World jay, crows, and a magpie. Using maximum likelihood methods, we found that both the transition/transversion ratio (kappa) and among site rate variation (alpha) were higher in flanking domains I and II than in the conserved central domain and that the frequency of indels was highest in domain II. Estimates of kappa and alpha were much more influenced by the density of taxon sampling than by alternative optimal tree topologies. We implemented a successive approximation method incorporating these parameters into phylogenetic analysis. In addition we compared our study in detail to a previous study using cytochrome b and morphology to examine the effect of taxon sampling, evolutionary rates of genes, and combined data on tree resolution. We found that the particular weighting scheme used had no effect on tree topology and little effect on tree robustness. Taxon sampling had a significant effect on tree robustness but little effect on the topology of the best tree. The CR data set differed nonsignificantly from the tree derived from the cytochrome b/morphological data set primarily in the placement of the genus Gymnorhinus, which is near the base of the CR tree. However, contrary to conventional taxonomy, the CR data set suggested that blue and black jays (Cyanocorax sensu lato) might be paraphyletic and that the brown jay Psilorhinus (=Cyanocorax) morio is the sister group to magpie jays (Calocitta), a phylogenetic hypothesis that is likely as parsimonious with regard to nonmolecular characters as monophyly of Cyanocorax. The CR tree also suggests that the common ancestor of NWJs was likely a cooperative breeder. Consistent with recent systematic theory, our data suggest that DNA sequences with high substitution rates such as the CR may

  18. Sequence variation in two mitochondrial DNA regions and internal transcribed spacer among isolates of the nematode Oesophagostomum asperum originating from goats in Hunan Province, China.

    PubMed

    Li, F; Hu, T; Duan, N C; Li, W Y; Teng, Q; Li, H; Liu, W; Liu, Y; Cheng, T Y

    2016-01-01

    The present study examined sequence variability in two mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1) and NADH dehydrogenase subunit 1 (nad1), and internal transcribed spacer (ITS) of nuclear ribosomal DNA (rDNA) among Oesophagostomum asperum isolates from goats in Hunan Province, China. A portion of the cox1 (pcox1), nad1 (pnad1) genes and the ITS (ITS1+5.8S rDNA+ITS2) rDNA were amplified by polymerase chain reaction (PCR) separately from adult O. asperum individuals and the representative amplicons were subjected to sequencing from both directions. The lengths of pcox1, pnad1 and ITS rDNA were 366 bp, 681 bp and 785 bp, respectively. The A+T contents of gene sequences were 71.5-72% for pcox1, 73.7-74.2% for pnad1 and 58-58.8% for ITS rDNA. Intra-specific sequence variations within O. asperum were 0-1.6% for pcox1, 0-1.9% for pnad1 and 0-1.7% for ITS rDNA, while inter-specific sequence differences among members of the genus Oesophagostomum were significantly higher, being 11.1-12.5%, 13.3-17.7% and 8.5-18.6% for pcox1, pnad1 and ITS rDNA, respectively. Phylogenetic analyses using combined sequences of pcox1 and pnad1, with three different computational algorithms (Bayesian inference, maximum likelihood and maximum parsimony), revealed distinct groups with high statistical support. These findings demonstrated the existence of intra-specific variation in mtDNA and rDNA sequences among O. asperum isolates from goats in Hunan Province, China, and have implications for studying molecular epidemiology and population genetics of O. asperum.

  19. [Genetic variation of Manchurian pheasant (Phasianus colchicus pallasi Rotshild, 1903) inferred from mitochondrial DNA control region sequences].

    PubMed

    Kozyrenko, M M; Fisenko, P V; Zhuravlev, Iu N

    2009-04-01

    Sequence variation of the mitochondrial DNA control region was studied in Manchurian pheasants (Phasianus colchicus pallasi Rotshild, 1903) representing three geographic populations from the southern part of the Russian Far East. Extremely low population genetic differentiation (F(ST) = 0.0003) pointed to a very high gene exchange between the populations. Combination of such characters as high haplotype diversity (0.884 to 0.913), low nucleotide diversity (0.0016 to 0.0022), low R2 values (0.1235 to 0.1337), certain patterns of pairwise-difference distributions, and the absence of phylogenetic structure suggested that the phylogenetic history of Ph. C. pallasi included passing through a bottleneck with further expansion in the postglacial period. According to the data obtained, it was suggested that differentiation between the mitochondrial lineages started approximately 100 000 years ago.

  20. Nucleotide sequence of a Proteus mirabilis DNA fragment homologous to the 60K-rnpA-rpmH-dnaA-dnaN-recF-gyrB region of Escherichia coli.

    PubMed

    Skovgaard, O

    1990-09-01

    A 6.5-kb DNA fragment from Proteus mirabilis hybridized to the Escherichia coli dnaA gene. This DNA fragment was cloned and the nucleotide (nt) sequence determined. The fragment is homologous to a region of the E. coli chromosome containing a part of the gene encoding a 60-kDa membrane-associated protein (60K), the rnpA-rpmH-dnaA-dnaN-recF genes, and the N-terminal part of the gyrB gene. The degree of homology is variable: the amino-acid (aa) sequence of a part of the 60K protein and a part of the DnaA protein is only minimally conserved, whereas the C-terminal 148 aa of DnaA are identical in the two species. The conservation of the nt sequence between the rnpA gene and the gene encoding the 60K protein suggests that this region encodes a hitherto unrecognized protein. The ORF for this protein partially overlaps the 3' end of the rnpA structural gene, and the degree of conservation suggests that this gene is important for these bacteria.

  1. Plant DNA sequencing for phylogenetic analyses: from plants to sequences.

    PubMed

    Neves, Susana S; Forrest, Laura L

    2011-01-01

    DNA sequences are important sources of data for phylogenetic analysis. Nowadays, DNA sequencing is a routine technique in molecular biology laboratories. However, there are specific questions associated with project design and sequencing of plant samples for phylogenetic analysis, which may not be familiar to researchers starting in the field. This chapter gives an overview of methods and protocols involved in the sequencing of plant samples, including general recommendations on the selection of species/taxa and DNA regions to be sequenced, and field collection of plant samples. Protocols of plant sample preparation, DNA extraction, PCR and cloning, which are critical to the success of molecular phylogenetic projects, are described in detail. Common problems of sequencing (using the Sanger method) are also addressed. Possible applications of second-generation sequencing techniques in plant phylogenetics are briefly discussed. Finally, orientation on the preparation of sequence data for phylogenetic analyses and submission to public databases is also given.

  2. Rapid and direct detection of clostridium chauvoei by PCR of the 16S-23S rDNA spacer region and partial 23S rDNA sequences.

    PubMed

    Sasaki, Y; Yamamoto, K; Kojima, A; Tetsuka, Y; Norimatsu, M; Tamura, Y

    2000-12-01

    Clostridium chauvoei causes blackleg, which is difficult to distinguish from the causative clostridia of malignant edema. Therefore, a single-step PCR system was developed for specific detection of C. chauvoei DNA using primers derived from the 16S-23S rDNA spacer region and partial 23S rDNA sequences. The specificity of the single-step PCR system was demonstrated by testing 37 strains of clostridia and 3 strains of other genera. A 509 bp PCR product, which is a C. choauvoei-specific PCR product, could be amplified from all of the C. chauvoei strains tested, but not from the other strains. Moreover, this single-step PCR system specifically detected C. chauvoei DNA in samples of muscle from mice 24 hr after inoculation with 100 spores of C. chauvoei, and in clinical materials from a cow affected with blackleg. These results suggest that our single-step PCR system may be useful for direct detection of C. chauvoei in culture and in clinical materials from animals affected with blackleg.

  3. cDNA sequence, genomic organization, and evolutionary conservation of a novel gene from the WAGR region

    SciTech Connect

    Schwartz, F.; Eisenman, R.; Knoll, J.; Bruns, G.

    1995-09-20

    A new gene (239FB) with predominant and differential expression in fetal brain has recently been isolated from a chromosome 11p13-p14 boundary area near FSHB. The corresponding mRNA has an open reading frame of 294 amino acids, a 3` untranslated region of 1247 nucleotides, and a highly GC-rich 5` untranslated region. The coding and 3` UT sequence is specified by 6 exons within nearly 87 kb of isolated genomic locus. The 5` end region of the transcript maps adjacent to the only genomically defined CpG island in a chromosomal subregion that may be associated with part of the mental retardation of some WAGR (Wilms tumor, aniridia, genitourinary anomalies, and mental retardation) syndrome patients. In addition to nucleotide and amino acid similarity to an EST from a normalized infant brain cDNA library, the predicted protein has extensive similarity to Caenorhbditis elegans polypeptides of, as yet, unknown function. The 239FB locus is, therefore, likely part of a family of genes with two members expressed in human brain. The extensive conservation of the predicted protein suggests a fundamental function of the gene product and will enable evaluation of the role of the 239FB gene in neurogenesis in model organisms. 48 refs., 4 figs., 1 tab.

  4. Sox2 regulatory region 2 sequence works as a DNA nuclear targeting sequence enhancing the efficiency of an exogenous gene expression in ES cells.

    PubMed

    Funabashi, Hisakage; Takatsu, Makoto; Saito, Mikako; Matsuoka, Hideaki

    2010-10-01

    In this report, the effects of two DNA nuclear targeting sequence (DTS) candidates on the gene expression efficiency in ES cells were investigated. Reporter plasmids containing the simian virus 40 (SV40) promoter/enhancer sequence (SV40-DTS), a DTS for various types of cells but not being reported yet for ES cells, and the 81 base pairs of Sox2 regulatory region 2 (SRR2) where two transcriptional factors in ES cells, Oct3/4 and Sox2, are bound (SRR2-DTS), were introduced into cytoplasm in living cells by femtoinjection. The gene expression efficiencies of each plasmid in mouse insulinoma cell line MIN6 cells and mouse ES cells were then evaluated. Plasmids including SV40-DTS and SRR2-DTS exhibited higher gene expression efficiency comparing to plasmids without these DTSs, and thus it was concluded that both sequences work as a DTS in ES cells. In addition, it was suggested that SRR2-DTS works as an ES cell-specific DTS. To the best of our knowledge, this is the first report to confirm the function of DTSs in ES cells.

  5. Comparative phylogeography between the ermine Mustela erminea and the least weasel M. nivalis of Palaearctic and Nearctic regions, based on analysis of mitochondrial DNA control region sequences.

    PubMed

    Kurose, Naoko; Abramov, Alexei V; Masuda, Ryuichi

    2005-10-01

    Phylogeography of the ermine Mustela erminea and the least weasel M. nivalis from Palaearctic and Nearctic regions were investigated based on mitochondrial DNA control region sequences. Mustela erminea exhibited a very low level of genetic variation, and geographic structures among populations were unclear. This may indicate that M. erminea recently reoccupied a wide territory in Eurasia following the last glacial retreat. In comparison with M. erminea, genetic variations within and among populations of M. nivalis were much greater. Molecular phylogenetic relationships showed that two lineages of M. nivalis occurred in the Holarctic region: one spread from the Eurasian region to North America, and the other occurred in south-eastern Europe, the Caucasus and Central Asia. The results suggest either mitochondrial DNA introgression among populations of south-eastern Europe, the Caucasus and Central Asia, or ancestral polymorphisms remaining in those populations. Contrastive phylogeographic patterns between the two mustelid species could reflect differences of their migration histories in Eurasia after the last glacial age.

  6. Comparison of orthologous and paralogous DNA flanking the wheat high molecular weight glutenin genes: sequence conservation and divergence, transposon distribution, and matrix-attachment regions.

    PubMed

    Anderson, O D; Larka, L; Christoffers, M J; McCue, K F; Gustafson, J P

    2002-04-01

    Extended flanking DNA sequences were characterized for five members of the wheat high molecular weight (HMW) glutenin gene family to understand more of the structure, control, and evolution of these genes. Analysis revealed more sequence conservation among orthologous regions than between paralogous regions, with differences mainly owing to transposition events involving putative retrotransposons and several miniature inverted transposable elements (MITEs). Both gyspy-like long terminal repeat (LTR) and non-LTR retrotransposon sequences are represented in the flanking DNAs. One of the MITEs is a novel class, but another MITE is related to the maize Stowaway family and is widely represented in Triticeae express sequence tags (ESTs). Flanking DNA of the longest sequence, a 20 425-bp fragment including and surrounding the HMW-glutenin Bx7 gene, showed additional cereal gene-like sequences both immediately 5' and 3' to the HMW-glutenin coding region. The transcriptional activities of sequences related to these flanking putative genes and the retrotransposon-related regions were indicated by matches to wheat and other Triticeae ESTs. Predictive analysis of matrix-attachment regions (MARs) of the HMW glutenin and several alpha-, gamma-, and omega-gliadin flanking DNAs indicate potential MARs immediately flanking each of the genes. Matrix binding activity in the predicted regions was confirmed for two of the HMW-glutenin genes.

  7. The Dynamics of DNA Sequencing.

    ERIC Educational Resources Information Center

    Morvillo, Nancy

    1997-01-01

    Describes a paper-and-pencil activity that helps students understand DNA sequencing and expands student understanding of DNA structure, replication, and gel electrophoresis. Appropriate for advanced biology students who are familiar with the Sanger method. (DDR)

  8. Biosensors for DNA sequence detection

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  9. [Comparative Analysis of DNA Sequences of Regions of X-Chromosome Attachment to the Nuclear Envelope of Nurse Cells Anopheles messeae Fall].

    PubMed

    Artemov, G N; Vasil'eva, O Yu; Stegniy, V N

    2015-07-01

    Polytene chromosomes of ovarian nurse cells of Anopheles mosquitoes form strong contacts with the nuclear envelope. The presence of contacts, their position at nurse cell chromosomes, and their morphological features are species-specific in malaria mosquitoes. It is important to determine the nature of these interspecies differences in the nuclear architecture, both to understand the function of the nucleus and to assess the role of the spatial organization of chromosomes in evolution. Using dot-blot hybridization, we compared DNA sequences of the clone library from the X-chromosome attachment region to the nuclear envelope of ovarian nurse cells of Anopheles messeae with DNA-probes: (1) of the X-chromosome attachment region of An. atroparvus, (2) of the 3R chromosome attachment region ofAn. messeae, and (3) of the chromosome 2 pericentromeric region of An. messeae, without expressed contacts with the nuclear envelope. It has been shown that the chromosome attachment regions have a significantly higher number of homologous DNA sequences as compared with the pericentromeric region of chromosome 2. Sequences that are common for attachment regions are largely potentially able to participate in the formation of chromatin loop domains and to interact with some nucleus frameworks, according to the analysis in the ChrClass program. The obtained results support the important role of DNA in the formation of strong chromosomal attachments to the nuclear envelope in nurse cells of Anopheles mosquitoes.

  10. Sequence analysis of the ITS region and 5.8S rDNA of Porphyra haitanensis

    NASA Astrophysics Data System (ADS)

    Li, Yanyan; Shen, Songdong; He, Lihong; Xu, Pu; Wang, Guangce

    2009-09-01

    The sequences of the ITS (internal transcribed spacer) and 5.8S rDNA of three cultivated strains of Porphyra haitanensis thalli (NB, PT and ST) were amplified, sequenced and analyzed. In addition, the phylogenic relationships of the sequences identified in this study with those of other Porphyra retrieved from GenBank were evaluated. The results are as follows: the sequences of the ITS and 5.8S rDNA were essentially identical among the three strains. The sequences of ITS1 were 331 bp to 334 bp, while those of the 5.8S rDNA were 158 bp and the sequences of ITS2 ranged from 673 bp to 681 bp. The sequences of the ITS had a high level of homology (up to 99.5%) with that of P. haitanensis (DQ662228) retrieved from GenBank, but were only approximately 50% homologous with those of other species of Porphyra. The results obtained when a phylogenetic tree was constructed coincided with the results of the homology analysis. These results suggest that the three cultivated strains of P. haitanensis evolved conservatively and that the ITS showed evolutionary consistency. However, the sequences of the ITS and 5.8S rDNA of different Porphyra species showed great variations. Therefore, the relationship of Porphyra interspecies phyletic evolution could be judged, which provides the proof for Porphyra identification study. However, proper classifications of the subspecies and the populations of Porphyra should be determined through the use of other molecular techniques to determine the genetic variability and rational phylogenetic relationships.

  11. DNA sequence analysis suggests that cytb-nd1 PCR-RFLP may not be applicable to sandfly species identification throughout the Mediterranean region.

    PubMed

    Llanes-Acevedo, Ivonne Pamela; Arcones, Carolina; Gálvez, Rosa; Martin, Oihane; Checa, Rocío; Montoya, Ana; Chicharro, Carmen; Cruz, Susana; Miró, Guadalupe; Cruz, Israel

    2016-03-01

    Molecular methods are increasingly used for both species identification of sandflies and assessment of their population structure. In general, they are based on DNA sequence analysis of targets previously amplified by PCR. However, this approach requires access to DNA sequence facilities, and in some circumstances, it is time-consuming. Though DNA sequencing provides the most reliable information, other downstream PCR applications are explored to assist in species identification. Thus, it has been recently proposed that the amplification of a DNA region encompassing partially both the cytochrome-B (cytb) and the NADH dehydrogenase 1 (nd1) genes followed by RFLP analysis with the restriction enzyme Ase I allows the rapid identification of the most prevalent species of phlebotomine sandflies in the Mediterranean region. In order to confirm the suitability of this method, we collected, processed, and molecularly analyzed a total of 155 sandflies belonging to four species including Phlebotomus ariasi, P. papatasi, P. perniciosus, and Sergentomyia minuta from different regions in Spain. This data set was completed with DNA sequences available at the GenBank for species prevalent in the Mediterranean basin and the Middle East. Additionally, DNA sequences from 13 different phlebotomine species (P. ariasi, P. balcanicus, P. caucasicus, P. chabaudi, P. chadlii, P. longicuspis, P. neglectus, P. papatasi, P. perfiliewi, P. perniciosus, P. riouxi, P. sergenti, and S. minuta), from 19 countries, were added to the data set. Overall, our molecular data revealed that this PCR-RFLP method does not provide a unique and specific profile for each phlebotomine species tested. Intraspecific variability and similar RFLP patterns were frequently observed among the species tested. Our data suggest that this method may not be applicable throughout the Mediterranean region as previously proposed. Other molecular approaches like DNA barcoding or phylogenetic analyses would allow a more

  12. Sequence of a cDNA encoding nitrite reductase from the tree Betula pendula and identification of conserved protein regions.

    PubMed

    Friemann, A; Brinkmann, K; Hachtel, W

    1992-02-01

    The sequence of an mRNA encoding nitrite reductase (NiR, EC 1.7.7.1.) from the tree Betula pendula was determined. A cDNA library constructed from leaf poly(A)+ mRNA was screened with an oligonucleotide probe deduced from NiR sequences from spinach and maize. A 2.5 kb cDNA was isolated that hybridized to an mRNA, the steady-state level of which increased markedly upon induction with nitrate. The nucleotide sequence of the cDNA contains a reading frame encoding a protein of 583 amino acids that reveals 79% identity with NiR from spinach. The transit peptide of the NiR precursor from birch was determined to be 22 amino acids in size by sequence comparison with NiR from spinach and maize and is the shortest transit peptide reported so far. A graphical evaluation of identities found in the NiR sequence alignment revealed nine well conserved sections each exceeding ten amino acids in size. Sequence comparisons with related redox proteins identified essential residues involved in cofactor binding. A putative binding site for ferredoxin was found in the N-terminal half of the protein.

  13. Graphene nanodevices for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Heerema, Stephanie J.; Dekker, Cees

    2016-02-01

    Fast, cheap, and reliable DNA sequencing could be one of the most disruptive innovations of this decade, as it will pave the way for personalized medicine. In pursuit of such technology, a variety of nanotechnology-based approaches have been explored and established, including sequencing with nanopores. Owing to its unique structure and properties, graphene provides interesting opportunities for the development of a new sequencing technology. In recent years, a wide range of creative ideas for graphene sequencers have been theoretically proposed and the first experimental demonstrations have begun to appear. Here, we review the different approaches to using graphene nanodevices for DNA sequencing, which involve DNA passing through graphene nanopores, nanogaps, and nanoribbons, and the physisorption of DNA on graphene nanostructures. We discuss the advantages and problems of each of these key techniques, and provide a perspective on the use of graphene in future DNA sequencing technology.

  14. Sequencing Intractable DNA to Close Microbial Genomes

    SciTech Connect

    Hurt, Jr., Richard Ashley; Brown, Steven D; Podar, Mircea; Palumbo, Anthony Vito; Elias, Dwayne A

    2012-01-01

    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  15. Phylogenetics of Bonamia parasites based on small subunit and internal transcribed spacer region ribosomal DNA sequence data.

    PubMed

    Hill, Kristina M; Stokes, Nancy A; Webb, Stephen C; Hine, P Mike; Kroeck, Marina A; Moore, James D; Morley, Margaret S; Reece, Kimberly S; Burreson, Eugene M; Carnegie, Ryan B

    2014-07-24

    The genus Bonamia (Haplosporidia) includes economically significant oyster parasites. Described species were thought to have fairly circumscribed host and geographic ranges: B. ostreae infecting Ostrea edulis in Europe and North America, B. exitiosa infecting O. chilensis in New Zealand, and B. roughleyi infecting Saccostrea glomerata in Australia. The discovery of B. exitiosa-like parasites in new locations and the observation of a novel species, B. perspora, in non-commercial O. stentina altered this perception and prompted our wider evaluation of the global diversity of Bonamia parasites. Samples of 13 oyster species from 21 locations were screened for Bonamia spp. by PCR, and small subunit and internal transcribed spacer regions of Bonamia sp. ribosomal DNA were sequenced from PCR-positive individuals. Infections were confirmed histologically. Phylogenetic analyses using parsimony and Bayesian methods revealed one species, B. exitiosa, to be widely distributed, infecting 7 oyster species from Australia, New Zealand, Argentina, eastern and western USA, and Tunisia. More limited host and geographic distributions of B. ostreae and B. perspora were confirmed, but nothing genetically identifiable as B. roughleyi was found in Australia or elsewhere. Newly discovered diversity included a Bonamia sp. in Dendostrea sandvicensis from Hawaii, USA, that is basal to the other Bonamia species and a Bonamia sp. in O. edulis from Tomales Bay, California, USA, that is closely related to both B. exitiosa and the previously observed Bonamia sp. from O. chilensis in Chile.

  16. Nucleotide sequence of the internal transcribed spacers and 5.8S region of ribosomal DNA in Pinus pinea L.

    PubMed

    Marrocco, R; Gelati, M T; Maggini, F

    1996-01-01

    The nucleotide sequence of the first internal transcribed spacer (ITS1) belonging to different ribosomal RNA genes from Pinus pinea are reported. The analyzed ITS1 can be distinguished on the basis of their length, being one 2631 bp and the other 271 bp long. Nucleotide comparison of these regions did not show appreciable sequence homology. The larger ITS1 contains five tandem arranged subrepeats with size ranging between 219 bp and 237 bp. The nucleotide sequence of the 5.8S and the ITS2 regions belonging to the larger ribosomal RNA gene are also reported.

  17. Characterization of a DNA sequence family in the Prader-Willi/Angelman syndrome chromosome region in 15q11-q13

    SciTech Connect

    Dittrich, B.; Knoblauch, H.; Buiting, K.; Horsthemke, B. )

    1993-04-01

    IR4-3R (D15S11) is an anonymous DNA sequence from human chromosome 15. Using YAC cloning and restriction enzyme analysis, the authors have found that IR4-3R detects five related DNA sequences, which are spread over 700 kb within the Prader-Willi/Angelman syndrome chromosome region in 15q11-q 13. The RsaI and StyI polymorphisms, which were described previously, are associated with the most proximal copy of IR4-3R and are in strong linkage disequilibrium. IR4-3R represents the third DNA sequence family that has been identified in 15q11-q13. 14 refs., 2 figs., 1 tab.

  18. Sequence independent amplification of DNA

    DOEpatents

    Bohlander, Stefan K.

    1998-01-01

    The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei.

  19. Sequence independent amplification of DNA

    DOEpatents

    Bohlander, S.K.

    1998-03-24

    The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example, the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei. 25 figs.

  20. Nucleotide sequencing and analysis of 16S rDNA and 16S-23S rDNA internal spacer region (ISR) of Taylorella equigenitalis, as an important pathogen for contagious equine metritis (CEM).

    PubMed

    Kagawa, S; Nagano, Y; Tazumi, A; Murayama, O; Millar, B C; Moore, J E; Matsuda, M

    2006-05-01

    The primer set for 16S rDNA amplified an amplicon of about 1500 bp in length for three strains of Taylorella equigenitalis (NCTC11184(T), Kentucky188 and EQ59). Sequence differences of the 16S rDNA among the six sequences, including three reference sequences, occurred at only a few nucleotide positions and thus, an extremely high sequence similarity of the 16S rDNA was first demonstrated among the six sequences. In addition, the primer set for 16S-23S rDNA internal spacer region (ISR) amplified two amplicons about 1300 bp and 1200 bp in length for the three strains. The ISRs were estimated to be about 920 bp in length for large ISR-A and about 830 bp for small ISR-B. Sequence alignment of the ISR-A and ISR-B demonstrated about 10 base differences between NCTC11184(T) and EQ59 and between Kentucky188 and EQ59. However, only minor sequence differences were demonstrated between the ISR-A and ISR-B from NCTC11184(T) and Kentucky188, respectively. A typical order of the intercistronic tRNAs with the 29 nucleotide spacer of 5'-16S rDNA-tRNA(Ile)-tRNA(Ala)-23S rDNA-3' was demonstrated in the all ISRs. The ISRs may be useful for the discrimination amongst isolates of T. equigenitalis if sequencing is employed.

  1. Nucleotide sequence of murine PCNA: interspecies comparison of the cDNA and the 5' flanking region of the gene.

    PubMed

    Shipman-Appasamy, P M; Cohen, K S; Prystowsky, M B

    1991-01-01

    Proliferating cell nuclear antigen (PCNA) RNA levels are regulated by transcription as well as changes in stability, in growing cells. We have cloned the murine PCNA cDNA and a fragment of the murine PCNA gene flanking the transcription initiation site. Comparison of the murine deduced amino acid sequence with the PCNA sequence from rat, human, Drosophila, Saccharomyces cerevisiae, and higher plants, reveals extensive homology between species. The homology is likely to be related to the fundamental role of PCNA as an auxiliary protein for DNA replication. Consensus sequences for transcriptional regulatory factors identified within 520 bp 5' of the cap site of the murine PCNA gene include: an inverted CCAAT site, an enhancer core element (EBP-1), three cAMP-response elements (CRE-BP), one AP-2 site, three Sp1 sites, and two octamer sequences. The first 20 bp of the transcriptional unit are homologous to an initiator element, which may direct transcription from RNA polymerase II in the absence of a TATAA box. The consensus elements in the murine PCNA gene are similar in sequence and/or location to elements identified in the genes for human, Drosophilia, and yeast PCNA.

  2. DNA Sequence Variants in the Five Prime Untranslated Region of the Cyclooxygenase-2 Gene Are Commonly Found in Healthy Dogs and Gray Wolves

    PubMed Central

    Safra, Noa; Hayward, Louisa J.; Aguilar, Miriam; Sacks, Benjamin N.; Westropp, Jodi L.; Mohr, F. Charles; Mellersh, Cathryn S.; Bannasch, Danika L.

    2015-01-01

    The aim of this study was to investigate the frequency of regional DNA variants upstream to the translation initiation site of the canine Cyclooxygenase-2 (Cox-2) gene in healthy dogs. Cox-2 plays a role in various disease conditions such as acute and chronic inflammation, osteoarthritis and malignancy. A role for Cox-2 DNA variants in genetic predisposition to canine renal dysplasia has been proposed and dog breeders have been encouraged to select against these DNA variants. We sequenced 272–422 bases in 152 dogs unaffected by renal dysplasia and found 19 different haplotypes including 11 genetic variants which had not been described previously. We genotyped 7 gray wolves to ascertain the wildtype variant and found that the wolves we analyzed had predominantly the second most common DNA variant found in dogs. Our results demonstrate an elevated level of regional polymorphism that appears to be a feature of healthy domesticated dogs. PMID:26244515

  3. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting

    PubMed Central

    Vlijm, Rifka; v.d. Torre, Jaco; Dekker, Cees

    2015-01-01

    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, have determined that AT-rich sequences have a lower binding energy than GC-rich sequences. In cells, however, the double-stranded backbone of DNA is destabilized by negative supercoiling, and not by temperature. To investigate what the effect of GC content is on DNA melting induced by negative supercoiling, we studied DNA molecules with a GC content ranging from 38% to 77%, using single-molecule magnetic tweezer measurements in which the length of a single DNA molecule is measured as a function of applied stretching force and supercoiling density. At low force (<0.5pN), supercoiling results into twisting of the dsDNA backbone and loop formation (plectonemes), without inducing any DNA melting. This process was not influenced by the DNA sequence. When negative supercoiling is introduced at increasing force, local melting of DNA is introduced. We measured for the different DNA molecules a characteristic force Fchar, at which negative supercoiling induces local melting of the dsDNA. Surprisingly, GC-rich sequences melt at lower forces than AT-rich sequences: Fchar = 0.56pN for 77% GC but 0.73pN for 38% GC. An explanation for this counterintuitive effect is provided by the realization that supercoiling densities of a few percent only induce melting of a few percent of the base pairs. As a consequence, denaturation bubbles occur in local AT-rich regions and the sequence-dependent effect arises from an increased DNA bending/torsional energy associated with the plectonemes. This new insight indicates that an increased GC-content adjacent to AT-rich DNA regions will enhance local opening of the double-stranded DNA helix. PMID:26513573

  4. The Nucleotide Capture Region of Alpha Hemolysin: Insights into Nanopore Design for DNA Sequencing from Molecular Dynamics Simulations.

    PubMed

    Manara, Richard M A; Tomasio, Susana; Khalid, Syma

    2015-01-27

    Nanopore technology for DNA sequencing is constantly being refined and improved. In strand sequencing a single strand of DNA is fed through a nanopore and subsequent fluctuations in the current are measured. A major hurdle is that the DNA is translocated through the pore at a rate that is too fast for the current measurement systems. An alternative approach is "exonuclease sequencing", in which an exonuclease is attached to the nanopore that is able to process the strand, cleaving off one base at a time. The bases then flow through the nanopore and the current is measured. This method has the advantage of potentially solving the translocation rate problem, as the speed is controlled by the exonuclease. Here we consider the practical details of exonuclease attachment to the protein alpha hemolysin. We employ molecular dynamics simulations to determine the ideal (a) distance from alpha-hemolysin, and (b) the orientation of the monophosphate nucleotides upon release from the exonuclease such that they will enter the protein. Our results indicate an almost linear decrease in the probability of entry into the protein with increasing distance of nucleotide release. The nucleotide orientation is less significant for entry into the protein.

  5. Quantitative analysis of dinoflagellates and diatoms community via Miseq sequencing of actin gene and v9 region of 18S rDNA

    PubMed Central

    Guo, Liliang; Sui, Zhenghong; Liu, Yuan

    2016-01-01

    Miseq sequencing and data analysis for the actin gene and v9 region of 18S rDNA of 7 simulated samples consisting of different mixture of dinoflagellates and diatoms were carried out. Not all the species were detectable in all the 18S v9 samples, and sequence percent in all the v9 samples were not consistent with the corresponding cell percent which may suggest that 18S rDNA copy number in different cells of these species differed greatly which result in the large deviation of the amplification. And 18S rDNA amplification of the microalgae was prone to be contaminated by fungus. The amplification of actin gene all was from the dinoflagellates because of its targeted degenerate primers. All the actin sequences of dinoflagellates were detected in the act samples except act4, and sequence percentage of the dinoflagellates in the act samples was not completely consistent with the dinoflagellates percentage of cell samples, but with certain amplification deviations. Indexes of alpha diversity of actin gene sequencing may be better reflection of community structure, and beta diversity analysis could cluster the dinoflagellates samples with identical or similar composition together and was distinguishable with blooming simulating samples at the generic level. Hence, actin gene was more proper than rDNA as the molecular marker for the community analysis of the dinoflagellates. PMID:27721499

  6. Genetic diversity in captive and wild Matschie's tree kangaroo (Dendrolagus matschiei) from Huon Peninsula, Papua New Guinea, based on mtDNA control region sequences.

    PubMed

    McGreevy, Thomas J; Dabek, Lisa; Gomez-Chiarri, Marta; Husband, Thomas P

    2009-05-01

    The Association of Zoos and Aquariums (AZA) Matschie's tree kangaroo (Dendrolagus matschiei) population is at a critical point for assessing long-term viability. This population, established from 19 genetically uncharacterized D. matschiei, has endured a founder effect because only four individuals contributed the majority of offspring. The highly variable mitochondrial DNA (mtDNA) control region was sequenced for five of the female-founders by examining extant representatives of their maternal lineage and compared with wild (n = 13) and captive (n = 18) D. matschiei from Papua New Guinea (PNG). AZA female-founder D. matschiei control region haplotype diversity was low, compared with captive D. matschiei held in PNG. AZA D. matschiei have only two control region haplotypes because four out of five AZA female-founder D. matschiei had an identical sequence. Both AZA haplotypes were identified among the 17 wild and captive D. matschiei haplotypes from PNG. Genomic DNA extracted from wild D. matschiei fecal samples was a reliable source of mtDNA that could be used for a larger scale study. We recommend a nuclear DNA genetic analysis to more fully characterize AZA D. matschiei genetic diversity and to assist their Species Survival Plan((R)). An improved understanding of D. matschiei genetics will contribute substantially to the conservation of these unique animals both in captivity and the wild.

  7. Statistical and linguistic features of DNA sequences

    NASA Technical Reports Server (NTRS)

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  8. The Nucleotide Capture Region of Alpha Hemolysin: Insights into Nanopore Design for DNA Sequencing from Molecular Dynamics Simulations

    PubMed Central

    Manara, Richard M. A.; Tomasio, Susana; Khalid, Syma

    2015-01-01

    Nanopore technology for DNA sequencing is constantly being refined and improved. In strand sequencing a single strand of DNA is fed through a nanopore and subsequent fluctuations in the current are measured. A major hurdle is that the DNA is translocated through the pore at a rate that is too fast for the current measurement systems. An alternative approach is “exonuclease sequencing”, in which an exonuclease is attached to the nanopore that is able to process the strand, cleaving off one base at a time. The bases then flow through the nanopore and the current is measured. This method has the advantage of potentially solving the translocation rate problem, as the speed is controlled by the exonuclease. Here we consider the practical details of exonuclease attachment to the protein alpha hemolysin. We employ molecular dynamics simulations to determine the ideal (a) distance from alpha-hemolysin, and (b) the orientation of the monophosphate nucleotides upon release from the exonuclease such that they will enter the protein. Our results indicate an almost linear decrease in the probability of entry into the protein with increasing distance of nucleotide release. The nucleotide orientation is less significant for entry into the protein.

  9. Biotools: Patenting DNA sequences

    SciTech Connect

    Yablonsky, M.D.; Hone, W.J.

    1995-07-01

    The decision, known as In re Deuel{sup 2}, rejects the PTO`s interpretation of a previous decision of the Federal Circuit and makes it more possible that a {open_quotes}nucleic acid of a particular sequence{close_quotes} - commonly known as a gene sequence - may be patentable. 15 refs.

  10. Location of functional regions of the Escherichia coli RecA protein by DNA sequence analysis of RecA protease-constitutive mutants.

    PubMed Central

    Wang, W B; Tessman, E S

    1986-01-01

    In previous work (E. S. Tessman and P. K. Peterson, J. Bacteriol. 163:677-687 and 688-695, 1985), we isolated many novel protease-constitutive (Prtc) recA mutants, i.e., mutants in which the RecA protein was always in the protease state without the usual need for DNA damage to activate it. Most Prtc mutants were recombinase positive and were designated Prtc Rec+; only a few Prtc mutants were recombinase negative, and those were designated Prtc Rec-. We report changes in DNA sequence of the recA gene for several of these mutants. The mutational changes clustered at three regions on the linear RecA polypeptide. Region 1 includes amino acid residues 25 through 39, region 2 includes amino acid residues 157 through 184, and region 3 includes amino acid residues 298 through 301. The in vivo response of these Prtc mutants to different effectors suggests that the RecA effector-binding sites have been altered. In particular we propose that the mutations may define single-stranded DNA- and nucleoside triphosphate-binding domains of RecA, that polypeptide regions 1 and 3 comprise part of the single-stranded DNA-binding domain, and that polypeptide regions 2 and 3 comprise part of the nucleoside triphosphate-binding domain. The overlapping of single-stranded DNA- and nucleoside triphosphate-binding domains in region 3 can explain previously known complex allosteric effects. Each of four Prtc Rec- mutants sequenced was found to contain a single amino acid change, showing that the change of just one amino acid can affect both the protease and recombinase activities and indicating that the functional domains for these two activities of RecA overlap. A recA promoter-down mutation was isolated by its ability to suppress the RecA protease activity of one of our strong Prtc mutants. PMID:3536864

  11. Sequence variation of the ribosomal DNA second internal transcribed spacer region in two spatially-distinct populations of Amblyomma americanum (L.) (Acari: Ixodidae).

    PubMed

    Reichard, M V; Kocan, A A; Van Den Bussche, R A; Barker, R W; Wyckoff, J H; Ewing, S A

    2005-04-01

    Sequence analysis of the ribosomal DNA second internal transcribed spacer (ITS 2) region in 2 spatially distinct populations of Amblyomma americanum (L.) revealed intraspecific variation. Nucleotide sequences from multiple DNA extractions and several polymerase chain reaction amplifications of eggs from mixed-parentage samples from both populations of ticks revealed that 12 of 1,145 (1.0%) sites varied. Three of the 12 sites of variation were distinct between the 2 A. americanum populations, which corresponded to a rate of 0.26%. Phylogenetic analysis based on ITS 2 sequences provided strong support (i.e., bootstrap value of 80%) that wild A. americanum clustered into a distinguishable group separate from those derived from colony ticks.

  12. Inferring ethnicity from mitochondrial DNA sequence

    PubMed Central

    2011-01-01

    Background The assignment of DNA samples to coarse population groups can be a useful but difficult task. One such example is the inference of coarse ethnic groupings for forensic applications. Ethnicity plays an important role in forensic investigation and can be inferred with the help of genetic markers. Being maternally inherited, of high copy number, and robust persistence in degraded samples, mitochondrial DNA may be useful for inferring coarse ethnicity. In this study, we compare the performance of methods for inferring ethnicity from the sequence of the hypervariable region of the mitochondrial genome. Results We present the results of comprehensive experiments conducted on datasets extracted from the mtDNA population database, showing that ethnicity inference based on support vector machines (SVM) achieves an overall accuracy of 80-90%, consistently outperforming nearest neighbor and discriminant analysis methods previously proposed in the literature. We also evaluate methods of handling missing data and characterize the most informative segments of the hypervariable region of the mitochondrial genome. Conclusions Support vector machines can be used to infer coarse ethnicity from a small region of mitochondrial DNA sequence with surprisingly high accuracy. In the presence of missing data, utilizing only the regions common to the training sequences and a test sequence proves to be the best strategy. Given these results, SVM algorithms are likely to also be useful in other DNA sequence classification applications. PMID:21554759

  13. In silico discrimination of single nucleotide polymorphisms and pathological mutations in human gene promoter regions by means of local DNA sequence context and regularity.

    PubMed

    Khan, Imtiaz A; Mort, Matthew; Buckland, Paul R; O'Donovan, Michael C; Cooper, David N; Chuzhanova, Nadia A

    2006-01-01

    DNA sequence features were sought that could be used for the in silico ascertainment of the likely functional consequences of single nucleotide changes in human gene promoter regions. To identify relevant features of the local DNA sequence context, we transformed into consensus tables the nucleotide composition of sequences flanking 101 promoter SNPs of type C<-->T or A<-->G, defined empirically as being either 'functional' or 'non-functional' on the basis of a standardised reporter gene assay. The similarity of a given sequence to these consensus tables was then measured by means of the Shapiro-Senapathy score. A decision rule with the potential to discriminate between empirically ascertained functional and non-functional SNPs was proposed that potentiated discrimination between functional and non-functional SNPs with a sensitivity of 80% and a specificity of 20%. Two further datasets (viz. disease-associated SNPs of types A<-->G and C<-->T (N = 75) and pathological promoter mutations (transitions, N = 114)) were retrieved from the Human Gene Mutation Database (HGMD; http://www.hgmd.org/) and analyzed using consensus tables derived from the functional and non-functional promoter SNPs; approximately 70% were correctly recognized as being of probable functional significance. Complexity analysis was also used to quantify the regularity of the local DNA sequence environment. Functional SNPs/mutations of type C<-->T were found to occur in DNA regions characterized by lower average sequence complexity as measured with respect to symmetric elements; complexity values increased gradually from functional SNPs and pathological mutations to functional disease-associated SNPs and non-functional SNPs. This may reflect the internal axial symmetry that frequently characterizes transcription factor binding sites.

  14. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    PubMed

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described.

  15. Analysis of the Escherichia coli genome VI: DNA sequence of the region from 92.8 through 100 minutes.

    PubMed Central

    Burland, V; Plunkett, G; Sofia, H J; Daniels, D L; Blattner, F R

    1995-01-01

    The 338.5 kb of the Escherichia coli genome described here together with previously described segments bring the total of contiguous finished sequence of this genome to > 1 Mb. Of 319 open reading frames (ORFs) found in this 338.5 kb segment, 147 (46%) are potential new genes. The positions of several genes which had been previously located here by mapping or partial sequencing have been confirmed. Several ORFs have functions suggested by similarities to other characterised genes but cannot be assigned with certainty. Fifteen of the ORFs of unknown function had been previously sequenced. Eight transfer RNAs are encoded in the region and there are two grey holes in which no features were found. The attachment site for phage P4 and three insertion sequences were located. The region was also analysed for chi sites, bend sites, REP elements and other repeats. A computer search identified potential promoters and tentative transcription units were assigned. The occurrence of the rare tetramer CTAG was analysed in 1.6 Mb of contiguous E.coli sequence. Hypotheses addressing the rarity and distribution of CTAG are discussed. PMID:7610040

  16. DNA sequencing with pyrophosphatase

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1996-03-12

    A kit or solution for use in extension of an oligonucleotide primer having a first single-stranded region on a template molecule having a second single-stranded region homologous to the first single-stranded region, comprising a first agent able to cause extension of the first single-stranded region of the primer on the second single-stranded region of the template in a reaction mixture, and a second agent able to reduce the amount of pyrophosphate in the reaction mixture below the amount produced during the extension in the absence of the second agent.

  17. DNA sequencing with pyrophosphatase

    DOEpatents

    Tabor, S.; Richardson, C.C.

    1996-03-12

    A kit or solution is disclosed for use in extension of an oligonucleotide primer having a first single-stranded region on a template molecule and having a second single-stranded region homologous to the first single-stranded region. The first agent is able to cause extension of the first single-stranded region of the primer on the second single-stranded region of the template in a reaction mixture. The second agent is able to reduce the amount of pyrophosphate in the reaction mixture below the amount produced during the extension in the absence of the second agent.

  18. The sequence of sequencers: The history of sequencing DNA.

    PubMed

    Heather, James M; Chain, Benjamin

    2016-01-01

    Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way.

  19. Image analysis for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Palaniappan, Kannappan; Huang, Thomas S.

    1991-07-01

    There is a great deal of interest in automating the process of DNA (deoxyribonucleic acid) sequencing to support the analysis of genomic DNA such as the Human and Mouse Genome projects. In one class of gel-based sequencing protocols autoradiograph images are generated in the final step and usually require manual interpretation to reconstruct the DNA sequence represented by the image. The need to handle a large volume of sequence information necessitates automation of the manual autoradiograph reading step through image analysis in order to reduce the length of time required to obtain sequence data and reduce transcription errors. Various adaptive image enhancement, segmentation and alignment methods were applied to autoradiograph images. The methods are adaptive to the local characteristics of the image such as noise, background signal, or presence of edges. Once the two-dimensional data is converted to a set of aligned one-dimensional profiles waveform analysis is used to determine the location of each band which represents one nucleotide in the sequence. Different classification strategies including a rule-based approach are investigated to map the profile signals, augmented with the original two-dimensional image data as necessary, to textual DNA sequence information.

  20. Sequence of a cDNA encoding the bi-specific NAD(P)H-nitrate reductase from the tree Betula pendula and identification of conserved protein regions.

    PubMed

    Friemann, A; Brinkmann, K; Hachtel, W

    1991-05-01

    Nitrate reductase (NR) assays revealed a bispecific NAD(P)H-NR (EC 1.6.6.2.) to be the only nitrate-reducing enzyme in leaves of hydroponically grown birches. To obtain the primary structure of the NAD(P)H-NR, leaf poly(A)+ mRNA was used to construct a cDNA library in the lambda gt11 phage. Recombinant clones were screened with heterologous gene probes encoding NADH-NR from tobacco and squash. A 3.0 kb cDNA was isolated which hybridized to a 3.2 kb mRNA whose level was significantly higher in plants grown on nitrate than in those grown on ammonia. The nucleotide sequence of the cDNA comprises a reading frame encoding a protein of 898 amino acids which reveals 67%-77% identity with NADH-nitrate reductase sequences from higher plants. To identify conserved and variable regions of the multicentre electron-transfer protein a graphical evaluation of identities found in NR sequence alignments was carried out. Thirteen well-conserved sections exceeding a size of 10 amino acids were found in higher plant nitrate reductases. Sequence comparisons with related redox proteins indicate that about half of the conserved NR regions are involved in cofactor binding. The most striking difference in the birch NAD(P)H-NR sequence in comparison to NADH-NR sequences was found at the putative pyridine nucleotide binding site. Southern analysis indicates that the bi-specific NR is encoded by a single copy gene in birch.

  1. Genetic diversity of Histoplasma capsulatum strains isolated from Argentina based on nucleotide sequence variations in the internal transcribed spacer regions of rDNA.

    PubMed

    Landaburu, Fernanda; Cuestas, María Luján; Rubio, Andrea; Elías, Nahuel Alejandro; Daneri, Gabriela Lopez; Veciño, Cecilia; Iovannitti, Cristina A; Mujica, María Teresa

    2014-05-01

    The internal transcribed spacer (ITS) regions of rDNA genes of 49 Histoplasma capsulatum (48 from clinical samples and one from soil) isolates were examined. Nucleotide sequence heterogeneity within this region was useful for phylogenetic classification of H. capsulatum and species identification. Thus, in 45 of 49 isolates we observed higher percentages of identity in the nucleotide sequences of ITS regions when the isolates studied herein were compared with those reported in our country in the South America B clade. Phylogenetic analyses of rDNA sequences corresponding to the 537 bp of the ITS region obtained from H. capsulatum isolates assigned South America type B clade (45 isolates), North America type 1 and Asia clade (2 isolates each one). H. capsulatum strains isolated from soil and from patients living in Argentina (45 of 49) clustered together with the H. capsulatum isolates of the South America B clade. The high level of genetic similarity among our isolates suggests that almost one genetic population is present in the microenvironment. Isolates described as H. capsulatum var. capsulatum or var. farciminosum (2 isolates) did not form a monophyletic group and were found in the Asia clade. Subsequent studies are needed to properly identify these isolates.

  2. DNA sequence variation in the mitochondrial control region of subterranean mole rats, Spalax ehrenbergi superspecies, in Israel.

    PubMed

    Reyes, Aurelio; Nevo, Eviatar; Saccone, Cecilia

    2003-04-01

    The complete mitochondrial control region was sequenced for 60 individuals representing different populations for each of the four species of the subterranean mole rat Spalax ehrenbergi superspecies in Israel: Spalax galili (2n = 52), S. golani (2n = 54), S. carmeli (2n = 58), and S. judaei (2n = 60). The control region of all species and populations is very similar both in length (979 to 983 bp) and in base composition. As in agreement with previous surveys on mitochondrial control regions on mammals, the mole rat control region can be divided into a central domain and two flanking domains, ETAS (extended termination associated sequences) and CSB (conserved sequence blocks). Along with the common conserved blocks found in these domains (ETAS1, ETAS2, CSB1, CSB2, and CSB3), we have also detected in all individuals an ETAS1-like and a CSB1-like element, both in the ETAS domain. The most conserved region was the central domain, followed by the CSB and ETAS domains, showing important differences in the four species analyzed. Phylogenetic analysis supported the existence of two clades. One clade contained individuals belonging to Spalax galili (2n = 52) and S. golani (2n = 54), separated in two different branches depending on the species. The other clade contained individuals belonging to S. carmeli (2n = 58) and S. judaei (2n = 60) mixed together, suggesting a more recent event of speciation. Within species we have observed a southward trend of increasing variability. These results have been explained as a consequence of the adaptation of the species to ecological factors such as aridity and temperature stresses.

  3. DNA Sequencing Sensors: An Overview

    PubMed Central

    Garrido-Cardenas, Jose Antonio; Garcia-Maroto, Federico; Alvarez-Bermejo, Jose Antonio; Manzano-Agugliaro, Francisco

    2017-01-01

    The first sequencing of a complete genome was published forty years ago by the double Nobel Prize in Chemistry winner Frederick Sanger. That corresponded to the small sized genome of a bacteriophage, but since then there have been many complex organisms whose DNA have been sequenced. This was possible thanks to continuous advances in the fields of biochemistry and molecular genetics, but also in other areas such as nanotechnology and computing. Nowadays, sequencing sensors based on genetic material have little to do with those used by Sanger. The emergence of mass sequencing sensors, or new generation sequencing (NGS) meant a quantitative leap both in the volume of genetic material that was able to be sequenced in each trial, as well as in the time per run and its cost. One can envisage that incoming technologies, already known as fourth generation sequencing, will continue to cheapen the trials by increasing DNA reading lengths in each run. All of this would be impossible without sensors and detection systems becoming smaller and more precise. This article provides a comprehensive overview on sensors for DNA sequencing developed within the last 40 years. PMID:28335417

  4. Quadruplex DNA: sequence, topology and structure

    PubMed Central

    Burge, Sarah; Parkinson, Gary N.; Hazel, Pascale; Todd, Alan K.; Neidle, Stephen

    2006-01-01

    G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and biological validation of these structures is starting to be explored, and there is particular interest in them as targets for therapeutic intervention. This survey focuses on the folding and structural features on quadruplexes formed from telomeric and non-telomeric DNA sequences, and examines fundamental aspects of topology and the emerging relationships with sequence. Emphasis is placed on information from the high-resolution methods of X-ray crystallography and NMR, and their scope and current limitations are discussed. Such information, together with biological insights, will be important for the discovery of drugs targeting quadruplexes from particular genes. PMID:17012276

  5. Helena, the hidden beauty: Resolving the most common West Eurasian mtDNA control region haplotype by massively parallel sequencing an Italian population sample.

    PubMed

    Bodner, Martin; Iuvaro, Alessandra; Strobl, Christina; Nagl, Simone; Huber, Gabriela; Pelotti, Susi; Pettener, Davide; Luiselli, Donata; Parson, Walther

    2015-03-01

    The analysis of mitochondrial (mt)DNA is a powerful tool in forensic genetics when nuclear markers fail to give results or maternal relatedness is investigated. The mtDNA control region (CR) contains highly condensed variation and is therefore routinely typed. Some samples exhibit an identical haplotype in this restricted range. Thus, they convey only weak evidence in forensic queries and limited phylogenetic information. However, a CR match does not imply that also the mtDNA coding regions are identical or samples belong to the same phylogenetic lineage. This is especially the case for the most frequent West Eurasian CR haplotype 263G 315.1C 16519C, which is observed in various clades within haplogroup H and occurs at a frequency of 3-4% in many European populations. In this study, we investigated the power of massively parallel complete mtGenome sequencing in 29 Italian samples displaying the most common West Eurasian CR haplotype - and found an unexpected high diversity. Twenty-eight different haplotypes falling into 19 described sub-clades of haplogroup H were revealed in the samples with identical CR sequences. This study demonstrates the benefit of complete mtGenome sequencing for forensic applications to enforce maximum discrimination, more comprehensive heteroplasmy detection, as well as highest phylogenetic resolution.

  6. The human clotting factor VIII cDNA contains an autonomously replicating sequence consensus- and matrix attachment region-like sequence that binds a nuclear factor, represses heterologous gene expression, and mediates the transcriptional effects of sodium butyrate.

    PubMed Central

    Fallaux, F J; Hoeben, R C; Cramer, S J; van den Wollenberg, D J; Briët, E; van Ormondt, H; van Der Eb, A J

    1996-01-01

    Expression of the human blood-clotting factor VIII (FVIII) cDNA is hampered by the presence of sequences located in the coding region that repress transcription. We have previously identified a 305-bp fragment within the FVIII cDNA that is involved in the repression (R.C. Hoeben, F.J. Fallaux, S.J. Cramer, D.J.M. van den Wollenberg, H. van Ormondt, E. Briet, and A.J. van der Eb, Blood 85:2447-2454, 1995). Here, we show that this 305-bp region of FVIII cDNA contains sequences that resemble the yeast (Saccharomyces cerevisiae) autonomously replicating sequence consensus. Two of these DNA elements coincide with AT-rich sequences that are often found in matrix attachment regions or scaffold-attached regions. One of these elements, consisting of nucleotides 1569 to 1600 of the FVIII cDNA (nucleotide numbering is according to the system of Wood et al. (W.I. Wood, D.J. Capon, C.C. Simonsen, D.L. Eaton, J. Gitschier, D. Keyt, P.H. Seeburg, D.H. Smith, P. Hollingshead, K.L. Wion, et al., Nature [London] 312:330-337,1984), binds a nuclear factor in vitro but loses this capacity after four of its base pairs have been changed. A synthetic heptamer of this segment can repress the expression of a chloramphenicol acetyltransferase (CAT) reporter gene and also loses this capacity upon mutation. Furthermore, we demonstrate that repression by FVIII sequences can be relieved by sodium butyrate. We demonstrate that the synthetic heptamer (FVIII nucleotides 1569 to 1600), when placed upstream of the Moloney murine leukemia virus long terminal repeat promoter that drives the CAT reporter, can render the CAT reporter inducible by butyrate. This effect was absent when the same element was mutated. The stimulatory effect of butyrate could not be attributed to butyrate-responsive elements in the studied long terminal repeat promoters. Our data provide a functional characterization of the sequences that repress expression of the FVIII cDNA. These data also suggest a link between

  7. Sequences of conserved region in the A subunit of DNA gyrase from nine species of the genus Mycobacterium: phylogenetic analysis and implication for intrinsic susceptibility to quinolones.

    PubMed

    Guillemin, I; Cambau, E; Jarlier, V

    1995-09-01

    The sequences of a conserved region in the A subunit of DNA gyrase corresponding to the quinolone resistance-determining region were determined for nine mycobacterial species and were compared. Although the nucleotide sequences were highly conserved, they clearly differentiated one species from another. The results of the phylogenetic analysis based on the sequences of the quinolone resistance-determining regions were compared with those provided by the 16S rRNA sequences. Deduced amino acid sequences were identical within the nine species except for amino acid 83, which was frequently involved in acquired resistance to quinolones in many genera, including mycobacteria. The presence at position 83 of an alanine for seven mycobacterial species (M. tuberculosis, M. bovis BCG, M. leprae, M. avium, M. kansasii, M. chelonae, and M. smegmatis) and of a serine for the two remaining mycobacterial species (M. fortuitum and M. aurum) correlated well with the MICs of ofloxacin for both groups of species, suggesting the role of this residue in intrinsic susceptibility to quinolones in mycobacteria.

  8. Sequencing of the intergenic 16S-23S rRNA spacer (ITS) region of Mollicutes species and their identification using microarray-based assay and DNA sequencing.

    PubMed

    Volokhov, Dmitriy V; George, Joseph; Liu, Sue X; Ikonomi, Pranvera; Anderson, Christine; Chizhikov, Vladimir

    2006-08-01

    We have completed sequencing the 16S-23S rRNA intergenic transcribed spacer (ITS) region of most known Mycoplasma , Acholeplasma , Ureaplasma , Mesoplasma , and Spiroplasma species. Analysis of the sequence data revealed a significant interspecies variability and low intraspecies polymorphism of the ITS region among Mollicutes . This finding enabled the application of a combined polymerase chain reaction-microarray technology for identifying Mollicutes species. The microarray included individual species-specific oligonucleotide probes for characterizing human Mollicutes species and other species known to be common cell line contaminants. Evaluation of the microarray was conducted using multiple, previously characterized, Mollicutes species. The microarray analysis of the samples used demonstrated a highly specific assay, which is capable of rapid and accurate discrimination among Mollicutes species.

  9. Structural Complexity of DNA Sequence

    PubMed Central

    Liou, Cheng-Yuan; Cheng, Wei-Chen; Tsai, Huai-Ying

    2013-01-01

    In modern bioinformatics, finding an efficient way to allocate sequence fragments with biological functions is an important issue. This paper presents a structural approach based on context-free grammars extracted from original DNA or protein sequences. This approach is radically different from all those statistical methods. Furthermore, this approach is compared with a topological entropy-based method for consistency and difference of the complexity results. PMID:23662161

  10. A highly basic sequence at the N-terminal region is essential for targeting the DNA replication protein ORC1 to the nucleus in Leishmania donovani.

    PubMed

    Kumar, Devanand; Kumar, Diwakar; Saha, Swati

    2012-07-01

    The conserved eukaryotic DNA replication protein ORC1 is one of the constituents of pre-replication complexes that assemble at or very near origins prior to replication initiation. ORC1 has been shown to be constitutively nuclear in Leishmania major. This study investigates the sequences involved in nuclear localization of ORC1 in Leishmania donovani, the causative agent of visceral leishmaniasis. Nuclear localization signals (NLSs) have been reported in only a few Leishmania proteins. Functional analyses have delineated NLSs to regions of ~60 amino acids in length in the tyrosyl DNA phosphodiesterase I and type II DNA topoisomerase of L. donovani, and in the L. major kinesin KIN13-1. Using a panel of site-directed mutations we have identified a sequence essential for nuclear import of LdORC1. This sequence at the N terminus of the protein comprises residues 2-5 (KRSR), with K2, R3 and R5 being crucial. Independent mutation of the K2 residue causes exclusion of the protein from the nucleus, while mutating the R5 residue leads to diffusion of the protein throughout the cell. This sequence, however, is insufficient for targeting a heterologous protein (β-galactosidase) to the nucleus. Analysis of additional ORC1 mutations and reporter constructs reveals that while the highly basic tetra-amino acid sequence at the N terminus is essential for nuclear localization, the ORC1 NLS in its entirety is more complex, and of a distributive character. Our results suggest that nuclear localization signalling sequences in Leishmania nuclear proteins are more complex than what is typically seen in higher eukaryotes.

  11. Identification and Typing of Malassezia Species by Amplified Fragment Length Polymorphism and Sequence Analyses of the Internal Transcribed Spacer and Large-Subunit Regions of Ribosomal DNA

    PubMed Central

    Gupta, Aditya K.; Boekhout, Teun; Theelen, Bart; Summerbell, Richard; Batra, Roma

    2004-01-01

    Malassezia yeasts are associated with several dermatological disorders. The conventional identification of Malassezia species by phenotypic methods is complicated and time-consuming, and the results based on culture methods are difficult to interpret. A comparative molecular approach based on the use of three molecular techniques, namely, amplified fragment length polymorphism (AFLP) analysis, sequencing of the internal transcribed spacer, and sequencing of the D1 and D2 domains of the large-subunit ribosomal DNA region, was applied for the identification of Malassezia species. All species could be correctly identified by means of these methods. The results of AFLP analysis and sequencing were in complete agreement with each other. However, some discrepancies were noted when the molecular methods were compared with the phenotypic method of identification. Specific genotypes were distinguished within a collection of Malassezia furfur isolates from Canadian sources. AFLP analysis revealed significant geographical differences between the North American and European M. furfur strains. PMID:15365020

  12. Genomic organization of the human PAX 3 gene: DNA sequence analysis of the region disrupted in alveolar rhabdomyosarcoma

    SciTech Connect

    Macina, R.A.; Galili, N.; Riethman, H.C.

    1995-03-01

    Mutations in the human PAX3 gene have previously been associated with two distinct diseases, Waardenburg syndrome and alveolar rhabdomyosarcoma. In this report the authors establish that the normal human PAX3 gene is encoded by 8 exons. Intron-exon boundary sequences were obtained for PAX 3 exons 5, 6, 7, and 8 and together with previous work provide the complete genomic sequence organization for PAX3. Difficulties in obtaining overlapping genomic clone coverage of PAX3 were circumvented in part by RARE cleavage mapping, which showed that the entire PAX3 gene spans 100 kb of chromosome 2. Sequence analysis of the last intron of PAX3, which contains the previously mapped t(2;13)(q35;q14) translocation breakpoints of alveolar rhabdomyosarcoma, revealed the presence of a pair of inverted Alu repeats and a pair of inverted (GT){sub n}-rich microsatellite repeats with in a 5k-kb region. This work establishes the complete structure of PAX 3 and will permit high-resolution analyses of this locus for mutations associated with Waardenburg syndrome, alveolar rhabdomyosarcoma, and other phenotypes for which PAX3 may be a candidate locus.31 refs., 5 figs., 1 tab.

  13. The Complete Sequence of 340 kb of DNA around the Rice Adh1–Adh2 Region Reveals Interrupted Colinearity with Maize Chromosome 4

    PubMed Central

    Tarchini, Renato; Biddle, Phyllis; Wineland, Robin; Tingey, Scott; Rafalski, Antoni

    2000-01-01

    A 2.3-centimorgan (cM) segment of rice chromosome 11 consisting of 340 kb of DNA sequence around the alcohol dehydrogenase Adh1 and Adh2 loci was completely sequenced, revealing the presence of 33 putative genes, including several apparently involved in disease resistance. Fourteen of the genes were confirmed by identifying the corresponding transcripts. Five genes, spanning 1.9 cM of the region, cross-hybridized with maize genomic DNA and were genetically mapped in maize, revealing a stretch of colinearity with maize chromosome 4. The Adh1 gene marked one significant interruption. This gene mapped to maize chromosome 1, indicating a possible translocation of Adh1 after the evolutionary divergence leading to maize and sorghum. Several other genes, most notably genes similar to known disease resistance genes, showed no cross-hybridization with maize genomic DNA, suggesting sequence divergence or absence of these sequences in maize, which is in contrast to several other well-conserved genes, including Adh1 and Adh2. These findings indicate that the use of rice as the model system for other cereals may sometimes be complicated by the presence of rapidly evolving gene families and microtranslocations. Seven retrotransposons and eight transposons were identified in this rice segment, including a Tc1/Mariner–like element, which is new to rice. In contrast to maize, retroelements are less frequent in rice. Only 14.4% of this genome segment consist of retroelements. Miniature inverted repeat transposable elements were found to be the most frequently occurring class of repetitive elements, accounting for 18.8% of the total repetitive DNA. PMID:10715324

  14. Apparatus for improved DNA sequencing

    DOEpatents

    Douthart, Richard J.; Crowell, Shannon L.

    1996-01-01

    This invention is a means for the rapid sequencing of DNA samples. More specifically, it consists of a new design direct blotting electrophoresis unit. The DNA sequence is deposited on a membrane attached to a rotating drum. Initial data compaction is facilitated by the use of a machined multi-channeled plate called a ribbon channel plate. Each channel is an isolated mini gel system much like a gel filled capillary. The system as a whole, however, is in a slab gel like format with the advantages of uniformity and easy reusability. The system can be used in different embodiments. The drum system is unique in that after deposition the drum rotates the deposited DNA into a large non-buffer open space where processing and detection can occur. The drum can also be removed in toto to special workstations for downstream processing, multiplexing and detection.

  15. Apparatus for improved DNA sequencing

    DOEpatents

    Douthart, R.J.; Crowell, S.L.

    1996-05-07

    This invention is a means for the rapid sequencing of DNA samples. More specifically, it consists of a new design direct blotting electrophoresis unit. The DNA sequence is deposited on a membrane attached to a rotating drum. Initial data compaction is facilitated by the use of a machined multi-channeled plate called a ribbon channel plate. Each channel is an isolated mini gel system much like a gel filled capillary. The system as a whole, however, is in a slab gel like format with the advantages of uniformity and easy reusability. The system can be used in different embodiments. The drum system is unique in that after deposition the drum rotates the deposited DNA into a large non-buffer open space where processing and detection can occur. The drum can also be removed in toto to special workstations for downstream processing, multiplexing and detection. 18 figs.

  16. Nucleotide sequence of Marchantia polymorpha chloroplast DNA: a region possibly encoding three tRNAs and three proteins including a homologue of E. coli ribosomal protein S14.

    PubMed Central

    Umesono, K; Inokuchi, H; Ohyama, K; Ozeki, H

    1984-01-01

    The nucleotide sequence of a region of Marchantia polymorpha chloroplast DNA was determined. On this DNA sequence (3.38kb), three open reading frames (ORFs) and three putative tRNA genes were detected in the following order: -ORF701-tRNASer(UGA)-ORF702-tRNAGly(GCC)-initiator tRNAMet(CAU)-ORF703-. The ORF703 is composed of 100 codons in which those for lysine (15%) and arginine (11%) are abundant, and could be accounted for as a counterpart of E. coli ribosomal protein S14 since they share 45% homology in the amino acid sequences. The ORF701 appears to code for a membrane protein, showing a periodic appearance of seven clusters of hydrophobic amino acids. Although the mechanisms remain unknown, the ORF701 causes a streptomycin-sensitive phenotype in resistant mutants of E. coli. The ORFs and tRNA genes are separated from each other by extremely AT-rich spacers containing sequences of dyad symmetry. The third letter positions of the codons in the ORFs are also rich in A and T residues. PMID:6393057

  17. The sequence of sequencers: The history of sequencing DNA

    PubMed Central

    Heather, James M.; Chain, Benjamin

    2016-01-01

    Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way. PMID:26554401

  18. Non-random DNA fragmentation in next-generation sequencing

    NASA Astrophysics Data System (ADS)

    Poptsova, Maria S.; Il'Icheva, Irina A.; Nechipurenko, Dmitry Yu.; Panchenko, Larisa A.; Khodikov, Mingian V.; Oparina, Nina Y.; Polozov, Robert V.; Nechipurenko, Yury D.; Grokhovsky, Sergei L.

    2014-03-01

    Next Generation Sequencing (NGS) technology is based on cutting DNA into small fragments, and their massive parallel sequencing. The multiple overlapping segments termed ``reads'' are assembled into a contiguous sequence. To reduce sequencing errors, every genome region should be sequenced several dozen times. This sequencing approach is based on the assumption that genomic DNA breaks are random and sequence-independent. However, previously we showed that for the sonicated restriction DNA fragments the rates of double-stranded breaks depend on the nucleotide sequence. In this work we analyzed genomic reads from NGS data and discovered that fragmentation methods based on the action of the hydrodynamic forces on DNA, produce similar bias. Consideration of this non-random DNA fragmentation may allow one to unravel what factors and to what extent influence the non-uniform coverage of various genomic regions.

  19. Post-glacial recolonization of the Great Lakes region by the common gartersnake (Thamnophis sirtalis) inferred from mtDNA sequences.

    PubMed

    Placyk, John S; Burghardt, Gordon M; Small, Randall L; King, Richard B; Casper, Gary S; Robinson, Jace W

    2007-05-01

    Pleistocene events played an important role in the differentiation of North American vertebrate populations. Michigan, in particular, and the Great Lakes region, in general, were greatly influenced by the last glaciation. While several hypotheses regarding the recolonization of this region have been advanced, none have been strongly supported. We generated 148 complete ND2 mitochondrial DNA (mtDNA) sequences from common gartersnake (Thamnophis sirtalis) populations throughout the Great Lakes region to evaluate phylogeographic patterns and population structure and to determine whether the distribution of haplotypic variants is related to the post-Pleistocene retreat of the Wisconsinan glacier. The common gartersnake was utilized, as it is believed to have been one of the primary vertebrate invaders of the Great Lakes region following the most recent period of glacial retreat and because it has been a model species for a variety of evolutionary, ecological, behavioral, and physiological studies. Several genetically distinct evolutionary lineages were supported by both genealogical and molecular population genetic analyses, although to different degrees. The geographic distribution of the majority of these lineages is interpreted as reflecting post-glacial recolonization dynamics during the late Pleistocene. These findings generally support previous hypotheses of range expansion in this region.

  20. Genetic relationships among some subspecies of the Peregrine Falcon (Falco peregrinus L.), inferred from mitochondrial DNA control-region sequences

    USGS Publications Warehouse

    White, Clayton M.; Sonsthagen, Sarah A.; Sage, George K.; Anderson, Clifford; Talbot, Sandra L.

    2013-01-01

    The ability to successfully colonize and persist in diverse environments likely requires broad morphological and behavioral plasticity and adaptability, and this may partly explain why the Peregrine Falcon (Falco peregrinus) exhibits a large range of morphological characteristics across their global distribution. Regional and local differences within Peregrine Falcons were sufficiently variable that ∼75 subspecies have been described; many were subsumed, and currently 19 are generally recognized. We used sequence information from the control region of the mitochondrial genome to test for concordance between genetic structure and representatives of 12 current subspecies and from two areas where subspecies distributions overlap. Haplotypes were broadly shared among subspecies, and all geographic locales shared a widely distributed common haplotype (FalconCR2). Haplotypes were distributed in a star-like phylogeny, consistent with rapid expansion of a recently derived species, with observed genetic patterns congruent with incomplete lineage sorting and/or differential rates of evolution on morphology and neutral genetic characters. Hierarchical analyses of molecular variance did not uncover genetic partitioning at the continental level, despite strong population-level structure (FST = 0.228). Similar analyses found weak partitioning, albeit significant, among subspecies (FCT = 0.138). All reconstructions placed the hierofalcons' (Gyrfalcon [F. rusticolus] and Saker Falcon [F. cherrug]) haplotypes in a well-supported clade either basal or unresolved with respect to the Peregrine Falcon. In addition, haplotypes representing Taita Falcon (F. fasciinucha) were placed within the Peregrine Falcon clade.

  1. Classification and phylogeny of sika deer (Cervus nippon) subspecies based on the mitochondrial control region DNA sequence using an extended sample set.

    PubMed

    Ba, Hengxing; Yang, Fuhe; Xing, Xiumei; Li, Chunyi

    2015-06-01

    To further refine the classification and phylogeny of sika deer subspecies, the well-annotated sequences of the complete mitochondrial DNA (mtDNA) control region of 13 sika deer subspecies from GenBank were downloaded, aligned and analyzed in this study. By reconstructing the phylogenetic tree with an extended sample set, the results revealed a split between Northern and Southern Mainland Asia/Taiwan lineages, and moreover, two subspecies, C.n.mantchuricus and C.n.hortulorum, were existed in Northern Mainland Asia. Unexpectedly, Dybowskii's sika deer that was thought to originate from Northern Mainland Asia joins the Southern Mainland Asia/Taiwan lineage. The genetic divergences were ranged from 2.1% to 4.7% between Dybowskii's sika deer and all the other established subspecies at the mtDNA sequence level, which suggests that the maternal lineage of uncertain sika subspecies in Europe had been maintained until today. This study also provides a better understanding for the classification, phylogeny and phylogeographic history of sika deer subspecies.

  2. Intraspecific variation in Radopholus similis isolates assessed with restriction fragment length polymorphism and DNA sequencing of the internal transcribed spacer region of the ribosomal RNA cistron.

    PubMed

    Elbadri, Gamal A A; De Ley, Paul; Waeyenberge, Lieven; Vierstraete, Andy; Moens, Maurice; Vanfleteren, Jacques

    2002-02-01

    Restriction fragment length polymorphism and direct sequencing of the internal transcribed spacer rDNA region of 19 isolates of Radopholus similis yielded significant diversity, both among isolates and within some individuals. Restriction fragment length polymorphism with HaeIII, AluI and Tru9I yielded two sets of patterns. Digestion with RsaI revealed one or two supernumerary bands in single nematodes from five isolates, and sequencing confirmed microheterogeneity in four of these. Phylogenetic analysis grouped most isolates closely together, except for the five isolates with additional bands for RsaI. Our data reveal more population structure than previously found and lend further support to the synonymy of R. similis and 'Radopholus citrophilus'.

  3. Cloning, characterization, and DNA sequence of the rfaLK region for lipopolysaccharide synthesis in Salmonella typhimurium LT2.

    PubMed Central

    MacLachlan, P R; Kadam, S K; Sanderson, K E

    1991-01-01

    We have cloned and sequenced the rfaL and rfaK genes for lipopolysaccharide synthesis in Salmonella typhimurium LT2 on a 4.28-kb HindIII fragment from the previously described R' factor pKZ3 (S. K. Kadam, A. Rehemtulla, and K. E. Sanderson, J. Bacteriol. 161:277-284, 1985). rfaL is thought to encode a component of the O-antigen ligase, and rfaK is believed to encode the N-acetylglucosamine transferase. The genes were identified by the loss of complementation of prototype rfaL and rfaK mutations after Tn1000 mutagenesis. Translation of the nucleotide sequence predicted sizes of 45.9 and 43.1 kDa for the rfaL and rfaK gene products, respectively. Hydropathy analysis of the rfaL product suggested that it was an integral membrane protein. A third gene, rfaZ, was found to be an 808-bp open reading frame on the pyrE side of rfaK. Insertions into rfaZ reduced rfaK complementation, suggesting cotranscription in the pyrE-cysE direction. The rfaL gene is transcribed in the opposite direction in a separate operon which may also include rfaC. An incomplete open reading frame with homology to an Escherichia coli gene in the same region, rfaY, was found on the pyrE side of rfaZ. Complementation studies with Tn1000 insertions in rfaL showed that rfaL446 and rfaL447 are allelic. With the cloning of the rfaL and -K genes, the order of genes within the rfa cluster at 79 units on the linkage map was found to be cysE-rfaDFCLKZYJIBG-pyrE. Images FIG. 3 PMID:1657881

  4. Channel plate for DNA sequencing

    DOEpatents

    Douthart, Richard J.; Crowell, Shannon L.

    1998-01-01

    This invention is a channel plate that facilitates data compaction in DNA sequencing. The channel plate has a length, a width and a thickness, and further has a plurality of channels that are parallel. Each channel has a depth partially through the thickness of the channel plate. Additionally an interface edge permits electrical communication across an interface through a buffer to a deposition membrane surface.

  5. Channel plate for DNA sequencing

    DOEpatents

    Douthart, R.J.; Crowell, S.L.

    1998-01-13

    This invention is a channel plate that facilitates data compaction in DNA sequencing. The channel plate has a length, a width and a thickness, and further has a plurality of channels that are parallel. Each channel has a depth partially through the thickness of the channel plate. Additionally an interface edge permits electrical communication across an interface through a buffer to a deposition membrane surface. 15 figs.

  6. DNA Sequencing Using capillary Electrophoresis

    SciTech Connect

    Dr. Barry Karger

    2011-05-09

    The overall goal of this program was to develop capillary electrophoresis as the tool to be used to sequence for the first time the Human Genome. Our program was part of the Human Genome Project. In this work, we were highly successful and the replaceable polymer we developed, linear polyacrylamide, was used by the DOE sequencing lab in California to sequence a significant portion of the human genome using the MegaBase multiple capillary array electrophoresis instrument. In this final report, we summarize our efforts and success. We began our work by separating by capillary electrophoresis double strand oligonucleotides using cross-linked polyacrylamide gels in fused silica capillaries. This work showed the potential of the methodology. However, preparation of such cross-linked gel capillaries was difficult with poor reproducibility, and even more important, the columns were not very stable. We improved stability by using non-cross linked linear polyacrylamide. Here, the entangled linear chains could move when osmotic pressure (e.g. sample injection) was imposed on the polymer matrix. This relaxation of the polymer dissipated the stress in the column. Our next advance was to use significantly lower concentrations of the linear polyacrylamide that the polymer could be automatically blown out after each run and replaced with fresh linear polymer solution. In this way, a new column was available for each analytical run. Finally, while testing many linear polymers, we selected linear polyacrylamide as the best matrix as it was the most hydrophilic polymer available. Under our DOE program, we demonstrated initially the success of the linear polyacrylamide to separate double strand DNA. We note that the method is used even today to assay purity of double stranded DNA fragments. Our focus, of course, was on the separation of single stranded DNA for sequencing purposes. In one paper, we demonstrated the success of our approach in sequencing up to 500 bases. Other

  7. The Historical Demography and Genetic Variation of the Endangered Cycas multipinnata (Cycadaceae) in the Red River Region, Examined by Chloroplast DNA Sequences and Microsatellite Markers

    PubMed Central

    Gong, Yi-Qing; Zhan, Qing-Qing; Nguyen, Khang Sinh; Nguyen, Hiep Tien; Wang, Yue-Hua; Gong, Xun

    2015-01-01

    Cycas multipinnata C.J. Chen & S.Y. Yang is a cycad endemic to the Red River drainage region that occurs under evergreen forest on steep limestone slopes in Southwest China and northern Vietnam. It is listed as endangered due to habitat loss and over-collecting for the ornamental plant trade, and only several populations remain. In this study, we assess the genetic variation, population structure, and phylogeography of C. multipinnata populations to help develop strategies for the conservation of the species. 60 individuals from six populations were used for chloroplast DNA (cpDNA) sequencing and 100 individuals from five populations were genotyped using 17 nuclear microsatellites. High genetic differentiation among populations was detected, suggesting that pollen or seed dispersal was restricted within populations. Two main genetic clusters were observed in both the cpDNA and microsatellite loci, corresponding to Yunnan China and northern Vietnam. These clusters indicated low levels of gene flow between the regions since their divergence in the late Pleistocene, which was inferred from both Bayesian and coalescent analysis. In addition, the result of a Bayesian skyline plot based on cpDNA portrayed a long history of constant population size followed by a decline in the last 50,000 years of C. multipinnata that was perhaps affected by the Quaternary glaciations, a finding that was also supported by the Garza-Williamson index calculated from the microsatellite data. The genetic consequences produced by climatic oscillations and anthropogenic disturbances are considered key pressures on C. multipinnata. To establish a conservation management plan, each population of C. multipinnata should be recognized as a Management Unit (MU). In situ and ex situ actions, such as controlling overexploitation and creating a germplasm bank with high genetic diversity, should be urgently implemented to preserve this species. PMID:25689828

  8. Particle sizer and DNA sequencer

    DOEpatents

    Olivares, Jose A.; Stark, Peter C.

    2005-09-13

    An electrophoretic device separates and detects particles such as DNA fragments, proteins, and the like. The device has a capillary which is coated with a coating with a low refractive index such as Teflon.RTM. AF. A sample of particles is fluorescently labeled and injected into the capillary. The capillary is filled with an electrolyte buffer solution. An electrical field is applied across the capillary causing the particles to migrate from a first end of the capillary to a second end of the capillary. A detector light beam is then scanned along the length of the capillary to detect the location of the separated particles. The device is amenable to a high throughput system by providing additional capillaries. The device can also be used to determine the actual size of the particles and for DNA sequencing.

  9. Investigating the Prehistory of Tungusic Peoples of Siberia and the Amur-Ussuri Region with Complete mtDNA Genome Sequences and Y-chromosomal Markers

    PubMed Central

    Duggan, Ana T.; Whitten, Mark; Wiebe, Victor; Crawford, Michael; Butthof, Anne; Spitsyn, Victor; Makarov, Sergey; Novgorodov, Innokentiy; Osakovsky, Vladimir; Pakendorf, Brigitte

    2013-01-01

    Evenks and Evens, Tungusic-speaking reindeer herders and hunter-gatherers, are spread over a wide area of northern Asia, whereas their linguistic relatives the Udegey, sedentary fishermen and hunter-gatherers, are settled to the south of the lower Amur River. The prehistory and relationships of these Tungusic peoples are as yet poorly investigated, especially with respect to their interactions with neighbouring populations. In this study, we analyse over 500 complete mtDNA genome sequences from nine different Evenk and even subgroups as well as their geographic neighbours from Siberia and their linguistic relatives the Udegey from the Amur-Ussuri region in order to investigate the prehistory of the Tungusic populations. These data are supplemented with analyses of Y-chromosomal haplogroups and STR haplotypes in the Evenks, Evens, and neighbouring Siberian populations. We demonstrate that whereas the North Tungusic Evenks and Evens show evidence of shared ancestry both in the maternal and in the paternal line, this signal has been attenuated by genetic drift and differential gene flow with neighbouring populations, with isolation by distance further shaping the maternal genepool of the Evens. The Udegey, in contrast, appear quite divergent from their linguistic relatives in the maternal line, with a mtDNA haplogroup composition characteristic of populations of the Amur-Ussuri region. Nevertheless, they show affinities with the Evenks, indicating that they might be the result of admixture between local Amur-Ussuri populations and Tungusic populations from the north. PMID:24349531

  10. Chloroplast DNA analysis of Tunisian cork oak populations (Quercus suber L.): sequence variations and molecular evolution of the trnL (UAA)-trnF (GAA) region.

    PubMed

    Abdessamad, A; Baraket, G; Sakka, H; Ammari, Y; Ksontini, M; Hannachi, A Salhi

    2016-10-24

    Sequences of the trnL-trnF spacer and combined trnL-trnF region in chloroplast DNA of cork oak (Quercus suber L.) were analyzed to detect polymorphisms and to elucidate molecular evolution and demographic history. The aligned sequences varied in length and nucleotide composition. The overall ratio of transition/transversion (ti/tv) of 0.724 for the intergenic spacer and 0.258 for the pooled sequences were estimated, and indicated that transversions are more frequent than transitions. The molecular evolution and demographic history of Q. suber were investigated. Neutrality tests (Tajima's D and Fu and Li) ruled out the null hypothesis of a strictly neutral model, and Fu's Fs and Ramos-Onsins and Rozas' R2 confirmed the recent expansion of cork oak trees, validating its persistency in North Africa since the last glaciation during the Quaternary. The observed uni-modal mismatch distribution and the Harpending's raggedness index confirmed the demographic history model for cork oak. A phylogenetic dendrogram showed that the distribution of Q. suber trees occurs independently of geographical origin, the relief of the population site, and the bioclimatic stages. The molecular history and cytoplasmic diversity suggest that in situ and ex situ conservation strategies can be recommended for preserving landscape value and facing predictable future climatic changes.

  11. Sequence and molecular characterization of a DNA region encoding the dibenzothiophene desulfurization operon of Rhodococcus sp. strain IGTS8.

    PubMed

    Piddington, C S; Kovacevich, B R; Rambosek, J

    1995-02-01

    Dibenzothiophene (DBT), a model compound for sulfur-containing organic molecules found in fossil fuels, can be desulfurized to 2-hydroxybiphenyl (2-HBP) by Rhodococcus sp. strain IGTS8. Complementation of a desulfurization (dsz) mutant provided the genes from Rhodococcus sp. strain IGTS8 responsible for desulfurization. A 6.7-kb TaqI fragment cloned in Escherichia coli-Rhodococcus shuttle vector pRR-6 was found to both complement this mutation and confer desulfurization to Rhodococcus fascians, which normally is not able to desulfurize DBT. Expression of this fragment in E. coli also conferred the ability to desulfurize DBT. A molecular analysis of the cloned fragment revealed a single operon containing three open reading frames involved in the conversion of DBT to 2-HBP. The three genes were designated dszA, dszB, and dszC. Neither the nucleotide sequences nor the deduced amino acid sequences of the enzymes exhibited significant similarity to sequences obtained from the GenBank, EMBL, and Swiss-Prot databases, indicating that these enzymes are novel enzymes. Subclone analyses revealed that the gene product of dszC converts DBT directly to DBT-sulfone and that the gene products of dszA and dszB act in concert to convert DBT-sulfone to 2-HBP.

  12. Spectral entropy criteria for structural segmentation in genomic DNA sequences

    NASA Astrophysics Data System (ADS)

    Chechetkin, V. R.; Lobzin, V. V.

    2004-07-01

    The spectral entropy is calculated with Fourier structure factors and characterizes the level of structural ordering in a sequence of symbols. It may efficiently be applied to the assessment and reconstruction of the modular structure in genomic DNA sequences. We present the relevant spectral entropy criteria for the local and non-local structural segmentation in DNA sequences. The results are illustrated with the model examples and analysis of intervening exon-intron segments in the protein-coding regions.

  13. Complete sequence of Euglena gracilis chloroplast DNA.

    PubMed Central

    Hallick, R B; Hong, L; Drager, R G; Favreau, M R; Monfort, A; Orsat, B; Spielmann, A; Stutz, E

    1993-01-01

    We report the complete DNA sequence of the Euglena gracilis, Pringsheim strain Z chloroplast genome. This circular DNA is 143,170 bp, counting only one copy of a 54 bp tandem repeat sequence that is present in variable copy number within a single culture. The overall organization of the genome involves a tandem array of three complete and one partial ribosomal RNA operons, and a large single copy region. There are genes for the 16S, 5S, and 23S rRNAs of the 70S chloroplast ribosomes, 27 different tRNA species, 21 ribosomal proteins plus the gene for elongation factor EF-Tu, three RNA polymerase subunits, and 27 known photosynthesis-related polypeptides. Several putative genes of unknown function have also been identified, including five within large introns, and five with amino acid sequence similarity to genes in other organisms. This genome contains at least 149 introns. There are 72 individual group II introns, 46 individual group III introns, 10 group II introns and 18 group III introns that are components of twintrons (introns-within-introns), and three additional introns suspected to be twintrons composed of multiple group II and/or group III introns, but not yet characterized. At least 54,804 bp, or 38.3% of the total DNA content is represented by introns. PMID:8346031

  14. The Value of DNA Sequencing - TCGA

    Cancer.gov

    DNA sequencing: what it tells us about DNA changes in cancer, how looking across many tumors will help to identify meaningful changes and potential drug targets, and how genomics is changing the way we think about cancer.

  15. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  16. DNA sequence from Cretaceous period bone fragments.

    PubMed

    Woodward, S R; Weyand, N J; Bunnell, M

    1994-11-18

    DNA was extracted from 80-million-year-old bone fragments found in strata of the Upper Cretaceous Blackhawk Formation in the roof of an underground coal mine in eastern Utah. This DNA was used as the template in a polymerase chain reaction that amplified and sequenced a portion of the gene encoding mitochondrial cytochrome b. These sequences differ from all other cytochrome b sequences investigated, including those in the GenBank and European Molecular Biology Laboratory databases. DNA isolated from these bone fragments and the resulting gene sequences demonstrate that small fragments of DNA may survive in bone for millions of years.

  17. Highly conserved repetitive DNA sequences are present at human centromeres.

    PubMed Central

    Grady, D L; Ratliff, R L; Robinson, D L; McCanlies, E C; Meyne, J; Moyzis, R K

    1992-01-01

    Highly conserved repetitive DNA sequence clones, largely consisting of (GGAAT)n repeats, have been isolated from a human recombinant repetitive DNA library by high-stringency hybridization with rodent repetitive DNA. This sequence, the predominant repetitive sequence in human satellites II and III, is similar to the essential core DNA of the Saccharomyces cerevisiae centromere, centromere DNA element (CDE) III. In situ hybridization to human telophase and Drosophila polytene chromosomes shows localization of the (GGAAT)n sequence to centromeric regions. Hyperchromicity studies indicate that the (GGAAT)n sequence exhibits unusual hydrogen bonding properties. The purine-rich strand alone has the same thermal stability as the duplex. Hyperchromicity studies of synthetic DNA variants indicate that all sequences with the composition (AATGN)n exhibit this unusual thermal stability. DNA-mobility-shift assays indicate that specific HeLa-cell nuclear proteins recognize this sequence with a relative affinity greater than 10(5). The extreme evolutionary conservation of this DNA sequence, its centromeric location, its unusual hydrogen bonding properties, its high affinity for specific nuclear proteins, and its similarity to functional centromeres isolated from yeast suggest that this sequence may be a component of the functional human centromere. Images PMID:1542662

  18. "First generation" automated DNA sequencing technology.

    PubMed

    Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M

    2011-10-01

    Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines.

  19. Haplogrouping mitochondrial DNA sequences in Legal Medicine/Forensic Genetics.

    PubMed

    Bandelt, Hans-Jürgen; van Oven, Mannis; Salas, Antonio

    2012-11-01

    Haplogrouping refers to the classification of (partial) mitochondrial DNA (mtDNA) sequences into haplogroups using the current knowledge of the worldwide mtDNA phylogeny. Haplogroup assignment of mtDNA control-region sequences assists in the focused comparison with closely related complete mtDNA sequences and thus serves two main goals in forensic genetics: first is the a posteriori quality analysis of sequencing results and second is the prediction of relevant coding-region sites for confirmation or further refinement of haplogroup status. The latter may be important in forensic casework where discrimination power needs to be as high as possible. However, most articles published in forensic genetics perform haplogrouping only in a rudimentary or incorrect way. The present study features PhyloTree as the key tool for assigning control-region sequences to haplogroups and elaborates on additional Web-based searches for finding near-matches with complete mtDNA genomes in the databases. In contrast, none of the automated haplogrouping tools available can yet compete with manual haplogrouping using PhyloTree plus additional Web-based searches, especially when confronted with artificial recombinants still present in forensic mtDNA datasets. We review and classify the various attempts at haplogrouping by using a multiplex approach or relying on automated haplogrouping. Furthermore, we re-examine a few articles in forensic journals providing mtDNA population data where appropriate haplogrouping following PhyloTree immediately highlights several kinds of sequence errors.

  20. Phylogenetic Analysis of a 'Jewel Orchid' Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions.

    PubMed

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1) Goodyera is not monophyletic; 2) Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3) sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection.

  1. Fibonacci Sequence and Supramolecular Structure of DNA.

    PubMed

    Shabalkin, I P; Grigor'eva, E Yu; Gudkova, M V; Shabalkin, P I

    2016-05-01

    We proposed a new model of supramolecular DNA structure. Similar to the previously developed by us model of primary DNA structure [11-15], 3D structure of DNA molecule is assembled in accordance to a mathematic rule known as Fibonacci sequence. Unlike primary DNA structure, supramolecular 3D structure is assembled from complex moieties including a regular tetrahedron and a regular octahedron consisting of monomers, elements of the primary DNA structure. The moieties of the supramolecular DNA structure forming fragments of regular spatial lattice are bound via linker (joint) sequences of the DNA chain. The lattice perceives and transmits information signals over a considerable distance without acoustic aberrations. Linker sequences expand conformational space between lattice segments allowing their sliding relative to each other under the action of external forces. In this case, sliding is provided by stretching of the stacked linker sequences.

  2. PCR detection and DNA sequence analysis of the regulatory region of lymphotropic papovavirus in peripheral blood mononuclear cells of an immunocompromised rhesus macaque

    NASA Technical Reports Server (NTRS)

    Lednicky, John A.; Halvorson, Steven J.; Butel, Janet S.

    2002-01-01

    A lymphotropic papovavirus (LPV) archetypal regulatory region was amplified from DNA from the blood of an immunocompromised rhesus monkey. We believe this is the first nonserological evidence of LPV infection in rhesus monkeys.

  3. Sequence and Structure Dependent DNA-DNA Interactions

    NASA Astrophysics Data System (ADS)

    Kopchick, Benjamin; Qiu, Xiangyun

    Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.

  4. Interaction of two sequence-specific single-stranded DNA-binding proteins with an essential region of the beta-casein gene promoter is regulated by lactogenic hormones.

    PubMed Central

    Altiok, S; Groner, B

    1993-01-01

    Transcription of the beta-casein gene in mammary epithelial cells is regulated by the lactogenic hormones insulin, glucocorticoids, and prolactin. The DNA sequence elements in the promoter which confer the action of the hormones on the transcriptional machinery and the nuclear proteins binding to this region have been investigated. We found that 221 nucleotides of promoter sequence 5' of the RNA start site are sufficient to mediate the induction of a chloramphenicol acetyltransferase reporter gene in transfected HC11 mammary epithelial cells. Deletion of 5' sequences to position -183 results in a construct with enhanced basal activity which still retains inducibility. A -170 beta-casein promoter-chloramphenicol acetyltransferase construct has very low transcriptional activity, which indicates the presence of a negative regulatory in the region between -221 and -183 and a positive regulatory element between -183 and -170. Band shift analysis showed that the promoter region between -194 and -163 specifically binds two nuclear proteins. The proteins are sequence-specific, single-stranded DNA-binding proteins which exclusively recognize the upper DNA strand and most likely play a repressing role in transcription. DNA binding activity of these nuclear proteins was observed only in nuclear extracts from mammary glands of mice in late pregnancy and postlactation, not during lactation. Hormonal control of the DNA binding activity of these proteins was also observed in the mammary epithelial cell line HC11. Mixing experiments showed that extracts from mammary tissue of lactating mice and from lactogenic hormone-treated HC11 cells contain an activity which can suppress the DNA binding of the single-stranded DNA-binding proteins.2+ identical specificity to the single-stranded DNA. Images PMID:8246951

  5. Using DNA looping to measure sequence dependent DNA elasticity

    NASA Astrophysics Data System (ADS)

    Kandinov, Alan; Raghunathan, Krishnan; Meiners, Jens-Christian

    2012-10-01

    We are using tethered particle motion (TPM) microscopy to observe protein-mediated DNA looping in the lactose repressor system in DNA constructs with varying AT / CG content. We use these data to determine the persistence length of the DNA as a function of its sequence content and compare the data to direct micromechanical measurements with constant-force axial optical tweezers. The data from the TPM experiments show a much smaller sequence effect on the persistence length than the optical tweezers experiments.

  6. Molecular phylogeny of the subgenus Ceratotropis (genus Vigna, Leguminosae) reveals three eco-geographical groups and Late Pliocene–Pleistocene diversification: evidence from four plastid DNA region sequences

    PubMed Central

    Javadi, Firouzeh; Tun, Ye Tun; Kawase, Makoto; Guan, Kaiyun; Yamaguchi, Hirofumi

    2011-01-01

    Background and Aims The subgenus Ceratotropis in the genus Vigna is widely distributed from the Himalayan highlands to South, Southeast and East Asia. However, the interspecific and geographical relationships of its members are poorly understood. This study investigates the phylogeny and biogeography of the subgenus Ceratotropis using chloroplast DNA sequence data. Methods Sequence data from four intergenic spacer regions (petA-psbJ, psbD-trnT, trnT-trnE and trnT-trnL) of chloroplast DNA, alone and in combination, were analysed using Bayesian and parsimony methods. Divergence times for major clades were estimated with penalized likelihood. Character evolution was examined by means of parsimony optimization and MacClade. Key Results Parsimony and Bayesian phylogenetic analyses on the combined data demonstrated well-resolved species relationships in which 18 Vigna species were divided into two major geographical clades: the East Asia–Southeast Asian clade and the Indian subcontinent clade. Within these two clades, three well-supported eco-geographical groups, temperate and subtropical (the East Asia–Southeast Asian clade) and tropical (the Indian subcontinent clade), are recognized. The temperate group consists of V. minima, V. nepalensis and V. angularis. The subtropical group comprises the V. nakashimae–V. riukiuensis–V. minima subgroup and the V. hirtella–V. exilis–V. umbellata subgroup. The tropical group contains two subgroups: the V. trinervia–V. reflexo-pilosa–V. trilobata subgroup and the V. mungo–V. grandiflora subgroup. An evolutionary rate analysis estimated the divergence time between the East Asia–Southeast Asia clade and the Indian subcontinent clade as 3·62 ± 0·3 million years, and that between the temperate and subtropical groups as 2·0 ± 0·2 million years. Conclusions The findings provide an improved understanding of the interspecific relationships, and ecological and geographical phylogenetic structure of the subgenus

  7. Multiple tag labeling method for DNA sequencing

    DOEpatents

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  8. Multiple tag labeling method for DNA sequencing

    DOEpatents

    Mathies, Richard A.; Huang, Xiaohua C.; Quesada, Mark A.

    1995-01-01

    A DNA sequencing method described which uses single lane or channel electrophoresis. Sequencing fragments are separated in said lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radio-isotope labels.

  9. Sequence of figwort mosaic virus DNA (caulimovirus group).

    PubMed

    Richins, R D; Scholthof, H B; Shepherd, R J

    1987-10-26

    The nucleotide sequence of an infectious clone of figwort mosaic virus (FMV) was determined using the dideoxynucleotide chain termination method. The double-stranded DNA genome (7743 base pairs) contained eight open reading frames (ORFs), seven of which corresponded approximately in size and location to the ORFs found in the genome of cauliflower mosaic virus (CaMV) and carnation etched ring virus (CERV). ORFs I and V of FMV demonstrated the highest degrees of nucleotide and amino acid sequence homology with the equivalent coding regions of CaMV and CERV. Regions II, III and IV showed somewhat less homology with the analogous regions of CaMV and CERV, and ORF VI showed homology with the corresponding gene of CaMV and CERV in only a short segment near the middle of the putative gene product. A 16 nucleotide sequence, complementary to the 3' terminus of methionine initiator tRNA (tRNAimet) and presumed to be the primer binding site for initiation of reverse transcription to produce minus strand DNA, was found in the FMV genome near the discontinuity in the minus strand. Sequences near the three interruptions in the plus strand of FMV DNA bear strong resemblance to similarly located sequences of 3 other caulimoviruses and are inferred to be initiation sites for second strand DNA synthesis. Additional conserved sequences in the small and large intergenic regions are pointed out including a highly conserved 35 bp sequence that occurs in the latter region.

  10. Fractal analysis of DNA sequence data

    SciTech Connect

    Berthelsen, C.L.

    1993-01-01

    DNA sequence databases are growing at an almost exponential rate. New analysis methods are needed to extract knowledge about the organization of nucleotides from this vast amount of data. Fractal analysis is a new scientific paradigm that has been used successfully in many domains including the biological and physical sciences. Biological growth is a nonlinear dynamic process and some have suggested that to consider fractal geometry as a biological design principle may be most productive. This research is an exploratory study of the application of fractal analysis to DNA sequence data. A simple random fractal, the random walk, is used to represent DNA sequences. The fractal dimension of these walks is then estimated using the [open quote]sandbox method[close quote]. Analysis of 164 human DNA sequences compared to three types of control sequences (random, base-content matched, and dimer-content matched) reveals that long-range correlations are present in DNA that are not explained by base or dimer frequencies. The study also revealed that the fractal dimension of coding sequences was significantly lower than sequences that were primarily noncoding, indicating the presence of longer-range correlations in functional sequences. The multifractal spectrum is used to analyze fractals that are heterogeneous and have a different fractal dimension for subsets with different scalings. The multifractal spectrum of the random walks of twelve mitochondrial genome sequences was estimated. Eight vertebrate mtDNA sequences had uniformly lower spectra values than did four invertebrate mtDNA sequences. Thus, vertebrate mitochondria show significantly longer-range correlations than to invertebrate mitochondria. The higher multifractal spectra values for invertebrate mitochondria suggest a more random organization of the sequences. This research also includes considerable theoretical work on the effects of finite size, embedding dimension, and scaling ranges.

  11. Alignment method for spectrograms of DNA sequences.

    PubMed

    Bucur, Anca; van Leeuwen, Jasper; Dimitrova, Nevenka; Mittal, Chetan

    2010-01-01

    DNA spectrograms express the periodicities of each of the four nucleotides A, T, C, and G in one or several genomic sequences to be analyzed. DNA spectral analysis can be applied to systematically investigate DNA patterns, which may correspond to relevant biological features. As opposed to looking at nucleotide sequences, spectrogram analysis may detect structural characteristics in very long sequences that are not identifiable by sequence alignment. Alignment of DNA spectrograms can be used to facilitate analysis of very long sequences or entire genomes at different resolutions. Standard clustering algorithms have been used in spectral analysis to find strong patterns in spectra. However, as they use a global distance metric, these algorithms can only detect strong patterns coexisting in several frequencies. In this paper, we propose a new method and several algorithms for aligning spectra suitable for efficient spectral analysis and allowing for the easy detection of strong patterns in both single frequencies and multiple frequencies.

  12. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    USGS Publications Warehouse

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  13. DNA sequencing: bench to bedside and beyond†

    PubMed Central

    Hutchison, Clyde A.

    2007-01-01

    Fifteen years elapsed between the discovery of the double helix (1953) and the first DNA sequencing (1968). Modern DNA sequencing began in 1977, with development of the chemical method of Maxam and Gilbert and the dideoxy method of Sanger, Nicklen and Coulson, and with the first complete DNA sequence (phage ϕX174), which demonstrated that sequence could give profound insights into genetic organization. Incremental improvements allowed sequencing of molecules >200 kb (human cytomegalovirus) leading to an avalanche of data that demanded computational analysis and spawned the field of bioinformatics. The US Human Genome Project spurred sequencing activity. By 1992 the first ‘sequencing factory’ was established, and others soon followed. The first complete cellular genome sequences, from bacteria, appeared in 1995 and other eubacterial, archaebacterial and eukaryotic genomes were soon sequenced. Competition between the public Human Genome Project and Celera Genomics produced working drafts of the human genome sequence, published in 2001, but refinement and analysis of the human genome sequence will continue for the foreseeable future. New ‘massively parallel’ sequencing methods are greatly increasing sequencing capacity, but further innovations are needed to achieve the ‘thousand dollar genome’ that many feel is prerequisite to personalized genomic medicine. These advances will also allow new approaches to a variety of problems in biology, evolution and the environment. PMID:17855400

  14. Nucleotide capacitance calculation for DNA sequencing

    SciTech Connect

    Lu, Jun-Qiang; Zhang, Xiaoguang

    2008-01-01

    Using a first-principles linear response theory, the capacitance of the DNA nucleotides, adenine, cytosine, guanine and thymine, are calculated. The difference in the capacitance between the nucleotides is studied with respect to conformational distortion. The result suggests that although an alternate current capacitance measurement of a single-stranded DNA chain threaded through a nano-gap electrodes may not sufficient to be used as a stand alone method for rapid DNA sequencing, the capacitance of the nucleotides should be taken into consideration in any GHz-frequency electric measurements and may also serve as an additional criterion for identifying the DNA sequence.

  15. Visible periodicity of strong nucleosome DNA sequences.

    PubMed

    Salih, Bilal; Tripathi, Vijay; Trifonov, Edward N

    2015-01-01

    Fifteen years ago, Lowary and Widom assembled nucleosomes on synthetic random sequence DNA molecules, selected the strongest nucleosomes and discovered that the TA dinucleotides in these strong nucleosome sequences often appear at 10-11 bases from one another or at distances which are multiples of this period. We repeated this experiment computationally, on large ensembles of natural genomic sequences, by selecting the strongest nucleosomes--i.e. those with such distances between like-named dinucleotides, multiples of 10.4 bases, the structural and sequence period of nucleosome DNA. The analysis confirmed the periodicity of TA dinucleotides in the strong nucleosomes, and revealed as well other periodic sequence elements, notably classical AA and TT dinucleotides. The matrices of DNA bendability and their simple linear forms--nucleosome positioning motifs--are calculated from the strong nucleosome DNA sequences. The motifs are in full accord with nucleosome positioning sequences derived earlier, thus confirming that the new technique, indeed, detects strong nucleosomes. Species- and isochore-specific variations of the matrices and of the positioning motifs are demonstrated. The strong nucleosome DNA sequences manifest the highest hitherto nucleosome positioning sequence signals, showing the dinucleotide periodicities in directly observable rather than in hidden form.

  16. DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

    PubMed

    Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

    2012-01-01

    DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

  17. Applications of mass spectrometry to DNA fingerprinting and DNA sequencing

    SciTech Connect

    Jacobson, K.B.; Buchanan, M.V.; Chen, C.H.; Doktycz, M.J.; McLuckey, S.A. ); Arlinghaus, H.F. )

    1993-01-01

    DNA fingerprinting and sequencing rely on polyacrylamide gel electrophoresis to determine the sizes of the DNA fragments. Innovative altematives to polyacrylamide gel electrophoresis are under investigation for characterization of such fingerprinting and sequencing. One method uses stable isotopes of tin and other elements to label the DNAwhereas other procedures do not require labels. The detectors in each case are mass spectrometers that detect either the stable isotopes or the DNA fragments themselves. If successful, these methods will speed up the rate of DNA analysis by one or two orders of magnitude.

  18. Applications of mass spectrometry to DNA fingerprinting and DNA sequencing

    SciTech Connect

    Jacobson, K.B.; Buchanan, M.V.; Chen, C.H.; Doktycz, M.J.; McLuckey, S.A.; Arlinghaus, H.F.

    1993-06-01

    DNA fingerprinting and sequencing rely on polyacrylamide gel electrophoresis to determine the sizes of the DNA fragments. Innovative altematives to polyacrylamide gel electrophoresis are under investigation for characterization of such fingerprinting and sequencing. One method uses stable isotopes of tin and other elements to label the DNAwhereas other procedures do not require labels. The detectors in each case are mass spectrometers that detect either the stable isotopes or the DNA fragments themselves. If successful, these methods will speed up the rate of DNA analysis by one or two orders of magnitude.

  19. T-DNA integration into the Arabidopsis genome depends on sequences of pre-insertion sites

    PubMed Central

    Brunaud, Véronique; Balzergue, Sandrine; Dubreucq, Bertrand; Aubourg, Sébastien; Samson, Franck; Chauvin, Stéphanie; Bechtold, Nicole; Cruaud, Corinne; DeRose, Richard; Pelletier, Georges; Lepiniec, Loïc; Caboche, Michel; Lecharny, Alain

    2002-01-01

    A statistical analysis of 9000 flanking sequence tags characterizing transferred DNA (T-DNA) transformants in Arabidopsis sheds new light on T-DNA insertion by illegitimate recombination. T-DNA integration is favoured in plant DNA regions with an A-T-rich content. The formation of a short DNA duplex between the host DNA and the left end of the T-DNA sets the frame for the recombination. The sequence immediately downstream of the plant A-T-rich region is the master element for setting up the DNA duplex, and deletions into the left end of the integrated T-DNA depend on the location of a complementary sequence on the T-DNA. Recombination at the right end of the T-DNA with the host DNA involves another DNA duplex, 2–3 base pairs long, that preferentially includes a G close to the right end of the T-DNA. PMID:12446565

  20. Data structures for DNA sequence manipulation.

    PubMed Central

    Lawrence, C B

    1986-01-01

    Two data structures designated Fragment and Construct are described. The Fragment data structure defines a continuous nucleic acid sequence from a unique genetic origin. The Construct defines a continuous sequence composed of sequences from multiple genetic origins. These data structures are manipulated by a set of software tools to simulate the construction of mosaic recombinant DNA molecules. They are also used as an interface between sequence data banks and analytical programs. PMID:3753765

  1. EGNAS: an exhaustive DNA sequence design algorithm

    PubMed Central

    2012-01-01

    Background The molecular recognition based on the complementary base pairing of deoxyribonucleic acid (DNA) is the fundamental principle in the fields of genetics, DNA nanotechnology and DNA computing. We present an exhaustive DNA sequence design algorithm that allows to generate sets containing a maximum number of sequences with defined properties. EGNAS (Exhaustive Generation of Nucleic Acid Sequences) offers the possibility of controlling both interstrand and intrastrand properties. The guanine-cytosine content can be adjusted. Sequences can be forced to start and end with guanine or cytosine. This option reduces the risk of “fraying” of DNA strands. It is possible to limit cross hybridizations of a defined length, and to adjust the uniqueness of sequences. Self-complementarity and hairpin structures of certain length can be avoided. Sequences and subsequences can optionally be forbidden. Furthermore, sequences can be designed to have minimum interactions with predefined strands and neighboring sequences. Results The algorithm is realized in a C++ program. TAG sequences can be generated and combined with primers for single-base extension reactions, which were described for multiplexed genotyping of single nucleotide polymorphisms. Thereby, possible foldback through intrastrand interaction of TAG-primer pairs can be limited. The design of sequences for specific attachment of molecular constructs to DNA origami is presented. Conclusions We developed a new software tool called EGNAS for the design of unique nucleic acid sequences. The presented exhaustive algorithm allows to generate greater sets of sequences than with previous software and equal constraints. EGNAS is freely available for noncommercial use at http://www.chm.tu-dresden.de/pc6/EGNAS. PMID:22716030

  2. A region of the polyoma virus genome between the replication origin and late protein coding sequences is required in cis for both early gene expression and viral DNA replication.

    PubMed Central

    Tyndall, C; La Mantia, G; Thacker, C M; Favaloro, J; Kamen, R

    1981-01-01

    Deletion mutants within the Py DNA region between the replication origin and the beginning of late protein coding sequences have been constructed and analysed for viability, early gene expression and viral DNA replication. Assay of replicative competence was facilitated by the use of Py transformed mouse cells (COP lines) which express functional large T-protein but contain no free viral DNA. Viable mutants defined three new nonessential regions of the genome. Certain deletions spanning the PvuII site at nt 5130 (67.4 mu) were unable to express early genes and had a cis-acting defect in DNA replication. Other mutants had intermediate phenotypes. Relevance of these results to eucaryotic "enhancer" elements is discussed. Images PMID:6275353

  3. DNA sequencing using electrical conductance measurements of a DNA polymerase

    NASA Astrophysics Data System (ADS)

    Chen, Yu-Shiun; Lee, Chia-Hui; Hung, Meng-Yen; Pan, Hsu-An; Chiou, Jin-Chern; Huang, G. Steven

    2013-06-01

    The development of personalized medicine--in which medical treatment is customized to an individual on the basis of genetic information--requires techniques that can sequence DNA quickly and cheaply. Single-molecule sequencing technologies, such as nanopores, can potentially be used to sequence long strands of DNA without labels or amplification, but a viable technique has yet to be established. Here, we show that single DNA molecules can be sequenced by monitoring the electrical conductance of a phi29 DNA polymerase as it incorporates unlabelled nucleotides into a template strand of DNA. The conductance of the polymerase is measured by attaching it to a protein transistor that consists of an antibody molecule (immunoglobulin G) bound to two gold nanoparticles, which are in turn connected to source and drain electrodes. The electrical conductance of the DNA polymerase exhibits well-separated plateaux that are ~3 pA in height. Each plateau corresponds to an individual base and is formed at a rate of ~22 nucleotides per second. Additional spikes appear on top of the plateaux and can be used to discriminate between the four different nucleotides. We also show that the sequencing platform works with a variety of DNA polymerases and can sequence difficult templates such as homopolymers.

  4. Sequencer-Based Capillary Gel Electrophoresis (SCGE) Targeting the rDNA Internal Transcribed Spacer (ITS) Regions for Accurate Identification of Clinically Important Yeast Species

    PubMed Central

    Chen, Sharon C.-A.; Wang, He; Zhang, Li; Fan, Xin; Xu, Zhi-Peng; Cheng, Jing-Wei; Kong, Fanrong; Zhao, Yu-Pei; Xu, Ying-Chun

    2016-01-01

    Accurate species identification of Candida, Cryptococcus, Trichosporon and other yeast pathogens is important for clinical management. In the present study, we developed and evaluated a yeast species identification scheme by determining the rDNA internal transcribed spacer (ITS) region length types (LTs) using a sequencer-based capillary gel electrophoresis (SCGE) approach. A total of 156 yeast isolates encompassing 32 species were first used to establish a reference SCGE ITS LT database. Evaluation of the ITS LT database was then performed on (i) a separate set of (n = 97) clinical isolates by SCGE, and (ii) 41 isolates of 41 additional yeast species from GenBank by in silico analysis. Of 156 isolates used to build the reference database, 41 ITS LTs were identified, which correctly identified 29 of the 32 (90.6%) species, with the exception of Trichosporon asahii, Trichosporon japonicum and Trichosporon asteroides. In addition, eight of the 32 species revealed different electropherograms and were subtyped into 2–3 different ITS LTs each. Of the 97 test isolates used to evaluate the ITS LT scheme, 96 (99.0%) were correctly identified to species level, with the remaining isolate having a novel ITS LT. Of the additional 41 isolates for in silico analysis, none was misidentified by the ITS LT database except for Trichosporon mucoides whose ITS LT profile was identical to that of Trichosporon dermatis. In conclusion, yeast identification by the present SCGE ITS LT assay is a fast, reproducible and accurate alternative for the identification of clinically important yeasts with the exception of Trichosporon species. PMID:27105313

  5. Laser desorption mass spectrometry for DNA analysis and sequencing

    SciTech Connect

    Chen, C.H.; Taranenko, N.I.; Tang, K.; Allman, S.L.

    1995-03-01

    Laser desorption mass spectrometry has been considered as a potential new method for fast DNA sequencing. Our approach is to use matrix-assisted laser desorption to produce parent ions of DNA segments and a time-of-flight mass spectrometer to identify the sizes of DNA segments. Thus, the approach is similar to gel electrophoresis sequencing using Sanger`s enzymatic method. However, gel, radioactive tagging, and dye labeling are not required. In addition, the sequencing process can possibly be finished within a few hundred microseconds instead of hours and days. In order to use mass spectrometry for fast DNA sequencing, the following three criteria need to be satisfied. They are (1) detection of large DNA segments, (2) sensitivity reaching the femtomole region, and (3) mass resolution good enough to separate DNA segments of a single nucleotide difference. It has been very difficult to detect large DNA segments by mass spectrometry before due to the fragile chemical properties of DNA and low detection sensitivity of DNA ions. We discovered several new matrices to increase the production of DNA ions. By innovative design of a mass spectrometer, we can increase the ion energy up to 45 KeV to enhance the detection sensitivity. Recently, we succeeded in detecting a DNA segment with 500 nucleotides. The sensitivity was 100 femtomole. Thus, we have fulfilled two key criteria for using mass spectrometry for fast DNA sequencing. The major effort in the near future is to improve the resolution. Different approaches are being pursued. When high resolution of mass spectrometry can be achieved and automation of sample preparation is developed, the sequencing speed to reach 500 megabases per year can be feasible.

  6. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, A.M.; Dawson, J.

    1993-12-14

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

  7. Extracting biological knowledge from DNA sequences

    SciTech Connect

    De La Vega, F.M.; Thieffry, D. |; Collado-Vides, J.

    1996-12-31

    This session describes the elucidation of information from dna sequences and what challenges computational biologists face in their task of summarizing and deciphering the human genome. Techniques discussed include methods from statistics, information theory, artificial intelligence and linguistics. 1 ref.

  8. Nanopore DNA sequencing using kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Ling, Xinsheng

    We propose a method of DNA sequencing by combining the physical method of nanopore electrical measurements and Southern's sequencing-by-hybridization. The new key ingredient, essential to both lowering the costs and increasing the precision, is an asymmetric nanopore sandwich device capable of measuring the DNA hybridization probe twice separated by a designed waiting time. Those incorrect probes appearing only once in nanopore ionic current traces are discriminated from the correct ones that appear twice. This method of discrimination is similar to the principle of kinetic proofreading proposed by Hopfield and Ninio in gene transcription and translation processes. An error analysis is of this nanopore kinetic proofreading (nKP) technique for DNA sequencing is carried out in comparison with the most precise 3' dideoxy termination method developed by Sanger. Nanopore DNA sequencing using kinetic proofreading.

  9. gargammel: a sequence simulator for ancient DNA.

    PubMed

    Renaud, Gabriel; Hanghøj, Kristian; Willerslev, Eske; Orlando, Ludovic

    2016-10-29

    Ancient DNA has emerged as a remarkable tool to infer the history of extinct species and past populations. However, many of its characteristics, such as extensive fragmentation, damage and contamination, can influence downstream analyses. To help investigators measure how these could impact their analyses in silico, we have developed gargammel, a package that simulates ancient DNA fragments given a set of known reference genomes. Our package simulates the entire molecular process from post-mortem DNA fragmentation and DNA damage to experimental sequencing errors, and reproduces most common bias observed in ancient DNA datasets.

  10. Chimeric DNA methyltransferases target DNA methylation to specific DNA sequences and repress expression of target genes

    PubMed Central

    Li, Fuyang; Papworth, Monika; Minczuk, Michal; Rohde, Christian; Zhang, Yingying; Ragozin, Sergei; Jeltsch, Albert

    2007-01-01

    Gene silencing by targeted DNA methylation has potential applications in basic research and therapy. To establish targeted methylation in human cell lines, the catalytic domains (CDs) of mouse Dnmt3a and Dnmt3b DNA methyltransferases (MTases) were fused to different DNA binding domains (DBD) of GAL4 and an engineered Cys2His2 zinc finger domain. We demonstrated that (i) Dense DNA methylation can be targeted to specific regions in gene promoters using chimeric DNA MTases. (ii) Site-specific methylation leads to repression of genes controlled by various cellular or viral promoters. (iii) Mutations affecting any of the DBD, MTase or target DNA sequences reduce targeted methylation and gene silencing. (iv) Targeted DNA methylation is effective in repressing Herpes Simplex Virus type 1 (HSV-1) infection in cell culture with the viral titer reduced by at least 18-fold in the presence of an MTase fused to an engineered zinc finger DBD, which binds a single site in the promoter of HSV-1 gene IE175k. In short, we show here that it is possible to direct DNA MTase activity to predetermined sites in DNA, achieve targeted gene silencing in mammalian cell lines and interfere with HSV-1 propagation. PMID:17151075

  11. Affordable hands-on DNA sequencing and genotyping: an exercise for teaching DNA analysis to undergraduates.

    PubMed

    Shah, Kushani; Thomas, Shelby; Stein, Arnold

    2013-01-01

    In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C Sanger sequencing reactions. They prepare and run the gels, perform Southern blots (which require only 10 min), and detect sequencing ladders using a colorimetric detection system. Students enlarge their sequencing ladders from digital images of their small nylon membranes, and read the sequence manually. They compare their reads with the actual DNA sequence using BLAST2. After mastering the DNA sequencing system, students prepare their own DNA from a cheek swab, polymerase chain reaction-amplify a region of their DNA that encompasses a SNP of interest, and perform sequencing to determine their genotype at the SNP position. A family pedigree can also be constructed. The SNP chosen by the instructor was rs17822931, which is in the ABCC11 gene and is the determinant of human earwax type. Genotypes at the rs178229931 site vary in different ethnic populations.

  12. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  13. Human gamma X satellite DNA: an X chromosome specific centromeric DNA sequence.

    PubMed

    Lee, C; Li, X; Jabs, E W; Court, D; Lin, C C

    1995-11-01

    The cosmid clone, CX16-2D12, was previously localized to the centromeric region of the human X chromosome and shown to lack human X-specific alpha satellite DNA. A 1.2 kb EcoRI fragment was subcloned from the CX16-2D12 cosmid and was named 2D12/E2. DNA sequencing revealed that this 1,205 bp fragment consisted of approximately five tandemly repeated DNA monomers of 220 bp. DNA sequence homology between the monomers of 2D12/E2 ranged from 72.8% to 78.6%. Interestingly, DNA sequence analysis of the 2D12/E2 clone displayed a change in monomer unit orientation between nucleotide positions 585-586 from a "tail-to-head" arrangement to a "head-to-tail" configuration. This may reflect the existence of at least one inversion within this repetitive DNA array in the centromeric region of the human X chromosome. The DNA consensus sequence derived from a compilation of these 220 bp monomers had approximately 62% DNA sequence similarity to the previously determined gamma 8 satellite DNA consensus sequence. Comparison of the 2D12/E2 and gamma 8 consensus sequences revealed a 20 bp DNA sequence that was well conserved in both DNA consensus sequences. Slot-blot analysis revealed that this repetitive DNA sequence comprises approximately 0.015% of the human genome, similar to that found with gamma 8 satellite DNA. These observations suggest that this satellite DNA clone is derived from a subfamily of gamma satellite DNA and is thus designated gamma X satellite DNA. When genomic DNA from six unrelated males and two unrelated females was cut with SstI or HpaI and separated by pulsed-field gel electrophoresis, no restriction fragment length polymorphisms were observed for either gamma X (2D12/E2) or gamma 8 (50E4) probes. Fluorescence in situ hybridization localized the 2D12/E2 clone to the lateral sides of the primary constriction specifically on the human X chromosome.

  14. Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region

    PubMed Central

    2010-01-01

    Background Euphorbia mosaic virus (EuMV) is a member of the SLCV clade, a lineage of New World begomoviruses that display distinctive features in their replication-associated protein (Rep) and virion-strand replication origin. The first entirely characterized EuMV isolate is native from Yucatan Peninsula, Mexico; subsequently, EuMV was detected in weeds and pepper plants from another region of Mexico, and partial DNA-A sequences revealed significant differences in their putative replication specificity determinants with respect to EuMV-YP. This study was aimed to investigate the replication compatibility between two EuMV isolates from the same country. Results A new isolate of EuMV was obtained from pepper plants collected at Jalisco, Mexico. Full-length clones of both genomic components of EuMV-Jal were biolistically inoculated into plants of three different species, which developed symptoms indistinguishable from those induced by EuMV-YP. Pseudorecombination experiments with EuMV-Jal and EuMV-YP genomic components demonstrated that these viruses do not form infectious reassortants in Nicotiana benthamiana, presumably because of Rep-iteron incompatibility. Sequence analysis of the EuMV-Jal DNA-B intergenic region (IR) led to the unexpected discovery of a 35-nt-long sequence that is identical to a segment of the rep gene in the cognate viral DNA-A. Similar short rep sequences ranging from 35- to 51-nt in length were identified in all EuMV isolates and in three distinct viruses from South America related to EuMV. These short rep sequences in the DNA-B IR are positioned downstream to a ~160-nt non-coding domain highly similar to the CP promoter of begomoviruses belonging to the SLCV clade. Conclusions EuMV strains are not compatible in replication, indicating that this begomovirus species probably is not a replicating lineage in nature. The genomic analysis of EuMV-Jal led to the discovery of a subgroup of SLCV clade viruses that contain in the non-coding region of

  15. A multi-locus analysis of phylogenetic relationships within grass subfamily Pooideae (Poaceae) inferred from sequences of nuclear single copy gene regions compared with plastid DNA.

    PubMed

    Hochbach, Anne; Schneider, Julia; Röser, Martin

    2015-06-01

    To investigate phylogenetic relationships within the grass subfamily Pooideae we studied about 50 taxa covering all recognized tribes, using one plastid DNA (cpDNA) marker (matK gene-3'trnK exon) and for the first time four nuclear single copy gene loci. DNA sequence information from two parts of the nuclear genes topoisomerase 6 (Topo6) spanning the exons 8-13 and 17-19, the exons 9-13 encoding plastid acetyl-CoA-carboxylase (Acc1) and the partial exon 1 of phytochrome B (PhyB) were generated. Individual and nuclear combined data were evaluated using maximum parsimony, maximum likelihood and Bayesian methods. All of the phylogenetic results show Brachyelytrum and the tribe Nardeae as earliest diverging lineages within the subfamily. The 'core' Pooideae (Hordeeae and the Aveneae/Poeae tribe complex) are also strongly supported, as well as the monophyly of the tribes Brachypodieae, Meliceae and Stipeae (except PhyB). The beak grass tribe Diarrheneae and the tribe Duthieeae are not monophyletic in some of the analyses. However, the combined nuclear DNA (nDNA) tree yields the highest resolution and the best delimitation of the tribes, and provides the following evolutionary hypothesis for the tribes: Brachyelytrum, Nardeae, Duthieeae, Meliceae, Stipeae, Diarrheneae, Brachypodieae and the 'core' Pooideae. Within the individual datasets, the phylogenetic trees obtained from Topo6 exon 8-13 shows the most interesting results. The divergent positions of some clone sequences of Ampelodesmos mauritanicus and Trikeraia pappiformis, for instance, may indicate a hybrid origin of these stipoid taxa.

  16. DNA sequencing using fluorescence background electroblotting membrane

    DOEpatents

    Caldwell, Karin D.; Chu, Tun-Jen; Pitt, William G.

    1992-01-01

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

  17. DNA sequencing using fluorescence background electroblotting membrane

    DOEpatents

    Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

    1992-05-12

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

  18. Intranuclear Anchoring of Repetitive DNA Sequences

    PubMed Central

    Weipoltshammer, Klara; Schöfer, Christian; Almeder, Marlene; Philimonenko, Vlada V.; Frei, Klemens; Wachtler, Franz; Hozák, Pavel

    1999-01-01

    Centromeres, telomeres, and ribosomal gene clusters consist of repetitive DNA sequences. To assess their contributions to the spatial organization of the interphase genome, their interactions with the nucleoskeleton were examined in quiescent and activated human lymphocytes. The nucleoskeletons were prepared using “physiological” conditions. The resulting structures were probed for specific DNA sequences of centromeres, telomeres, and ribosomal genes by in situ hybridization; the electroeluted DNA fractions were examined by blot hybridization. In both nonstimulated and stimulated lymphocytes, centromeric alpha-satellite repeats were almost exclusively found in the eluted fraction, while telomeric sequences remained attached to the nucleoskeleton. Ribosomal genes showed a transcription-dependent attachment pattern: in unstimulated lymphocytes, transcriptionally inactive ribosomal genes located outside the nucleolus were eluted completely. When comparing transcription unit and intergenic spacer, significantly more of the intergenic spacer was removed. In activated lymphocytes, considerable but similar amounts of both rDNA fragments were eluted. The results demonstrate that: (a) the various repetitive DNA sequences differ significantly in their intranuclear anchoring, (b) telomeric rather than centromeric DNA sequences form stable attachments to the nucleoskeleton, and (c) different attachment mechanisms might be responsible for the interaction of ribosomal genes with the nucleoskeleton. PMID:10613900

  19. Nanopore-CMOS Interfaces for DNA Sequencing.

    PubMed

    Magierowski, Sebastian; Huang, Yiyun; Wang, Chengjie; Ghafar-Zadeh, Ebrahim

    2016-08-06

    DNA sequencers based on nanopore sensors present an opportunity for a significant break from the template-based incumbents of the last forty years. Key advantages ushered by nanopore technology include a simplified chemistry and the ability to interface to CMOS technology. The latter opportunity offers substantial promise for improvement in sequencing speed, size and cost. This paper reviews existing and emerging means of interfacing nanopores to CMOS technology with an emphasis on massively-arrayed structures. It presents this in the context of incumbent DNA sequencing techniques, reviews and quantifies nanopore characteristics and models and presents CMOS circuit methods for the amplification of low-current nanopore signals in such interfaces.

  20. Osmylated DNA, a novel concept for sequencing DNA using nanopores

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia

    2015-03-01

    Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. ‘Base calling’ becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.

  1. Improved Algorithm for Analysis of DNA Sequences Using Multiresolution Transformation

    PubMed Central

    Inbamalar, T. M.; Sivakumar, R.

    2015-01-01

    Bioinformatics and genomic signal processing use computational techniques to solve various biological problems. They aim to study the information allied with genetic materials such as the deoxyribonucleic acid (DNA), the ribonucleic acid (RNA), and the proteins. Fast and precise identification of the protein coding regions in DNA sequence is one of the most important tasks in analysis. Existing digital signal processing (DSP) methods provide less accurate and computationally complex solution with greater background noise. Hence, improvements in accuracy, computational complexity, and reduction in background noise are essential in identification of the protein coding regions in the DNA sequences. In this paper, a new DSP based method is introduced to detect the protein coding regions in DNA sequences. Here, the DNA sequences are converted into numeric sequences using electron ion interaction potential (EIIP) representation. Then discrete wavelet transformation is taken. Absolute value of the energy is found followed by proper threshold. The test is conducted using the data bases available in the National Centre for Biotechnology Information (NCBI) site. The comparative analysis is done and it ensures the efficiency of the proposed system. PMID:26000337

  2. Bacterial identification and subtyping using DNA microarray and DNA sequencing.

    PubMed

    Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D

    2012-01-01

    The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

  3. Female-specific DNA sequences in geese.

    PubMed

    Huang, M C; Lin, W C; Horng, Y M; Rouvier, R; Huang, C W

    2003-07-01

    1. The OPAE random primers (Operon Technologies, Inc., CA) were used for random amplified polymorphic DNA (RAPD) fingerprinting in Chinese, White Roman and Landaise geese. One of these primers, OPAE-06, produced a 938-bp sex-specific fragment in all females and in no males of Chinese geese only. 2. A novel female-specific DNA sequence in Chinese goose was cloned and sequenced. Two primers, CGSex-F and CGSex-R, were designed in order to amplify a 912-bp sex-specific polymerase chain reaction (PCR) fragment on genomic DNA from female geese. 3. It was shown that a simple and effective PCR-based sexing technique could be used in the three goose breeds studied. 4. Nucleotide sequencing of the sex-specific fragments in White Roman and Landaise geese was performed and sequence differences were observed among these three breeds.

  4. Dynamics and control of DNA sequence amplification

    NASA Astrophysics Data System (ADS)

    Marimuthu, Karthikeyan; Chakrabarti, Raj

    2014-10-01

    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reaction are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.

  5. Dynamics and control of DNA sequence amplification

    SciTech Connect

    Marimuthu, Karthikeyan; Chakrabarti, Raj E-mail: rajc@andrew.cmu.edu

    2014-10-28

    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reaction are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.

  6. Nuclear and mitochondrial DNA sequences from two Denisovan individuals

    PubMed Central

    Sawyer, Susanna; Renaud, Gabriel; Viola, Bence; Hublin, Jean-Jacques; Gansauge, Marie-Theres; Shunkov, Michael V.; Derevianko, Anatoly P.; Prüfer, Kay; Pääbo, Svante

    2015-01-01

    Denisovans, a sister group of Neandertals, have been described on the basis of a nuclear genome sequence from a finger phalanx (Denisova 3) found in Denisova Cave in the Altai Mountains. The only other Denisovan specimen described to date is a molar (Denisova 4) found at the same site. This tooth carries a mtDNA sequence similar to that of Denisova 3. Here we present nuclear DNA sequences from Denisova 4 and a morphological description, as well as mitochondrial and nuclear DNA sequence data, from another molar (Denisova 8) found in Denisova Cave in 2010. This new molar is similar to Denisova 4 in being very large and lacking traits typical of Neandertals and modern humans. Nuclear DNA sequences from the two molars form a clade with Denisova 3. The mtDNA of Denisova 8 is more diverged and has accumulated fewer substitutions than the mtDNAs of the other two specimens, suggesting Denisovans were present in the region over an extended period. The nuclear DNA sequence diversity among the three Denisovans is comparable to that among six Neandertals, but lower than that among present-day humans. PMID:26630009

  7. Sequencing and analysis of the internal transcribed spacers (ITSs) and coding regions in the EcoR I fragment of the ribosomal DNA of the Japanese pond frog Rana nigromaculata.

    PubMed

    Sumida, Masayuki; Kato, Yoji; Kurabayashi, Atsushi

    2004-04-01

    The rDNA of eukaryotic organisms is transcribed as the 40S-45S rRNA precursor, and this precursor contains the following segments: 5' - ETS - 18S rRNA - ITS 1 - 5.8S rRNA - ITS 2 - 28S rRNA - 3'. In amphibians, the nucleotide sequences of the rRNA precursor have been completely determined in only two species of Xenopus. In the other amphibian species investigated so far, only the short nucleotide sequences of some rDNA fragments have been reported. We obtained a genomic clone containing the rDNA precursor from the Japanese pond frog Rana nigromaculata and analyzed its nucleotide sequence. The cloned genomic fragment was 4,806 bp long and included the 3'-terminus of 18S rRNA, ITS 1, 5.8S rRNA, ITS 2, and a long portion of 28S rRNA. A comparison of nucleotide sequences among Rana, the two species of Xenopus, and human revealed the following: (1) The 3'-terminus of 18S rRNA and the complete 5.8S rRNA were highly conserved among these four taxa. (2) The regions corresponding to the stem and loop of the secondary structure in 28S rRNA were conserved between Xenopus and Rana, but the rate of substitutions in the loop was higher than that in the stem. Many of the human loop regions had large insertions not seen in amphibians. (3) Two ITS regions had highly diverged sequences that made it difficult to compare the sequences not only between human and frogs, but also between Xenopus and Rana. (4) The short tracts in the ITS regions were strictly conserved between the two Xenopus species, and there was a corresponding sequence for Rana. Our data on the nucleotide sequence of the rRNA precursor from the Japanese pond frog Rana nigromaculata were used to examine the potential usefulness of the rRNA genes and ITS regions for evolutionary studies on frogs, because the rRNA precursor contains both highly conserved regions and rapidly evolving regions.

  8. Compressing DNA sequence databases with coil

    PubMed Central

    White, W Timothy J; Hendy, Michael D

    2008-01-01

    Background Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip) compression – an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. Results We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression – the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST) data. Finally, coil can efficiently encode incremental additions to a sequence database. Conclusion coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work. PMID:18489794

  9. Probe mapping to facilitate transposon-based DNA sequencing

    SciTech Connect

    Strausbaugh, L.D.; Bourke, M.T.; Sommer, M.T.; Coon, M.E.; Berg, C.M. )

    1990-08-01

    A promising strategy for DNA sequencing exploits transposons to provide mobile sites for the binding of sequencing primers. For such a strategy to be maximally efficient, the location and orientation of the transposon must be readily determined and the insertion sites should be randomly distributed. The authors demonstrate an efficient probe-based method for the localization and orientation of transposon-borne primer sites, which is adaptable to large-scale sequencing strategies. This approach requires no prior restriction enzyme mapping or knowledge of the cloned sequence and eliminates the inefficiency inherent in totally random sequencing methods. To test the efficiency of probe mapping, 49 insertions of the transposon {gamma}{delta} (Tn1000) in a cloned fragment of Drosophila melanogaster DNA were mapped and oriented. In addition, oligonucleotide primers specific for unique subterminal {gamma}{delta} segments were used to prime dideoxynucleotide double-stranded sequencing. These data provided an opportunity to rigorously examine {gamma}{delta} insertion sites. The insertions were quire randomly distributed, even though the target DNA fragment had both A+T-rich and G+C-rich regions; in G+C-rich DNA, the insertions were found in A+T-rich valleys. These data demonstrate that {gamma}{delta} is an excellent choice for supplying mobile primer binding sites to cloned DNA and that transposon-based probe mapping permits the sequences of large cloned segments to be determined without any subcloning.

  10. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  11. Sequencing of long stretches of repetitive DNA

    PubMed Central

    De Bustos, Alfredo; Cuadrado, Angeles; Jouve, Nicolás

    2016-01-01

    Repetitive DNA is widespread in eukaryotic genomes, in some cases making up more than 80% of the total. SSRs are a type of repetitive DNA formed by short motifs repeated in tandem arrays. In some species, SSRs may be organized into long stretches, usually associated with the constitutive heterochromatin. Variation in repeats can alter the expression of genes, and changes in the number of repeats have been linked to certain human diseases. Unfortunately, the molecular characterization of these repeats has been hampered by technical limitations related to cloning and sequencing. Indeed, most sequenced genomes contain gaps owing to repetitive DNA-related assembly difficulties. This paper reports an alternative method for sequencing of long stretches of repetitive DNA based on the combined use of 1) a linear vector to stabilize the cloning process, and 2) the use of exonuclease III for obtaining progressive deletions of SSR-rich fragments. This strategy allowed the sequencing of a fragment containing a stretch of 6.2 kb of continuous SSRs. To demonstrate that this procedure can sequence other kinds of repetitive DNA, it was used to examine a 4.5 kb fragment containing a cluster of 15 repeats of the 5S rRNA gene of barley. PMID:27819354

  12. DNA sequencing by synthesis based on elongation delay detection

    NASA Astrophysics Data System (ADS)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2015-03-01

    The one of most important problem in modern genetics, biology and medicine is determination of the primary nucleotide sequence of the DNA of living organisms (DNA sequencing). This paper describes the label-free DNA sequencing approach, based on the observation of a discrete dynamics of DNA sequence elongation phase. The proposed DNA sequencing principle are studied by numerical simulation. The numerical model for proposed label-free DNA sequencing approach is based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) and dynamics of nucleotides incorporation to rising DNA strand. The estimates for number of copied DNA sequences for required probability of nucleotide incorporation event detection and correct DNA sequence determination was obtained. The proposed approach can be applied at all known DNA sequencing devices with "sequencing by synthesis" principle of operation.

  13. Human somatostatin I: sequence of the cDNA.

    PubMed Central

    Shen, L P; Pictet, R L; Rutter, W J

    1982-01-01

    RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

  14. Applications of recursive segmentation to the analysis of DNA sequences.

    PubMed

    Li, Wentian; Bernaola-Galván, Pedro; Haghighi, Fatameh; Grosse, Ivo

    2002-07-01

    Recursive segmentation is a procedure that partitions a DNA sequence into domains with a homogeneous composition of the four nucleotides A, C, G and T. This procedure can also be applied to any sequence converted from a DNA sequence, such as to a binary strong(G + C)/weak(A + T) sequence, to a binary sequence indicating the presence or absence of the dinucleotide CpG, or to a sequence indicating both the base and the codon position information. We apply various conversion schemes in order to address the following five DNA sequence analysis problems: isochore mapping, CpG island detection, locating the origin and terminus of replication in bacterial genomes, finding complex repeats in telomere sequences, and delineating coding and noncoding regions. We find that the recursive segmentation procedure can successfully detect isochore borders, CpG islands, and the origin and terminus of replication, but it needs improvement for detecting complex repeats as well as borders between coding and noncoding regions.

  15. Unzipping of DNA with correlated base sequence.

    PubMed

    Allahverdyan, A E; Gevorkian, Zh S; Hu, Chin-Kun; Wu, Ming-Chya

    2004-06-01

    We consider force-induced unzipping transition for a heterogeneous DNA model with a correlated base sequence. Both finite-range and long-range correlated situations are considered. It is shown that finite-range correlations increase stability of DNA with respect to the external unzipping force. Due to long-range correlations the number of unzipped base pairs displays two widely different scenarios depending on the details of the base sequence: either there is no unzipping phase transition at all, or the transition is realized via a sequence of jumps with magnitude comparable to the size of the system. Both scenarios are different from the behavior of the average number of unzipped base pairs (non-self-averaging). The results can be relevant for explaining the biological purpose of correlated structures in DNA.

  16. Entire Mitochondrial DNA Sequencing on Massively Parallel Sequencing for the Korean Population

    PubMed Central

    2017-01-01

    Mitochondrial DNA (mtDNA) genome analysis has been a potent tool in forensic practice as well as in the understanding of human phylogeny in the maternal lineage. The traditional mtDNA analysis is focused on the control region, but the introduction of massive parallel sequencing (MPS) has made the typing of the entire mtDNA genome (mtGenome) more accessible for routine analysis. The complete mtDNA information can provide large amounts of novel genetic data for diverse populations as well as improved discrimination power for identification. The genetic diversity of the mtDNA sequence in different ethnic populations has been revealed through MPS analysis, but the Korean population not only has limited MPS data for the entire mtGenome, the existing data is mainly focused on the control region. In this study, the complete mtGenome data for 186 Koreans, obtained using Ion Torrent Personal Genome Machine (PGM) technology and retrieved from rather common mtDNA haplogroups based on the control region sequence, are described. The results showed that 24 haplogroups, determined with hypervariable regions only, branched into 47 subhaplogroups, and point heteroplasmy was more frequent in the coding regions. In addition, sequence variations in the coding regions observed in this study were compared with those presented in other reports on different populations, and there were similar features observed in the sequence variants for the predominant haplogroups among East Asian populations, such as Haplogroup D and macrohaplogroups M9, G, and D. This study is expected to be the trigger for the development of Korean specific mtGenome data followed by numerous future studies. PMID:28244283

  17. Negatively supercoiled simian virus 40 DNA contains Z-DNA segments within transcriptional enhancer sequences

    NASA Technical Reports Server (NTRS)

    Nordheim, A.; Rich, A.

    1983-01-01

    Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.

  18. A Bioluminometric Method of DNA Sequencing

    NASA Technical Reports Server (NTRS)

    Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

    2001-01-01

    Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

  19. FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  20. A sequence-specific DNA-binding factor (VF1) from Anabaena sp. strain PCC 7120 vegetative cells binds to three adjacent sites in the xisA upstream region.

    PubMed Central

    Chastain, C J; Brusca, J S; Ramasubramanian, T S; Wei, T F; Golden, J W

    1990-01-01

    A DNA-binding factor (VF1) partially purified from Anabaena sp. strain PCC 7120 vegetative cell extracts by heparin-Sepharose chromatography was found to have affinity for the xisA upstream region. The xisA gene is required for excision of an 11-kilobase element from the nifD gene during heterocyst differentiation. Previous studies of the xisA upstream sequences demonstrated that deletion of this region is required for the expression of xisA from heterologous promoters in vegetative cells. Mobility shift assays with a labeled 250-base-pair fragment containing the binding sites revealed three distinct DNA-protein complexes. Competition experiments showed that VF1 also bound to the upstream sequences of the rbcL and glnA genes, but the rbcL and glnA fragments showed only single complexes in mobility shift assays. The upstream region of the nifH gene formed a weak complex with VF1. DNase footprinting and deletion analysis of the xisA binding site mapped the binding to a 66-base-pair region containing three repeats of the consensus recognition sequence ACATT. Images PMID:2118506

  1. Mitochondrial DNA control region variation in Dubai, United Arab Emirates.

    PubMed

    Alshamali, Farida; Brandstätter, Anita; Zimmermann, Bettina; Parson, Walther

    2008-01-01

    249 entire mtDNA control region sequences were generated and analyzed in a population sample from Dubai, one of the seven United Arab Emirates. The control region was amplified in one piece and sequenced with different sequencing primers. Sequence evaluation was performed twice and validated by a third senior mtDNA scientist. Phylogenetic analyses were used for quality assurance purposes and for the determination of the haplogroup affiliation of the samples. Upon publication, the population data are going to be available in the EMPOP database (www.empop.org).

  2. Nanopore Technology: A Simple, Inexpensive, Futuristic Technology for DNA Sequencing.

    PubMed

    Gupta, P D

    2016-10-01

    In health care, importance of DNA sequencing has been fully established. Sanger's Capillary Electrophoresis DNA sequencing methodology is time consuming, cumbersome, hence become more expensive. Lately, because of its versatility DNA sequencing became house hold name, and therefore, there is an urgent need of simple, fast, inexpensive, DNA sequencing technology. In the beginning of this century efforts were made, and Nanopore DNA sequencing technology was developed; still it is infancy, nevertheless, it is the futuristic technology.

  3. A microchannel electrophoresis DNA sequencing system

    SciTech Connect

    Madabhushi, R S; Warth, T; Balch, J W; Bass, M; Brewer, L R; Copeland, A C; Davidson, J C; Fitch, J P; Kegelmeyer, L M; Kimbrough, J R; McCready, P; Nelson, D; Pastrone, R L; Richardson, P M; Swierkowski, S P; Tarte, L A; Vainer, M

    1999-01-01

    In order to increase the DNA sequencing throughput of the Joint Genome Institute, we have developed a microchannel electrophoresis system. The critical new and unique elements of this system include 1) a process for the production of arrays of 96 and 384 microchannels on bonded glass substrates up to 14 x 58 cm and 2) new sieving media for high resolution and high speed separations. With custom fabrication apparatus, microchannels are etched in a borosilicate substrate, and then fusion bonded to a top substrate 1.1 mm thick that has access holes formed in it. SEM examination shows a typical microchannel to be 40 micrometers deep x 180 micrometers wide by 46 cm long. This technology offers significant advantages over discrete capillaries or conventional slab-gel approaches. High throughput DNA sequencing with over 550 base pairs resolution has been achieved in roughly half the time of conventional sequencers. In February 1999, we begin a pre-production evaluation protocol for the microchannel and for three glass capillary electrophoresis systems (two from industry and one developed by Lawrence Berkeley National Laboratory for the Joint Genome Institute). In order to utilize these instruments for DNA production sequencing, we have been evaluating and implementing software to convert raw electropherograms into called DNA bases with an associated probability of error. Our original intent was to utilize the DNA base calling software known as Plan and Phred developed by the University of Washington. This software has been outstanding for our slab gel electrophoresis systems currently in the production facility. In our tests and evaluations of this software applied to microchannel data, we observed that the electropherograms are of a different statistical and underlying signal structure compared to slab gels. Even with substantial modifications to the software, base calling performance was not satisfactory for the microchannel data. In this paper, we will present o The

  4. New Stopping Criteria for Segmenting DNA Sequences

    SciTech Connect

    Li, Wentian

    2001-06-18

    We propose a solution on the stopping criterion in segmenting inhomogeneous DNA sequences with complex statistical patterns. This new stopping criterion is based on Bayesian information criterion in the model selection framework. When this criterion is applied to telomere of S.cerevisiae and the complete sequence of E.coli, borders of biologically meaningful units were identified, and a more reasonable number of domains was obtained. We also introduce a measure called segmentation strength which can be used to control the delineation of large domains. The relationship between the average domain size and the threshold of segmentation strength is determined for several genome sequences.

  5. New Stopping Criteria for Segmenting DNA Sequences

    NASA Astrophysics Data System (ADS)

    Li, Wentian

    2001-06-01

    We propose a solution on the stopping criterion in segmenting inhomogeneous DNA sequences with complex statistical patterns. This new stopping criterion is based on Bayesian information criterion in the model selection framework. When this criterion is applied to telomere of S. cerevisiae and the complete sequence of E. coli, borders of biologically meaningful units were identified, and a more reasonable number of domains was obtained. We also introduce a measure called segmentation strength which can be used to control the delineation of large domains. The relationship between the average domain size and the threshold of segmentation strength is determined for several genome sequences.

  6. DNA Sequence Alignment during Homologous Recombination.

    PubMed

    Greene, Eric C

    2016-05-27

    Homologous recombination allows for the regulated exchange of genetic information between two different DNA molecules of identical or nearly identical sequence composition, and is a major pathway for the repair of double-stranded DNA breaks. A key facet of homologous recombination is the ability of recombination proteins to perfectly align the damaged DNA with homologous sequence located elsewhere in the genome. This reaction is referred to as the homology search and is akin to the target searches conducted by many different DNA-binding proteins. Here I briefly highlight early investigations into the homology search mechanism, and then describe more recent research. Based on these studies, I summarize a model that includes a combination of intersegmental transfer, short-distance one-dimensional sliding, and length-specific microhomology recognition to efficiently align DNA sequences during the homology search. I also suggest some future directions to help further our understanding of the homology search. Where appropriate, I direct the reader to other recent reviews describing various issues related to homologous recombination.

  7. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  8. The first determination of DNA sequence of a specific gene.

    PubMed

    Inouye, Masayori

    2016-05-10

    How and when the first DNA sequence of a gene was determined? In 1977, F. Sanger came up with an innovative technology to sequence DNA by using chain terminators, and determined the entire DNA sequence of the 5375-base genome of bacteriophage φX 174 (Sanger et al., 1977). While this Sanger's achievement has been recognized as the first DNA sequencing of genes, we had determined DNA sequence of a gene, albeit a partial sequence, 11 years before the Sanger's DNA sequence (Okada et al., 1966).

  9. Imaging of DNA sequences with chemiluminescence.

    PubMed Central

    Tizard, R; Cate, R L; Ramachandran, K L; Wysk, M; Voyta, J C; Murphy, O J; Bronstein, I

    1990-01-01

    We have coupled a chemiluminescent detection method that uses an alkaline phosphatase label to the genomic DNA sequencing protocol of Church and Gilbert [Church, G. M. & Gilbert, W. (1984) Proc. Natl. Acad. Sci. USA 81, 1991-1995]. Images of sequence ladders are obtained on x-ray film with exposure times of less than 30 min, as compared to 40 h required for a similar exposure with a 32P-labeled oligomer. Chemically cleaved DNA from a sequencing gel is transferred to a nylon membrane, and specific sequence ladders are selected by hybridization to DNA oligonucleotides labeled with alkaline phosphatase or with biotin, leading directly or indirectly to deposition of enzyme. If a biotinylated probe is used, an incubation with avidin-alkaline phosphatase conjugate follows. The membrane is soaked in the chemiluminescent substrate (AMPPD) and is exposed to film. Dephosphorylation of AMPPD leads in a two-step pathway to a highly localized emission of visible light. The demonstrated shorter exposure times may improve the efficiency of a serial reprobing strategy such as the multiplex sequencing approach of Church and Kieffer-Higgins [Church, G. M. & Kieffer-Higgins, S. (1988) Science 240, 185-188]. Images PMID:2191292

  10. Nanopore-CMOS Interfaces for DNA Sequencing

    PubMed Central

    Magierowski, Sebastian; Huang, Yiyun; Wang, Chengjie; Ghafar-Zadeh, Ebrahim

    2016-01-01

    DNA sequencers based on nanopore sensors present an opportunity for a significant break from the template-based incumbents of the last forty years. Key advantages ushered by nanopore technology include a simplified chemistry and the ability to interface to CMOS technology. The latter opportunity offers substantial promise for improvement in sequencing speed, size and cost. This paper reviews existing and emerging means of interfacing nanopores to CMOS technology with an emphasis on massively-arrayed structures. It presents this in the context of incumbent DNA sequencing techniques, reviews and quantifies nanopore characteristics and models and presents CMOS circuit methods for the amplification of low-current nanopore signals in such interfaces. PMID:27509529

  11. Repetitive DNA sequences in Mycoplasma pneumoniae.

    PubMed Central

    Wenzel, R; Herrmann, R

    1988-01-01

    Two types of different repetitive DNA sequences called RepMP1 and RepMP2 were identified in the genome of Mycoplasma pneumoniae. The number of these repeated elements, their nucleotide sequence and their localization on a physical map of the M. pneumoniae genome were determined. The results show that RepMP1 appears at least 10 times and RepMP2 at least 8 times in the genome. The repeated elements are dispersed on the chromosome and, in three cases, linked to each other by a homologous DNA sequence of 400 bp. The elements themselves are 300 bp (for RepMP1) and 150 bp (for RepMP2) long showing a high degree of homology. One copy of RepMP2 is a translated part of the gene for the major cytadhesin protein P1 which is responsible for the adsorption of M. pneumoniae to its host cell. Images PMID:3138660

  12. DNA sequencing by nanopores: advances and challenges

    NASA Astrophysics Data System (ADS)

    Agah, Shaghayegh; Zheng, Ming; Pasquali, Matteo; Kolomeisky, Anatoly B.

    2016-10-01

    Developing inexpensive and simple DNA sequencing methods capable of detecting entire genomes in short periods of time could revolutionize the world of medicine and technology. It will also lead to major advances in our understanding of fundamental biological processes. It has been shown that nanopores have the ability of single-molecule sensing of various biological molecules rapidly and at a low cost. This has stimulated significant experimental efforts in developing DNA sequencing techniques by utilizing biological and artificial nanopores. In this review, we discuss recent progress in the nanopore sequencing field with a focus on the nature of nanopores and on sensing mechanisms during the translocation. Current challenges and alternative methods are also discussed.

  13. Sequence-Dependent Persistence Lengths of DNA.

    PubMed

    Mitchell, Jonathan S; Glowacki, Jaroslaw; Grandchamp, Alexandre E; Manning, Robert S; Maddocks, John H

    2017-03-24

    A Monte Carlo code applied to the cgDNA coarse-grain rigid-base model of B-form double-stranded DNA is used to predict a sequence-averaged persistence length of lF = 53.5 nm in the sense of Flory, and of lp = 160 bp or 53.5 nm in the sense of apparent tangent-tangent correlation decay. These estimates are slightly higher than the consensus experimental values of 150 bp or 50 nm, but we believe the agreement to be good given that the cgDNA model is itself parametrized from molecular dynamics simulations of short fragments of length 10-20 bp, with no explicit fit to persistence length. Our Monte Carlo simulations further predict that there can be substantial dependence of persistence lengths on the specific sequence [Formula: see text] of a fragment. We propose, and confirm the numerical accuracy of, a simple factorization that separates the part of the apparent tangent-tangent correlation decay [Formula: see text] attributable to intrinsic shape, from a part [Formula: see text] attributable purely to stiffness, i.e., a sequence-dependent version of what has been called sequence-averaged dynamic persistence length l̅d (=58.8 nm within the cgDNA model). For ensembles of both random and λ-phage fragments, the apparent persistence length [Formula: see text] has a standard deviation of 4 nm over sequence, whereas our dynamic persistence length [Formula: see text] has a standard deviation of only 1 nm. However, there are notable dynamic persistence length outliers, including poly(A) (exceptionally straight and stiff), poly(TA) (tightly coiled and exceptionally soft), and phased A-tract sequence motifs (exceptionally bent and stiff). The results of our numerical simulations agree reasonably well with both molecular dynamics simulation and diverse experimental data including minicircle cyclization rates and stereo cryo-electron microscopy images.

  14. Compilation and analysis of Escherichia coli promoter DNA sequences.

    PubMed Central

    Hawley, D K; McClure, W R

    1983-01-01

    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter mutations. Nearly all of the altered base pairs in the mutants conform to the following general rule: down-mutations decrease homology and up-mutations increase homology to the consensus sequence. PMID:6344016

  15. Sequence-specific recognition of DNA nanostructures.

    PubMed

    Rusling, David A; Fox, Keith R

    2014-05-15

    DNA is the most exploited biopolymer for the programmed self-assembly of objects and devices that exhibit nanoscale-sized features. One of the most useful properties of DNA nanostructures is their ability to be functionalized with additional non-nucleic acid components. The introduction of such a component is often achieved by attaching it to an oligonucleotide that is part of the nanostructure, or hybridizing it to single-stranded overhangs that extend beyond or above the nanostructure surface. However, restrictions in nanostructure design and/or the self-assembly process can limit the suitability of these procedures. An alternative strategy is to couple the component to a DNA recognition agent that is capable of binding to duplex sequences within the nanostructure. This offers the advantage that it requires little, if any, alteration to the nanostructure and can be achieved after structure assembly. In addition, since the molecular recognition of DNA can be controlled by varying pH and ionic conditions, such systems offer tunable properties that are distinct from simple Watson-Crick hybridization. Here, we describe methodology that has been used to exploit and characterize the sequence-specific recognition of DNA nanostructures, with the aim of generating functional assemblies for bionanotechnology and synthetic biology applications.

  16. Compilation of DNA sequences of Escherichia coli

    PubMed Central

    Kröger, Manfred

    1989-01-01

    We have compiled the DNA sequence data for E.coli K12 available from the GENBANK and EMBO databases and over a period of several years independently from the literature. We have introduced all available genetic map data and have arranged the sequences accordingly. As far as possible the overlaps are deleted and a total of 940,449 individual bp is found to be determined till the beginning of 1989. This corresponds to a total of 19.92% of the entire E.coli chromosome consisting of about 4,720 kbp. This number may actually be higher by some extra 2% derived from the sequence of lysogenic bacteriophage lambda and the various insertion sequences. This compilation may be available in machine readable form from one of the international databanks in some future. PMID:2654890

  17. Detecting and Analyzing DNA Sequencing Errors: Toward a Higher Quality of the Bacillus subtilis Genome Sequence

    PubMed Central

    Médigue, Claudine; Rose, Matthias; Viari, Alain; Danchin, Antoine

    1999-01-01

    During the determination of a DNA sequence, the introduction of artifactual frameshifts and/or in-frame stop codons in putative genes can lead to misprediction of gene products. Detection of such errors with a method based on protein similarity matching is only possible when related sequences are available in databases. Here, we present a method to detect frameshift errors in DNA sequences that is based on the intrinsic properties of the coding sequences. It combines the results of two analyses, the search for translational initiation/termination sites and the prediction of coding regions. This method was used to screen the complete Bacillus subtilis genome sequence and the regions flanking putative errors were resequenced for verification. This procedure allowed us to correct the sequence and to analyze in detail the nature of the errors. Interestingly, in several cases in-frame termination codons or frameshifts were not sequencing errors but confirmed to be present in the chromosome, indicating that the genes are either nonfunctional (pseudogenes) or subject to regulatory processes such as programmed translational frameshifts. The method can be used for checking the quality of the sequences produced by any prokaryotic genome sequencing project. PMID:10568751

  18. RNA–DNA sequence differences in Saccharomyces cerevisiae

    PubMed Central

    Wang, Isabel X.; Grunseich, Christopher; Chung, Youree G.; Kwak, Hojoong; Ramrattan, Girish; Zhu, Zhengwei; Cheung, Vivian G.

    2016-01-01

    Alterations of RNA sequences and structures, such as those from editing and alternative splicing, result in two or more RNA transcripts from a DNA template. It was thought that in yeast, RNA editing only occurs in tRNAs. Here, we found that Saccharomyces cerevisiae have all 12 types of RNA–DNA sequence differences (RDDs) in the mRNA. We showed these sequence differences are propagated to proteins, as we identified peptides encoded by the RNA sequences in addition to those by the DNA sequences at RDD sites. RDDs are significantly enriched at regions with R-loops. A screen of yeast mutants showed that RDD formation is affected by mutations in genes regulating R-loops. Loss-of-function mutations in ribonuclease H, senataxin, and topoisomerase I that resolve RNA–DNA hybrids lead to increases in RDD frequency. Our results demonstrate that RDD is a conserved process that diversifies transcriptomes and proteomes and provide a mechanistic link between R-loops and RDDs. PMID:27638543

  19. Directly repeated sequences associated with pathogenic mitochondrial DNA deletions.

    PubMed Central

    Johns, D R; Rutledge, S L; Stine, O C; Hurko, O

    1989-01-01

    We determined the nucleotide sequences of junctional regions associated with large deletions of mitochondrial DNA found in four unrelated individuals with a phenotype of chronic progressive external ophthalmoplegia. In each patient, the deletion breakpoint occurred within a directly repeated sequence of 13-18 base pairs, present in different regions of the normal mitochondrial genome-separated by 4.5-7.7 kilobases. In two patients, the deletions were identical. When all four repeated sequences are compared, a consensus sequence of 11 nucleotides emerges, similar to putative recombination signals, suggesting the involvement of a recombinational event. Partially deleted and normal mitochondrial DNAs were found in all tissues examined, but in very different proportions, indicating that these mutations originated before the primary cell layers diverged. Images PMID:2813377

  20. DNA SEQUENCING RESEARCH GROUP (DSRG) 2003—A GENERAL SURVEY OF CORE DNA SEQUENCING FACILITIES

    PubMed Central

    Wiebe, Glenis J.; Pershad, Rashmi; Escobar, Helaman; Hawes, John W.; Hunter, Timothy; Jackson-Machelski, Emily; Knudtson, Kevin L.; Robertson, Margaret; Thannhauser, Theodore W.

    2003-01-01

    DNA sequencing core facilities serve as centralized resources within both academic and commercial institutions, providing expertise in the area of DNA analysis. The composition and configuration of these facilities continue to evolve in response to new developments in instrumentation and methodology. The goal of the 2003 DNA Sequencing Research Group (DSRG) survey was to identify recent changes in staffing, funding, instrumentation, services, and customer relations. Responses to 58 survey questions from 30 participants are presented to offer a look at the current typical DNA core sequencing facility. The results from this study will serve as a resource for institutions to benchmark their shared core laboratories, and to give facility directors an opportunity to compare and contrast their respective services and experiences.

  1. Random Coding Bounds for DNA Codes Based on Fibonacci Ensembles of DNA Sequences

    DTIC Science & Technology

    2008-07-01

    COVERED (From - To) 6 Jul 08 – 11 Jul 08 4. TITLE AND SUBTITLE RANDOM CODING BOUNDS FOR DNA CODES BASED ON FIBONACCI ENSEMBLES OF DNA SEQUENCES ... sequences which are generalizations of the Fibonacci sequences . 15. SUBJECT TERMS DNA Codes, Fibonacci Ensembles, DNA Computing, Code Optimization 16...coding bound on the rate of DNA codes is proved. To obtain the bound, we use some ensembles of DNA sequences which are generalizations of the Fibonacci

  2. Organization and partial sequence of a DNA region of the Rhizobium leguminosarum symbiotic plasmid pRL6JI containing the genes fixABC, nifA, nifB and a novel open reading frame.

    PubMed Central

    Grönger, P; Manian, S S; Reiländer, H; O'Connell, M; Priefer, U B; Pühler, A

    1987-01-01

    By hybridization and heteroduplex studies the fixABC and nifA genes of the Rhizobium leguminosarum symbiotic plasmid pRL6JI have been identified. DNA sequencing of the region containing nifA showed an open reading frame of 1557 bp encoding a protein of 56, 178 D. Based on sequence homology, this ORF was confirmed to correspond to the nifA gene. Comparison of three nifA proteins (Klebsiella pneumoniae, Rhizobium meliloti, Rhizobium leguminosarum) revealed only a weak relationship in their N-terminal regions, whereas the C-terminal parts exhibited strong homology. Sequence analysis also showed that the R. leguminosarum nifA gene is followed by nifB and preceded by fixC with an open reading frame inserted in between. This novel ORF of 294 bp was found to be highly conserved also in R. meliloti. No known promoter and termination signals could be defined on the sequenced R. leguminosarum fragment. Images PMID:3029674

  3. An oligonucleotide hybridization approach to DNA sequencing.

    PubMed

    Khrapko, K R; Lysov YuP; Khorlyn, A A; Shick, V V; Florentiev, V L; Mirzabekov, A D

    1989-10-09

    We have proposed a DNA sequencing method based on hybridization of a DNA fragment to be sequenced with the complete set of fixed-length oligonucleotides (e.g., 4(8) = 65,536 possible 8-mers) immobilized individually as dots of a 2-D matrix [(1989) Dokl. Akad. Nauk SSSR 303, 1508-1511]. It was shown that the list of hybridizing octanucleotides is sufficient for the computer-assisted reconstruction of the structures for 80% of random-sequence fragments up to 200 bases long, based on the analysis of the octanucleotide overlapping. Here a refinement of the method and some experimental data are presented. We have performed hybridizations with oligonucleotides immobilized on a glass plate, and obtained their dissociation curves down to heptanucleotides. Other approaches, e.g., an additional hybridization of short oligonucleotides which continuously extend duplexes formed between the fragment and immobilized oligonucleotides, should considerably increase either the probability of unambiguous reconstruction, or the length of reconstructed sequences, or decrease the size of immobilized oligonucleotides.

  4. Text mining of DNA sequence homology searches.

    PubMed

    McCallum, John; Ganesh, Siva

    2003-01-01

    Primary tasks in analysis and annotation of expressed sequence tag (EST) datasets are to identify similarity among sequences by unsupervised clustering and assign putative function based on BLAST homology searches. We investigated the usefulness of text mining as a simple approach for further higher-level clustering of EST datasets using IBM Intelligent Miner for Text v2.3 tools. Agglomerative and k-means clustering tools were used to cluster BLASTx homology search documents from two onion EST datasets and optimised by pre-processing and pruning. Subjective evaluation confirmed that these tools provided biologically useful and complementary views of the two libraries, provided new insights into their composition and revealed clusters previously identified by human experts. We compared BLASTx textual clusters for two gene families with their DNA sequence-based clusters and confirmed that these shared similar morphology.

  5. Generalized Levy-walk model for DNA nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Simons, M.; Stanley, H. E.

    1993-01-01

    We propose a generalized Levy walk to model fractal landscapes observed in noncoding DNA sequences. We find that this model provides a very close approximation to the empirical data and explains a number of statistical properties of genomic DNA sequences such as the distribution of strand-biased regions (those with an excess of one type of nucleotide) as well as local changes in the slope of the correlation exponent alpha. The generalized Levy-walk model simultaneously accounts for the long-range correlations in noncoding DNA sequences and for the apparently paradoxical finding of long subregions of biased random walks (length lj) within these correlated sequences. In the generalized Levy-walk model, the lj are chosen from a power-law distribution P(lj) varies as lj(-mu). The correlation exponent alpha is related to mu through alpha = 2-mu/2 if 2 < mu < 3. The model is consistent with the finding of "repetitive elements" of variable length interspersed within noncoding DNA.

  6. DNA methylation mapping by tag-modified bisulfite genomic sequencing.

    PubMed

    Han, Weiguo; Cauchi, Stephane; Herman, James G; Spivack, Simon D

    2006-08-01

    A tag-modified bisulfite genomic sequencing (tBGS) method employing direct cycle sequencing of polymerase chain reaction (PCR) products at kilobase scale, without conventional DNA fragment cloning, was developed for simplified evaluation of DNA methylation sites. The method entails subjecting bisulfite-modified genomic DNA to a second-round PCR amplification employing GC-tagged primers. Qualitative results from tBGS closely correlated with those from conventional BGS (R=0.935, p=0.002). In application, the intertissue and interindividual CpG methylation differences in promoter sequence for two genes, CYP1B1 and GSTP1, were then explored across four human tissue types (peripheral blood cells, exfoliated buccal cells, paired nontumor-tumor lung tissues), and two lung cell types in culture (normal NHBE and malignant A549). Predominantly conserved methylation maps for the two gene promoters were apparent across donors and tissues. At any given CpG site, variation in the degree of methylation could be determined by the relative height of C and T peaks in the sequencing trace. Methylation maps for the GSTP1 promoter diverged between NHBE (unmethylated) and A549 (completely methylated) cells in a previously unexplored upstream region, correlating with a 2.7-fold difference in GSTP1 mRNA expression (p<0.01). The tBGS method simplifies detailed methylation scanning of kilobase-scale genomic DNA, facilitating more ambitious genomic methylation mapping studies.

  7. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  8. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1987-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

  9. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1989-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

  10. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1988-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

  11. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1990-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

  12. Aspects of coverage in medical DNA sequencing

    PubMed Central

    Wendl, Michael C; Wilson, Richard K

    2008-01-01

    Background DNA sequencing is now emerging as an important component in biomedical studies of diseases like cancer. Short-read, highly parallel sequencing instruments are expected to be used heavily for such projects, but many design specifications have yet to be conclusively established. Perhaps the most fundamental of these is the redundancy required to detect sequence variations, which bears directly upon genomic coverage and the consequent resolving power for discerning somatic mutations. Results We address the medical sequencing coverage problem via an extension of the standard mathematical theory of haploid coverage. The expected diploid multi-fold coverage, as well as its generalization for aneuploidy are derived and these expressions can be readily evaluated for any project. The resulting theory is used as a scaling law to calibrate performance to that of standard BAC sequencing at 8× to 10× redundancy, i.e. for expected coverages that exceed 99% of the unique sequence. A differential strategy is formalized for tumor/normal studies wherein tumor samples are sequenced more deeply than normal ones. In particular, both tumor alleles should be detected at least twice, while both normal alleles are detected at least once. Our theory predicts these requirements can be met for tumor and normal redundancies of approximately 26× and 21×, respectively. We explain why these values do not differ by a factor of 2, as might intuitively be expected. Future technology developments should prompt even deeper sequencing of tumors, but the 21× value for normal samples is essentially a constant. Conclusion Given the assumptions of standard coverage theory, our model gives pragmatic estimates for required redundancy. The differential strategy should be an efficient means of identifying potential somatic mutations for further study. PMID:18485222

  13. Genomic libraries: II. Subcloning, sequencing, and assembling large-insert genomic DNA clones.

    PubMed

    Quail, Mike A; Matthews, Lucy; Sims, Sarah; Lloyd, Christine; Beasley, Helen; Baxter, Simon W

    2011-01-01

    Sequencing large insert clones to completion is useful for characterizing specific genomic regions, identifying haplotypes, and closing gaps in whole genome sequencing projects. Despite being a standard technique in molecular laboratories, DNA sequencing using the Sanger method can be highly problematic when complex secondary structures or sequence repeats are encountered in genomic clones. Here, we describe methods to isolate DNA from a large insert clone (fosmid or BAC), subclone the sample, and sequence the region to the highest industry standard. Troubleshooting solutions for sequencing difficult templates are discussed.

  14. DNA Methylation within Transcribed Regions

    PubMed Central

    To, Taiko K.; Saze, Hidetoshi; Kakutani, Tetsuji

    2015-01-01

    DNA methylation within transcribed genes is commonly found in diverse animals and plants. Here, we provide an overview of recent advances and the remaining mystery regarding intragenic DNA methylation. PMID:26143255

  15. Detection of regional DNA methylation using DNA-graphene affinity interactions.

    PubMed

    Haque, Md Hakimul; Gopalan, Vinod; Yadav, Sharda; Islam, Md Nazmul; Eftekhari, Ehsan; Li, Qin; Carrascosa, Laura G; Nguyen, Nam-Trung; Lam, Alfred K; Shiddiky, Muhammad J A

    2017-01-15

    We report a new method for the detection of regional DNA methylation using base-dependent affinity interaction (i.e., adsorption) of DNA with graphene. Due to the strongest adsorption affinity of guanine bases towards graphene, bisulfite-treated guanine-enriched methylated DNA leads to a larger amount of the adsorbed DNA on the graphene-modified electrodes in comparison to the adenine-enriched unmethylated DNA. The level of the methylation is quantified by monitoring the differential pulse voltammetric current as a function of the adsorbed DNA. The assay is sensitive to distinguish methylated and unmethylated DNA sequences at single CpG resolution by differentiating changes in DNA methylation as low as 5%. Furthermore, this method has been used to detect methylation levels in a collection of DNA samples taken from oesophageal cancer tissues.

  16. Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

    SciTech Connect

    Winston Chen, C.H.; Taranenko, N.I.; Zhu, Y.F.; Chung, C.N.; Allman, S.L.

    1997-03-01

    Since laser mass spectrometry has the potential for achieving very fast DNA analysis, the authors recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Snager`s enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. The preliminary results indicate laser mass spectrometry can possibly be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, the authors applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

  17. Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

    NASA Astrophysics Data System (ADS)

    Chen, C. H. Winston; Taranenko, N. I.; Zhu, Y. F.; Chung, C. N.; Allman, S. L.

    1997-05-01

    Since laser mass spectrometry has the potential for achieving very fast DNA analysis, we recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Sanger's enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. Our preliminary results indicate laser mass spectrometry can possible be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, we applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

  18. Mitochondrial DNA Sequencing of Cat Hair: An Informative Forensic Tool*

    PubMed Central

    Tarditi, Christy R.; Grahn, Robert A.; Evans, Jeffrey J.; Kurushima, Jennifer D.; Lyons, Leslie A.

    2010-01-01

    Approximately 81.7 million cats are in 37.5 million USA households. Shed fur can be criminal evidence due to transfer to victims, suspects, and / or their belongings. To improve cat hairs as forensic evidence, the mtDNA control region from single hairs, with and without root tags, was sequenced. A dataset of a 402 bp CR segment from 174 random-bred cats representing four USA geographic areas was generated to determine the informativeness of the mtDNA region. Thirty-two mtDNA mitotypes were observed ranging in frequencies from 0.6-27%. Four common types occurred in all populations. Low heteroplasmy, 1.7%, was determined. Unique mitotypes were found in 18 individuals, 10.3% of the population studied. The calculated discrimination power implied that 8.3 of 10 randomly selected individuals can be excluded by this region. The genetic characteristics of the region and the generated dataset support the use of this cat mtDNA region in forensic applications. PMID:21077873

  19. Methods for sequencing GC-rich and CCT repeat DNA templates

    DOEpatents

    Robinson, Donna L.

    2007-02-20

    The present invention is directed to a PCR-based method of cycle sequencing DNA and other polynucleotide sequences having high CG content and regions of high GC content, and includes for example DNA strands with a high Cytosine and/or Guanosine content and repeated motifs such as CCT repeats.

  20. Sequence-specific binding of simian virus 40 A protein to nonorigin and cellular DNA.

    PubMed Central

    Wright, P J; DeLucia, A L; Tegtmeyer, P

    1984-01-01

    The simian virus 40 A protein (T antigen) recognized and bound to the consensus sequence 5'-GAGGC-3' in DNA from many sources. Sequence-specific binding to single pentanucleotides in randomly chosen DNA predominated over binding to nonspecific sequences. The asymmetric orientation of protein bound to nonorigin recognition sequences also resembled that of protein bound to the origin region of simian virus 40 DNA. Sequence variations in the DNA adjacent to single pentanucleotides influenced binding affinities even though methylation interference and protection studies did not reveal specific interactions outside of pentanucleotides. Thus, potential locations of A protein bound to any DNA can be predicted although the determinants of binding affinity are not yet understood. Sequence-specific binding of A protein to cellular DNA would provide a mechanism for specific alterations of host gene expression that facilitate viral function. Images PMID:6570189

  1. Sequence dependent hole evolution in DNA.

    PubMed

    Lakhno, V D

    2004-06-01

    The paper examines thedynamical behavior of a radical cation(G(+*)) generated in adouble stranded DNA for differentoligonucleotide sequences. The resonancehole tunneling through an oligonucleotidesequence is studied by the method ofnumerical integration of self-consistentquantum-mechanical equations. The holemotion is considered quantum mechanicallyand nucleotide base oscillations aretreated classically. The results obtaineddemonstrate a strong dependence of chargetransfer on the type of nucleotidesequence. The rates of the hole transferare calculated for different nucleotidesequences and compared with experimentaldata on the transfer from (G(+*))to a GGG unit.

  2. Recent advances in DNA sequencing techniques

    NASA Astrophysics Data System (ADS)

    Singh, Rama Shankar

    2013-06-01

    Successful mapping of the draft human genome in 2001 and more recent mapping of the human microbiome genome in 2012 have relied heavily on the parallel processing of the second generation/Next Generation Sequencing (NGS) DNA machines at a cost of several millions dollars and long computer processing times. These have been mainly biochemical approaches. Here a system analysis approach is used to review these techniques by identifying the requirements, specifications, test methods, error estimates, repeatability, reliability and trends in the cost reduction. The first generation, NGS and the Third Generation Single Molecule Real Time (SMART) detection sequencing methods are reviewed. Based on the National Human Genome Research Institute (NHGRI) data, the achieved cost reduction of 1.5 times per yr. from Sep. 2001 to July 2007; 7 times per yr., from Oct. 2007 to Apr. 2010; and 2.5 times per yr. from July 2010 to Jan 2012 are discussed.

  3. Transverse Electronic Signature of DNA for Electronic Sequencing

    NASA Astrophysics Data System (ADS)

    Xu, Mingsheng; Endres, Robert G.; Arakawa, Yasuhiko

    In recent years, the proliferation of large-scale DNA sequencing projects for applications in clinical medicine and health care has driven the search for new methods that could reduce the time and cost. The commonly used Sanger sequencing method relies on the chemistry to read the bases in DNA and is far too slow and expensive for reading personal genetic codes. There were earlier attempts to sequence DNA by directly visualizing the nucleotide composition of the DNA molecules by scanning tunneling microscopy (STM). However, sequencing DNA based on directly imaging DNA's atomic structure has not yet been successful. In Chap. 9, Xu, Endres, and Arakawa report a potential physical alternative by detecting unique transverse electronic signatures of DNA bases using ultrahigh vacuum STM. Supported by the principles, calculations and statistical analyses, these authors argue that it would be possible to directly sequence DNA by the STM-based technology without any modification of the DNA.

  4. [Current applications of high-throughput DNA sequencing technology in antibody drug research].

    PubMed

    Yu, Xin; Liu, Qi-Gang; Wang, Ming-Rong

    2012-03-01

    Since the publication of a high-throughput DNA sequencing technology based on PCR reaction was carried out in oil emulsions in 2005, high-throughput DNA sequencing platforms have been evolved to a robust technology in sequencing genomes and diverse DNA libraries. Antibody libraries with vast numbers of members currently serve as a foundation of discovering novel antibody drugs, and high-throughput DNA sequencing technology makes it possible to rapidly identify functional antibody variants with desired properties. Herein we present a review of current applications of high-throughput DNA sequencing technology in the analysis of antibody library diversity, sequencing of CDR3 regions, identification of potent antibodies based on sequence frequency, discovery of functional genes, and combination with various display technologies, so as to provide an alternative approach of discovery and development of antibody drugs.

  5. Image Correlation Method for DNA Sequence Alignment

    PubMed Central

    Curilem Saldías, Millaray; Villarroel Sassarini, Felipe; Muñoz Poblete, Carlos; Vargas Vásquez, Asticio; Maureira Butler, Iván

    2012-01-01

    The complexity of searches and the volume of genomic data make sequence alignment one of bioinformatics most active research areas. New alignment approaches have incorporated digital signal processing techniques. Among these, correlation methods are highly sensitive. This paper proposes a novel sequence alignment method based on 2-dimensional images, where each nucleic acid base is represented as a fixed gray intensity pixel. Query and known database sequences are coded to their pixel representation and sequence alignment is handled as object recognition in a scene problem. Query and database become object and scene, respectively. An image correlation process is carried out in order to search for the best match between them. Given that this procedure can be implemented in an optical correlator, the correlation could eventually be accomplished at light speed. This paper shows an initial research stage where results were “digitally” obtained by simulating an optical correlation of DNA sequences represented as images. A total of 303 queries (variable lengths from 50 to 4500 base pairs) and 100 scenes represented by 100 x 100 images each (in total, one million base pair database) were considered for the image correlation analysis. The results showed that correlations reached very high sensitivity (99.01%), specificity (98.99%) and outperformed BLAST when mutation numbers increased. However, digital correlation processes were hundred times slower than BLAST. We are currently starting an initiative to evaluate the correlation speed process of a real experimental optical correlator. By doing this, we expect to fully exploit optical correlation light properties. As the optical correlator works jointly with the computer, digital algorithms should also be optimized. The results presented in this paper are encouraging and support the study of image correlation methods on sequence alignment. PMID:22761742

  6. Image correlation method for DNA sequence alignment.

    PubMed

    Curilem Saldías, Millaray; Villarroel Sassarini, Felipe; Muñoz Poblete, Carlos; Vargas Vásquez, Asticio; Maureira Butler, Iván

    2012-01-01

    The complexity of searches and the volume of genomic data make sequence alignment one of bioinformatics most active research areas. New alignment approaches have incorporated digital signal processing techniques. Among these, correlation methods are highly sensitive. This paper proposes a novel sequence alignment method based on 2-dimensional images, where each nucleic acid base is represented as a fixed gray intensity pixel. Query and known database sequences are coded to their pixel representation and sequence alignment is handled as object recognition in a scene problem. Query and database become object and scene, respectively. An image correlation process is carried out in order to search for the best match between them. Given that this procedure can be implemented in an optical correlator, the correlation could eventually be accomplished at light speed. This paper shows an initial research stage where results were "digitally" obtained by simulating an optical correlation of DNA sequences represented as images. A total of 303 queries (variable lengths from 50 to 4500 base pairs) and 100 scenes represented by 100 x 100 images each (in total, one million base pair database) were considered for the image correlation analysis. The results showed that correlations reached very high sensitivity (99.01%), specificity (98.99%) and outperformed BLAST when mutation numbers increased. However, digital correlation processes were hundred times slower than BLAST. We are currently starting an initiative to evaluate the correlation speed process of a real experimental optical correlator. By doing this, we expect to fully exploit optical correlation light properties. As the optical correlator works jointly with the computer, digital algorithms should also be optimized. The results presented in this paper are encouraging and support the study of image correlation methods on sequence alignment.

  7. Degradation in forensic trace DNA samples explored by massively parallel sequencing.

    PubMed

    Hanssen, Eirik Nataas; Lyle, Robert; Egeland, Thore; Gill, Peter

    2017-03-01

    Routine forensic analysis using STRs will fail if the DNA is too degraded. The DNA degradation process in biological stain material is not well understood. In this study we sequenced old semen and blood stains by massively parallel sequencing. The sequence data coverage was used to measure degradation across the genome. The results supported the contention that degradation is uniform across the genome, showing no evidence of regions with increased or decreased resistance towards degradation. Thus the lack of genetic regions robust to degradation removes the possibility of using such regions to further optimize analysis performance for degraded DNA.

  8. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  9. Next generation sequencing of DNA-launched Chikungunya vaccine virus

    SciTech Connect

    Hidajat, Rachmat; Nickols, Brian; Forrester, Naomi; Tretyakova, Irina; Weaver, Scott; Pushko, Peter

    2016-03-15

    Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.

  10. Pericentric satellite DNA sequences in Pipistrellus pipistrellus (Vespertilionidae; Chiroptera).

    PubMed

    Barragán, M J L; Martínez, S; Marchal, J A; Fernández, R; Bullejos, M; Díaz de la Guardia, R; Sánchez, A

    2003-09-01

    This paper reports the molecular and cytogenetic characterization of a HindIII family of satellite DNA in the bat species Pipistrellus pipistrellus. This satellite is organized in tandem repeats of 418 bp monomer units, and represents approximately 3% of the whole genome. The consensus sequence from five cloned monomer units has an A-T content of 62.20%. We have found differences in the ladder pattern of bands between two populations of the same species. These differences are probably because of the absence of the target sites for the HindIII enzyme in most monomer units of one population, but not in the other. Fluorescent in situ hybridization (FISH) localized the satellite DNA in the pericentromeric regions of all autosomes and the X chromosome, but it was absent from the Y chromosome. Digestion of genomic DNAs with HpaII and its isoschizomer MspI demonstrated that these repetitive DNA sequences are not methylated. Other bat species were tested for the presence of this repetitive DNA. It was absent in five Vespertilionidae and one Rhinolophidae species, indicating that it could be a species/genus specific, repetitive DNA family.

  11. Molecular cloning of cDNA for the zeta isoform of the 14-3-3 protein: homologous sequences in the 3'-untranslated region of frog and human zeta isoforms.

    PubMed

    Miura, I; Nakajima, T; Ohtani, H; Kashiwagi, A; Nakamura, M

    1997-10-01

    14-3-3 proteins constitute a family of well-conserved eukaryotic proteins that possess diverse biochemical activities such as regulation of gene transcription, cell proliferation and activation of protein kinase C. At least 7 subtypes (alpha to theta) of 14-3-3 protein are known, but the zeta subtype of this protein has been cloned only in mammals. We cloned the zeta subtype of 14-3-3 protein (14-3-3 zeta) from the frog, Rana rugosa. The sequence encoded 245 amino acids that share 92% identity with rat and bovine 14-3-3 zeta s, and 92% with human phospholipase A2 (PLA2; 14-3-3 zeta). Northern blot analysis revealed a single band of about 1.8 kb in tadpoles at stage 25. The 14-3-3 zeta mRNA level was high in the brain, lung, spleen and kidney, and low in the heart and testis, as opposed to the mRNA level, which was only faintly detected in the liver, pancreas, ovary and muscle. Furthermore, high similarity in the 3'-untranslated region (3'-UTR) was observed between frog and human 14-3-3 zeta cDNA. The results suggest that 14-3-3 zeta is highly conserved throughout eukaryotic evolution, and that the homologous sequence in the 3'-UTR of 14-3-3 zeta cDNA may be conserved in frogs and humans.

  12. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.

    PubMed

    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter

    2014-09-01

    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow.

  13. Fine mapping and DNA fiber FISH analysis locates the tobamovirus resistance gene L3 of Capsicum chinense in a 400-kb region of R-like genes cluster embedded in highly repetitive sequences.

    PubMed

    Tomita, R; Murai, J; Miura, Y; Ishihara, H; Liu, S; Kubotera, Y; Honda, A; Hatta, R; Kuroda, T; Hamada, H; Sakamoto, M; Munemura, I; Nunomura, O; Ishikawa, K; Genda, Y; Kawasaki, S; Suzuki, K; Meksem, K; Kobayashi, K

    2008-11-01

    The tobamovirus resistance gene L(3) of Capsicum chinense was mapped using an intra-specific F2 population (2,016 individuals) of Capsicum annuum cultivars, into one of which had been introduced the C. chinense L(3) gene, and an inter-specific F2 population (3,391 individuals) between C. chinense and Capsicum frutescence. Analysis of a BAC library with an AFLP marker closely linked to L(3)-resistance revealed the presence of homologs of the tomato disease resistance gene I2. Partial or full-length coding sequences were cloned by degenerate PCR from 35 different pepper I2 homologs and 17 genetic markers were generated in the inter-specific combination. The L(3) gene was mapped between I2 homolog marker IH1-04 and BAC-end marker 189D23M, and located within a region encompassing two different BAC contigs consisting of four and one clones, respectively. DNA fiber FISH analysis revealed that these two contigs are separated from each other by about 30 kb. DNA fiber FISH results and Southern blotting of the BAC clones suggested that the L(3) locus-containing region is rich in highly repetitive sequences. Southern blot analysis indicated that the two BAC contigs contain more than ten copies of the I2 homologs. In contrast to the inter-specific F2 population, no recombinant progeny were identified to have a crossover point within two BAC contigs consisting of seven and two clones in the intra-specific F2 population. Moreover, distribution of the crossover points differed between the two populations, suggesting linkage disequilibrium in the region containing the L locus.

  14. Determining orientation and direction of DNA sequences

    DOEpatents

    Goodwin, Edwin H.; Meyne, Julianne

    2000-01-01

    Determining orientation and direction of DNA sequences. A method by which fluorescence in situ hybridization can be made strand specific is described. Cell cultures are grown in a medium containing a halogenated nucleotide. The analog is partially incorporated in one DNA strand of each chromatid. This substitution takes place in opposite strands of the two sister chromatids. After staining with the fluorescent DNA-binding dye Hoechst 33258, cells are exposed to long-wavelength ultraviolet light which results in numerous strand nicks. These nicks enable the substituted strand to be denatured and solubilized by heat, treatment with high or low pH aqueous solutions, or by immersing the strands in 2.times.SSC (0.3M NaCl+0.03M sodium citrate), to name three procedures. It is unnecessary to enzymatically digest the strands using Exo III or another exonuclease in order to excise and solubilize nucleotides starting at the sites of the nicks. The denaturing/solubilizing process removes most of the substituted strand while leaving the prereplication strand largely intact. Hybridization of a single-stranded probe of a tandem repeat arranged in a head-to-tail orientation will result in hybridization only to the chromatid with the complementary strand present.

  15. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  16. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  17. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  18. cDNA encoding a polypeptide including a hevein sequence

    SciTech Connect

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  19. Partition enrichment of nucleotide sequences (PINS)--a generally applicable, sequence based method for enrichment of complex DNA samples.

    PubMed

    Kvist, Thomas; Sondt-Marcussen, Line; Mikkelsen, Marie Just

    2014-01-01

    The dwindling cost of DNA sequencing is driving transformative changes in various biological disciplines including medicine, thus resulting in an increased need for routine sequencing. Preparation of samples suitable for sequencing is the starting point of any practical application, but enrichment of the target sequence over background DNA is often laborious and of limited sensitivity thereby limiting the usefulness of sequencing. The present paper describes a new method, Probability directed Isolation of Nucleic acid Sequences (PINS), for enrichment of DNA, enabling the sequencing of a large DNA region surrounding a small known sequence. A 275,000 fold enrichment of a target DNA sample containing integrated human papilloma virus is demonstrated. Specifically, a sample containing 0.0028 copies of target sequence per ng of total DNA was enriched to 786 copies per ng. The starting concentration of 0.0028 target copies per ng corresponds to one copy of target in a background of 100,000 complete human genomes. The enriched sample was subsequently amplified using rapid genome walking and the resulting DNA sequence revealed not only the sequence of a the truncated virus, but also 1026 base pairs 5' and 50 base pairs 3' to the integration site in chromosome 8. The demonstrated enrichment method is extremely sensitive and selective and requires only minimal knowledge of the sequence to be enriched and will therefore enable sequencing where the target concentration relative to background is too low to allow the use of other sample preparation methods or where significant parts of the target sequence is unknown.

  20. Phylogenetic inference of Indian malaria vectors from multilocus DNA sequences.

    PubMed

    Dixit, Jyotsana; Srivastava, Hemlata; Sharma, Meenu; Das, Manoj K; Singh, O P; Raghavendra, K; Nanda, Nutan; Dash, Aditya P; Saksena, D N; Das, Aparup

    2010-08-01

    Inferences on the taxonomic positions, phylogenetic interrelationships and divergence time among closely related species of medical importance is essential to understand evolutionary patterns among species, and based on which, disease control measures could be devised. To this respect, malaria is one of the important mosquito borne diseases of tropical and sub-tropical parts of the globe. Taxonomic status of malaria vectors has been so far documented based on morphological, cytological and few molecular genetic features. However, utilization of multilocus DNA sequences in phylogenetic inferences are still in dearth. India contains one of the richest resources of mosquito species diversity but little molecular taxonomic information is available in Indian malaria vectors. We herewith utilized the whole genome sequence information of An. gambiae to amplify and sequence three orthologous nuclear genetic regions in six Indian malaria vector species (An. culicifacies, An. minimus, An. sundaicus, An. fluviatilis, An. annularis and An. stephensi). Further, we utilized the previously published DNA sequence information on the COII and ITS2 genes in all the six species, making the total number of loci to five. Multilocus molecular phylogenetic study of Indian anophelines and An. gambiae was conducted at each individual genetic region using Neighbour Joining (NJ), Maximum Likelihood (ML), Maximum Parsimony (MP) and Bayesian approaches. Although tree topologies with COII, and ITS2 genes were similar, for no other three genetic regions similar tree topologies were observed. In general, the reconstructed phylogenetic status of Indian malaria vectors follows the pattern based on morphological and cytological classifications that was reconfirmed with COII and ITS2 genetic regions. Further, divergence times based on COII gene sequences were estimated among the seven Anopheles species which corroborate the earlier hypothesis on the radiation of different species of the Anopheles

  1. Nucleotide sequence of a preferred maize chloroplast genome template for in vitro DNA synthesis.

    PubMed Central

    Gold, B; Carrillo, N; Tewari, K K; Bogorad, L

    1987-01-01

    Maize chloroplast DNA sequences representing 94% of the chromosome have been surveyed for their activity as autonomously replicating sequences in yeast and as templates for DNA synthesis in vitro by a partially purified chloroplast DNA polymerase. A maize chloroplast DNA region extending over about 9 kilobase pairs is especially active as a template for the DNA synthesis reaction. Fragments from within this region are much more active than DNA from elsewhere in the chromosome and 50- to 100-fold more active than DNA of the cloning vector pBR322. The smallest of the strongly active subfragments that we have studied, the 1368-base-pair EcoRI fragment x, has been sequenced and found to contain the coding region of chloroplast ribosomal protein L16. EcoRI fragment x shows sequence homology with a portion of the Chlamydomonas reinhardtii chloroplast chromosome that forms a displacement loop [Wang, X.-M., Chang, C.H., Waddell, J. & Wu, M. (1984) Nucleic Acids Res. 12, 3857-3872]. Maize chloroplast DNA fragments that permit autonomous replication of DNA in yeast are not active as templates for DNA synthesis in the in vitro assay. The template active region we have identified may represent one of the origins of replication of maize chloroplast DNA. Images PMID:3025853

  2. cDNA sequences of two apolipoproteins from lamprey

    SciTech Connect

    Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.

    1987-03-24

    The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point.

  3. EFFECT OF DIFFERENT REGIONS OF AMPLIFIED 16S RDNA ON A PERFORMANCE OF A MULTIPLEXED, BEAD-BASED METHOD FOR ANALYSIS OF DNA SEQUENCES IN ENVIRONMENTAL SAMPLES.

    EPA Science Inventory

    Using a bead-based method for multiplexed analysis of community DNA, the dynamics of aquatic microbial communities can be assessed. Capture probes, specific for a genus or species of bacteria, are attached to the surface of uniquely labeled, microscopic polystyrene beads. Primers...

  4. Sequencing mitochondrial DNA from a tooth and application to forensic odontology.

    PubMed

    Yamada, Y; Ohira, H; Iwase, H; Takatori, T; Nagao, M; Ohtani, S

    1997-06-01

    Genetic identification can be complicated by long intervals between the time of death and examination of tissues, and sometimes only bone and teeth may be available for analysis. Several investigators have described the isolation of nuclear DNA from these materials, but all have indicated that the DNA is significantly degraded. Recently, the polymerase chain reaction (PCR) and direct DNA sequencing have enabled rapid and reliable characterization of specific highly polymorphic DNA sequences from different individuals. Above all, mitochondrial DNA sequences offer several unique advantages for the identification of human remains. The isolation of mtDNA from a tooth and the symmetrical PCR amplification and direct DNA sequencing of its most polymorphic regions are reported.

  5. Model System for DNA Replication of a Plasmid DNA Containing the Autonomously Replicating Sequence from Saccharomyces cerevisiae

    NASA Astrophysics Data System (ADS)

    Ishimi, Yukio; Matsumoto, Ken

    1993-06-01

    A negatively supercoiled plasmid DNA containing autonomously replicating sequence (ARS) 1 from Saccharomyces cerevisiae was replicated with the proteins required for simian virus 40 DNA replication. The proteins included simian virus 40 large tumor antigen as a DNA helicase, DNA polymerase α^\\cdotprimase, and the multisubunit human single-stranded DNA-binding protein from HeLa cells; DNA gyrase from Escherichia coli, which relaxes positive but not negative supercoils, was included as a "swivelase." DNA replication started from the ARS region, proceeded bidirectionally with the synthesis of leading and lagging strands, and resulted in the synthesis of up to 10% of the input DNA in 1 h. The addition of HeLa DNA topoisomerase I, which relaxes both positive and negative supercoils, to this system inhibited DNA replication, suggesting that negative supercoiling of the template DNA is required for initiation. These results suggest that DNA replication starts from the ARS region where the DNA duplex is unwound by torsional stress; this unwound region can be recognized by a DNA helicase with the assistance of the multisubunit human single-stranded DNA-binding protein.

  6. The regions of sequence variation in caulimovirus gene VI.

    PubMed

    Sanger, M; Daubert, S; Goodman, R M

    1991-06-01

    The sequence of gene VI from figwort mosaic virus (FMV) clone x4 was determined and compared with that previously published for FMV clone DxS. Both clones originated from the same virus isolation, but the virus used to clone DxS was propagated extensively in a host of a different family prior to cloning whereas that used to clone x4 was not. Differences in the amino acid sequence inferred from the DNA sequences occurred in two clusters. An N-terminal conserved region preceded two regions of variation separated by a central conserved region. Variation in cauliflower mosaic virus (CaMV) gene VI sequences, all of which were derived from virus isolates from hosts from one host family, was similar to that seen in the FMV comparison, though the extent of variation was less. Alignment of gene VI domains from FMV and CaMV revealed regions of amino acid sequence identical in both viruses within the conserved regions. The similarity in the pattern of conserved and variable domains of these two viruses suggests common host-interactive functions in caulimovirus gene VI homologues, and possibly an analogy between caulimoviruses and certain animal viruses in the influence of the host on sequence variability of viral genes.

  7. Population structure and genetic diversity of Indian Major Carp, Labeo rohita (Hamilton, 1822) from three phylo-geographically isolated riverine ecosystems of India as revealed by mtDNA cytochrome b region sequences.

    PubMed

    Behera, Bijay Kumar; Baisvar, Vishwamitra Singh; Kunal, Swaraj Priyaranjan; Meena, Dharmendra Kumar; Panda, Debarata; Pakrashi, Sudip; Paria, Prasenjit; Das, Pronob; Bhakta, Dibakar; Debnath, Dipesh; Roy, Suvra; Suresh, V R; Jena, J K

    2016-12-26

    The population structure and genetic diversity of Rohu (Labeo rohita Hamilton, 1822) was studied by analysis of the partial sequences of mitochondrial DNA cytochrome b region. We examined 133 samples collected from six locations in three geographically isolated rivers of India. Analysis of 11 haplotypes showed low haplotype diversity (0.00150), nucleotide diversity (π) (0.02884) and low heterogeneity value (0.00374). Analysis of molecular variance (AMOVA) revealed the genetic diversity of L. rohita within population is very high than between the populations. The Fst scores (-0.07479 to 0.07022) were the indication of low genetic structure of L. rohita populations of three rivers of India. Conspicuously, Farakka-Bharuch population pair Fst score of 0.0000, although the sampling sites are from different rivers. The phylogenetic reconstruction of unique haplotypes revealed sharing of a single central haplotype (Hap_1) by all the six populations with a point mutations ranging from 1-25 nucleotides.

  8. DNA extraction from vegetative tissue for next-generation sequencing.

    PubMed

    Furtado, Agnelo

    2014-01-01

    The quality of extracted DNA is crucial for several applications in molecular biology. If the DNA is to be used for next-generation sequencing (NGS), then microgram quantities of good-quality DNA is required. In addition, the DNA must substantially be of high molecular weight so that it can be used for library preparation and NGS sequencing. Contaminating phenol or starch in the isolated DNA can be easily removed by filtration through kit-based cartridges. In this chapter we describe a simple two-reagent DNA extraction protocol which yields a high quality and quantity of DNA which can be used for different applications including NGS.

  9. From DNA sequence to transcriptional behaviour: a quantitative approach.

    PubMed

    Segal, Eran; Widom, Jonathan

    2009-07-01

    Complex transcriptional behaviours are encoded in the DNA sequences of gene regulatory regions. Advances in our understanding of these behaviours have been recently gained through quantitative models that describe how molecules such as transcription factors and nucleosomes interact with genomic sequences. An emerging view is that every regulatory sequence is associated with a unique binding affinity landscape for each molecule and, consequently, with a unique set of molecule-binding configurations and transcriptional outputs. We present a quantitative framework based on existing methods that unifies these ideas. This framework explains many experimental observations regarding the binding patterns of factors and nucleosomes and the dynamics of transcriptional activation. It can also be used to model more complex phenomena such as transcriptional noise and the evolution of transcriptional regulation.

  10. Solid-Phase Purification of Synthetic DNA Sequences.

    PubMed

    Grajkowski, Andrzej; Cieslak, Jacek; Beaucage, Serge L

    2016-08-05

    Although high-throughput methods for solid-phase synthesis of DNA sequences are currently available for synthetic biology applications and technologies for large-scale production of nucleic acid-based drugs have been exploited for various therapeutic indications, little has been done to develop high-throughput procedures for the purification of synthetic nucleic acid sequences. An efficient process for purification of phosphorothioate and native DNA sequences is described herein. This process consists of functionalizing commercial aminopropylated silica gel with aminooxyalkyl functions to enable capture of DNA sequences carrying a 5'-siloxyl ether linker with a "keto" function through an oximation reaction. Deoxyribonucleoside phosphoramidites functionalized with the 5'-siloxyl ether linker were prepared in yields of 75-83% and incorporated last into the solid-phase assembly of DNA sequences. Capture of nucleobase- and phosphate-deprotected DNA sequences released from the synthesis support is demonstrated to proceed near quantitatively. After shorter than full-length DNA sequences were washed from the capture support, the purified DNA sequences were released from this support upon treatment with tetra-n-butylammonium fluoride in dry DMSO. The purity of released DNA sequences exceeds 98%. The scalability and high-throughput features of the purification process are demonstrated without sacrificing purity of the DNA sequences.

  11. Sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2, and 28S rDNA) of Demodex and phylogenetic analysis of Acari based on 18S and 28S rDNA.

    PubMed

    Zhao, Ya-E; Wu, Li-Ping; Hu, Li; Xu, Yang; Wang, Zheng-Hang; Liu, Wen-Yan

    2012-11-01

    Due to the difficulty of DNA extraction for Demodex, few studies dealt with the identification and the phyletic evolution of Demodex at molecular level. In this study, we amplified, sequenced, and analyzed a complete (Demodex folliculorum) and an almost complete (D12 missing) (Demodex brevis) ribosomal DNA (rDNA) sequence and also analyzed the primary sequences of divergent domains in small-subunit ribosomal RNA (rRNA) of 51 species and in large-subunit rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea, and Ixodoidea). The results revealed that 18S rDNA sequence was relatively conserved in rDNA-coding regions and was not evolving as rapidly as 28S rDNA sequence. The evolutionary rates of transcribed spacer regions were much higher than those of the coding regions. The maximum parsimony trees of 18S and 28S rDNA appeared to be almost identical, consistent with their morphological classification. Based on the fact that the resolution capability of sequence length and the divergence of the 13 segments (D1-D6, D7a, D7b, and D8-D12) of 28S rDNA were stronger than that of the nine variable regions (V1-V9) of 18S rDNA, we were able to identify Demodex (Cheyletoidea) by the indels occurring in D2, D6, and D8.

  12. What Advances Are Being Made in DNA Sequencing?

    MedlinePlus

    ... DNA building blocks (nucleotides) in an individual's genetic code, called DNA sequencing, has advanced the study of ... breakthrough that helped scientists determine the human genetic code, but it is time-consuming and expensive. The ...

  13. Theoretical modelling of epigenetically modified DNA sequences

    PubMed Central

    Carvalho, Alexandra Teresa Pires; Gouveia, Maria Leonor; Raju Kanna, Charan; Wärmländer, Sebastian K. T. S.; Platts, Jamie; Kamerlin, Shina Caroline Lynn

    2015-01-01

    We report herein a set of calculations designed to examine the effects of epigenetic modifications on the structure of DNA. The incorporation of methyl, hydroxymethyl, formyl and carboxy substituents at the 5-position of cytosine is shown to hardly affect the geometry of CG base pairs, but to result in rather larger changes to hydrogen-bond and stacking binding energies, as predicted by dispersion-corrected density functional theory (DFT) methods. The same modifications within double-stranded GCG and ACA trimers exhibit rather larger structural effects, when including the sugar-phosphate backbone as well as sodium counterions and implicit aqueous solvation. In particular, changes are observed in the buckle and propeller angles within base pairs and the slide and roll values of base pair steps, but these leave the overall helical shape of DNA essentially intact. The structures so obtained are useful as a benchmark of faster methods, including molecular mechanics (MM) and hybrid quantum mechanics/molecular mechanics (QM/MM) methods. We show that previously developed MM parameters satisfactorily reproduce the trimer structures, as do QM/MM calculations which treat bases with dispersion-corrected DFT and the sugar-phosphate backbone with AMBER. The latter are improved by inclusion of all six bases in the QM region, since a truncated model including only the central CG base pair in the QM region is considerably further from the DFT structure. This QM/MM method is then applied to a set of double-stranded DNA heptamers derived from a recent X-ray crystallographic study, whose size puts a DFT study beyond our current computational resources. These data show that still larger structural changes are observed than in base pairs or trimers, leading us to conclude that it is important to model epigenetic modifications within realistic molecular contexts. PMID:26448859

  14. Isolation, characterization and chromosome localization of repetitive DNA sequences in bananas (Musa spp.).

    PubMed

    Valárik, M; Simková, H; Hribová, E; Safár, J; Dolezelová, M; Dolezel, J

    2002-01-01

    Partial genomic DNA libraries were constructed in Musa acuminata and M. balbisiana and screened for clones carrying repeated sequences, and sequences carrying rDNA. Isolated clones were characterized in terms of copy number, genomic distribution in M. acuminata and M. balbisiana, and sequence similarity to known DNA sequences. Ribosomal RNA genes have been the most abundant sequences recovered. FISH with probes for DNA clones Radkal and Radka7, which carry different fragments of Musa 26S rDNA, and Radka14, for which no homology with known DNA sequences has been found, resulted in clear signals at secondary constrictions. Only one clone carrying 5S rDNA, named Radka2, has been recovered. All remaining DNA clones exhibited more or less pronounced clustering at centromeric regions. The study revealed small differences in genomic distribution of repetitive DNA sequences between M. acuminata and M. balbisiana, the only exception being the 5S rDNA where the two Musa clones under study differed in the number of sites. All repetitive sequences were more abundant in M. acuminata whose genome is about 12% larger than that of M. balbisiana. While, for some sequences, the differences in copy number between the species were relatively small, for some of them, e.g. Radka5, the difference was almost thirty-fold. These observations suggest that repetitive DNA sequences contribute to the difference in genome size between both species, albeit to different extents. Isolation and characterization of new repetitive DNA sequences improves the knowledge of long-range organization of chromosomes in

  15. Multigenome DNA sequence conservation identifies Hox cis-regulatory elements

    PubMed Central

    Kuntz, Steven G.; Schwarz, Erich M.; DeModena, John A.; De Buysscher, Tristan; Trout, Diane; Shizuya, Hiroaki; Sternberg, Paul W.; Wold, Barbara J.

    2008-01-01

    To learn how well ungapped sequence comparisons of multiple species can predict cis-regulatory elements in Caenorhabditis elegans, we made such predictions across the large, complex ceh-13/lin-39 locus and tested them transgenically. We also examined how prediction quality varied with different genomes and parameters in our comparisons. Specifically, we sequenced ∼0.5% of the C. brenneri and C. sp. 3 PS1010 genomes, and compared five Caenorhabditis genomes (C. elegans, C. briggsae, C. brenneri, C. remanei, and C. sp. 3 PS1010) to find regulatory elements in 22.8 kb of noncoding sequence from the ceh-13/lin-39 Hox subcluster. We developed the MUSSA program to find ungapped DNA sequences with N-way transitive conservation, applied it to the ceh-13/lin-39 locus, and transgenically assayed 21 regions with both high and low degrees of conservation. This identified 10 functional regulatory elements whose activities matched known ceh-13/lin-39 expression, with 100% specificity and a 77% recovery rate. One element was so well conserved that a similar mouse Hox cluster sequence recapitulated the native nematode expression pattern when tested in worms. Our findings suggest that ungapped sequence comparisons can predict regulatory elements genome-wide. PMID:18981268

  16. mtDNAprofiler: a Web application for the nomenclature and comparison of human mitochondrial DNA sequences.

    PubMed

    Yang, In Seok; Lee, Hwan Young; Yang, Woo Ick; Shin, Kyoung-Jin

    2013-07-01

    Mitochondrial DNA (mtDNA) is a valuable tool in the fields of forensic, population, and medical genetics. However, recording and comparing mtDNA control region or entire genome sequences would be difficult if researchers are not familiar with mtDNA nomenclature conventions. Therefore, mtDNAprofiler, a Web application, was designed for the analysis and comparison of mtDNA sequences in a string format or as a list of mtDNA single-nucleotide polymorphisms (mtSNPs). mtDNAprofiler which comprises four mtDNA sequence-analysis tools (mtDNA nomenclature, mtDNA assembly, mtSNP conversion, and mtSNP concordance-check) supports not only the accurate analysis of mtDNA sequences via an automated nomenclature function, but also consistent management of mtSNP data via direct comparison and validity-check functions. Since mtDNAprofiler consists of four tools that are associated with key steps of mtDNA sequence analysis, mtDNAprofiler will be helpful for researchers working with mtDNA. mtDNAprofiler is freely available at http://mtprofiler.yonsei.ac.kr.

  17. Potential use of DNA barcoding for the identification of Salvia based on cpDNA and nrDNA sequences.

    PubMed

    Wang, Meng; Zhao, Hong-Xia; Wang, Long; Wang, Tao; Yang, Rui-Wu; Wang, Xiao-Li; Zhou, Yong-Hong; Ding, Chun-Bang; Zhang, Li

    2013-10-10

    An effective DNA marker for authenticating the genus Salvia was screened using seven DNA regions (rbcL, matK, trnL-F, and psbA-trnH from the chloroplast genome, and ITS, ITS1, and ITS2 from the nuclear genome) and three combinations (rbcL+matK, psbA-trnH+ITS1, and trnL-F+ITS1). The present study collected 232 sequences from 27 Salvia species through DNA sequencing and 77 sequences within the same taxa from the GenBank. The discriminatory capabilities of these regions were evaluated in terms of PCR amplification success, intraspecific and interspecific divergence, DNA barcoding gaps, and identification efficiency via a tree-based method. ITS1 was superior to the other marker for discriminating between species, with an accuracy of 81.48%. The three combinations did not increase species discrimination. Finally, we found that ITS1 is a powerful barcode for identifying Salvia species, especially Salvia miltiorrhiza.

  18. Next Generation Sequencing of DNA-Launched Chikungunya Vaccine Virus

    PubMed Central

    Hidajat, Rachmat; Nickols, Brian; Forrester, Naomi; Tretyakova, Irina; Weaver, Scott; Pushko, Peter

    2016-01-01

    Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3’ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. PMID:26855330

  19. Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.

    PubMed

    Yin, Changchuan

    2015-04-01

    To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.

  20. Microfluidic devices for DNA sequencing: sample preparation and electrophoretic analysis.

    PubMed

    Paegel, Brian M; Blazej, Robert G; Mathies, Richard A

    2003-02-01

    Modern DNA sequencing 'factories' have revolutionized biology by completing the human genome sequence, but in the race to completion we are left with inefficient, cumbersome, and costly macroscale processes and supporting facilities. During the same period, microfabricated DNA sequencing, sample processing and analysis devices have advanced rapidly toward the goal of a 'sequencing lab-on-a-chip'. Integrated microfluidic processing dramatically reduces analysis time and reagent consumption, and eliminates costly and unreliable macroscale robotics and laboratory apparatus. A microfabricated device for high-throughput DNA sequencing that couples clone isolation, template amplification, Sanger extension, purification, and electrophoretic analysis in a single microfluidic circuit is now attainable.

  1. DNA Sequence Determination by Hybridization: A Strategy for Efficient Large-Scale Sequencing

    NASA Astrophysics Data System (ADS)

    Drmanac, R.; Drmanac, S.; Strezoska, Z.; Paunesku, T.; Labat, I.; Zeremski, M.; Snoddy, J.; Funkhouser, W. K.; Koop, B.; Hood, L.; Crkvenjakov, R.

    1993-06-01

    The concept of sequencing by hybridization (SBH) makes use of an array of all possible n-nucleotide oligomers (n-mers) to identify n-mers present in an unknown DNA sequence. Computational approaches can then be used to assemble the complete sequence. As a validation of this concept, the sequences of three DNA fragments, 343 base pairs in length, were determined with octamer oligonucleotides. Possible applications of SBH include physical mapping (ordering) of overlapping DNA clones, sequence checking, DNA fingerprinting comparisons of normal and disease-causing genes, and the identification of DNA fragments with particular sequence motifs in complementary DNA and genomic libraries. The SBH techniques may accelerate the mapping and sequencing phases of the human genome project.

  2. DNA sequence determination by hybridization: A strategy for efficient large-scale sequencing

    SciTech Connect

    Drmanac, R.; Drmanac, S.; Strezoska, Z.; Paunesku, T.; Labat, I.; Zeremski, M.; Snoody, J.; Crkvenjakov, R. ); Funkhouser, W.K.; Koop, B.; Hood, L. )

    1993-06-11

    The concept of sequencing by hybridization (SBH) makes use of an array of all possible n-nucleotide oligomers (n-mers) to identify n-mers present in an unknown DNA sequence. Computational approaches can then be used to assemble the complete sequence. As a validation of this concept, the sequences of three DNA fragments, 343 base pairs in length, were determined with octamer oligonucleotides. Possible applications of SBH include physical mapping (ordering) of overlapping DNA clones, sequence checking, DNA fingerprinting comparisons of normal and disease-causing genes, and the identification of DNA fragments with particular sequence motifs in complementary DNA and genomic libraries. The SBH techniques may accelerate the mapping and sequencing phases of the human genome project. 22 refs., 3 figs.

  3. Recent patents of nanopore DNA sequencing technology: progress and challenges.

    PubMed

    Zhou, Jianfeng; Xu, Bingqian

    2010-11-01

    DNA sequencing techniques witnessed fast development in the last decades, primarily driven by the Human Genome Project. Among the proposed new techniques, Nanopore was considered as a suitable candidate for the single DNA sequencing with ultrahigh speed and very low cost. Several fabrication and modification techniques have been developed to produce robust and well-defined nanopore devices. Many efforts have also been done to apply nanopore to analyze the properties of DNA molecules. By comparing with traditional sequencing techniques, nanopore has demonstrated its distinctive superiorities in main practical issues, such as sample preparation, sequencing speed, cost-effective and read-length. Although challenges still remain, recent researches in improving the capabilities of nanopore have shed a light to achieve its ultimate goal: Sequence individual DNA strand at single nucleotide level. This patent review briefly highlights recent developments and technological achievements for DNA analysis and sequencing at single molecule level, focusing on nanopore based methods.

  4. Amerindian mitochondrial DNA haplogroups predominate in the population of Argentina: towards a first nationwide forensic mitochondrial DNA sequence database.

    PubMed

    Bobillo, Maria Cecilia; Zimmermann, Bettina; Sala, Andrea; Huber, Gabriela; Röck, Alexander; Bandelt, Hans-Jürgen; Corach, Daniel; Parson, Walther

    2010-07-01

    The study presents South American mitochondrial DNA (mtDNA) data from selected north (N = 98), central (N = 193) and south (N = 47) Argentinean populations. Sequence analysis of the complete mtDNA control region (CR, 16024-576) resulted in 288 unique haplotypes ignoring C-insertions around positions 16193, 309, and 573; the additional analysis of coding region single nucleotide polymorphisms enabled a fine classification of the described lineages. The Amerindian haplogroups were most frequent in the north and south representing more than 60% of the sequences. A slightly different situation was observed in central Argentina where the Amerindian haplogroups represented less than 50%, and the European contribution was more relevant. Particular clades of the Amerindian subhaplogroups turned out to be nearly region-specific. A minor contribution of African lineages was observed throughout the country. This comprehensive admixture of worldwide mtDNA lineages and the regional specificity of certain clades in the Argentinean population underscore the necessity of carefully selecting regional samples in order to develop a nationwide mtDNA database for forensic and anthropological purposes. The mtDNA sequencing and analysis were performed under EMPOP guidelines in order to attain high quality for the mtDNA database.

  5. Rediscovery of historical Vitis vinifera varieties from the South Anatolia region by using amplified fragment length polymorphism and simple sequence repeat DNA fingerprinting methods.

    PubMed

    Yilancioglu, Kaan; Cetiner, Selim

    2013-05-01

    Anatolia played an important role in the diversification and spread of economically important Vitis vinifera varieties. Although several biodiversity studies have been conducted with local cultivars in different regions of Anatolia, our aim is to gain a better knowledge on the biodiversity of endangered historical V. vinifera varieties in the northern Adana region of southern Anatolia, particularly those potentially displaying viticulture characteristics. We also demonstrate the genetic relatedness in a selected subset of widely cultivated and commercialized V. vinifera collection cultivars, which were obtained from the National Grapevine Germplasm located at the Institute of Viticulture, Turkey. In the present study, microsatellites were used in narrowing the sample size from 72 accessions down to a collection of 27 varieties. Amplified fragment length polymorphisms were then employed to determine genetic relatedness among this collection and local V. vinifera cultivars. The unweighted pair group method with arithmetic mean cluster and principal component analyses revealed that Saimbeyli local cultivars form a distinct group, which is distantly related to a selected subset of V. vinifera collection varieties from all over Turkey. To our knowledge, this is the first study conducted with these cultivars. Further preservation and use of these potential viticultural varieties will be helpful to avoid genetic erosion and to promote continued agriculture in the region.

  6. Introns and their flanking sequences of Bombyx mori rDNA.

    PubMed Central

    Fujiwara, H; Ogura, T; Takada, N; Miyajima, N; Ishikawa, H; Maekawa, H

    1984-01-01

    We obtained two different clones (16 kb and 13 kb) of B. mori rDNA with intron sequence within the 28S-rRNA coding region. The sequence surrounding the intron was found to be highly conserved as indicated in several eukaryotes (Tetrahymena, Drosophila and Xenopus). The 28S rRNA-coding sequence of 16 kb and 13 kb clone was interrupted at precisely the same sites as those where the D. melanogaster rDNA interrupted by the type I and type II intron, respectively. The intron sequences of B. mori were different from those of D. melanogaster. In 16 kb clone, the intron was flanked by 14 bp duplication of the junction sequence, which was also present once within the 28S rRNA-coding region of rDNA without intron. This 14 bp sequence was identical with those surrounding the introns of Dipteran rDNAs. PMID:6091041

  7. Sequence dependence of isothermal DNA amplification via EXPAR

    PubMed Central

    Qian, Jifeng; Ferguson, Tanya M.; Shinde, Deepali N.; Ramírez-Borrero, Alissa J.; Hintze, Arend; Adami, Christoph; Niemz, Angelika

    2012-01-01

    Isothermal nucleic acid amplification is becoming increasingly important for molecular diagnostics. Therefore, new computational tools are needed to facilitate assay design. In the isothermal EXPonential Amplification Reaction (EXPAR), template sequences with similar thermodynamic characteristics perform very differently. To understand what causes this variability, we characterized the performance of 384 template sequences, and used this data to develop two computational methods to predict EXPAR template performance based on sequence: a position weight matrix approach with support vector machine classifier, and RELIEF attribute evaluation with Naïve Bayes classification. The methods identified well and poorly performing EXPAR templates with 67–70% sensitivity and 77–80% specificity. We combined these methods into a computational tool that can accelerate new assay design by ruling out likely poor performers. Furthermore, our data suggest that variability in template performance is linked to specific sequence motifs. Cytidine, a pyrimidine base, is over-represented in certain positions of well-performing templates. Guanosine and adenosine, both purine bases, are over-represented in similar regions of poorly performing templates, frequently as GA or AG dimers. Since polymerases have a higher affinity for purine oligonucleotides, polymerase binding to GA-rich regions of a single-stranded DNA template may promote non-specific amplification in EXPAR and other nucleic acid amplification reactions. PMID:22416064

  8. Advances in high throughput DNA sequence data compression.

    PubMed

    Sardaraz, Muhammad; Tahir, Muhammad; Ikram, Ataul Aziz

    2016-06-01

    Advances in high throughput sequencing technologies and reduction in cost of sequencing have led to exponential growth in high throughput DNA sequence data. This growth has posed challenges such as storage, retrieval, and transmission of sequencing data. Data compression is used to cope with these challenges. Various methods have been developed to compress genomic and sequencing data. In this article, we present a comprehensive review of compression methods for genome and reads compression. Algorithms are categorized as referential or reference free. Experimental results and comparative analysis of various methods for data compression are presented. Finally, key challenges and research directions in DNA sequence data compression are highlighted.

  9. Nanopores: A journey towards DNA sequencing

    PubMed Central

    Wanunu, Meni

    2013-01-01

    Much more than ever, nucleic acids are recognized as key building blocks in many of life's processes, and the science of studying these molecular wonders at the single-molecule level is thriving. A new method of doing so has been introduced in the mid 1990's. This method is exceedingly simple: a nanoscale pore that spans across an impermeable thin membrane is placed between two chambers that contain an electrolyte, and voltage is applied across the membrane using two electrodes. These conditions lead to a steady stream of ion flow across the pore. Nucleic acid molecules in solution can be driven through the pore, and structural features of the biomolecules are observed as measurable changes in the trans-membrane ion current. In essence, a nanopore is a high-throughput ion microscope and a single-molecule force apparatus. Nanopores are taking center stage as a tool that promises to read a DNA sequence, and this promise has resulted in overwhelming academic, industrial, and national interest. Regardless of the fate of future nanopore applications, in the process of this 16-year-long exploration, many studies have validated the indispensability of nanopores in the toolkit of single-molecule biophysics. This review surveys past and current studies related to nucleic acid biophysics, and will hopefully provoke a discussion of immediate and future prospects for the field. PMID:22658507

  10. Preparing DNA libraries for multiplexed paired-end deep sequencing for Illumina GA sequencers.

    PubMed

    Son, Mike S; Taylor, Ronald K

    2011-02-01

    Whole-genome sequencing, also known as deep sequencing, is becoming a more affordable and efficient way to identify SNP mutations, deletions, and insertions in DNA sequences across several different strains. Two major obstacles preventing the widespread use of deep sequencers are the costs involved in services used to prepare DNA libraries for sequencing and the overall accuracy of the sequencing data. This unit describes the preparation of DNA libraries for multiplexed paired-end sequencing using the Illumina GA series sequencer. Self-preparation of DNA libraries can help reduce overall expenses, especially if optimization is required for the different samples, and use of the Illumina GA Sequencer can improve the quality of the data.

  11. Phylogenetic Analysis of a ‘Jewel Orchid’ Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions

    PubMed Central

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1) Goodyera is not monophyletic; 2) Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3) sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection. PMID:26927946

  12. Bisulfite sequencing of chromatin immunoprecipitated DNA (BisChIP-seq) directly informs methylation status of histone-modified DNA

    PubMed Central

    Statham, Aaron L.; Robinson, Mark D.; Song, Jenny Z.; Coolen, Marcel W.; Stirzaker, Clare; Clark, Susan J.

    2012-01-01

    The complex relationship between DNA methylation, chromatin modification, and underlying DNA sequence is often difficult to unravel with existing technologies. Here, we describe a novel technique based on high-throughput sequencing of bisulfite-treated chromatin immunoprecipitated DNA (BisChIP-seq), which can directly interrogate genetic and epigenetic processes that occur in normal and diseased cells. Unlike most previous reports based on correlative techniques, we found using direct bisulfite sequencing of Polycomb H3K27me3-enriched DNA from normal and prostate cancer cells that DNA methylation and H3K27me3-marked histones are not always mutually exclusive, but can co-occur in a genomic region-dependent manner. Notably, in cancer, the co-dependency of marks is largely redistributed with an increase of the dual repressive marks at CpG islands and transcription start sites of silent genes. In contrast, there is a loss of DNA methylation in intergenic H3K27me3-marked regions. Allele-specific methylation status derived from the BisChIP-seq data clearly showed that both methylated and unmethylated alleles can simultaneously be associated with H3K27me3 histones, highlighting that DNA methylation status in these regions is not dependent on Polycomb chromatin status. BisChIP-seq is a novel approach that can be widely applied to directly interrogate the genomic relationship between allele-specific DNA methylation, histone modification, or other important epigenetic regulators. PMID:22466171

  13. Sequence Recognition in the Pairing of DNA Duplexes

    NASA Astrophysics Data System (ADS)

    Kornyshev, A. A.; Leikin, S.

    2001-04-01

    Pairing of DNA fragments with homologous sequences occurs in gene shuffling, DNA repair, and other vital processes. While chemical individuality of base pairs is hidden inside the double helix, x ray and NMR revealed sequence-dependent modulation of the structure of DNA backbone. Here we show that the resulting modulation of the DNA surface charge pattern enables duplexes longer than ~50 base pairs to recognize sequence homology electrostatically at a distance of up to several water layers. This may explain the local recognition observed in pairing of homologous chromosomes and the observed length dependence of homologous recombination.

  14. ITS1 sequence variabilities correlate with 18S rDNA sequence types in the genus Acanthamoeba (Protozoa: Amoebozoa).

    PubMed

    Köhsler, Martina; Leitner, Brigitte; Blaschitz, Marion; Michel, Rolf; Aspöck, Horst; Walochnik, Julia

    2006-01-01

    The subgenus classification of the ubiquitously spread and potentially pathogenic acanthamoebae still poses a great challenge. Fifteen 18S rDNA sequence types (T1-T15) have been established, but the vast majority of isolates fall into sequence type T4, and so far, there is no means to reliably differentiate within T4. In this study, the first internal transcribed spacer (ITS1), a more variable region than the 18S rRNA gene, was sequenced, and the sequences of 15 different Acanthamoeba isolates were compared to reveal if ITS1 sequence variability correlates with 18S rDNA sequence typing and if the ITS1 sequencing allows a differentiation within T4. It was shown that the variability in ITS1 is tenfold higher than in the 18S rDNA, and that ITS1 clusters correlate with the 18S rDNA clusters and thus corroborate the Acanthamoeba sequence type system. Moreover, high sequence dissimilarities and distinctive microsatellite patterns could enable a more detailed differentiation within T4.

  15. Laser Desorption Mass Spectrometry for DNA Sequencing and Analysis

    NASA Astrophysics Data System (ADS)

    Chen, C. H. Winston; Taranenko, N. I.; Golovlev, V. V.; Isola, N. R.; Allman, S. L.

    1998-03-01

    Rapid DNA sequencing and/or analysis is critically important for biomedical research. In the past, gel electrophoresis has been the primary tool to achieve DNA analysis and sequencing. However, gel electrophoresis is a time-consuming and labor-extensive process. Recently, we have developed and used laser desorption mass spectrometry (LDMS) to achieve sequencing of ss-DNA longer than 100 nucleotides. With LDMS, we succeeded in sequencing DNA in seconds instead of hours or days required by gel electrophoresis. In addition to sequencing, we also applied LDMS for the detection of DNA probes for hybridization LDMS was also used to detect short tandem repeats for forensic applications. Clinical applications for disease diagnosis such as cystic fibrosis caused by base deletion and point mutation have also been demonstrated. Experimental details will be presented in the meeting. abstract.

  16. Scanning probe and nanopore DNA sequencing: core techniques and possibilities.

    PubMed

    Lund, John; Parviz, Babak A

    2009-01-01

    We provide an overview of the current state of research towards DNA sequencing using nanopore and scanning probe techniques. Additionally, we provide methods for the creation of two key experimental platforms for studies relating to nanopore and scanning probe DNA studies: a synthetic nanopore apparatus and an atomically flat conductive substrate with stretched DNA molecules.

  17. cDNA cloning and sequencing of tarantula hemocyanin subunits.

    PubMed

    Voit, R; Feldmaier-Fuchs, G

    1990-01-01

    Tarantula heart cDNA libraries were screened with synthetic oligonucleotide probes deduced from the highly conserved amino acid sequences of the two copper-binding sites, copper A and copper B, found in chelicerate hemocyanins. Positive cDNA clones could be obtained and four different cDNA types were characterized.

  18. Food Fish Identification from DNA Extraction through Sequence Analysis

    ERIC Educational Resources Information Center

    Hallen-Adams, Heather E.

    2015-01-01

    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  19. Characteristics of cloned repeated DNA sequences in the barley genome

    SciTech Connect

    Anan'ev, E.V.; Bochkanov, S.S.; Ryzhik, M.V.; Sonina, N.V.; Chernyshev, A.I.; Shchipkova, N.I.; Yakovleva, E.Yu.

    1986-12-01

    A partial clone library of barley DNA fragments based on plasmid pBR325 was created. The cloned EcoRI-fragments of chromosomal DNA are from 2 to 14 kbp in length. More than 95% of the barley DNA inserts comprise repeated sequences of different complexity and copy number. Certain of these DNA sequences are from families comprising at least 1% of the barley genome. A significant proportion of the clones hybridize with numerous sets of restriction fragments of genome DNA and they are dispersed throughout the barley chromosomes.

  20. Affordable Hands-On DNA Sequencing and Genotyping: An Exercise for Teaching DNA Analysis to Undergraduates

    ERIC Educational Resources Information Center

    Shah, Kushani; Thomas, Shelby; Stein, Arnold

    2013-01-01

    In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C…

  1. Retroviral DNA Sequences as a Means for Determining Ancient Diets

    PubMed Central

    Rivera-Perez, Jessica I.; Cano, Raul J.; Narganes-Storde, Yvonne; Chanlatte-Baik, Luis; Toranzos, Gary A.

    2015-01-01

    For ages, specialists from varying fields have studied the diets of the primeval inhabitants of our planet, detecting diet remains in archaeological specimens using a range of morphological and biochemical methods. As of recent, metagenomic ancient DNA studies have allowed for the comparison of the fecal and gut microbiomes associated to archaeological specimens from various regions of the world; however the complex dynamics represented in those microbial communities still remain unclear. Theoretically, similar to eukaryote DNA the presence of genes from key microbes or enzymes, as well as the presence of DNA from viruses specific to key organisms, may suggest the ingestion of specific diet components. In this study we demonstrate that ancient virus DNA obtained from coprolites also provides information reconstructing the host’s diet, as inferred from sequences obtained from pre-Columbian coprolites. This depicts a novel and reliable approach to determine new components as well as validate the previously suggested diets of extinct cultures and animals. Furthermore, to our knowledge this represents the first description of the eukaryotic viral diversity found in paleofaeces belonging to pre-Columbian cultures. PMID:26660678

  2. Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human

    PubMed Central

    Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai

    2017-01-01

    DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation. PMID:28212312

  3. DNA polymerases drive DNA sequencing-by-synthesis technologies: both past and present.

    PubMed

    Chen, Cheng-Yao

    2014-01-01

    Next-generation sequencing (NGS) technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. Escherichia coli DNA polymerase I proteolytic (Klenow) fragment was originally utilized in Sanger's dideoxy chain-terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE) and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ϕ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ϕ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

  4. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, S.; Richardson, C.

    1997-03-25

    A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

  5. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles

    1997-01-01

    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  6. Neandertal DNA sequences and the origin of modern humans.

    PubMed

    Krings, M; Stone, A; Schmitz, R W; Krainitzki, H; Stoneking, M; Pääbo, S

    1997-07-11

    DNA was extracted from the Neandertal-type specimen found in 1856 in western Germany. By sequencing clones from short overlapping PCR products, a hitherto unknown mitochondrial (mt) DNA sequence was determined. Multiple controls indicate that this sequence is endogenous to the fossil. Sequence comparisons with human mtDNA sequences, as well as phylogenetic analyses, show that the Neandertal sequence falls outside the variation of modern humans. Furthermore, the age of the common ancestor of the Neandertal and modern human mtDNAs is estimated to be four times greater than that of the common ancestor of human mtDNAs. This suggests that Neandertals went extinct without contributing mtDNA to modern humans.

  7. Deep-Sequencing Technologies and Potential Applications in Forensic DNA Testing.

    PubMed

    Zascavage, R R; Shewale, S J; Planz, J V

    2013-03-01

    Development of second- and third-generation DNA sequencing technologies have enabled an increasing number of applications in different areas such as molecular diagnostics, gene therapy, monitoring food and pharmaceutical products, biosecurity, and forensics. These technologies are based on different biochemical principles such as monitoring released pyrophosphate upon incorporation of a base (pyrosequencing), fluorescence detection subsequent to reversible incorporation of a fluorescently labeled terminator base, ligation based approach wherein fluorescence of cleaved nucleotide after ligation is measured, measuring the proton released after incorporation of a base (semiconductor-based sequencing), monitoring incorporation of a nucleotide by measuring the fluorescence of the fluorophore attached to the phosphate chain of the nucleotide, and by detecting the altered charge in a protein nanopore due to released nucleotide by exonuclease cleavage of a DNA strand. Analysis of multiple DNA fragments in parallel increases the depth of coverage while decreasing labor, cost, and time, highlighting some major advantages of deep-sequencing technologies. DNA sequencing has been routinely used in the forensic laboratories for mitochondrial DNA analysis. Fragment analysis, however, is the preferred method for Short Tandem Repeat genotyping due to the cumbersome and costly nature of fi rst-generation DNA sequencing methodologies. Deep-sequencing technologies have brought a new perspective to forensic DNA analysis. Studies include STR analysis to reveal hidden variation in the repeat regions, mtDNA sequencing, Single Nucleotide Polymorphism analysis, mixture resolution, and body fluid identification. Recent publications reveal that attempts are being made to expand the capability.

  8. Structure of mitochondrial DNA control region of Pholis fangi and its phylogenetic implication

    NASA Astrophysics Data System (ADS)

    Li, Lin; Zhang, Hui; Sun, Dianrong; Gao, Tianxiang

    2014-06-01

    In this study, the entire mitochondrial DNA (mtDNA) control region (CR) of Pholis fangi was amplified via polymerase chain reaction followed by direct sequencing. The length of the mtDNA CR consensus sequence of P. fangi was 853 bp in length. In accordance with the recognition sites as were previously reported in fish species, the mtDNA CR sequence of P. fangi can be divided into 3 domains, i.e., the extended terminal associated sequence (ETAS), the central conserved sequence block (CSB), and the CSB domain. In addition, the following structures were identified in the mtDNA CR sequence of P. fangi: 2 ETASs in the ETAS domain (TAS and cTAS), 6 CSBs in the central CSB domain (CSB-F to CSB-A), and 3 CSBs in the CSB domain (CSB-1 to CSB-3). These demonstrated that the structure of the mtDNA CR of P. fangi was substantially different from those of most other fish species. The mtDNA CR sequence of P. fangi contained one conserved region from 656 bp to 815 bp. Similar to most other fish species, P. fangi has no tandem repeat sequences in its mtDNA CR sequence. Phylogenetic analysis based on the complete mtDNA CR sequences showed that there were no genetic differences within P. fangi populations of the same geographical origin and between P. fangi populations of different geographical origins.

  9. Application of 2-D graphical representation of DNA sequence

    NASA Astrophysics Data System (ADS)

    Liao, Bo; Tan, Mingshu; Ding, Kequan

    2005-10-01

    Recently, we proposed a 2-D graphical representation of DNA sequence [Bo Liao, A 2-D graphical representation of DNA sequence, Chem. Phys. Lett. 401 (2005) 196-199]. Based on this representation, we consider properties of mutations and compute the similarities among 11 mitochondrial sequences belonging to different species. The elements of the similarity matrix are used to construct phylogenic tree. Unlike most existing phylogeny construction methods, the proposed method does not require multiple alignment.

  10. Evolution of a complex minisatellite DNA sequence.

    PubMed

    Barros, Paula; Blanco, Miguel G; Boán, Francisco; Gómez-Márquez, Jaime

    2008-11-01

    Minisatellites are tandem repeats of short DNA units widely distributed in genomes. However, the information on their dynamics in a phylogenetic context is very limited. Here we have studied the organization of the MsH43 locus in several species of primates and from these data we have reconstructed the evolutionary history of this complex minisatellite. Overall, with the exception of gibbon, MsH43 has an organization that is asymmetric, since the distribution of repeats is distinct between the 5' and 3' halves, and heterogeneous since there are many different repeats, some of them characteristic of each species. Inspection of the MsH43 arrays showed the existence of many duplications and deletions, suggesting the implication of slippage processes in the generation of polymorphism. Concerning the evolutionary history of this minisatellite, we propose that the birth of MsH43 may be situated before the divergence of Old World Monkeys since we found the existence of some MsH43 repeat motifs in prosimians and New World Monkeys. The analysis of MsH43 in apes revealed the existence of an evolutionary breakpoint in the pathway that originated African great apes and humans. Remarkably, human MsH43 is more homologous to orang-utan than to the corresponding sequence in gorilla and chimpanzee. This finding does not comply with the evolutionary paradigm that continuous alterations occur during the course of genome evolution. To adjust our results to the standard phylogeny of primates, we propose the existence of a wandering allele that was maintained almost unaltered during the period that extends between orang-utan and humans.

  11. Advanced microinstrumentation for rapid DNA sequencing and large DNA fragment separation

    SciTech Connect

    Balch, J.; Davidson, J.; Brewer, L.; Gingrich, J.; Koo, J.; Mariella, R.; Carrano, A.

    1995-01-25

    Our efforts to develop novel technology for a rapid DNA sequencer and large fragment analysis system based upon gel electrophoresis are described. We are using microfabrication technology to build dense arrays of high speed micro electrophoresis lanes that will ultimately increase the sequencing rate of DNA by at least 100 times the rate of current sequencers. We have demonstrated high resolution DNA fragment separation needed for sequencing in polyacrylamide microgels formed in glass microchannels. We have built prototype arrays of microchannels having up to 48 channels. Significant progress has also been made in developing a sensitive fluorescence detection system based upon a confocal microscope design that will enable the diagnostics and detection of DNA fragments in ultrathin microchannel gels. Development of a rapid DNA sequencer and fragment analysis system will have a major impact on future DNA instrumentation used in clinical, molecular and forensic analysis of DNA fragments.

  12. Simulations Using Random-Generated DNA and RNA Sequences

    ERIC Educational Resources Information Center

    Bryce, C. F. A.

    1977-01-01

    Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

  13. Recombinant human MDM2 oncoprotein shows sequence composition selectivity for binding to both RNA and DNA.

    PubMed

    Challen, Christine; Anderson, John J; Chrzanowska-Lightowlers, Zofia M A; Lightowlers, Robert N; Lunec, John

    2012-03-01

    MDM2 is a 90 kDa nucleo-phosphoprotein that binds p53 and other proteins contributing to its oncogenic properties. Its structure includes an amino proximal p53 binding site, a central acidic domain and a carboxy region which incorporates Zinc and Ring Finger domains suggestive of nucleic acid binding or transcription factor function. It has previously been reported that a bacculovirus expressed MDM2 protein binds RNA in a sequence-specific manner through the Ring Finger domain, however, its ability to bind DNA has yet to be examined. We report here that a bacterially expressed human MDM2 protein binds both DNA as well as the previously defined RNA consensus sequence. DNA binding appears selective and involves the carboxy-terminal domain of the molecule. RNA binding is inhibited by an MDM2 specific antibody, which recognises an epitope within the carboxy region of the protein. Selection cloning and sequence analysis of MDM2 DNA binding sequences, unlike RNA binding sequences, revealed no obvious DNA binding consensus sequence, but preferential binding to oligopurine:pyrimidine-rich stretches. Our results suggest that the observed preferential DNA binding may occur through the Zinc Finger or in a charge-charge interaction through the Ring Finger, thereby implying potentially different mechanisms for DNA and RNA MDM2 binding.

  14. Multiplexed Sequence Encoding: A Framework for DNA Communication

    PubMed Central

    Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.

    2016-01-01

    Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

  15. [DNA analysis for the post genome-sequencing era].

    PubMed

    Kambara, Hideki

    2002-05-01

    With the completion of the human genome sequencing, the new post genome-sequencing era has started. The major subjects are clarifying the function of genes to apply this information to medical as well as various industrial fields. Various DNA analysis methods and instruments for gene expression profiling as well as genetic diversity including SNPs typing are required and have been developed. Here, the history and technologies related to DNA analysis including the Wada project in the early 1980's, and the Human genome project from 1990 are described. Various new technologies have developed in this decade. They include a capillary gel array DNA sequencer, DNA chips, bead probe arrays, a new DNA sequencing method using pyrosequencing and an efficient SNP typing method by BAMPER.

  16. A mathematical model and numerical method for thermoelectric DNA sequencing

    NASA Astrophysics Data System (ADS)

    Shi, Liwei; Guilbeau, Eric J.; Nestorova, Gergana; Dai, Weizhong

    2014-05-01

    Single nucleotide polymorphisms (SNPs) are single base pair variations within the genome that are important indicators of genetic predisposition towards specific diseases. This study explores the feasibility of SNP detection using a thermoelectric sequencing method that measures the heat released when DNA polymerase inserts a deoxyribonucleoside triphosphate into a DNA strand. We propose a three-dimensional mathematical model that governs the DNA sequencing device with a reaction zone that contains DNA template/primer complex immobilized to the surface of the lower channel wall. The model is then solved numerically. Concentrations of reactants and the temperature distribution are obtained. Results indicate that when the nucleoside is complementary to the next base in the DNA template, polymerization occurs lengthening the complementary polymer and releasing thermal energy with a measurable temperature change, implying that the thermoelectric conceptual device for sequencing DNA may be feasible for identifying specific genes in individuals.

  17. DNA Shape Dominates Sequence Affinity in Nucleosome Formation

    NASA Astrophysics Data System (ADS)

    Freeman, Gordon S.; Lequieu, Joshua P.; Hinckley, Daniel M.; Whitmer, Jonathan K.; de Pablo, Juan J.

    2014-10-01

    Nucleosomes provide the basic unit of compaction in eukaryotic genomes, and the mechanisms that dictate their position at specific locations along a DNA sequence are of central importance to genetics. In this Letter, we employ molecular models of DNA and proteins to elucidate various aspects of nucleosome positioning. In particular, we show how DNA's histone affinity is encoded in its sequence-dependent shape, including subtle deviations from the ideal straight B-DNA form and local variations of minor groove width. By relying on high-precision simulations of the free energy of nucleosome complexes, we also demonstrate that, depending on DNA's intrinsic curvature, histone binding can be dominated by bending interactions or electrostatic interactions. More generally, the results presented here explain how sequence, manifested as the shape of the DNA molecule, dominates molecular recognition in the problem of nucleosome positioning.

  18. An Evolution Based Biosensor Receptor DNA Sequence Generation Algorithm

    PubMed Central

    Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M.; Lee, Jaewan; Zang, Yupeng

    2010-01-01

    A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements. PMID:22315543

  19. Complementary DNA sequences of the constant regions of T-cell antigen receptors α, β and γ in mandarin fish, Siniperca chuatsi Basilewsky, and their transcriptional changes after stimulation with Flavobacterium columnare.

    PubMed

    Tian, J Y; Qi, Z T; Wu, N; Chang, M X; Nie, P

    2014-02-01

    In this study, the constant-region genes (Cα, Cβ and Cγ) that encode the T-cell antigen receptor (TCR) α, β and γ chains were cloned from mandarin fish, Siniperca chuatsi Basilewsky, an important freshwater fish species in China. The complementary DNA sequences of Cα, Cβ and Cγ were 843, 716 and 906 base pairs (bp) in length and had a 465-, 289- and 360-bp 3' untranslated region, encoding 125, 142 and 182 amino acids, respectively. The amino-acid sequences of the constant regions of mandarin fish TCR α, β and γ chains (encoded by Cα, Cβ and Cγ, respectively) were most similar to those of their teleost counterparts, showing 60% similarity with pufferfish, 48% similarity with Atlantic salmon and 57% similarity with flounder, respectively. The phylogenetic analysis revealed that the mandarin fish Cα, Cβ and Cγ were clustered, respectively, with their vertebrate counterparts. The mandarin fish Cα, Cβ and Cγ could also be separated into four domains: immunoglobulin; connecting peptide (CP); transmembrane (TM); and cytoplasmic tail. Several conserved features in mammalian TCRs were also found in those of mandarin fish, such as a conserved cysteine residue in the CP domain of Cα, necessary for creating an interchain disulphide bond with the TCR β chain, and a conserved antigen receptor TM motif in Cα and Cβ. Meanwhile, transcripts of Cα, Cβ and Cγ were detectable in all examined organs, with a stronger signal observed in lymphoid organs. In addition, the temporal transcriptional changes for Cα and Cγ were investigated, 1, 2, 3, 4, 5, 6 and 8 weeks after stimulation with Flavobacterium columnare, in head kidney, spleen, blood, thymus, gill and intestine, using real-time polymerase chain reaction. The results demonstrated stimulation-dependent up-regulations in almost all tissues examined, which indicates that T cells may play important roles in preventing mandarin fish from bacterial invasion. In particular, apart from thymus, T cells were

  20. Microhomology-mediated DNA strand annealing and elongation by human DNA polymerases λ and β on normal and repetitive DNA sequences

    PubMed Central

    Crespan, Emmanuele; Czabany, Tibor; Maga, Giovanni; Hübscher, Ulrich

    2012-01-01

    ‘Classical’ non-homologous end joining (NHEJ), dependent on the Ku70/80 and the DNA ligase IV/XRCC4 complexes, is essential for the repair of DNA double-strand breaks. Eukaryotic cells possess also an alternative microhomology-mediated end-joining (MMEJ) mechanism, which is independent from Ku and DNA ligase 4/XRCC4. The components of the MMEJ machinery are still largely unknown. Family X DNA polymerases (pols) are involved in the classical NHEJ pathway. We have compared in this work, the ability of human family X DNA pols β, λ and μ, to promote the MMEJ of different model templates with terminal microhomology regions. Our results reveal that DNA pol λ and DNA ligase I are sufficient to promote efficient MMEJ repair of broken DNA ends in vitro, and this in the absence of auxiliary factors. However, DNA pol β, not λ, was more efficient in promoting MMEJ of DNA ends containing the (CAG)n triplet repeat sequence of the human Huntingtin gene, leading to triplet expansion. The checkpoint complex Rad9/Hus1/Rad1 promoted end joining by DNA pol λ on non-repetitive sequences, while it limited triplet expansion by DNA pol β. We propose a possible novel role of DNA pol β in MMEJ, promoting (CAG)n triplet repeats instability. PMID:22373917

  1. An Optimal Seed Based Compression Algorithm for DNA Sequences

    PubMed Central

    Gopalakrishnan, Gopakumar; Karunakaran, Muralikrishnan

    2016-01-01

    This paper proposes a seed based lossless compression algorithm to compress a DNA sequence which uses a substitution method that is similar to the LempelZiv compression scheme. The proposed method exploits the repetition structures that are inherent in DNA sequences by creating an offline dictionary which contains all such repeats along with the details of mismatches. By ensuring that only promising mismatches are allowed, the method achieves a compression ratio that is at par or better than the existing lossless DNA sequence compression algorithms. PMID:27555868

  2. DNA Methyltransferase Accessibility Protocol for Individual Templates by Deep Sequencing

    PubMed Central

    Darst, Russell P.; Nabilsi, Nancy H.; Pardo, Carolina E.; Riva, Alberto; Kladde, Michael P.

    2013-01-01

    A single-molecule probe of chromatin structure can uncover dynamic chromatin states and rare epigenetic variants of biological importance that bulk measures of chromatin structure miss. In bisulfite genomic sequencing, each sequenced clone records the methylation status of multiple sites on an individual molecule of DNA. An exogenous DNA methyltransferase can thus be used to image nucleosomes and other protein–DNA complexes. In this chapter, we describe the adaptation of this technique, termed Methylation Accessibility Protocol for individual templates, to modern high-throughput sequencing, which both simplifies the workflow and extends its utility. PMID:22929770

  3. DNA sequence analysis with droplet-based microfluidics

    PubMed Central

    Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.

    2014-01-01

    Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based assay. Using probes of different sequences, we interrogate a target DNA molecule for polymorphisms. With a larger probe set, additional polymorphisms can be interrogated as well as targets of arbitrary sequence. PMID:24185402

  4. Current-voltage characteristics of double-strand DNA sequences

    NASA Astrophysics Data System (ADS)

    Bezerril, L. M.; Moreira, D. A.; Albuquerque, E. L.; Fulco, U. L.; de Oliveira, E. L.; de Sousa, J. S.

    2009-09-01

    We use a tight-binding formulation to investigate the transmissivity and the current-voltage (I-V) characteristics of sequences of double-strand DNA molecules. In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for the genomic DNA sequence with those of artificial sequences (the long-range correlated Fibonacci and Rudin-Shapiro one) and a random sequence, which is a kind of prototype of a short-range correlated system. The random sequence is presented here with the same first neighbors pair correlations of the human DNA sequence. We found that the long-range character of the correlations is important to the transmissivity spectra, although the I-V curves seem to be mostly influenced by the short-range correlations.

  5. Mylodon darwinii DNA sequences from ancient fecal hair shafts.

    PubMed

    Clack, Andrew A; MacPhee, Ross D E; Poinar, Hendrik N

    2012-01-20

    Preserved hair has been increasingly used as an ancient DNA source in high throughput sequencing endeavors, and it may actually offer several advantages compared to more traditional ancient DNA substrates like bone. However, cold environments have yielded the most informative ancient hair specimens, while its preservation, and thus utility, in temperate regions is not well documented. Coprolites could represent a previously underutilized preservation substrate for hairs, which, if present therein, represent macroscopic packages of specific cells that are relatively simple to separate, clean and process. In this pilot study, we report amplicons 147-152 base pairs in length (w/primers) from hair shafts preserved in a south Chilean coprolite attributed to Darwin's extinct ground sloth, Mylodon darwinii. Our results suggest that hairs preserved in coprolites from temperate cave environments can serve as an effective source of ancient DNA. This bodes well for potential molecular-based population and phylogeographic studies on sloths, several species of which have been understudied despite leaving numerous coprolites in caves across of the Americas.

  6. DNA Sequencing by Hexagonal Boron Nitride Nanopore: A Computational Study

    PubMed Central

    Zhang, Liuyang; Wang, Xianqiao

    2016-01-01

    The single molecule detection associated with DNA sequencing has motivated intensive efforts to identify single DNA bases. However, little research has been reported utilizing single-layer hexagonal boron nitride (hBN) for DNA sequencing. Here we employ molecular dynamics simulations to explore pathways for single-strand DNA (ssDNA) sequencing by nanopore on the hBN sheet. We first investigate the adhesive strength between nucleobases and the hBN sheet, which provides the foundation for the hBN-base interaction and nanopore sequencing mechanism. Simulation results show that the purine base has a more remarkable energy profile and affinity than the pyrimidine base on the hBN sheet. The threading of ssDNA through the hBN nanopore can be clearly identified due to their different energy profiles and conformations with circular nanopores on the hBN sheet. The sequencing process is orientation dependent when the shape of the hBN nanopore deviates from the circle. Our results open up a promising avenue to explore the capability of DNA sequencing by hBN nanopore.

  7. Plasmonic Nanopores for Trapping, Controlling Displacement, and Sequencing of DNA

    PubMed Central

    2015-01-01

    With the aim of developing a DNA sequencing methodology, we theoretically examine the feasibility of using nanoplasmonics to control the translocation of a DNA molecule through a solid-state nanopore and to read off sequence information using surface-enhanced Raman spectroscopy. Using molecular dynamics simulations, we show that high-intensity optical hot spots produced by a metallic nanostructure can arrest DNA translocation through a solid-state nanopore, thus providing a physical knob for controlling the DNA speed. Switching the plasmonic field on and off can displace the DNA molecule in discrete steps, sequentially exposing neighboring fragments of a DNA molecule to the pore as well as to the plasmonic hot spot. Surface-enhanced Raman scattering from the exposed DNA fragments contains information about their nucleotide composition, possibly allowing the identification of the nucleotide sequence of a DNA molecule transported through the hot spot. The principles of plasmonic nanopore sequencing can be extended to detection of DNA modifications and RNA characterization. PMID:26401685

  8. Estimation of DNA sequence context-dependent mutation rates using primate genomic sequences.

    PubMed

    Zhang, Wei; Bouffard, Gerard G; Wallace, Susan S; Bond, Jeffrey P

    2007-09-01

    It is understood that DNA and amino acid substitution rates are highly sequence context-dependent, e.g., C --> T substitutions in vertebrates may occur much more frequently at CpG sites and that cysteine substitution rates may depend on support of the context for participation in a disulfide bond. Furthermore, many applications rely on quantitative models of nucleotide or amino acid substitution, including phylogenetic inference and identification of amino acid sequence positions involved in functional specificity. We describe quantification of the context dependence of nucleotide substitution rates using baboon, chimpanzee, and human genomic sequence data generated by the NISC Comparative Sequencing Program. Relative mutation rates are reported for the 96 classes of mutations of the form 5' alphabetagamma 3' --> 5' alphadeltagamma 3', where alpha, beta, gamma, and delta are nucleotides and beta not equal delta, based on maximum likelihood calculations. Our results confirm that C --> T substitutions are enhanced at CpG sites compared with other transitions, relatively independent of the identity of the preceding nucleotide. While, as expected, transitions generally occur more frequently than transversions, we find that the most frequent transversions involve the C at CpG sites (CpG transversions) and that their rate is comparable to the rate of transitions at non-CpG sites. A four-class model of the rates of context-dependent evolution of primate DNA sequences, CpG transitions > non-CpG transitions approximately CpG transversions > non-CpG transversions, captures qualitative features of the mutation spectrum. We find that despite qualitative similarity of mutation rates among different genomic regions, there are statistically significant differences.

  9. DNA sequence compression using the burrows-wheeler transform.

    PubMed

    Adjeroh, Don; Zhang, Yong; Mukherjee, Amar; Powell, Matt; Bell, Tim

    2002-01-01

    We investigate off-line dictionary oriented approaches to DNA sequence compression, based on the Burrows-Wheeler Transform (BWT). The preponderance of short repeating patterns is an important phenomenon in biological sequences. Here, we propose off-line methods to compress DNA sequences that exploit the different repetition structures inherent in such sequences. Repetition analysis is performed based on the relationship between the BWT and important pattern matching data structures, such as the suffix tree and suffix array. We discuss how the proposed approach can be incorporated in the BWT compression pipeline.

  10. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    SciTech Connect

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S. ); Rocchi, M. )

    1991-01-15

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH{sub 2}-terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH{sub 2}-terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids.

  11. Targeted DNA methylation analysis by high throughput sequencing in porcine peri-attachment embryos.

    PubMed

    Morrill, Benson H; Cox, Lindsay; Ward, Anika; Heywood, Sierra; Prather, Randall S; Isom, S Clay

    2013-01-01

    The purpose of this experiment was to implement and evaluate the effectiveness of a next-generation sequencing-based method for DNA methylation analysis in porcine embryonic samples. Fourteen discrete genomic regions were amplified by PCR using bisulfite-converted genomic DNA derived from day 14 in vivo-derived (IVV) and parthenogenetic (PA) porcine embryos as template DNA. Resulting PCR products were subjected to high-throughput sequencing using the Illumina Genome Analyzer IIx platform. The average depth of sequencing coverage was 14,611 for IVV and 17,068 for PA. Quantitative analysis of the methylation profiles of both input samples for each genomic locus showed distinct differences in methylation profiles between IVV and PA samples for six of the target loci, and subtle differences in four loci. It was concluded that high throughput sequencing technologies can be effectively applied to provide a powerful, cost-effective approach to targeted DNA methylation analysis of embryonic and other reproductive tissues.

  12. DNA sequencing using polymerase substrate-binding kinetics

    PubMed Central

    Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min

    2015-01-01

    Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

  13. Characterizing self-similarity in bacteria DNA sequences

    NASA Astrophysics Data System (ADS)

    Lu, Xin; Sun, Zhirong; Chen, Huimin; Li, Yanda

    1998-09-01

    In this paper some parametric methods are introduced to characterize the self-similarity of DNA sequences. Compared with Fourier analysis, these methods perform statistically more stably and yield more reliable results. Using these methods, eight whole genomes of bacteria provided by NCBI are analyzed. Long-range correlation properties in the nucleotide density distribution along these DNA sequences are explored. Estimation results show that the long-range correlation structure prevails through the entire molecule of DNA. Higher order statistics through coarse graining reveal that rather than multifractal, there are only monofractal phenomena presented in the sequences. Hence, the nucleotide density distribution can be modeled asymptotically as fractional Gaussian noise. This result points to a new direction for analyzing and understanding the intrinsic structures of DNA sequences.

  14. Microchannel DNA Sequencing by End-Labelled Free Solution Electrophoresis

    SciTech Connect

    Barron, A.

    2005-09-29

    The further development of End-Labeled Free-Solution Electrophoresis will greatly simplify DNA separation and sequencing on microfluidic devices. The development and optimization of drag-tags is critical to the success of this research.

  15. ATRF Houses the Latest DNA Sequencing Technologies | Poster

    Cancer.gov

    By Ashley DeVine, Staff Writer By the end of October, the Advanced Technology Research Facility (ATRF) will be one of the few facilities in the world to house all of the latest DNA sequencing technologies.

  16. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system

    PubMed Central

    Jenior, Matthew L.; Koumpouras, Charles C.; Westcott, Sarah L.; Highlander, Sarah K.

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina’s MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3–V5, V1–V3, V1–V5, V1–V6, and V1–V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1–V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina’s MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  17. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.

    PubMed

    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting.

  18. GRAIL seeks out genes buried in DNA sequence

    SciTech Connect

    Roberts, L.

    1991-11-08

    When the Human Genome Project achieves its ultimate goal, supposedly around 2005, biologists will have in hand the exact sequence of all 3 billion nucleotides arrayed along the human chromosomes. But they have never been entirely sure how they will read the language of the long string of As, Gs, Ts, and Cs. How will they even be able to pick out the genes, which account for a mere 5% of the genome, from the mass of letters in between Now Edward Ubergacher, a biophysicist-turned-computational-biologist at Oak Ridge National Laboratory, has come one step toward providing an answer: a new artificial intelligence program, called GRAIL, that can pick out the coding regions of genes in a long stretch of sequence data. So far, the Oak Ridge team has analyzed 5 million bases of DNA. One year ago, even 6 months ago, it was virtually impossible to go into human genomic sequence and find genes by computer with any reliability. Now we can go in and find 90% of the genes very quickly. GRAIL can be used on a PC, not a supercomputer, and it provides an answer almost instantly.

  19. Sequence-Specific Molecular Lithography on Single DNA Molecules

    NASA Astrophysics Data System (ADS)

    Keren, Kinneret; Krueger, Michael; Gilad, Rachel; Ben-Yoseph, Gdalyahu; Sivan, Uri; Braun, Erez

    2002-07-01

    Recent advances in the realization of individual molecular-scale electronic devices emphasize the need for novel tools and concepts capable of assembling such devices into large-scale functional circuits. We demonstrated sequence-specific molecular lithography on substrate DNA molecules by harnessing homologous recombination by RecA protein. In a sequence-specific manner, we patterned the coating of DNA with metal, localized labeled molecular objects and grew metal islands on specific sites along the DNA substrate, and generated molecularly accurate stable DNA junctions for patterning the DNA substrate connectivity. In our molecular lithography, the information encoded in the DNA molecules replaces the masks used in conventional microelectronics, and the RecA protein serves as the resist. The molecular lithography works with high resolution over a broad range of length scales from nanometers to many micrometers.

  20. Genomic MRI - a Public Resource for Studying Sequence Patterns within Genomic DNA

    PubMed Central

    Prakash, Ashwin; Bechtel, Jason; Fedorov, Alexei

    2011-01-01

    Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in their nucleotide composition and consist of a complex mosaic of sequence patterns. These patterns include so-called Mid-Range Inhomogeneity (MRI) regions -- sequences 30-10000 nucleotides in length that are enriched by a particular base or combination of bases (e.g. (G+T)-rich, purine-rich, etc.). MRI regions are associated with unusual (non-B-form) DNA structures that are often involved in regulation of gene expression, recombination, and other genetic processes (Fedorova & Fedorov 2010). The existence of a strong fixation bias within MRI regions against mutations that tend to reduce their sequence inhomogeneity additionally supports the functionality and importance of these genomic sequences (Prakash et al. 2009). Here we demonstrate a freely available Internet resource -- the Genomic MRI program package -- designed for computational analysis of genomic sequences in order to find and characterize various MRI patterns within them (Bechtel et al. 2008). This package also allows generation of randomized sequences with various properties and level of correspondence to the natural input DNA sequences. The main goal of this resource is to facilitate examination of vast regions of non-coding DNA that are still scarcely investigated and await thorough exploration and recognition. PMID:21610667

  1. Nucleotide correlations and electronic transport of DNA sequences

    NASA Astrophysics Data System (ADS)

    Albuquerque, E. L.; Vasconcelos, M. S.; Lyra, M. L.; de Moura, F. A. B. F.

    2005-02-01

    We use a tight-binding formulation to investigate the transmissivity and wave-packet dynamics of sequences of single-strand DNA molecules made up from the nucleotides guanine G , adenine A , cytosine C , and thymine T . In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for the genomic DNA sequence with those of two artificial sequences: (i) the Rudin-Shapiro one, which has long-range correlations; (ii) a random sequence, which is a kind of prototype of a short-range correlated system, presented here with the same first-neighbor pair correlations of the human DNA sequence. We found that the long-range character of the correlations is important to the persistence of resonances of finite segments. On the other hand, the wave-packet dynamics seems to be mostly influenced by the short-range correlations.

  2. Real-Time DNA Sequencing in the Antarctic Dry Valleys Using the Oxford Nanopore Sequencer

    PubMed Central

    Johnson, Sarah S.; Zaikova, Elena; Goerlitz, David S.; Bai, Yu; Tighe, Scott W.

    2017-01-01

    The ability to sequence DNA outside of the laboratory setting has enabled novel research questions to be addressed in the field in diverse areas, ranging from environmental microbiology to viral epidemics. Here, we demonstrate the application of offline DNA sequencing of environmental samples using a hand-held nanopore sequencer in a remote field location: the McMurdo Dry Valleys, Antarctica. Sequencing was performed using a MK1B MinION sequencer from Oxford Nanopore Technologies (ONT; Oxford, United Kingdom) that was equipped with software to operate without internet connectivity. One-direction (1D) genomic libraries were prepared using portable field techniques on DNA isolated from desiccated microbial mats. By adequately insulating the sequencer and laptop, it was possible to run the sequencing protocol for up to 2½ h under arduous conditions. PMID:28337073

  3. Real-Time DNA Sequencing in the Antarctic Dry Valleys Using the Oxford Nanopore Sequencer.

    PubMed

    Johnson, Sarah S; Zaikova, Elena; Goerlitz, David S; Bai, Yu; Tighe, Scott W

    2017-04-01

    The ability to sequence DNA outside of the laboratory setting has enabled novel research questions to be addressed in the field in diverse areas, ranging from environmental microbiology to viral epidemics. Here, we demonstrate the application of offline DNA sequencing of environmental samples using a hand-held nanopore sequencer in a remote field location: the McMurdo Dry Valleys, Antarctica. Sequencing was performed using a MK1B MinION sequencer from Oxford Nanopore Technologies (ONT; Oxford, United Kingdom) that was equipped with software to operate without internet connectivity. One-direction (1D) genomic libraries were prepared using portable field techniques on DNA isolated from desiccated microbial mats. By adequately insulating the sequencer and laptop, it was possible to run the sequencing protocol for up to 2½ h under arduous conditions.

  4. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus.

  5. Effects of sequence on DNA wrapping around histones

    NASA Astrophysics Data System (ADS)

    Ortiz, Vanessa

    2011-03-01

    A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).

  6. Generating Multiple Base-Resolution DNA Methylomes Using Reduced Representation Bisulfite Sequencing.

    PubMed

    Chatterjee, Aniruddha; Rodger, Euan J; Stockwell, Peter A; Le Mée, Gwenn; Morison, Ian M

    2017-01-01

    Reduced representation bisulfite sequencing (RRBS) is an effective technique for profiling genome-wide DNA methylation patterns in eukaryotes. RRBS couples size selection, bisulfite conversion, and second-generation sequencing to enrich for CpG-dense regions of the genome. The progressive improvement of second-generation sequencing technologies and reduction in cost provided an opportunity to examine the DNA methylation patterns of multiple genomes. Here, we describe a protocol for sequencing multiple RRBS libraries in a single sequencing reaction to generate base-resolution methylomes. Furthermore, we provide a brief guideline for base-calling and data analysis of multiplexed RRBS libraries. These strategies will be useful to perform large-scale, genome-wide DNA methylation analysis.

  7. Cloning and sequencing of dolphinfish (Coryphaena hippurus, Coryphaenidae) growth hormone-encoding cDNA.

    PubMed

    Peduel, A D; Elizur, A; Knibb, W

    1994-01-01

    The cDNA encoding the preprotein growth hormone from the dolphinfish (Coryphaena hippurus) has been cloned and sequenced. The cDNA was derived by reverse transcription of RNA from the pituitary of a young fish using the method known as Rapid Amplification of cDNA Ends (RACE). An oligonucleotide primer corresponding to the 5' region of Pagrus major and the universal RACE primer enabled amplification using the Polymerase Chain Reaction (PCR). The dolphinfish and yellow-tail, Seriola quineqeradiata, are both members of the sub-order Percoidei (Perciforme) and their GH sequences show a high level of homology.

  8. Using Next-Generation Sequencing for DNA Barcoding: Capturing Allelic Variation in ITS2

    PubMed Central

    Batovska, Jana; Cogan, Noel O. I.; Lynch, Stacey E.; Blacket, Mark J.

    2016-01-01

    Internal Transcribed Spacer 2 (ITS2) is a popular DNA barcoding marker; however, in some animal species it is hypervariable and therefore difficult to sequence with traditional methods. With next-generation sequencing (NGS) it is possible to sequence all gene variants despite the presence of single nucleotide polymorphisms (SNPs), insertions/deletions (indels), homopolymeric regions, and microsatellites. Our aim was to compare the performance of Sanger sequencing and NGS amplicon sequencing in characterizing ITS2 in 26 mosquito species represented by 88 samples. The suitability of ITS2 as a DNA barcoding marker for mosquitoes, and its allelic diversity in individuals and species, was also assessed. Compared to Sanger sequencing, NGS was able to characterize the ITS2 region to a greater extent, with resolution within and between individuals and species that was previously not possible. A total of 382 unique sequences (alleles) were generated from the 88 mosquito specimens, demonstrating the diversity present that has been overlooked by traditional sequencing methods. Multiple indels and microsatellites were present in the ITS2 alleles, which were often specific to species or genera, causing variation in sequence length. As a barcoding marker, ITS2 was able to separate all of the species, apart from members of the Culex pipiens complex, providing the same resolution as the commonly used Cytochrome Oxidase I (COI). The ability to cost-effectively sequence hypervariable markers makes NGS an invaluable tool with many applications in the DNA barcoding field, and provides insights into the limitations of previous studies and techniques. PMID:27799340

  9. Terminal repetitive sequences in herpesvirus saimiri virion DNA.

    PubMed

    Bankier, A T; Dietrich, W; Baer, R; Barrell, B G; Colbère-Garapin, F; Fleckenstein, B; Bodemer, W

    1985-07-01

    The H-DNA repeat unit of Herpesvirus saimiri strain 11 was cloned in plasmid vector pAGO, and the nucleotide sequence was determined by the dideoxy chain termination method. One unit of repetitive DNA has 1,444 base pairs with 70.8% G+C content. The structural features of repeat DNA sequences at the termini of intact virion M-DNA (160 kilobases) and orientation of reiterated DNA were analyzed by radioactive end labeling of M-DNA, followed by cleavage of the end fragments with restriction endonucleases. The termini appeared to be blunt ended with a 5'-phosphate group, probably generated during encapsidation by cleavage in the immediate vicinity of the single ApaI recognition site in the H-DNA repeat unit. The sequence did not reveal sizeable open reading frames, the longest hypothetical peptide from H-DNA being 85 amino acids. There was no evidence for an mRNA promoter or terminator element, and H-DNA-specific transcription could not be found in productively infected cells.

  10. The properties and applications of single-molecule DNA sequencing

    PubMed Central

    2011-01-01

    Single-molecule sequencing enables DNA or RNA to be sequenced directly from biological samples, making it well-suited for diagnostic and clinical applications. Here we review the properties and applications of this rapidly evolving and promising technology. PMID:21349208

  11. Ancient DNA sequence revealed by error-correcting codes

    PubMed Central

    Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo

    2015-01-01

    A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228

  12. Microfabricated bioprocessor for integrated nanoliter-scale Sanger DNA sequencing.

    PubMed

    Blazej, Robert G; Kumaresan, Palani; Mathies, Richard A

    2006-05-09

    An efficient, nanoliter-scale microfabricated bioprocessor integrating all three Sanger sequencing steps, thermal cycling, sample purification, and capillary electrophoresis, has been developed and evaluated. Hybrid glass-polydimethylsiloxane (PDMS) wafer-scale construction is used to combine 250-nl reactors, affinity-capture purification chambers, high-performance capillary electrophoresis channels, and pneumatic valves and pumps onto a single microfabricated device. Lab-on-a-chip-level integration enables complete Sanger sequencing from only 1 fmol of DNA template. Up to 556 continuous bases were sequenced with 99% accuracy, demonstrating read lengths required for de novo sequencing of human and other complex genomes. The performance of this miniaturized DNA sequencer provides a benchmark for predicting the ultimate cost and efficiency limits of Sanger sequencing.

  13. Electronic Transport and Thermopower in Aperiodic DNA Sequences

    NASA Astrophysics Data System (ADS)

    Roche, Stephan; Maciá, Enrique

    A detailed study of charge transport properties of synthetic and genomic DNA sequences is reported. Genomic sequences of the Chromosome 22, λ-bacteriophage, and D1s80 genes of Human and Pygmy chimpanzee are considered in this work, and compared with both periodic and quasiperiodic (Fibonacci) sequences of nucleotides. Charge transfer efficiency is compared for all these different sequences, and large variations in charge transfer efficiency, stemming from sequence-dependent effects, are reported. In addition, basic characteristics of tunneling currents, including contact effects, are described. Finally, the thermoelectric power of nucleobases connected in between metallic contacts at different temperatures is presented.

  14. Beyond reasonable doubt: evolution from DNA sequences.

    PubMed

    White, W Timothy J; Zhong, Bojian; Penny, David

    2013-01-01

    We demonstrate quantitatively that, as predicted by evolutionary theory, sequences of homologous proteins from different species converge as we go further and further back in time. The converse, a non-evolutionary model can be expressed as probabilities, and the test works for chloroplast, nuclear and mitochondrial sequences, as well as for sequences that diverged at different time depths. Even on our conservative test, the probability that chance could produce the observed levels of ancestral convergence for just one of the eight datasets of 51 proteins is ≈1×10⁻¹⁹ and combined over 8 datasets is ≈1×10⁻¹³². By comparison, there are about 10⁸⁰ protons in the universe, hence the probability that the sequences could have been produced by a process involving unrelated ancestral sequences is about 10⁵⁰ lower than picking, among all protons, the same proton at random twice in a row. A non-evolutionary control model shows no convergence, and only a small number of parameters are required to account for the observations. It is time that that researchers insisted that doubters put up testable alternatives to evolution.

  15. DNA-protein recognition and sequence-dependent variations of DNA conformational properties

    NASA Astrophysics Data System (ADS)

    Vologodskii, Alexander

    2015-03-01

    Parameters of B-DNA, the major form of the double helix, depend on its sequence. This dependence can contribute to the recognition of specific DNA sequences by proteins. Here we try to analyze this contribution quantitatively. In the first approach to this goal we used experimental data on the sequence dependence of DNA bending rigidity and its helical repeat. The solution data on these parameters of B-DNA were derived from the experiments on cyclization of short DNA fragments with specially designed sequences. The data allowed calculating the sequence variations of DNA bending energy, as well as the variations of the energy of torsional deformation of the double helix associated with a protein binding. The results show that DNA conformational parameters can have very limited influence on the sequence specificity of protein binding. In the second approach we analyzed the experimental data on the binding affinity of the nucleosome core with DNA fragments of different sequences. The conclusions derived in these two approaches are in a good agreement with one another.

  16. Sequence specificity of DNA cleavage by Micrococcus luteus. gamma. endonuclease

    SciTech Connect

    Hentosh, P.; Henner, W.D.; Reynolds, R.J.

    1985-04-01

    DNA fragments of defined sequence have been used to determine the sites of cleavage by ..gamma..-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus ..gamma.. endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to ..gamma.. radiation.

  17. High sequence turnover in the regulatory regions of the developmental gene hunchback in insects.

    PubMed

    Hancock, J M; Shaw, P J; Bonneton, F; Dover, G A

    1999-02-01

    Extensive sequence analysis of the developmental gene hunchback and its 5' and 3' regulatory regions in Drosophila melanogaster, Drosophila virilis, Musca domestica, and Tribolium castaneum, using a variety of computer algorithms, reveals regions of high sequence simplicity probably generated by slippage-like mechanisms of turnover. No regions are entirely refractory to the action of slippage, although the density and composition of simple sequence motifs varies from region to region. Interestingly, the 5' and 3' flanking regions share short repetitive motifs despite their separation by the gene itself, and the motifs are different in composition from those in the exons and introns. Furthermore, there are high levels of conservation of motifs in equivalent orthologous regions. Detailed sequence analysis of the P2 promoter and DNA footprinting assays reveal that the number, orientation, sequence, spacing, and protein-binding affinities of the BICOID-binding sites varies between species and that the 'P2' promoter, the nanos response element in the 3' untranslated region, and several conserved boxes of sequence in the gene (e.g., the two zinc-finger regions) are surrounded by cryptically-simple-sequence DNA. We argue that high sequence turnover and genetic redundancy permit both the general maintenance of promoter functions through the establishment of coevolutionary (compensatory) changes in cis- and trans-acting genetic elements and, at the same time, the possibility of subtle changes in the regulation of hunchback in the different species.

  18. Molecular Poltergeists: Mitochondrial DNA Copies (numts) in Sequenced Nuclear Genomes

    PubMed Central

    Hazkani-Covo, Einat; Zeller, Raymond M.; Martin, William

    2010-01-01

    The natural transfer of DNA from mitochondria to the nucleus generates nuclear copies of mitochondrial DNA (numts) and is an ongoing evolutionary process, as genome sequences attest. In humans, five different numts cause genetic disease and a dozen human loci are polymorphic for the presence of numts, underscoring the rapid rate at which mitochondrial sequences reach the nucleus over evolutionary time. In the laboratory and in nature, numts enter the nuclear DNA via non-homolgous end joining (NHEJ) at double-strand breaks (DSBs). The frequency of numt insertions among 85 sequenced eukaryotic genomes reveal that numt content is strongly correlated with genome size, suggesting that the numt insertion rate might be limited by DSB frequency. Polymorphic numts in humans link maternally inherited mitochondrial genotypes to nuclear DNA haplotypes during the past, offering new opportunities to associate nuclear markers with mitochondrial markers back in time. PMID:20168995

  19. Nanopore-based fourth-generation DNA sequencing technology.

    PubMed

    Feng, Yanxiao; Zhang, Yuechuan; Ying, Cuifeng; Wang, Deqiang; Du, Chunlei

    2015-02-01

    Nanopore-based sequencers, as the fourth-generation DNA sequencing technology, have the potential to quickly and reliably sequence the entire human genome for less than $1000, and possibly for even less than $100. The single-molecule techniques used by this technology allow us to further study the interaction between DNA and protein, as well as between protein and protein. Nanopore analysis opens a new door to molecular biology investigation at the single-molecule scale. In this article, we have reviewed academic achievements in nanopore technology from the past as well as the latest advances, including both biological and solid-state nanopores, and discussed their recent and potential applications.

  20. Efficient depletion of host DNA contamination in malaria clinical sequencing.

    PubMed

    Oyola, Samuel O; Gu, Yong; Manske, Magnus; Otto, Thomas D; O'Brien, John; Alcock, Daniel; Macinnis, Bronwyn; Berriman, Matthew; Newbold, Chris I; Kwiatkowski, Dominic P; Swerdlow, Harold P; Quail, Michael A

    2013-03-01

    The cost of whole-genome sequencing (WGS) is decreasing rapidly as next-generation sequencing technology continues to advance, and the prospect of making WGS available for public health applications is becoming a reality. So far, a number of studies have demonstrated the use of WGS as an epidemiological tool for typing and controlling outbreaks of microbial pathogens. Success of these applications is hugely dependent on efficient generation of clean genetic material that is free from host DNA contamination for rapid preparation of sequencing libraries. The presence of large amounts of host DNA severely affects the efficiency of characterizing pathogens using WGS and is therefore a serious impediment to clinical and epidemiological sequencing for health care and public health applications. We have developed a simple enzymatic treatment method that takes advantage of the methylation of human DNA to selectively deplete host contamination from clinical samples prior to sequencing. Using malaria clinical samples with over 80% human host DNA contamination, we show that the enzymatic treatment enriches Plasmodium falciparum DNA up to ∼9-fold and generates high-quality, nonbiased sequence reads covering >98% of 86,158 catalogued typeable single-nucleotide polymorphism loci.

  1. Structural biology of disease-associated repetitive DNA sequences and protein-DNA complexes involved in DNA damage and repair

    SciTech Connect

    Gupta, G.; Santhana Mariappan, S.V.; Chen, X.; Catasti, P.; Silks, L.A. III; Moyzis, R.K.; Bradbury, E.M.; Garcia, A.E.

    1997-07-01

    This project is aimed at formulating the sequence-structure-function correlations of various microsatellites in the human (and other eukaryotic) genomes. Here the authors have been able to develop and apply structure biology tools to understand the following: the molecular mechanism of length polymorphism microsatellites; the molecular mechanism by which the microsatellites in the noncoding regions alter the regulation of the associated gene; and finally, the molecular mechanism by which the expansion of these microsatellites impairs gene expression and causes the disease. Their multidisciplinary structural biology approach is quantitative and can be applied to all coding and noncoding DNA sequences associated with any gene. Both NIH and DOE are interested in developing quantitative tools for understanding the function of various human genes for prevention against diseases caused by genetic and environmental effects.

  2. Ultrasensitive fluorescence detection of DNA sequencing gels

    SciTech Connect

    Mathies, R.A.

    1991-01-01

    During the three years of this grant we have: (1) Developed and applied a new theory for optimizing high-sensitivity fluorescence detection. (2) Developed and patented a new high-sensitivity confocal-fluorescence laser-excited gel-scanner. (3) Applied this scanner to the development of a new class of versatile and sensitive fluorescent dyes for DNA detection. (4) Developed methods for the detection of single fluorescent molecules by fluorescence burst detection. 11 refs., 10 figs.

  3. Recognizing a Single Base in an Individual DNA Strand: A Step Toward Nanopore DNA Sequencing**

    PubMed Central

    Ashkenasy, N.; Sánchez-Quesada, J.; Ghadiri, M. R.; Bayley, H.

    2007-01-01

    Functional supramolecular chemistry at the single-molecule level. Single strands of DNA can be captured inside α-hemolysin transmembrane pore protein to form single-species α-HL·DNA pseudorotaxanes. This process can be used to identify a single adenine nucleotide at a specific location on a strand of DNA by the characteristic reductions in the α-HL ion conductance. This study suggests that α-HL-mediated single-molecule DNA sequencing might be fundamentally feasible. PMID:15666419

  4. Analysis of Human Accelerated DNA Regions Using Archaic Hominin Genomes

    PubMed Central

    Burbano, Hernán A.; Green, Richard E.; Maricic, Tomislav; Lalueza-Fox, Carles; de la Rasilla, Marco; Rosas, Antonio; Kelso, Janet; Pollard, Katherine S.; Lachmann, Michael; Pääbo, Svante

    2012-01-01

    Several previous comparisons of the human genome with other primate and vertebrate genomes identified genomic regions that are highly conserved in vertebrate evolution but fast-evolving on the human lineage. These human accelerated regions (HARs) may be regions of past adaptive evolution in humans. Alternatively, they may be the result of non-adaptive processes, such as biased gene conversion. We captured and sequenced DNA from a collection of previously published HARs using DNA from an Iberian Neandertal. Combining these new data with shotgun sequence from the Neandertal and Denisova draft genomes, we determine at least one archaic hominin allele for 84% of all positions within HARs. We find that 8% of HAR substitutions are not observed in the archaic hominins and are thus recent in the sense that the derived allele had not come to fixation in the common ancestor of modern humans and archaic hominins. Further, we find that recent substitutions in HARs tend to have come to fixation faster than substitutions elsewhere in the genome and that substitutions in HARs tend to cluster in time, consistent with an episodic rather than a clock-like process underlying HAR evolution. Our catalog of sequence changes in HARs will help prioritize them for functional studies of genomic elements potentially responsible for modern human adaptations. PMID:22412940

  5. Analysis of sequence variation in Gnathostoma spinigerum mitochondrial DNA by single-strand conformation polymorphism analysis and DNA sequence.

    PubMed

    Ngarmamonpirat, Charinthon; Waikagul, Jitra; Petmitr, Songsak; Dekumyoy, Paron; Rojekittikhun, Wichit; Anantapruti, Malinee T

    2005-03-01

    Morphological variations were observed in the advance third stage larvae of Gnathostoma spinigerum collected from swamp eel (Fluta alba), the second intermediate host. Larvae with typical and three atypical types were chosen for partial cytochrome c oxidase subunit I (COI) gene sequence analysis. A 450 bp polymerase chain reaction product of the COI gene was amplified from mitochondrial DNA. The variations were analyzed by single-strand conformation polymorphism and DNA sequencing. The nucleotide variations of the COI gene in the four types of larvae indicated the presence of an intra-specific variation of mitochondrial DNA in the G. spinigerum population.

  6. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

    PubMed

    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

    2004-01-01

    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae.

  7. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    USGS Publications Warehouse

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  8. Comparison of latent and nominal rabbit Ig VHa1 allotype cDNA sequences.

    PubMed

    McCormack, W T; Dhanarajan, P; Roux, K H

    1988-09-15

    The genetic basis for the expression of a latent VH allotype in the rabbit was investigated. VH region cDNA libraries were produced from spleen mRNA derived from a homozygous a2a2 rabbit expressing an induced latent VHa1 allotype and, for comparison, from a normal homozygus a1a1 rabbit expressing nominal VHa1 allotype. The deduced amino acid sequences of the nominal VHa1 cDNA were concordant with previously published VHa1 protein sequences. A comparison of two complete VH-DH-JH and six partial VHa1 sequences reveals highly conserved sequence within VH framework regions (FR) and considerable diversity in complementarity-determining regions and D region sequences. Two functional JH genes or alleles are evident. Amino acid sequencing of the N-terminal 15 residues of pooled affinity-purified latent VHa1 H chain showed complete sequence identity with the nominal VHa1 sequences. Possible latent VHa1-encoding cDNA clones, derived from the a2a2 rabbit, were selected by hybridization with oligonucleotide probes corresponding to the VHa1 allotype-associated segments of the first and third framework regions (FR1 and FR3). cDNA sequence analysis reveals that the 5' untranslated regions of nominal and latent VHa1 cDNA were virtually identical to each other and to previously reported sequences associated with VHa2 and VHa-negative genes. Moreover, some latent VHa1 genes encode FR1 segments that are essentially homologous to the corresponding segment of a nominal VHa1 allotype. In contrast, other putative latent genes display blocks of VHa1 sequence in either FR1 or FR3 that are flanked by blocks of sequence identical to other rabbit VH genes (i.e., VHa2 or VHa-negative). These composite sequences may be directly encoded by composite germ-line VH genes or may be the products of somatically generated recombination or gene conversion between genes encoding latent and nominal allotypes. The data do not support the hypothesis that latent genes are the result of extensive modification

  9. Estimating genomic distance from DNA sequence location in cell nuclei by a random walk model

    SciTech Connect

    Engh, G. van den; Trask, B.J. ); Sachs, R. )

    1992-09-04

    The folding of chromatin in interphase cell nuclei was studied by fluorescent in situ hybridization with pairs of unique DNA sequence probes. The sites of DNA sequences separated by 100 to 2000 kilobase pairs (kbp) are distributed in interphase chromatin according to a random walk model. This model provides the basis for calculating the spacing of sequences along the linear DNA molecule from interphase distance measurements. An interphase mapping strategy based on this model was tested with 13 probes from a 4-megabase pair (Mbp) region of chromosome 4 containing the Huntington disease locus. The results confirmed the locations of the probes and showed that the remaining gap in the published maps of this region is negligible in size. Interphase distance measurements should facilitate construction of chromosome maps with an average marker density of one per 100 kbp, approximately ten times greater than that achieved by hybridization to metaphase chromosomes.

  10. Estimating Genomic Distance from DNA Sequence Location in Cell Nuclei by a Random Walk Model

    NASA Astrophysics Data System (ADS)

    van den Engh, Ger; Sachs, Rainer; Trask, Barbara J.

    1992-09-01

    The folding of chromatin in interphase cell nuclei was studied by fluorescent in situ hybridization with pairs of unique DNA sequence probes. The sites of DNA sequences separated by 100 to 2000 kilobase pairs (kbp) are distributed in interphase chromatin according to a random walk model. This model provides the basis for calculating the spacing of sequences along the linear DNA molecule from interphase distance measurements. An interphase mapping strategy based on this model was tested with 13 probes from a 4-megabase pair (Mbp) region of chromosome 4 containing the Huntington disease locus. The results confirmed the locations of the probes and showed that the remaining gap in the published maps of this region is negligible in size. Interphase distance measurements should facilitate construction of chromosome maps with an average marker density of one per 100 kbp, approximately ten times greater than that achieved by hybridization to metaphase chromosomes.

  11. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.

    2015-01-01

    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  12. Probabilistic models for semisupervised discriminative motif discovery in DNA sequences.

    PubMed

    Kim, Jong Kyoung; Choi, Seungjin

    2011-01-01

    Methods for discriminative motif discovery in DNA sequences identify transcription factor binding sites (TFBSs), searching only for patterns that differentiate two sets (positive and negative sets) of sequences. On one hand, discriminative methods increase the sensitivity and specificity of motif discovery, compared to generative models. On the other hand, generative models can easily exploit unlabeled sequences to better detect functional motifs when labeled training samples are limited. In this paper, we develop a hybrid generative/discriminative model which enables us to make use of unlabeled sequences in the framework of discriminative motif discovery, leading to semisupervised discriminative motif discovery. Numerical experiments on yeast ChIP-chip data for discovering DNA motifs demonstrate that the best performance is obtained between the purely-generative and the purely-discriminative and the semisupervised learning improves the performance when labeled sequences are limited.

  13. Selective enrichment of damaged DNA molecules for ancient genome sequencing

    PubMed Central

    2014-01-01

    Contamination by present-day human and microbial DNA is one of the major hindrances for large-scale genomic studies using ancient biological material. We describe a new molecular method, U selection, which exploits one of the most distinctive features of ancient DNA—the presence of deoxyuracils—for selective enrichment of endogenous DNA against a complex background of contamination during DNA library preparation. By applying the method to Neanderthal DNA extracts that are heavily contaminated with present-day human DNA, we show that the fraction of useful sequence information increases ∼10-fold and that the resulting sequences are more efficiently depleted of human contamination than when using purely computational approaches. Furthermore, we show that U selection can lead to a four- to fivefold increase in the proportion of endogenous DNA sequences relative to those of microbial contaminants in some samples. U selection may thus help to lower the costs for ancient genome sequencing of nonhuman samples also. PMID:25081630

  14. DNA sequence and structure requirements for cleavage of V(D)J recombination signal sequences.

    PubMed Central

    Cuomo, C A; Mundy, C L; Oettinger, M A

    1996-01-01

    Purified RAG1 and RAG2 proteins can cleave DNA at V(D)J recombination signals. In dissecting the DNA sequence and structural requirements for cleavage, we find that the heptamer and nonamer motifs of the recombination signal sequence can independently direct both steps of the cleavage reaction. Proper helical spacing between these two elements greatly enhances the efficiency of cleavage, whereas improper spacing can lead to interference between the two elements. The signal sequences are surprisingly tolerant of structural variation and function efficiently when nicks, gaps, and mismatched bases are introduced or even when the signal sequence is completely single stranded. Sequence alterations that facilitate unpairing of the bases at the signal/coding border activate the cleavage reaction, suggesting that DNA distortion is critical for V(D)J recombination. PMID:8816481

  15. PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities

    PubMed Central

    2011-01-01

    Background Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS) that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. Results The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. Conclusions PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/. PMID:21385349

  16. Mapping DNA polymerase errors by single-molecule sequencing

    PubMed Central

    Lee, David F.; Lu, Jenny; Chang, Seungwoo; Loparo, Joseph J.; Xie, Xiaoliang S.

    2016-01-01

    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replication product is tagged with a unique nucleotide sequence before amplification. This allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases. PMID:27185891

  17. Label-free DNA sequencing using Millikan detection.

    PubMed

    Dettloff, Roger; Leiske, Danielle; Chow, Andrea; Farinas, Javier

    2015-10-15

    A label-free method for DNA sequencing based on the principle of the Millikan oil drop experiment was developed. This sequencing-by-synthesis approach sensed increases in bead charge as nucleotides were added by a polymerase to DNA templates attached to beads. The balance between an electrical force, which was dependent on the number of nucleotide charges on a bead, and opposing hydrodynamic drag and restoring tether forces resulted in a bead velocity that was a function of the number of nucleotides attached to the bead. The velocity of beads tethered via a polymer to a microfluidic channel and subjected to an oscillating electric field was measured using dark-field microscopy and used to determine how many nucleotides were incorporated during each sequencing-by-synthesis cycle. Increases in bead velocity of approximately 1% were reliably detected during DNA polymerization, allowing for sequencing of short DNA templates. The method could lead to a low-cost, high-throughput sequencing platform that could enable routine sequencing in medical applications.

  18. Label-Free DNA Sequencing Using Millikan Detection

    PubMed Central

    Dettloff, Roger; Leiske, Danielle; Chow, Andrea; Farinas, Javier

    2015-01-01

    A label-free method for DNA sequencing based on the principle of the Millikan oil drop experiment was developed. This sequencing-by-synthesis approach sensed increases in bead charge as nucleotides were added by a polymerase to DNA templates attached to beads. The balance between an electrical force, which was dependent on the number of nucleotide charges on a bead, and opposing hydrodynamic drag and restoring tether forces resulted in a bead velocity that was a function of the number of nucleotides attached to the bead. The velocity of beads tethered via a polymer to a microfluidic channel and subjected to an oscillating electric field was measured using dark-field microscopy and used to determine how many nucleotides were incorporated during each sequencing-by-synthesis cycle. Increases in bead velocity of ~ 1% were reliably detected during DNA polymerization allowing for sequencing of short DNA templates. The method could lead to a low-cost, high-throughput sequencing platform that could enable routine sequencing in medical applications. PMID:26151683

  19. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  20. Polyphyletism of Celastrales deduced from a chloroplast noncoding DNA region.

    PubMed

    Savolainen, V; Spichiger, R; Manen, J F

    1997-04-01

    In a previous study we examined the phylogeny of four families related to the angiosperm order Celastrales based on chloroplast rbcL 5' flanking sequences. We have added here several additional dicots, sampled from 6 of the 7 families of Celastrales sensu Cronquist and 19 putatively related genera. Based on a cladistic analysis of these DNA sequences, the order Celastrales appears polyphyletic: it is here restricted to Celastraceae (including Hippocrateaceae and Brexia) with Parnassia as sister; Aquifoliaceae plus Helwingia are included in Asteridae. Neither Salvadoraceae nor Geissolomataceae, Icacinaceae, Phellinaceae, Aextoxicaceae, Corynocarpaceae, Dichapetalaceae, Stackhousiaceae, or Goupiaceae are related to Celastrales. The usefulness of this noncoding region is discussed and the influence of the A + T content of neighboring bases on the increase of transversions is also observed as previously shown in chloroplast noncoding regions of monocots.

  1. Correlations in DNA sequences across the three domains of life

    NASA Astrophysics Data System (ADS)

    Guharay, Sabyasachi; Hunt, Brian R.; Yorke, James A.; White, Owen R.

    2000-11-01

    We report statistical studies of correlation properties of ∼7500 gene sequences, covering coding (exon) and non-coding (intron) sequences for DNA and primary amino acid sequences for proteins, across all three domains of life, namely Eukaryotes (cells with nuclei), Prokaryotes (bacteria) and Archaea (archaebacteria). Mutual information function, power spectrum and Hölder exponent analyses show exons with somewhat greater correlation content than the introns studied. These results are further confirmed with hypothesis testing. While ∼30% of the Eukaryote coding sequences show distinct correlations above noise threshold, this is true for only ∼10% of the Prokaryote and Archaea coding sequences. For protein sequences, we observe correlation lengths similar to that of “random” sequences.

  2. Yeast general transcription factor GFI: sequence requirements for binding to DNA and evolutionary conservation.

    PubMed Central

    Dorsman, J C; van Heeswijk, W C; Grivell, L A

    1990-01-01

    GFI is an abundant DNA binding protein in the yeast S. cerevisiae. The protein binds to specific sequences in both ARS elements and the upstream regions of a large number of genes and is likely to play an important role in yeast cell growth. To get insight into the relative strength of the various GFI-DNA binding sites within the yeast genome, we have determined dissociation rates for several GFI-DNA complexes and found them to vary over a 70-fold range. Strong binding sites for GFI are present in the upstream activating sequences of the gene encoding the 40 kDa subunit II of the QH2:cytochrome c reductase, the gene encoding ribosomal protein S33 and in the intron of the actin gene. The binding site in the ARS1-TRP1 region is of intermediate strength. All strong binding sites conform to the sequence 5' RTCRYYYNNNACG-3'. Modification interference experiments and studies with mutant binding sites indicate that critical bases for GFI recognition are within the two elements of the consensus DNA recognition sequence. Proteins with the DNA binding specificities of GFI and GFII can also be detected in the yeast K. lactis, suggesting evolutionary conservation of at least the respective DNA-binding domains in both yeasts. Images PMID:2187179

  3. DNA Sequence Analysis of SLC26A5, Encoding Prestin, in a Patient-Control Cohort: Identification of Fourteen Novel DNA Sequence Variations

    PubMed Central

    Minor, Jacob S.; Tang, Hsiao-Yuan; Pereira, Fred A.; Alford, Raye Lynn

    2009-01-01

    Background Prestin, encoded by the gene SLC26A5, is a transmembrane protein of the cochlear outer hair cell (OHC). Prestin is required for the somatic electromotile activity of OHCs, which is absent in OHCs and causes severe hearing impairment in mice lacking prestin. In humans, the role of sequence variations in SLC26A5 in hearing loss is less clear. Although prestin is expected to be required for functional human OHCs, the clinical significance of reported putative mutant alleles in humans is uncertain. Methodology/Principal Findings To explore the hypothesis that SLC26A5 may act as a modifier gene, affecting the severity of hearing loss caused by an independent etiology, a patient-control cohort was screened for DNA sequence variations in SLC26A5 using sequencing and allele specific methods. Patients in this study carried known pathogenic or controversial sequence variations in GJB2, encoding Connexin 26, or confirmed or suspected sequence variations in SLC26A5; controls included four ethnic populations. Twenty-three different DNA sequence variations in SLC26A5, 14 of which are novel, were observed: 4 novel sequence variations were found exclusively among patients; 7 novel sequence variations were found exclusively among controls; and, 12 sequence variations, 3 of which are novel, were found in both patients and controls. Twenty-one of the 23 DNA sequence variations were located in non-coding regions of SLC26A5. Two coding sequence variations, both novel, were observed only in patients and predict a silent change, p.S434S, and an amino acid substitution, p.I663V. In silico analysis of the p.I663V amino acid variation suggested this variant might be benign. Using Fisher's exact test, no statistically significant difference was observed between patients and controls in the frequency of the identified DNA sequence variations. Haplotype analysis using HaploView 4.0 software revealed the same predominant haplotype in patients and controls and derived haplotype blocks

  4. Genome-Wide Analyses of Recombination Prone Regions Predict Role of DNA Structural Motif in Recombination

    PubMed Central

    Das, Swapan Kumar; Chowdhury, Shantanu

    2009-01-01

    HapMap findings reveal surprisingly asymmetric distribution of recombinogenic regions. Short recombinogenic regions (hotspots) are interspersed between large relatively non-recombinogenic regions. This raises the interesting possibility of DNA sequence and/or other cis- elements as determinants of recombination. We hypothesized the involvement of non-canonical sequences that can result in local non-B DNA structures and tested this using the G-quadruplex DNA as a model. G-quadruplex or G4 DNA is a unique form of four-stranded non-B DNA structure that engages certain G-rich sequences, presence of such motifs has been noted within telomeres. In support of this hypothesis, genome-wide computational analyses presented here reveal enrichment of potential G4 (PG4) DNA forming sequences within 25618 human hotspots relative to 9290 coldspots (p<0.0001). Furthermore, co-occurrence of PG4 DNA within several short sequence elements that are associated with recombinogenic regions was found to be significantly more than randomly expected. Interestingly, analyses of more than 50 DNA binding factors revealed that co-occurrence of PG4 DNA with target DNA binding sites of transcription factors c-Rel, NF-kappa B (p50 and p65) and Evi-1 was significantly enriched in recombination-prone regions. These observations support involvement of G4 DNA in recombination, predicting a functional model that is consistent with duplex-strand separation induced by formation of G4 motifs in supercoiled DNA and/or when assisted by other cellular factors. PMID:19198658

  5. Dialects of the DNA Uptake Sequence in Neisseriaceae

    PubMed Central

    Frye, Stephan A.; Nilsen, Mariann; Tønjum, Tone; Ambur, Ole Herman

    2013-01-01

    In all sexual organisms, adaptations exist that secure the safe reassortment of homologous alleles and prevent the intrusion of potentially hazardous alien DNA. Some bacteria engage in a simple form of sex known as transformation. In the human pathogen Neisseria meningitidis and in related bacterial species, transformation by exogenous DNA is regulated by the presence of a specific DNA Uptake Sequence (DUS), which is present in thousands of copies in the respective genomes. DUS affects transformation by limiting DNA uptake and recombination in favour of homologous DNA. The specific mechanisms of DUS–dependent genetic transformation have remained elusive. Bioinformatic analyses of family Neisseriaceae genomes reveal eight distinct variants of DUS. These variants are here termed DUS dialects, and their effect on interspecies commutation is demonstrated. Each of the DUS dialects is remarkably conserved within each species and is distributed consistent with a robust Neisseriaceae phylogeny based on core genome sequences. The impact of individual single nucleotide transversions in DUS on meningococcal transformation and on DNA binding and uptake is analysed. The results show that a DUS core 5′-CTG-3′ is required for transformation and that transversions in this core reduce DNA uptake more than two orders of magnitude although the level of DNA binding remains less affected. Distinct DUS dialects are efficient barriers to interspecies recombination in N. meningitidis, N. elongata, Kingella denitrificans, and Eikenella corrodens, despite the presence of the core sequence. The degree of similarity between the DUS dialect of the recipient species and the donor DNA directly correlates with the level of transformation and DNA binding and uptake. Finally, DUS–dependent transformation is documented in the genera Eikenella and Kingella for the first time. The results presented here advance our understanding of the function and evolution of DUS and genetic transformation

  6. Mitochondrial DNA sequences of five squamates: phylogenetic affiliation of snakes.

    PubMed

    Kumazawa, Yoshinori

    2004-04-30

    Complete or nearly complete mitochondrial DNA sequences were determined from four lizards (Western fence lizard, Warren's spinytail lizard, Terrestrial arboreal alligator lizard, and Chinese crocodile lizard) and a snake (Texas blind snake). These genomes had a typical gene organization found in those of most mammals and fishes, except for a translocation of the glutamine tRNA gene in the blind snake and a tandem duplication of the threonine and proline tRNA genes in the spinytail lizard. Although previous work showed the existence of duplicate control regions in mitochondrial DNAs of several snakes, the blind snake did not have this characteristic. Phylogenetic analyses based on different tree-building methods consistently supported that the blind snake and a colubrid snake (akamata) make a sister clade relative to all the lizard taxa from six different families. An alternative hypothesis that snakes evolved from a lineage of varanoids was not favored and nearly statistically rejected by the Kishino-Hasegawa test. It is therefore likely that the apparent similarity of the tongue structure between snakes and varanoids independently evolved and that the duplication of the control region occurred on a snake lineage after divergence of the blind snake.

  7. Mitochondrial DNA Sequence Divergence among Lycopersicon and Related Solanum Species

    PubMed Central

    McClean, Phillip E.; Hanson, Maureen R.

    1986-01-01

    Sequence divergence among the mitochondrial (mt) DNA of nine Lycopersicon and two closely related Solanum species was estimated using the shared fragment method. A portion of each mt genome was highlighted by probing total DNA with a series of plasmid clones containing mt-specific DNA fragments from Lycopersicon pennellii. A total of 660 fragments were compared. As calculated by the shared fragment method, sequence divergence among the mtDNAs ranged from 0.4% for the L. esculentum-L. esculentum var. cerasiforme pair to 2.7% for the Solanum rickii-L. pimpinellifolium and L. cheesmanii-L. chilense pairs. The mtDNA divergence is higher than that reported for Lycopersicon chloroplast (cp) DNA, which indicates that the DNAs of the two plant organelles are evolving at different rates. The percentages of shared fragments were used to construct a phenogram that illustrates the present-day relationships of the mtDNAs. The mtDNA-derived phenogram places L. hirsutum closer to L. esculentum than taxonomic and cpDNA comparisons. Further, the recent assignment of L. pennellii to the genus Lycopersicon is supported by the mtDNA analysis. PMID:17246320

  8. Metagenomics to paleogenomics: large-scale sequencing of mammoth DNA.

    PubMed

    Poinar, Hendrik N; Schwarz, Carsten; Qi, Ji; Shapiro, Beth; Macphee, Ross D E; Buigues, Bernard; Tikhonov, Alexei; Huson, Daniel H; Tomsho, Lynn P; Auch, Alexander; Rampp, Markus; Miller, Webb; Schuster, Stephan C

    2006-01-20

    We sequenced 28 million base pairs of DNA in a metagenomics approach, using a woolly mammoth (Mammuthus primigenius) sample from Siberia. As a result of exceptional sample preservation and the use of a recently developed emulsion polymerase chain reaction and pyrosequencing technique, 13 million base pairs (45.4%) of the sequencing reads were identified as mammoth DNA. Sequence identity between our data and African elephant (Loxodonta africana) was 98.55%, consistent with a paleontologically based divergence date of 5 to 6 million years. The sample includes a surprisingly small diversity of environmental DNAs. The high percentage of endogenous DNA recoverable from this single mammoth would allow for completion of its genome, unleashing the field of paleogenomics.

  9. Accelerating Computation of DNA Sequence Alignment in Distributed Environment

    NASA Astrophysics Data System (ADS)

    Guo, Tao; Li, Guiyang; Deaton, Russel

    Sequence similarity and alignment are most important operations in computational biology. However, analyzing large sets of DNA sequence seems to be impractical on a regular PC. Using multiple threads with JavaParty mechanism, this project has successfully implemented in extending the capabilities of regular Java to a distributed environment for simulation of DNA computation. With the aid of JavaParty and the design of multiple threads, the results of this study demonstrated that the modified regular Java program could perform parallel computing without using RMI or socket communication. In this paper, an efficient method for modeling and comparing DNA sequences with dynamic programming and JavaParty was firstly proposed. Additionally, results of this method in distributed environment have been discussed.

  10. Identification of Chinese Herbs Using a Sequencing-Free Nanostructured Electrochemical DNA Biosensor

    PubMed Central

    Lei, Yan; Yang, Fan; Tang, Lina; Chen, Keli; Zhang, Guo-Jun

    2015-01-01

    Due to the nearly identical phenotypes and chemical constituents, it is often very challenging to accurately differentiate diverse species of a Chinese herbal genus. Although technologies including DNA barcoding have been introduced to help address this problem, they are generally time-consuming and require expensive sequencing. Herein, we present a simple sequencing-free electrochemical biosensor, which enables easy differentiation between two closely related Fritillaria species. To improve its differentiation capability using trace amounts of DNA sample available from herbal extracts, a stepwise electrochemical deposition of reduced graphene oxide (RGO) and gold nanoparticles (AuNPs) was adopted to engineer a synergistic nanostructured sensing interface. By using such a nanofeatured electrochemical DNA (E-DNA) biosensor, two Chinese herbal species of Fritillaria (F. thunbergii and F. cirrhosa) were successfully discriminated at the DNA level, because a fragment of 16-mer sequence at the spacer region of the 5S-rRNA only exists in F. thunbergii. This E-DNA sensor was capable of identifying the target sequence in the range from 100 fM to 10 nM, and a detection limit as low as 11.7 fM (S/N = 3) was obtained. Importantly, this sensor was applied to detect the unique fragment of the PCR products amplified from F. thunbergii and F. cirrhosa, respectively. We anticipate that such a direct, sequencing-free sensing mode will ultimately pave the way towards a new generation of herb-identification strategies. PMID:26633399

  11. Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy

    PubMed Central

    Schmid, Andreas K.; Davis, Ronald W.

    2016-01-01

    DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging. PMID:27149617

  12. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.

    1987-10-07

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.

  13. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.

    1990-10-09

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.

  14. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, James H.; Keller, Richard A.; Martin, John C.; Moyzis, Robert K.; Ratliff, Robert L.; Shera, E. Brooks; Stewart, Carleton C.

    1990-01-01

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed.

  15. Multiple Base Substitution Corrections in DNA Sequence Evolution

    NASA Astrophysics Data System (ADS)

    Kowalczuk, M.; Mackiewicz, P.; Szczepanik, D.; Nowicka, A.; Dudkiewicz, M.; Dudek, M. R.; Cebrat, S.

    We discuss the Jukes and Cantor's one-parameter model and Kimura's two-parameter model unability to describe evolution of asymmetric DNA molecules. The standard distance measure between two DNA sequences, which is the number of substitutions per site, should include the effect of multiple base substitutions separately for each type of the base. Otherwise, the respective tables of substitutions cannot reconstruct the asymmetric DNA molecule with respect to the composition. Basing on Kimura's neutral theory, we have derived a linear law for the correlation of the mean survival time of nucleotides under constant mutation pressure and their fraction in the genome. According to the law, the corrections to Kimura's theory have been discussed to describe evolution of genomes with asymmetric nucleotide composition. We consider the particular case of the strongly asymmetric Borrelia burgdorferi genome and we discuss in detail the corrections, which should be introduced into the distance measure between two DNA sequences to include multiple base substitutions.

  16. Next Generation DNA Sequencing and the Future of Genomic Medicine

    PubMed Central

    Anderson, Matthew W.; Schrijver, Iris

    2010-01-01

    In the years since the first complete human genome sequence was reported, there has been a rapid development of technologies to facilitate high-throughput sequence analysis of DNA (termed “next-generation” sequencing). These novel approaches to DNA sequencing offer the promise of complete genomic analysis at a cost feasible for routine clinical diagnostics. However, the ability to more thoroughly interrogate genomic sequence raises a number of important issues with regard to result interpretation, laboratory workflow, data storage, and ethical considerations. This review describes the current high-throughput sequencing platforms commercially available, and compares the inherent advantages and disadvantages of each. The potential applications for clinical diagnostics are considered, as well as the need for software and analysis tools to interpret the vast amount of data generated. Finally, we discuss the clinical and ethical implications of the wealth of genetic information generated by these methods. Despite the challenges, we anticipate that the evolution and refinement of high-throughput DNA sequencing technologies will catalyze a new era of personalized medicine based on individualized genomic analysis. PMID:24710010

  17. Identification and isolation of full-length cDNA sequences by sequencing and analysis of expressed sequence tags from guarana (Paullinia cupana).

    PubMed

    Figueirêdo, L C; Faria-Campos, A C; Astolfi-Filho, S; Azevedo, J L

    2011-06-21

    The current intense production of biological data, generated by sequencing techniques, has created an ever-growing volume of unanalyzed data. We reevaluated data produced by the guarana (Paullinia cupana) transcriptome sequencing project to identify cDNA clones with complete coding sequences (full-length clones) and complete sequences of genes of biotechnological interest, contributing to the knowledge of biological characteristics of this organism. We analyzed 15,490 ESTs of guarana in search of clones with complete coding regions. A total of 12,402 sequences were analyzed using BLAST, and 4697 full-length clones were identified, responsible for the production of 2297 different proteins. Eighty-four clones were identified as full-length for N-methyltransferase and 18 were sequenced in both directions to obtain the complete genome sequence, and confirm the search made in silico for full-length clones. Phylogenetic analyses were made with the complete genome sequences of three clones, which showed only 0.017% dissimilarity; these are phylogenetically close to the caffeine synthase of Theobroma cacao. The search for full-length clones allowed the identification of numerous clones that had the complete coding region, demonstrating this to be an efficient and useful tool in the process of biological data mining. The sequencing of the complete coding region of identified full-length clones corroborated the data from the in silico search, strengthening its efficiency and utility.

  18. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  19. Ancient mtDNA sequences from the First Australians revisited

    PubMed Central

    Subramanian, Sankar; Wright, Joanne L.; Endicott, Phillip; Westaway, Michael Carrington; Huynen, Leon; Parson, Walther; Millar, Craig D.; Willerslev, Eske; Lambert, David M.

    2016-01-01

    The publication in 2001 by Adcock et al. [Adcock GJ, et al. (2001) Proc Natl Acad Sci USA 98(2):537–542] in PNAS reported the recovery of short mtDNA sequences from ancient Australians, including the 42,000-y-old Mungo Man [Willandra Lakes Hominid (WLH3)]. This landmark study in human ancient DNA suggested that an early modern human mitochondrial lineage emerged in Asia and that the theory of modern human origins could no longer be considered solely through the lens of the “Out of Africa” model. To evaluate these claims, we used second generation DNA sequencing and capture methods as well as PCR-based and single-primer extension (SPEX) approaches to reexamine the same four Willandra Lakes and Kow Swamp 8 (KS8) remains studied in the work by Adcock et al. Two of the remains sampled contained no identifiable human DNA (WLH15 and WLH55), whereas the Mungo Man (WLH3) sample contained no Aboriginal Australian DNA. KS8 reveals human mitochondrial sequences that differ from the previously inferred sequence. Instead, we recover a total of five modern European contaminants from Mungo Man (WLH3). We show that the remaining sample (WLH4) contains ∼1.4% human DNA, from which we assembled two complete mitochondrial genomes. One of these was a previously unidentified Aboriginal Australian haplotype belonging to haplogroup S2 that we sequenced to a high coverage. The other was a contaminating modern European mitochondrial haplotype. Although none of the sequences that we recovered matched those reported by Adcock et al., except a contaminant, these findings show the feasibility of obtaining important information from ancient Aboriginal Australian remains. PMID:27274055

  20. Ancient mtDNA sequences from the First Australians revisited.

    PubMed

    Heupink, Tim H; Subramanian, Sankar; Wright, Joanne L; Endicott, Phillip; Westaway, Michael Carrington; Huynen, Leon; Parson, Walther; Millar, Craig D; Willerslev, Eske; Lambert, David M

    2016-06-21

    The publication in 2001 by Adcock et al. [Adcock GJ, et al. (2001) Proc Natl Acad Sci USA 98(2):537-542] in PNAS reported the recovery of short mtDNA sequences from ancient Australians, including the 42,000-y-old Mungo Man [Willandra Lakes Hominid (WLH3)]. This landmark study in human ancient DNA suggested that an early modern human mitochondrial lineage emerged in Asia and that the theory of modern human origins could no longer be considered solely through the lens of the "Out of Africa" model. To evaluate these claims, we used second generation DNA sequencing and capture methods as well as PCR-based and single-primer extension (SPEX) approaches to reexamine the same four Willandra Lakes and Kow Swamp 8 (KS8) remains studied in the work by Adcock et al. Two of the remains sampled contained no identifiable human DNA (WLH15 and WLH55), whereas the Mungo Man (WLH3) sample contained no Aboriginal Australian DNA. KS8 reveals human mitochondrial sequences that differ from the previously inferred sequence. Instead, we recover a total of five modern European contaminants from Mungo Man (WLH3). We show that the remaining sample (WLH4) contains ∼1.4% human DNA, from which we assembled two complete mitochondrial genomes. One of these was a previously unidentified Aboriginal Australian haplotype belonging to haplogroup S2 that we sequenced to a high coverage. The other was a contaminating modern European mitochondrial haplotype. Although none of the sequences that we recovered matched those reported by Adcock et al., except a contaminant, these findings show the feasibility of obtaining important information from ancient Aboriginal Australian remains.

  1. Mitochondrial DNA sequences from a 7000-year old brain.

    PubMed Central

    Pääbo, S; Gifford, J A; Wilson, A C

    1988-01-01

    Pieces of mitochondrial DNA from a 7000-year-old human brain were amplified by the polymerase chain reaction and sequenced. Albumin and high concentrations of polymerase were required to overcome a factor in the brain extract that inhibits amplification. For this and other sources of ancient DNA, we find an extreme inverse dependence of the amplification efficiency on the length of the sequence to be amplified. This property of ancient DNA distinguishes it from modern DNA and thus provides a new criterion of authenticity for use in research on ancient DNA. The brain is from an individual recently excavated from Little Salt Spring in southwestern Florida and the anthropologically informative sequences it yielded are the first obtained from archaeologically retrieved remains. The sequences show that this ancient individual belonged to a mitochondrial lineage that is rare in the Old World and not previously known to exist among Native Americans. Our finding brings to three the number of maternal lineages known to have been involved in the prehistoric colonization of the New World. Images PMID:3186445

  2. Preparation of next-generation sequencing libraries from damaged DNA.

    PubMed

    Briggs, Adrian W; Heyn, Patricia

    2012-01-01

    Next-generation sequencing (NGS) has revolutionized ancient DNA research, especially when combined with high-throughput target enrichment methods. However, attaining high sequencing depth and accuracy from samples often remains problematic due to the damaged state of ancient DNA, in particular the extremely low copy number of ancient DNA and the abundance of uracil residues derived from cytosine deamination that lead to miscoding errors. It is therefore critical to use a highly efficient procedure for conversion of a raw DNA extract into an adaptor-ligated sequencing library, and equally important to reduce errors from uracil residues. We present a protocol for NGS library preparation that allows highly efficient conversion of DNA fragments into an adaptor-ligated form. The protocol incorporates an option to remove the vast majority of uracil miscoding lesions as part of the library preparation process. The procedure requires only two spin column purification steps and no gel purification or bead handling. Starting from an aliquot of DNA extract, a finished, highly amplified library can be generated in 5 h, or under 3 h if uracil removal is not required.

  3. Isolation of a sex-linked DNA sequence in cranes.

    PubMed

    Duan, W; Fuerst, P A

    2001-01-01

    A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

  4. Rapid Amplification of cDNA Ends for RNA Transcript Sequencing in Staphylococcus.

    PubMed

    Miller, Eric

    2016-01-01

    Rapid amplification of cDNA ends (RACE) is a technique that was developed to swiftly and efficiently amplify full-length RNA molecules in which the terminal ends have not been characterized. Current usage of this procedure has been more focused on sequencing and characterizing RNA 5' and 3' untranslated regions. Herein is described an adapted RACE protocol to amplify bacterial RNA transcripts.

  5. Isolation and characterization of centromeric repetitive DNA sequences in Saccharum spontaneum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sugarcane (Saccharum hybrids spp.) is the most important sugar crop that accounts for ~75% of the world's sugar production. Recently, a whole-genome sequencing project was launched on the wild species S. spontaneum. To obtain information on the DNA composition of the repeat-enriched region of the ce...

  6. Bayesian estimation of sequence damage in ancient DNA.

    PubMed

    Ho, Simon Y W; Heupink, Tim H; Rambaut, Andrew; Shapiro, Beth

    2007-06-01

    DNA extracted from archaeological and paleontological remains is usually damaged by biochemical processes postmortem. Some of these processes lead to changes in the structure of the DNA molecule, which can result in the incorporation of incorrect nucleotides during polymerase chain reaction. These base misincorporations, or miscoding lesions, can lead to the inclusion of spurious additional mutations in ancient DNA (aDNA) data sets. This has the potential to affect the outcome of phylogenetic and population genetic analyses, including estimates of mutation rates and genetic diversity. We present a novel model, termed the delta model, which estimates the amount of damage in DNA data and accounts for its effects in a Bayesian phylogenetic framework. The ability of the delta model to estimate damage is first investigated using a simulation study. The model is then applied to 13 aDNA data sets. The amount of damage in these data sets is shown to be significant but low (about 1 damaged base per 750 nt), suggesting that precautions for limiting the influence of damaged sites, such as cloning and enzymatic treatment, are worthwhile. The results also suggest that relatively high rates of mutation previously estimated from aDNA data are not entirely an artifact of sequence damage and are likely to be due to other factors such as the persistence of transient polymorphisms. The delta model appears to be particularly useful for placing upper credibility limits on the amount of sequence damage in an alignment, and this capacity might be beneficial for future aDNA studies or for the estimation of sequencing errors in modern DNA.

  7. Real-time DNA sequencing from single polymerase molecules.

    PubMed

    Eid, John; Fehr, Adrian; Gray, Jeremy; Luong, Khai; Lyle, John; Otto, Geoff; Peluso, Paul; Rank, David; Baybayan, Primo; Bettman, Brad; Bibillo, Arkadiusz; Bjornson, Keith; Chaudhuri, Bidhan; Christians, Frederick; Cicero, Ronald; Clark, Sonya; Dalal, Ravindra; Dewinter, Alex; Dixon, John; Foquet, Mathieu; Gaertner, Alfred; Hardenbol, Paul; Heiner, Cheryl; Hester, Kevin; Holden, David; Kearns, Gregory; Kong, Xiangxu; Kuse, Ronald; Lacroix, Yves; Lin, Steven; Lundquist, Paul; Ma, Congcong; Marks, Patrick; Maxham, Mark; Murphy, Devon; Park, Insil; Pham, Thang; Phillips, Michael; Roy, Joy; Sebra, Robert; Shen, Gene; Sorenson, Jon; Tomaney, Austin; Travers, Kevin; Trulson, Mark; Vieceli, John; Wegener, Jeffrey; Wu, Dawn; Yang, Alicia; Zaccarin, Denis; Zhao, Peter; Zhong, Frank; Korlach, Jonas; Turner, Stephen

    2009-01-02

    We present single-molecule, real-time sequencing data obtained from a DNA polymerase performing uninterrupted template-directed synthesis using four distinguishable fluorescently labeled deoxyribonucleoside triphosphates (dNTPs). We detected the temporal order of their enzymatic incorporation into a growing DNA strand with zero-mode waveguide nanostructure arrays, which provide optical observation volume confinement and enable parallel, simultaneous detection of thousands of single-molecule sequencing reactions. Conjugation of fluorophores to the terminal phosphate moiety of the dNTPs allows continuous observation of DNA synthesis over thousands of bases without steric hindrance. The data report directly on polymerase dynamics, revealing distinct polymerization states and pause sites corresponding to DNA secondary structure. Sequence data were aligned with the known reference sequence to assay biophysical parameters of polymerization for each template position. Consensus sequences were generated from the single-molecule reads at 15-fold coverage, showing a median accuracy of 99.3%, with no systematic error beyond fluorophore-dependent error rates.

  8. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    NASA Technical Reports Server (NTRS)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  9. Reduced-stringency DNA reassociation: sequence specific duplex formation.

    PubMed Central

    Burr, H E; Schimke, R T

    1982-01-01

    Reduced-stringency DNA reassociation conditions allow low stability duplexes to be detected in prokaryotic, plant, fish, avian, mammalian, and primate genomes. Highly diverged families of sequences can be detected in avian, mouse, and human unique sequence dNAs. Such a family has been described among twelve species of birds; based on species specific melting profiles and fractionation of sequences belonging to this family, it was concluded that permissive reassociation conditions did not artifactually produce low stability structures (1). We report S1 nuclease and optical melting experiments, and further fractionation of the diverged family to confirm sequence specific DNA reassociation at 50 degrees in 0.5 M phosphate buffer. PMID:6278429

  10. Identification of Bacterial Species in Kuwaiti Waters Through DNA Sequencing

    NASA Astrophysics Data System (ADS)

    Chen, K.

    2017-01-01

    With an objective of identifying the bacterial diversity associated with ecosystem of various Kuwaiti Seas, bacteria were cultured and isolated from 3 water samples. Due to the difficulties for cultured and isolated fecal coliforms on the selective agar plates, bacterial isolates from marine agar plates were selected for molecular identification. 16S rRNA genes were successfully amplified from the genome of the selected isolates using Universal Eubacterial 16S rRNA primers. The resulted amplification products were subjected to automated DNA sequencing. Partial 16S rDNA sequences obtained were compared directly with sequences in the NCBI database using BLAST as well as with the sequences available with Ribosomal Database Project (RDP).

  11. Efficiency of ITS sequences for DNA barcoding in Passiflora (Passifloraceae).

    PubMed

    Giudicelli, Giovanna Câmara; Mäder, Geraldo; de Freitas, Loreta Brandão

    2015-04-01

    DNA barcoding is a technique for discriminating and identifying species using short, variable, and standardized DNA regions. Here, we tested for the first time the performance of plastid and nuclear regions as DNA barcodes in Passiflora. This genus is a largely variable, with more than 900 species of high ecological, commercial, and ornamental importance. We analyzed 1034 accessions of 222 species representing the four subgenera of Passiflora and evaluated the effectiveness of five plastid regions and three nuclear datasets currently employed as DNA barcodes in plants using barcoding gap, applied similarity-, and tree-based methods. The plastid regions were able to identify less than 45% of species, whereas the nuclear datasets were efficient for more than 50% using "best match" and "best close match" methods of TaxonDNA software. All subgenera presented higher interspecific pairwise distances and did not fully overlap with the intraspecific distance, and similarity-based methods showed better results than tree-based methods. The nuclear ribosomal internal transcribed spacer 1 (ITS1) region presented a higher discrimination power than the other datasets and also showed other desirable characteristics as a DNA barcode for this genus. Therefore, we suggest that this region should be used as a starting point to identify Passiflora species.

  12. Efficiency of ITS Sequences for DNA Barcoding in Passiflora (Passifloraceae)

    PubMed Central

    Giudicelli, Giovanna Câmara; Mäder, Geraldo; de Freitas, Loreta Brandão

    2015-01-01

    DNA barcoding is a technique for discriminating and identifying species using short, variable, and standardized DNA regions. Here, we tested for the first time the performance of plastid and nuclear regions as DNA barcodes in Passiflora. This genus is a largely variable, with more than 900 species of high ecological, commercial, and ornamental importance. We analyzed 1034 accessions of 222 species representing the four subgenera of Passiflora and evaluated the effectiveness of five plastid regions and three nuclear datasets currently employed as DNA barcodes in plants using barcoding gap, applied similarity-, and tree-based methods. The plastid regions were able to identify less than 45% of species, whereas the nuclear datasets were efficient for more than 50% using “best match” and “best close match” methods of TaxonDNA software. All subgenera presented higher interspecific pairwise distances and did not fully overlap with the intraspecific distance, and similarity-based methods showed better results than tree-based methods. The nuclear ribosomal internal transcribed spacer 1 (ITS1) region presented a higher discrimination power than the other datasets and also showed other desirable characteristics as a DNA barcode for this genus. Therefore, we suggest that this region should be used as a starting point to identify Passiflora species. PMID:25837628

  13. An optimization approach and its application to compare DNA sequences

    NASA Astrophysics Data System (ADS)

    Liu, Liwei; Li, Chao; Bai, Fenglan; Zhao, Qi; Wang, Ying

    2015-02-01

    Studying the evolutionary relationship between biological sequences has become one of the main tasks in bioinformatics research by means of comparing and analyzing the gene sequence. Many valid methods have been applied to the DNA sequence alignment. In this paper, we propose a novel comparing method based on the Lempel-Ziv (LZ) complexity to compare biological sequences. Moreover, we introduce a new distance measure and make use of the corresponding similarity matrix to construct phylogenic tree without multiple sequence alignment. Further, we construct phylogenic tree for 24 species of Eutherian mammals and 48 countries of Hepatitis E virus (HEV) by an optimization approach. The results indicate that this new method improves the efficiency of sequence comparison and successfully construct phylogenies.

  14. Contrasting DNA sequence organisation patterns in sauropsidian genomes.

    PubMed

    Epplen, J T; Diedrich, U; Wagenmann, M; Schmidtke, J; Engel, W

    1979-11-01

    The genomic DNA organisation patterns of four sauropsidian species, namely Python reticularis, Caiman crocodilus, Terrapene carolina triungius and Columba livia domestica were investigated by reassociation of short and long DNA fragments, by hyperchromicity measurements of reannealed fragments and by length estimations of S1-nuclease resistant repetitive duplexes. While the genomic DNA of the three reptilian species shows a short period interspersion pattern, the genome of the avian species is organised in a long period interspersion pattern apparently typical for birds. These findings are discussed in view of the close phylogenetic relationships of birds and reptiles, and also with regard to a possible relationship between the extent of sequence interspersion and genome size.

  15. Base-sequence-dependent sliding of proteins on DNA.

    PubMed

    Barbi, M; Place, C; Popkov, V; Salerno, M

    2004-10-01

    The possibility that the sliding motion of proteins on DNA is influenced by the base sequence through a base pair reading interaction, is considered. Referring to the case of the T7 RNA-polymerase, we show that the protein should follow a noise-influenced sequence-dependent motion which deviate from the standard random walk usually assumed. The general validity and the implications of the results are discussed.

  16. Feature Extraction From DNA Sequences by Multifractal Analysis

    DTIC Science & Technology

    2007-11-02

    genome may lead to an under- standing of the genome and to the understanding of life. Recently a draft sequence of the human genome ...which covers 96% of the entire human genome containing base pairs, has been published by the Human Genome Project (HGP) and Celera Genomics . However...time series model based on the global structure of the complete genome , and showed long-range correlations in the bacteria DNA sequences . Although

  17. A novel satellite DNA sequence in the Peromyscus genome (PMSat): Evolution via copy number fluctuation.

    PubMed

    Louzada, Sandra; Vieira-da-Silva, Ana; Mendes-da-Silva, Ana; Kubickova, Svatava; Rubes, Jiri; Adega, Filomena; Chaves, Raquel

    2015-11-01

    Satellite DNAs (satDNA) are tandemly arrayed repeated sequences largely present in eukaryotic genomes, which play important roles in genome evolution and function, and therefore, their analysis is vital. Here, we describe the isolation of a novel satellite DNA family (PMSat) from the rodent Peromyscus eremicus (Cricetidae, Rodentia), which is located in pericentromeric regions and exhibits a typical satellite DNA genome organization. Orthologous PMSat sequences were isolated and characterized from three species belonging to Cricetidae: Cricetus cricetus, Phodopus sungorus and Microtus arvalis. In these species, PMSat is highly conserved, with the absence of fixed species-specific mutations. Strikingly, different numbers of copies of this sequence were found among the species, suggesting evolution by copy number fluctuation. Repeat units of PMSat were also found in the Peromyscus maniculatus bairdii BioProject, but our results suggest that these repeat units are from genome regions outside the pericentromere. The remarkably high evolutionary sequence conservation along with the preservation of a few numbers of copies of this sequence in the analyzed genomes may suggest functional significance but a different sequence nature/organization. Our data highlight that repeats are difficult to analyze due to the limited tools available to dissect genomes and the fact that assemblies do not cover regions of constitutive heterochromatin.

  18. A new family of satellite DNA sequences as a major component of centromeric heterochromatin in owls (Strigiformes).

    PubMed

    Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Matsuda, Yoichi

    2004-03-01

    We isolated a new family of satellite DNA sequences from HaeIII- and EcoRI-digested genomic DNA of the Blakiston's fish owl ( Ketupa blakistoni). The repetitive sequences were organized in tandem arrays of the 174 bp element, and localized to the centromeric regions of all macrochromosomes, including the Z and W chromosomes, and microchromosomes. This hybridization pattern was consistent with the distribution of C-band-positive centromeric heterochromatin, and the satellite DNA sequences occupied 10% of the total genome as a major component of centromeric heterochromatin. The sequences were homogenized between macro- and microchromosomes in this species, and therefore intraspecific divergence of the nucleotide sequences was low. The 174 bp element cross-hybridized to the genomic DNA of six other Strigidae species, but not to that of the Tytonidae, suggesting that the satellite DNA sequences are conserved in the same family but fairly divergent between the different families in the Strigiformes. Secondly, the centromeric satellite DNAs were cloned from eight Strigidae species, and the nucleotide sequences of 41 monomer fragments were compared within and between species. Molecular phylogenetic relationships of the nucleotide sequences were highly correlated with both the taxonomy based on morphological traits and the phylogenetic tree constructed by DNA-DNA hybridization. These results suggest that the satellite DNA sequence has evolved by concerted evolution in the Strigidae and that it is a good taxonomic and phylogenetic marker to examine genetic diversity between Strigiformes species.

  19. Distribution of repetitive DNA sequences in chromosomes of five opisthorchid species (Trematoda, Opisthorchiidae).

    PubMed

    Zadesenets, Kira S; Karamysheva, Tatyana V; Katokhin, Alexei V; Mordvinov, Viatcheslav A; Rubtsov, Nikolay B

    2012-03-01

    Genomes of opisthorchid species are characterized by small size, suggesting a reduced amount of repetitive DNA in their genomes. Distribution of repetitive DNA sequences in the chromosomes of five species of the family Opisthorchiidae (Opisthorchis felineus 2n = 14 (Rivolta, 1884), Opisthorchis viverrini 2n = 12 (Poirier, 1886), Metorchis xanthosomus 2n = 14 (Creplin, 1846), Metorchis bilis 2n = 14 (Braun, 1890), Clonorchis sinensis 2n = 14 (Cobbold, 1875)) was studied with C- and AgNOR-banding, generation of microdissected DNA probes from individual chromosomes and fluorescent in situ hybridization on mitotic and meiotic chromosomes. Small-sized C-bands were discovered in pericentric regions of chromosomes. Ag-NOR staining of opisthorchid chromosomes and FISH with ribosomal DNA probe showed that karyotypes of all studied species were characterized by the only nucleolus organizer region in one of small chromosomes. The generation of DNA probes from chromosomes 1 and 2 of O. felineus and M. xanthosomus was performed with chromosome microdissection followed by DOP-PCR. FISH of obtained microdissected DNA probes on chromosomes of these species revealed chromosome specific DNA repeats in pericentric C-bands. It was also shown that microdissected DNA probes generated from chromosomes could be used as the Whole Chromosome Painting Probes without suppression of repetitive DNA hybridization. Chromosome painting using microdissected chromosome specific DNA probes showed the overall repeat distribution in opisthorchid chromosomes.

  20. Alignments of DNA and protein sequences containing frameshift errors.

    PubMed

    Guan, X; Uberbacher, E C

    1996-02-01

    Molecular sequences, like all experimental data, are subject to error. Many current DNA sequencing protocols have very significant error rates and often generate artefactual insertions and deletions of bases (indels) which corrupt the translation of sequences and compromise the detection of protein homologies. The impact of these errors on the utility of molecular sequence data is dependent on the analytic technique used to interpret the data. In the presence of frameshift errors, standard algorithms using six-frame translation can miss important homologies because only subfragments of the correct translation are available in any given frame. We present a new algorithm which can detect and correct frameshift errors in DNA sequences during comparison of translated sequences with protein sequences in the databases. This algorithm can recognize homologous proteins sharing 30% identity even in the presence of a 7% frameshift error rate. Our algorithm uses dynamic programming, producing a guaranteed optimal alignment in the presence of frameshifts, and has a sensitivity equivalent to Smith-Waterman. The computational efficiency of the algorithm is O(nm) where n and m are the sizes of two sequences being compared. The algorithm does not rely on prior knowledge or heuristic rules and performs significantly better than any previously reported method.

  1. Characterization, evolution and chromosomal distribution of two satellite DNA sequence families in Lathyrus species.

    PubMed

    Ceccarelli, M; Sarri, V; Polizzi, E; Andreozzi, G; Cionini, P G

    2010-06-01

    DNA clones containing highly repetitive DNA sequences were selected from partial libraries of Lathyrus sativus and L. sylvestris. Two satellite DNA sequence families were isolated from the genome of the former species. A first family was made up of repeats that varied in length from 54-56 bp, and shared 51.7-94.8% nucleotide sequence similarity. The repeats of the second sequence family were 52-62 bp in length, and shared a 58.5-78.5% nucleotide sequence similarity. All the repeat units contained in a clone from L. sylvestris were 41 bp in length and showed an almost perfect structural conservation (95.1-100% nucleotide sequence similarity). The evolution of the first sequence family from L. sativus and of that isolated from L. sylvestris was studied by dot-blot hybridization to the genomic DNA of these species and 3 other Lathyrus species, L. clymenum, L. latifolius and L. odoratus. The former repeats were found to be species-specific and their redundancy was calculated to be 2.9 x 10(7). The satellite DNA sequence isolated from L. sylvestris was present also in L.latifolius, with a redundancy of 1.4 x 10(7) and 1.1 x 10(7), respectively. Fluorescent in situ hybridization (FISH) was used to investigate the chromosomal distribution of the two sequence families and of 45S and 5S ribosomal genes. The species-specific sequences of L. sativus were located around the centromere of chromosome pair IV, where they occupied a very broad region, and, in a much smaller amount, close to the centromere in the short arm of pair II. Sequences related to the repeat units isolated from L. sylvestris were found, both in this species and L. latifolius, in all of the chromosome pairs at terminal and interstitial regions, where they co-localize with the vast majority of DAPI bands. The pattern of distribution of the satellite DNA sequences investigated, together with that of DAPI bands and ribosomal DNA, allowed each chromosome pair of the 3 complements studied to be identified

  2. Expressed sequence tags from a NaCl-treated Suaeda salsa cDNA library.

    PubMed

    Zhang, L; Ma, X L; Zhang, Q; Ma, C L; Wang, P P; Sun, Y F; Zhao, Y X; Zhang, H

    2001-04-18

    Past efforts to improve plant tolerance to osmotic stress have had limited success owing to the genetic complexity of stress responses. The first step towards cataloging and categorizing genetically complex abotic stress responses is the rapid discovery of genes by the large-scale partial sequencing of randomly selected cDNA clones or expressed sequence tags (ESTs). Suaeda salsa, which can survive seawater-level salinity, is a favorite halophytic model for salt tolerant research. We constructed a NaCl-treated cDNA library of Suaeda salsa and sequenced 1048 randomly selected clones, out of which 1016 clones produced readable sequences (773 showed homology to previously identified genes, 227 matched unknown protein coding regions, 16 anomalous sequences or sequences of bacterial origin were excluded from further analysis). By sequence analysis we identified 492 unique clones: 315 showed homology to previously identified genes, 177 matched unknown protein coding regions (101 of which have been found before in other organisms and 76 are completely novel). All our EST data are available on the Internet. We believe that our dbEST and the associated DNA materials will be a useful source to scientists engaging in stress-tolerance study.

  3. A Promoter Region Mutation Affecting Replication of the Tetrahymena Ribosomal DNA Minichromosome

    PubMed Central

    Gallagher, Renata C.; Blackburn, Elizabeth H.

    1998-01-01

    In the ciliated protozoan Tetrahymena thermophila the ribosomal DNA (rDNA) minichromosome replicates partially under cell cycle control and is also subject to a copy number control mechanism. The relationship between rDNA replication and rRNA gene transcription was investigated by the analysis of replication, transcription, and DNA-protein interactions in a mutant rDNA, the rmm3 rDNA. The rmm3 (for rDNA maturation or maintenance mutant 3) rDNA contains a single-base deletion in the rRNA promoter region, in a phylogenetically conserved sequence element that is repeated in the replication origin region of the rDNA minichromosome. The multicopy rmm3 rDNA minichromosome has a maintenance defect in the presence of a competing rDNA allele in heterozygous cells. No difference in the level of rRNA transcription was found between wild-type and rmm3 strains. However, rmm3 rDNA replicating intermediates exhibited an enhanced pause in the region of the replication origin, roughly 750 bp upstream from the rmm3 mutation. In footprinting of isolated nuclei, the rmm3 rDNA lacked the wild-type dimethyl sulfate (DMS) footprint in the promoter region adjacent to the base change. In addition, a DMS footprint in the origin region was lost in the rmm3 rDNA minichromosome. This is the first reported correlation in this system between an rDNA minichromosome maintenance defect and an altered footprint in the origin region. Our results suggest that a promoter region mutation can affect replication without detectably affecting transcription. We propose a model in which interactions between promoter and origin region complexes facilitate replication and maintenance of the Tetrahymena rDNA minichromosome. PMID:9566921

  4. Intragenomic and interspecific 5S rDNA sequence variation in five Asian pines.

    PubMed

    Liu, Zhan-Lin; Zhang, Daming; Wang, Xiao-Quan; Ma, Xiao-Fei; Wang, Xiao-Ru

    2003-01-01

    Patterns of intragenomic and interspecific variation of 5S rDNA in Pinus (Pinaceae) were studied by cloning and sequencing multiple 5S rDNA repeats from individual trees. Five pines, from both subgenera, Pinus and Strobus, were selected. The 5S rDNA repeat in pines has a conserved 120-base pair (bp) transcribed region and an intergenic spacer region of variable length (382-608 bp). The evolutionary rate in the spacer region is three- to sevenfold higher than in the genic region. We found substantial sequence divergence between the two subgenera. Intragenomic sequence heterogeneity was high for all species, and more than 86% of the clones within each individual were unique. The 5S gene tree revealed that different 5S repeats within individuals are polyphyletic, indicating that their ancestral divergence preceded the speciation events. The degrees of interspecific and intragenomic divergence among diploxylon pines are similar. The observed sequence patterns suggest that concerted evolution has been acting after the diversification of the two subgenera but very weak after the speciation of the four diploxylon pines. Sequence patterns in P. densata are consistent with hybrid origin. It had higher intragenomic diversity and maintained polymorphic copies of the parental types in addition to new and recombinant types unique to the hybrid.

  5. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    NASA Astrophysics Data System (ADS)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

    2014-12-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5'-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 . 10-14 cm2 and 7.06 . 10-14 cm2. The highest cross section was found for 5'-TT(ATA)3TT and 5'-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy.

  6. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    PubMed Central

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

  7. Characterization and organization of DNA sequences adjacent to the human telomere associated repeat (TTAGGG)n.

    PubMed Central

    Weber, B; Collins, C; Robbins, C; Magenis, R E; Delaney, A D; Gray, J W; Hayden, M R

    1990-01-01

    We present a strategy for the cloning of DNA sequences adjacent to the tandemly repeated DNA sequence (TTAGGG)n. Sequence analysis of 14 independently isolated clones revealed the presence of non-repetitive sequences immediately adjacent to or flanked by blocks of the simple repeat (TTAGGG)n. In addition, we provide sequence information on two previously undescribed tandemly repeated sequences, including a 9 bp repeat and a modification of the (TTAGGG)n repeat. Using different mapping approaches six sub-clones, free of the TTAGGG repeat, were assigned to a single human chromosome. Moreover, in situ hybridization mapped one of these subclones, G2 - 1H, definitively to the telomeric band on chromosome 4q. However, Bal 31 insensitivity suggests a location in a more subterminal region. All the (TTAGGG)n-adjacent unique sequences tested are highly conserved among primates but are not present in other mammalian species. Identification and mapping of TTAGGG-adjacent sequences will provide a refined insight into the genomic organization of the (TTAGGG)n repeat. The isolation of chromosome specific TTAGGG-adjacent sequences from subtelomeric regions of all human chromosomes will serve as important end points for the genetic maps and will be useful for the molecular characterization of chromosomal rearrangements involving telomeres. Images PMID:2356126

  8. Investigation of a Sybr-Green-Based Method to Validate DNA Sequences for DNA Computing

    DTIC Science & Technology

    2005-05-01

    stranded DNA . We previously demonstrated that this technique can be exploited to distinguish between stably-hybridized Watson - Crick duplexes and...et al., 2004) we described the difference between the canonical Watson - Crick base pairs of DNA and the usually less stable mismatches that can also...computing, cross-hybridized duplexes represent errors. It is therefore crucial that DNA sequences be designed so that the formation of a Watson - Crick

  9. Mitochondrial DNA sequence evolution in the Arctoidea.

    PubMed Central

    Zhang, Y P; Ryder, O A

    1993-01-01

    Some taxa in the superfamily Arctoidea, such as the giant panda and the lesser panda, have presented puzzles to taxonomists. In the present study, approximately 397 bases of the cytochrome b gene, 364 bases of the 12S rRNA gene, and 74 bases of the tRNA(Thr) and tRNA(Pro) genes from the giant panda, lesser panda, kinkajou, raccoon, coatimundi, and all species of the Ursidae were sequenced. The high transition/transversion ratios in cytochrome b and RNA genes prior to saturation suggest that the presumed transition bias may represent a trend for some mammalian lineages rather than strictly a primate phenomenon. Transversions in the 12S rRNA gene accumulate in arctoids at about half the rate reported for artiodactyls. Different arctoid lineages evolve at different rates: the kinkajou, a procyonid, evolves the fastest, 1.7-1.9 times faster than the slowest lineage that comprises the spectacled and polar bears. Generation-time effect can only partially explain the different rates of nucleotide substitution in arctoids. Our results based on parsimony analysis show that the giant panda is more closely related to bears than to the lesser panda; the lesser panda is neither closely related to bears nor to the New World procyonids. The kinkajou, raccoon, and coatimundi diverged from each other very early, even though they group together. The polar bear is closely related to the spectacled bear, and they began to diverge from a common mitochondrial ancestor approximately 2 million years ago. Relationships of the remaining five bear species are derived. PMID:8415740

  10. Mitochondrial DNA heteroplasmy in the emerging field of massively parallel sequencing

    PubMed Central

    Just, Rebecca S.; Irwin, Jodi A.; Parson, Walther

    2015-01-01

    Long an important and useful tool in forensic genetic investigations, mitochondrial DNA (mtDNA) typing continues to mature. Research in the last few years has demonstrated both that data from the entire molecule will have practical benefits in forensic DNA casework, and that massively parallel sequencing (MPS) methods will make full mitochondrial genome (mtGenome) sequencing of forensic specimens feasible and cost-effective. A spate of recent studies has employed these new technologies to assess intraindividual mtDNA variation. However, in several instances, contamination and other sources of mixed mtDNA data have been erroneously identified as heteroplasmy. Well vetted mtGenome datasets based on both Sanger and MPS sequences have found authentic point heteroplasmy in approximately 25% of individuals when minor component detection thresholds are in the range of 10–20%, along with positional distribution patterns in the coding region that differ from patterns of point heteroplasmy in the well-studied control region. A few recent studies that examined very low-level heteroplasmy are concordant with these observations when the data are examined at a common level of resolution. In this review we provide an overview of considerations related to the use of MPS technologies to detect mtDNA heteroplasmy. In addition, we examine published reports on point heteroplasmy to characterize features of the data that will assist in the evaluation of future mtGenome data developed by any typing method. PMID:26009256

  11. Cloning and sequencing of the PIF gene involved in repair and recombination of yeast mitochondrial DNA.

    PubMed Central

    Foury, F; Lahaye, A

    1987-01-01

    The nuclear gene PIF of Saccharomyces cerevisiae is required for both repair of mitochondrial DNA (mtDNA) and recognition of a recombinogenic signal characterized by a 26-bp palindromic AT sequence in the ery region of mtDNA. This gene has been cloned in yeast by genetic complementation of pif mutants. Its chromosomal disruption does not destroy the genetic function of mitochondria. The nucleotide sequence of the 3.5-kb insert from a complementing plasmid reveals an open reading frame encoding a potential protein of 857 amino acids and Mr = 97,500. An ATP-binding domain is present in the central part of the gene and in the carboxy-terminal region a putative DNA-binding site is present. Its alpha helix-turn-alpha helix motif is found in DNA-binding proteins such as lambda and lactose repressors which recognize symmetric sequences. Significant amino acid homology is observed with yeast RAD3 and E. coli UvrD (helicase II) proteins which are required for excision repair of damaged DNA. Images Fig. 1. Fig. 2. PMID:3038524

  12. Subtelomeric regions of yeast chromosomes contain a 36 base-pair tandemly repeated sequence.

    PubMed Central

    Horowitz, H; Haber, J E

    1984-01-01

    We have determined the nucleotide sequence of a region of DNA derived from the end of one chromosome of the yeast, Saccharomyces cerevisiae. Inspection of the sequence reveals the presence of 12 tandem direct repeats, each 36 nucleotides long and having nearly identical sequence. Each 36 base-pair repeat can be further subdivided into three tandem sub-repeats of a similar 12 base-pair sequence. Analysis of total genomic yeast DNA from several strains by Southern hybridization suggests that the number of tandem 36 base-pair repeat units may vary from approximately 8 to 25 among different telomeric regions. Differences in the number of repeats may have arisen by unequal crossing over between them. Furthermore, the finding that the pattern of bases at multiple variable positions within the repeat unit is not random suggests that these regions may undergo gene conversion events that render them homogeneous. Images PMID:6091055

  13. Relationships in subtribe Diocleinae (Leguminosae; Papilionoideae) inferred from internal transcribed spacer sequences from nuclear ribosomal DNA.

    PubMed

    Varela, Eduardo S; Lima, João P M S; Galdino, Alexsandro S; Pinto, Luciano da S; Bezerra, Walderly M; Nunes, Edson P; Alves, Maria A O; Grangeiro, Thalles B

    2004-01-01

    The complete sequences of nuclear ribosomal DNA (nrDNA) internal transcribed spacer regions (ITS/5.8S) were determined for species belonging to six genera from the subtribe Diocleinae as well as for the anomalous genera Calopogonium and Pachyrhizus. Phylogenetic trees constructed by distance matrix, maximum parsimony and maximum likelihood methods showed that Calopogonium and Pachyrhizus were outside the clade Diocleinae (Canavalia, Camptosema, Cratylia, Dioclea, Cymbosema, and Galactia). This finding supports previous morphological, phytochemical, and molecular evidence that Calopogonium and Pachyrhizus do not belong to the subtribe Diocleinae. Within the true Diocleinae clade, the clustering of genera and species were congruent with morphology-based classifications, suggesting that ITS/5.8S sequences can provide enough informative sites to allow resolution below the genus level. This is the first evidence of the phylogeny of subtribe Diocleinae based on nuclear DNA sequences.

  14. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis.

    PubMed

    Shaw, Joey; Lickey, Edgar B; Beck, John T; Farmer, Susan B; Liu, Wusheng; Miller, Jermey; Siripun, Kunsiri C; Winder, Charles T; Schilling, Edward E; Small, Randall L

    2005-01-01

    Chloroplast DNA sequences are a primary source of data for plant molecular systematic studies. A few key papers have provided the molecular systematics community with universal primer pairs for noncoding regions that have dominated the field, namely trnL-trnF and trnK/matK. These two regions have provided adequate information to resolve species relationships in some taxa, but often provide little resolution at low taxonomic levels. To obtain better phylogenetic resolution, sequence data from these regions are often coupled with other sequence data. Choosing an appropriate cpDNA region for phylogenetic investigation is difficult because of the scarcity of information about the tempo of evolutionary rates among different noncoding cpDNA regions. The focus of this investigation was to determine whether there is any predictable rate heterogeneity among 21 noncoding cpDNA regions identified as phylogenetically useful at low levels. To test for rate heterogeneity among the different cpDNA regions, we used three species from each of 10 groups representing eight major phylogenetic lineages of phanerogams. The results of this study clearly show that a survey using as few as three representative taxa can be predictive of the amount of phylogenetic information offered by a cpDNA region and that rate heterogeneity exists among noncoding cpDNA regions.

  15. Effect of Noise on DNA Sequencing via Transverse Electronic Transport

    PubMed Central

    Krems, Matt; Zwolak, Michael; Pershin, Yuriy V.; Di Ventra, Massimiliano

    2009-01-01

    Abstract Previous theoretical studies have shown that measuring the transverse current across DNA strands while they translocate through a nanopore or channel may provide a statistically distinguishable signature of the DNA bases, and may thus allow for rapid DNA sequencing. However, fluctuations of the environment, such as ionic and DNA motion, introduce important scattering processes that may affect the viability of this approach to sequencing. To understand this issue, we have analyzed a simple model that captures the role of this complex environment in electronic dephasing and its ability to remove charge carriers from current-carrying states. We find that these effects do not strongly influence the current distributions due to the off-resonant nature of tunneling through the nucleotides—a result we expect to be a common feature of transport in molecular junctions. In particular, only large scattering strengths, as compared to the energetic gap between the molecular states and the Fermi level, significantly alter the form of the current distributions. Since this gap itself is quite large, the current distributions remain protected from this type of noise, further supporting the possibility of using transverse electronic transport measurements for DNA sequencing. PMID:19804730

  16. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

    PubMed

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-22

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  17. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation

    NASA Astrophysics Data System (ADS)

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-01

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  18. Light-generated oligonucleotide arrays for rapid DNA sequence analysis.

    PubMed Central

    Pease, A C; Solas, D; Sullivan, E J; Cronin, M T; Holmes, C P; Fodor, S P

    1994-01-01

    In many areas of molecular biology there is a need to rapidly extract and analyze genetic information; however, current technologies for DNA sequence analysis are slow and labor intensive. We report here how modern photolithographic techniques can be used to facilitate sequence analysis by generating miniaturized arrays of densely packed oligonucleotide probes. These probe arrays, or DNA chips, can then be applied to parallel DNA hybridization analysis, directly yielding sequence information. In a preliminary experiment, a 1.28 x 1.28 cm array of 256 different octanucleotides was produced in 16 chemical reaction cycles, requiring 4 hr to complete. The hybridization pattern of fluorescently labeled oligonucleotide targets was then detected by epifluorescence microscopy. The fluorescence signals from complementary probes were 5-35 times stronger than those with single or double base-pair hybridization mismatches, demonstrating specificity in the identification of complementary sequences. This method should prove to be a powerful tool for rapid investigations in human genetics and diagnostics, pathogen detection, and DNA molecular recognition. Images PMID:8197176

  19. Decoding long nanopore sequencing reads of natural DNA.

    PubMed

    Laszlo, Andrew H; Derrington, Ian M; Ross, Brian C; Brinkerhoff, Henry; Adey, Andrew; Nova, Ian C; Craig, Jonathan M; Langford, Kyle W; Samson, Jenny Mae; Daza, Riza; Doering, Kenji; Shendure, Jay; Gundlach, Jens H

    2014-08-01

    Nanopore sequencing of DNA is a single-molecule technique that may achieve long reads, low cost and high speed with minimal sample preparation and instrumentation. Here, we build on recent progress with respect to nanopore resolution and DNA control to interpret the procession of ion current levels observed during the translocation of DNA through the pore MspA. As approximately four nucleotides affect the ion current of each level, we measured the ion current corresponding to all 256 four-nucleotide combinations (quadromers). This quadromer map is highly predictive of ion current levels of previously unmeasured sequences derived from the bacteriophage phi X 174 genome. Furthermore, we show nanopore sequencing reads of phi X 174 up to 4,500 bases in length, which can be unambiguously aligned to the phi X 174 reference genome, and demonstrate proof-of-concept utility with respect to hybrid genome assembly and polymorphism detection. This work provides a foundation for nanopore sequencing of long, natural DNA strands.

  20. Derivatized versions of ligase enzymes for constructing DNA sequences

    DOEpatents

    Mariella, Jr., Raymond P.; Christian, Allen T.; Tucker, James D.; Dzenitis, John M.; Papavasiliou, Alexandros P.

    2006-08-15

    A method of making very long, double-stranded synthetic poly-nucleotides. A multiplicity of short oligonucleotides is provided. The short oligonucleotides are sequentially hybridized to each other. Enzymatic ligation of the oligonucleotides provides a contiguous piece of PCR-ready DNA of predetermined sequence.

  1. Exome sequencing from nanogram amounts of starting DNA: comparing three approaches.

    PubMed

    Rykalina, Vera N; Shadrin, Alexey A; Amstislavskiy, Vyacheslav S; Rogaev, Evgeny I; Lehrach, Hans; Borodina, Tatiana A

    2014-01-01

    Hybridization-based target enrichment protocols require relatively large starting amounts of genomic DNA, which is not always available. Here, we tested three approaches to pre-capture library preparation starting from 10 ng of genomic DNA: (i and ii) whole-genome amplification of DNA samples with REPLI-g (Qiagen) and GenomePlex (Sigma) kits followed by standard library preparation, and (iii) library construction with a low input oriented ThruPLEX kit (Rubicon Genomics). Exome capture with Agilent SureSelectXT2 Human AllExon v4+UTRs capture probes, and HiSeq2000 sequencing were performed for test libraries along with the control library prepared from 1 µg of starting DNA. Tested protocols were characterized in terms of mapping efficiency, enrichment ratio, coverage of the target region, and reliability of SNP genotyping. REPLI-g- and ThruPLEX-FD-based protocols seem to be adequate solutions for exome sequencing of low input samples.

  2. Complete mitochondrial DNA sequence analysis of Bison bison and bison-cattle hybrids: function and phylogeny.

    PubMed

    Douglas, Kory C; Halbert, Natalie D; Kolenda, Claire; Childers, Christopher; Hunter, David L; Derr, James N

    2011-01-01

    Complete mitochondrial DNA (mtDNA) genomes from 43 bison and bison-cattle hybrids were sequenced and compared with other bovids. Selected animals reflect the historical range and current taxonomic structure of bison. This study identified regions of potential nuclear-mitochondrial incompatibilities in hybrids, provided a complete mtDNA phylogenetic tree for this species, and uncovered evidence of bison population substructure. Seventeen bison haplotypes defined by 66 polymorphic sites were discovered, whereas 728 fixed differences and 86 non-synonymous mutations were identified between bison and bison-cattle hybrid sequences. The potential roles of the mtDNA genome in the function of hybrid animals and bison taxonomy are discussed.

  3. Periodic power spectrum with applications in detection of latent periodicities in DNA sequences.

    PubMed

    Yin, Changchuan; Wang, Jiasong

    2016-11-01

    Periodic elements play important roles in genomic structures and functions, yet some complex periodic elements in genomes are difficult to detect by conventional methods such as digital signal processing and statistical analysis. We propose a periodic power spectrum (PPS) method for analyzing periodicities of DNA sequences. The PPS method employs periodic nucleotide distributions of DNA sequences and directly calculates power spectra at specific periodicities. The magnitude of a PPS reflects the strength of a signal on periodic positions. In comparison with Fourier transform, the PPS method avoids spectral leakage, and reduces background noise that appears high in Fourier power spectrum. Thus, the PPS method can effectively capture hidden periodicities in DNA sequences. Using a sliding window approach, the PPS method can precisely locate periodic regions in DNA sequences. We apply the PPS method for detection of hidden periodicities in different genome elements, including exons, microsatellite DNA sequences, and whole genomes. The results show that the PPS method can minimize the impact of spectral leakage and thus capture true hidden periodicities in genomes. In addition, performance tests indicate that the PPS method is more effective and efficient than a fast Fourier transform. The computational complexity of the PPS algorithm is [Formula: see text]. Therefore, the PPS method may have a broad range of applications in genomic analysis. The MATLAB programs for implementing the PPS method are available from MATLAB Central ( http://www.mathworks.com/matlabcentral/fileexchange/55298 ).

  4. Molecular cloning and nucleotide sequencing of human immunoglobulin epsilon chain cDNA.

    PubMed Central

    Seno, M; Kurokawa, T; Ono, Y; Onda, H; Sasada, R; Igarashi, K; Kikuchi, M; Sugino, Y; Nishida, Y; Honjo, T

    1983-01-01

    DNA complementary to mRNA of human immunoglobulin E heavy chain (epsilon chain) isolated and purified from U266 cells has been synthesized and inserted into the PstI site of pBR322 by G-C tailing. This recombinant plasmid was used to transform E. coli chi 1776 to screen 1445 tetracycline resistant colonies. Nine clones (pGETI - 9) containing cDNA coding for the human epsilon chain were recognized by colony hybridization and Southern blotting analysis with a nick-translated human IgE genome fragment. The nucleotide sequence of the longest cDNA contained in pGET2 was determined. The results indicate that the sequence of 1657 nucleotides codes for 494 amino acids covering a part of the variable region and all of the constant region of the human epsilon chain. Most of the amino acid sequence deduced from the nucleotide sequence is in substantial agreement with that reported. Furthermore a termination codon after the -COOH terminal amino acid marks the beginning of a 3' untranslated region of 125 nucleotides with a poly A tail. Taking this into account, the structure of the human epsilon chain mRNA, except a part of the 5' end, is conserved fairly well in the cDNA insert in pGET2. Images PMID:6300763

  5. Population subdivision in Europe's great bustard inferred from mitochondrial and nuclear DNA sequence variation.

    PubMed

    Pitra, C; Lieckfeldt, D; Alonso, J C

    2000-08-01

    A continent-wide survey of sequence variation in mitochondrial (mt) and nuclear (n) DNA of the endangered great bustard (Otis tarda) was conducted to assess the extent of phylogeographic structure in a morphologically monotypic bird. DNA sequence variation in a combined 809 bp segment of the mtDNA genome from 66 individuals from the last six breeding regions showed relatively low levels of intraspecific sequence diversity (n = 0.32%) but significant differences in the regional distribution of 11 haplotypes (phiST = 0.49). Despite their exceptional potential for dispersal, a complete and long-term historical separation between the populations from the Iberian Peninsula (Spain) and mainland Europe (Hungary, Slovakia, Germany, and Russia) was demonstrated. Divergence between populations based on a 3-bp insertion-deletion polymorphism within the intron region of the nuclear CHD-Z gene was geographically concordant with the primary subdivision identified within the mtDNA sequences. Inferred aspects of phylogeography were used to formulate conservation recommendations for this endangered species.

  6. Probing the linearity and nonlinearity in DNA sequences

    NASA Astrophysics Data System (ADS)

    Tsonis, Anastasios A.; Heller, Fred L.; Tsonis, Panagiotis A.

    2002-09-01

    In this paper, we apply the principles of information theory that relate to the definition of nonlinear predictability, which is a measure that describes both the linear and nonlinear components of a system. By comparing this measure to a measure of linear predictability, one can assess whether a given system has a strong linear or a strong nonlinear component. This provides insights as to whether the system should be modeled by a nonlinear or a linear model. We apply these ideas to DNA sequences. Our results, which extend previous results on this issue indicate that all DNA sequences (coding and noncoding) exhibit strong nonlinear structure. At the same time the results provide insights to understand DNA structure and possible clues about evolutionary mechanisms.

  7. Electronic density of states in sequence dependent DNA molecules

    NASA Astrophysics Data System (ADS)

    de Oliveira, B. P. W.; Albuquerque, E. L.; Vasconcelos, M. S.

    2006-09-01

    We report in this work a numerical study of the electronic density of states (DOS) in π-stacked arrays of DNA single-strand segments made up from the nucleotides guanine G, adenine A, cytosine C and thymine T, forming a Rudin-Shapiro (RS) as well as a Fibonacci (FB) polyGC quasiperiodic sequences. Both structures are constructed starting from a G nucleotide as seed and following their respective inflation rules. Our theoretical method uses Dyson's equation together with a transfer-matrix treatment, within an electronic tight-binding Hamiltonian model, suitable to describe the DNA segments modelled by the quasiperiodic chains. We compared the DOS spectra found for the quasiperiodic structure to those using a sequence of natural DNA, as part of the human chromosome Ch22, with a remarkable concordance, as far as the RS structure is concerned. The electronic spectrum shows several peaks, corresponding to localized states, as well as a striking self-similar aspect.

  8. Sequence heterogeneity accelerates protein search for targets on DNA

    NASA Astrophysics Data System (ADS)

    Shvets, Alexey A.; Kolomeisky, Anatoly B.

    2015-12-01

    The process of protein search for specific binding sites on DNA is fundamentally important since it marks the beginning of all major biological processes. We present a theoretical investigation that probes the role of DNA sequence symmetry, heterogeneity, and chemical composition in the protein search dynamics. Using a discrete-state stochastic approach with a first-passage events analysis, which takes into account the most relevant physical-chemical processes, a full analytical description of the search dynamics is obtained. It is found that, contrary to existing views, the protein search is generally faster on DNA with more heterogeneous sequences. In addition, the search dynamics might be affected by the chemical composition near the target site. The physical origins of these phenomena are discussed. Our results suggest that biological processes might be effectively regulated by modifying chemical composition, symmetry, and heterogeneity of a genome.

  9. Sequence heterogeneity accelerates protein search for targets on DNA

    SciTech Connect

    Shvets, Alexey A.; Kolomeisky, Anatoly B.

    2015-12-28

    The process of protein search for specific binding sites on DNA is fundamentally important since it marks the beginning of all major biological processes. We present a theoretical investigation that probes the role of DNA sequence symmetry, heterogeneity, and chemical composition in the protein search dynamics. Using a discrete-state stochastic approach with a first-passage events analysis, which takes into account the most relevant physical-chemical processes, a full analytical description of the search dynamics is obtained. It is found that, contrary to existing views, the protein search is generally faster on DNA with more heterogeneous sequences. In addition, the search dynamics might be affected by the chemical composition near the target site. The physical origins of these phenomena are discussed. Our results suggest that biological processes might be effectively regulated by modifying chemical composition, symmetry, and heterogeneity of a genome.

  10. The DNA sequence and biology of human chromosome 19

    SciTech Connect

    Grimwood, J; Gordon, L A; Olsen, A; Terry, A; Schmutz, J; Lamerdin, J; Hellsten, U; Goodstein, D; Couronne, O; Tran-Gyamfi, M

    2004-04-06

    Chromosome 19 has the highest gene density of all human chromosomes, more than double the genome-wide average. The large clustered gene families, corresponding high GC content, CpG islands and density of repetitive DNA indicate a chromosome rich in biological and evolutionary significance. Here we describe 55.8 million base pairs of highly accurate finished sequence representing 99.9% of the euchromatin portion of the chromosome. Manual curation of gene loci reveals 1,461 protein-coding genes and 321 pseudogenes. Among these are genes directly implicated in Mendelian disorders, including familial hypercholesterolemia and insulin-resistant diabetes. Nearly one quarter of these genes belong to tandemly arranged families, encompassing more than 25% of the chromosome. Comparative analyses show a fascinating picture of conservation and divergence, revealing large blocks of gene orthology with rodents, scattered regions with more recent gene family expansions and deletions, and segments of coding and non-coding conservation with the distant fish species Takifugu.

  11. The DNA sequence and biology of human chromosome 19

    SciTech Connect

    Grimwood, Jane; Gordon, Laurie A.; Olsen, Anne; Terry, Astrid; Schmutz, Jeremy; Lamerdin, Jane; Hellsten, Uffe; Goodstein, David; Couronne, Olivier; Tran-Gyamfi, Mary; Aerts, Andrea; Altherr, Michael; Ashworth, Linda; Bajorek, Eva; Black, Stacey; Branscomb, Elbert; Caenepeel, Sean; Carrano, Anthony; Caoile, Chenier; Chan, Yee Man; Christensen, Mari; Cleland, Catherine A.; Copeland, Alex; Dalin, Eileen; Dehal, Paramvir; Denys, Mirian; Detter, John C.; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Garcia, Carmen; Georgescu, Anca M.; Glavina, Tijana; Gomez, Maria; Gonzales, Eldelyn; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Ho, Issac; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Larionov, Vladimer; Leem, Sun-Hee; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Malfatti, Stephanie; Martinez, Diego; McCready, Paula; Medina, Catherine; Morgan, Jenna; Nelson, Kathryn; Nolan, Matt; Ovcharenko, Ivan; Pitluck, Sam; Pollard, Martin; Popkie, Anthony P.; Predki, Paul; Quan, Glenda; Ramirez, Lucia; Rash, Sam; Retterer, James; Rodriguez, Alex; Rogers, Stephanine; Salamov, Asaf; Salazar, Angelica; She, Xinwei; Smith, Doug; Slezak, Tom; Solovyev, Victor; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wagner, Mark; Wheeler, Jeremy; Wu, Kevin; Xie, Gary; Yang, Joan; Dubchak, Inna; Furey, Terrence S.; DeJong, Pieter; Dickson, Mark; Gordon, David; Eichler, Evan E.; Pennacchio, Len A.; Richardson, Paul; Stubbs, Lisa; Rokhsar, Daniel S.; Myers, Richard M.; Rubin, Edward M.; Lucas, Susan M.

    2003-09-15

    Chromosome 19 has the highest gene density of all human chromosomes, more than double the genome-wide average. The large clustered gene families, corresponding high G1C content, CpG islands and density of repetitive DNA indicate a chromosome rich in biological and evolutionary significance. Here we describe 55.8 million base pairs of highly accurate finished sequence representing 99.9 percent of the euchromatin portion of the chromosome. Manual curation of gene loci reveals 1,461 protein-coding genes and 321 pseudogenes. Among these are genes directly implicated in mendelian disorders, including familial hypercholesterolaemia and insulin-resistant diabetes. Nearly one-quarter of these genes belong to tandemly arranged families, encompassing more than 25 percent of the chromosome. Comparative analyses show a fascinating picture of conservation and divergence, revealing large blocks of gene orthology with rodents, scattered regions with more recent gene family expansions and deletions, a nd segments of coding and non-coding conservation with the distant fish species Takifugu.

  12. Cloning and sequencing of human intestinal alkaline phosphatase cDNA

    SciTech Connect

    Berger, J.; Garattini, E.; Hua, J.C.; Udenfriend, S.

    1987-02-01

    Partial protein sequence data obtained on intestinal alkaline phosphatase indicated a high degree of homology with the reported sequence of the placental isoenzyme. Accordingly, placental alkaline phosphatase cDNA was cloned and used as a probe to clone intestinal alkaline phosphatase cDNA. The latter is somewhat larger (3.1 kilobases) than the cDNA for the placental isozyme (2.8 kilobases). Although the 3' untranslated regions are quite different, there is almost 90% homology in the translated regions of the two isozymes. There are, however, significant differences at their amino and carboxyl termini and a substitution of an alanine in intestinal alkaline phosphatase for a glycine in the active site of the placental isozyme.

  13. Timing of human protein evolution as revealed by massively parallel capture of Neandertal nuclear DNA sequences

    PubMed Central

    Burbano, Hernán A.; Hodges, Emily; Green, Richard E.; Briggs, Adrian W.; Krause, Johannes; Meyer, Matthias; Good, Jeffrey M.; Maricic, Tomislav; Johnson, Philipp L.F.; Xuan, Zhenyu; Rooks, Michelle; Bhattacharjee, Arindam; Brizuela, Leonardo; Albert, Frank W.; de la Rasilla, Marco; Fortea, Javier; Rosas, Antonio; Lachmann, Michael; Hannon, Gregory J.; Pääbo, Svante

    2010-01-01

    Whole genome shotgun sequencing is now possible for extinct organisms, as well as the targeted capture of specific regions. However, targeted resequencing of megabase sized parts of nuclear genomes has yet to be demonstrated for ancient DNA. Here we show that hybridization capture on microarrays can be used to generate large scale targeted data from Neandertal DNA even in the presence of ~99.8% microbial DNA. It is thus now possible to generate high quality data from large regions of the nuclear genome from Neandertals and other extinct organisms. Using this approach we have sequenced ~14,000 protein coding positions that have been inferred to have changed on the human lineage since the last common ancestor shared with chimpanzees. We identify 88 amino acid substitutions that have become fixed in all humans since the divergence from the Neandertals. PMID:20448179

  14. A blind testing design for authenticating ancient DNA sequences.

    PubMed

    Yang, H; Golenberg, E M; Shoshani, J

    1997-04-01

    Reproducibility is a serious concern among researchers of ancient DNA. We designed a blind testing procedure to evaluate laboratory accuracy and authenticity of ancient DNA obtained from closely related extant and extinct species. Soft tissue and bones of fossil and contemporary museum proboscideans were collected and identified based on morphology by one researcher, and other researchers carried out DNA testing on the samples, which were assigned anonymous numbers. DNA extracted using three principal isolation methods served as template in PCR amplifications of a segment of the cytochrome b gene (mitochondrial genome), and the PCR product was directly sequenced and analyzed. The results show that such a blind testing design performed in one laboratory, when coupled with phylogenetic analysis, can nonarbitrarily test the consistency and reliability of ancient DNA results. Such reproducible results obtained from the blind testing can increase confidence in the authenticity of ancient sequences obtained from postmortem specimens and avoid bias in phylogenetic analysis. A blind testing design may be applicable as an alternative to confirm ancient DNA results in one laboratory when independent testing by two laboratories is not available.

  15. Reiterated DNA sequences in Rhizobium and Agrobacterium spp.

    PubMed Central

    Flores, M; González, V; Brom, S; Martínez, E; Piñero, D; Romero, D; Dávila, G; Palacios, R

    1987-01-01

    Repeated DNA sequences are a general characteristic of eucaryotic genomes. Although several examples of DNA reiteration have been found in procaryotic organisms, only in the case of the archaebacteria Halobacterium halobium and Halobacterium volcanii [C. Sapienza and W. F. Doolittle, Nature (London) 295:384-389, 1982], has DNA reiteration been reported as a common genomic feature. The genomes of two Rhizobium phaseoli strains, one Rhizobium meliloti strain, and one Agrobacterium tumefaciens strain were analyzed for the presence of repetitive DNA. Rhizobium and Agrobacterium spp. are closely related soil bacteria that interact with plants and that belong to the taxonomical family Rhizobiaceae. Rhizobium species establish a nitrogen-fixing symbiosis in the roots of legumes, whereas Agrobacterium species is a pathogen in different plants. The four strains revealed a large number of repeated DNA sequences. The family size was usually small, from 2 to 5 elements, but some presented more than 10 elements. Rhizobium and Agrobacterium spp. contain large plasmids in addition to the chromosomes. Analysis of the two Rhizobium strains indicated that DNA reiteration is not confined to the chromosome or to some plasmids but is a property of the whole genome. Images PMID:3450286

  16. Ultra-Deep Sequencing of Mouse Mitochondrial DNA: Mutational Patterns and Their Origins

    PubMed Central

    Freyer, Christoph; Hagström, Erik; Ingman, Max; Larsson, Nils-Göran; Gyllensten, Ulf

    2011-01-01

    Somatic mutations of mtDNA are implicated in the aging process, but there is no universally accepted method for their accurate quantification. We have used ultra-deep sequencing to study genome-wide mtDNA mutation load in the liver of normally- and prematurely-aging mice. Mice that are homozygous for an allele expressing a proof-reading–deficient mtDNA polymerase (mtDNA mutator mice) have 10-times-higher point mutation loads than their wildtype siblings. In addition, the mtDNA mutator mice have increased levels of a truncated linear mtDNA molecule, resulting in decreased sequence coverage in the deleted region. In contrast, circular mtDNA molecules with large deletions occur at extremely low frequencies in mtDNA mutator mice and can therefore not drive the premature aging phenotype. Sequence analysis shows that the main proportion of the mutation load in heterozygous mtDNA mutator mice and their wildtype siblings is inherited from their heterozygous mothers consistent with germline transmission. We found no increase in levels of point mutations or deletions in wildtype C57Bl/6N mice with increasing age, thus questioning the causative role of these changes in aging. In addition, there was no increased frequency of transversion mutations with time in any of the studied genotypes, arguing against oxidative damage as a major cause of mtDNA mutations. Our results from studies of mice thus indicate that most somatic mtDNA mutations occur as replication errors during development and do not result from damage accumulation in adult life. PMID:21455489

  17. Applying machine learning techniques to DNA sequence analysis

    SciTech Connect

    Shavlik, J.W.

    1992-01-01

    We are developing a machine learning system that modifies existing knowledge about specific types of biological sequences. It does this by considering sample members and nonmembers of the sequence motif being learned. Using this information (which we call a domain theory''), our learning algorithm produces a more accurate representation of the knowledge needed to categorize future sequences. Specifically, the KBANN algorithm maps inference rules, such as consensus sequences, into a neural (connectionist) network. Neural network training techniques then use the training examples of refine these inference rules. We have been applying this approach to several problems in DNA sequence analysis and have also been extending the capabilities of our learning system along several dimensions.

  18. Applying machine learning techniques to DNA sequence analysis

    SciTech Connect

    Shavlik, J.W. . Dept. of Computer Sciences); Noordewier, M.O. . Dept. of Computer Science)

    1992-01-01

    We are primarily developing a machine teaming (ML) system that modifies existing knowledge about specific types of biological sequences. It does this by considering sample members and nonmembers of the sequence motif being teamed. Using this information, our teaming algorithm produces a more accurate representation of the knowledge needed to categorize future sequences. Specifically, our KBANN algorithm maps inference rules about a given recognition task into a neural network. Neural network training techniques then use the training examples to refine these inference rules. We call these rules a domain theory, following the convention in the machine teaming community. We have been applying this approach to several problems in DNA sequence analysis. In addition, we have been extending the capabilities of our teaming system along several dimensions. We have also been investigating parallel algorithms that perform sequence alignments in the presence of frameshift errors.

  19. Cloning, sequencing and analysis of dnaK -dnaJ gene cluster of Bacillus megaterium.

    PubMed

    Bao, Fangming; Gong, Lei; Shao, Weilan

    2008-12-01

    The DNA fragment of heat shock genes (hrcA-grpE-dnaK-dnaJ) containing complete hrcA-grpE-dnaK operon and the transcription unit of dnaJ was cloned, sequensed and analyzed from Bacillus megaterium RF5. The sequence of hrcA, grpE and dnaJ were first time reported, and their coding products exibit 60%, 63% and 81% of identities to the homologs of B. subtilis. A sigmaA-type promoter of Gram-positive bacteria (PA1) and a terminator were located upstream of the hrcA and downstream of dnaK, and a Controlling inverted repeat of chaperone expression element (CIRCE) was identified between PA1 and hrcA. Another sigmaA-type promoter (PA2) and a terminator were found upstream and downstream of dnaJ, indicating B. megaterium has a transcription unit containing a single gene dnaJ. The structure of dnaJ transcription unit is more similar to that of Listeria monocytogenes than other species of Bacillus. A partial protein-based phylogenetic tree, derived from Gram-positive bacteria using HrcA sequence, indicated a closer phylogenetic relationship between B. megaterium and Geobacillus species than other two Bacillus species.

  20. A two-locus DNA sequence database for identifying host-specific pathogens and phylogenetic diversity within the Fusarium oxysporum species complex

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An electronically portable two-locus DNA sequence database, comprising partial sequences of the translation elongation factor gene (EF-1a, 634 bp alignment) and nearly complete sequences of the nuclear ribosomal intergenic spacer region (IGS rDNA, 2220 bp alignment) for 850 isolates spanning the phy...

  1. Exploring the reasons for the large density of triplex-forming oligonucleotide target sequences in the human regulatory regions

    PubMed Central

    Goñi, Josep Ramon; Vaquerizas, Juan Manuel; Dopazo, Joaquin; Orozco, Modesto

    2006-01-01

    Background DNA duplex sequences that can be targets for triplex formation are highly over-represented in the human genome, especially in regulatory regions. Results Here we studied using bioinformatics tools several properties of triplex target sequences in an attempt to determine those that make these sequences so special in the genome. Conclusion Our results strongly suggest that the unique physical properties of these sequences make them particularly suitable as "separators" between protein-recognition sites in the promoter region. PMID:16566817

  2. DNA sequence analysis using hierarchical ART-based classification networks

    SciTech Connect

    LeBlanc, C.; Hruska, S.I.; Katholi, C.R.; Unnasch, T.R.

    1994-12-31

    Adaptive resonance theory (ART) describes a class of artificial neural network architectures that act as classification tools which self-organize, work in real-time, and require no retraining to classify novel sequences. We have adapted ART networks to provide support to scientists attempting to categorize tandem repeat DNA fragments from Onchocerca volvulus. In this approach, sequences of DNA fragments are presented to multiple ART-based networks which are linked together into two (or more) tiers; the first provides coarse sequence classification while the sub- sequent tiers refine the classifications as needed. The overall rating of the resulting classification of fragments is measured using statistical techniques based on those introduced to validate results from traditional phylogenetic analysis. Tests of the Hierarchical ART-based Classification Network, or HABclass network, indicate its value as a fast, easy-to-use classification tool which adapts to new data without retraining on previously classified data.

  3. Methyl-binding DNA capture Sequencing for Patient Tissues

    PubMed Central

    Jadhav, Rohit R.; Wang, Yao V.; Hsu, Ya-Ting; Liu, Joseph; Garcia, Dawn; Lai, Zhao; Huang, Tim H. M.; Jin, Victor X.

    2016-01-01

    Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System). PMID:27842364

  4. Spectral sum rules and search for periodicities in DNA sequences

    NASA Astrophysics Data System (ADS)

    Chechetkin, V. R.

    2011-04-01

    Periodic patterns play the important regulatory and structural roles in genomic DNA sequences. Commonly, the underlying periodicities should be understood in a broad statistical sense, since the corresponding periodic patterns have been strongly distorted by the random point mutations and insertions/deletions during molecular evolution. The latent periodicities in DNA sequences can be efficiently displayed by Fourier transform. The criteria of significance for observed periodicities are obtained via the comparison versus the counterpart characteristics of the reference random sequences. We show that the restrictions imposed on the significance criteria by the rigorous spectral sum rules can be rationally described with De Finetti distribution. This distribution provides the convenient intermediate asymptotic form between Rayleigh distribution and exact combinatoric theory.

  5. Genome-wide profiling of DNA methylation reveals preferred sequences of DNMTs in hepatocellular carcinoma cells.

    PubMed

    Fan, Hong; Zhao, Zhujiang; Cheng, Yuchao; Cui, He; Qiao, Fengchang; Wang, Ling; Hu, Jiaojiao; Wu, Huzhang; Song, Wei

    2016-01-01

    Aberrant DNA methylation of CpG site is among the earliest and most frequent alterations in developmental process and diseases including cancer. To elucidate the functional preferred site of DNMTs, we analyzed the feature of distinct methylated sequences and established the defined relationship between DNMTs and preference genomic DNA sequences. Small interfering RNA (siRNA) construct of DNTM1, DNMT3A, and DNMT3B was transfected into the human hepatocellular carcinoma cell line SMMC-7721, respectively. Distinguishing methylated fragments pool was enriched by SHH method in cells which is knocked down DNMT1, DNMT3A, DNMT3B, separately. The defined binding transcription factors (TFs) containing of 5'CpG islands were obtained with bioinformatics software and website. In SMMC-7721 hepatocellular carcinoma (HCC) cell line, DNMT1, DNMT3A, and DNMT3B were specific suppressed by their corresponding siRNA construct, separately. A 46, 42, 67 distinctive methylated fragments from three different DNMTs were evaluated according to genomic DNA database. Those separated fragments were distributed among genomic DNA regions of all chromosome complements, including coding genes, repeat sequences, and genes with unknown function. The majority of coding genes contain CpG islands in their promoter region. Cluster analysis demonstrated all of preference sequences identified by three DNMTs shares their own conserved sequences. In depleting of different DNMTs cells, 80 % of 103 upregulation genes induced by DNMT1 knock-down contain CpG sites; 76 % of 25 upregulation genes induced by DNMT3A knock-down contain CpG sites; 63 % of 126 upregulation genes induced by DNMT3B knock-down contain CpG sites. Our findings suggested that distinctive DNMTs targeted DNA methylation site to their preference sequences, and this targeting might be associated with diverse roles of DNMTs in tumorigenesis. Meanwhile, the analysis of preference sequences provides an alternative way to find out the individual

  6. Detection of DNA sequence polymorphisms in human genomic DNA by using denaturing gradient gel blots

    SciTech Connect

    Gray, M.R. )

    1992-02-01

    Denaturing gradient gel electrophoresis can detect sequence differences outside restriction-enzyme recognition sites. DNA sequence polymorphisms can be detected as restriction-fragment melting polymorphisms (RFMPs) in genomic DNA by using blots made from denaturing gradient gels. In contrast to the use of Southern blots to find sequence differences, denaturing gradient gel blots can detect differences almost anywhere, not just at 4-6-bp restriction-enzyme recognition sites. Human genomic DNA was digested with one of several randomly selected 4-bp recognition-site restriction enzymes, electrophoresed in denaturing gradient gels, and transferred to nylon membranes. The blots were hydridized with radioactive probes prepared from the factor VIII, type II collagen, insulin receptor, [beta][sub 2]-adrenergic receptor, and 21-hydroxylase genes; in unrelated individuals, several RFM's were found in fragments from every locus tested. No restriction map or sequence information was used to detect RFMP's.

  7. Chloroplast DNA Sequence Homologies among Vascular Plants 1

    PubMed Central

    Lamppa, Gayle K.; Bendich, Arnold J.

    1979-01-01

    The extent of sequence conservation in the chloroplast genome of higher plants has been investigated. Supercoiled chloroplast DNA, prepared from pea seedlings, was labeled in vitro and used as a probe in reassociation experiments with a high concentration of total DNAs extracted from several angiosperms, gymnosperms, and lower vascular plants. In each case the probe reassociation was accelerated, demonstrating that some chloroplast sequences have been highly conserved throughout the evolution of vascular plants. Only among the flowering plants were distinct levels of cross-reaction with the pea chloroplast probe evident; broad bean and barley exhibited the highest and lowest levels, respectively. With the hydroxylapatite assay these levels decreased with a decrease in probe fragment length (from 1,860 to 735 bases), indicating that many conserved sequences in the chloroplast genome are separated by divergent sequences on a rather fine scale. Despite differences observed in levels of homology with the hydroxylapatite assay, S1 nuclease analysis of heteroduplexes showed that outside of the pea family the extent of sequence relatedness between the probe and various heterologous DNAs is approximately the same: 30%. In our interpretation, the fundamental changes in the chloroplast genome during angiosperm evolution involved the rearrangement of this 30% with respect to the more rapidly changing sequences of the genome. These rearrangements may have been more extensive in dicotyledons than in monocotyledons. We have estimated the amount of conserved and divergent DNA interspersed between one another. From the reassociation experiments, determinations were made of the percentage of chloroplast DNA in total DNA extracts from different higher plants; this value remained relatively constant when compared with the large variation in the diploid genome size of the plants. PMID:16660786

  8. Identification of parasite DNA in common bile duct stones by PCR and DNA sequencing

    PubMed Central

    Jang, Ji Sun; Kim, Kyung Ho; Yu, Jae-Ran

    2007-01-01

    We attempted to identify parasite DNA in the biliary stones of humans via PCR and DNA sequencing. Genomic DNA was isolated from each of 15 common bile duct (CBD) stones and 5 gallbladder (GB) stones. The patients who had the CBD stones suffered from cholangitis, and the patients with GB stones showed acute cholecystitis, respectively. The 28S and 18S rDNA genes were amplified successfully from 3 and/or 1 common bile duct stone samples, and then cloned and sequenced. The 28S and 18S rDNA sequences were highly conserved among isolates. Identity of the obtained 28S D1 rDNA with that of Clonorchis sinensis was higher than 97.6%, and identity of the 18S rDNA with that of other Ascarididae was 97.9%. Almost no intra-specific variations were detected in the 28S and 18S rDNA with the exception of a few nucleotide variations, i.e., substitution and deletion. These findings suggest that C. sinensis and Ascaris lumbricoides may be related with the biliary stone formation and development. PMID:18165713

  9. Aberrant DNA methylation in 5' regions of DNA methyltransferase genes in aborted bovine clones.

    PubMed

    Liu, Jinghe; Liang, Xingwei; Zhu, Jiaqiao; Wei, Liang; Hou, Yi; Chen, Da-Yuan; Sun, Qing-Yuan

    2008-09-01

    High rate of abortion and developmental abnormalities is thought to be closely associated with inefficient epigenetic reprogramming of the transplanted nuclei during bovine cloning. It is known that one of the important mechanisms for epigenetic reprogramming is DNA methylation. DNA methylation is established and maintained by DNA methyltransferases (DNMTs), therefore, it is postulated that the inefficient epigenetic reprogramming of transplanted nuclei may be due to abnormal expression of DNMTs. Since DNA methylation can strongly inhibit gene expression, aberrant DNA methylation of DNMT genes may disturb gene expression. But presently, it is not clear whether the methylation abnormality of DNMT genes is related to developmental failure of somatic cell nuclear transfer embryos. In our study, we analyzed methylation patterns of the 5' regions of four DNMT genes including Dnmt3a, Dnmt3b, Dnmt1 and Dnmt2 in four aborted bovine clones. Using bisulfite sequencing method, we found that 3 out of 4 aborted bovine clones (AF1, AF2 and AF3) showed either hypermethylation or hypomethylation in the 5' regions of Dnmt3a and Dnmt3b, indicating that Dnmt3a and Dnmt3b genes are not properly reprogrammed. However, the individual AF4 exhibited similar methylation level and pattern to age-matched in vitro fertilized (IVF) fetuses. Besides, we found that the 5' regions of Dnmt1 and Dnmt2 were nearly completely unmethylated in all normal adults, IVF fetuses, sperm and aborted clones. Together, our results suggest that the aberrant methylation of Dnmt3a and Dnmt3b 5' regions is probably associated with the high abortion of bovine clones.

  10. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    PubMed

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions.

  11. Second generation sequencing allows for mtDNA mixture deconvolution and high resolution detection of heteroplasmy

    PubMed Central

    Holland, Mitchell M.; McQuillan, Megan R.; O’Hanlon, Katherine A.

    2011-01-01

    Aim To use parallel array pyrosequencing to deconvolute mixtures of mitochondrial DNA (mtDNA) sequence and provide high resolution analysis of mtDNA heteroplasmy. Methods The hypervariable segment 1 (HV1) of the mtDNA control region was analyzed from 30 individuals using the 454 GS Junior instrument. Mock mixtures were used to evaluate the system’s ability to deconvolute mixtures and to reliably detect heteroplasmy, including heteroplasmic differences between 5 family members of the same maternal lineage. Amplicon sequencing was performed on polymerase chain reaction (PCR) products generated with primers that included multiplex identifiers (MID) and adaptors for pyrosequencing. Data analysis was performed using NextGENe® software. The analysis of an autosomal short tandem repeat (STR) locus (D18S51) and a Y-STR locus (DYS389 I/II) was performed simultaneously with a portion of HV1 to illustrate that multiplexing can encompass different markers of forensic interest. Results Mixtures, including heteroplasmic variants, can be detected routinely down to a component ratio of 1:250 (20 minor variant copies with a coverage rate of 5000 sequences) and can be readily detected down to 1:1000 (0.1%) with expanded coverage. Amplicon sequences from D18S51, DYS389 I/II, and the second half of HV1 were successfully partitioned and analyzed. Conclusions The ability to routinely deconvolute mtDNA mixtures down to a level of 1:250 allows for high resolution analysis of mtDNA heteroplasmy, and for differentiation of individuals from the same maternal lineage. The pyrosequencing approach results in poor resolution of homopolymeric sequences, and PCR/sequencing artifacts require a filtering mechanism similar to that for STR stutter and spectral bleed through. In addition, chimeric sequences from jumping PCR must be addressed to make the method operational. PMID:21674826

  12. [Characterization and modification of phage T7 DNA polymerase for use in DNA sequencing]: Progress report

    SciTech Connect

    Not Available

    1992-01-01

    This project focuses on the DNA polymerase and accessory proteins of phage T7 for use in DNA sequence analysis. T7 DNA polymerase (gene 5 protein) interacts with accessory proteins for the acquisition of properties such as processivity that are necessary for DNA replication. One goal is to understand these interactions in order to modify the proteins to increase their usefulness with DNA sequence analysis. Using a genetically modified gene 5 protein lacking 3' to 5' exonuclease activity we have found that in the presence of manganese there is no discrimination against dideoxynucleotides, a property that enables novel approaches to DNA sequencing using automated technology. Pyrophosphorolysis can create problems in DNA sequence determination, a problem that can be eliminated by the addition of pyrophosphatase. Crystals of the gene 5 protein/thioredoxin complex have now been obtained and X-ray diffraction analysis will be undertaken once their quality has been improved. Amino acid changes in gene 5 protein have been identified that alter its interaction with thioredoxin. Characterization of these proteins should help determine how thioredoxin confers processivity on polymerization. We have characterized the 17 DNA binding protein, the gene 2.5 protein, and shown that it interacts with gene 5 protein and gene 4 protein. The gene 2.5 protein mediates homologous base pairing and strand uptake. Gene 5.5 protein interacts with E. coli Hl protein and affects gene expression. Biochemical and genetic studies on the T7 56-kDa gene 4 protein, the helicase, are focused on its physical interaction with T7 DNA polymerase and the mechanism by which the hydrolysis of nucleoside triphosphates fuels its unidirectional translocation on DNA.

  13. [Characterization and modification of phage T7 DNA polymerase for use in DNA sequencing]: Progress report

    SciTech Connect

    Not Available

    1992-12-31

    This project focuses on the DNA polymerase and accessory proteins of phage T7 for use in DNA sequence analysis. T7 DNA polymerase (gene 5 protein) interacts with accessory proteins for the acquisition of properties such as processivity that are necessary for DNA replication. One goal is to understand these interactions in order to modify the proteins to increase their usefulness with DNA sequence analysis. Using a genetically modified gene 5 protein lacking 3` to 5` exonuclease activity we have found that in the presence of manganese there is no discrimination against dideoxynucleotides, a property that enables novel approaches to DNA sequencing using automated technology. Pyrophosphorolysis can create problems in DNA sequence determination, a problem that can be eliminated by the addition of pyrophosphatase. Crystals of the gene 5 protein/thioredoxin complex have now been obtained and X-ray diffraction analysis will be undertaken once their quality has been improved. Amino acid changes in gene 5 protein have been identified that alter its interaction with thioredoxin. Characterization of these proteins should help determine how thioredoxin confers processivity on polymerization. We have characterized the 17 DNA binding protein, the gene 2.5 protein, and shown that it interacts with gene 5 protein and gene 4 protein. The gene 2.5 protein mediates homologous base pairing and strand uptake. Gene 5.5 protein interacts with E. coli Hl protein and affects gene expression. Biochemical and genetic studies on the T7 56-kDa gene 4 protein, the helicase, are focused on its physical interaction with T7 DNA polymerase and the mechanism by which the hydrolysis of nucleoside triphosphates fuels its unidirectional translocation on DNA.

  14. Delineating relative homogeneous G+C domains in DNA sequences.

    PubMed

    Li, W

    2001-10-03

    The concept of homogeneity of G+C content is always relative and subjective. This point is emphasized and quantified in this paper using a simple example of one sequence segmented into two subsequences. Whether the sequence is homogeneous or not can be answered by whether the two-subsequence model describes the DNA sequence better than the one-sequence model. There are at least three equivalent ways of looking at the 1-to-2 segmentation: Jensen-Shannon divergence measure, log likelihood ratio test, and model selection using Bayesian information criterion. Once a criterion is chosen, a DNA sequence can be recursively segmented into multiple domains. We use one subjective criterion called segmentation strength based on the Bayesian information criterion. Whether or not a sequence is homogeneous and how many domains it has depend on this criterion. We compare six different genome sequences (yeast S. cerevisiae chromosome III and IV, bacterium M. pneumoniae, human major histocompatibility complex sequence, longest contigs in human chromosome 21 and 22) by recursive segmentations at different strength criteria. Results by recursive segmentation confirm that yeast chromosome IV is more homogeneous than yeast chromosome III, human chromosome 21 is more homogeneous than human chromosome 22, and bacterial genomes may not be homogeneous due to short segments with distinct base compositions. The recursive segmentation also provides a quantitative criterion for identifying isochores in human sequences. Some features of our recursive segmentation, such as the possibility of delineating domain borders accurately, are superior to those of the moving-window approach commonly used in such analyses.

  15. A measure of DNA sequence similarity by Fourier Transform with applications on hierarchical clustering.

    PubMed

    Yin, Changchuan; Chen, Ying; Yau, Stephen S-T

    2014-10-21

    Multiple sequence alignment (MSA) is a prominent method for classification of DNA sequences, yet it is hampered with inherent limitations in computational complexity. Alignment-free methods have been developed over past decade for more efficient comparison and classification of DNA sequences than MSA. However, most alignment-free methods may lose structural and functional information of DNA sequences because they are based on feature extractions. Therefore, they may not fully reflect the actual differences among DNA sequences. Alignment-free methods with information conservation are needed for more accurate comparison and classification of DNA sequences. We propose a new alignment-free similarity measure of DNA sequences using the Discrete Fourier Transform (DFT). In this method, we map DNA sequences into four binary indicator sequences and apply DFT to the indicator sequences to transform them into frequency domain. The Euclidean distance of full DFT power spectra of the DNA sequences is used as similarity distance metric. To compare the DFT power spectra of DNA sequences with different lengths, we propose an even scaling method to extend shorter DFT power spectra to equal the longest length of the sequences compared. After the DFT power spectra are evenly scaled, the DNA sequences are compared in the same DFT frequency space dimensionality. We assess the accuracy of the similarity metric in hierarchical clustering using simulated DNA and virus sequences. The results demonstrate that the DFT based method is an effective and accurate measure of DNA sequence similarity.

  16. Sequence Features and Transcriptional Stalling within Centromere DNA Promote Establishment of CENP-A Chromatin

    PubMed Central

    Catania, Sandra; Pidoux, Alison L.; Allshire, Robin C.

    2015-01-01

    Centromere sequences are not conserved between species, and there is compelling evidence for epigenetic regulation of centromere identity, with location being dictated by the presence of chromatin containing the histone H3 variant CENP-A. Paradoxically, in most organisms CENP-A chromatin generally occurs on particular sequences. To investigate the contribution of primary DNA sequence to establishment of CENP-A chromatin in vivo, we utilised the fission yeast Schizosaccharomyces pombe. CENP-ACnp1 chromatin is normally assembled on ∼10 kb of central domain DNA within these regional centromeres. We demonstrate that overproduction of S. pombe CENP-ACnp1 bypasses the usual requirement for adjacent heterochromatin in establishing CENP-ACnp1 chromatin, and show that central domain DNA is a preferred substrate for de novo establishment of CENP-ACnp1 chromatin. When multimerised, a 2 kb sub-region can establish CENP-ACnp1 chromatin and form functional centromeres. Randomization of the 2 kb sequence to generate a sequence that maintains AT content and predicted nucleosome positioning is unable to establish CENP-ACnp1 chromatin. These analyses indicate that central domain DNA from fission yeast centromeres contains specific information that promotes CENP-ACnp1 incorporation into chromatin. Numerous transcriptional start sites were detected on the forward and reverse strands within the functional 2 kb sub-region and active promoters were identified. RNAPII is enriched on central domain DNA in wild-type cells, but only low levels of transcripts are detected, consistent with RNAPII stalling during transcription of centromeric DNA. Cells lacking factors involved in restarting transcription—TFIIS and Ubp3—assemble CENP-ACnp1 on central domain DNA when CENP-ACnp1 is at wild-type levels, suggesting that persistent stalling of RNAPII on centromere DNA triggers chromatin remodelling events that deposit CENP-ACnp1. Thus, sequence-encoded features of centromeric DNA create an

  17. A frameshift error detection algorithm for DNA sequencing projects.

    PubMed Central

    Fichant, G A; Quentin, Y

    1995-01-01

    During the determination of DNA sequences, frameshift errors are not the most frequent but they are the most bothersome as they corrupt the amino acid sequence over several residues. Detection of such errors by sequence alignment is only possible when related sequences are found in the databases. To avoid this limitation, we have developed a new tool based on the distribution of non-overlapping 3-tuples or 6-tuples in the three frames of an ORF. The method relies upon the result of a correspondence analysis. It has been extensively tested on Bacillus subtilis and Saccharomyces cerevisiae sequences and has also been examined with human sequences. The results indicate that it can detect frameshift errors affecting as few as 20 bp with a low rate of false positives (no more than 1.0/1000 bp scanned). The proposed algorithm can be used to scan a large collection of data, but it is mainly intended for laboratory practice as a tool for checking the quality of the sequences produced during a sequencing project. PMID:7659513

  18. A generalized topological entropy for analyzing the complexity of DNA sequences.

    PubMed

    Jin, Shuilin; Tan, Renjie; Jiang, Qinghua; Xu, Li; Peng, Jiajie; Wang, Yong; Wang, Yadong

    2014-01-01

    Topological entropy is one of the most difficult entropies to be used to analyze the DNA sequences, due to the finite sample and high-dimensionality problems. In order to overcome these problems, a generalized topological entropy is introduced. The relationship between the topological entropy and the generalized topological entropy is compared, which shows the topological entropy is a special case of the generalized entropy. As an application the generalized topological entropy in introns, exons and promoter regions was computed, respectively. The results indicate that the entropy of introns is higher than that of exons, and the entropy of the exons is higher than that of the promoter regions for each chromosome, which suggest that DNA sequence of the promoter regions is more regular than the exons and introns.

  19. Polymorphisms in the control region of mitochondrial DNA associated with elite Japanese athlete status.

    PubMed

    Mikami, E; Fuku, N; Takahashi, H; Ohiwa, N; Pitsiladis, Y P; Higuchi, M; Kawahara, T; Tanaka, M

    2013-10-01

    The control region of mitochondrial DNA (mtDNA) contains the main regulatory elements for mtDNA replication and transcription. Certain polymorphisms in this region would, therefore, contribute to elite athletic performance, because mitochondrial function is one of determinants of physical performance. The present study was undertaken to examine the effect of polymorphisms in this region on elite athlete status by sequencing the mtDNA control region. Subjects comprised 185 elite Japanese athletes who had represented Japan at international competitions (i.e., 100 endurance/middle-power athletes: EMA; 85 sprint/power athletes: SPA), and 672 Japanese controls (CON). The mtDNA control region was analyzed by direct sequencing. Frequency differences of polymorphisms (minor allele frequency ≥ 0.05) in the mtDNA control region between EMA, SPA, and CON were examined. EMA displayed excess of three polymorphisms [m.152T>C, m.514(CA)n repeat (n ≥ 5), and poly-C stretch at m.568-573 (C ≥ 7)] compared with CON. On the other hand, SPA showed greater frequency of the m.204T>C polymorphism compared with CON. In addition, none of the SPA had m.16278C>T polymorphism, whereas the frequencies of this polymorphism in CON and EMA were 8.3% and 10.0%, respectively. These findings imply that several polymorphisms detected in the control region of mtDNA may influence physical performance probably in a functional manner.

  20. DNA sequences that activate isocitrate lyase gene expression during late embryogenesis and during postgerminative growth.

    PubMed Central

    Zhang, J Z; Santes, C M; Engel, M L; Gasser, C S; Harada, J J

    1996-01-01

    We analyzed DNA sequences that regulate the expression of an isocitrate lyase gene from Brassica napus L. during late embryogenesis and during postgerminative growth to determine whether glyoxysomal function is induced by a common mechanism at different developmental stages. beta-Glucuronidase constructs were used both in transient expression assays in B. napus and in transgenic Arabidopsis thaliana to identify the segments of the isocitrate lyase 5' flanking region that influence promoter activity. DNA sequences that play the principal role in activating the promoter during post-germinative growth are located more than 1,200 bp upstream of the gene. Distinct DNA sequences that were sufficient for high-level expression during late embryogenesis but only low-level expression during postgerminative growth were also identified. Other parts of the 5' flanking region increased promoter activity both in developing seed and in seedlings. We conclude that a combination of elements is involved in regulating the isocitrate lyase gene and that distinct DNA sequences play primary roles in activating the gene in embryos and in seedlings. These findings suggest that different signals contribute to the induction of glyoxysomal function during these two developmental stages. We also showed that some of the constructs were expressed differently in transient expression assays and in transgenic plants. PMID:8934622

  1. Detection of sequences homologous to human retroviral DNA in multiple sclerosis by gene amplification

    SciTech Connect

    Greenberg, S.J.; Ehrlich, G.D.; Abbott, M.A.; Hurwitz, B.J.; Waldmann, T.A.; Poiesz, B.J. )

    1989-04-01

    Twenty-one patients with multiple sclerosis, chronic progressive type, were examined for DNA sequences homologous to a human retrovirus. Genomic DNA from peripheral blood mononuclear cells was analyzed for the presence of homologous sequences to the human T-cell leukemia/lymphoma virus type I (HTLV-I) long terminal repeat, 3{prime} gag, pol, and env domains by the enzymatic in vitro gene amplification technique, polymerase chain reaction. Positive identification of homologous pol sequences was made in the amplified DNA from six of these patients (29%). Three of these six patients (14%) also tested positive for the env region, but not for the other regions tested. In contrast, none of the samples from 35 normal individuals studied was positive when amplified and tested with the same primers and probes. Comparison of patterns obtained from controls and from patients with adult T-cell leukemia or tropical spastic paraparesis suggests that the DNA sequences identified are exogenous to the human genome and may correspond to a human retroviral species. The data support the detection of a human retroviral agent in some patients with multiple sclerosis.

  2. A CLIQUE algorithm using DNA computing techniques based on closed-circle DNA sequences.

    PubMed

    Zhang, Hongyan; Liu, Xiyu

    2011-07-01

    DNA computing has been applied in broad fields such as graph theory, finite state problems, and combinatorial problem. DNA computing approaches are more suitable used to solve many combinatorial problems because of the vast parallelism and high-density storage. The CLIQUE algorithm is one of the gird-based clustering techniques for spatial data. It is the combinatorial problem of the density cells. Therefore we utilize DNA computing using the closed-circle DNA sequences to execute the CLIQUE algorithm for the two-dimensional data. In our study, the process of clustering becomes a parallel bio-chemical reaction and the DNA sequences representing the marked cells can be combined to form a closed-circle DNA sequences. This strategy is a new application of DNA computing. Although the strategy is only for the two-dimensional data, it provides a new idea to consider the grids to be vertexes in a graph and transform the search problem into a combinatorial problem.

  3. Development of a protein microarray using sequence-specific DNA binding domain on DNA chip surface

    SciTech Connect

    Choi, Yoo Seong; Pack, Seung Pil; Yoo, Young Je . E-mail: yjyoo@snu.ac.kr

    2005-04-22

    A protein microarray based on DNA microarray platform was developed to identify protein-protein interactions in vitro. The conventional DNA chip surface by 156-bp PCR product was prepared for a substrate of protein microarray. High-affinity sequence-specific DNA binding domain, GAL4 DNA binding domain, was introduced to the protein microarray as fusion partner of a target model protein, enhanced green fluorescent protein. The target protein was oriented immobilized directly on the DNA chip surface. Finally, monoclonal antibody of the target protein was used to identify the immobilized protein on the surface. This study shows that the conventional DNA chip can be used to make a protein microarray directly, and this novel protein microarray can be applicable as a tool for identifying protein-protein interactions.

  4. Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus (Digenea): Species Differentiation Based on mtDNA (Barcode) and Partial LSUrDNA Sequences

    USGS Publications Warehouse

    Bergmame, L.; Huffman, J.; Cole, R.; Dayanandan, S.; Tkach, V.; McLaughlin, J.D.

    2011-01-01

    Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota. ?? 2011 American Society of Parasitologists.

  5. Cloning and sequencing of cDNA and genomic DNA encoding PDM phosphatase of Fusarium moniliforme.

    PubMed

    Yoshida, Hiroshi; Iizuka, Mari; Narita, Takao; Norioka, Naoko; Norioka, Shigemi

    2006-12-01

    PDM phosphatase was purified approximately 500-fold through six steps from the extract of dried powder of the culture filtrate of Fusarium moniliforme. The purified preparation appeared homogeneous on SDS-PAGE although the protein band was broad. Amino acid sequence information was collected on tryptic peptides from this preparation. cDNA cloning was carried out based on the information. A full-length cDNA was obtained and sequenced. The sequence had an open reading frame of 651 amino acid residues with a molecular mass of 69,988 Da. Cloning and sequencing of the genomic DNA corresponding to the cDNA was also conducted. The deduced amino acid sequence could account for many but not all of the tryptic peptides, suggesting presence of contaminant protein(s). SDS-PAGE analysis after chemical deglycosylation showed two proteins with molecular masses of 58 and 68 kDa. This implied that the 58 kDa protein had been copurified with PDM phosphatase. Homology search showed that PDM phosphatase belongs to the purple acid phosphatase family, which is widely distributed in the biosphere. Sequence data of fungal purple acid phosphatases were collected from the database. Processing of the data revealed presence of two types, whose evolutionary relationships were discussed.

  6. DNA capture and next-generation sequencing can recover whole mitochondrial genomes from highly degraded samples for human identification

    PubMed Central

    2013-01-01

    Background Mitochondrial DNA (mtDNA) typing can be a useful aid for identifying people from compromised samples when nuclear DNA is too damaged, degraded or below detection thresholds for routine short tandem repeat (STR)-based analysis. Standard mtDNA typing, focused on PCR amplicon sequencing of the control region (HVS I and HVS II), is limited by the resolving power of this short sequence, which misses up to 70% of the variation present in the mtDNA genome. Methods We used in-solution hybridisation-based DNA capture (using DNA capture probes prepared from modern human mtDNA) to recover mtDNA from post-mortem human remains in which the majority of DNA is both highly fragmented (<100 base pairs in length) and chemically damaged. The method ‘immortalises’ the finite quantities of DNA in valuable extracts as DNA libraries, which is followed by the targeted enrichment of endogenous mtDNA sequences and characterisation by next-generation sequencing (NGS). Results We sequenced whole mitochondrial genomes for human identification from samples where standard nuclear STR typing produced only partial profiles or demonstrably failed and/or where standard mtDNA hypervariable region sequences lacked resolving power. Multiple rounds of enrichment can substantially improve coverage and sequencing depth of mtDNA genomes from highly degraded samples. The application of this method has led to the reliable mitochondrial sequencing of human skeletal remains from unidentified World War Two (WWII) casualties approximately 70 years old and from archaeological remains (up to 2,500 years old). Conclusions This approach has potential applications in forensic science, historical human identification cases, archived medical samples, kinship analysis and population studies. In particular the methodology can be applied to any case, involving human or non-human species, where whole mitochondrial genome sequences are required to provide the highest level of maternal lineage discrimination

  7. Global matrilineal population structure in sperm whales as indicated by mitochondrial DNA sequences.

    PubMed Central

    Lyrholm, T; Gyllensten, U

    1998-01-01

    The genetic variability and population structure of worldwide populations of the sperm whale was investigated by sequence analysis of the first 5'L 330 base pairs in the mitochondrial DNA (mtDNA) control region. The study included a total of 231 individuals from three major oceanic regions, the North Atlantic, the North Pacific and the Southern Hemisphere. Fifteen segregating nucleotide sites defined 16 mtDNA haplotypes (lineages). The most common mtDNA types were present in more than one oceanic region, whereas ocean-specific types were rare. Analyses of heterogeneity of mtDNA type frequencies between oceans indicated moderate (GST = 0.03) but statistically significant (p = 0.0007) genetic differentiation on a global scale. In addition, strong genetic differentiation was found between potential social groups (GST = 0.03-0.6), indicating matrilineal relatedness within groups. The global nucleotide diversity was quite low (pi = 0.004) implying a recent common mtDNA ancestry (< 100,000) years ago) and a young global population structure. However, within this time period, female dispersal has apparently been limited enough to allow the development of global mtDNA differentiation. The results are consistent with those from observational studies and whaling data indicating stable social affiliations, some degree of area fidelity and latitudinal range limitations in groups of females and juveniles. PMID:9753788

  8. Testing the utility of matK and ITS DNA regions for discrimination of Allium species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Molecular phylogenetic analysis of the genus Allium L. has been mainly based on the nucleotide sequences of ITS region. In 2009 matK and rbcL were accepted as a two-locus DNA barcode to classify plant species by the Consortium for the Barcode of Life (CBOL) Plant Working Group. MatK region has been ...

  9. Viral Discovery and Sequence Recovery Using DNA Microarrays

    PubMed Central

    Wang, David; Urisman, Anatoly; Liu, Yu-Tsueng; Springer, Michael; Ksiazek, Thomas G; Erdman, Dean D; Mardis, Elaine R; Hickenbotham, Matthew; Magrini, Vincent; Eldred, James; Latreille, J. Phillipe; Wilson, Richard K; Ganem, Don

    2003-01-01

    Because of the constant threat posed by emerging infectious diseases and the limitations of existing approaches used to identify new pathogens, there is a great demand for new technological methods for viral discovery. We describe herein a DNA microarray-based platform for novel virus identification and characterization. Central to this approach was a DNA microarray designed to detect a wide range of known viruses as well as novel members of existing viral families; this microarray contained the most highly conserved 70mer sequences from every fully sequenced reference viral genome in GenBank. During an outbreak of severe acute respiratory syndrome (SARS) in March 2003, hybridization to this microarray revealed the presence of a previously uncharacterized coronavirus in a viral isolate cultivated from a SARS patient. To further characterize this new virus, approximately 1 kb of the unknown virus genome was cloned by physically recovering viral sequences hybridized to individual array elements. Sequencing of these fragments confirmed that the virus was indeed a new member of the coronavirus family. This combination of array hybridization followed by direct viral sequence recovery should prove to be a general strategy for the rapid identification and characterization of novel viruses and emerging infectious disease. PMID:14624234

  10. A syntactic pattern recognition system for DNA sequences

    SciTech Connect

    Searls, D.; Dong, S.

    1993-12-31

    The authors review both theoretical and practical results of a linguistic approach to studying the structure of features of DNA sequences. Using generative grammars, complex assemblages can not only be described and analyzed abstractly, but also concretely, such that features can be searched for by a general-purpose parser. Their parser, called GENLANG, uses an extended logic grammar formalism and has found features as complex as TRNA genes, group 1 introns, and protein-encoding genes, within input sequences on a genomic scale.

  11. Detection theory in identification of RNA-DNA sequence differences using RNA-sequencing.

    PubMed

    Toung, Jonathan M; Lahens, Nicholas; Hogenesch, John B; Grant, Gregory

    2014-01-01

    Advances in sequencing technology have allowed for detailed analyses of the transcriptome at single-nucleotide resolution, facilitating the study of RNA editing or sequence differences between RNA and DNA genome-wide. In humans, two types of post-transcriptional RNA editing processes are known to occur: A-to-I deamination by ADAR and C-to-U deamination by APOBEC1. In addition to these sequence differences, researchers have reported the existence of all 12 types of RNA-DNA sequence differences (RDDs); however, the validity of these claims is debated, as many studies claim that technical artifacts account for the majority of these non-canonical sequence differences. In this study, we used a detection theory approach to evaluate the performance of RNA-Sequencing (RNA-Seq) and associated aligners in accurately identifying RNA-DNA sequence differences. By generating simulated RNA-Seq datasets containing RDDs, we assessed the effect of alignment artifacts and sequencing error on the sensitivity and false discovery rate of RDD detection. Overall, we found that even in the presence of sequencing errors, false negative and false discovery rates of RDD detection can be contained below 10% with relatively lenient thresholds. We also assessed the ability of various filters to target false positive RDDs and found them to be effective in discriminating between true and false positives. Lastly, we used the optimal thresholds we identified from our simulated analyses to identify RDDs in a human lymphoblastoid cell line. We found approximately 6,000 RDDs, the majority of which are A-to-G edits and likely to be mediated by ADAR. Moreover, we found the majority of non A-to-G RDDs to be associated with poorer alignments and conclude from these results that the evidence for widespread non-canonical RDDs in humans is weak. Overall, we found RNA-Seq to be a powerful technique for surveying RDDs genome-wide when coupled with the appropriate thresholds and filters.

  12. Physical localisation of repetitive DNA sequences in Alstroemeria: karyotyping of two species with species-specific and ribosomal DNA.

    PubMed

    Kamstra, S A; Kuipers, A G; De Jeu, M J; Ramanna, M S; Jacobsen, E

    1997-10-01

    Fluorescence in situ hybridization (FISH) was used to localise two species-specific repetitive DNA sequences, A001-I and D32-13, and two highly conserved 25S and 5S rDNA sequences on the metaphase chromosomes of two species of Alstroemeria. The Chilean species, Alstroemeria aurea (2n = 16), has abundant constitutive heterochromatin, whereas the Brazilian species, Alstroemeria inodora, has hardly any heterochromatin. The A. aurea specific A001-I probe hybridized specifically to the C-band regions on all chromosomes. The FISH patterns on A. inodora chromosomes using species-specific probe D32-13 resembled the C-banding pattern and the A001-I pattern on A. aurea chromosomes. There were notable differences in number and distribution of rDNA sites between the two species. The 25S rDNA probe revealed 16 sites in A. aurea that closely colocalised with A001-I sites and 12 in A. inodora that were predominantly detected in the centromeric regions. FISH karyotypes of the two Alstroemeria species were constructed accordingly, enabling full identification of all individual chromosomes. These FISH karyotypes will be useful for monitoring the chromosomes of both Alstroemeria species in hybrids and backcross derivatives.

  13. Complete cDNA and derived amino acid sequence of human factor V

    SciTech Connect

    Jenny, R.J.; Pittman, D.D.; Toole, J.J.; Kriz, R.W.; Aldape, R.A.; Hewick, R.M.; Kaufman, R.J.; Mann, K.G.

    1987-07-01

    cDNA clones encoding human factor V have been isolated from an oligo(dT)-primed human fetal liver cDNA library prepared with vector Charon 21A. The cDNA sequence of factor V from three overlapping clones includes a 6672-base-pair (bp) coding region, a 90-bp 5' untranslated region, and a 163-bp 3' untranslated region within which is a poly(A)tail. The deduced amino acid sequence consists of 2224 amino acids inclusive of a 28-amino acid leader peptide. Direct comparison with human factor VIII reveals considerable homology between proteins in amino acid sequence and domain structure: a triplicated A domain and duplicated C domain show approx. 40% identity with the corresponding domains in factor VIII. As in factor VIII, the A domains of factor V share approx. 40% amino acid-sequence homology with the three highly conserved domains in ceruloplasmin. The B domain of factor V contains 35 tandem and approx. 9 additional semiconserved repeats of nine amino acids of the form Asp-Leu-Ser-Gln-Thr-Thr/Asn-Leu-Ser-Pro and 2 additional semiconserved repeats of 17 amino acids. Factor V contains 37 potential N-linked glycosylation sites, 25 of which are in the B domain, and a total of 19 cysteine residues.

  14. Belgian canine population and purebred study for forensics by improved mitochondrial DNA sequencing.

    PubMed

    Desmyter, Stijn; Gijsbers, Leonie

    2012-01-01

    In canine population studies for forensics, the mitochondrial DNA is profiled by sequencing the two hyper variable regions, HV1 and HV2 of the control region. In a first effort to create a Belgian population database some samples showed partially poor sequence quality. We demonstrated that a nuclear pseudogene was co-amplified with the mtDNA control region. Using a new combination of primers this adverse result was no longer observed and sequencing quality was improved. All former samples with poor sequence data were reanalyzed. Furthermore, the forensic canine population study was extended to 208 breed and mixed dogs. In total, 58 haplotypes were identified, resulting in an exclusion capacity of 0.92. The profile distribution of the Belgian population sample was not significantly different from those observed in population studies of three other countries. In addition to the total population study 107 Belgian registered pedigree dogs of six breeds were profiled. Per breed, the obtained haplotypes were supplemented with those from population and purebred studies. The combined data revealed that some haplotypes were more or less prominent present in particular dog breeds. The statistically significant differences in haplotype distribution between breeds and population sample can have consequences on mtDNA databasing and matching probabilities in forensics.

  15. A Two-locus DNA Sequence Database for Typing Plant and Human Pathogens Within the Fusarium oxysporum Species Complex

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We constructed a two-locus database, comprising partial translation elongation factor (EF-1alpha) gene sequences and nearly full-length sequences of the nuclear ribosomal intergenic spacer region (IGS rDNA) for 850 isolates spanning the phylogenetic breadth of the Fusarium oxysporum species complex ...

  16. cisExpress: motif detection in DNA sequences

    PubMed Central

    Triska, Martin; Grocutt, David; Southern, James; Murphy, Denis J.; Tatarinova, Tatiana

    2013-01-01

    Motivation: One of the major challenges for contemporary bioinformatics is the analysis and accurate annotation of genomic datasets to enable extraction of useful information about the functional role of DNA sequences. This article describes a novel genome-wide statistical approach to the detection of specific DNA sequence motifs based on similarities between the promoters of similarly expressed genes. This new tool, cisExpress, is especially designed for use with large datasets, such as those generated by publicly accessible whole genome and transcriptome projects. cisExpress uses a task farming algorithm to exploit all available computational cores within a shared memory node. We demonstrate the robust nature and validity of the proposed method. It is applicable for use with a wide range of genomic databases for any species of interest. Availability: cisExpress is available at www.cisexpress.org. Contact: tatiana.tatarinova@usc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23793750

  17. Effect of dephasing on DNA sequencing via transverse electronic transport

    SciTech Connect

    Zwolak, Michael; Krems, Matt; Pershin, Yuriy V; Di Ventra, Massimiliano

    2009-01-01

    We study theoretically the effects of dephasing on DNA sequencing in a nanopore via transverse electronic transport. To do this, we couple classical molecular dynamics simulations with transport calculations using scattering theory. Previous studies, which did not include dephasing, have shown that by measuring the transverse current of a particular base multiple times, one can get distributions of currents for each base that are distinguishable. We introduce a dephasing parameter into transport calculations to simulate the effects of the ions and other fluctuations. These effects lower the overall magnitude of the current, but have little effect on the current distributions themselves. The results of this work further implicate that distinguishing DNA bases via transverse electronic transport has potential as a sequencing tool.

  18. DNA Sequence Heterogeneity of Campylobacter jejuni CJIE4 Prophages and Expression of Prophage Genes

    PubMed Central

    Clark, Clifford G.; Chong, Patrick M.; McCorrister, Stuart J.; Mabon, Philip; Walker, Matthew; Westmacott, Garrett R.

    2014-01-01

    Campylobacter jejuni carry temperate bacteriophages that can affect the biology or virulence of the host bacterium. Known effects include genomic rearrangements and resistance to DNA transformation. C. jejuni prophage CJIE1 shows sequence variability and variability in the content of morons. Homologs of the CJIE1 prophage enhance both adherence and invasion to cells in culture and increase the expression of a specific subset of bacterial genes. Other C. jejuni temperate phages have so far not been well characterized. In this study we describe investigations into the DNA sequence variability and protein expression in a second prophage, CJIE4. CJIE4 sequences were obtained de novo from DNA sequencing of five C. jejuni isolates, as well as from whole genome sequences submitted to GenBank by other research groups. These CJIE4 DNA sequences were heterogenous, with several different insertions/deletions (indels) in different parts of the prophage genome. Two variants of a 3–4 kb region inserted within CJIE4 had different gene content that distinguished two major conserved CJIE4 prophage families. Additional indels were detected throughout the prophage. Detection of proteins in the five isolates characterized in our laboratory in isobaric Tags for Relative and Absolute Quantitation (iTRAQ) experiments indicated that prophage proteins within each of the two large indel variants were expressed during growth of the bacteria on Mueller Hinton agar plates. These proteins included the extracellular DNase associated with resistance to DNA transformation and prophage repressor proteins. Other proteins a