Roles of Fragile X Mental Retardation Protein in Dopaminergic Stimulation-induced Synapse-associated Protein Synthesis and Subsequent α-Amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) Receptor Internalization*

PubMed Central

Wang, Hansen; Kim, Susan S.; Zhuo, Min

2010-01-01

Fragile X syndrome, the most common form of inherited mental retardation, is caused by the absence of the RNA-binding protein fragile X mental retardation protein (FMRP). FMRP regulates local protein synthesis in dendritic spines. Dopamine (DA) is involved in the modulation of synaptic plasticity. Activation of DA receptors can regulate higher brain functions in a protein synthesis-dependent manner. Our recent study has shown that FMRP acts as a key messenger for DA modulation in forebrain neurons. Here, we demonstrate that FMRP is critical for DA D1 receptor-mediated synthesis of synapse-associated protein 90/PSD-95-associated protein 3 (SAPAP3) in the prefrontal cortex (PFC). DA D1 receptor stimulation induced dynamic changes of FMRP phosphorylation. The changes in FMRP phosphorylation temporally correspond with the expression of SAPAP3 after D1 receptor stimulation. Protein phosphatase 2A, ribosomal protein S6 kinase, and mammalian target of rapamycin are the key signaling molecules for FMRP linking DA D1 receptors to SAPAP3. Knockdown of SAPAP3 did not affect surface expression of α-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) GluR1 receptors induced by D1 receptor activation but impaired their subsequent internalization in cultured PFC neurons; the subsequent internalization of GluR1 was also impaired in Fmr1 knock-out PFC neurons, suggesting that FMRP may be involved in subsequent internalization of GluR1 through regulating the abundance of SAPAP3 after DA D1 receptor stimulation. Our study thus provides further insights into FMRP involvement in DA modulation and may help to reveal the molecular mechanisms underlying impaired learning and memory in fragile X syndrome. PMID:20457613

Roles of fragile X mental retardation protein in dopaminergic stimulation-induced synapse-associated protein synthesis and subsequent alpha-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) receptor internalization.

PubMed

Wang, Hansen; Kim, Susan S; Zhuo, Min

2010-07-09

Fragile X syndrome, the most common form of inherited mental retardation, is caused by the absence of the RNA-binding protein fragile X mental retardation protein (FMRP). FMRP regulates local protein synthesis in dendritic spines. Dopamine (DA) is involved in the modulation of synaptic plasticity. Activation of DA receptors can regulate higher brain functions in a protein synthesis-dependent manner. Our recent study has shown that FMRP acts as a key messenger for DA modulation in forebrain neurons. Here, we demonstrate that FMRP is critical for DA D1 receptor-mediated synthesis of synapse-associated protein 90/PSD-95-associated protein 3 (SAPAP3) in the prefrontal cortex (PFC). DA D1 receptor stimulation induced dynamic changes of FMRP phosphorylation. The changes in FMRP phosphorylation temporally correspond with the expression of SAPAP3 after D1 receptor stimulation. Protein phosphatase 2A, ribosomal protein S6 kinase, and mammalian target of rapamycin are the key signaling molecules for FMRP linking DA D1 receptors to SAPAP3. Knockdown of SAPAP3 did not affect surface expression of alpha-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) GluR1 receptors induced by D1 receptor activation but impaired their subsequent internalization in cultured PFC neurons; the subsequent internalization of GluR1 was also impaired in Fmr1 knock-out PFC neurons, suggesting that FMRP may be involved in subsequent internalization of GluR1 through regulating the abundance of SAPAP3 after DA D1 receptor stimulation. Our study thus provides further insights into FMRP involvement in DA modulation and may help to reveal the molecular mechanisms underlying impaired learning and memory in fragile X syndrome.

Characteristics of AMPA receptor-mediated responses of cultured cortical and spinal cord neurones and their correlation to the expression of glutamate receptor subunits, GluR1-4

PubMed Central

Dai, Wei-Min; Egebjerg, Jan; Lambert, John D C

2001-01-01

Electrophysiological recordings have been used to characterize responses mediated by AMPA receptors expressed by cultured rat cortical and spinal cord neurones. The EC50 values for AMPA were 17 and 11 μM, respectively.Responses of cortical neurones to AMPA were inhibited competitively by NBQX (pKi=6.6). Lower concentrations of NBQX (⩽1 μM) also potentiated the plateau responses of spinal cord neurones to AMPA, which could be attributed to a depression of desensitization to AMPA.GYKI 52466 inhibited responses of spinal cord neurones to AMPA to about twice the extent of responses of cortical neurones.Blockade of AMPA receptor desensitization by cyclothiazide (CTZ) potentiated responses of spinal cord neurones (6.8 fold) significantly more than responses of cortical neurones (4.8 fold). Responses of cortical neurones to KA were potentiated 3.5 fold by CTZ, while responses of spinal cord neurones were unaffected.Ultra-fast applications of AMPA to outside-out patches showed responses of spinal cord neurones desensitized by 97.5% and exhibit marked inward rectification, whereas cortical neurones desensitized by 91% and exhibited slight outward rectification. The time constants of deactivation and desensitization were about twice as fast in spinal cord than cortical neurones.In cortical neurones, single-cell RT – PCR showed GluR2 and GluR1 accounted for 91% of all subunits and were expressed together in 67% of neurones, predominantly as the flip variants (78%). GluR2 was detected alone in 24% of neurones. GluR3 and GluR4 were present in only 14 and 29% of neurones, respectively. For spinal cord neurones, GluR4o was detected in 81% of neurones, whereas predominantly flop versions of GluR1, 2 and 3 were detected in 38, 13 and 13% of neurones, respectively. These expression patterns are related to the respective pharmacological and mechanistic properties. PMID:11309259

GluR2-3Y Inhibits the Acquisition and Reinstatement of Morphine-Induced Conditioned Place Preference in Rats.

PubMed

Lin, Xiao-Jing; Zhang, Jian-Jun; Yu, Long-Chuan

2016-04-01

Accumulating evidence indicates that α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptors (AMPARs) are involved in the relapse to abused drugs. However, the role of AMPARs containing the GluR2 subunit in opiate addiction is still unclear. GluR2-3Y, an interfering peptide, prevents the endocytosis of AMPARs containing the GluR2 subunit. In this study, we explored the effect of intravenous injection of GluR2-3Y on the acquisition, expression, and reinstatement of morphine-induced conditioned place preference (mCPP) in rats. We found that infusion of GluR2-3Y (1.5 nmol/g) one hour before morphine during the conditioning phase inhibited the acquisition of mCPP, while an identical injection one hour before the post-conditioning test had no influence on the expression of mCPP. Injection of GluR2-3Y (1.5 nmol/g) after mCPP extinction blocked the morphine-induced reinstatement of mCPP. Our results strongly support the hypothesis that inhibition of AMPAR endocytosis provides a new target for the treatment of opiate addiction.

Alleviating neuropathic pain mechanical allodynia by increasing Cdh1 in the anterior cingulate cortex.

PubMed

Tan, Wei; Yao, Wen-Long; Hu, Rong; Lv, You-You; Wan, Li; Zhang, Chuan-Han; Zhu, Chang

2015-09-12

Plastic changes in the anterior cingulate cortex (ACC) are critical in the pathogenesis of pain hypersensitivity caused by injury to peripheral nerves. Cdh1, a co-activator subunit of anaphase-promoting complex/cyclosome (APC/C) regulates synaptic differentiation and transmission. Based on this, we hypothesised that the APC/C-Cdh1 played an important role in long-term plastic changes induced by neuropathic pain in ACC. We employed spared nerve injury (SNI) model in rat and found Cdh1 protein level in the ACC was down-regulated 3, 7 and 14 days after SNI surgery. We detected increase in c-Fos expression, numerical increase of organelles, swollen myelinated fibre and axon collapse of neuronal cells in the ACC of SNI rat. Additionally, AMPA receptor GluR1 subunit protein level was up-regulated on the membrane through a pathway that involves EphA4 mediated by APC/C-Cdh1, 3 and 7 days after SNI surgery. To confirm the effect of Cdh1 in neuropathic pain, Cdh1-expressing lentivirus was injected into the ACC of SNI rat. Intra-ACC treatment with Cdh1-expressing lentivirus vectors elevated Cdh1 levels, erased synaptic strengthening, as well as alleviating established mechanical allodynia in SNI rats. We also found Cdh1-expressing lentivirus normalised SNI-induced redistribution of AMPA receptor GluR1 subunit in ACC by regulating AMPA receptor trafficking. These results provide evidence that Cdh1 in ACC synapses may offer a novel therapeutic strategy for treating chronic neuropathic pain.

The Rewarding and Locomotor-Sensitizing Effects of Repeated Cocaine Administration are Distinct and Separable in Mice

PubMed Central

Riday, Thorfinn T.; Kosofsky, Barry E.; Malanga, C.J.

2011-01-01

Repeated psychostimulant exposure progressively increases their potency to stimulate motor activity in rodents. This behavioral or locomotor sensitization is considered a model for some aspects of drug addiction in humans, particularly drug craving during abstinence. However, the role of increased motor behavior in drug reward remains incompletely understood. Intracranial self-stimulation (ICSS) was measured concurrently with locomotor activity to determine if acute intermittent cocaine administration had distinguishable effects on motor behavior and perception of brain stimulation-reward (BSR) in the same mice. Sensitization is associated with changes in neuronal activity and glutamatergic neurotransmission in brain reward circuitry. Expression of AMPA receptor subunits (GluR1 and GluR2) and CRE binding protein (CREB) was measured in the ventral tegmental area (VTA), dorsolateral striatum (STR) and nucleus accumbens (NAc) before and after a sensitizing regimen of cocaine, with and without ICSS. Repeated cocaine administration sensitized mice to its locomotor stimulating effects but not its ability to potentiate BSR. ICSS increased GluR1 in the VTA but not NAc or STR, demonstrating selective changes in protein expression with electrical stimulation of discrete brain structures. Repeated cocaine reduced GluR1, GluR2 and CREB expression in the NAc, and reductions of GluR1 and GluR2 but not CREB were further enhanced by ICSS. These data suggest that the effects of repeated cocaine exposure on reward and motor processes are dissociable in mice, and that reduction of excitatory neurotransmission in the NAc may predict altered motor function independently from changes in reward perception. PMID:22197517

Ionotropic glutamate receptor GluR2/3-immunoreactive neurons in the cat, rabbit, and hamster superficial superior colliculus.

PubMed

Park, Won-Mee; Kim, Min-Jeong; Jeon, Chang-Jin

2004-06-01

Ionotropic glutamate receptor (GluR) subtypes occur in various types of cells in the central nervous system. We studied the distribution of AMPA glutamate receptor subtype GluR2/3 in the superficial layers of cat, rabbit, and hamster superior colliculus (SC) with antibody immunocytochemistry and the effect of enucleation on this distribution. Furthermore, we compared this labeling to that of calbindin D28K and parvalbumin. Anti-GluR2/3-immunoreactive (IR) cells formed a dense band of labeled cells within the lower superficial gray layer (SGL) and upper optic layer (OL) in the cat SC. By contrast, GluR2/3-IR cells formed a dense band within the upper OL in the rabbit and within the OL in the hamster SC. Calbindin D28K-IR cells are located in three layers in the SC: one within the zonal layer (ZL) and the upper SGL in all three animals, a second within the lower OL and upper IGL in the cat, within the IGL in the rabbit and within the OL in the hamster, and a third within the deep gray layer (DGL) in all three animals. Many parvalbumin-IR neurons were found within the lower SGL and upper OL. Thus, the GluR2/3-IR band was sandwiched between the first and second layers of calbindin D28K-IR cells in the cat and rabbit SC while the distribution of GluR2/3-IR cells in the hamster matches the second layer of calbindin D28K-IR cells. The patterned distribution of GluR2/3-IR cells overlapped the tier of parvalbumin-IR neurons in cat, but only partially overlapped in hamster and rabbit. Two-color immunofluorescence revealed that more than half (55.1%) of the GluR2/3-IR cells in the hamster SC expressed calbindin D28K. By contrast, only 9.9% of GluR2/3-IR cells expressed calbindin D28K in the cat. Double-labeled cells were not found in the rabbit SC. Some (4.8%) GluR2/3-IR cells in the cat SC also expressed parvalbumin, while no GluR2/3-IR cells in rabbit and hamster SC expressed parvalbumin. In this dense band of GluR2/3, the majority of labeled cells were small to medium-sized round/oval or stellate cells. Immunoreactivity for the GluR2/3 was clearly reduced in the contralateral SC following unilateral enucleation in the hamster. By contrast, enucleation appeared to have had no effect on the GluR2/3 immunoreactivity in the cat and rabbit SC. The results indicate that neurons in the mammalian SC express GluR2/3 in specific layers, which does not correlate with the expression of calbindin D28K and parvalbumin among the animals.

Prenatal Exposure to Tributyltin Decreases GluR2 Expression in the Mouse Brain.

PubMed

Ishida, Keishi; Saiki, Takashi; Umeda, Kanae; Miyara, Masatsugu; Sanoh, Seigo; Ohta, Shigeru; Kotake, Yaichiro

2017-01-01

Tributyltin (TBT), a common environmental contaminant, is widely used as an antifouling agent in paint. We previously reported that exposure of primary cortical neurons to TBT in vitro decreased the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit glutamate receptor 2 (GluR2) expression and subsequently increased neuronal vulnerability to glutamate. Therefore, to identify whether GluR2 expression also decreases after TBT exposure in vivo, we evaluated the changes in GluR2 expression in the mouse brain after prenatal or postnatal exposure to 10 and 25 ppm TBT through pellet diets. Although the mean feed intake and body weight did not decrease in TBT-exposed mice compared with that in control mice, GluR2 expression in the cerebral cortex and hippocampus decreased after TBT exposure during the prenatal period. These results indicate that a decrease in neuronal GluR2 may be involved in TBT-induced neurotoxicity, especially during the fetal period.

Trafficking of presynaptic AMPA receptors mediating neurotransmitter release: neuronal selectivity and relationships with sensitivity to cyclothiazide.

PubMed

Pittaluga, Anna; Feligioni, Marco; Longordo, Fabio; Luccini, Elisa; Raiteri, Maurizio

2006-03-01

Postsynaptic glutamate AMPA receptors (AMPARs) can recycle between plasma membrane and intracellular pools. In contrast, trafficking of presynaptic AMPARs has not been investigated. AMPAR surface expression involves interactions between the GluR2 carboxy tail and various proteins including glutamate receptor-interacting protein (GRIP), AMPA receptor-binding protein (ABP), protein interacting with C kinase 1 (PICK1), N-ethyl-maleimide-sensitive fusion protein (NSF). Here, peptides known to selectively block the above interactions were entrapped into synaptosomes to study the effects on the AMPA-evoked release of [3H]noradrenaline ([3H]NA) and [3H]acetylcholine ([3H]ACh) from rat hippocampal and cortical synaptosomes, respectively. Internalization of pep2-SVKI to prevent GluR2-GRIP/ABP/PICK1 interactions potentiated the AMPA-evoked release of [3H]NA but left unmodified that of [3H]ACh. Similar potentiation was caused by pep2-AVKI, the blocker of GluR2-PICK1 interaction. Conversely, a decrease in the AMPA-evoked release of [3H]NA, but not of [3H]ACh, was caused by pep2m, a selective blocker of the GluR2-NSF interaction. In the presence of pep2-SVKI the presynaptic AMPARs on noradrenergic terminals lost sensitivity to cyclothiazide. AMPARs releasing [3H]ACh, but not those releasing [3H]NA, were sensitive to spermine, suggesting that they are GluR2-lacking AMPARs. To conclude: (i) release-regulating presynaptic AMPARs constitutively cycle in isolated nerve terminals; (ii) the process exhibits neuronal selectivity; (iii) AMPAR trafficking and desensitization may be interrelated.

Orchestrated Regulation of Nogo Receptors, Lotus, AMPA Receptors and BDNF in an ECT Model Suggests Opening and Closure of a Window of Synaptic Plasticity

PubMed Central

Nordgren, Max; Karlsson, Tobias; Svensson, Maria; Koczy, Josefin; Josephson, Anna; Olson, Lars; Tingström, Anders; Brené, Stefan

2013-01-01

Electroconvulsive therapy (ECT) is an efficient and relatively fast acting treatment for depression. However, one severe side effect of the treatment is retrograde amnesia, which in certain cases can be long-term. The mechanisms behind the antidepressant effect and the amnesia are not well understood. We hypothesized that ECT causes transient downregulation of key molecules needed to stabilize synaptic structure and to prevent Ca2+ influx, and a simultaneous increase in neurotrophic factors, thus providing a short time window of increased structural synaptic plasticity. Here we followed regulation of NgR1, NgR3, LOTUS, BDNF, and AMPA subunits GluR1 and GluR2 flip and flop mRNA levels in hippocampus at 2, 4, 12, 24, and 72 hours after a single episode of induced electroconvulsive seizures (ECS) in rats. NgR1 and LOTUS mRNA levels were transiently downregulated in the dentate gyrus 2, 4, 12 and 4, 12, 24 h after ECS treatment, respectively. GluR2 flip, flop and GluR1 flop were downregulated at 4 h. GluR2 flip remained downregulated at 12 h. In contrast, BDNF, NgR3 and GluR1 flip mRNA levels were upregulated. Thus, ECS treatment induces a transient regulation of factors important for neuronal plasticity. Our data provide correlations between ECS treatment and molecular events compatible with the hypothesis that both effects and side effects of ECT may be caused by structural synaptic rearrangements. PMID:24244357

Orchestrated regulation of Nogo receptors, LOTUS, AMPA receptors and BDNF in an ECT model suggests opening and closure of a window of synaptic plasticity.

PubMed

Nordgren, Max; Karlsson, Tobias; Svensson, Maria; Koczy, Josefin; Josephson, Anna; Olson, Lars; Tingström, Anders; Brené, Stefan

2013-01-01

Electroconvulsive therapy (ECT) is an efficient and relatively fast acting treatment for depression. However, one severe side effect of the treatment is retrograde amnesia, which in certain cases can be long-term. The mechanisms behind the antidepressant effect and the amnesia are not well understood. We hypothesized that ECT causes transient downregulation of key molecules needed to stabilize synaptic structure and to prevent Ca2+ influx, and a simultaneous increase in neurotrophic factors, thus providing a short time window of increased structural synaptic plasticity. Here we followed regulation of NgR1, NgR3, LOTUS, BDNF, and AMPA subunits GluR1 and GluR2 flip and flop mRNA levels in hippocampus at 2, 4, 12, 24, and 72 hours after a single episode of induced electroconvulsive seizures (ECS) in rats. NgR1 and LOTUS mRNA levels were transiently downregulated in the dentate gyrus 2, 4, 12 and 4, 12, 24 h after ECS treatment, respectively. GluR2 flip, flop and GluR1 flop were downregulated at 4 h. GluR2 flip remained downregulated at 12 h. In contrast, BDNF, NgR3 and GluR1 flip mRNA levels were upregulated. Thus, ECS treatment induces a transient regulation of factors important for neuronal plasticity. Our data provide correlations between ECS treatment and molecular events compatible with the hypothesis that both effects and side effects of ECT may be caused by structural synaptic rearrangements.

Acquisition and expression of conditioned taste aversion differentially affects extracellular signal regulated kinase and glutamate receptor phosphorylation in rat prefrontal cortex and nucleus accumbens

PubMed Central

Marotta, Roberto; Fenu, Sandro; Scheggi, Simona; Vinci, Stefania; Rosas, Michela; Falqui, Andrea; Gambarana, Carla; De Montis, M. Graziella; Acquas, Elio

2014-01-01

Conditioned taste aversion (CTA) can be applied to study associative learning and its relevant underpinning molecular mechanisms in discrete brain regions. The present study examined, by immunohistochemistry and immunocytochemistry, the effects of acquisition and expression of lithium-induced CTA on activated Extracellular signal Regulated Kinase (p-ERK) in the prefrontal cortex (PFCx) and nucleus accumbens (Acb) of male Sprague-Dawley rats. The study also examined, by immunoblotting, whether acquisition and expression of lithium-induced CTA resulted in modified levels of phosphorylation of glutamate receptor subunits (NR1 and GluR1) and Thr34- and Thr75-Dopamine-and-cAMP-Regulated PhosphoProtein (DARPP-32). CTA acquisition was associated with an increase of p-ERK-positive neurons and phosphorylated NR1 receptor subunit (p-NR1) in the PFCx, whereas p-GluR1, p-Thr34- and p-Thr75-DARPP-32 levels were not changed in this brain region. CTA expression increased the number of p-ERK-positive neurons in the shell (AcbSh) and core (AcbC) but left unmodified p-NR1, p-GluR1, p-Thr34- and p-Thr75-DARPP-32 levels. Furthermore, post-embedding immunogold quantitative analysis in AcbSh revealed that CTA expression significantly increased nuclear p-ERK immunostaining as well as p-ERK-labeled axo-spinous contacts. Overall, these results indicate that ERK and NR1, but not GluR1 and DARPP-32, are differentially phosphorylated as a consequence of acquisition and expression of aversive associative learning. Moreover, these results confirm that CTA represents an useful approach to study the molecular basis of associative learning in rats and suggest the involvement of ERK cascade in learning-associated synaptic plasticity. PMID:24847227

Increased Glutamate Receptor and Transporter Expression in the Cerebral Cortex and Striatum of Gcdh -/- Mice: Possible Implications for the Neuropathology of Glutaric Acidemia Type I

PubMed Central

Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M.; Woontner, Michael; Goodman, Stephen I.; de Souza, Diogo Onofre Gomes; Wajner, Moacir

2014-01-01

We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh -/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh -/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh -/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh -/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh -/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh -/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh -/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh -/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I. PMID:24594605

Increased glutamate receptor and transporter expression in the cerebral cortex and striatum of gcdh-/- mice: possible implications for the neuropathology of glutaric acidemia type I.

PubMed

Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M; Woontner, Michael; Goodman, Stephen I; de Souza, Diogo Onofre Gomes; Wajner, Moacir

2014-01-01

We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh-/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh-/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh-/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh-/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh-/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh-/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh-/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh-/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I.

Characterization, cell-surface expression and ligand-binding properties of different truncated N-terminal extracellular domains of the ionotropic glutamate receptor subunit GluR1.

PubMed

McIlhinney, R A; Molnár, E

1996-04-01

To identify the location of the first transmembrane segment of the GluR1 glutamate receptor subunit artificial stop codons have been introduced into the N-terminal domain at amino acid positions 442, 510, and 563, namely just before and spanning the proposed first two transmembrane regions. The resultant truncated N-terminal fragments of GluR1, termed NT1, NT2, and NT3 respectively were expressed in Cos-7 cells and their cellular distribution and cell-surface expression analysed using an N-terminal antibody to GluR1. All of the fragments were fully glycosylated and were found to be associated with cell membranes but none was secreted. Differential extraction of the cell membranes indicated that both NT1 and NT2 behave as peripheral membrane proteins. In contrast NT3, like the full subunit, has integral membrane protein properties. Furthermore only NT3 is expressed at the cell surface as determined by immunofluorescence and cell-surface biotinylation. Protease protection assays indicated that only NT3 had a cytoplasmic tail. Binding studies using the selective ligand [(3)H]alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate ([(3)H]AMPA) demonstrated that NT3 does not bind ligand. Together these results indicate that the first transmembrane domain of the GluR1 subunit lies between residues 509 and 562, that the N-terminal domain alone cannot form a functional ligand-binding site and that this domain can be targeted to the cell surface provided that it has a transmembrane-spanning region.

Genistein inhibition of OGD-induced brain neuron death correlates with its modulation of apoptosis, voltage-gated potassium and sodium currents and glutamate signal pathway.

PubMed

Ma, Xue-Ling; Zhang, Feng; Wang, Yu-Xiang; He, Cong-Cong; Tian, Kun; Wang, Hong-Gang; An, Di; Heng, Bin; Liu, Yan-Qiang

2016-07-25

In the present study, we established an in vitro model of hypoxic-ischemia via exposing primary neurons of newborn rats to oxygen-glucose deprivation (OGD) and observing the effects of genistein, a soybean isoflavone, on hypoxic-ischemic neuron viability, apoptosis, voltage-activated potassium (Kv) and sodium (Nav) currents, and glutamate receptor subunits. The results indicated that OGD exposure reduced the viability and increased the apoptosis of brain neurons. Meanwhile, OGD exposure caused changes in the current-voltage curves and current amplitude values of voltage-activated potassium and sodium currents; OGD exposure also decreased GluR2 expression and increased NR2 expression. However, genistein at least partially reversed the effects caused by OGD. The results suggest that hypoxic-ischemia-caused neuronal apoptosis/death is related to an increase in K(+) efflux, a decrease in Na(+) influx, a down-regulation of GluR2, and an up-regulation of NR2. Genistein may exert some neuroprotective effects via the modulation of Kv and Nav currents and the glutamate signal pathway, mediated by GluR2 and NR2. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Myelin Proteolipid Protein Complexes with αv Integrin and AMPA Receptors In Vivo and Regulates AMPA-Dependent Oligodendrocyte Progenitor Cell Migration through the Modulation of Cell-Surface GluR2 Expression

PubMed Central

Harlow, Danielle E.; Saul, Katherine E.; Komuro, Hitoshi

2015-01-01

In previous studies, stimulation of ionotropic AMPA/kainate glutamate receptors on cultured oligodendrocyte cells induced the formation of a signaling complex that includes the AMPA receptor, integrins, calcium-binding proteins, and, surprisingly, the myelin proteolipid protein (PLP). AMPA stimulation of cultured oligodendrocyte progenitor cells (OPCs) also caused an increase in OPC migration. The current studies focused primarily on the formation of the PLP–αv integrin–AMPA receptor complex in vivo and whether complex formation impacts OPC migration in the brain. We found that in wild-type cerebellum, PLP associates with αv integrin and the calcium-impermeable GluR2 subunit of the AMPA receptor, but in mice lacking PLP, αv integrin did not associate with GluR2. Live imaging studies of OPC migration in ex vivo cerebellar slices demonstrated altered OPC migratory responses to neurotransmitter stimulation in the absence of PLP and GluR2 or when αv integrin levels were reduced. Chemotaxis assays of purified OPCs revealed that AMPA stimulation was neither attractive nor repulsive but clearly increased the migration rate of wild-type but not PLP null OPCs. AMPA receptor stimulation of wild-type OPCs caused decreased cell-surface expression of the GluR2 AMPA receptor subunit and increased intracellular Ca2+ signaling, whereas PLP null OPCs did not reduce GluR2 at the cell surface or increase Ca2+ signaling in response to AMPA treatment. Together, these studies demonstrate that PLP is critical for OPC responses to glutamate signaling and has important implications for OPC responses when levels of glutamate are high in the extracellular space, such as following demyelination. SIGNIFICANCE STATEMENT After demyelination, such as occurs in multiple sclerosis, remyelination of axons is often incomplete, leading to loss of neuronal function and clinical disability. Remyelination may fail because oligodendrocyte precursor cells (OPCs) do not completely migrate into demyelinated areas or OPCs in lesions may not mature into myelinating oligodendrocytes. We have found that the myelin proteolipid protein is critical to regulating OPC migratory responses to the neurotransmitter glutamate through modulation of cell-surface expression of the calcium-impermeable GluR2 subunit of the AMPA glutamate receptor and increased intercellular Ca2+ signaling. Altered glutamate homeostasis has been reported in demyelinated lesions. Therefore, understanding how OPCs respond to glutamate has important implications for treatment after white matter injury and disease. PMID:26311781

Presynaptic establishment of the synaptic cleft extracellular matrix is required for post-synaptic differentiation

PubMed Central

Rohrbough, Jeffrey; Rushton, Emma; Woodruff, Elvin; Fergestad, Tim; Vigneswaran, Krishanthan; Broadie, Kendal

2007-01-01

Formation and regulation of excitatory glutamatergic synapses is essential for shaping neural circuits throughout development. In a Drosophila genetic screen for synaptogenesis mutants, we identified mind the gap (mtg), which encodes a secreted, extracellular N-glycosaminoglycan-binding protein. MTG is expressed neuronally and detected in the synaptic cleft, and is required to form the specialized transsynaptic matrix that links the presynaptic active zone with the post-synaptic glutamate receptor (GluR) domain. Null mtg embryonic mutant synapses exhibit greatly reduced GluR function, and a corresponding loss of localized GluR domains. All known post-synaptic signaling/scaffold proteins functioning upstream of GluR localization are also grossly reduced or mislocalized in mtg mutants, including the dPix–dPak–Dock cascade and the Dlg/PSD-95 scaffold. Ubiquitous or neuronally targeted mtg RNA interference (RNAi) similarly reduce post-synaptic assembly, whereas post-synaptically targeted RNAi has no effect, indicating that presynaptic MTG induces and maintains the post-synaptic pathways driving GluR domain formation. These findings suggest that MTG is secreted from the presynaptic terminal to shape the extracellular synaptic cleft domain, and that the cleft domain functions to mediate transsynaptic signals required for post-synaptic development. PMID:17901219

Endocytosis and recycling of AMPA receptors lacking GluR2/3.

PubMed

Biou, Virginie; Bhattacharyya, Samarjit; Malenka, Robert C

2008-01-22

Excitatory synapses in the mammalian brain contain two types of ligand-gated ion channels: AMPA receptors (AMPARs) and NMDA receptors (NMDARs). AMPARs are responsible for generating excitatory synaptic responses, whereas NMDAR activation triggers long-lasting changes in these responses by modulating the trafficking of AMPARs toward and away from synapses. AMPARs are tetramers composed of four subunits (GluR1-GluR4), which current models suggest govern distinct AMPAR trafficking behavior during synaptic plasticity. Here, we address the roles of GluR2 and GluR3 in controlling the recycling- and activity-dependent endocytosis of AMPARs by using cultured hippocampal neurons prepared from knockout (KO) mice lacking these subunits. We find that synapses and dendritic spines form normally in cells lacking GluR2/3 and that upon NMDAR activation, GluR2/3-lacking AMPARs are endocytosed in a manner indistinguishable from GluR2-containing AMPARs in wild-type (WT) neurons. AMPARs lacking GluR2/3 also recycle to the plasma membrane identically to WT AMPARs. However, because of their permeability to calcium, GluR2-lacking but not WT AMPARs exhibited robust internalization throughout the dendritic tree in response to AMPA application. Dendritic endocytosis of AMPARs also was observed in GABAergic neurons, which express a high proportion of GluR2-lacking AMPARs. These results demonstrate that GluR2 and GluR3 are not required for activity-dependent endocytosis of AMPARs and suggest that the most important property of GluR2 in the context of AMPAR trafficking may be its influence on calcium permeability.

AMPA/kainate glutamate receptors contribute to inflammation, degeneration and pain related behaviour in inflammatory stages of arthritis

PubMed Central

Bonnet, Cleo S; Williams, Anwen S; Gilbert, Sophie J; Harvey, Ann K; Evans, Bronwen A; Mason, Deborah J

2015-01-01

Objectives Synovial fluid glutamate concentrations increase in arthritis. Activation of kainate (KA) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptors (GluRs) increase interleukin-6 (IL-6) release and cause arthritic pain, respectively. We hypothesised that AMPA and KA GluRs are expressed in human arthritis, and that intra-articular NBQX (AMPA/KA GluR antagonist) prevents pain and pathology in antigen-induced arthritis (AIA). Methods GluR immunohistochemistry was related to synovial inflammation and degradation in osteoarthritis (OA) and rheumatoid arthritis (RA). A single intra-articular NBQX injection was given at induction, and knee swelling and gait of AIA and AIA+NBQX rats compared over 21 days, before imaging, RT-qPCR, histology and immunohistochemistry of joints. Effects of NBQX on human primary osteoblast (HOB) activity were determined. Results AMPAR2 and KA1 immunolocalised to remodelling bone, cartilage and synovial cells in human OA and RA, and rat AIA. All arthritic tissues showed degradation and synovial inflammation. NBQX reduced GluR abundance, knee swelling (p<0.001, days 1–21), gait abnormalities (days 1–2), end-stage joint destruction (p<0.001), synovial inflammation (p<0.001), and messenger RNA expression of meniscal IL-6 (p<0.05) and whole joint cathepsin K (p<0.01). X-ray and MRI revealed fewer cartilage and bone erosions, and less inflammation after NBQX treatment. NBQX reduced HOB number and prevented mineralisation. Conclusions AMPA/KA GluRs are expressed in human OA and RA, and in AIA, where a single intra-articular injection of NBQX reduced swelling by 33%, and inflammation and degeneration scores by 34% and 27%, respectively, exceeding the efficacy of approved drugs in the same model. AMPA/KA GluR antagonists represent a potential treatment for arthritis. PMID:24130267

Phrenic motoneuron expression of serotonergic and glutamatergic receptors following upper cervical spinal cord injury

PubMed Central

Mantilla, Carlos B.; Bailey, Jeffrey P.; Zhan, Wen-Zhi; Sieck, Gary C.

2012-01-01

Following cervical spinal cord injury at C2 (SH hemisection model) there is progressive recovery of phrenic activity. Neuroplasticity in the postsynaptic expression of neurotransmitter receptors may contribute to functional recovery. Phrenic motoneurons express multiple serotonergic (5-HTR) and glutamatergic (GluR) receptors, but the timing and possible role of these different neurotransmitter receptor subtypes in the neuroplasticity following SH are not clear. The current study was designed to test the hypothesis that there is an increased expression of serotonergic and glutamatergic neurotransmitter receptors within phrenic motoneurons after SH. In adult male rats, phrenic motoneurons were labeled retrogradely by intrapleural injection of Alexa 488-conjugated cholera toxin B. In thin (10 μm) frozen sections of the spinal cord, fluorescently-labeled phrenic motoneurons were visualized for laser capture microdissection (LCM). Using quantitative real-time RT-PCR in LCM samples, the time course of changes in 5-HTR and GluR mRNA expression was determined in phrenic motoneurons up to 21 days post-SH. Expression of 5-HTR subtypes 1b, 2a and 2c and GluR subtypes AMPA, NMDA, mGluR1 and mGluR5 was evident in phrenic motoneurons from control and SH rats. Phrenic motoneuron expression of 5-HTR2a increased ~8-fold (relative to control) at 14 days post-SH, whereas NMDA expression increased ~16-fold by 21-days post-SH. There were no other significant changes in receptor expression at any time post-SH. This is the first study to systematically document changes in motoneuron expression of multiple neurotransmitter receptors involved in regulation of motoneuron excitability. By providing information on the neuroplasticity of receptors expressed in a motoneuron pool that is inactivated by a higher-level spinal cord injury, appropriate pharmacological targets can be identified to alter motoneuron excitability. PMID:22227062

AMPK Signaling in the Dorsal Hippocampus Negatively Regulates Contextual Fear Memory Formation

PubMed Central

Han, Ying; Luo, Yixiao; Sun, Jia; Ding, Zengbo; Liu, Jianfeng; Yan, Wei; Jian, Min; Xue, Yanxue; Shi, Jie; Wang, Ji-Shi; Lu, Lin

2016-01-01

Both the formation of long-term memory (LTM) and dendritic spine growth that serves as a physical basis for the long-term storage of information require de novo protein synthesis. Memory formation also critically depends on transcription. Adenosine monophosphate-activated protein kinase (AMPK) is a transcriptional regulator that has emerged as a major energy sensor that maintains cellular energy homeostasis. However, still unknown is its role in memory formation. In the present study, we found that AMPK is primarily expressed in neurons in the hippocampus, and then we demonstrated a time-dependent decrease in AMPK activity and increase in mammalian target of rapamycin complex 1 (mTORC1) activity after contextual fear conditioning in the CA1 but not CA3 area of the dorsal hippocampus. Using pharmacological methods and adenovirus gene transfer to bidirectionally regulate AMPK activity, we found that increasing AMPK activity in the CA1 impaired the formation of long-term fear memory, and decreasing AMPK activity enhanced fear memory formation. These findings were associated with changes in the phosphorylation of AMPK and p70s6 kinase (p70s6k) and expression of BDNF and membrane GluR1 and GluR2 in the CA1. Furthermore, the prior administration of an mTORC1 inhibitor blocked the enhancing effect of AMPK inhibition on fear memory formation, suggesting that this negative regulation of contextual fear memory by AMPK in the CA1 depends on the mTORC1 signaling pathway. Finally, we found that AMPK activity regulated hippocampal spine growth associated with memory formation. In summary, our results indicate that AMPK is a key negative regulator of plasticity and fear memory formation. PMID:26647974

Input- and subunit-specific AMPA receptor trafficking underlying long-term potentiation at hippocampal CA3 synapses.

PubMed

Kakegawa, Wataru; Tsuzuki, Keisuke; Yoshida, Yukari; Kameyama, Kimihiko; Ozawa, Seiji

2004-07-01

Hippocampal CA3 pyramidal neurons receive synaptic inputs from both mossy fibres (MFs) and associational fibres (AFs). Long-term potentiation (LTP) at these synapses differs in its induction sites and N-methyl-D-aspartate receptor (NMDAR) dependence. Most evidence favours the presynaptic and postsynaptic mechanisms for induction of MF LTP and AF LTP, respectively. This implies that molecular and functional properties differ between MF and AF synapses at both presynaptic and postsynaptic sites. In this study, we focused on the difference in the postsynaptic trafficking of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) between these synapses. To trace the subunit-specific trafficking of AMPARs at each synapse, GluR1 and GluR2 subunits were introduced into CA3 pyramidal neurons in hippocampal organotypic cultures using the Sindbis viral expression system. The electrophysiologically-tagged GluR2 AMPARs, produced by the viral-mediated transfer of the unedited form of GluR2 (GluR2Q), were inserted into both MF and AF postsynaptic sites in a neuronal activity-independent manner. Endogenous Ca(2+)-impermeable AMPARs at these synapses were replaced with exogenous Ca(2+)-permeable receptors, and Ca(2+) influx via the newly expressed postsynaptic AMPARs induced NMDAR-independent LTP at AF synapses. In contrast, no GluR1 AMPAR produced by the gene transfer was constitutively incorporated into AF postsynaptic sites, and only a small amount into MF postsynaptic sites. The synaptic trafficking of GluR1 AMPARs was triggered by the activity of Ca(2+)/calmodulin-dependent kinase II or high-frequency stimulation to induce LTP at AF synapses, but not at MF synapses. These results indicate that MF and AF postsynaptic sites possess distinct properties for AMPAR trafficking in CA3 pyramidal neurons.

Premyelinated central axons express neurotoxic NMDA receptors: relevance to early developing white-matter injury

PubMed Central

Huria, Tahani; Beeraka, Narasimha Murthy; Al-Ghamdi, Badrah; Fern, Robert

2015-01-01

Ischemic-type injury to developing white matter is associated with the significant clinical condition cerebral palsy and with the cognitive deficits associated with premature birth. Premyelinated axons are the major cellular component of fetal white matter and loss of axon function underlies the disability, but the cellular mechanisms producing ischemic injury to premyelinated axons have not previously been described. Injury was found to require longer periods of modelled ischemia than at latter developmental points. Ischemia produced initial hyperexcitability in axons followed by loss of function after Na+ and Ca2+ influx. N-methyl-D-aspartate- (NMDA) type glutamate receptor (GluR) agonists potentiated axon injury while antagonists were protective. The NMDA GluR obligatory Nr1 subunit colocalized with markers of small premyelinated axons and expression was found at focal regions of axon injury. Ischemic injury of glial cells present in early developing white matter was NMDA GluR independent. Axons in human postconception week 18 to 23 white matter had a uniform prediameter expansion phenotype and postembedded immuno-gold labelling showed Nr1 subunit expression on the membrane of these axons, demonstrating a shared key neuropathologic feature with the rodent model. Premyelinated central axons therefore express high levels of functional NMDA GluRs that confer sensitivity to ischemic injury. PMID:25515212

Immunocytochemical localization of metabotropic (mGluR2/3 and mGluR4a) and ionotropic (GluR2/3) glutamate receptors in adrenal medullary ganglion cells.

PubMed

Sarría, R; Díez, J; Losada, J; Doñate-Oliver, F; Kuhn, R; Grandes, P

2006-02-01

The localization of metabotropic glutamate receptors of groups II (mGluR2/3) and III (mGluR4a) and the subunits 2 and 3 of alfa-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) ionotropic glutamate receptors (GluR2/3) was investigated with immunocytochemical methods in the rat adrenal gland. MGluR2/3, mGluR4a and GluR2/3 immunoreactivities were observed in large-sized, centrally located type I adrenal medullary ganglion neurons. Furthermore, the small-sized type II adrenal ganglion neurons identified by their immunoreactivity to brain nitric oxide synthase (bNOS), also expressed mGluR2/3, mGluR4a and GluR2/3. These cells were disposed in the peripheral portion of the adrenal medulla. None of the type I neurons were positively labeled for bNOS. These morphological observations suggest that activation of glutamate receptors in ganglion neurons may be instrumental in the control of adrenal endocrine systems as well as blood regulation.

Chronic renal failure induces cell death in rat hippocampal CA1 via upregulation of αCaMKII/NR2A synaptic complex and phosphorylated GluR1-containing AMPA receptor cascades.

PubMed

Kim, Jong Wan; Ha, Gyoung Yim; Jung, Yong Wook

2014-09-01

N-methyl-D-aspartate (NMDA) and alpha-amino-3-hydroxy-5-methylisoxazole-4-propinoic acid (AMPA) receptors bound to postsynaptic density-95 (PSD-95) and α isoform of calcium/calmodulin-dependent protein kinase II (αCaMKII) is fundamentally involved in the regulation of working memory. The aim of present study was to investigate the alterations of NMDA and AMPA receptors responsible for hippocampal synaptic dysfunction and selective neuronal cell death after chronic renal failure (CRF) which may be associated with impairment of working memory. Altered interactions between NMDA and AMPA receptors and PSD-95 and αCaMKII were analyzed in the cornu ammonis (CA) 1 and CA3/dentate gyrus (DG) subfields of the uremic rat hippocampi using the immunoblotting and immunoprecipitation methods. Uremia induced by CRF produced necrotic cell death and decreased neuronal nucleoli protein levels in the hippocampal CA1 subfield, but not in the CA3/DG subfields. The CA1 subfields of CRF rats exhibited significant decreases and increases, respectively, in the expressions of PSD-95/NR2B and αCaMKII/NR2A synaptic complex. Moreover, increased phosphorylation of glutamate receptor type 1 (GluR1) AMPA receptor at ser831 was observed in the CA1 subfield after CRF. These hippocampal CA1 neuronal vulnerability may be responsible for memory dysfunction after CRF as mediated by an increase in NR2A-containing NMDA receptors bound to αCaMKII and subsequent activation of GluR1-containing AMPA receptors caused by the phosphorylation of GluR1 at ser831.

STRIATAL-ENRICHED PROTEIN TYROSINE PHOSPHATASE (STEP) KNOCKOUT MICE HAVE ENHANCED HIPPOCAMPAL MEMORY

PubMed Central

Venkitaramani, Deepa V.; Moura, Paula J.; Picciotto, Marina R.; Lombroso, Paul J.

2011-01-01

STEP is a brain-specific phosphatase that opposes synaptic strengthening by the regulation of key synaptic signaling proteins. Previous studies suggest a possible role for STriatal-Enriched protein tyrosine Phosphatase (STEP) in learning and memory. To demonstrate the functional importance of STEP in learning and memory, we generated STEP knockout (KO) mice and examined the effect of deletion of STEP on behavioral performance, as well as the phosphorylation and expression of its substrates. Here we report that loss of STEP leads to significantly enhanced performance in hippocampal-dependent learning and memory tasks. In addition, STEP KO mice displayed greater dominance behavior, although they were normal in their motivation, motor coordination, visual acuity and social interactions. STEP KO mice displayed enhanced tyrosine phosphorylation of extracellular-signal regulated kinase 1/2 (ERK1/2), the NR2B subunit of the N-methyl-D-aspartate receptor (NMDAR), Proline-rich tyrosine kinase (Pyk2), as well as an increased phosphorylation of ERK1/2 substrates. Concomitant to the increased phosphorylation of NR2B, synaptosomal expression of NR1/NR2B NMDARs was increased in STEP KO mice, as was the GluR1/GluR2 containing α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid receptors (AMPAR), providing a potential molecular mechanism for the improved cognitive performance. The data support a role for STEP in the regulation of synaptic strengthening. The absence of STEP improves cognitive performance, and may do so by the regulation of downstream effectors necessary for synaptic transmission. PMID:21501258

Subunit-dependent postsynaptic expression of kainate receptors on hippocampal interneurons in area CA1

PubMed Central

Wondolowski, Joyce; Frerking, Matthew

2009-01-01

Kainate receptors (KARs) contribute to postsynaptic excitation in only a select subset of neurons. To define the parameters that specify the postsynaptic expression of KARs, we examined the contribution of KARs to EPSCs on hippocampal interneurons in area CA1. Interneurons in stratum radiatum/lacunosum-moleculare (SR/SLM) express KARs both with and without the GluR5 subunit, but KAR-mediated EPSCs are generated mainly, if not entirely, by GluR5-containing KARs. Extrasynaptic glutamate spillover profoundly recruits AMPARs with little effect on KARs, indicating that KARs are targeted at the synapse more precisely than AMPARs. However, spontaneous EPSCs with a conventional AMPAR component did not have a resolvable contribution of KARs, suggesting that the KARs that contribute to the evoked EPSCs are at a distinct set of synapses. GluR5-containing KARs on interneurons in stratum oriens do not contribute substantially to the EPSC. We conclude that KARs are localized to synapses by cell type-, synapse-, and subunit-selective mechanisms. PMID:19144856

Propofol inhibits invasion and proliferation of C6 glioma cells by regulating the Ca2+ permeable AMPA receptor-system xc- pathway.

PubMed

Wang, Xin-Yue; Li, Yan-Li; Wang, Hai-Yun; Zhu, Min; Guo, Di; Wang, Guo-Lin; Gao, Ying-Tang; Yang, Zhuo; Li, Tang; Yang, Chen-Yi; Chen, Yi-Meng

2017-10-01

Anesthetics are documented to affect tumors; therefore, we studied the antiglioma effect of propofol on proliferation and invasiveness of glioma cells and explored the underlying mechanism. C6 glioma cells were cultured and treated with propofol, and cell viability, invasiveness, and migration were measured. Glutamate release was measured using an enzyme-catalyzed kinetic reaction. xCT protein and α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor GluR2 subunit protein expression was assessed with Western blot analysis and immunofluorescent staining. We observed that propofol significantly inhibited C6 glioma cell viability, invasiveness, and migration and decreased glutamate release. An agonist of the cystine/glutamate antiporter system (system x c - ), N-acetylcysteine (NAC), reversed propofol's effects, and propofol could inhibit C6 glioma cell proliferation by adding excess exogenous glutamate (100μM). Finally, propofol increased the surface expression of GluR2, but decreased surface expression of xCT. The effects of propofol on surface expression of GluR2 and xCT could be rescued by (R, S)-AMPA, an agonist of Ca 2+ permeable AMPA receptor (CPAR). Thus, propofol can inhibit cell viability, invasiveness, and migration of C6 glioma cells, and the CPAR-system x c - pathway contributes to these events. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dominant negative mutant of ionotropic glutamate receptor subunit GluR3: implications for the role of a cysteine residue for its channel activity and pharmacological properties.

PubMed Central

Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K

1997-01-01

We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754

Opposing effects of AMPA and 5-HT1A receptor blockade on passive avoidance and object recognition performance: correlation with AMPA receptor subunit expression in rat hippocampus.

PubMed

Schiapparelli, L; Simón, A M; Del Río, J; Frechilla, D

2006-06-01

It has been suggested that antagonists at serotonin 5-HT1A receptors may exert a procognitive effect by facilitating glutamatergic neurotransmission. Here we further explored this issue by looking for the ability of a 5-HT1A antagonist to prevent the learning deficit induced by AMPA receptor blockade in two behavioural procedures in rats, and for concomitant molecular changes presumably involved in memory formation in the hippocampus. Pretraining administration of the competitive AMPA receptor antagonist, NBQX, produced a dose-related retention impairment in a passive avoidance task 24h later, and also impaired retention in a novel object recognition test when an intertrial interval of 3h was selected. Pretreatment with the selective 5-HT1A receptor antagonist, WAY-100635, prevented the learning deficit induced by NBQX in the two behavioural procedures. In biochemical studies performed on rat hippocampus after the retention tests, we found that learning increased the membrane levels of AMPA receptor GluR1 and GluR2/3 subunits, as well as the phosphorylated forms of GluR1, effects that were abolished by NBQX administration before the training session. Pretreatment with WAY-100635 counteracted the NBQX effects and restored the initial learning-specific increase in Ca2+/calmodulin-dependent protein kinase II (CaMKII) function and the later increase in GluR2/3 and phosphorylated GluR1 surface expression. Moreover, administration of WAY-100635 before object recognition training improved recognition memory 24h later and potentiated the learning-associated increase in AMPA receptor subunits. The results support the proposed utility of 5-HT1A antagonists in the treatment of cognitive disorders.

Gating characteristics control glutamate receptor distribution and trafficking in vivo.

PubMed

Petzoldt, Astrid G; Lee, Yü-Hien; Khorramshahi, Omid; Reynolds, Eric; Plested, Andrew J R; Herzel, Hanspeter; Sigrist, Stephan J

2014-09-08

Glutamate-releasing synapses dominate excitatory release in the brain. Mechanisms governing their assembly are of major importance for circuit development and long-term plasticity underlying learning and memory. AMPA/Kainate-type glutamate receptors (GluRs) are tetrameric ligand-gated ion channels that open their ion-conducting pores in response to binding of the neurotransmitter. Changes in subunit composition of postsynaptic GluRs are highly relevant for plasticity and development of glutamatergic synapses [1-4]. To date, posttranslational modifications, mostly operating via the intracellular C-terminal domains (CTDs) of GluRs, are presumed to be the major regulator of trafficking [5]. In recent years, structural and electrophysiological analyses have improved our understanding of GluR gating mechanism [6-11]. However, whether conformational changes subsequent to glutamate binding may per se be able to influence GluR trafficking has remained an unaddressed question. Using a Drosophila system allowing for extended visualization of GluR trafficking in vivo, we here provide evidence that mutations changing the gating behavior alter GluR distribution and trafficking. GluR mutants associated with reduced charge transfer segregated from coexpressed wild-type GluRs on the level of individual postsynaptic densities. Segregation was lost upon blocking of evoked glutamate release. Photobleaching experiments suggested increased mobility of mutants with reduced charge transfer, which accumulated prematurely during early steps of synapse assembly, but failed to further increase their level in accordance with assembly of the presynaptic scaffold. In summary, gating characteristics seem to be a new variable for the understanding of GluR trafficking relevant to both development and plasticity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Prenatal chronic mild stress induces depression-like behavior and sex-specific changes in regional glutamate receptor expression patterns in adult rats.

PubMed

Wang, Y; Ma, Y; Hu, J; Cheng, W; Jiang, H; Zhang, X; Li, M; Ren, J; Li, X

2015-08-20

Chronic stress during critical periods of human fetal brain development is associated with cognitive, behavioral, and mood disorders in later life. Altered glutamate receptor (GluR) expression has been implicated in the pathogenesis of stress-dependent disorders. To test whether prenatal chronic mild stress (PCMS) enhances offspring's vulnerability to stress-induced behavioral and neurobiological abnormalities and if this enhanced vulnerability is sex-dependent, we measured depression-like behavior in the forced swimming test (FST) and regional changes in GluR subunit expression in PCMS-exposed adult male and female rats. Both male and female PCMS-exposed rats exhibited stronger depression-like behavior than controls. Males and females exhibited unique regional changes in GluR expression in response to PCMS alone, FST alone (CON-FST), and PCMS with FST (PCMS-FST). In females, PCMS alone did not alter N-methyl-d-aspartate receptor (NMDAR) or metabotropic glutamate receptor (mGluR) expression, while in PCMS males, higher mGluR2/3, mGluR5, and NR1 expression levels were observed in the prefrontal cortex. In addition, PCMS altered the change in GluR expression induced by acute stress (the FST test), and this too was sex-specific. Male PCMS-FST rats expressed significantly lower mGluR5 levels in the hippocampus, lower mGluR5, NR1, postsynaptic density protein (PSD)95, and higher mGluR2/3 in the prefrontal cortex, and higher mGluR5 and PSD95 in the amygdala than male CON-FST rats. Female PCMS-FST rats expressed lower NR1 in the hippocampus, lower NR2B and PSD95 in the prefrontal cortex, lower mGluR2/3 in the amygdala, and higher PSD95 in the amygdala than female CON-FST rats. PCMS may increase the offspring's vulnerability to depression by altering sex-specific stress-induced changes in glutamatergic signaling. Copyright © 2015. Published by Elsevier Ltd.

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Alterations in Hippocampal Oxidative Stress, Expression of AMPA Receptor GluR2 Subunit and Associated Spatial Memory Loss by Bacopa monnieri Extract (CDRI-08) in Streptozotocin-Induced Diabetes Mellitus Type 2 Mice.

PubMed

Pandey, Surya P; Singh, Hemant K; Prasad, S

2015-01-01

Bacopa monnieri extract has been implicated in the recovery of memory impairments due to various neurological disorders in animal models and humans. However, the precise molecular mechanism of the role of CDRI-08, a well characterized fraction of Bacopa monnieri extract, in recovery of the diabetes mellitus-induced memory impairments is not known. Here, we demonstrate that DM2 mice treated orally with lower dose of CDRI-08 (50- or 100 mg/kg BW) is able to significantly enhance spatial memory in STZ-DM2 mice and this is correlated with a significant decline in oxidative stress and up regulation of the AMPA receptor GluR2 subunit gene expression in the hippocampus. Treatment of DM2 mice with its higher dose (150 mg/kg BW or above) shows anti-diabetic effect in addition to its ability to recover the spatial memory impairment by reversing the DM2-induced elevated oxidative stress and decreased GluR2 subunit expression near to their values in normal and CDRI-08 treated control mice. Our results provide evidences towards molecular basis of the memory enhancing and anti diabetic role of the Bacopa monnieri extract in STZ-induced DM2 mice, which may have therapeutic implications.

Alterations in Hippocampal Oxidative Stress, Expression of AMPA Receptor GluR2 Subunit and Associated Spatial Memory Loss by Bacopa monnieri Extract (CDRI-08) in Streptozotocin-Induced Diabetes Mellitus Type 2 Mice

PubMed Central

Pandey, Surya P.; Singh, Hemant K.; Prasad, S.

2015-01-01

Bacopa monnieri extract has been implicated in the recovery of memory impairments due to various neurological disorders in animal models and humans. However, the precise molecular mechanism of the role of CDRI-08, a well characterized fraction of Bacopa monnieri extract, in recovery of the diabetes mellitus-induced memory impairments is not known. Here, we demonstrate that DM2 mice treated orally with lower dose of CDRI-08 (50- or 100 mg/kg BW) is able to significantly enhance spatial memory in STZ-DM2 mice and this is correlated with a significant decline in oxidative stress and up regulation of the AMPA receptor GluR2 subunit gene expression in the hippocampus. Treatment of DM2 mice with its higher dose (150 mg/kg BW or above) shows anti-diabetic effect in addition to its ability to recover the spatial memory impairment by reversing the DM2-induced elevated oxidative stress and decreased GluR2 subunit expression near to their values in normal and CDRI-08 treated control mice. Our results provide evidences towards molecular basis of the memory enhancing and anti diabetic role of the Bacopa monnieri extract in STZ-induced DM2 mice, which may have therapeutic implications. PMID:26161865

Editing for an AMPA receptor subunit RNA in prefrontal cortex and striatum in Alzheimer's disease, Huntington's disease and schizophrenia

NASA Technical Reports Server (NTRS)

Akbarian, S.; Smith, M. A.; Jones, E. G.; Bloom, F. E. (Principal Investigator)

1995-01-01

Animal studies and cell culture experiments demonstrated that posttranscriptional editing of the transcript of the GluR-2 gene, resulting in substitution of an arginine for glutamine in the second transmembrane region (TM II) of the expressed protein, is associated with a reduction in Ca2+ permeability of the receptor channel. Thus, disturbances in GluR-2 RNA editing with alteration of intracellular Ca2+ homeostasis could lead to neuronal dysfunction and even neuronal degeneration. The present study determined the proportions of edited and unedited GluR-2 RNA in the prefrontal cortex of brains from patients with Alzheimer's disease, in the striatum of brains from patients with Huntington's disease, and in the same areas of brains from age-matched schizophrenics and controls, by using reverse transcriptase-polymerase chain reaction, restriction endonuclease digestion, gel electrophoresis and scintillation radiometry. In the prefrontal cortex of controls, < 0.1% of all GluR-2 RNA molecules were unedited and > 99.9% were edited; in the prefrontal cortex both of schizophrenics and of Alzheimer's patients approximately 1.0% of all GluR-2 RNA molecules were unedited and 99% were edited. In the striatum of controls and of schizophrenics, approximately 0.5% of GluR-2 RNA molecules were unedited and 99.5% were edited; in the striatum of Huntington's patients nearly 5.0% of GluR-2 RNA was unedited. In the prefrontal white matter of controls, approximately 7.0% of GluR-2 RNA was unedited. In the normal human prefrontal cortex and striatum, the large majority of GluR-2 RNA molecules contains a CGG codon for arginine in the TMII coding region; this implies that the corresponding AMPA receptors have a low Ca2+ permeability, as previously demonstrated for the rat brain. The process of GluR-2 RNA editing is compromised in a region-specific manner in schizophrenia, in Alzheimer's disease and Huntington's Chorea although in each of these disorders there is still a large excess of edited GluR-2 RNA molecules. Disturbances of GluR-2 RNA editing leading to excessive Ca2+ permeability, may contribute to neuronal dysfunction in schizophrenia and to neuronal death in Alzheimer's disease and Huntington's disease.

Regulation of cellular plasticity and resilience by mood stabilizers: the role of AMPA receptor trafficking

PubMed Central

Du, Jing; Quiroz, Jorge A.; Gray, Neil A.; Szabo, Steve T.; Zarate Jr, Carlos A.; Manji, Husseini K.

2004-01-01

There is increasing evidence from a variety of sources that severe mood disorders are associated with regional reductions in brain volume, as well as reductions in the number, size, and density of glia and neurons in discrete brain areas. Although the precise pathophysiology underlying these morphometric changes remains to be fully elucidated, the data suggest that severe mood disorders are associated with impairments of structural plasticity and cellular resilience. In this context, it is noteworthy that a growing body of data suggests that the glutamaiergic system (which is known to play a major role in neuronal plasticity and cellular resilience) may be involved in the pathophysiology and treatment of mood disorders. Glutamate α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) GluR1 receptor trafficking plays a critical role in regulating various forms of neural plasticity. It is thus noteworthy that recent studies have shown that structurally dissimilar mood stabilizers lithium and valproate regulate GluR1 receptor subunit trafficking and localization at synapses. These studies suggest that regulation of glutamatergically mediated synaptic plasticity may play a role in the treatment of mood disorders, and raises the possibility that agents more directly affecting synaptic GluR1 represent novel therapies for these devastating illnesses. PMID:22034247

Nuclear and membrane estrogen receptor antagonists induce similar mTORC2 activation-reversible changes in synaptic protein expression and actin polymerization in the mouse hippocampus.

PubMed

Xing, Fang-Zhou; Zhao, Yan-Gang; Zhang, Yuan-Yuan; He, Li; Zhao, Ji-Kai; Liu, Meng-Ying; Liu, Yan; Zhang, Ji-Qiang

2018-06-01

Estrogens play pivotal roles in hippocampal synaptic plasticity through nuclear receptors (nERs; including ERα and ERβ) and the membrane receptor (mER; also called GPR30), but the underlying mechanism and the contributions of nERs and mER remain unclear. Mammalian target of rapamycin complex 2 (mTORC2) is involved in actin cytoskeleton polymerization and long-term memory, but whether mTORC2 is involved in the regulation of hippocampal synaptic plasticity by ERs is unclear. We treated animals with nER antagonists (MPP/PHTPP) or the mER antagonist (G15) alone or in combination with A-443654, an activator of mTORC2. Then, we examined the changes in hippocampal SRC-1 expression, mTORC2 signaling (rictor and phospho-AKTSer473), actin polymerization (phospho-cofilin and profilin-1), synaptic protein expression (GluR1, PSD95, spinophilin, and synaptophysin), CA1 spine density, and synapse density. All of the examined parameters except synaptophysin expression were significantly decreased by MPP/PHTPP and G15 treatment. MPP/PHTPP and G15 induced a similar decrease in most parameters except p-cofilin, GluR1, and spinophilin expression. The ER antagonist-induced decreases in these parameters were significantly reversed by mTORC2 activation, except for the change in SRC-1, rictor, and synaptophysin expression. nERs and mER contribute similarly to the changes in proteins and structures associated with synaptic plasticity, and mTORC2 may be a novel target of hippocampal-dependent dementia such as Alzheimer's disease as proposed by previous studies. © 2018 John Wiley & Sons Ltd.

Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

PubMed Central

Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

2013-01-01

A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

Straight-chain alcohols exhibit a cutoff in potency for the inhibition of recombinant glutamate receptor subunits

PubMed Central

Akinshola, B Emmanuel

2001-01-01

The effects of n-alcohols (methanol to 1-decanol) on kainate-activated AMPA receptor subunit GluR1 and GluR3 ion currents were studied in Xenopus oocytes using the two-electrode voltage-clamp recording technique. For short-chain alcohols from methanol to 1-hexanol, potency for inhibition of GluR1 and GluR3 receptor-mediated current increased in proportion to the chain length or hydrophobicity of the alcohol. The IC50 values of these alcohols for GluR1 were: methanol, 702 mM; ethanol, 170 mM; 1-propanol, 69 mM; 1-butanol, 20 mM; 1-pentanol, 17 mM; and 1-hexanol, 10 mM. For GluR3, IC50 values were: methanol, 712 mM; ethanol, 238 mM; 1-propanol, 50 mM; 1-butanol, 32 mM; 1-pentanol, 13 mM; and 1-hexanol, 7 mM. For long-chain alcohols, 1-heptanol was less potent than 1-hexanol (estimated IC50: 19 mM for GluR1 and 18 mM for GluR3), 1-octanol had little effect only on GluR3, and 1-nonanol and 1-decanol did not significantly inhibit both GluR1 and GluR3 responses. The observations indicate that straight-chain n-alcohols exhibit a cutoff in their potency for inhibition of the function of non-NMDA glutamate receptor subunits, GluR1 and GluR3. The cutoff in potency of n-alcohols for inhibition of non-NMDA glutamate receptor function is consistent with the interpretation that alcohols affect the function of these receptor-channels by interacting with an alcohol binding site of specific dimensions on the receptor protein. PMID:11429388

Neuron-to-glia signaling mediated by excitatory amino acid receptors regulates ErbB receptor function in astroglial cells of the neuroendocrine brain.

PubMed

Dziedzic, Barbara; Prevot, Vincent; Lomniczi, Alejandro; Jung, Heike; Cornea, Anda; Ojeda, Sergio R

2003-02-01

Hypothalamic astroglial erbB tyrosine kinase receptors are required for the timely initiation of mammalian puberty. Ligand-dependent activation of these receptors sets in motion a glia-to-neuron signaling pathway that prompts the secretion of luteinizing hormone-releasing hormone (LHRH), the neuropeptide controlling sexual development, from hypothalamic neuroendocrine neurons. The neuronal systems that may regulate this growth factor-mediated back signaling to neuroendocrine neurons have not been identified. Here we demonstrate that hypothalamic astrocytes contain metabotropic receptors of the metabotropic glutamate receptor 5 subtype and the AMPA receptor subunits glutamate receptor 2 (GluR2) and GluR3. As in excitatory synapses, these receptors are in physical association with their respective interacting/clustering proteins Homer and PICK1. In addition, they are associated with erbB-1 and erbB-4 receptors. Concomitant activation of astroglial metabotropic and AMPA receptors results in the recruitment of erbB tyrosine kinase receptors and their respective ligands to the glial cell membrane, transactivation of erbB receptors via a mechanism requiring metalloproteinase activity, and increased erbB receptor gene expression. By facilitating erbB-dependent signaling and promoting erbB receptor gene expression in astrocytes, a neuron-to-glia glutamatergic pathway may represent a basic cell-cell communication mechanism used by the neuroendocrine brain to coordinate the facilitatory transsynaptic and astroglial input to LHRH neurons during sexual development.

Alterations in GluR2 AMPA receptor phosphorylation at serine 880 following group I metabotropic glutamate receptor stimulation in the rat dorsal striatum.

PubMed

Ahn, Sung Min; Choe, Eun Sang

2010-04-01

Phosphorylation of ionotropic glutamate receptors in the brain plays a crucial role in the regulation of synaptic plasticity. In this study, we investigated the regulation of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor phosphorylation by the stimulation of group I metabotropic glutamate receptors (mGluRs) in the dorsal striatum in vivo. The results showed that intrastriatal infusion of the group I mGluR agonist, (RS)-3,5-dihydroxyphenylglycine (DHPG, 250 nmol), enhanced the sensitivity of GluR2 subunit in its phosphorylation at serine 880 (S880) in the dorsal striatum. This enhancement of the sensitivity of GluR2-S880 phosphorylation was reduced by blocking group I mGluRs and N-methyl-D-aspartate (NMDA) receptors. Similar reduction of the enhancement was also induced by inhibiting phospholipase C (PLC), calcium/calmodulin-dependent protein kinase (CaMK), c-Jun N-terminal kinase (JNK), and protein kinase C (PKC). Inhibition of protein phosphatase (PP) 1/2A and calcineurin (PP2B) alone enhanced GluR2-S880 phosphorylation in the dorsal striatum, whereas inhibition of these phosphatases did not further enhance the S880 phosphorylation by DHPG stimulation. In addition, inhibition of PP1/2A or PP2B also enhanced the phosphorylation of CaMKII, JNK and PKC. These data suggest that the phosphorylation of AMPA receptor GluR2 subunit at S880 is subject to the upregulation by the stimulation of group I mGluRs. Interactions among glutamate receptors, protein kinases, and PPs participate in this upregulation. (c) 2009 Wiley-Liss, Inc.

N-linked glycosylation of cortical N-methyl-D-aspartate and kainate receptor subunits in schizophrenia.

PubMed

Tucholski, Janusz; Simmons, Micah S; Pinner, Anita L; McMillan, Laurence D; Haroutunian, Vahram; Meador-Woodruff, James H

2013-08-21

Dysfunctional glutamate neurotransmission has been implicated in the pathophysiology of schizophrenia. Abnormal expressions in schizophrenia of ionotropic glutamate receptors (iGluRs) and the proteins that regulate their trafficking have been found to be region and subunit specific in brain, suggesting that abnormal trafficking of iGluRs may contribute toward altered glutamatergic neurotransmission. The post-translational modification N-glycosylation of iGluR subunits can be used as a proxy for their intracellular localization. Receptor complexes assemble in the lumen of the endoplasmic reticulum, where N-glycosylation begins with the addition of N-linked oligomannose glycans, and is subsequently trimmed and replaced by more elaborate glycans while trafficking through the Golgi apparatus. Previously, we found abnormalities in N-glycosylation of the GluR2 AMPA receptor subunit in schizophrenia. Here, we investigated N-glycosylation of N-methyl-D-aspartate and kainate (KA) receptor subunits in the dorsolateral prefrontal cortex from patients with schizophrenia and a comparison group. We used enzymatic deglycosylation with two glycosidases: endoglycosidase H (Endo H), which removes immature high mannose-containing sugars, and peptide-N-glycosidase F (PNGase F), which removes all N-linked sugars. The NR1, NR2A, NR2B, GluR6, and KA2 subunits were all sensitive to treatment with Endo H and PNGase F. The GluR6 KA receptor subunit was significantly more sensitive to Endo H-mediated deglycosylation in schizophrenia, suggesting a larger molecular mass of N-linked high mannose and/or hybrid sugars on GluR6. This finding, taken with our previous work, suggests that a cellular mechanism underlying abnormal glutamate neurotransmission in schizophrenia may involve abnormal trafficking of both AMPA and KA receptors.

Gene transfer of constitutively active protein kinase C into striatal neurons accelerates onset of levodopa-induced motor response alterations in parkinsonian rats

PubMed Central

Oh, Justin D.; Geller, Alfred I.; Zhang, Guo-rong; Chase, Thomas N.

2006-01-01

Alterations in motor response that complicate levodopa treatment of Parkinson’s disease appear to involve sensitization of striatal ionotropic glutamate receptors. Since protein kinase C (PKC)-mediated phosphorylation regulates glutamatergic receptors of the α-amino-3-hydroxyl-5-methyl-4-isoxazole propionic acid (AMPA) subtype and has been linked to several forms of behavioral plasticity, activation of PKC signaling in striatal spiny neurons may also contribute to the motor plasticity changes associated with chronic levodopa therapy. To evaluate this possibility, we sought to augment PKC signaling by using Herpes Simplex Virus type 1 vectors (pHSVpkcΔ) to directly transfer the catalytic domain of the PKCβII gene into striatal neurons of parkinsonian rats. Microinjection of pHSVpkcΔ vectors lead to the persistent expression of PkcΔ (35% loss over 21 days) in medium spiny neurons together with an increase in serine 831 phosphorylation on AMPA receptor GluR1 subunits and hastened the appearance of the shortened response duration produced by chronic levodopa treatment (P<0.05). In pHSVpkcΔ-infected animals, intrastriatal injection of the PKC inhibitor NPC-15437 (1.0 μg) attenuated both the increased GluR1 phosphorylation (P<0.01) and the accelerated onset of the levodopa-induced response modifications (P<0.01). However, in rats that received levodopa treatment for 21 days without the gene transfer, intrastriatal NPC-15437 had no effect on the response shortening or on GluR1 S831 phosphorylation. The results suggest that an increase in PKC-mediated signaling, including, in part, phosphorylation of AMPA receptors, on striatal spiny neurons may be sufficient to promote the initial appearance, but not necessary the ultimate expression, of the levodopa-induced motor response changes occurring in a rodent model of the human motor complication syndrome. PMID:12691833

Extinction Training Regulates Neuroadaptive Responses to Withdrawal from Chronic Cocaine Self-Administration

PubMed Central

Self, David W.; Choi, Kwang-Ho; Simmons, Diana; Walker, John R.; Smagula, Cynthia S.

2004-01-01

Cocaine produces multiple neuroadaptations with chronic repeated use. Many of these neuroadaptations can be reversed or normalized by extinction training during withdrawal from chronic cocaine self-administration in rats. This article reviews our past and present studies on extinction-induced modulation of the neuroadaptive response to chronic cocaine in the mesolimbic dopamine system, and the role of this modulation in addictive behavior in rats. Extinction training normalizes tyrosine hydroxylase levels in the nucleus accumbens (NAc) shell, an effect that could help ameliorate dysphoria and depression associated with withdrawal from chronic cocaine use. Extinction training also increases levels of GluR1 and GluR2/3 AMPA receptor subunits, while normalizing deficits in NR1 NMDA receptor subunits, in a manner consistent with long-term potentiation of excitatory synapses in the NAc shell. Our results suggest that extinction-induced increases in AMPA and NMDA receptors may restore deficits in cortico-accumbal neurotransmission in the NAc shell and facilitate inhibitory control over cocaine-seeking behavior. Other changes identified by gene expression profiling, including up-regulation in the AMPA receptor aggregating protein Narp, suggest that extinction training induces extensive synaptic reorganization. These studies highlight potential benefits for extinction training procedures in the treatment of drug addiction. PMID:15466321

Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

2005-11-01

The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

Ethanol up-regulates nucleus accumbens neuronal activity dependent pentraxin (Narp): implications for alcohol-induced behavioral plasticity.

PubMed

Ary, Alexis W; Cozzoli, Debra K; Finn, Deborah A; Crabbe, John C; Dehoff, Marlin H; Worley, Paul F; Szumlinski, Karen K

2012-06-01

Neuronal activity dependent pentraxin (Narp) interacts with α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate (AMPA) glutamate receptors to facilitate excitatory synapse formation by aggregating them at established synapses. Alcohol is well-characterized to influence central glutamatergic transmission, including AMPA receptor function. Herein, we examined the influence of injected and ingested alcohol upon Narp protein expression, as well as basal Narp expression in mouse lines selectively bred for high blood alcohol concentrations under limited access conditions. Alcohol up-regulated accumbens Narp levels, concomitant with increases in levels of the GluR1 AMPA receptor subunit. However, accumbens Narp or GluR1 levels did not vary as a function of selectively bred genotype. We next employed a Narp knock-out (KO) strategy to begin to understand the behavioral relevance of alcohol-induced changes in protein expression in several assays of alcohol reward. Compared to wild-type mice, Narp KO animals: fail to escalate daily intake of high alcohol concentrations under free-access conditions; shift their preference away from high alcohol concentrations with repeated alcohol experience; exhibit a conditioned place-aversion in response to the repeated pairing of 3 g/kg alcohol with a distinct environment and fail to exhibit alcohol-induced locomotor hyperactivity following repeated alcohol treatment. Narp deletion did not influence the daily intake of either food or water, nor did it alter any aspect of spontaneous or alcohol-induced motor activity, including the development of tolerance to its motor-impairing effects with repeated treatment. Taken together, these data indicate that Narp induction, and presumably subsequent aggregation of AMPA receptors, may be important for neuroplasticity within limbic subcircuits mediating or maintaining the rewarding properties of alcohol. Published by Elsevier Inc.

Ethanol up-regulates nucleus accumbens neuronal activity dependent pentraxin (Narp): implications for alcohol-induced behavioral plasticity

PubMed Central

Ary, Alexis W.; Cozzoli, Debra K.; Finn, Deborah A.; Crabbe, John C.; Dehoff, Marlin H.; Worley, Paul F.; Szumlinski, Karen K.

2012-01-01

Neuronal activity-dependent pentraxin (Narp) interacts with α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate (AMPA) glutamate receptors to facilitate excitatory synapse formation by aggregating them at established synapses. Alcohol is well-characterized to influence central glutamatergic transmission, including AMPA receptor function. Herein, we examined the influence of injected and ingested alcohol upon Narp protein expression, as well as basal Narp expression in mouse lines selectively bred for high blood alcohol concentrations under limited access conditions. Alcohol up-regulated accumbens Narp levels, concomitant with increases in levels of the GluR1 AMPA receptor subunit. However, accumbens Narp or GluR1 levels did not vary as a function of selectively bred genotype. We next employed a Narp knock-out (KO) strategy to begin to understand the behavioral relevance of alcohol-induced changes in protein expression in several assays of alcohol reward. Compared to wild-type mice, Narp KO animals: fail to escalate daily intake of high alcohol concentrations under free-access conditions; shift their preference away from high alcohol concentrations with repeated alcohol experience; exhibit a conditioned place-aversion in response to the repeated pairing of 3 g/kg alcohol with a distinct environment and fail to exhibit alcohol-induced locomotor hyperactivity following repeated alcohol treatment. Narp deletion did not influence the daily intake of either food or water, nor did it alter any aspect of spontaneous or alcohol-induced motor activity, including the development of tolerance to its motor-impairing effects with repeated treatment. Taken together, these data indicate that Narp induction, and presumably subsequent aggregation of AMPA receptors, may be important for neuroplasticity within limbic subcircuits mediating or maintaining the rewarding properties of alcohol. PMID:22444953

[Effect of rhynchophylline on behaviors of methamphetamine-dependent zebrafish and the mechanism].

PubMed

Chen, Yi-Fei; Peng, Ju; Fang, Miao; Liu, Yi; Nie, Ling-Hui; Mo, Zhi-Xian; Zhu, Ling-Ling

2016-11-20

To observe the effect of rhynchophylline on methamphetamine-dependent zebrafish and explore the possible mechanism. Zebrafish were divided into control group, amphetamine group, low- (50 mg/kg) and high (100 mg/kg)-dose rhynchophylline groups, and ketamine (150 mg/kg) group. Conditioned place preference (CPP) was induced in zebrafish with methamphetamine, and the staying time in the drug box and the tracking map of the zebrafish were observed with Noldus Ethovision XT system. The protein expressions of TH, NR2B and GLUR2 in the brain of zebrafish with CPP were detected with Western blotting. Compared with the control group, zebrafish in methamphetamine group showed significant variations in the staying time and swimming distance in the drug box after conditioning (P<0.05) with obvious alterations of NR2B, TH and GLUR2 expressions in the brain (P<0.05). Treatment of methamphetamine-dependent zebrafish with high-dose rhynchophylline significantly reduced the variations in the staying time and swimming distance in the drug box (P<0.05) and in the expressions of NR2B, TH and GLUR2 in the brain (P<0.05). Rhynchophylline can inhibit methamphetamine dependence in zebrafish, the mechanism of which may involve the expressions of TH, NR2B and GLUR2 proteins in the brain.

Cytochemical Organization of the Retino-Suprachiasmatic System

DTIC Science & Technology

1994-03-11

strongly expiessed of the, non-NMDA ionotropic receptors . Other AMPA-preferring receptors , GluR3 and -R4, were also found, but to lesser extent...kainate, and NMDA receptor RN was found in the hypothalamus. GluRi and GluR2 were ang the nmst strongly expressed of the non-NvDA ionotropic receptors ...several different glutamate receptors . The expression of many different types of ionotropic glutamate receptors throughout the hypothalamus suggests that

Distribution of AMPA receptor subunits GluR1-4 in the dorsal vagal complex of the rat: a light and electron microscope immunocytochemical study.

PubMed

Kessler, J P; Baude, A

1999-10-01

The dorsal vagal complex, localized in the dorsomedial medulla, includes the nucleus tractus solitarii (NTS), the dorsal motor nucleus of the vagus nerve (DMN) and the area postrema (AP). The distribution of AMPA-preferring glutamate receptors (AMPA receptors) within this region was investigated using immunohistochemistry and antibodies recognizing either one (GluR1 or GluR4) or two (GluR2 and GluR3) AMPA receptors subunits. The distribution of GluR1 immunoreactivity showed high contrast of staining between strongly and lightly labeled areas. Labeling was intense in the AP and weak in the NTS, except for its medial and dorsalmost parts which exhibited moderate staining. Almost no GluR1 immunoreactivity was found in the DMN. GluR2/3 immunolabeling was present in the entire dorsal vagal complex. This labeling was strong in the AP, the DMN and the medial half of the NTS and moderate in the lateral half of the NTS, except for the interstitial subdivision which exhibited intense staining. Labeling induced by the GluR4 antibody was very weak throughout the dorsal vagal complex. Ultrastructural examination showed that GluR1 and GluR2/3 immunoreactivity was localized in neuronal cell bodies and dendrites. No labeled axon terminal or glial cell body was found. Immunoperoxidase staining in labeled cell bodies and dendrites was associated with intracellular organelles (microtubules, mitochondria, cisternae of the endoplasmic reticulum,.) and/or parts of the plasma membrane. Plasma membrane labeling was often associated with asymmetrical synaptic differentiations. No labeled symmetrical synapse was found using either GluR1 or GluR2/3 antibody. The present results show that AMPA receptors have a widespread distribution in neuronal perikarya and dendrites of the rat dorsal vagal complex. They suggest differences in subunit composition between AMPA receptors localized in the NTS, the DMN and the AP. Ultrastructural data are consistent with the fact that AMPA receptors associated with the plasma membrane are mostly synaptic receptors. However, they also suggest the existence of a large intracellular pool of receptor subunits in neuronal soma and dendrites. Copyright 1999 Wiley-Liss, Inc.

Early continuous white noise exposure alters l-alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor subunit glutamate receptor 2 and gamma-aminobutyric acid type a receptor subunit beta3 protein expression in rat auditory cortex.

PubMed

Xu, Jinghong; Yu, Liping; Zhang, Jiping; Cai, Rui; Sun, Xinde

2010-02-15

Auditory experience during the postnatal critical period is essential for the normal maturation of auditory function. Previous studies have shown that rearing infant rat pups under conditions of continuous moderate-level noise delayed the emergence of adult-like topographic representational order and the refinement of response selectivity in the primary auditory cortex (A1) beyond normal developmental benchmarks and indefinitely blocked the closure of a brief, critical-period window. To gain insight into the molecular mechanisms of these physiological changes after noise rearing, we studied expression of the AMPA receptor subunit GluR2 and GABA(A) receptor subunit beta3 in the auditory cortex after noise rearing. Our results show that continuous moderate-level noise rearing during the early stages of development decreases the expression levels of GluR2 and GABA(A)beta3. Furthermore, noise rearing also induced a significant decrease in the level of GABA(A) receptors relative to AMPA receptors. However, in adult rats, noise rearing did not have significant effects on GluR2 and GABA(A)beta3 expression or the ratio between the two units. These changes could have a role in the cellular mechanisms involved in the delayed maturation of auditory receptive field structure and topographic organization of A1 after noise rearing. Copyright 2009 Wiley-Liss, Inc.

Prolonged seizure activity leads to increased Protein Kinase A activation in the rat pilocarpine model of status epilepticus.

PubMed

Bracey, James M; Kurz, Jonathan E; Low, Brian; Churn, Severn B

2009-08-04

Status epilepticus is a life-threatening form of seizure activity that represents a major medical emergency associated with significant morbidity and mortality. Protein Kinase A is an important regulator of synaptic strength that may play an important role in the development of status epilepticus-induced neuronal pathology. This study demonstrated an increase in PKA activity against exogenous and endogenous substrates during later stages of SE. As SE progressed, a significant increase in PKA-mediated phosphorylation of an exogenous peptide substrate was demonstrated in cortical structures. The increased activity was not due to altered expression of either regulatory or catalytic subunits of the enzyme. Through the use of phospho-specific antibodies, this study also investigated the effects of SE on the phosphorylation of the GluR1 subunit of the AMPA subtype of glutamate receptor. After the onset of continuous seizure activity, an increase in phosphorylation of the PKA site on the GluR1 subunit of the AMPA receptor was observed. These data suggest a potential mechanism by which SE may increase neuronal excitability in the cortex, potentially leading to maintenance of seizure activity or long-term neuronal pathology.

Modulation of spinal nociception by GluR5 kainate receptor ligands in acute and hyperalgesic states and the role of gabaergic mechanisms.

PubMed

Mascias, Paula; Scheede, Manuela; Bloms-Funke, Petra; Chizh, Boris

2002-09-01

GluR5 receptors modulate spinal nociception, however, their role in nociceptive hypersensitivity remains unclear. Using behavioural and electrophysiological approaches, we have investigated several GluR5 ligands in acute and hyperalgesic states. Furthermore, as the GABAergic system plays a role in GluR5 mediated effects in the brain, we also analysed the interaction between GluR5 agonists and GABA(A) antagonists in the spinal cord. In young rats in vivo, the GluR5 selective agonist ATPA was antinociceptive and antihyperalgesic in a model of inflammatory hyperalgesia (ED(50) approximately 4.6 and approximately 5.2 mg/kg, respectively), whereas the GluR5/GluR6 agonist SYM2081 was only antihyperalgesic. ATPA, but not SYM2081, was also able to inhibit nociceptive motoneurone responses in anaesthetised adult rats after intrathecal administration. In hemisected spinal cords in vitro, SYM2081 was inactive, whereas ATPA and another GluR5 agonist, (S)-5-iodowillardiine, inhibited nociceptive reflexes (EC(50) 1.1+/-0.4 micro M and 0.36+/-0.05 micro M, respectively). Both GluR5 agonists also inhibited motoneurone responses to repetitive dorsal root stimulation and their cumulative depolarisation, a correlate of wind-up. The GABA(A) antagonists bicuculline (10 micro M) and SR95531 (1 micro M) enhanced polysynaptic responses to single stimuli but abolished the cumulative depolarisation. Both bicuculline and SR95531 significantly attenuated the inhibition of nociceptive responses by 1 micro M ATPA (by approximately 50%). We conclude that selective GluR5 kainate receptor activation inhibits spinal nociception and its sensitisation caused by ongoing peripheral nociceptive drive. GABA(A) receptors are involved in tonic inhibition of segmental responses, but contribute to their sensitisation by repetitive primary afferent stimulation. Furthermore, there is a cross-talk between the two systems, presumably due to GluR5-mediated activation of GABAergic inhibitory interneurones in the spinal cord.

Plasticity-Related PKMζ Signaling in the Insular Cortex Is Involved in the Modulation of Neuropathic Pain after Nerve Injury

PubMed Central

Han, Jeongsoo; Kwon, Minjee; Cha, Myeounghoon; Tanioka, Motomasa; Hong, Seong-Karp; Bai, Sun Joon; Lee, Bae Hwan

2015-01-01

The insular cortex (IC) is associated with important functions linked with pain and emotions. According to recent reports, neural plasticity in the brain including the IC can be induced by nerve injury and may contribute to chronic pain. Continuous active kinase, protein kinase Mζ (PKMζ), has been known to maintain the long-term potentiation. This study was conducted to determine the role of PKMζ in the IC, which may be involved in the modulation of neuropathic pain. Mechanical allodynia test and immunohistochemistry (IHC) of zif268, an activity-dependent transcription factor required for neuronal plasticity, were performed after nerve injury. After ζ-pseudosubstrate inhibitory peptide (ZIP, a selective inhibitor of PKMζ) injection, mechanical allodynia test and immunoblotting of PKMζ, phospho-PKMζ (p-PKMζ), and GluR1 and GluR2 were observed. IHC demonstrated that zif268 expression significantly increased in the IC after nerve injury. Mechanical allodynia was significantly decreased by ZIP microinjection into the IC. The analgesic effect lasted for 12 hours. Moreover, the levels of GluR1, GluR2, and p-PKMζ were decreased after ZIP microinjection. These results suggest that peripheral nerve injury induces neural plasticity related to PKMζ and that ZIP has potential applications for relieving chronic pain. PMID:26457205

Glutamate receptor 1 phosphorylation at serine 831 and 845 modulates seizure susceptibility and hippocampal hyperexcitability after early life seizures.

PubMed

Rakhade, Sanjay N; Fitzgerald, Erin F; Klein, Peter M; Zhou, Chengwen; Sun, Hongyu; Huganir, Richard L; Hunganir, Richard L; Jensen, Frances E

2012-12-05

Neonatal seizures can lead to later life epilepsy and neurobehavioral deficits, and there are no treatments to prevent these sequelae. We showed previously that hypoxia-induced seizures in a neonatal rat model induce rapid phosphorylation of serine-831 (S831) and Serine 845 (S845) sites of the AMPA receptor GluR1 subunit and later neuronal hyperexcitability and epilepsy, suggesting that seizure-induced posttranslational modifications may represent a novel therapeutic target. To unambiguously assess the contribution of these sites, we examined seizure susceptibility in wild-type mice versus transgenic knock-in mice with deficits in GluR1 S831 and S845 phosphorylation [GluR1 double-phosphomutant (GluR1 DPM) mice]. Phosphorylation of the GluR1 S831 and S845 sites was significantly increased in the hippocampus and cortex after a single episode of pentyleneterazol-induced seizures in postnatal day 7 (P7) wild-type mouse pups and that transgenic knock-in mice have a higher threshold and longer latencies to seizures. Like the rat, hypoxic seizures in P9 C57BL/6N wild-type mice resulted in transient increases in GluR1 S831 and GluR1 S845 phosphorylation in cortex and were associated with enhanced seizure susceptibility to later-life kainic-acid-induced seizures. In contrast, later-life seizure susceptibility after hypoxia-induced seizures was attenuated in GluR1 DPM mice, supporting a role for posttranslational modifications in seizure-induced network excitability. Finally, human hippocampal samples from neonatal seizure autopsy cases also showed an increase in GluR1 S831 and S845, supporting the validation of this potential therapeutic target in human tissue.

Glutamate receptor 1 phosphorylation at Serine 831 and 845 modulates seizure susceptibility and hippocampal hyperexcitability following early life seizures

PubMed Central

Rakhade, S.N.; Fitzgerald, E.F.; Klein, P.M.; Zhou, C.; Sun, H; Huganir, R.L.; Jensen, F.E.

2012-01-01

Neonatal seizures can lead to later life epilepsy and neurobehavioral deficits, and there are no treatments to prevent these sequelae. We previously showed that hypoxia-induced seizures in a neonatal rat model induce rapid phosphorylation of S831 and S845 sites of the AMPA receptor GluR1 subunit and later neuronal hyperexcitability and epilepsy, suggesting that seizure-induced post-translational modifications may represent a novel therapeutic target. To unambiguously assess the contribution of these sites, we examined seizure susceptibility in wild type mice versus transgenic knock-in mice with deficits in GluR1 S831 and S845 phosphorylation (GluR1 double phosphomutant (GluR1DPM) mice). Phosphorylation of the GluR1 S831 and S845 sites was significantly increased in the hippocampus and cortex following a single episode of pentyleneterazol (PTZ) induced seizures in postnatal day 9 (P9) wild type mouse pups, and that transgenic knock-in mice have a higher threshold and longer latencies to seizures. Like the rat, hypoxic seizures in P9 C57BL/6N wild type mice resulted in transient increases in GluR1 S831 and GluR1 S845 phosphorylation in cortex, and were associated with enhanced seizure susceptibility to later-life kainic acid induced seizures. In contrast, later-life seizure susceptibility following hypoxia-induced seizures was attenuated in GluR1 DPM mice, supporting a role for post-translational modifications in seizure-induced network excitability. Finally, human hippocampal samples from neonatal seizure autopsy cases also showed an increase in GluR1 S831 and S845, supporting the validation of this potential therapeutic target in human tissue. PMID:23223299

Functional kainate-selective glutamate receptors in cultured hippocampal neurons.

PubMed

Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B

1993-12-15

Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors.

Functional kainate-selective glutamate receptors in cultured hippocampal neurons.

PubMed Central

Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B

1993-01-01

Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors. PMID:7505445

Glutamate increases pancreatic cancer cell invasion and migration via AMPA receptor activation and Kras-MAPK signaling.

PubMed

Herner, Alexander; Sauliunaite, Danguole; Michalski, Christoph W; Erkan, Mert; De Oliveira, Tiago; Abiatari, Ivane; Kong, Bo; Esposito, Irene; Friess, Helmut; Kleeff, Jörg

2011-11-15

Glutamate has been implicated in tumorigenesis through activation of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors (AMPAR). However, the function of a glutamate-to-AMPAR signal in pancreatic ductal adenocarcinoma (PDAC) has remained elusive. We now show that glutamate-mediated AMPA receptor activation increases invasion and migration of pancreatic cancer cells via activation of the classical MAPK pathway. Glutamate levels were increased in pancreatic cancer accompanied by downregulation of GluR subunits 1, 2, and 4. In pancreatic cancer precursor lesions, pancreatic intraepithelial neoplasia (PanIN), GluR1 subunit levels were strikingly and step-wise increased but its expression was rare in PDAC. Pharmacological inhibition or RNAi-mediated suppression of GluR1 or GluR2 did not affect cancer cell growth but significantly decreased invasion. In a K-ras wildtype cell line, AMPA receptor activation enhanced K-ras activity and--further downstream--phosphorylation of p38 and of p44/42. Preemptive blockade of AMPA receptors in a mouse model of pancreatic cancer inhibited tumor cell settling. AMPA receptor activation thus not only activates MAPK signalling but also directly increases activity of K-ras. Glutamate might serve as a molecular switch that decreases the threshold of K-ras-induced oncogenic signalling and increases the chance of malignant transformation of pancreatic cancer precursor lesions. Copyright © 2011 UICC.

NMDA and AMPA receptors in the anterior cingulate cortex mediates visceral pain in visceral hypersensitivity rats.

PubMed

Zhou, Lin; Huang, Junjing; Gao, Jun; Zhang, Guanpo; Jiang, Jinjin

2014-02-01

Several studies have shown that N-methyl-D-aspartate (NMDA)-receptor activation in anterior cingulate cortex (ACC) neurons plays critical roles in modulating visceral pain responses in visceral hypersensitivity (VH) rats. However, there are few reports about the expressions of NMDA and α-amino-3-hydroxy-5-methyl-4-isox-azolepropionic-acid (AMPA) receptor subtypes in ACC of VH model rats at different time points. The current study was undertaken to investigate NR2A, NR2B and GluR2 expressions in ACC of VH rats that were induced by administration with 5% mustard oil. Our results indicated that NR2B, but not NR2A, was highly expressed in VH model group on day 15, 22, and 36 compared with normal group (p < 0.05). GluR2 expression was also higher in VH model group on day 15, 22, and 36 than that of normal group (p < 0.05). These findings suggested increased expression of NR2B and GluR2 might be key mechanisms for long-term synaptic plastic changes in VH rats. Copyright © 2014. Published by Elsevier Inc.

The type II cGMP dependent protein kinase regulates GluA1 levels at the plasma membrane of developing cerebellar granule cells

PubMed Central

Incontro, Salvatore; Ciruela, Francisco; Ziff, Edward; Hofmann, Franz; Sánchez-Prieto, José; Torres, Magdalena

2014-01-01

Trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) is regulated by specific interactions with other proteins and by post-translational mechanisms, such as phosphorylation. We have found that the type II cGMP-dependent protein kinase (cGKII) phosphorylates GluA1 (formerly GluR1) at S845, augmenting the surface expression of AMPARs at both synaptic and extrasynaptic sites. Activation of cGKII by 8-Br-cGMP enhances the surface expression of GluA1, whereas its inhibition or suppression effectively diminished the expression of this protein at the cell surface. In granule cells, NMDA receptor activation (NMDAR) stimulates nitric oxide and cGMP production, which in turn activates cGKII and induces the phosphorylation of GluA1, promoting its accumulation in the plasma membrane. GluA1 is mainly incorporated into calcium permeable AMPARs as exposure to 8-Br-cGMP or NMDA activation enhanced AMPA-elicited calcium responses that are sensitive to NASPM inhibition. We summarize evidence for an increase of calcium permeable AMPA receptors downstream of NMDA receptor activation that might be relevant for granule cell development and plasticity. PMID:23545413

Motor Skills Training Enhances α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid Receptor Subunit mRNA Expression in the Ipsilateral Sensorimotor Cortex and Striatum of Rats Following Intracerebral Hemorrhage.

PubMed

Tamakoshi, Keigo; Ishida, Kazuto; Kawanaka, Kentaro; Takamatsu, Yasuyuki; Tamaki, Hiroyuki

2017-10-01

We investigated the effects of acrobatic training (AT) on expression of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) subunits in the sensorimotor cortex and striatum after intracerebral hemorrhage (ICH). Male Wistar rats were divided into 4 groups: ICH without AT (ICH), ICH with AT (ICH + AT), sham operation without AT (SHAM), and sham operation with AT (SHAM + AT). ICH was induced by collagenase injection into the left striatum. The ICH + AT group performed 5 acrobatic tasks daily on days 4-28 post ICH. Forelimb sensorimotor function was evaluated using the forelimb placing test. On days 14 and 29, mRNA expression levels of AMPAR subunits GluR1-4 were measured by real-time reverse transcription-polymerase chain reaction. Forelimb placing test scores were significantly higher in the ICH + AT group than in the ICH group. Expression levels of all AMPAR subunit mRNAs were significantly higher in the ipsilateral sensorimotor cortex of rats in the ICH + AT group than in that of rats in the ICH group on day 29. GluR3 and GluR4 expression levels were reduced in the ipsilateral striatum of rats in the ICH group compared with that of rats in the SHAM group on day 14. These changes may play a critical role in motor skills training-induced recovery after ICH. Copyright © 2017 National Stroke Association. Published by Elsevier Inc. All rights reserved.

Enhanced susceptibility of Prnp-deficient mice to kainate-induced seizures, neuronal apoptosis, and death: Role of AMPA/kainate receptors.

PubMed

Rangel, Alejandra; Burgaya, Ferran; Gavín, Rosalina; Soriano, Eduardo; Aguzzi, Adriano; Del Río, José A

2007-09-01

Normal physiologic functions of the cellular prion protein (PrPc) are still elusive. This GPI-anchored protein exerts many functions, including roles in neuron proliferation, neuroprotection or redox homeostasis. There are, however, conflicting data concerning its role in synaptic transmission. Although several studies report that PrPc participates in NMDA-mediated neurotransmission, parallel studies describe normal behavior of PrPc-mutant mice. Abnormal axon connections have been described in the dentate gyrus of the hippocampi of PrPc-deficient mice similar to those observed in epilepsy. A study indicates increased susceptibility to kainate (KA) in these mutant mice. We extend the observation of these studies by means of several histologic and biochemical analyses of KA-treated mice. PrPc-deficient mice showed increased sensitivity to KA-induced seizures in vivo and in vitro in organotypic slices. In addition, we show that this sensitivity is cell-specific because interference experiments to abolish PrPc expression increased susceptibility to KA in PrPc-expressing cells. We indicate a correlation of susceptibility to KA in cells lacking PrPc with the differential expression of GluR6 and GluR7 KA receptor subunits using real-time RT-PCR methods. These results indicate that PrPc exerts a neuroprotective role against KA-induced neurotoxicity, probably by regulating the expression of KA receptor subunits. (c) 2007 Wiley-Liss, Inc.

Glutamate mediates platelet activation through the AMPA receptor

PubMed Central

Morrell, Craig N.; Sun, Henry; Ikeda, Masahiro; Beique, Jean-Claude; Swaim, Anne Marie; Mason, Emily; Martin, Tanika V.; Thompson, Laura E.; Gozen, Oguz; Ampagoomian, David; Sprengel, Rolf; Rothstein, Jeffrey; Faraday, Nauder; Huganir, Richard; Lowenstein, Charles J.

2008-01-01

Glutamate is an excitatory neurotransmitter that binds to the kainate receptor, the N-methyl-D-aspartate (NMDA) receptor, and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each receptor was first characterized and cloned in the central nervous system (CNS). Glutamate is also present in the periphery, and glutamate receptors have been identified in nonneuronal tissues, including bone, heart, kidney, pancreas, and platelets. Platelets play a central role in normal thrombosis and hemostasis, as well as contributing greatly to diseases such as stroke and myocardial infarction. Despite the presence of glutamate in platelet granules, the role of glutamate during hemostasis is unknown. We now show that activated platelets release glutamate, that platelets express AMPAR subunits, and that glutamate increases agonist-induced platelet activation. Furthermore, we demonstrate that glutamate binding to the AMPAR increases intracellular sodium concentration and depolarizes platelets, which are important steps in platelet activation. In contrast, platelets treated with the AMPAR antagonist CNQX or platelets derived from GluR1 knockout mice are resistant to AMPA effects. Importantly, mice lacking GluR1 have a prolonged time to thrombosis in vivo. Our data identify glutamate as a regulator of platelet activation, and suggest that the AMPA receptor is a novel antithrombotic target. PMID:18283118

Different structural requirements for functional ion pore transplantation suggest different gating mechanisms of NMDA and kainate receptors.

PubMed

Villmann, Carmen; Hoffmann, Jutta; Werner, Markus; Kott, Sabine; Strutz-Seebohm, Nathalie; Nilsson, Tanja; Hollmann, Michael

2008-10-01

Although considerable progress has been made in characterizing the physiological function of the high-affinity kainate (KA) receptor subunits KA1 and KA2, no homomeric ion channel function has been shown. An ion channel transplantation approach was employed in this study to directly test if homomerically expressed KA1 and KA2 pore domains are capable of conducting currents. Transplantation of the ion pore of KA1 or KA2 into GluR6 generated perfectly functional ion channels that allowed characterization of those electrophysiological and pharmacological properties that are determined exclusively by the ion pore of KA1 or KA2. This demonstrates for the first time that KA1 and KA2 ion pore domains are intrinsically capable of conducting ions even in homomeric pore assemblies. NMDA receptors, similar to KA1- or KA2-containing receptors, function only as heteromeric complexes. They are composed of NR1 and NR2 subunits, which both are non-functional when expressed homomerically. In contrast to NR1, the homomeric NR2B ion pore failed to translate ligand binding into pore opening when transplanted into GluR6. Similarly, heteromeric coexpression of the ion channel domains of both NR1 and NR2 inserted into GluR6 failed to produce functional channels. Therefore, we conclude that the mechanism underlying the ion channel opening in the obligatorily heterotetrameric NMDA receptors differs significantly from that in the facultatively heterotetrameric alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate and KA receptors.

Sex-specific effects of prenatal chronic mild stress on adult spatial learning capacity and regional glutamate receptor expression profiles.

PubMed

Wang, Yan; Ma, Yuchao; Hu, Jingmin; Zhang, Xinxin; Cheng, Wenwen; Jiang, Han; Li, Min; Ren, Jintao; Zhang, Xiaosong; Liu, Mengxi; Sun, Anji; Wang, Qi; Li, Xiaobai

2016-07-01

Both animal experiments and clinical studies have demonstrated that prenatal stress can cause cognitive disorders in offspring. To explore the scope of these deficits and identify potential underlying mechanisms, we examined the spatial learning and memory performance and glutamate receptor (GluR) expression patterns of adult rats exposed to prenatal chronic mild stress (PCMS). Principal component analysis (PCA) was employed to reveal the interrelationships among spatial learning indices and GluR expression changes. Female PCMS-exposed offspring exhibited markedly impaired spatial learning and memory in the Morris water maze (MWM) task compared to control females, while PCMS-exposed males showed better initial spatial learning in the MWM compared to control males. PCMS also altered basal and post-MWM glutamate receptor expression patterns, but these effects differed markedly between sexes. Male PCMS-exposed offspring exhibited elevated basal expression of NR1, mGluR5, and mGluR2/3 in the prefrontal cortex (PFC), whereas females showed no basal expression changes. Following MWM training, PCMS-exposed males expressed higher NR1 in the PFC and mammillary body (MB), higher mGluR2/3 in PFC, and lower NR2B in the hippocampus (HIP), PFC, and MB compared to unstressed MWM-trained males. Female PCMS-exposed offspring showed strongly reduced NR1 in MB and NR2B in the HIP, PFC, and MB, and increased mGluR2/3 in PFC compared to unstressed MWM-trained females. This is the first report suggesting that NMDA subunits in the MB are involved in spatial learning. Additionally, PCA further suggests that the NR1-NR2B form is the most important for spatial memory formation. These results reveal long-term sex-specific effects of PCMS on spatial learning and memory performance in adulthood and implicate GluR expression changes within HIP, PFC, and MB as possible molecular mechanisms underlying cognitive dysfunction in offspring exposed to prenatal stress. Copyright © 2016 Elsevier Inc. All rights reserved.

Developmental regulation of N-methyl-D-aspartate- and kainate-type glutamate receptor expression in the rat spinal cord

NASA Technical Reports Server (NTRS)

Stegenga, S. L.; Kalb, R. G.

2001-01-01

Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.

Boutons containing vesicular zinc define a subpopulation of synapses with low AMPAR content in rat hippocampus.

PubMed

Sindreu, Carlos Balet; Varoqui, Hélène; Erickson, Jeffrey D; Pérez-Clausell, Jeús

2003-08-01

Cortical regions of the brain stand out for their high content in synaptic zinc, which may thus be involved in synaptic function. The relative number, chemical nature and transmitter receptor profile of synapses that sequester vesicular zinc are largely unknown. To address this, we combined pre-embedding zinc histochemistry and post-embedding immunogold electron microscopy in rat hippocampus. All giant mossy fibre (MF) terminals in the CA3 region and approximately 45% of boutons making axospinous synapses in stratum radiatum in CA1 contained synaptic vesicles that stained for zinc. Both types of zinc-positive boutons selectively expressed the vesicular zinc transporter ZnT-3. Zinc-positive boutons further immunoreacted to the vesicular glutamate transporter VGLUT-1, but not to the transmitter gamma-aminobutyric acid. Most dendritic spines in CA1 immunoreacted to alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor (AMPAR) subunits GluR1-3 (approximately 80%) and to N-methyl-D-aspartate receptor (NMDAR) subunits NR1 + NR2A/B (approximately 90%). Synapses made by zinc-positive boutons contained 40% less AMPAR particles than those made by zinc-negative boutons, whereas NMDAR counts were similar. Further analysis indicated that this was due to the reduced synaptic expression of both GluR1 and GluR2 subunits. Hence, the levels of postsynaptic AMPARs may vary according to the presence of vesicular zinc in excitatory afferents to CA1. Zinc-positive and zinc-negative synapses may represent two glutamatergic subpopulations with distinct synaptic signalling.

Late calcium EDTA rescues hippocampal CA1 neurons from global ischemia-induced death.

PubMed

Calderone, Agata; Jover, Teresa; Mashiko, Toshihiro; Noh, Kyung-min; Tanaka, Hidenobu; Bennett, Michael V L; Zukin, R Suzanne

2004-11-03

Transient global ischemia induces a delayed rise in intracellular Zn2+, which may be mediated via glutamate receptor 2 (GluR2)-lacking AMPA receptors (AMPARs), and selective, delayed death of hippocampal CA1 neurons. The molecular mechanisms underlying Zn2+ toxicity in vivo are not well delineated. Here we show the striking finding that intraventricular injection of the high-affinity Zn2+ chelator calcium EDTA (CaEDTA) at 30 min before ischemia (early CaEDTA) or at 48-60 hr (late CaEDTA), but not 3-6 hr, after ischemia, afforded robust protection of CA1 neurons in approximately 50% (late CaEDTA) to 75% (early CaEDTA) of animals. We also show that Zn2+ acts via temporally distinct mechanisms to promote neuronal death. Early CaEDTA attenuated ischemia-induced GluR2 mRNA and protein downregulation (and, by inference, formation of Zn2+-permeable AMPARs), the delayed rise in Zn2+, and neuronal death. These findings suggest that Zn2+ acts at step(s) upstream from GluR2 gene downregulation and implicate Zn2+ in transcriptional regulation and/or GluR2 mRNA stability. Early CaEDTA also blocked mitochondrial release of cytochrome c and Smac/DIABLO (second mitochondria-derived activator of caspases/direct inhibitor of apoptosis protein-binding protein with low pI), caspase-3 activity (but not procaspase-3 cleavage), p75NTR induction, and DNA fragmentation. These findings indicate that CaEDTA preserves the functional integrity of the mitochondrial outer membrane and arrests the caspase death cascade. Late injection of CaEDTA at a time when GluR2 is downregulated and caspase is activated inhibited the delayed rise in Zn2+, p75NTR induction, DNA fragmentation, and cell death. The finding of neuroprotection by late CaEDTA administration has striking implications for intervention in the delayed neuronal death associated with global ischemia.

A Single Brief Burst Induces GluR1-Dependent Associative Short-Term Potentiation: A Potential Mechanism for Short-Term Memory

ERIC Educational Resources Information Center

Erickson, Martha A.; Maramara, Lauren A.; Lisman, John

2010-01-01

Recent work showed that short-term memory (STM) is selectively reduced in GluR1 knockout mice. This raises the possibility that a form of synaptic modification dependent on GluR1 might underlie STM. Studies of synaptic plasticity have shown that stimuli too weak to induce long-term potentiation induce short-term potentiation (STP), a phenomenon…

Input from the medial geniculate nucleus modulates amygdala encoding of fear memory discrimination.

PubMed

Ferrara, Nicole C; Cullen, Patrick K; Pullins, Shane P; Rotondo, Elena K; Helmstetter, Fred J

2017-09-01

Generalization of fear can involve abnormal responding to cues that signal safety and is common in people diagnosed with post-traumatic stress disorder. Differential auditory fear conditioning can be used as a tool to measure changes in fear discrimination and generalization. Most prior work in this area has focused on elevated amygdala activity as a critical component underlying generalization. The amygdala receives input from auditory cortex as well as the medial geniculate nucleus (MgN) of the thalamus, and these synapses undergo plastic changes in response to fear conditioning and are major contributors to the formation of memory related to both safe and threatening cues. The requirement for MgN protein synthesis during auditory discrimination and generalization, as well as the role of MgN plasticity in amygdala encoding of discrimination or generalization, have not been directly tested. GluR1 and GluR2 containing AMPA receptors are found at synapses throughout the amygdala and their expression is persistently up-regulated after learning. Some of these receptors are postsynaptic to terminals from MgN neurons. We found that protein synthesis-dependent plasticity in MgN is necessary for elevated freezing to both aversive and safe auditory cues, and that this is accompanied by changes in the expressions of AMPA receptor and synaptic scaffolding proteins (e.g., SHANK) at amygdala synapses. This work contributes to understanding the neural mechanisms underlying increased fear to safety signals after stress. © 2017 Ferrara et al.; Published by Cold Spring Harbor Laboratory Press.

Presynaptic DLG regulates synaptic function through the localization of voltage-activated Ca2+ Channels

PubMed Central

Astorga, César; Jorquera, Ramón A.; Ramírez, Mauricio; Kohler, Andrés; López, Estefanía; Delgado, Ricardo; Córdova, Alex; Olguín, Patricio; Sierralta, Jimena

2016-01-01

The DLG-MAGUK subfamily of proteins plays a role on the recycling and clustering of glutamate receptors (GLUR) at the postsynaptic density. discs-large1 (dlg) is the only DLG-MAGUK gene in Drosophila and originates two main products, DLGA and DLGS97 which differ by the presence of an L27 domain. Combining electrophysiology, immunostaining and genetic manipulation at the pre and postsynaptic compartments we study the DLG contribution to the basal synaptic-function at the Drosophila larval neuromuscular junction. Our results reveal a specific function of DLGS97 in the regulation of the size of GLUR fields and their subunit composition. Strikingly the absence of any of DLG proteins at the presynaptic terminal disrupts the clustering and localization of the calcium channel DmCa1A subunit (Cacophony), decreases the action potential-evoked release probability and alters short-term plasticity. Our results show for the first time a crucial role of DLG proteins in the presynaptic function in vivo. PMID:27573697

Presynaptic DLG regulates synaptic function through the localization of voltage-activated Ca(2+) Channels.

PubMed

Astorga, César; Jorquera, Ramón A; Ramírez, Mauricio; Kohler, Andrés; López, Estefanía; Delgado, Ricardo; Córdova, Alex; Olguín, Patricio; Sierralta, Jimena

2016-08-30

The DLG-MAGUK subfamily of proteins plays a role on the recycling and clustering of glutamate receptors (GLUR) at the postsynaptic density. discs-large1 (dlg) is the only DLG-MAGUK gene in Drosophila and originates two main products, DLGA and DLGS97 which differ by the presence of an L27 domain. Combining electrophysiology, immunostaining and genetic manipulation at the pre and postsynaptic compartments we study the DLG contribution to the basal synaptic-function at the Drosophila larval neuromuscular junction. Our results reveal a specific function of DLGS97 in the regulation of the size of GLUR fields and their subunit composition. Strikingly the absence of any of DLG proteins at the presynaptic terminal disrupts the clustering and localization of the calcium channel DmCa1A subunit (Cacophony), decreases the action potential-evoked release probability and alters short-term plasticity. Our results show for the first time a crucial role of DLG proteins in the presynaptic function in vivo.

4-Alkylated homoibotenic acid (HIBO) analogues: versatile pharmacological agents with diverse selectivity profiles towards metabotropic and ionotropic glutamate receptor subtypes.

PubMed

Madsen, Ulf; Pickering, Darryl S; Nielsen, Birgitte; Bräuner-Osborne, Hans

2005-01-01

4-Alkylated analogues of homoibotenic acid (HIBO) have previously shown high potency and selectivity at ionotropic and metabotropic glutamic acid receptor (iGluR and mGluR) subtypes. Compounds with different selectivity profiles are valuable pharmacological tools for neuropharmacological studies, and the series of 4-alkyl-HIBO analogues have been extended in this paper in the search for versatile agents. Pharmacological characterization of five new analogues, branched and unbranched 4-alkyl-HIBO analogues, have been carried out. The present compounds are all weak antagonists at Group I mGluRs (mGluR1 and 5) presenting only small differences in potencies (Ki values ranging from 89 to 670 microM). Affinities were studied at native and cloned iGluRs, and the compounds described show preference for the AMPA receptor subtypes GluR1 and 2 over GluR3 and 4. However, compared to previous 4-alkyl-HIBO analogues, these compounds show a remarkably high affinity for the Kain preferring subtype GluR5. The observed GluR5 affinities were either similar or higher compared to their GluR1 and 2 affinity. Isopropyl-HIBO showed the highest affinity for GluR5 (Ki=0.16 microM), and represents a unique compound with high affinity towards the three subtypes GluR1, 2 and 5. In general, these compounds represent new selectivity profiles compared to previously reported Glu receptor analogues.

Agonist-stimulated cobalt uptake provides selective visualization of neurons expressing AMPA- or kainate-type glutamate receptors in the retina.

PubMed

Pourcho, Roberta G; Qin, Pu; Goebel, Dennis J; Fyk-Kolodziej, Bozena

2002-12-16

Fast-acting excitatory neurotransmission in the retina is mediated primarily by glutamate, acting at alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) -selective and kainate-selective receptors. To localize these sites of action, cat retinas were stimulated with either AMPA or kainate and processed for histochemical visualization of cobalt uptake through calcium-permeable channels. Treatment with both agonists resulted in staining of A- and B-type horizontal cells and several types of OFF cone bipolar cells; there was no evidence for staining of ON cone bipolar cells or rod bipolar cells. The subpopulations of OFF cone bipolar cells differed in their responses with two distinct types that stained heavily with cobalt after exposure to AMPA and three different types that were preferentially labeled after exposure to kainate. Although many amacrine and ganglion cells appeared to respond to both agonists, AII amacrine cells were stained after stimulation by AMPA but not by kainate. The OFF cone bipolar cells that exhibit AMPA-stimulated cobalt uptake were found to have a high level of correspondence with cells that show immunocytochemical staining for the AMPA-selective glutamate receptor subunits GluR1 and GluR2/3. Similarly, the cone bipolar cells exhibiting kainate-stimulated cobalt uptake resemble those that are immunoreactive for the kainate subunit GluR5. The results indicate that, whereas many retinal neurons express both AMPA and kainate receptors, AII amacrine cells and subpopulations of OFF cone bipolar cells are limited to the expression of either AMPA or kainate receptors. This differential expression may contribute to the unique character of transmission by these cell types. Copyright 2002 Wiley-Liss, Inc.

Role of spinal cord alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors in complete Freund's adjuvant-induced inflammatory pain.

PubMed

Park, Jang-Su; Yaster, Myron; Guan, Xiaowei; Xu, Ji-Tian; Shih, Ming-Hung; Guan, Yun; Raja, Srinivasa N; Tao, Yuan-Xiang

2008-12-30

Spinal cord alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) mediate acute spinal processing of nociceptive and non-nociceptive information, but whether and how their activation contributes to the central sensitization that underlies persistent inflammatory pain are still unclear. Here, we examined the role of spinal AMPARs in the development and maintenance of complete Freund's adjuvant (CFA)-induced persistent inflammatory pain. Intrathecal application of two selective non-competitive AMPAR antagonists, CFM-2 (25 and 50 microg) and GYKI 52466 (50 microg), significantly attenuated mechanical and thermal hypersensitivities on the ipsilateral hind paw at 2 and 24 h post-CFA injection. Neither CFM-2 nor GYKI 52466 affected the contralateral basal responses to thermal and mechanical stimuli. Locomotor activity was not altered in any of the drug-treated animals. CFA-induced inflammation did not change total expression or distribution of AMPAR subunits GluR1 and GluR2 in dorsal horn but did alter their subcellular distribution. The amount of GluR2 was markedly increased in the crude cytosolic fraction and decreased in the crude membrane fraction from the ipsilateral L4-5 dorsal horn at 24 h (but not at 2 h) post-CFA injection. Conversely, the level of GluR1 was significantly decreased in the crude cytosolic fraction and increased in the crude membrane fraction from the ipsilateral L4-5 dorsal horn at 24 h (but not at 2 h) post-CFA injection. These findings suggest that spinal AMPARs might participate in the central spinal mechanism of persistent inflammatory pain.

Cocaine-Induced Behavioral Sensitization Is Associated With Changes in the Expression of Endocannabinoid and Glutamatergic Signaling Systems in the Mouse Prefrontal Cortex

PubMed Central

Blanco, Eduardo; Pavón, Francisco J.; Palomino, Ana; Luque-Rojas, María Jesús; Serrano, Antonia; Rivera, Patricia; Bilbao, Ainhoa; Alen, Francisco; Vida, Margarita; Suárez, Juan

2015-01-01

Background: Endocannabinoids modulate the glutamatergic excitatory transmission by acting as retrograde messengers. A growing body of studies has reported that both signaling systems in the mesocorticolimbic neural circuitry are involved in the neurobiological mechanisms underlying drug addiction. Methods: We investigated whether the expression of both endocannabinoid and glutamatergic systems in the prefrontal cortex (PFC) were altered by an acute and/or repeated cocaine administration schedule that resulted in behavioral sensitization. We measured the protein and mRNA expression of the main endocannabinoid metabolic enzymes and the cannabinoid receptor type 1 (CB1). We also analyzed the mRNA expression of relevant components of the glutamate-signaling system, including glutamate-synthesizing enzymes, metabotropic receptors, and ionotropic receptors. Results: Although acute cocaine (10mg/kg) produced no significant changes in the endocannabinoid-related proteins, repeated cocaine administration (20mg/kg daily) induced a pronounced increase in the CB1 receptor expression. In addition, acute cocaine administration (10mg/kg) in cocaine-sensitized mice (referred to as cocaine priming) induced a selective increase in the endocannabinoid-degrading enzymes fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL). These protein changes were accompanied by an overall decrease in the ratios of endocannabinoid synthesis/degradation, especially the N-acyl phosphatidylethanolamine phospholipase D/FAAH and diacylglycerol lipase alpha/MAGL ratios. Regarding mRNA expression, while acute cocaine administration produced a decrease in CB1 receptors and N-acyl phosphatidylethanolamine phospholipase D, repeated cocaine treatment enhanced CB1 receptor expression. Cocaine-sensitized mice that were administered priming injections of cocaine mainly displayed an increased FAAH expression. These endocannabinoid changes were associated with modifications in glutamatergic transmission-related genes. An overall decrease was observed in the mRNA expression of the glutamate-synthesizing gene kidney-type glutaminase (KGA), the metabotropic glutamate receptors (mGluR3 and GluR), and subunits of NMDA ionotropic receptors (NR1, NR2A, NR2B and NR2C) after acute cocaine administration, while mice repeatedly exposed to cocaine only displayed an increase in NR2C. However, in cocaine-sensitized mice primed with cocaine, this inhibition was reversed and a strong increase was detected in the mGluR5, NR2 subunits, and both GluR1 and GluR3. Conclusions: These findings indicate that cocaine sensitization is associated with an endocannabinoid downregulation and a hyperglutamatergic state in the PFC that, overall, contribute to an enhanced glutamatergic input into PFC-projecting areas. PMID:25539508

Disruption of the endocytic protein HIP1 results in neurological deficits and decreased AMPA receptor trafficking.

PubMed

Metzler, Martina; Li, Bo; Gan, Lu; Georgiou, John; Gutekunst, Claire-Anne; Wang, Yushan; Torre, Enrique; Devon, Rebecca S; Oh, Rosemary; Legendre-Guillemin, Valerie; Rich, Mark; Alvarez, Christine; Gertsenstein, Marina; McPherson, Peter S; Nagy, Andras; Wang, Yu Tian; Roder, John C; Raymond, Lynn A; Hayden, Michael R

2003-07-01

Huntingtin interacting protein 1 (HIP1) is a recently identified component of clathrin-coated vesicles that plays a role in clathrin-mediated endocytosis. To explore the normal function of HIP1 in vivo, we created mice with targeted mutation in the HIP1 gene (HIP1(-/-)). HIP1(-/-) mice develop a neurological phenotype by 3 months of age manifest with a failure to thrive, tremor and a gait ataxia secondary to a rigid thoracolumbar kyphosis accompanied by decreased assembly of endocytic protein complexes on liposomal membranes. In primary hippocampal neurons, HIP1 colocalizes with GluR1-containing AMPA receptors and becomes concentrated in cell bodies following AMPA stimulation. Moreover, a profound dose-dependent defect in clathrin-mediated internalization of GluR1-containing AMPA receptors was observed in neurons from HIP1(-/-) mice. Together, these data provide strong evidence that HIP1 regulates AMPA receptor trafficking in the central nervous system through its function in clathrin-mediated endocytosis.

Comparative analysis of A-to-I editing in human and non-human primate brains reveals conserved patterns and context-dependent regulation of RNA editing.

PubMed

O'Neil, Richard T; Wang, Xiaojing; Morabito, Michael V; Emeson, Ronald B

2017-04-06

A-to-I RNA editing is an important process for generating molecular diversity in the brain through modification of transcripts encoding several proteins important for neuronal signaling. We investigated the relationships between the extent of editing at multiple substrate transcripts (5HT2C, MGLUR4, CADPS, GLUR2, GLUR4, and GABRA3) in brain tissue obtained from adult humans and rhesus macaques. Several patterns emerged from these studies revealing conservation of editing across primate species. Additionally, variability in the human population allows us to make novel inferences about the co-regulation of editing at different editing sites and even across different brain regions.

ERK-GluR1 phosphorylation in trigeminal spinal subnucleus caudalis neurons is involved in pain associated with dry tongue.

PubMed

Nakaya, Yuka; Tsuboi, Yoshiyuki; Okada-Ogawa, Akiko; Shinoda, Masamichi; Kubo, Asako; Chen, Jui Yen; Noma, Noboru; Batbold, Dulguun; Imamura, Yoshiki; Sessle, Barry J; Iwata, Koichi

2016-01-01

Dry mouth is known to cause severe pain in the intraoral structures, and many dry mouth patients have been suffering from intraoral pain. In development of an appropriate treatment, it is crucial to study the mechanisms underlying intraoral pain associated with dry mouth, yet the detailed mechanisms are not fully understood. To evaluate the mechanisms underlying pain related to dry mouth, the dry-tongue rat model was developed. Hence, the mechanical or heat nocifensive reflex, the phosphorylated extracellular signal-regulated kinase and phosphorylated GluR1-IR immunohistochemistries, and the single neuronal activity were examined in the trigeminal spinal subnucleus caudalis of dry-tongue rats. The head-withdrawal reflex threshold to mechanical, but not heat, stimulation of the tongue was significantly decreased on day 7 after tongue drying. The mechanical, but not heat, responses of trigeminal spinal subnucleus caudalis nociceptive neurons were significantly enhanced in dry-tongue rats compared to sham rats on day 7. The number of phosphorylated extracellular signal-regulated kinase-immunoreactive cells was also significantly increased in the trigeminal spinal subnucleus caudalis following noxious stimulation of the tongue in dry-tongue rats compared to sham rats on day 7. The decrement of the mechanical head-withdrawal reflex threshold (HWT) was reversed during intracisternal administration of the mitogen-activated protein kinase kinase 1 inhibitor, PD98059. The trigeminal spinal subnucleus caudalis neuronal activities and the number of phosphorylated extracellular signal-regulated kinase-immunoreactive cells following noxious mechanical stimulation of dried tongue were also significantly decreased following intracisternal administration of PD98059 compared to vehicle-administrated rats. Increased number of the phosphorylated GluR1-IR cells was observed in the trigeminal spinal subnucleus caudalis of dry-tongue rats, and the number of phosphorylated GluR1-IR cells was significantly reduced in PD98059-administrated rats compared to the vehicle-administrated tongue-dry rats. These findings suggest that the pERK-pGluR1 cascade is involved in central sensitization of trigeminal spinal subnucleus caudalis nociceptive neurons, thus resulting in tongue mechanical hyperalgesia associated with tongue drying. © The Author(s) 2016.

Disruption of the endocytic protein HIP1 results in neurological deficits and decreased AMPA receptor trafficking

PubMed Central

Metzler, Martina; Li, Bo; Gan, Lu; Georgiou, John; Gutekunst, Claire-Anne; Wang, Yushan; Torre, Enrique; Devon, Rebecca S.; Oh, Rosemary; Legendre-Guillemin, Valerie; Rich, Mark; Alvarez, Christine; Gertsenstein, Marina; McPherson, Peter S.; Nagy, Andras; Wang, Yu Tian; Roder, John C.; Raymond, Lynn A.; Hayden, Michael R.

2003-01-01

Huntingtin interacting protein 1 (HIP1) is a recently identified component of clathrin-coated vesicles that plays a role in clathrin-mediated endocytosis. To explore the normal function of HIP1 in vivo, we created mice with targeted mutation in the HIP1 gene (HIP1–/–). HIP1–/– mice develop a neurological phenotype by 3 months of age manifest with a failure to thrive, tremor and a gait ataxia secondary to a rigid thoracolumbar kyphosis accompanied by decreased assembly of endocytic protein complexes on liposomal membranes. In primary hippocampal neurons, HIP1 colocalizes with GluR1-containing AMPA receptors and becomes concentrated in cell bodies following AMPA stimulation. Moreover, a profound dose-dependent defect in clathrin-mediated internalization of GluR1-containing AMPA receptors was observed in neurons from HIP1–/– mice. Together, these data provide strong evidence that HIP1 regulates AMPA receptor trafficking in the central nervous system through its function in clathrin-mediated endocytosis. PMID:12839988

Chronic treatment with ginsenoside Rg1 promotes memory and hippocampal long-term potentiation in middle-aged mice.

PubMed

Zhu, G; Wang, Y; Li, J; Wang, J

2015-04-30

Ginseng serves as a potential candidate for the treatment of aging-related memory decline or memory loss. However, the related mechanism is not fully understood. In this study, we applied an intraperitoneal injection of ginsenoside Rg1, an active compound from ginseng in middle-aged mice and detected memory improvement and the underlying mechanisms. Our results showed that a period of 30-day administration of ginsenoside Rg1 enhanced long-term memory in the middle-aged animals. Consistent with the memory improvement, ginsenoside Rg1 administration facilitated weak theta-burst stimulation (TBS)-induced long-term potentiation (LTP) in acute hippocampal slices from middle-aged animals. Ginsenoside Rg1 administration increased the dendritic apical spine numbers and area in the CA1 region. In addition, ginsenoside Rg1 administration up-regulated the expression of hippocampal p-AKT, brain-derived neurotrophic factor (BDNF), proBDNF and glutamate receptor 1 (GluR1), but not p-ERK. Interestingly, the phosphatase and tensin homolog deleted on chromosome ten (PTEN) inhibitor (bpV) mimicked the ginsenoside Rg1 effects, including increasing p-AKT expression, promoting hippocampal basal synaptic transmission, LTP and memory. Taken together, our data suggest that ginsenoside Rg1 treatment improves memory in middle-aged mice possibly through regulating the PI3K/AKT pathway, altering apical spines and facilitating hippocampal LTP. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

Chronic SO2 inhalation above environmental standard impairs neuronal behavior and represses glutamate receptor gene expression and memory-related kinase activation via neuroinflammation in rats.

PubMed

Yao, Gaoyi; Yue, Huifeng; Yun, Yang; Sang, Nan

2015-02-01

Sulfur dioxide (SO2), as a ubiquitous air pollutant implicated in the genesis of pulmonary disease, is now being considered to be involved in neurotoxicity and increased risk for hospitalization of brain disorders. However, comparatively little is known about the impact of chronically SO2 inhalation on neuronal function. In the present study, by exposing male Wistar rats to SO2 at 3.50 and 7.00 mg/m(3) (approximately 1225 and 2450 ppb, 4.08-8.16 (24h average concentration) times higher than the EPA standard for environmental air concentrations) or filtered air for 90 days, we investigated the impact of chronic SO2 inhalation on performance in Morris water maze, and probed the accompanying neurobiological effects, including activity-regulated cytoskeletal associated gene (Arc) and glutamate receptor gene expression, memory-related kinase level and inflammatory cytokine release in the hippocampus. Here, we found that SO2 exposure reduced the number of target zone crossings and time spent in the target quadrant during the test session in the spatial memory retention of the Morris water maze. Following the neuro-functional abnormality, we detected that SO2 inhalation reduced the expression of Arc and glutamate receptor subunits (GluR1, GluR2, NR1, NR2A, and NR2B) with a concentration-dependent property in comparison to controls. Additionally, the expression of memory kinases was attenuated statistically in the animals receiving the higher concentration, including protein kinase A (PKA), protein kinase C (PKC) and calcium/calmodulin-dependent protein kinaseIIα (CaMKIIα). And the inflammatory cytokine release was increased in rats exposed to SO2. Taken together, our results suggest that long-term exposure to SO2 air pollution at concentrations above the environmental standard in rats impaired spatial learning and memory, and indicate a close link between the neurobiological changes highlighted in the brain and the behavioral disturbances. Copyright © 2014 Elsevier Inc. All rights reserved.

FMRP acts as a key messenger for dopamine modulation in the forebrain.

PubMed

Wang, Hansen; Wu, Long-Jun; Kim, Susan S; Lee, Frank J S; Gong, Bo; Toyoda, Hiroki; Ren, Ming; Shang, Yu-Ze; Xu, Hui; Liu, Fang; Zhao, Ming-Gao; Zhuo, Min

2008-08-28

The fragile X mental retardation protein (FMRP) is an RNA-binding protein that controls translational efficiency and regulates synaptic plasticity. Here, we report that FMRP is involved in dopamine (DA) modulation of synaptic potentiation. AMPA glutamate receptor subtype 1 (GluR1) surface expression and phosphorylation in response to D1 receptor stimulation were reduced in cultured Fmr1(-/-) prefrontal cortex (PFC) neurons. Furthermore, D1 receptor signaling was impaired, accompanied by D1 receptor hyperphosphorylation at serine sites and subcellular redistribution of G protein-coupled receptor kinase 2 (GRK2) in both PFC and striatum of Fmr1(-/-) mice. FMRP interacted with GRK2, and pharmacological inhibition of GRK2 rescued D1 receptor signaling in Fmr1(-/-) neurons. Finally, D1 receptor agonist partially rescued hyperactivity and enhanced the motor function of Fmr1(-/-) mice. Our study has identified FMRP as a key messenger for DA modulation in the forebrain and may provide insights into the cellular and molecular mechanisms underlying fragile X syndrome.

Changes in expression of c-Fos protein following cocaine-cue extinction learning.

PubMed

Nic Dhonnchadha, B Á; Lovascio, B F; Shrestha, N; Lin, A; Leite-Morris, K A; Man, H Y; Kaplan, G B; Kantak, K M

2012-09-01

Extinguishing abnormally strengthened learned responses to cues associated with drugs of abuse remains a key tactic for alleviating addiction. To assist in developing pharmacotherapies to augment exposure therapy for relapse prevention, investigation into neurobiological underpinnings of drug-cue extinction learning is needed. We used regional analyses of c-Fos and GluR2 protein expression to delineate neural activity and plasticity that may be associated with cocaine-cue extinction learning. Rats were trained to self-administer cocaine paired with a light cue, and later underwent a single 2h extinction session for which cocaine was withheld but response-contingent cues were presented (cocaine-cue extinction). Control groups consisted of rats yoked to animals self-administering cocaine and receiving saline non-contingently followed by an extinction session, or rats trained to self-administer cocaine followed by a no-extinction session for which levers were retracted, and cocaine and cues were withheld. Among 11 brain sites examined, extinction training increased c-Fos expression in basolateral amygdala and prelimbic prefrontal cortex of cocaine-cue extinguished rats relative to both control conditions. In dorsal subiculum and infralimbic prefrontal cortex, extinction training increased c-Fos expression in both cocaine-cue and saline-cue extinguished rats relative to the no-extinction control condition. GluR2 protein expression was not altered in any site examined after extinction or control training. Findings suggest that basolateral amygdala and prelimbic prefrontal cortex neurons are activated during acquisition of cocaine-cue extinction learning, a process that is independent of changes in GluR2 abundance. Other sites are implicated in processing the significance of cues that are present early in extinction training. Copyright © 2012 Elsevier B.V. All rights reserved.

Phosphatidylinositol 3-kinase is a key mediator of central sensitization in painful inflammatory conditions

PubMed Central

Pezet, Sophie; Marchand, Fabien; D'Mello, Richard; Grist, John; Clark, Anna K.; Malcangio, Marzia; Dickenson, Anthony H.; Williams, Robert J.; McMahon, Stephen B.

2010-01-01

Here we show that phosphatidylinositol 3-kinase (PI3K) is a key player in the establishment of central sensitization, the spinal cord phenomenon associated with persistent afferent inputs and contributing to chronic pain states. We demonstrated electrophysiologically that PI3K is required for the full expression of spinal neuronal wind-up. In an inflammatory pain model, intrathecal administration of LY294002, a potent PI3K inhibitor, dose-dependently inhibited pain related behavior. This effect was correlated with a reduction of the phosphorylation of extracellular signal-regulated kinase (ERK) and CaMKinase II. In addition, we observed a significant decrease in the phosphorylation of the NMDA receptor subunit NR2B, decreased translocation to the plasma membrane of the GluR1 AMPA receptor subunit in the spinal cord and a reduction of evoked neuronal activity as measured using c-Fos immunohistochemistry. Our study suggests that PI3K is a major factor in the expression of central sensitization after noxious inflammatory stimuli. PMID:18417706

Crystal structure and association behaviour of the GluR2 amino-terminal domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin, Rongsheng; Singh, Satinder K.; Gu, Shenyan

2009-09-02

Fast excitatory neurotransmission is mediated largely by ionotropic glutamate receptors (iGluRs), tetrameric, ligand-gated ion channel proteins comprised of three subfamilies, AMPA, kainate and NMDA receptors, with each subfamily sharing a common, modular-domain architecture. For all receptor subfamilies, active channels are exclusively formed by assemblages of subunits within the same subfamily, a molecular process principally encoded by the amino-terminal domain (ATD). However, the molecular basis by which the ATD guides subfamily-specific receptor assembly is not known. Here we show that AMPA receptor GluR1- and GluR2-ATDs form tightly associated dimers and, by the analysis of crystal structures of the GluR2-ATD, propose mechanismsmore » by which the ATD guides subfamily-specific receptor assembly.« less

A noncognate aminoacyl-tRNA synthetase that may resolve a missing link in protein evolution.

PubMed

Skouloubris, Stephane; Ribas de Pouplana, Lluis; De Reuse, Hilde; Hendrickson, Tamara L

2003-09-30

Efforts to delineate the advent of many enzymes essential to protein translation are often limited by the fact that the modern genetic code evolved before divergence of the tree of life. Glutaminyl-tRNA synthetase (GlnRS) is one noteworthy exception to the universality of the translation apparatus. In eukaryotes and some bacteria, this enzyme is essential for the biosynthesis of Gln-tRNAGln, an obligate intermediate in translation. GlnRS is absent, however, in archaea, and most bacteria, organelles, and chloroplasts. Phylogenetic analyses predict that GlnRS arose from glutamyl-tRNA synthetase (GluRS), via gene duplication with subsequent evolution of specificity. A pertinent question to ask is whether, in the advent of GlnRS, a transient GluRS-like intermediate could have been retained in an extant organism. Here, we report the discovery of an essential GluRS-like enzyme (GluRS2), which coexists with another GluRS (GluRS1) in Helicobacter pylori. We show that GluRS2's primary role is to generate Glu-tRNAGln, not Glu-tRNAGlu. Thus, GluRS2 appears to be a transient GluRS-like ancestor of GlnRS and can be defined as a GluGlnRS.

Glutamate receptor antibodies directed against AMPA receptors subunit 3 peptide B (GluR3B) can be produced in DBA/2J mice, lower seizure threshold and induce abnormal behavior.

PubMed

Ganor, Yonatan; Goldberg-Stern, Hadassa; Cohen, Ran; Teichberg, Vivian; Levite, Mia

2014-04-01

Anti-GluR3B antibodies (GluR3B Ab's), directed against peptide B/aa372-395 of GluR3 subunit of glutamate/AMPA receptors, are found in ∼35% of epilepsy patients, activate glutamate/AMPA receptors, evoke ion currents, kill neurons and damage the brain. We recently found that GluR3B Ab's also associate with neurological/psychiatric/behavioral abnormalities in epilepsy patients. Here we asked if GluR3B Ab's could be produced in DBA/2J mice, and also modulate seizure threshold and/or cause behavioral/motor impairments in these mice. DBA/2J mice were immunized with the GluR3B peptide in Complete Freund's Adjuvant (CFA), or with controls: ovalbumin (OVA), CFA, or phosphate-buffer saline (PBS). GluR3B Ab's and OVA Ab's were tested. Seizures were induced in all mice by the chemoconvulsant pentylenetetrazole (PTZ) at three time points, each time with less PTZ to avoid non-specific death. Behavior was examined in Open-Field, RotaRod and Grip tests. GluR3B Ab's were produced only in GluR3B-immunized mice, while OVA Ab's were produced only in OVA-immunized mice, showing high Ab's specificity. In GluR3B Ab's negative mice, seizure severity scores and percentages of animals developing generalized seizures declined in response to decreasing PTZ doses. In contrast, both parameters remained unchanged/high in the GluR3B Ab's positive mice, showing that these mice were more susceptible to seizures. The seizure scores associated significantly with the GluR3B Ab's levels. GluR3B Ab's positive mice were also more anxious in Open-Field test, fell faster in RotaRod test, and fell more in Grip test, compared to all the control mice. GluR3B Ab's are produced in DBA/2J mice, facilitate seizures and induce behavioral/motor impairments. This animal model can therefore serve for studying autoimmune epilepsy and abnormal behavior mediated by pathogenic anti-GluR3B Ab's. Copyright © 2014 Elsevier Ltd. All rights reserved.

Membrane Localization is Critical for Activation of the PICK1 BAR Domain

PubMed Central

Madsen, Kenneth L.; Eriksen, Jacob; Milan-Lobo, Laura; Han, Daniel S.; Niv, Masha Y.; Ammendrup-Johnsen, Ina; Henriksen, Ulla; Bhatia, Vikram K.; Stamou, Dimitrios; Sitte, Harald H.; McMahon, Harvey T.; Weinstein, Harel; Gether, Ulrik

2013-01-01

The PSD-95/Discs-large/ZO-1 homology (PDZ) domain protein, protein interacting with C kinase 1 (PICK1) contains a C-terminal Bin/amphiphysin/Rvs (BAR) domain mediating recognition of curved membranes; however, the molecular mechanisms controlling the activity of this domain are poorly understood. In agreement with negative regulation of the BAR domain by the N-terminal PDZ domain, PICK1 distributed evenly in the cytoplasm, whereas truncation of the PDZ domain caused BAR domain-dependent redistribution to clusters colocalizing with markers of recycling endosomal compartments. A similar clustering was observed both upon truncation of a short putative α-helical segment in the linker between the PDZ and the BAR domains and upon coexpression of PICK1 with a transmembrane PDZ ligand, including the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor GluR2 subunit, the GluR2 C-terminus transferred to the single transmembrane protein Tac or the dopamine transporter C-terminus transferred to Tac. In contrast, transfer of the GluR2 C-terminus to cyan fluorescent protein, a cytosolic protein, did not elicit BAR domain-dependent clustering. Instead, localizing PICK1 to the membrane by introducing an N-terminal myristoylation site produced BAR domain-dependent, but ligand-independent, PICK1 clustering. The data support that in the absence of PDZ ligand, the PICK1 BAR domain is inhibited through a PDZ domain-dependent and linker-dependent mechanism. Moreover, they suggest that unmasking of the BAR domain’s membrane-binding capacity is not a consequence of ligand binding to the PDZ domain per se but results from, and coincides with, recruitment of PICK1 to a membrane compartment. PMID:18466293

Role of amino acids in salivation and the localization of their receptors in the rat salivary gland.

PubMed

Shida, T; Kondo, E; Ueda, Y; Takai, N; Yoshida, Y; Araki, T; Kiyama, H; Tohyama, M

1995-11-01

The distribution of gamma-aminobutyric acid (GABA) receptor subunits such as GABAAR-gamma 1 and GABAAR-gamma 2, and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) type receptor subunits such as GluR-1, GluR-2/3 and GluR-4, and N-methyl-D-aspartic acid (NMDA) type subunits such as NR1 were investigated by immunocytochemistry. Furthermore, the roles of these amino acids, GABA and glutamate, on salivation were analyzed in the rat submandibular and sublingual glands. Some similarities were observed in the distribution patterns of GABAA type receptors and AMPA receptors. In the submandibular ganglion cells, collecting ducts and striated ducts, these subunits were expressed strongly; however, there were some differences in their expression patterns between the submandibular and sublingual gland acinar cells. Since these receptor subunits were expressed in the acinar cell bodies of the submandibular gland, they were not expressed in the acinar cells but were expressed in the myoepithelial cells in the sublingual gland. On the other hand, no NR1 expression was observed. To examine the roles of GABA and glutamate in salivation, the submandibular and sublingual glands were perfused partially with Ringer's solution via a facial artery to avoid systemic influence, and substrates were infused into the perfusion solution. No salivary secretion was evoked by GABA or glutamate infusion in the absence of electrical stimulation (2-3 V, 5 ms, 20 Hz). Salivary flow evoked by electrical stimulation of the chorda-lingual nerve caused significant inhibition by GABA (10(-6), 10(-5), 10(-4) and 10(-3) M) and the GABAAR agonist muscimol 10(-3) and 10(-6) M) (n = 6, P < 0.05). Such GABA-induced inhibition was antagonized by the GABAAR antagonists bicuculline (BCC; 10(-6) and 10(-3) M) and picrotoxin (PTX; 10(-6) and 10(-3) M). On the other hand, salivary flow evoked by electrical stimulation (8-10 V, 5 ms, 20 Hz) of the superior cervical ganglion (SCG) was not affected by GABA. While high doses of glutamate (10(-1) M) and NMDA (10(-1) M) showed no effects on salivary flow despite application of electrical stimulation, AMPA at a high concentration (10(-1) M) significantly inhibited salivary secretion (n = 6, P < 0.05). These studies revealed that inhibitory and excitatory amino acid receptors such as GABAA and AMPA type receptors are coexpressed in the rat salivary glands, and that GABA inhibits salivary secretion via GABAA receptors which may act with acetylcholine. However, the role of glutamate in salivation remains unclear despite the presence of AMPA type receptors. The present findings suggest that glutamate does not act alone but with other substances such as peptides and/or other amino acids.

Delayed Noradrenergic Activation in the Dorsal Hippocampus Promotes the Long-Term Persistence of Extinguished Fear

PubMed Central

Chai, Ning; Liu, Jian-Feng; Xue, Yan-Xue; Yang, Chang; Yan, Wei; Wang, Hui-Min; Luo, Yi-Xiao; Shi, Hai-Shui; Wang, Ji-Shi; Bao, Yan-Ping; Meng, Shi-Qiu; Ding, Zeng-Bo; Wang, Xue-Yi; Lu, Lin

2014-01-01

Fear extinction has been extensively studied, but little is known about the molecular processes that underlie the persistence of extinction long-term memory (LTM). We found that microinfusion of norepinephrine (NE) into the CA1 area of the dorsal hippocampus during the early phase (0 h) after extinction enhanced extinction LTM at 2 and 14 days after extinction. Intra-CA1 infusion of NE during the late phase (12 h) after extinction selectively promoted extinction LTM at 14 days after extinction that was blocked by the β-receptor antagonist propranolol, protein kinase A (PKA) inhibitor Rp-cAMPS, and protein synthesis inhibitors anisomycin and emetine. The phosphorylation levels of PKA, cyclic adenosine monophosphate response element-binding protein (CREB), GluR1, and the membrane GluR1 level were increased by NE during the late phase after extinction that was also blocked by propranolol and Rp-cAMPS. These results suggest that the enhancement of extinction LTM persistence induced by NE requires the activation of the β-receptor/PKA/CREB signaling pathway and membrane GluR1 trafficking. Moreover, extinction increased the phosphorylation levels of Erk1/2, CREB, and GluR1, and the membrane GluR1 level during the late phase, and anisomycin/emetine alone disrupted the persistence of extinction LTM, indicating that the persistence of extinction LTM requires late-phase protein synthesis in the CA1. Propranolol and Rp-cAMPS did not completely disrupt the persistence of extinction LTM, suggesting that another β-receptor/PKA-independent mechanism underlies the persistence of extinction LTM. Altogether, our results showed that enhancing hippocampal noradrenergic activity during the late phase after extinction selectively promotes the persistence of extinction LTM. PMID:24553734

Glutamate-dependent transcriptional regulation in bergmann glia cells: involvement of p38 MAP kinase.

PubMed

Zepeda, Rossana C; Barrera, Iliana; Castelán, Francisco; Soto-Cid, Abraham; Hernández-Kelly, Luisa C; López-Bayghen, Esther; Ortega, Arturo

2008-07-01

Glutamate (Glu) is the major excitatory neurotransmitter in the Central Nervous System (CNS). Ionotropic and metabotropic glutamate receptors (GluRs) are present in neurons and glial cells and are involved in gene expression regulation. Mitogen-activated proteins kinases (MAPK) are critical for all the membrane to nuclei signaling pathways described so far. In cerebellar Bergmann glial cells, glutamate-dependent transcriptional regulation is partially dependent on p42/44 MAPK activity. Another member of this kinase family, p38 MAPK is activated by non-mitogenic stimuli through its Thr180/Tyr182 phosphorylation and phosphorylates cytoplasmic and nuclear protein targets involved in translational and transcriptional events. Taking into consideration that the role of p38MAPK in glial cells is not well understood, we demonstrate here that glutamate increases p38 MAPK phosphorylation in a time and dose dependent manner in cultured chick cerebellar Bergmann glial cells (BGC). Moreover, p38 MAPK is involved in the glutamate-induced transcriptional activation in these cells. Ionotropic as well as metabotropic glutamate receptors participate in p38 MAPK activation. The present findings demonstrate the involvement of p38 MAPK in glutamate-dependent gene expression regulation in glial cells.

ApoE4 expression accelerates hippocampus-dependent cognitive deficits by enhancing Aβ impairment of insulin signaling in an Alzheimer’s disease mouse model

PubMed Central

Chan, Elizabeth S.; Shetty, Mahesh Shivarama; Sajikumar, Sreedharan; Chen, Christopher; Soong, Tuck Wah; Wong, Boon-Seng

2016-01-01

The apolipoprotein E4 (ApoE4) is the strongest genetic risk factor for Alzheimer’s disease (AD). The AD brain was shown to be insulin resistant at end stage, but the interplay between insulin signaling, ApoE4 and Aβ across time, and their involvement in memory decline is unclear. To investigate insulin response in the ageing mouse hippocampus, we crossed the human ApoE-targeted replacement mice with the mutant human amyloid precursor protein (APP) mice (ApoExAPP). While hippocampal Aβ levels were comparable between ApoE3xAPP and ApoE4xAPP mice at 26 weeks, insulin response was impaired in the ApoE4xAPP hippocampus. Insulin treatment was only able to stimulate insulin signaling and increased AMPA-GluR1 phosphorylation in forskolin pre-treated hippocampal slices from ApoE3xAPP mice. In ApoE4xAPP mice, insulin dysfunction was also associated with poorer spatial memory performance. Using dissociated hippocampal neuron in vitro, we showed that insulin response in ApoE3 and ApoE4 neurons increased AMPA receptor-mediated miniature excitatory postsynaptic current (mEPSC) amplitudes and GluR1-subunit insertion. Pre-treatment of ApoE3 neurons with Aβ42 did not affect insulin-mediated GluR1 subunit insertion. However, impaired insulin sensitivity observed only in the presence of ApoE4 and Aβ42, attenuated GluR1-subunit insertion. Taken together, our results suggest that ApoE4 enhances Aβ inhibition of insulin-stimulated AMPA receptor function, which accelerates memory impairment in ApoE4xAPP mice. PMID:27189808

Differential glutamate AMPA-receptor plasticity in subpopulations of VTA neurons in the presence or absence of residual cocaine: Implications for the development of addiction

PubMed Central

Lane, D.A.; Reed, B.; Kreek, M.J.; Pickel, V.M.

2011-01-01

Cocaine-induced plasticity of mesocorticolimbic dopamine (DA) neurons, originating in the ventral tegmental area (VTA), persists in the absence of cocaine and may contribute to both drug-craving and relapse. Glutamate AMPA receptors (AMPARs) in these neurons are implicated in this plasticity. However, there is no ultrastructural evidence that the absence of cocaine following repeated administrations affects the critical surface/synaptic availability of AMPAR GluR1 subunits in either DA or non-DA, putative GABAergic neurons within the VTA. To assess this, we used electron microscopic immunolabeling in the VTA of adult male mice sacrificed at 30 minutes or 72 hours after receiving the final of six (15 mg/kg) cocaine injections, a dosing paradigm that resulted in development of locomotor sensitization. At each time point, both cocaine- and saline-injected mice showed AMPAR GluR1 immunogold labeling in somatodendritic profiles, many of which contained immunoperoxidase labeling for the DA-synthesizing enzyme, tyrosine hydroxylase (TH). At 30 minutes after the last injection, when cocaine was systemically present, only the non-TH labeled dendrites showed a significant increase in the synaptic/plasmalemmal density of GluR1 immunogold particles. At 72 hours, when systemic cocaine was depleted, synaptic GluR1 labeling was greatly enhanced in TH-containing dendrites throughout the VTA and in non-TH dendrites of the limbic-associated paranigral VTA. Our results demonstrate that systemic cocaine produces GluR1 trafficking specifically in non-DA neurons of the VTA, which may subsequently contribute to the abstinent-induced enhancement of AMPA receptor synaptic transmission in mesocorticolimbic DA neurons leading to heightened drug seeking behavior. PMID:21215761

LY404187: a novel positive allosteric modulator of AMPA receptors.

PubMed

Quirk, Jennifer C; Nisenbaum, Eric S

2002-01-01

LY404187 is a selective, potent and centrally active positive allosteric modulator of AMPA receptors. LY404187 preferentially acts at recombinant human homomeric GluR2 and GluR4 versus GluR1 and GluR3 AMPA receptors. In addition, LY404187 potentiates the flip splice variant of these AMPA receptors to a greater degree than the flop splice variant. In both recombinant and native AMPA receptors, potentiation by LY404187 displays a unique time-dependent growth that appears to involve a suppression of the desensitization process of these ion channels. LY404187 has been shown to enhance glutamatergic synaptic transmission both in vitro and in vivo. This augmentation of synaptic activity is due to the direct potentiation of AMPA receptor function, as well as an indirect recruitment of voltage-dependent NMDA receptor activity. Enhanced calcium influx through NMDA receptors is known to be a critical step in initiating long-term modifications in synaptic function (e.g., long-term potentiation, LTP). These modifications in synaptic function may be substrates for certain forms of memory encoding. Consistent with a recruitment of NMDA receptor activity, LY404187 has been shown to enhance performance in animal models of cognitive function requiring different mnemonic processes. These data suggest that AMPA receptor potentiators may be therapeutically beneficial for treating cognitive deficits in a variety of disorders, particularly those that are associated with reduced glutamatergic signaling such as schizophrenia. In addition, LY404187 has been demonstrated to be efficacious in animal models of behavioral despair that possess considerable predictive validity for antidepressant activity. Although the therapeutic efficacy of AMPA receptor potentiators in these and other diseases will ultimately be determined in the clinic, evidence suggests that the benefit of these compounds will be mediated by multiple mechanisms of action. These mechanisms include direct enhancement of AMPA receptor function, secondary mobilization of intracellular signaling cascades, and prolonged modulation of gene expression.

AMPA Receptors Mediate Acetylcholine Release from Starburst Amacrine Cells in the Rabbit Retina

PubMed Central

FIRTH, SALLY I.; LI, WEI; MASSEY, STEPHEN C.; MARSHAK, DAVID W.

2012-01-01

The light response of starburst amacrine cells is initiated by glutamate released from bipolar cells. To identify the receptors that mediate this response, we used a combination of anatomical and physiological techniques. An in vivo, rabbit eyecup was preloaded with [3H]-choline, and the [3H]-acetylcholine (ACh) released into the superfusate was monitored. A photopic, 3 Hz flashing light increased ACh release, and the selective AMPA receptor antagonist, GYKI 53655, blocked this light-evoked response. Nonselective AMPA/kainate agonists increased the release of ACh, but the specific kainate receptor agonist, SYM 2081, did not increase ACh release. Selective AMPA receptor antagonists, GYKI 53655 or GYKI 52466, also blocked the responses to agonists. We conclude that the predominant excitatory input to starburst amacrine cells is mediated by AMPA receptors. We also labeled lightly fixed rabbit retinas with antisera to choline acetyltransferase (ChAT), AMPA receptor subunits GluR1, GluR2/3, or GluR4, and kainate receptor subunits GluR6/7 and KA2. Labeled puncta were observed in the inner plexiform layer with each of these antisera to glutamate receptors, but only GluR2/3-IR puncta and GluR4-IR puncta were found on the ChAT-IR processes. The same was true of starburst cells injected intracellularly with Neurobiotin, and these AMPA receptor subunits were localized to two populations of puncta. The AMPA receptors are expected to desensitize rapidly, enhancing the sensitivity of starburst amacrine cells to moving or other rapidly changing stimuli. PMID:14515241

Exposure to 50 Hz electromagnetic radiation promote early maturation and differentiation in newborn rat cerebellar granule neurons.

PubMed

Lisi, A; Ciotti, M T; Ledda, M; Pieri, M; Zona, C; Mercanti, D; Rieti, S; Giuliani, L; Grimaldi, S

2005-08-01

The wish of this work is the study of the effect of electromagnetic (EMF) radiations at a frequency of 50 Hz on the development of cerebellar granule neurons (CGN). Granule neurons, prepared from newborn rat cerebellum (8 days after birth), were cultured after plate-seeding in the presence of EMF radiations, with the plan of characterizing their cellular and molecular biochemistry, after exposure to the electromagnetic stimulus. Five days challenge to EMF radiations showed, by the cytotoxic glutamate (Glu) pulse test, a 30% decrease of cells survival, while only 5% of mortality was reported for unexposed sample. Moreover, blocking the glutamate receptor (GluR) with the Glu competitor MK-801, no toxicity effect after CGN challenge to EMF radiations and Glu was detected. By patch-clamp recording technique, the Kainate-induced currents from 6 days old exposed CGN exhibited a significant increase with respect to control cells. Western blot and reverse transcription-polymerase chain reaction (RT-PCR) analyses show that EMF exposure of rats CGN, induces a change in both GluRs proteins and mRNAs expression with respect to control. In addition, the use of monoclonal antibody raised against neurofilament protein (NF-200) reveals an increase in NF-200 synthesis in the exposed CGN. All these results indicate that exposure to non-ionizing radiations contribute to a premature expression of GluRs reducing the life span of CGN, leading to a more rapid cell maturation. (c) 2005 Wiley-Liss, Inc.

Prostacyclin regulates spinal nociceptive processing through cyclic adenosine monophosphate-induced translocation of glutamate receptors.

PubMed

Schuh, Claus Dieter; Brenneis, Christian; Zhang, Dong Dong; Angioni, Carlo; Schreiber, Yannick; Ferreiros-Bouzas, Nerea; Pierre, Sandra; Henke, Marina; Linke, Bona; Nüsing, Rolf; Scholich, Klaus; Geisslinger, Gerd

2014-02-01

Prostacyclin (PGI2) is known to be an important mediator of peripheral pain sensation (nociception) whereas little is known about its role in central sensitization. The levels of the stable PGI2-metabolite 6-keto-prostaglandin F1α (6-keto-PGF1α) and of prostaglandin E2 (PGE2) were measured in the dorsal horn with the use of mass spectrometry after peripheral inflammation. Expression of the prostanoid receptors was determined by immunohistology. Effects of prostacyclin receptor (IP) activation on spinal neurons were investigated with biochemical assays (cyclic adenosine monophosphate-, glutamate release-measurement, Western blot analysis) in embryonic cultures and adult spinal cord. The specific IP antagonist Cay10441 was applied intrathecally after zymosan-induced mechanical hyperalgesia in vivo. Peripheral inflammation caused a significant increase of the stable PGI2 metabolite 6-keto-PGF1α in the dorsal horn of wild-type mice (n = 5). IP was located on spinal neurons and did not colocalize with the prostaglandin E2 receptors EP2 or EP4. The selective IP-agonist cicaprost increased cyclic adenosine monophosphate synthesis in spinal cultures from wild-type but not from IP-deficient mice (n = 5-10). The combination of fluorescence-resonance-energy transfer-based cyclic adenosine monophosphate imaging and calcium imaging showed a cicaprost-induced cyclic adenosine monophosphate synthesis in spinal cord neurons (n = 5-6). Fittingly, IP activation increased glutamate release from acute spinal cord sections of adult mice (n = 13-58). Cicaprost, but not agonists for EP2 and EP4, induced protein kinase A-dependent phosphorylation of the GluR1 subunit and its translocation to the membrane. Accordingly, intrathecal administration of the IP receptor antagonist Cay10441 had an antinociceptive effect (n = 8-11). Spinal prostacyclin synthesis during early inflammation causes the recruitment of GluR1 receptors to membrane fractions, thereby augmenting the onset of central sensitization.

Protective effect of the daming capsule on impaired baroreflexes in STZ-induced diabetic rats with hyperlipoidemia.

PubMed

Ai, Jing; Wang, Li-Hong; Zhang, Rong; Qiao, Guo-Fen; Wang, Ning; Sun, Li-Hua; Lu, Guan-Yi; Sun, Chao; Yang, Bao-Feng

2010-12-22

The Daming capsule (DMC) is a traditional Chinese medicine used to treat hyperlipoidemia. Both clinic trials and studies on animal models have demonstrated that DMC is beneficial against diabetic symptoms. Impairment of the baroreflex can cause life-threatening arrhythmias and sudden cardiac death in patients with diabetes mellitus (DM). This study was designed to elucidate the effects of DMC on baroreflexes in streptozocin (STZ)-induced diabetic rats with hyperlipoidemia. Wistar rats were randomly divided into three groups: untreated controls, rats pretreated STZ and high lipids (a diabetes model or DM rats), and DM rats treated with DMC. The baroreflex sensitivity was examined during intravenous injection of phenylephrine (PE) or sodium nitroprusside (SNP) and quantified by the change in heart rate over the change in mean arterial blood pressure (ΔHR/ΔMABP). Morphological remodeling of baroreceptors was analyzed by transmission electron microscopy (TEM). The mRNA levels and expression of GluR2 and a GABAA receptor subunit were measured by quantitative RT-PCR and Western blotting. Compared to untreated DM rats, DMC significantly elevated the ratio of ΔHR/ΔMABP by enhancing the compensatory reduction in HR (-ΔHR) in response to PE-induced hypertension (+ΔMABP) (P < 0.05). In the presence of SNP, DMC increased the ΔMABP (P < 0.05). In addition, DMC markedly shortened the duration of blood pressure changes elicited by PE or SNP in DM rats compared to the untreated DM group (P < 0.05). Electron microscopy revealed disrupted myelin sheaths, swollen ER, and lysed mitochondria in the nucleus ambiguous (NAm) DM rats. These signs of neuropathology were largely prevented by treatment with DMC for 30 days. Treatment with DMC elevated both mRNA and protein level of GluR2 in the NAm of DM rats, but had no effect on GABAA receptor expression. The Daming capsule partially reversed the parasympathetic baroreflex impairment observed in STZ-induced diabetic rats with hyperlipoidemia. Treatment with DMC also prevented the degeneration of neurons and myelinated axons in the brain stem NAm and reversed the down-regulation of GluR2 mRNA. Rescue of NAm function may contribute to the medicinal properties of DMC in diabetic rats.

Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus

PubMed Central

Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

2007-01-01

Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC50 values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins. PMID:17881566

Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus.

PubMed

Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

2007-09-25

Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC(50) values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins.

Capsaicin-induced glutamate release is implicated in nociceptive processing through activation of ionotropic glutamate receptors and group I metabotropic glutamate receptor in primary afferent fibers.

PubMed

Jin, You-Hong; Yamaki, Fumiko; Takemura, Motohide; Koike, Yuichi; Furuyama, Akira; Yonehara, Norifumi

2009-02-01

Glutamate (Glu) is the major excitatory neurotransmitter in the central nervous system. The role of peripheral Glu and Glu receptors (GluRs) in nociceptive transmission is, however, still unclear. In the present study, we examined Glu levels released in the subcutaneous perfusate of the rat hind instep using a microdialysis catheter and the thermal withdrawal latency using the Plantar Test following injection of drugs associated with GluRs with/without capsaicin into the hindpaw. The injection of capsaicin into the rat hind instep caused an increase of Glu level in the s.c. perfusate. Capsaicin also significantly decreased withdrawal latency to irradiation. These effects of capsaicin were inhibited by pretreatment with capsazepine, a transient receptor potential vanilloid receptor 1 (TRPV1) competitive antagonist. Capsaicin-induced Glu release was also suppressed by combination with each antagonist of ionotropic GluRs (iGluRs: NMDA/AMPA receptors) and group I metabotropic GluR (mGluR), but not group II and group III mGluRs. Furthermore, these GluRs antagonists showed remarkable inhibition against capsaicin-induced thermal hyperalgesia. These results suggest that Glu is released from the peripheral endings of small-diameter afferent fibers by noxious stimulation and then activates peripheral iGluRs and group I mGluR in development and/or maintenance of nociception. Furthermore, the activation of peripheral NMDA/AMPA receptors and group I mGluR may be important in mechanisms whereby capsaicin evokes nociceptive responses.

Effect of Progesterone on Cerebral Vasospasm and Neurobehavioral Outcomes in a Rodent Model of Subarachnoid Hemorrhage.

PubMed

Turan, Nefize; Miller, Brandon A; Huie, J Russell; Heider, Robert A; Wang, Jun; Wali, Bushra; Yousuf, Seema; Ferguson, Adam R; Sayeed, Iqbal; Stein, Donald G; Pradilla, Gustavo

2018-02-01

Subarachnoid hemorrhage (SAH) induces widespread inflammation leading to cellular injury, vasospasm, and ischemia. Evidence suggests that progesterone (PROG) can improve functional recovery in acute brain injury owing to its anti-inflammatory and neuroprotective properties, which could also be beneficial in SAH. We hypothesized that PROG treatment attenuates inflammation-mediated cerebral vasospasm and microglial activation, improves synaptic connectivity, and ameliorates functional recovery after SAH. We investigated the effect of PROG in a cisternal SAH model in adult male C57BL/6 mice. Neurobehavioral outcomes were evaluated using rotarod latency and grip strength tests. Basilar artery perimeter, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid glutamate receptor 1 (GluR1)/synaptophysin colocalization, and Iba-1 immunoreactivity were quantified histologically. PROG (8 mg/kg) significantly improved rotarod latency at day 6 and grip strength at day 9. PROG-treated mice had significantly reduced basilar artery vasospasm at 24 hours. GluR1/synaptophysin colocalization, indicative of synaptic GluR1, was significantly reduced in the SAH+Vehicle group at 24 hours, and PROG treatment significantly attenuated this reduction. PROG treatment significantly reduced microglial cell activation and proliferation in cerebellum and cortex but not in the brainstem at 10 days. PROG treatment ameliorated cerebral vasospasm, reduced microglial activation, restored synaptic GluR1 localization, and improved neurobehavioral performance in a murine model of SAH. These results provide a rationale for further translational testing of PROG therapy in SAH. Copyright © 2017 Elsevier Inc. All rights reserved.

Glutamate receptor mutations in psychiatric and neurodevelopmental disorders

PubMed Central

Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Àlex

2014-01-01

Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications. PMID:24605182

Glutamate receptor mutations in psychiatric and neurodevelopmental disorders.

PubMed

Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Alex

2014-01-01

Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications.

Synaptic Neurotransmission Depression in Ventral Tegmental Dopamine Neurons and Cannabinoid-Associated Addictive Learning

PubMed Central

Liu, Zhiqiang; Han, Jing; Jia, Lintao; Maillet, Jean-Christian; Bai, Guang; Xu, Lin; Jia, Zhengping; Zheng, Qiaohua; Zhang, Wandong; Monette, Robert; Merali, Zul; Zhu, Zhou; Wang, Wei; Ren, Wei; Zhang, Xia

2010-01-01

Drug addiction is an association of compulsive drug use with long-term associative learning/memory. Multiple forms of learning/memory are primarily subserved by activity- or experience-dependent synaptic long-term potentiation (LTP) and long-term depression (LTD). Recent studies suggest LTP expression in locally activated glutamate synapses onto dopamine neurons (local Glu-DA synapses) of the midbrain ventral tegmental area (VTA) following a single or chronic exposure to many drugs of abuse, whereas a single exposure to cannabinoid did not significantly affect synaptic plasticity at these synapses. It is unknown whether chronic exposure of cannabis (marijuana or cannabinoids), the most commonly used illicit drug worldwide, induce LTP or LTD at these synapses. More importantly, whether such alterations in VTA synaptic plasticity causatively contribute to drug addictive behavior has not previously been addressed. Here we show in rats that chronic cannabinoid exposure activates VTA cannabinoid CB1 receptors to induce transient neurotransmission depression at VTA local Glu-DA synapses through activation of NMDA receptors and subsequent endocytosis of AMPA receptor GluR2 subunits. A GluR2-derived peptide blocks cannabinoid-induced VTA synaptic depression and conditioned place preference, i.e., learning to associate drug exposure with environmental cues. These data not only provide the first evidence, to our knowledge, that NMDA receptor-dependent synaptic depression at VTA dopamine circuitry requires GluR2 endocytosis, but also suggest an essential contribution of such synaptic depression to cannabinoid-associated addictive learning, in addition to pointing to novel pharmacological strategies for the treatment of cannabis addiction. PMID:21187978

Identification of the kainate receptor subunits underlying modulation of excitatory synaptic transmission in the CA3 region of the hippocampus.

PubMed

Contractor, A; Swanson, G T; Sailer, A; O'Gorman, S; Heinemann, S F

2000-11-15

To understand the physiological role of kainate receptors and their participation in seizure induction in animal models of epilepsy, it will be necessary to develop a comprehensive description of their action in the CA3 region of the hippocampus. Activation of presynaptic kainate receptors depresses excitatory synaptic transmission at mossy fiber and associational-commissural inputs to CA3 pyramidal neurons (Vignes et al., 1998; Bortolotto et al., 1999; Kamiya and Ozawa, 2000). In this study, we use gene-targeted mice lacking glutamate receptor 5 (GluR5) or GluR6 kainate receptor subunits to identify the receptor subunits that comprise the kainate receptors responsible for presynaptic modulation of CA3 transmission. We found that bath application of kainate (3 microm) profoundly reduced EPSCs at mossy fiber and collateral synapses in neurons from wild-type and GluR5(-/-) mice but had no effect on EPSCs in neurons from GluR6(-/-) mice. These results therefore contrast with previous studies that supported a role for GluR5-containing receptors at mossy fiber and associational-commissural synapses (Vignes et al., 1998; Bortolotto et al., 1999). Surprisingly, at perforant path synapses kainate receptor activation enhanced transmission; this potentiation was abolished in both GluR5 and GluR6 knock-out mice. Kainate receptors thus play multiple and complex roles to modulate excitatory synaptic transmission in the CA3 region of the hippocampus.

Xenon reduces glutamate-, AMPA-, and kainate-induced membrane currents in cortical neurones.

PubMed

Dinse, A; Föhr, K J; Georgieff, M; Beyer, C; Bulling, A; Weigt, H U

2005-04-01

The anaesthetic, analgesic, and neuroprotective effects of xenon (Xe) are believed to be mediated by a block of the NMDA (N-methyl-D-aspartate) receptor channel. Interestingly, the clinical profile of the noble gas differs markedly from that of specific NMDA receptor antagonists. The aim of this study was, therefore, to investigate whether Xe might be less specific, also inhibiting the two other subtypes of glutamate receptor channels, such as the alpha-amino-3-hydroxy-5-methyl-4-isoxazolole propionate (AMPA) and kainate receptors. The study was performed on voltage-clamped cortical neurones from embryonic mice and SH-SY5Y cells expressing GluR6 kainate receptors. Drugs were applied by a multi-barreled fast perfusion system. Xe, dissolved at approximately 3.45 mM in aqueous solution, diminished the peak and even more the plateau of AMPA and glutamate induced currents. At the control EC(50) value for AMPA (29 microM) these reductions were by about 40 and 56% and at 3 mM glutamate the reductions were by 45 and 66%, respectively. Currents activated at the control EC(50) value for kainate (57 microM) were inhibited by 42%. Likewise, Xe showed an inhibitory effect on kainate-induced membrane currents of SH-SY5Y cells transfected with the GluR6 subunit of the kainate receptor. Xe reduced kainate-induced currents by between 35 and 60%, depending on the kainate concentration. Xe blocks not only NMDA receptors, but also AMPA and kainate receptors in cortical neurones as well as GluR6-type receptors expressed in SH-SY5Y cells. Thus, Xe seems to be rather non-specific as a channel blocker and this may contribute to the analgesic and anaesthetic potency of Xe.

Overexpressed Calponin3 by Subsonic Vibration Induces Neural Differentiation of hUC-MSCs by Regulating the Ionotropic Glutamate Receptor.

PubMed

Kim, Hyun-Jung; Kim, Jin-Hee; Song, Yeo-Ju; Seo, Young-Kwon; Park, Jung-Keug; Kim, Chan-Wha

2015-09-01

In this study, we used proteomics to investigate the effects of sonic vibration (SV) on mesenchymal stem cells derived from human umbilical cords (hUC-MSCs) during neural differentiation to understand how SV enhances neural differentiation of hUC-MSCs. We investigated the levels of gene and protein related to neural differentiation after 3 or 5 days in a group treated with 40-Hz SV. In addition, protein expression patterns were compared between the control and the 40-Hz SV-treated hUC-MSC groups via a proteomic approach. Among these proteins, calponin3 (CNN3) was confirmed to have 299 % higher expression in the 40-Hz SV stimulated hUC-MSCs group than that in the control by Western blotting. Notably, overexpression of CNN3-GFP in Chinese hamster ovary (CHO)-K1 cells had positive effects on the stability and reorganization of F-actin compared with that in GFP-transfected cells. Moreover, CNN3 changed the morphology of the cells by making a neurite-like form. After being subjected to SV, messenger RNA (mRNA) levels of glutamate receptors such as PSD95, GluR1, and NR1 as well as intracellular calcium levels were upregulated. These results suggest that the activity of glutamate receptors increased because of CNN3 characteristics. Taken together, these results demonstrate that overexpressed CNN3 during SV increases expression of glutamate receptors and promotes functional neural differentiation of hUC-MSCs.

The effect of propofol postconditioning on the expression of K(+)-Cl(-)-co-transporter 2 in GABAergic inhibitory interneurons of acute ischemia/reperfusion injury rats.

PubMed

Wang, Hongbai; Liu, Shuying; Wang, Haiyun; Wang, Guolin; Zhu, Ai

2015-02-09

It has been shown in our previous study that propofol postconditioning enhanced the activity of phosphatidylinositol-3-kinase (PI3K) and prevented the internalization of GluR2 subunit of α-amino-3-hydroxyl-5-methyl-4-isoxazolepropionic acid (AMPA) receptors, thus provided neuroprotection in cerebral ischemia/reperfusion (I/R) injury. Regarding inhibitory system in CNS, K(+)-Cl(-)-co-transporter 2 (KCC2), a Cl(-) extruder, plays a critical role in gamma-aminobutyric acid (GABA) inhibitory effect in mature central neurons. However, the effect of propofol postconditioning on the expression of KCC2 in GABAergic interneurons is unclear. Therefore, in this article we describe the role of KCC2 in GABAergic interneurons in the ipsilateral hippocampal CA1 region of adult rats and the effects of propofol postconditioning on this region. Herein we demonstrate that propofol postconditioning (20mg/kg/h, 2h) improved rats' neurobehavioral abilities, increased the number of survival neurons, and up-regulated neuronal KCC2 expression in glutamic acid decarboxylase 67 (GAD67) expressing GABAergic interneurons in hippocampal CA1 region at 24h after I/R. In contrast, when rats were injected with the KCC2 antagonist, [(dihydroindenyl)oxy] alkanoic acid (DIOA), the neuroprotective effects induced by propofol postconditioning were reversed. Our study indicated that propofol postconditioning increased the expression of KCC2 in inhibitory GABAergic interneurons, thus providing acute neuroprotection to rats who had undergone cerebral I/R injury. Copyright © 2014 Elsevier B.V. All rights reserved.

Changes of several brain receptor complexes in the cerebral cortex of patients with Alzheimer disease: probable new potential pharmaceutical targets.

PubMed

Falsafi, Soheil Keihan; Roßner, Steffen; Ghafari, Maryam; Groessl, Michael; Morawski, Markus; Gerner, Christopher; Lubec, Gert

2014-01-01

Although Alzheimer disease (AD) has been linked to defects in major brain receptors, studies thus far have been limited to the determination of receptor subunits or specific ligand binding studies. However, the availability of current technology enables the determination and quantification of brain receptor complexes. Thus, we examined levels of native receptor complexes in the brains of patients with AD. Cortical tissue was obtained from control subjects (n = 12 females and 12 males) and patients with AD (n = 12 females and 12 males) within a 3-h postmortem time period. The tissues were kept frozen until further biochemical analyses. Membrane proteins were extracted and subsequently enriched by ultracentrifugation using a sucrose gradient. Membrane proteins were then electrophoresed onto native gels and immunoblotted using antibodies against individual brain receptors. We found that the levels were comparable for complexes containing GluR2, GluR3 and GluR4 as well as 5-HT1A. Moreover, the levels of complexes containing muscarinic AChR M1, NR1 and GluR1 were significantly increased in male patients with AD. Nicotinic AChRs 4 and 7 as well as dopaminergic receptors D1 and D2 were also increased in males and females with AD. These findings reveal a pattern of altered receptor complex levels that may contribute to the deterioration of the concerted activity of these receptors and thus result in cognitive deficits observed in patients with AD. It should be emphasised that receptor complexes function as working units rather than individual subunits. Thus, the receptor deficits identified may be relevant for the design of experimental therapies. Therefore, specific pharmacological modulation of these receptors is within the pharmaceutical repertoire.

Association of the AMPA receptor-related postsynaptic density proteins GRIP and ABP with subsets of glutamate-sensitive neurons in the rat retina.

PubMed

Gábriel, Robert; de Souza, Sunita; Ziff, Edward B; Witkovsky, Paul

2002-07-22

We used specific antibodies against two postsynaptic density proteins, GRIP (glutamate receptor interacting protein) and ABP (AMPA receptor-binding protein), to study their distribution in the rat retina. In the central nervous system, it has been shown that both proteins bind strongly to the AMPA glutamate receptor (GluR) 2/3 subunits, but not other GluRs, through a set of three PDZ domains. Western blots detected a single GRIP protein that was virtually identical in retina and brain, whereas retinal ABP corresponded to only one of three ABP peptides found in brain. The retinal distributions of GluR2/3, GRIP, and ABP immunoreactivity (IR) were similar but not identical. GluR2/3 immunoreactivity (IR) was abundant in both plexiform layers and in large perikarya. ABP IR was concentrated in large perikarya but was sparse in the plexiform layers, whereas GRIP IR was relatively more abundant in the plexiform layers than in perikarya. Immunolabel for these three antibodies consisted of puncta < or = 0.2 microm in diameter. The cellular localization of GRIP and ABP IR was examined by double labeling subclasses of retinal neuron with characteristic marker proteins, e.g., calbindin. GRIP, ABP, and GluR2/3 IR were detected in horizontal cells, dopaminergic and glycinergic AII amacrine cells and large ganglion cells. Immunolabel was absent in rod bipolar and weak or absent in cholinergic amacrine cells. By using the tyramide method of signal amplification, a colocalization of GluR2/3 was found with either GRIP or ABP in horizontal cell terminals, and perikarya of amacrine and ganglion cells. Our results show that ABP and GRIP colocalize with GluR2/3 in particular subsets of retinal neuron, as was previously established for certain neurons in the brain. Copyright 2002 Wiley-Liss, Inc.

Environmental Enrichment Mitigates Deficits after Repetitive Mild Traumatic Brain Injury.

PubMed

Liu, Xixia; Qiu, Jianhua; Alcon, Sasha; Hashim, Jumana; Meehan, William P; Mannix, Rebekah

2017-08-15

Although environmental enrichment has been shown to improve functional and histologic outcomes in pre-clinical moderate-to-severe traumatic brain injury (TBI), there are a paucity of pre-clinical data regarding enrichment strategies in the setting of repetitive mild traumatic brain injury (rmTBI). Given the vast numbers of athletes and those in the military who sustain rmTBI, the mounting evidence of the long-term and progressive sequelae of rmTBI, and the lack of targeted therapies to mitigate these sequelae, successful enrichment interventions in rmTBI could have large public health significance. Here, we evaluated enrichment strategies in an established pre-clinical rmTBI model. Seventy-one male C57BL/6 mice were randomized to two different housing conditions, environmental enrichment (EE) or normal condition (NC), then subjected to rmTBI injury (seven injuries in 9 days) or sham injury (anesthesia only). Functional outcomes in all four groups (NC-TBI, EE-TBI, NC-sham, and EE-sham) were assessed by motor, exploratory/anxiety, and mnemonic behavioral tests. At the synaptic level, N-methyl d-aspartate receptor (NMDAR) subunit expression of phosphorylated glutamate receptor 1 (GluR1), phosphorylated Ca 2+ /calmodulin-dependent protein kinase II (CaMKII), and calpain were evaluated by western blot. Compared to injured NC-TBI mice, EE-TBI mice had improved memory and decreased anxiety and exploratory activity post-injury. Treatment with enrichment also corresponded to normal NMDAR subunit expression, decreased GluR1 phosphorylation, decreased phosphorylated CaMKII, and normal calpain expression post-rmTBI. These data suggest that enrichment strategies may improve functional outcomes and mitigate synaptic changes post-rmTBI. Given that enrichment strategies are feasible in the clinical setting, particularly for athletes and soldiers for whom the risk of repetitive injury is greatest, these data suggest that clinical trials may be warranted.

Altered expression of genes involved in GABAergic transmission and neuromodulation of granule cell activity in the cerebellum of schizophrenia patients.

PubMed

Bullock, W Michael; Cardon, Karen; Bustillo, Juan; Roberts, Rosalinda C; Perrone-Bizzozero, Nora I

2008-12-01

Deficits in gamma-aminobutyric acid (GABA) signaling have been described in the prefrontal cortex, limbic system, and cerebellum in individuals with schizophrenia. The purpose of the present study was to further investigate cerebellar gene expression alterations as they relate to decreases in GABAergic transmission by examining the expression of GABAergic markers, N-methyl-d-aspartic-acid (NMDA) receptor subunits, and cerebellum neuromodulators in individuals with schizophrenia. Subjects were postmortem men with a diagnosis of schizophrenia (N=13) and a postmortem interval-matched non-psychiatric male comparison group (N=13). The authors utilized real-time-quantitative polymerase chain reaction (PCR) to measure mRNA levels of the following GABAergic markers: glutamic acid decarboxylase (GAD) 65 and 67; GABA plasma membrane transporter-1 (GAT-1); GABA type A (GABA(A)) receptor subunits alpha(6), beta(3), and delta; and parvalbumin. In addition, real-time-quantitative PCR was utilized to assess mRNA levels of the NMDA receptor (NR) subunits NR1, NR2-A, NR2-B, NR2-C, and NR2-D as well as the cerebellar neuromodulators glutamate receptor (GluR)-6, kainate-preferring glutamate receptor subunit-2 (KA2), metabotropic glutamate receptor (mGluR)-2 and mGluR3, and neuronal nitric oxide synthase. Measurements for mRNA levels were determined using lateral cerebellar hemisphere tissue from both schizophrenia and comparison subjects. Schizophrenia subjects showed significant decreases in mRNA levels of GAD(67), GAD(65), GAT-1, mGluR2, and neuronal nitric oxide synthase. Increases in GABA(A)-alpha(6 )and GABA(A)-delta as well as GluR6 and KA2 were also observed. Medication effects on the expression of the same genes were examined in rats treated with either haloperidol (Sprague-Dawley rats [N=16]) or clozapine (Long-Evans rats [N=20]). Both haloperidol and clozapine increased the levels of GAD(67) in the cerebellum and altered the expression of other cerebellar mRNAs. These findings suggest that GABA transmission is decreased in the cerebellar cortices in individuals with schizophrenia and additional gene expression changes may reflect an attempt to increase GABA neurotransmission at the cerebellar glomerulus.

Rapid modulation of gene expression profiles in the telencephalon of male goldfish following exposure to waterborne sex pheromones.

PubMed

Lado, Wudu E; Zhang, Dapeng; Mennigen, Jan A; Zamora, Jacob M; Popesku, Jason T; Trudeau, Vance L

2013-10-01

Sex pheromones rapidly affect endocrine physiology and behaviour, but little is known about their effects on gene expression in the neural tissues that mediate olfactory processing. In this study, we exposed male goldfish for 6h to waterborne 17,20βP (4.3 nM) and PGF2α (3 nM), the main pre-ovulatory and post-ovulatory pheromones, respectively. Both treatments elevated milt volume (P=0.001). Microarray analysis of male telencephalon following PGF2α treatment identified 71 unique transcripts that were differentially expressed (q<5%; 67 up, 4 down). Functional annotation of these regulated genes indicates that PGF2α pheromone exposure affects diverse biological processes including nervous system functions, energy metabolism, cholesterol/lipoprotein transport, translational regulation, transcription and chromatin remodelling, protein processing, cytoskeletal organization, and signalling. By using real-time RT-PCR, we further validated three candidate genes, ependymin-II, calmodulin-A and aldolase C, which exhibited 3-5-fold increase in expression following PGF2α exposure. Expression levels of some other genes that are thought to be important for reproduction were also determined using real-time RT-PCR. Expression of sGnRH was increased by PGF2α, but not 17,20βP, whereas cGnRH expression was increased by 17,20βP but not PGF2α. In contrast, both pheromones increase the expression of glutamate (GluR2a, NR2A) and γ-aminobutyric acid (GABAA γ2) receptor subunit mRNAs. Milt release and rapid modulation of neuronal transcription are part of the response of males to female sex pheromones. Copyright © 2013 Elsevier Inc. All rights reserved.

Activation of PPARγ Ameliorates Spatial Cognitive Deficits through Restoring Expression of AMPA Receptors in Seipin Knock-Out Mice.

PubMed

Zhou, Libin; Chen, Tingting; Li, Guoxi; Wu, Chaoming; Wang, Conghui; Li, Lin; Sha, Sha; Chen, Lei; Liu, George; Chen, Ling

2016-01-27

A characteristic phenotype of congenital generalized lipodystrophy 2 (CGL2) that is caused by loss-of-function of seipin gene is mental retardation. Here, we show that seipin deficiency in hippocampal CA1 pyramidal cells caused the reduction of peroxisome proliferator-activated receptor gamma (PPARγ). Twelve-week-old systemic seipin knock-out mice and neuronal seipin knock-out (seipin-nKO) mice, but not adipose seipin knock-out mice, exhibited spatial cognitive deficits as assessed by the Morris water maze and Y-maze, which were ameliorated by the treatment with the PPARγ agonist rosiglitazone (rosi). In addition, seipin-nKO mice showed the synaptic dysfunction and the impairment of NMDA receptor-dependent LTP in hippocampal CA1 regions. The density of AMPA-induced current (IAMPA) in CA1 pyramidal cells and GluR1/GluR2 expression were significantly reduced in seipin-nKO mice, whereas the NMDA-induced current (INMDA) and NR1/NR2 expression were not altered. Rosi treatment in seipin-nKO mice could correct the decrease in expression and activity of AMPA receptor (AMPAR) and was accompanied by recovered synaptic function and LTP induction. Furthermore, hippocampal ERK2 and CREB phosphorylation in seipin-nKO mice were reduced and this could be rescued by rosi treatment. Rosi treatment in seipin-nKO mice elevated BDNF concentration. The MEK inhibitor U0126 blocked rosi-restored AMPAR expression and LTP induction in seipin-nKO mice, but the Trk family inhibitor K252a did not. These findings indicate that the neuronal seipin deficiency selectively suppresses AMPAR expression through reducing ERK-CREB activities, leading to the impairment of LTP and spatial memory, which can be rescued by PPARγ activation. Congenital generalized lipodystrophy 2 (CGL2), caused by loss-of-function mutation of seipin gene, is characterized by mental retardation. By the generation of systemic or neuronal seipin knock-out mice, the present study provides in vivo evidence that neuronal seipin deficiency causes deficits in spatial memory and hippocampal LTP induction. Neuronal seipin deficiency selectively suppresses AMPA receptor expression, ERK-CREB phosphorylation with the decline of PPARγ. The PPARγ agonist rosiglitazone can ameliorate spatial cognitive deficits and rescue the LTP induction in seipin knock-out mice by restoring AMPA receptor expression and ERK-CREB activities. Copyright © 2016 the authors 0270-6474/16/361242-12$15.00/0.

MicroRNA expression, target genes, and signaling pathways in infants with a ventricular septal defect.

PubMed

Chai, Hui; Yan, Zhaoyuan; Huang, Ke; Jiang, Yuanqing; Zhang, Lin

2018-02-01

This study aimed to systematically investigate the relationship between miRNA expression and the occurrence of ventricular septal defect (VSD), and characterize the miRNA target genes and pathways that can lead to VSD. The miRNAs that were differentially expressed in blood samples from VSD and normal infants were screened and validated by implementing miRNA microarrays and qRT-PCR. The target genes regulated by differentially expressed miRNAs were predicted using three target gene databases. The functions and signaling pathways of the target genes were enriched using the GO database and KEGG database, respectively. The transcription and protein expression of specific target genes in critical pathways were compared in the VSD and normal control groups using qRT-PCR and western blotting, respectively. Compared with the normal control group, the VSD group had 22 differentially expressed miRNAs; 19 were downregulated and three were upregulated. The 10,677 predicted target genes participated in many biological functions related to cardiac development and morphogenesis. Four target genes (mGLUR, Gq, PLC, and PKC) were involved in the PKC pathway and four (ECM, FAK, PI3 K, and PDK1) were involved in the PI3 K-Akt pathway. The transcription and protein expression of these eight target genes were significantly upregulated in the VSD group. The 22 miRNAs that were dysregulated in the VSD group were mainly downregulated, which may result in the dysregulation of several key genes and biological functions related to cardiac development. These effects could also be exerted via the upregulation of eight specific target genes, the subsequent over-activation of the PKC and PI3 K-Akt pathways, and the eventual abnormal cardiac development and VSD.

Effects of exposure to Streptococcus iniae on microRNA expression in the head kidney of genetically improved farmed tilapia (Oreochromis niloticus).

PubMed

Qiang, Jun; Tao, Fanyi; He, Jie; Sun, Lanyi; Xu, Pao; Bao, Wenjin

2017-02-20

Genetically improved farmed tilapia (GIFT, Oreochromis niloticus) are susceptible to infection by Streptococcus iniae when maintained in modern intensive culture systems. GIFT are commercially important fishes that are cultured widely in southern China. The role of microRNAs (miRNAs) in the regulatory response of GIFT to S. iniae infection has been underestimated and has not yet been well studied. Head kidney has an important immune function in teleost fishes. The main aim of this study was to determine the possible function of miRNAs in head kidney of S. iniae-infected GIFT. MiRNAs are small, non-coding RNAs that regulate gene expression by binding to the 3'-untranslated regions of their target mRNAs. MiRNAs are known to regulate immune-regulated signaling and inflammatory response pathways. High-throughput deep sequencing of two libraries (control group [CO] and infected group [IN]) of RNA extracted from GIFT head kidney tissues generated 12,089,630 (CO) and 12,624,975 (IN) clean reads. Bioinformatics analysis identified 1736 and 1729 conserved miRNAs and 164 and 165 novel miRNAs in the CO and IN libraries, respectively. Three miRNAs (miR-310-3p, miR-92, and miR-127) were found to be up-regulated and four miRNAs (miR-92d-3p, miR-375-5p, miR-146-3p, and miR-694) were found to be down-regulated in the S. iniae-infected GIFT. The expressions of these miRNAs were verified by quantitative real-time PCR. RNAhybrid and TargetScan were used to identify complementary miRNA and mRNA target sites, and the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes databases were used to annotate and predict potential downstream regulation of biological pathways. Seven target genes, which encode immune-related proteins (complement C3, cytidine deaminase, regulator of G-protein Rgs22, mitogen-activated protein kinase Mapk1, metabotropic glutamate receptorm GluR8, calcium-sensing receptor CaSR, and microtubule-associated protein Map1S) were predicted to play crucial roles in the GIFT response to S. iniae infection. S. iniae outbreaks have hindered the development of the tilapia industry in China. Understanding the miRNA transcriptome of S. iniae-infected GIFT is important for exploring the immune responses regulated by miRNAs as well as for studying novel regulated networks to prevent and treat S. iniae infections in the future.

Structure and assembly mechanism for heteromeric kainate receptors.

PubMed

Kumar, Janesh; Schuck, Peter; Mayer, Mark L

2011-07-28

Native glutamate receptor ion channels are tetrameric assemblies containing two or more different subunits. NMDA receptors are obligate heteromers formed by coassembly of two or three divergent gene families. While some AMPA and kainate receptors can form functional homomeric ion channels, the KA1 and KA2 subunits are obligate heteromers which function only in combination with GluR5-7. The mechanisms controlling glutamate receptor assembly involve an initial step in which the amino terminal domains (ATD) assemble as dimers. Here, we establish by sedimentation velocity that the ATDs of GluR6 and KA2 coassemble as a heterodimer of K(d) 11 nM, 32,000-fold lower than the K(d) for homodimer formation by KA2; we solve crystal structures for the GluR6/KA2 ATD heterodimer and heterotetramer assemblies. Using these structures as a guide, we perform a mutant cycle analysis to probe the energetics of assembly and show that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors. Copyright © 2011 Elsevier Inc. All rights reserved.

TPEN, a Specific Zn2+ Chelator, Inhibits Sodium Dithionite and Glucose Deprivation (SDGD)-Induced Neuronal Death by Modulating Apoptosis, Glutamate Signaling, and Voltage-Gated K+ and Na+ Channels.

PubMed

Zhang, Feng; Ma, Xue-Ling; Wang, Yu-Xiang; He, Cong-Cong; Tian, Kun; Wang, Hong-Gang; An, Di; Heng, Bin; Xie, Lai-Hua; Liu, Yan-Qiang

2017-03-01

Hypoxia-ischemia-induced neuronal death is an important pathophysiological process that accompanies ischemic stroke and represents a major challenge in preventing ischemic stroke. To elucidate factors related to and a potential preventative mechanism of hypoxia-ischemia-induced neuronal death, primary neurons were exposed to sodium dithionite and glucose deprivation (SDGD) to mimic hypoxic-ischemic conditions. The effects of N,N,N',N'-tetrakis (2-pyridylmethyl) ethylenediamine (TPEN), a specific Zn 2+ -chelating agent, on SDGD-induced neuronal death, glutamate signaling (including the free glutamate concentration and expression of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor (GluR2) and N-methyl-D-aspartate (NMDA) receptor subunits (NR2B), and voltage-dependent K + and Na + channel currents were also investigated. Our results demonstrated that TPEN significantly suppressed increases in cell death, apoptosis, neuronal glutamate release into the culture medium, NR2B protein expression, and I K as well as decreased GluR2 protein expression and Na + channel activity in primary cultured neurons exposed to SDGD. These results suggest that TPEN could inhibit SDGD-induced neuronal death by modulating apoptosis, glutamate signaling (via ligand-gated channels such as AMPA and NMDA receptors), and voltage-gated K + and Na + channels in neurons. Hence, Zn 2+ chelation might be a promising approach for counteracting the neuronal loss caused by transient global ischemia. Moreover, TPEN could represent a potential cell-targeted therapy.

Blast waves from detonated military explosive reduce GluR1 and synaptophysin levels in hippocampal slice cultures✩

PubMed Central

Smith, Marquitta; Piehler, Thuvan; Benjamin, Richard; Farizatto, Karen L.; Pait, Morgan C.; Almeida, Michael F.; Ghukasyan, Vladimir V.; Bahr, Ben A.

2017-01-01

Explosives create shockwaves that cause blast-induced neurotrauma, one of the most common types of traumatic brain injury (TBI) linked to military service. Blast-induced TBIs are often associated with reduced cognitive and behavioral functions due to a variety of factors. To study the direct effects of military explosive blasts on brain tissue, we removed systemic factors by utilizing rat hippocampal slice cultures. The long-term slice cultures were briefly sealed air-tight in serum-free medium, lowered into a 37 °C water-filled tank, and small 1.7-gram assemblies of cyclotrimethylene trinitramine (RDX) were detonated 15 cm outside the tank, creating a distinct shockwave recorded at the culture plate position. Compared to control mock-treated groups of slices that received equal submerge time, 1–3 blast impacts caused a dose-dependent reduction in the AMPA receptor subunit GluR1. While only a small reduction was found in hippocampal slices exposed to a single RDX blast and harvested 1–2 days later, slices that received two consecutive RDX blasts 4 min apart exhibited a 26–40% reduction in GluR1, and the receptor subunit was further reduced by 64–72% after three consecutive blasts. Such loss correlated with increased levels of HDAC2, a histone deacetylase implicated in stress-induced reduction of glutamatergic transmission. No evidence of synaptic marker recovery was found at 72 h post-blast. The presynaptic marker synaptophysin was found to have similar susceptibility as GluR1 to the multiple explosive detonations. In contrast to the synaptic protein reductions, actin levels were unchanged, spectrin breakdown was not detected, and Fluoro-Jade B staining found no indication of degenerating neurons in slices exposed to three RDX blasts, suggesting that small, sub-lethal explosives are capable of producing selective alterations to synaptic integrity. Together, these results indicate that blast waves from military explosive cause signs of synaptic compromise without producing severe neurodegeneration, perhaps explaining the cognitive and behavioral changes in those blast-induced TBI sufferers that have no detectable neuropathology. PMID:27720798

tRNAGlu increases the affinity of glutamyl-tRNA synthetase for its inhibitor glutamyl-sulfamoyl-adenosine, an analogue of the aminoacylation reaction intermediate glutamyl-AMP: mechanistic and evolutionary implications.

PubMed

Blais, Sébastien P; Kornblatt, Jack A; Barbeau, Xavier; Bonnaure, Guillaume; Lagüe, Patrick; Chênevert, Robert; Lapointe, Jacques

2015-01-01

For tRNA-dependent protein biosynthesis, amino acids are first activated by aminoacyl-tRNA synthetases (aaRSs) yielding the reaction intermediates aminoacyl-AMP (aa-AMP). Stable analogues of aa-AMP, such as aminoacyl-sulfamoyl-adenosines, inhibit their cognate aaRSs. Glutamyl-sulfamoyl-adenosine (Glu-AMS) is the best known inhibitor of Escherichia coli glutamyl-tRNA synthetase (GluRS). Thermodynamic parameters of the interactions between Glu-AMS and E. coli GluRS were measured in the presence and in the absence of tRNA by isothermal titration microcalorimetry. A significant entropic contribution for the interactions between Glu-AMS and GluRS in the absence of tRNA or in the presence of the cognate tRNAGlu or of the non-cognate tRNAPhe is indicated by the negative values of -TΔSb, and by the negative value of ΔCp. On the other hand, the large negative enthalpy is the dominant contribution to ΔGb in the absence of tRNA. The affinity of GluRS for Glu-AMS is not altered in the presence of the non-cognate tRNAPhe, but the dissociation constant Kd is decreased 50-fold in the presence of tRNAGlu; this result is consistent with molecular dynamics results indicating the presence of an H-bond between Glu-AMS and the 3'-OH oxygen of the 3'-terminal ribose of tRNAGlu in the Glu-AMS•GluRS•tRNAGlu complex. Glu-AMS being a very close structural analogue of Glu-AMP, its weak binding to free GluRS suggests that the unstable Glu-AMP reaction intermediate binds weakly to GluRS; these results could explain why all the known GluRSs evolved to activate glutamate only in the presence of tRNAGlu, the coupling of glutamate activation to its transfer to tRNA preventing unproductive cleavage of ATP.

tRNAGlu Increases the Affinity of Glutamyl-tRNA Synthetase for Its Inhibitor Glutamyl-Sulfamoyl-Adenosine, an Analogue of the Aminoacylation Reaction Intermediate Glutamyl-AMP: Mechanistic and Evolutionary Implications

PubMed Central

Blais, Sébastien P.; Kornblatt, Jack A.; Barbeau, Xavier; Bonnaure, Guillaume; Lagüe, Patrick; Chênevert, Robert; Lapointe, Jacques

2015-01-01

For tRNA-dependent protein biosynthesis, amino acids are first activated by aminoacyl-tRNA synthetases (aaRSs) yielding the reaction intermediates aminoacyl-AMP (aa-AMP). Stable analogues of aa-AMP, such as aminoacyl-sulfamoyl-adenosines, inhibit their cognate aaRSs. Glutamyl-sulfamoyl-adenosine (Glu-AMS) is the best known inhibitor of Escherichia coli glutamyl-tRNA synthetase (GluRS). Thermodynamic parameters of the interactions between Glu-AMS and E. coli GluRS were measured in the presence and in the absence of tRNA by isothermal titration microcalorimetry. A significant entropic contribution for the interactions between Glu-AMS and GluRS in the absence of tRNA or in the presence of the cognate tRNAGlu or of the non-cognate tRNAPhe is indicated by the negative values of –TΔSb, and by the negative value of ΔCp. On the other hand, the large negative enthalpy is the dominant contribution to ΔGb in the absence of tRNA. The affinity of GluRS for Glu-AMS is not altered in the presence of the non-cognate tRNAPhe, but the dissociation constant K d is decreased 50-fold in the presence of tRNAGlu; this result is consistent with molecular dynamics results indicating the presence of an H-bond between Glu-AMS and the 3’-OH oxygen of the 3’-terminal ribose of tRNAGlu in the Glu-AMS•GluRS•tRNAGlu complex. Glu-AMS being a very close structural analogue of Glu-AMP, its weak binding to free GluRS suggests that the unstable Glu-AMP reaction intermediate binds weakly to GluRS; these results could explain why all the known GluRSs evolved to activate glutamate only in the presence of tRNAGlu, the coupling of glutamate activation to its transfer to tRNA preventing unproductive cleavage of ATP. PMID:25860020

Modulation of opiate-related signaling molecules in morphine-dependent conditioned behavior: conditioned place preference to morphine induces CREB phosphorylation.

PubMed

Morón, José A; Gullapalli, Srinivas; Taylor, Chirisse; Gupta, Achla; Gomes, Ivone; Devi, Lakshmi A

2010-03-01

Opiate addiction is a chronic, relapsing behavioral disorder where learned associations that develop between the abused opiate and the environment in which it is consumed are brought about through Pavlovian (classical) conditioning processes. However, the signaling mechanisms/pathways regulating the mechanisms that underlie the responses to opiate-associated cues or the development of sensitization as a consequence of repeated context-independent administration of opiates are unknown. In this study we examined the phosphorylation levels of various classic signaling molecules in brain regions implicated in addictive behaviors after acute and repeated morphine administration. An unbiased place conditioning protocol was used to examine changes in phosphorylation that are associated with (1) the expression of the rewarding effects of morphine and (2) the sensitization that develops to this effect. We also examined the effects of a delta-receptor antagonist on morphine-induced conditioned behavior and on the phosphorylation of classic signaling molecules in view of data showing that blockade of delta-opioid receptor (deltaOR) prevents the development of sensitization to the rewarding effects of morphine. We find that CREB phosphorylation is specifically induced upon the expression of a sensitized response to morphine-induced conditioned behavior in brain areas related to memory consolidation, such as the hippocampus and cortex. A similar effect is also observed, albeit to a lesser extent, in the case of the GluR1 subunit of AMPA glutamate receptor. These increases in the phosphorylation levels of CREB and pGluR1 are significantly blocked by pretreatment with a deltaOR antagonist. These results indicate a critical role for phospho-CREB, AMPA, and deltaOR activities in mediating the expression of a sensitized response to morphine-dependent conditioned behavior.

Distinct subunits in heteromeric kainate receptors mediate ionotropic and metabotropic function at hippocampal mossy fiber synapses.

PubMed

Ruiz, Arnaud; Sachidhanandam, Shankar; Utvik, Jo Kristian; Coussen, Françoise; Mulle, Christophe

2005-12-14

Heteromeric kainate receptors (KARs) containing both glutamate receptor 6 (GluR6) and KA2 subunits are involved in KAR-mediated EPSCs at mossy fiber synapses in CA3 pyramidal cells. We report that endogenous glutamate, by activating KARs, reversibly inhibits the slow Ca2+-activated K+ current I(sAHP) and increases neuronal excitability through a G-protein-coupled mechanism. Using KAR knockout mice, we show that KA2 is essential for the inhibition of I(sAHP) in CA3 pyramidal cells by low nanomolar concentrations of kainate, in addition to GluR6. In GluR6(-/-) mice, both ionotropic synaptic transmission and inhibition of I(sAHP) by endogenous glutamate released from mossy fibers was lost. In contrast, inhibition of I(sAHP) was absent in KA2(-/-) mice despite the preservation of KAR-mediated EPSCs. These data indicate that the metabotropic action of KARs did not rely on the activation of a KAR-mediated inward current. Biochemical analysis of knock-out mice revealed that KA2 was required for the interaction of KARs with Galpha(q/11)-proteins known to be involved in I(sAHP) modulation. Finally, the ionotropic and metabotropic actions of KARs at mossy fiber synapses were differentially sensitive to the competitive glutamate receptor ligands kainate (5 nM) and kynurenate (1 mM). We propose a model in which KARs could operate in two modes at mossy fiber synapses: through a direct ionotropic action of GluR6, and through an indirect G-protein-coupled mechanism requiring the binding of glutamate to KA2.

Stable liquid glucagon formulations for rescue treatment and bi-hormonal closed-loop pancreas

PubMed Central

Jackson, Melanie A.; Caputo, Nicholas; Castle, Jessica R.; David, Larry L.; Roberts, Charles T.; Ward, W. Kenneth

2014-01-01

Small doses of glucagon given subcutaneously in the research setting by an automated system prevent most cases of hypoglycemia in persons with diabetes. However, glucagon is very unstable and cannot be kept in a portable pump. Glucagon rapidly forms amyloid fibrils, even within the first day after reconstitution. Aggregation eventually leads to insoluble gels, which occlude pump catheters. Fibrillation occurs rapidly at acid pH, but is absent or minimal at alkaline pH values of ~10. Glucagon also degrades over time; this problem is greater at alkaline pH. Several studies suggest that its primary degradative pathway is deamidation, which results in a conversion of asparagine to aspartic acid. A cell-based assay for glucagon bioactivity that assesses glucagon receptor (GluR) activation can screen promising glucagon formulations. However, mammalian hepatocytes are usually problematic as they can lose GluR expression during culture. Assays for cyclic AMP (cAMP) or its downstream effector, protein kinase A (PKA), in engineered cell systems, are more reliable and suitable for inexpensive, high-throughput assessment of bioactivity. PMID:22972416

Dendritic Glutamate Receptor mRNAs Show Contingent Local Hotspot-Dependent Translational Dynamics

PubMed Central

Kim, Tae Kyung; Sul, Jai-Yoon; Helmfors, Henrik; Langel, Ulo; Kim, Junhyong; Eberwine, James

2014-01-01

SUMMARY Protein synthesis in neuronal dendrites underlies long-term memory formation in the brain. Local translation of reporter mRNAs has demonstrated translation in dendrites at focal points called translational hotspots. Various reports have shown that hundreds to thousands of mRNAs are localized to dendrites, yet the dynamics of translation of multiple dendritic mRNAs has remained elusive. Here, we show that the protein translational activities of two dendritically localized mRNAs are spatiotemporally complex but constrained by the translational hotspots in which they are colocalized. Cotransfection of glutamate receptor 2 (GluR2) and GluR4 mRNAs (engineered to encode different fluorescent proteins) into rat hippocampal neurons demonstrates a heterogeneous distribution of translational hotspots for the two mRNAs along dendrites. Stimulation with s-3,5-dihydroxy-phenylglycine modifies the translational dynamics of both of these RNAs in a complex saturable manner. These results suggest that the translational hotspot is a primary structural regulator of the simultaneous yet differential translation of multiple mRNAs in the neuronal dendrite. PMID:24075992

Effects of acute versus repeated cocaine exposure on the expression of endocannabinoid signaling-related proteins in the mouse cerebellum.

PubMed

Palomino, Ana; Pavón, Francisco-Javier; Blanco-Calvo, Eduardo; Serrano, Antonia; Arrabal, Sergio; Rivera, Patricia; Alén, Francisco; Vargas, Antonio; Bilbao, Ainhoa; Rubio, Leticia; Rodríguez de Fonseca, Fernando; Suárez, Juan

2014-01-01

Growing awareness of cerebellar involvement in addiction is based on the cerebellum's intermediary position between motor and reward, potentially acting as an interface between motivational and cognitive functions. Here, we examined the impact of acute and repeated cocaine exposure on the two main signaling systems in the mouse cerebellum: the endocannabinoid (eCB) and glutamate systems. To this end, we investigated whether eCB signaling-related gene and protein expression {cannabinoid receptor type 1 receptors and enzymes that produce [diacylglycerol lipase alpha/beta (DAGLα/β) and N-acyl phosphatidylethanolamine phospholipase D (NAPE-PLD)] and degrade [monoacylglycerol lipase (MAGL) and fatty acid amino hydrolase (FAAH)] eCB} were altered. In addition, we analyzed the gene expression of relevant components of the glutamate signaling system [glutamate synthesizing enzymes liver-type glutaminase isoform (LGA) and kidney-type glutaminase isoform (KGA), metabotropic glutamatergic receptor (mGluR3/5), NMDA-ionotropic glutamatergic receptor (NR1/2A/2B/2C) and AMPA-ionotropic receptor subunits (GluR1/2/3/4)] and the gene expression of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, because noradrenergic terminals innervate the cerebellar cortex. Results indicated that acute cocaine exposure decreased DAGLα expression, suggesting a down-regulation of 2-arachidonylglycerol (2-AG) production, as well as gene expression of TH, KGA, mGluR3 and all ionotropic receptor subunits analyzed in the cerebellum. The acquisition of conditioned locomotion and sensitization after repeated cocaine exposure were associated with an increased NAPE-PLD/FAAH ratio, suggesting enhanced anandamide production, and a decreased DAGLβ/MAGL ratio, suggesting decreased 2-AG generation. Repeated cocaine also increased LGA gene expression but had no effect on glutamate receptors. These findings indicate that acute cocaine modulates the expression of the eCB and glutamate systems. Repeated cocaine results in normalization of glutamate receptor expression, although sustained changes in eCB is observed. We suggest that cocaine-induced alterations to cerebellar eCB should be considered when analyzing the adaptations imposed by psychostimulants that lead to addiction.

Effects of acute versus repeated cocaine exposure on the expression of endocannabinoid signaling-related proteins in the mouse cerebellum

PubMed Central

Palomino, Ana; Pavón, Francisco-Javier; Blanco-Calvo, Eduardo; Serrano, Antonia; Arrabal, Sergio; Rivera, Patricia; Alén, Francisco; Vargas, Antonio; Bilbao, Ainhoa; Rubio, Leticia; Rodríguez de Fonseca, Fernando; Suárez, Juan

2014-01-01

Growing awareness of cerebellar involvement in addiction is based on the cerebellum’s intermediary position between motor and reward, potentially acting as an interface between motivational and cognitive functions. Here, we examined the impact of acute and repeated cocaine exposure on the two main signaling systems in the mouse cerebellum: the endocannabinoid (eCB) and glutamate systems. To this end, we investigated whether eCB signaling-related gene and protein expression {cannabinoid receptor type 1 receptors and enzymes that produce [diacylglycerol lipase alpha/beta (DAGLα/β) and N-acyl phosphatidylethanolamine phospholipase D (NAPE-PLD)] and degrade [monoacylglycerol lipase (MAGL) and fatty acid amino hydrolase (FAAH)] eCB} were altered. In addition, we analyzed the gene expression of relevant components of the glutamate signaling system [glutamate synthesizing enzymes liver-type glutaminase isoform (LGA) and kidney-type glutaminase isoform (KGA), metabotropic glutamatergic receptor (mGluR3/5), NMDA-ionotropic glutamatergic receptor (NR1/2A/2B/2C) and AMPA-ionotropic receptor subunits (GluR1/2/3/4)] and the gene expression of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, because noradrenergic terminals innervate the cerebellar cortex. Results indicated that acute cocaine exposure decreased DAGLα expression, suggesting a down-regulation of 2-arachidonylglycerol (2-AG) production, as well as gene expression of TH, KGA, mGluR3 and all ionotropic receptor subunits analyzed in the cerebellum. The acquisition of conditioned locomotion and sensitization after repeated cocaine exposure were associated with an increased NAPE-PLD/FAAH ratio, suggesting enhanced anandamide production, and a decreased DAGLβ/MAGL ratio, suggesting decreased 2-AG generation. Repeated cocaine also increased LGA gene expression but had no effect on glutamate receptors. These findings indicate that acute cocaine modulates the expression of the eCB and glutamate systems. Repeated cocaine results in normalization of glutamate receptor expression, although sustained changes in eCB is observed. We suggest that cocaine-induced alterations to cerebellar eCB should be considered when analyzing the adaptations imposed by psychostimulants that lead to addiction. PMID:24634647

Characterization and reversal of synaptic defects in the amygdala in a mouse model of fragile X syndrome.

PubMed

Suvrathan, Aparna; Hoeffer, Charles A; Wong, Helen; Klann, Eric; Chattarji, Sumantra

2010-06-22

Fragile X syndrome (FXS), a common inherited form of mental impairment and autism, is caused by transcriptional silencing of the fragile X mental retardation 1 (FMR1) gene. Earlier studies have identified a role for aberrant synaptic plasticity mediated by the metabotropic glutamate receptors (mGluRs) in FXS. However, many of these observations are derived primarily from studies in the hippocampus. The strong emotional symptoms of FXS, on the other hand, are likely to involve the amygdala. Unfortunately, little is known about how exactly FXS affects synaptic function in the amygdala. Here, using whole-cell recordings in brain slices from adult Fmr1 knockout mice, we find mGluR-dependent long-term potentiation to be impaired at thalamic inputs to principal neurons in the lateral amygdala. Consistent with this long-term potentiation deficit, surface expression of the AMPA receptor subunit, GluR1, is reduced in the lateral amygdala of knockout mice. In addition to these postsynaptic deficits, lower presynaptic release was manifested by a decrease in the frequency of spontaneous miniature excitatory postsynaptic currents (mEPSCs), increased paired-pulse ratio, and slower use-dependent block of NMDA receptor currents. Strikingly, pharmacological inactivation of mGluR5 with 2-methyl-6-phenylethynyl-pyridine (MPEP) fails to rescue either the deficit in long-term potentiation or surface GluR1. However, the same acute MPEP treatment reverses the decrease in mEPSC frequency, a finding of potential therapeutic relevance. Therefore, our results suggest that synaptic defects in the amygdala of knockout mice are still amenable to pharmacological interventions against mGluR5, albeit in a manner not envisioned in the original hippocampal framework.

Roles of testosterone and amygdaloid LTP induction in determining sex differences in fear memory magnitude.

PubMed

Chen, Li-Shen; Tzeng, Wen-Yu; Chuang, Jia-Ying; Cherng, Chianfang G; Gean, Po-Wu; Yu, Lung

2014-08-01

Women are thought to form fear memory more robust than men do and testosterone is suspected to play a role in determining such a sex difference. Mouse cued fear freezing was used to study the sex-related susceptibility and the role of testosterone in fear memory in humans. A 75-dB tone was found to provoke weak freezing, while 0.15-mA and 0.20-mA footshock caused strong freezing responses. No sex differences were noticed in the tone- or footshock-induced (naïve fear) freezing. Following the conditionings, female mice exhibited greater tone (cued fear)-induced freezing than did male mice. Nonetheless, female mice demonstrated indistinctive cued fear freezing across the estrous phases and ovariectomy did not affect such freezing in female mice. Orchidectomy enhanced the cued fear freezing in male mice. Systemic testosterone administrations and an intra-lateral nucleus of amygdala (LA) testosterone infusion diminished the cued fear freezing in orchidectomized male mice, while pretreatment with flutamide (Flu) eradicated these effects. Long-term potentiation (LTP) magnitude in LA has been known to correlate with the strength of the cued fear conditioning. We found that LA LTP magnitude was indeed greater in female than male mice. Orchidectomy enhanced LTP magnitude in males' LA, while ovariectomy decreased LTP magnitude in females' LA. Testosterone decreased LTP magnitude in orchidectomized males' LA and estradiol enhanced LTP magnitude in ovariectomized females' LA. Finally, male mice had lower LA GluR1 expression than female mice and orchidectomy enhanced the GluR1 expression in male mice. These findings, taken together, suggest that testosterone plays a critical role in rendering the sex differences in the cued fear freezing and LA LTP. Testosterone is negatively associated with LA LTP and the cued fear memory in male mice. However, ovarian hormones and LA LTP are loosely associated with the cued fear memory in female mice. Copyright © 2014 Elsevier Inc. All rights reserved.

Activation of AMPA receptor in the infralimbic cortex facilitates extinction and attenuates the heroin-seeking behavior in rats.

PubMed

Chen, Weisheng; Wang, Yiqi; Sun, Anna; Zhou, Linyi; Xu, Wenjin; Zhu, Huaqiang; Zhuang, Dingding; Lai, Miaojun; Zhang, Fuqiang; Zhou, Wenhua; Liu, Huifen

2016-01-26

Infralimbic cortex (IL) is proposed to suppress cocaine seeking after extinction, but whether the IL regulates the extinction and reinstatement of heroin-seeking behavior is unknown. To address this issue, the male SD rats were trained to self-administer heroin under a FR1 schedule for consecutive 14 days, then the rats underwent 7 daily 2h extinction session in the operant chamber. The activation of IL by microinjection PEPA, an allosteric AMPA receptor potentiator into IL before each of extinction session facilitated the extinction responding after heroin self-administration, but did not alter the locomotor activity in an open field testing environment. Other rats were first trained under a FR1 schedule for heroin self-administration for 14 days, followed by 14 days of extinction training, and reinstatement of heroin-seeking induced by cues was measured for 2h. Intra-IL microinjecting of PEPA at 15min prior to test inhibited the reinstatement of heroin-seeking induced by cues. Moreover, the expression of GluR1 in the IL and NAc remarkably increased after treatment with PEPA during the reinstatement. These finding suggested that activation of glutamatergic projection from IL to NAc shell may be involved in the extinction and reinstatement of heroin-seeking. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Sorting of β1-Adrenergic Receptors Is Mediated by Pathways That Are Either Dependent on or Independent of Type I PDZ, Protein Kinase A (PKA), and SAP97*

PubMed Central

Nooh, Mohammed M.; Chumpia, Maryanne M.; Hamilton, Thomas B.; Bahouth, Suleiman W.

2014-01-01

The β1-adrenergic receptor (β1-AR) is a target for treatment of major cardiovascular diseases, such as heart failure and hypertension. Recycling of agonist-internalized β1-AR is dependent on type I PSD-95/DLG/ZO1 (PDZ) in the C-tail of the β1-AR and on protein kinase A (PKA) activity (Gardner, L. A., Naren, A. P., and Bahouth, S. W. (2007) J. Biol. Chem. 282, 5085–5099). We explored the effects of point mutations in the PDZ and in the activity of PKA on recycling of the β1-AR and its binding to the PDZ-binding protein SAP97. These studies indicated that β1-AR recycling was inhibited by PKA inhibitors and by mutations in the PDZ that interfered with SAP97 binding. The trafficking effects of short sequences differing in PDZ and SAP97 binding were examined using chimeric mutant β1-AR. β1-AR chimera containing the type I PDZ of the β2-adrenergic receptor that does not bind to SAP97 failed to recycle except when serine 312 was mutated to aspartic acid. β1-AR chimera with type I PDZ sequences from the C-tails of aquaporin-2 or GluR1 recycled in a SAP97- and PKA-dependent manner. Non-PDZ β1-AR chimera derived from μ-opioid, dopamine 1, or GluR2 receptors promoted rapid recycling of chimeric β1-AR in a SAP97- and PKA-independent manner. Moreover, the nature of the residue at position −3 in the PDZ regulated whether the β1-AR was internalized alone or in complex with SAP97. These results indicate that divergent pathways were involved in trafficking the β1-AR and provide a roadmap for its trafficking via type I PDZs versus non-PDZs. PMID:24324269

Somatic and neuritic spines on tyrosine hydroxylase–immunopositive cells of rat retina

PubMed Central

Fasoli, Anna; Dang, James; Johnson, Jeffrey S.; Gouw, Aaron H.; Iseppe, Alex Fogli; Ishida, Andrew T.

2018-01-01

Dopamine- and tyrosine hydroxylase–immunopositive cells (TH cells) modulate visually driven signals as they flow through retinal photoreceptor, bipolar, and ganglion cells. Previous studies suggested that TH cells release dopamine from varicose axons arborizing in the inner and outer plexiform layers after glutamatergic synapses depolarize TH cell dendrites in the inner plexiform layer and these depolarizations propagate to the varicosities. Although it has been proposed that these excitatory synapses are formed onto appendages resembling dendritic spines, spines have not been found on TH cells of most species examined to date or on TH cell somata that release dopamine when exposed to glutamate receptor agonists. By use of protocols that preserve proximal retinal neuron morphology, we have examined the shape, distribution, and synapse-related immunoreactivity of adult rat TH cells. We report here that TH cell somata, tapering and varicose inner plexiform layer neurites, and varicose outer plexiform layer neurites all bear spines, that some of these spines are immunopositive for glutamate receptor and postsynaptic density proteins (viz., GluR1, GluR4, NR1, PSD-95, and PSD-93), that TH cell somata and tapering neurites are also immunopositive for a γ-aminobutyric acid (GABA) receptor subunit (GABAARα1), and that a synaptic ribbon-specific protein (RIBEYE) is found adjacent to some colocalizations of GluR1 and TH in the inner plexiform layer. These results identify previously undescribed sites at which glutamatergic and GABAergic inputs may stimulate and inhibit dopamine release, especially at somata and along varicose neurites that emerge from these somata and arborize in various levels of the retina. PMID:28035673

Conformation change of tRNA/sub Glu/ in the complex with glutamyl-tRNA synthetase is required for the specific binding of L-glutamate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hara-Yokoyama, M.; Yokoyama, S.; Miyazawa, T.

1986-11-04

The binding of Thermus thermophilus glutamyl-tRNA synthetase (GluRS) with T. thermophilus tRNA/sup Glu/, Escherichia coli tRNA/sup Glu/, and amino acids was studied by fluorescence measurements. In the absence of tRNA/sup Glu/, GluRS binds with D-glutamate as well as L-glutamate. However, in the presence of E.coli tRNA/sup Glu/, GluRS binds specifically with L-glutamate. The KCl effects on the Michaelis constants (K/sub m/) for tRNA/sup Glu/, L-glutamate, and ATP were studied for the aminoacylation of the homologous tRNA/sup Glu/ and heterologous tRNA/sup Glu/ species. As the KCl concentration is raised from 0 to 100 mM, the K/sub m/ value for L-glutamate inmore » the heterologous system is remarkably increased whereas the K/sub m/ value for L-glutamate in the homologous system is only slightly increased. The circular dichroism analyses were made mainly of the bands due to the 2-thiouridine derivatives of tRNA/sup Glu/ in the complex. The conformation change of T. thermophilus tRNA/sup Glu/ upon complex formation with GluRS is not affected by addition of KCl. In contrast, the heterologous tRNA/sup Glu/GluRS complex is in equilibrium of two forms that depends on KCl concentration. The predominant form at low KCl concentration is closely related to the small K/sub m/ value for L-glutamate. In this form of the complex, the conformation of tRNA/sup Glu/ is appreciably different from that of free molecule. Accordingly, such a conformation change of tRNA/sup Glu/ in the complex with GluRS is required for the specific binding of L-glutamate as the substrate.« less

Glutamatergic Receptor Activation in the Commisural Nucleus Tractus Solitarii (cNTS) Mediates Brain Glucose Retention (BGR) Response to Anoxic Carotid Chemoreceptor (CChr) Stimulation in Rats.

PubMed

Cuéllar, R; Montero, S; Luquín, S; García-Estrada, J; Dobrovinskaya, O; Melnikov, V; Lemus, M; de Álvarez-Buylla, E Roces

2015-01-01

Glutamate, released from central terminals of glossopharyngeal nerve, is a major excitatory neurotransmitter of commissural nucleus tractus solitarii (cNTS) afferent terminals, and brain derived neurotrophic factor (BDNF) has been shown to attenuate glutamatergic AMPA currents in NTS neurons. To test the hypothesis that AMPA contributes to glucose regulation in vivo modulating the hyperglycemic reflex with brain glucose retention (BGR), we microinjected AMPA and NBQX (AMPA antagonist) into the cNTS before carotid chemoreceptor stimulation in anesthetized normal Wistar rats, while hyperglycemic reflex an brain glucose retention (BGR) were analyzed. To investigate the underlying mechanisms, GluR2/3 receptor and c-Fos protein expressions in cNTS neurons were determined. We showed that AMPA in the cNTS before CChr stimulation inhibited BGR observed in aCSF group. In contrast, NBQX in similar conditions, did not modify the effects on glucose variables observed in aCSF control group. These experiments suggest that glutamatergic pathways, via AMPA receptors, in the cNTS may play a role in glucose homeostasis.

Obesogenic diet intake during pregnancy programs aberrant synaptic plasticity and addiction-like behavior to a palatable food in offspring.

PubMed

Camacho, Alberto; Montalvo-Martinez, Larisa; Cardenas-Perez, Robbi E; Fuentes-Mera, Lizeth; Garza-Ocañas, Lourdes

2017-07-14

Contextual food conditioned behaviors require plasticity of glutamatergic neurotransmission in the reward system, involving changes in the expression of including a-amino-3-hydroxy-5-methylisoxazole 4-propionate receptors (AMPA), N-methyl-d-aspartic acid (NMDA) and metabotropic glutamate 2,3 (mGlur 2,3). However, the role of changes in glutamatergic synaptic markers on energy-dense palatable food preference during development has not been described. Here, we determine the effect of nutritional programing during gestation on fat food choices using a conditioned place preference (CPP) test and an operant training response and its effect on glutamatergic markers in the nucleus accumbens (Nac) shell and prefrontal cortex (PFC). Our data showed that rats displayed preference for palatable fat food and an increase in caloric intake when compared to a chow diet. Notably, 74% of rats showing a preference for fat food intake correlate with a positive HFD-paired score whereas 26% failed to get HFD-conditioned. Also, male rats trained under an operant training response schedule (FR1, FR5 and PR) showed high and low responder groups to work for food. Notably, hypercaloric nutritional programing of female rats leads to exacerbation for reinforcers in female offspring compared to offspring from chow diet. Finally, we found that an operant training response to palatable reinforcers correlates with upregulation of mGlur 2,3 in the NAc shell and PFC of male rats and female offspring. Also, we found selective Nr1 upregulation in NAc shell and the PFC of female offspring. Our data suggest that nutritional programing by hypercaloric intake leads to incentive motivation to work for food and synaptic plasticity alteration in the mesolimbic system. Copyright © 2017 Elsevier B.V. All rights reserved.

Enriched environment influences hormonal status and hippocampal brain derived neurotrophic factor in a sex dependent manner.

PubMed

Bakos, J; Hlavacova, N; Rajman, M; Ondicova, K; Koros, C; Kitraki, E; Steinbusch, H W M; Jezova, D

2009-12-01

The present study is aimed at testing the hypothesis that an enriched environment (EE) induces sex-dependent changes in stress hormone release and in markers of increased brain plasticity. The focus was on hypothalamic-pituitary-adrenocortical (HPA) axis activity, plasma levels of stress hormones, gene expression of glutamate receptor subunits and concentrations of brain-derived neurotrophic factor (BDNF) in selected brain regions. Rats exposed to EE were housed in groups of 12 in large cages with various objects, which were frequently changed, for 6 weeks. Control animals were housed four per cage under standard conditions. In females the EE-induced rise in hippocampal BDNF, a neurotrophic factor associated with increased neural plasticity, was more pronounced than in males. Similar sex-specific changes were observed in BDNF concentrations in the hypothalamus. EE also significantly attenuated oxytocin and aldosterone levels only in female but not male rats. Plasma testosterone positively correlated with hippocampal BDNF in female but not male rats housed in EE. In male rats housing in EE led to enhanced levels of testosterone and adrenocorticotropic hormone (ACTH), this was not seen in females. Hippocampal glucocorticoid but not mineralocorticoid receptor levels decreased in rats housed in EE irrespective of sex. Housing conditions failed to modify mRNA levels of glutamate receptor type 1 (Glur1) and metabotropic glutamate receptor subtype 5 (mGlur5) subunits of glutamate receptors in the forebrain. Moreover, a negative association between corticosterone and BDNF was observed in both sexes. The results demonstrate that the association between hormones and changes in brain plasticity is sex related. In particular, testosterone seems to be involved in the regulatory processes related to neuroplasticity in females.

Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors

PubMed Central

Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

2006-01-01

Glutamate acts at central synapses via ionotropic (iGluR – NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed. PMID:16945965

Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors.

PubMed

Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

2006-11-15

Glutamate acts at central synapses via ionotropic (iGluR--NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed.

Distribution of protein kinase C isoforms in the cat retina.

PubMed

Fyk-Kolodziej, Bozena; Cai, Wenhui; Pourcho, Roberta G

2002-01-01

Immunocytochemical localization was carried out for five isoforms of protein kinase C (PKC) in the cat retina. In common with other mammalian species, PKCalpha was found in rod bipolar cells. Staining was also seen in a small population of cone bipolar cells with axon terminals ramifying near the middle of the inner plexiform layer (IPL). PKCbetaI was localized to rod bipolar cells, one class of cone bipolar cell, and numerous amacrine and displaced amacrine cells. Staining for PKCbetaI was seen in three types of cone bipolar cells as well as in amacrine and ganglion cells. Immunoreactivity for both PKCepsilon and PKCzeta was found in rod bipolar cells; PKCepsilon was also seen in a population of cone bipolar cells and a few amacrine and ganglion cells whereas PKCzeta was found in all ganglion cells. Double-label immunofluorescence studies showed that dendrites of the two PKCbetaII-positive OFF-cone bipolar cells exhibit immmunoreactivity for the kainate-selective glutamate receptor GluR5. The third PKCbetaII cone bipolar is an ON-type cell and did not stain for GluR5. The retinal distribution of these isoforms of PKC is consistent with a role in modulation of various aspects of neurotransmission including synaptic vesicle release and regulation of receptor molecules.

Focused microwave irradiation-assisted immunohistochemistry to study effects of ketamine on phospho-ERK expression in the mouse brain.

PubMed

Fernandes, Alda; Li, Yu-Wen

2017-09-01

Ketamine produces rapid and long-lasting antidepressant effects in depressive patients. Preclinical studies demonstrate that ketamine stimulates AMPA receptor transmission and activates BDNF/TrkB-Akt/ERK-mTOR signaling cascades, leading to a sustained increase in synaptic protein synthesis and strengthening of synaptic plasticity, a potential mechanism underlying the antidepressant effects. The purpose of this study was to develop an immunohistochemistry (IHC) assay to map the distribution of extracellular signal-regulated kinase (ERK) phosphorylation in the mouse brain in response to systemic ketamine treatment. We established a focused microwave irradiation-assisted IHC assay to detect phosphorylated (phospho) proteins including phospho-ERK, phospho- cAMP-response- element-binding protein (CREB), phospho- glutamate receptor 1 (GluR1) and phospho- calcium/calmodulin-dependent protein kinase II (CaMKII) with greater sensitivity and reproducibility in comparison to conventional IHC methods. A single dose of ketamine produced a robust, dose- and time-dependent increase in phospho-ERK immunoreactive (phospho-ERK-ir) neurons in the medial prefrontal cortex (mPFC) and the central nucleus of the amygdala. Phospho-ERK-ir neurons in the mPFC were primarily located in the prelimbic and anterior cingulate subregions with the morphology resembling pyramidal neurons. An increase in phospho-ERK-ir was also observed in the brainstem dorsal raphe nucleus and locus coeruleus. The NMDA GluN2B subtype receptor antagonist Ro 25-6981 increased phospho-ERK expression in the brain in a similar pattern as ketamine. In summary, we have established a sensitive and reliable focused microwave irradiation-assisted IHC assay, and defined the activation pattern of ERK, in response to systemic ketamine and Ro 25-6981 treatment, in brain regions that are potentially responsible for mediating the antidepressant effects. Copyright © 2017 Elsevier B.V. All rights reserved.

Differences in kainate receptor involvement in hippocampal mossy fibre long-term potentiation depending on slice orientation.

PubMed

Sherwood, John L; Amici, Mascia; Dargan, Sheila L; Culley, Georgia R; Fitzjohn, Stephen M; Jane, David E; Collingridge, Graham L; Lodge, David; Bortolotto, Zuner A

2012-09-01

Long-term potentiation (LTP) is a well-established experimental model used to investigate the synaptic basis of learning and memory. LTP at mossy fibre - CA3 synapses in the hippocampus is unusual because it is normally N-methyl-d-aspartate (NMDA) receptor-independent. Instead it seems that the trigger for mossy fibre LTP involves kainate receptors (KARs). Although it is generally accepted that pre-synaptic KARs play an essential role in frequency facilitation and LTP, their subunit composition remains a matter of significant controversy. We have reported previously that both frequency facilitation and LTP can be blocked by selective antagonism of GluK1 (formerly GluR5/Glu(K5))-containing KARs, but other groups have failed to reproduce this effect. Moreover, data from receptor knockout and mRNA expression studies argue against a major role of GluK1, supporting a more central role for GluK2 (formerly GluR6/Glu(K6)). A potential reason underlying the controversy in the pharmacological experiments may reside in differences in the preparations used. Here we show differences in pharmacological sensitivity of synaptic plasticity at mossy fibre - CA3 synapses depend critically on slice orientation. In transverse slices, LTP of fEPSPs was invariably resistant to GluK1-selective antagonists whereas in parasagittal slices LTP was consistently blocked by GluK1-selective antagonists. In addition, there were pronounced differences in the magnitude of frequency facilitation and the sensitivity to the mGlu2/3 receptor agonist DCG-IV. Using anterograde labelling of granule cells we show that slices of both orientations possess intact mossy fibres and both large and small presynaptic boutons. Transverse slices have denser fibre tracts but a smaller proportion of giant mossy fibre boutons. These results further demonstrate a considerable heterogeneity in the functional properties of the mossy fibre projection. Copyright © 2012 Elsevier Ltd. All rights reserved.

Genetic Evidence for a Role for Protein Kinase A in the Maintenance of Sleep and Thalamocortical Oscillations

PubMed Central

Hellman, Kevin; Hernandez, Pepe; Park, Alice; Abel, Ted

2010-01-01

Study Objectives: Genetic manipulation of cAMP-dependent protein kinase A (PKA) in Drosophila has implicated an important role for PKA in sleep/wake state regulation. Here, we characterize the role of this signaling pathway in the regulation of sleep using electroencephalographic (EEG) and electromyographic (EMG) recordings in R(AB) transgenic mice that express a dominant negative form of the regulatory subunit of PKA in neurons within cortex and hippocampus. Previous studies have revealed that these mutant mice have reduced PKA activity that results in the impairment of hippocampus-dependent long-term memory and long-lasting forms of hippocampal synaptic plasticity. Design: PKA assays, in situ hybridization, immunoblots, and sleep studies were performed in R(AB) transgenic mice and wild-type control mice. Measurements and Results: We have found that R(AB) transgenic mice have reduced PKA activity within cortex and reduced Ser845 phosphorylation of the glutamate receptor subunit GluR1. R(AB) transgenic mice exhibit non-rapid eye movement (NREM) sleep fragmentation and increased amounts of rapid eye movement (REM) sleep relative to wild-type mice. Further, R(AB) transgenic mice have more delta power but less sigma power during NREM sleep relative to wild-type mice. After sleep deprivation, the amounts of NREM and REM sleep were comparable between wild-type and R(AB) transgenic mice. However, the homeostatic rebound of sigma power in R(AB) transgenic mice was reduced. Conclusions: Alterations in cortical synaptic receptors, impairments in sleep continuity, and alterations in sleep oscillations in R(AB) mice imply that PKA is involved not only in synaptic plasticity and memory storage but also in the regulation of sleep/wake states. Citation: Hellman K; Hernandez P; Park A; Abel T. Genetic evidence for a role for protein kinase a in the maintenance of sleep and thalamocortical oscillations. SLEEP 2010;33(1):19-28. PMID:20120617

Group I mGluR-Regulated Translation of the Neuronal Glutamate Transporter, Excitatory Amino Acid Carrier 1 (EAAC1)

PubMed Central

Ross, John R.; Ramakrishnan, Hariharasubramanian; Porter, Brenda E.; Robinson, Michael B.

2011-01-01

Recently, we demonstrated that mRNA for the neuronal glutamate transporter, excitatory amino acid carrier 1 (EAAC1), is found in dendrites of hippocampal neurons in culture and in dendrites of hippocampal pyramidal cells after pilocarpine-induced status epilepticus (SE). We also showed that SE increased the levels of EAAC1 mRNA ~15-fold in synaptoneurosomes. In the present study, the effects of SE on the distribution EAAC1 protein in hippocampus were examined. In addition, the effects of Group 1 mGluR receptor activation on the levels of EAAC1 protein were examined in synaptoneurosomes prepared from sham control animals and from animals that experience pilocarpine-induced SE. We find that EAAC1 immunoreactivity increases in pyramidal cells of the hippocampus after 3 h of SE. In addition, the group I mGluR agonist, (S)-3,5-dihydroxyphenylglycine (DHPG), caused an increase in EAAC1 protein levels in hippocampal synaptoneurosomes; this effect of DHPG was much larger (~3- to 5-fold) after 3 h of SE. The DHPG-induced increases in EAAC1 protein were blocked by two different inhibitors of translation but not by inhibitors of transcription. mGluR1 or mGluR5 antagonists completely blocked the DHPG-induced increases in EAAC1 protein. DHPG also increased the levels of GluR2/3 protein, but this effect was not altered by SE. The DHPG-induced increase in EAAC1 protein was blocked by an inhibitor of the mammalian target of rapamycin (mTOR) or an inhibitor of extracellular signal-regulated kinase (ERK). These studies provide the first evidence EAAC1 translation can be regulated, and they show that regulated translation of EAAC1 is up-regulated after SE. PMID:21371038

Early memory formation disrupted by atypical PKC inhibitor ZIP in the medial prefrontal cortex but not hippocampus

PubMed Central

Evuarherhe, Obaro; Barker, Gareth R. I.; Savalli, Giorgia; Warburton, Elizabeth C.; Brown, Malcolm W.

2014-01-01

Atypical isoforms of protein kinase C (aPKCs; particularly protein kinase M zeta: PKMζ) have been hypothesised to be necessary and sufficient for the maintenance of long-term potentiation (LTP) and long term memory by maintaining postsynaptic AMPA receptors via the GluR2 subunit. A myristoylated PKMζ pseudosubstrate peptide (ZIP) blocks PKMζ activity. We examined the actions of ZIP in medial prefrontal cortex (mPFC) and hippocampus in associative recognition memory in rats during early memory formation and memory maintenance. ZIP infusion in either hippocampus or mPFC impaired memory maintenance. However, early memory formation was impaired by ZIP in mPFC but not hippocampus; and blocking GluR2-dependent removal of AMPA receptors did not affect this impairment caused by ZIP in the mPFC. The findings indicate: (i) a difference in the actions of ZIP in hippocampus and medial prefrontal cortex, and (ii) a GluR2-independent target of ZIP (possibly PKCλ) in the mPFC during early memory formation. PMID:24729442

Platelet Kainate Receptor Signaling Promotes Thrombosis by Stimulating Cyclooxygenase Activation

PubMed Central

Sun, Henry; Swaim, AnneMarie; Herrera, Jesus Enrique; Becker, Diane; Becker, Lewis; Srivastava, Kalyan; Thompson, Laura E.; Shero, Michelle R.; Perez-Tamayo, Alita; Suktitpat, Bhoom; Mathias, Rasika; Contractor, Anis; Faraday, Nauder; Morrell, Craig N.

2009-01-01

Rationale Glutamate is a major signaling molecule that binds to glutamate receptors including the ionotropic glutamate receptors; kainate (KA) receptor (KAR), the N-methyl-D-aspartate (NMDA) receptor (NMDAR), and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each is well characterized in the central nervous system (CNS), but glutamate has important signaling roles in peripheral tissues as well, including a role in regulating platelet function. Objective Our previous work has demonstrated that glutamate is released by platelets in high concentrations within a developing thrombus and increases platelet activation and thrombosis. We now show that platelets express a functional KAR that drives increased agonist induced platelet activation. Methods and Results KAR induced increase in platelet activation is in part the result of activation of platelet cyclooxygenase (COX) in a Mitogen Activated Protein Kinase (MAPK) dependent manner. Platelets derived from KA receptor subunit knockout mice (GluR6−/−) are resistant to KA effects and have a prolonged time to thrombosis in vivo. Importantly, we have also identified polymorphisms in KA receptor subunits that are associated with phenotypic changes in platelet function in a large group of Caucasians and African Americans. Conclusion Our data demonstrate that glutamate regulation of platelet activation is in part COX dependent, and suggest that the KA receptor is a novel anti-thrombotic target. PMID:19679838

A Critical Role for Protein Degradation in the Nucleus Accumbens Core in Cocaine Reward Memory

PubMed Central

Ren, Zhen-Yu; Liu, Meng-Meng; Xue, Yan-Xue; Ding, Zeng-Bo; Xue, Li-Fen; Zhai, Suo-Di; Lu, Lin

2013-01-01

The intense associative memories that develop between cocaine-paired contexts and rewarding stimuli contribute to cocaine seeking and relapse. Previous studies have shown impairment in cocaine reward memories by manipulating a labile state induced by memory retrieval, but the mechanisms that underlie the destabilization of cocaine reward memory are unknown. In this study, using a Pavlovian cocaine-induced conditioned place preference (CPP) procedure in rats, we tested the contribution of ubiquitin-proteasome system-dependent protein degradation in destabilization of cocaine reward memory. First, we found that polyubiquitinated protein expression levels and polyubiquitinated N-ethylmaleimide-sensitive fusion (NSF) markedly increased 15 min after retrieval while NSF protein levels decreased 1 h after retrieval in the synaptosomal membrane fraction in the nucleus accumbens (NAc) core. We then found that infusion of the proteasome inhibitor lactacystin into the NAc core prevented the impairment of memory reconsolidation induced by the protein synthesis inhibitor anisomycin and reversed the effects of anisomycin on NSF and glutamate receptor 2 (GluR2) protein levels in the synaptosomal membrane fraction in the NAc core. We also found that lactacystin infusion into the NAc core but not into the shell immediately after extinction training sessions inhibited CPP extinction and reversed the extinction training-induced decrease in NSF and GluR2 in the synaptosomal membrane fraction in the NAc core. Finally, infusions of lactacystin by itself into the NAc core immediately after each training session or before the CPP retrieval test had no effect on the consolidation and retrieval of cocaine reward memory. These findings suggest that ubiquitin-proteasome system-dependent protein degradation is critical for retrieval-induced memory destabilization. PMID:23303053

Nefiracetam facilitates hippocampal neurotransmission by a mechanism independent of the piracetam and aniracetam action.

PubMed

Nomura, T; Nishizaki, T

2000-07-07

Nefiracetam, a nootropic (cognition-enhancing) agent, facilitated neurotransmission in the dentate gyrus of rat hippocampal slices in a dose-dependent manner at concentrations ranged from 1 nM to 1 microM, being evident at 60-min washing-out of the drug. The facilitatory action was blocked by the nicotinic acetylcholine (ACh) receptor antagonists, alpha-bungarotoxin and mecamylamine. A similar facilitation was induced by the other nootropic agents, piracetam and aniracetam, but the facilitation was not inhibited by nicotinic ACh receptor antagonists and it did not occlude the potentiation induced by nefiracetam. In the Xenopus oocyte expression systems, nefiracetam potentiated currents through a variety of neuronal nicotinic ACh receptors (alpha 3beta 2, alpha 3beta 4, alpha 4 beta 2, alpha 4 beta 4, and alpha 7) to a different extent. In contrast, neither piracetam nor aniracetam had any potentiating action on alpha 7 receptor currents. While aniracetam delayed the decay time of currents through the alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, GluR1, -2, -3, expressed in oocytes, nefiracetam or piracetam had no effect on the currents. Nefiracetam, thus, appears to facilitate hippocampal neurotransmission by functionally targeting nicotinic ACh receptors, independently of the action of piracetam and aniracetam.

Human Neural Cell-Based Biosensor

DTIC Science & Technology

2010-04-26

SNAP25 (SNAP25), GluR1 (GRIA1) glutamate receptor , ionotropic , AMPA1, Nav1.2 (SCN2A), Nav1.6 (SCN8A), CaV 2.1 (CACNA1A), HERG (KCNH2), and KCC2...transitions to mesenchymal progenitor cells." Tissue Eng Part A 15(8): 1897-907. Haltiwanger, R. S. and P. Stanley (2002). "Modulation of receptor ...cytometry studies previously conducted by the Stice lab identified ciliary neurotrophic factor receptor alpha (CNTFRα) as a novel cell surface marker to

Glutamate Receptor Aptamers and ALS

DTIC Science & Technology

2008-01-01

XXGATC ACC Consensus sequence RNA library Cloning and sequencing SELEX DIAGRAM Fig. 1. (a) Flow chart of SELEX. The library we used for SELEX...recording electrode and placed ~100 µm away from the hole. The linear flow rate of the solution is 1-4 cm/s. An optical fiber through which laser light for...channel recording (26) GluR6Q 1.1 × 104 4.2 × 102 Laser-pulse photolysis (67) 1.0 × 104 4.4 × 102 Fitting (52) 1.0 × 104 Flow measurement (46

Molecular alterations in the hippocampus after experimental subarachnoid hemorrhage

PubMed Central

Han, Sang Myung; Wan, Hoyee; Kudo, Gen; Foltz, Warren D; Vines, Douglass C; Green, David E; Zoerle, Tommaso; Tariq, Asma; Brathwaite, Shakira; D'Abbondanza, Josephine; Ai, Jinglu; Macdonald, R Loch

2014-01-01

Patients with aneurysmal subarachnoid hemorrhage (SAH) frequently have deficits in learning and memory that may or may not be associated with detectable brain lesions. We examined mediators of long-term potentiation after SAH in rats to determine what processes might be involved. There was a reduction in synapses in the dendritic layer of the CA1 region on transmission electron microscopy as well as reduced colocalization of microtubule-associated protein 2 (MAP2) and synaptophysin. Immunohistochemistry showed reduced staining for GluR1 and calmodulin kinase 2 and increased staining for GluR2. Myelin basic protein staining was decreased as well. There was no detectable neuronal injury by Fluoro-Jade B, TUNEL, or activated caspase-3 staining. Vasospasm of the large arteries of the circle of Willis was mild to moderate in severity. Nitric oxide was increased and superoxide anion radical was decreased in hippocampal tissue. Cerebral blood flow, measured by magnetic resonance imaging, and cerebral glucose metabolism, measured by positron emission tomography, were no different in SAH compared with control groups. The results suggest that the etiology of loss of LTP after SAH is not cerebral ischemia but may be mediated by effects of subarachnoid blood such as oxidative stress and inflammation. PMID:24064494

The Timing of Multiple Retrieval Events Can Alter GluR1 Phosphorylation and the Requirement for Protein Synthesis in Fear Memory Reconsolidation

ERIC Educational Resources Information Center

Jarome, Timothy J.; Kwapis, Janine L.; Werner, Craig T.; Parsons, Ryan G.; Gafford, Georgette M.; Helmstetter, Fred J.

2012-01-01

Numerous studies have indicated that maintaining a fear memory after retrieval requires de novo protein synthesis. However, no study to date has examined how the temporal dynamics of repeated retrieval events affect this protein synthesis requirement. The present study varied the timing of a second retrieval of an established auditory fear memory…

WITHDRAWN: H-reflex up-conditioning after sciatic nerve transection and regeneration may increase VGLUT-1 terminals and GluR2/3 immunoreactivity in spinal motoneurons.

PubMed

Sun, Chenyou; Wang, Yu; Chen, Xiang Yang

2011-12-17

This article has been withdrawn at the request of the author(s) and/or editor. The Publisher apologizes for any inconvenience this may cause. The full Elsevier Policy on Article Withdrawal can be found at http://www.elsevier.com/locate/withdrawalpolicy. Copyright © 2011. Published by Elsevier Ireland Ltd.. All rights reserved.

Organophosphates dysregulate dopamine signaling, glutamatergic neurotransmission, and induce neuronal injury markers in striatum

PubMed Central

Torres-Altoro, Melissa I.; Mathur, Brian N.; Drerup, Justin M.; Thomas, Rachel; Lovinger, David; O’Callaghan, James P.; Bibb, James A.

2011-01-01

The neurological effects of organophosphate pesticides, commonly used on foods and in households, are an important public health concern. Furthermore, subclinical exposure to combinations of organophosphates is implicated in Gulf War illness. Here we characterized the effects of the broadly-used insecticide chlorpyrifos on dopamine and glutamatergic neurotransmission effectors in corticostriatal motor/reward circuitry. Chlorpyrifos potentiated PKA-dependent phosphorylation of the striatal protein DARPP-32 and the GluR1 subunit of AMPA receptors in mouse brain slices. It also increased GluR1 phosphorylation by PKA when administered systemically. This correlated with enhanced glutamate release from cortical projections in rat striatum. Similar effects were induced by the sarin congener, diisopropyl fluorophosphate, alone or in combination with the putative neuroprotectant, pyridostigmine bromide and the pesticide DEET. This combination, meant to mimic the neurotoxicant exposure encountered by veterans of the 1991 Persian Gulf War, also induced hyperphosphorylation of the neurofibrillary tangle-associated protein tau. Diisopropyl fluorophosphate and pyrodostigmine bromide, alone or in combination, also increased the aberrant activity of the protein kinase, Cdk5, as indicated by conversion of its activating cofactor p35 to p25. Thus consistent with recent findings in humans and animals, organophosphate exposure causes dysregulation in the motor/reward circuitry and invokes mechanisms associated with neurological disorders and neurodegeneration. PMID:21848865

Differential Binding of Human ApoE Isoforms to Insulin Receptor is Associated with Aberrant Insulin Signaling in AD Brain Samples.

PubMed

Chan, Elizabeth S; Chen, Christopher; Soong, Tuck Wah; Wong, Boon-Seng

2018-03-01

Apolipoprotein E4 (ApoE4) is the strongest genetic risk factor for sporadic Alzheimer's disease (AD), where inheritance of this isoform predisposes development of AD in a gene dose-dependent manner. Although the mode of action of ApoE4 on AD onset and progression remains unknown, we have previously shown that ApoE4, and not ApoE3 expression, resulted in insulin signaling deficits in the presence of amyloid beta (Aβ). However, these reports were not conducted with clinical samples that more accurately reflect human disease. In this study, we investigated the effect of ApoE genotype on the insulin signaling pathway in control and AD human brain samples. We found that targets of the insulin signaling pathway were attenuated in AD cases, regardless of ApoE isoform. We also found a decrease in GluR1 subunit expression, and an increase NR2B subunit expression in AD cases, regardless of ApoE isoform. Lastly, we observed that more insulin receptor (IR) was immunoprecipitated in control cases, and more Aβ was immunoprecipitated with AD cases. But, when comparing among AD cases, we found that more IR was immunoprecipitated with ApoE3 than ApoE4, and more Aβ was immunoprecipitated with ApoE4 than ApoE3. Our results suggest that the difference in IR binding and effect on protein expression downstream of the IR may affect onset and progression of AD.

Role of Major NMDA or AMPA Receptor Subunits in MK-801 Potentiation of Ethanol Intoxication

PubMed Central

Palachick, Benjamin; Chen, Yi-Chyan; Enoch, Abigail J.; Karlsson, Rose-Marie; Mishina, Masayoshi; Holmes, Andrew

2008-01-01

Background The glutamate system plays a major role in mediating EtOH’s effects on brain and behavior, and is implicated in the pathophysiology of alcohol-related disorders. N-methyl-D-aspartate receptor (NMDAR) antagonists such as MK-801 (dizocilpine) interact with EtOH at the behavioral level, but the molecular basis of this interaction is unclear. Methods We first characterized the effects of MK-801 treatment on responses to the ataxic (accelerating rotarod), hypothermic and sedative/hypnotic effects of acute EtOH administration in C57BL/6J and 129/SvImJ inbred mice. Effects of another NMDAR antagonist, phencyclidine, on EtOH-induced sedation/hypnosis were also assessed. Gene knockout of the NMDAR subunit NR2A or L-alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate GluR1 or pharmacological antagonism of the NMDAR subunit NR2B (via Ro 25-6981) was employed to examine whether inactivating any one of these glutamate signaling molecules modified MK-801’s effect on EtOH-related behaviors. Results MK-801 markedly potentiated the ataxic effects of 1.75 g/kg EtOH and the sedative/hypnotic effects of 3.0 g/kg EtOH, but not the hypothermic effects of 3.0 g/kg EtOH, in C57BL/6J and 129/SvImJ mice. Phencyclidine potentiated EtOH-induced sedation/hypnosis in both inbred strains. Neither NR2A nor GluR1 KO significantly altered basal EtOH-induced ataxia, hypothermia, or sedation/hypnosis. Ro 25-6981 modestly increased EtOH-induced sedation/hypnosis. The ability of MK-801 to potentiate EtOH-induced ataxia and sedation/hypnosis was unaffected by GluR1 KO or NR2B antagonism. NR2A KO partially reduced MK-801 + EtOH-induced sedation/hypnosis, but not ataxia or hypothermia. Conclusions Data confirm a robust and response-specific potentiating effect of MK-801 on sensitivity to EtOH’s intoxicating effects. Inactivation of three major components of glutamate signaling had no or only partial impact on the ability of MK-801 to potentiate behavioral sensitivity to EtOH. Further work to elucidate the mechanisms underlying NMDAR × EtOH interactions could ultimately provide novel insight into the role of NMDARs in alcoholism and its treatment. PMID:18565157

Neuroplasticity and Calcium Signaling in Stressed Rat Amygdala

DTIC Science & Technology

2005-02-01

kainate receptor and neuroplasticity in the amygdala. National Institute of aging, November, 2001. • He Li: GluR5 kainate receptor mediated synaptic...functions in the amygdala. National Institute of Mental Health, April, 2002. 50 " Maria F. M. Braga: Chronic Stress Causes Impairment of aI-Adrenoceptor...resistance All animal experiments were performed in accordance with of 1.5-5.0 Mf when filled with a solution containing (in our institutional guidelines

Early effects of 16O radiation on neuronal morphology and cognition in a murine model

NASA Astrophysics Data System (ADS)

Carr, Hannah; Alexander, Tyler C.; Groves, Thomas; Kiffer, Frederico; Wang, Jing; Price, Elvin; Boerma, Marjan; Allen, Antiño R.

2018-05-01

Astronauts exposed to high linear energy transfer radiation may experience cognitive injury. The pathogenesis of this injury is unknown but may involve glutamate receptors or modifications to dendritic structure and/or dendritic spine density and morphology. Glutamate is the major excitatory neurotransmitter in the central nervous system, where it acts on ionotropic and metabotropic glutamate receptors located at the presynaptic terminal and in the postsynaptic membrane at synapses in the hippocampus. Dendritic spines are sites of excitatory synaptic transmission, and changes in spine structure and dendrite morphology are thought to be morphological correlates of altered brain function associated with hippocampal-dependent learning and memory. The aim of the current study is to assess whether behavior, glutamate receptor gene expression, and dendritic structure in the hippocampus are altered in mice after early exposure to 16O radiation in mice. Two weeks post-irradiation, animals were tested for hippocampus-dependent cognitive performance in the Y-maze. During Y-maze testing, mice exposed to 0.1 Gy and 0.25 Gy radiation failed to distinguish the novel arm, spending approximately the same amount of time in all 3 arms during the retention trial. Exposure to 16O significantly reduced the expression of Nr1 and GluR1 in the hippocampus and modulated spine morphology in the dentate gyrus and cornu Ammon 1 within the hippocampus. The present data provide evidence that 16O radiation has early deleterious effects on mature neurons that are associated with hippocampal learning and memory.

Decreased levels of NMDA but not AMPA receptors in the lipid-raft fraction of 3xTg-AD model of Alzheimer's disease: Relation to Arc/Arg3.1 protein expression.

PubMed

Morin, Jean-Pascal; Díaz-Cintra, Sofía; Bermúdez-Rattoni, Federico; Delint-Ramírez, Ilse

2016-11-01

It was recently suggested that alteration in lipid raft composition in Alzheimer's disease may lead to perturbations in neurons signalosome, which may help explain the deficits observed in synaptic plasticity mechanisms and long-term memory impairments in AD models. As a first effort to address this issue, we evaluated lipid-raft contents of distinct NMDA and AMPA receptor subunits in the hippocampus of the 3xTg-AD model of Alzheimer's disease. Our results show that compared to controls, 10 months-old 3xTg-AD mice have diminished levels of NMDA receptors in rafts but not in post-synaptic density or total fractions. Additionally, the levels of GluR1 were unaltered in all the analyzed fractions. Finally, we went on to show that the diminished levels of NMDA receptors in rafts correlated with diminished global levels of Arc/Arg3.1, a synaptic protein with a central role in long-term memory formation. This study adds to our current understanding of the signaling pathways disruptions observed in current Alzheimer's disease models. Copyright © 2016 Elsevier Ltd. All rights reserved.

Assessment of the cerebellar neurotoxic effects of nicotine in prenatal alcohol exposure in rats.

PubMed

Bhattacharya, Dwipayan; Majrashi, Mohammed; Ramesh, Sindhu; Govindarajulu, Manoj; Bloemer, Jenna; Fujihashi, Ayaka; Crump, Bailee-Ryan; Hightower, Harrison; Bhattacharya, Subhrajit; Moore, Timothy; Suppiramaniam, Vishnu; Dhanasekaran, Muralikrishnan

2018-02-01

The adverse effects of prenatal nicotine and alcohol exposure on human reproductive outcomes are a major scientific and public health concern. In the United States, substantial percentage of women (20-25%) of childbearing age currently smoke cigarettes and consume alcohol, and only a small percentage of these individuals quit after learning of their pregnancy. However, there are very few scientific reports on the effect of nicotine in prenatal alcohol exposure on the cerebellum of the offspring. Therefore, this study was conducted to investigate the cerebellar neurotoxic effects of nicotine in a rodent model of Fetal Alcohol Spectrum Disorder (FASD). In this study, we evaluated the behavioral changes, biochemical markers of oxidative stress and apoptosis, mitochondrial functions and the molecular mechanisms associated with nicotine in prenatal alcohol exposure on the cerebellum. Prenatal nicotine and alcohol exposure induced oxidative stress, did not affect the mitochondrial functions, increased the monoamine oxidase activity, increased caspase expression and decreased ILK, PSD-95 and GLUR1 expression without affecting the GSK-3β. Thus, our current study of prenatal alcohol and nicotine exposure on cerebellar neurotoxicity may lead to new scientific perceptions and novel and suitable therapeutic actions in the future. Copyright © 2017. Published by Elsevier Inc.

Role of ionotropic glutamate receptors in LTP in rat hippocampal CA1 oriens-lacunosum moleculare interneurons

PubMed Central

Oren, Iris; Nissen, Wiebke; Kullmann, Dimitri M.; Somogyi, Peter; Lamsa, Karri P.

2009-01-01

Some interneurons of the hippocampus exhibit NMDA receptor-independent long-term potentiation (LTP) that is induced by presynaptic glutamate release when the postsynaptic membrane potential is hyperpolarized. This ‘anti-Hebbian’ form of LTP is prevented by postsynaptic depolarization or by blocking AMPA and kainate receptors. Although both AMPA and kainate receptors are expressed in hippocampal interneurons, their relative roles in anti-Hebbian LTP are not known. Because interneuron diversity potentially conceals simple rules underlying different forms of plasticity, we focus on glutamatergic synapses onto a subset of interneurons with dendrites in stratum oriens and a main ascending axon that projects to stratum lacunosum-moleculare, the O-LM cells. We show that anti-Hebbian LTP in O-LM interneurons has consistent induction and expression properties, and is prevented by selective inhibition of AMPA receptors. The majority of the ionotropic glutamatergic synaptic current in these cells is mediated by inwardly rectifying Ca2+ -permeable AMPA receptors. Although GluR5-containing kainate receptors contribute to synaptic currents at high stimulus frequency, they are not required for LTP induction. Glutamatergic synapses on O-LM cells thus behave in a homogeneous manner, and exhibit LTP dependent on Ca2+-permeable AMPA receptors. PMID:19176803

The N-terminal domain of GluR6-subtype glutamate receptor ion channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Janesh; Schuck, Peter; Jin, Rongsheng

2009-09-25

The amino-terminal domain (ATD) of glutamate receptor ion channels, which controls their selective assembly into AMPA, kainate and NMDA receptor subtypes, is also the site of action of NMDA receptor allosteric modulators. Here we report the crystal structure of the ATD from the kainate receptor GluR6. The ATD forms dimers in solution at micromolar protein concentrations and crystallizes as a dimer. Unexpectedly, each subunit adopts an intermediate extent of domain closure compared to the apo and ligand-bound complexes of LIVBP and G protein-coupled glutamate receptors (mGluRs), and the dimer assembly has a markedly different conformation from that found in mGluRs.more » This conformation is stabilized by contacts between large hydrophobic patches in the R2 domain that are absent in NMDA receptors, suggesting that the ATDs of individual glutamate receptor ion channels have evolved into functionally distinct families.« less

AMPA receptors mediate passive avoidance deficits induced by sleep deprivation.

PubMed

Dubiela, Francisco Paulino; Queiroz, Claudio Marcos; Moreira, Karin Di Monteiro; Nobrega, Jose N; Sita, Luciane Valéria; Tufik, Sergio; Hipolide, Debora Cristina

2013-11-15

The present study addressed the effects of sleep deprivation (SD) on AMPA receptor (AMPAR) binding in brain regions associated with learning and memory, and investigated whether treatment with drugs acting on AMPAR could prevent passive avoidance deficits in sleep deprived animals. [(3)H]AMPA binding and GluR1 in situ hybridization signals were quantified in different brain regions of male Wistar rats either immediately after 96 h of sleep deprivation or after 24h of sleep recovery following 96 h of sleep deprivation. Another group of animals were sleep deprived and then treated with either the AMPAR potentiator, aniracetam (25, 50 and 100mg/kg, acute administration) or the AMPAR antagonist GYKI-52466 (5 and 10mg/kg, acute and chronic administration) before passive avoidance training. Task performance was evaluated 2h and 24h after training. A significant reduction in [(3)H]AMPA binding was found in the hippocampal formation of SD animals, while no alterations were observed in GluR1 mRNA levels. The highest dose of aniracetam (100mg/kg) reverted SD-induced impairment of passive avoidance performance in both retention tests, whereas GYKI-52466 treatment had no effect. Pharmacological enhancement of AMPAR function may revert hippocampal-dependent learning impairments produced after SD. We argue that such effects might be associated with reduced AMPAR binding in the hippocampus of sleep deprived animals. Copyright © 2013 Elsevier B.V. All rights reserved.

Dopamine D1 vs D5 receptor-dependent induction of seizures in relation to DARPP-32, ERK1/2 and GluR1-AMPA signalling

PubMed Central

O’Sullivan, Gerard J.; Dunleavy, Mark; Hakansson, Kerstin; Clementi, Mario; Kinsella, Anthony; Croke, David T.; Drago, John; Fienberg, Allen A.; Greengard, Paul; Sibley, David R.; Fisone, Gilberto; Henshall, David C.; Waddington, John L.

2013-01-01

Summary Recent reports have shown that the selective dopamine D1-like agonist SKF 83822 [which stimulates adenylate cyclase, but not phospholipase C] induces prominent behavioral seizures in mice, whereas its benzazepine congener SKF 83959 [which stimulates phospholipase C, but not adenylate cyclase] does not. To investigate the relative involvement of D1 vs D5 receptors in mediating seizures, ethological behavioral topography and cortical EEGs were recorded in D1, D5 and DARPP-32 knockout mice in response to a convulsant dose of SKF 83822. SKF 83822-induced behavioral and EEG seizures were gene dose-dependently abolished in D1 knockouts. In both heterozygous and homozygous D5 knockouts, the latency to first seizure was significantly increased and total EEG seizures were reduced relative to wild-types. The majority (60%) of homozygous DARPP-32 knockouts did not have seizures; of those having seizures (40%), the latency to first seizure was significantly increased and the number of high amplitude, high frequency polyspike EEG events was reduced. In addition, immunoblotting was performed to investigate downstream intracellular signalling mechanisms at D1-like receptors following challenge with SKF 83822 and SKF 83959. In wild-types administered SKF 83822, levels of ERK1/2 and GluR1 AMPA receptor phosphorylation increased two-fold in both the striatum and hippocampus; in striatal slices DARPP-32 phosphorylation at Thr34 increased five-fold relative to vehicle-treated controls. These findings indicate that D1, and to a lesser extent D5, receptor coupling to DARPP-32, ERK1/2 and glutamatergic signalling is involved in mediating the convulsant effects of SKF 83822. PMID:18367215

Early natural stimulation through environmental enrichment accelerates neuronal development in the mouse dentate gyrus.

PubMed

Liu, Na; He, Shan; Yu, Xiang

2012-01-01

The dentate gyrus is the primary afferent into the hippocampal formation, with important functions in learning and memory. Granule cells, the principle neuronal type in the dentate gyrus, are mostly formed postnatally, in a process that continues into adulthood. External stimuli, including environmental enrichment, voluntary exercise and learning, have been shown to significantly accelerate the generation and maturation of dentate granule cells in adult rodents. Whether, and to what extent, such environmental stimuli regulate the development and maturation of dentate granule cells during early postnatal development is largely unknown. Furthermore, whether natural stimuli affect the synaptic properties of granule cells had been investigated neither in newborn neurons of the adult nor during early development. To examine the effect of natural sensory stimulation on the dentate gyrus, we reared newborn mice in an enriched environment (EE). Using immunohistochemistry, we showed that dentate granule cells from EE-reared mice exhibited earlier morphological maturation, manifested as faster peaking of doublecortin expression and elevated expression of mature neuronal markers (including NeuN, calbindin and MAP2) at the end of the second postnatal week. Also at the end of the second postnatal week, we found increased density of dendritic spines across the entire dentate gyrus, together with elevated levels of postsynaptic scaffold (post-synaptic density 95) and receptor proteins (GluR2 and GABA(A)Rγ2) of excitatory and inhibitory synapses. Furthermore, dentate granule cells of P14 EE-reared mice had lower input resistances and increased glutamatergic and GABAergic synaptic inputs. Together, our results demonstrate that EE-rearing promotes morphological and electrophysiological maturation of dentate granule cells, underscoring the importance of natural environmental stimulation on development of the dentate gyrus.

[Rasmussen encephalitis and non-herpetic acute limbic encephalitis].

PubMed

Takahashi, Yukitoshi; Kubota, Yuko; Yamasaki, Etsuko; Matsuda, Kazumi

2008-03-01

Rasmussen syndrome (RS) and non-herpetic acute limbic encephalitis (NHALE) have pathophysiological background related with autoimmunity to glutamate receptors (GluRs) after infections. RS and NHALE were reviewed, depending mainly on our recent studies. RS is the prototype of autoimmune-mediated epilepsy. In patients with RS, several kinds of autoantibodies against neuronal molecules, for example, GluR3, GluRepsilon2 (NMDA-R2B), etc., are reported. These autoantibodies are not specific for RS. About autoantibodies against GluR3, significance and stimulating effects to GluR3 are controversial. Autoantibodies against GluRepsilon2 were detected in all patients within six months from epilepsy onset, and in some patients at chronic stage. These data suggest that autoantibodies against GluRepsilon2 may be involved in the pathological mechanisms in the early stage, but we could not confirm the effect of the autoantibodies from RS patients on excitatory postsynaptic NMDA current using patch clump methods. However, anti-double-stranded DNA antibodies in patients with SLE are reported to cross-react with n-terminal of GluRepsilon2, and cause neuronal apoptosis in rat hippocampus, ensuing memory impairment, and emotional behavior impairment in mice. Therefore, autoantibodies against GluRepsilon2 may contribute to the cognitive and behavioral changes in RS. Concerning about cellular immunity in RS, lymphocytes stimulating tests revealed peripheral lymphocytes sensitized by antigens containing GluRepsilon2. Cytotoxic T cells (CTLs) excreting Granzyme B were reported in resected brain tissue, and we confirmed the elevated levels of Granzyme B, not in sera, but in CSF. These data suggest that CTLs activated by infection invade into CNS, and recognize neural antigens, and excrete Granzyme B. The incidence of NHALE is 4.1/1 million/year in Japanese adults. Our study in 91 adult patients with NHALE revealed the following characteristics. Mean onset age was 35.2 +/- 16.9 years old, and preceding infections existed in 68.7% of patients, and predominant symptoms at the onset were psychiatric symptoms (33.3%) and convulsions (25.0%). CSF showed slightly elevated cell counts (55.5 +/- 139.9), protein levels (48.1 +/- 36.0 mg/dl), and IgG levels (4.5 +/- 3.9 mg/dl). MRI lesions with high intensity were found in 40.8% (DWI) and 54.2% (FLAIR) of patients in various stages after onsets. Autoantibodies against GluRepsilon2 in sera were detected in approximately 60% of NHALE patients from acute to chronic stages, and the autoantibodies in CSF were detected in 51.8% (acute stage), 41.4% (recovery stage), 28.6% (chronic stage) of patients and included epitopes to n-terminal of GluRepsilon2 (NT1). These data suggest that autoantibodies against GluRepsilon2 produced in sera after infection infiltrate into CNS through damaged BBB in acute stages, and affect n-terminal of GluRepsilon2. In chronic stage, recovery of function of BBB reduces levels of the autoantibodies in CSF. Because BBB in hippocampi and amygdala are vulnerable, autoantibodies against GluRepsilon2 including epitopes to n-terminal may contribute to the limbic symptoms around onset. Among several autoantibodies related with NHALE, autoantibodies against GluRepsilon2 were found in patients around 15-34 years old, autoantibodies against VGKC were around 50.4 years old, autoantibodies against NAE were around 59 years old, autoantibodies against Hu were around 61.5 years old. These data suggest that autoantibodies related with NHALE have age-dependent heterogeneity.

Kalirin, a Key Player in Synapse Formation, Is Implicated in Human Diseases

PubMed Central

Mandela, Prashant; Ma, Xin-Ming

2012-01-01

Synapse formation is considered to be crucial for learning and memory. Understanding the underlying molecular mechanisms of synapse formation is a key to understanding learning and memory. Kalirin-7, a major isoform of Kalirin in adult rodent brain, is an essential component of mature excitatory synapses. Kalirin-7 interacts with multiple PDZ-domain-containing proteins including PSD95, spinophilin, and GluR1 through its PDZ-binding motif. In cultured hippocampal/cortical neurons, overexpression of Kalirin-7 increases spine density and spine size whereas reduction of endogenous Kalirin-7 expression decreases synapse number, and spine density. In Kalirin-7 knockout mice, spine length, synapse number, and postsynaptic density (PSD) size are decreased in hippocampal CA1 pyramidal neurons; these morphological alterations are accompanied by a deficiency in long-term potentiation (LTP) and a decreased spontaneous excitatory postsynaptic current (sEPSC) frequency. Human Kalirin-7, also known as Duo or Huntingtin-associated protein-interacting protein (HAPIP), is equivalent to rat Kalirin-7. Recent studies show that Kalirin is relevant to many human diseases such as Huntington's Disease, Alzheimer's Disease, ischemic stroke, schizophrenia, depression, and cocaine addiction. This paper summarizes our recent understanding of Kalirin function. PMID:22548195

Kalirin, a key player in synapse formation, is implicated in human diseases.

PubMed

Mandela, Prashant; Ma, Xin-Ming

2012-01-01

Synapse formation is considered to be crucial for learning and memory. Understanding the underlying molecular mechanisms of synapse formation is a key to understanding learning and memory. Kalirin-7, a major isoform of Kalirin in adult rodent brain, is an essential component of mature excitatory synapses. Kalirin-7 interacts with multiple PDZ-domain-containing proteins including PSD95, spinophilin, and GluR1 through its PDZ-binding motif. In cultured hippocampal/cortical neurons, overexpression of Kalirin-7 increases spine density and spine size whereas reduction of endogenous Kalirin-7 expression decreases synapse number, and spine density. In Kalirin-7 knockout mice, spine length, synapse number, and postsynaptic density (PSD) size are decreased in hippocampal CA1 pyramidal neurons; these morphological alterations are accompanied by a deficiency in long-term potentiation (LTP) and a decreased spontaneous excitatory postsynaptic current (sEPSC) frequency. Human Kalirin-7, also known as Duo or Huntingtin-associated protein-interacting protein (HAPIP), is equivalent to rat Kalirin-7. Recent studies show that Kalirin is relevant to many human diseases such as Huntington's Disease, Alzheimer's Disease, ischemic stroke, schizophrenia, depression, and cocaine addiction. This paper summarizes our recent understanding of Kalirin function.

The phosphorylation status and cytoskeletal remodeling of striatal astrocytes treated with quinolinic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pierozan, Paula; Ferreira, Fernanda; Ortiz de Lima, Bárbara

2014-04-01

Quinolinic acid (QUIN) is a glutamate agonist which markedly enhances the vulnerability of neural cells to excitotoxicity. QUIN is produced from the amino acid tryptophan through the kynurenine pathway (KP). Dysregulation of this pathway is associated with neurodegenerative conditions. In this study we treated striatal astrocytes in culture with QUIN and assayed the endogenous phosphorylating system associated with glial fibrillary acidic protein (GFAP) and vimentin as well as cytoskeletal remodeling. After 24 h incubation with 100 µM QUIN, cells were exposed to {sup 32}P-orthophosphate and/or protein kinase A (PKA), protein kinase dependent of Ca{sup 2+}/calmodulin II (PKCaMII) or protein kinasemore » C (PKC) inhibitors, H89 (20 μM), KN93 (10 μM) and staurosporin (10 nM), respectively. Results showed that hyperphosphorylation was abrogated by PKA and PKC inhibitors but not by the PKCaMII inhibitor. The specific antagonists to ionotropic NMDA and non-NMDA (50 µM DL-AP5 and CNQX, respectively) glutamate receptors as well as to metabotropic glutamate receptor (mGLUR; 50 µM MCPG), mGLUR1 (100 µM MPEP) and mGLUR5 (10 µM 4C3HPG) prevented the hyperphosphorylation provoked by QUIN. Also, intra and extracellular Ca{sup 2+} quelators (1 mM EGTA; 10 µM BAPTA-AM, respectively) prevented QUIN-mediated effect, while Ca{sup 2+} influx through voltage-dependent Ca{sup 2+} channel type L (L-VDCC) (blocker: 10 µM verapamil) is not implicated in this effect. Morphological analysis showed dramatically altered actin cytoskeleton with concomitant change of morphology to fusiform and/or flattened cells with retracted cytoplasm and disruption of the GFAP meshwork, supporting misregulation of actin cytoskeleton. Both hyperphosphorylation and cytoskeletal remodeling were reversed 24 h after QUIN removal. Astrocytes are highly plastic cells and the vulnerability of astrocyte cytoskeleton may have important implications for understanding the neurotoxicity of QUIN in neurodegenerative disorders. - Highlights: • Quinolinic acid (QUIN) induces hypersphorylation of cytoskeletal proteins in striatal astrocytes. • Glutamate, Ca{sup 2+}, PKA and PKC are implicated in the aberrantly phosphorylated GFAP and vimentin. • QUIN induces reorganization of actin and GFAP cytoskeleton. • Hyperphosphorylation and cytoskeletal remodeling are reversed after QUIN removal. • Disruption of cytoskeleton is a cytotoxic action of QUIN in striatal astrocytes.« less

Morphology and kainate-receptor immunoreactivity of identified neurons within the entorhinal cortex projecting to superior temporal sulcus in the cynomolgus monkey

NASA Technical Reports Server (NTRS)

Good, P. F.; Morrison, J. H.; Bloom, F. E. (Principal Investigator)

1995-01-01

Projections of the entorhinal cortex to the hippocampus are well known from the classical studies of Cajal (Ramon y Cajal, 1904) and Lorente de No (1933). Projections from the entorhinal cortex to neocortical areas are less well understood. Such connectivity is likely to underlie the consolidation of long-term declarative memory in neocortical sites. In the present study, a projection arising in layer V of the entorhinal cortex and terminating in a polymodal association area of the superior temporal gyrus has been identified with the use of retrograde tracing. The dendritic arbors of neurons giving rise to this projection were further investigated by cell filling and confocal microscopy with computer reconstruction. This analysis demonstrated that the dendritic arbor of identified projection neurons was largely confined to layer V, with the exception of a solitary, simple apical dendrite occasionally ascending to superficial laminae but often confined to the lamina dissecans (layer IV). Finally, immunoreactivity for glutamate-receptor subunit proteins GluR 5/6/7 of the dendritic arbor of identified entorhinal projection neurons was examined. The solitary apical dendrite of identified entorhinal projection neurons was prominently immunolabeled for GluR 5/6/7, as was the dendritic arbor of basilar dendrites of these neurons. The restriction of the large bulk of the dendritic arbor of identified entorhinal projection neurons to layer V implies that these neurons are likely to be heavily influenced by hippocampal output arriving in the deep layers of the entorhinal cortex. Immunoreactivity for GluR 5/6/7 throughout the dendritic arbor of such neurons indicates that this class of glutamate receptor is in a position to play a prominent role in mediating excitatory neurotransmission within hippocampal-entorhinal circuits.

An essential role for UBE2A/HR6A in learning and memory and mGLUR-dependent long-term depression.

PubMed

Bruinsma, Caroline F; Savelberg, Sanne M C; Kool, Martijn J; Jolfaei, Mehrnoush Aghadavoud; Van Woerden, Geeske M; Baarends, Willy M; Elgersma, Ype

2016-01-01

UBE2A deficiency syndrome (also known as X-linked intellectual disability type Nascimento) is an intellectual disability syndrome characterized by prominent dysmorphic features, impaired speech and often epilepsy. The syndrome is caused by Xq24 deletions encompassing the UBE2A (HR6A) gene or by intragenic UBE2A mutations. UBE2A encodes an E2 ubiquitin-conjugating enzyme involved in DNA repair and female fertility. A recent study in Drosophila showed that dUBE2A binds to the E3 ligase Parkin, which is required for mitochondrial function and responsible for juvenile Parkinson's disease. In addition, these studies showed impairments in synaptic transmission in dUBE2A mutant flies. However, a causal role of UBE2A in of cognitive deficits has not yet been established. Here, we show that Ube2a knockout mice have a major deficit in spatial learning tasks, whereas other tested phenotypes, including epilepsy and motor coordination, were normal. Results from electrophysiological measurements in the hippocampus showed no deficits in synaptic transmission nor in the ability to induce long-term synaptic potentiation. However, a small but significant deficit was observed in mGLUR-dependent long-term depression, a pathway previously implied in several other mouse models for neurodevelopmental disorders. Our results indicate a causal role of UBE2A in learning and mGLUR-dependent long-term depression, and further indicate that the Ube2a knockout mouse is a good model to study the molecular mechanisms underlying UBE2A deficiency syndrome. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Simultaneous monitoring of presynaptic transmitter release and postsynaptic receptor trafficking reveals an enhancement of presynaptic activity in metabotropic glutamate receptor-mediated long-term depression.

PubMed

Xu, Wei; Tse, Yiu Chung; Dobie, Frederick A; Baudry, Michel; Craig, Ann Marie; Wong, Tak Pan; Wang, Yu Tian

2013-03-27

Although the contribution of postsynaptic mechanisms to long-term synaptic plasticity has been studied extensively, understanding the contribution of presynaptic modifications to this process lags behind, primarily because of a lack of techniques with which to directly and quantifiably measure neurotransmitter release from synaptic terminals. Here, we developed a method to measure presynaptic activity through the biotinylation of vesicular transporters in vesicles fused with presynaptic membranes during neurotransmitter release. This method allowed us for the first time to selectively quantify the spontaneous or evoked release of glutamate or GABA at their respective synapses. Using this method to investigate presynaptic changes during the expression of group I metabotropic glutamate receptor (mGluR1/5)-mediated long-term depression (LTD) in cultured rat hippocampal neurons, we discovered that this form of LTD was associated with increased presynaptic release of glutamate, despite reduced miniature EPSCs measured with whole-cell recording. Moreover, we found that specific blockade of AMPA receptor (AMPAR) endocytosis with a membrane-permeable GluR2-derived peptide not only prevented the expression of LTD but also eliminated LTD-associated increase in presynaptic release. Thus, our work not only demonstrates that mGluR1/5-mediated LTD is associated with increased endocytosis of postsynaptic AMPARs but also reveals an unexpected homeostatic/compensatory increase in presynaptic release. In addition, this study indicates that biotinylation of vesicular transporters in live cultured neurons is a valuable tool for studying presynaptic function.

Mice Deficient in lysophosphatidic acid acyltransferase delta (Lpaatδ)/acylglycerophosphate acyltransferase 4 (Agpat4) Have Impaired Learning and Memory.

PubMed

Bradley, Ryan M; Mardian, Emily B; Bloemberg, Darin; Aristizabal Henao, Juan J; Mitchell, Andrew S; Marvyn, Phillip M; Moes, Katherine A; Stark, Ken D; Quadrilatero, Joe; Duncan, Robin E

2017-11-15

We previously characterized LPAATδ/AGPAT4 as a mitochondrial lysophosphatidic acid acyltransferase that regulates brain levels of phosphatidylcholine (PC), phosphatidylethanolamine (PE), and phosphatidylinositol (PI). Here, we report that Lpaat δ -/- mice display impaired spatial learning and memory compared to wild-type littermates in the Morris water maze and our investigation of potential mechanisms associated with brain phospholipid changes. Marker protein immunoblotting suggested that the relative brain content of neurons, glia, and oligodendrocytes was unchanged. Relative abundance of the important brain fatty acid docosahexaenoic acid was also unchanged in phosphatidylserine, phosphatidylglycerol, and cardiolipin, in agreement with prior data on PC, PE and PI. In phosphatidic acid, it was increased. Specific decreases in ethanolamine-containing phospholipids were detected in mitochondrial lipids, but the function of brain mitochondria in Lpaat δ -/- mice was unchanged. Importantly, we found that Lpaat δ -/- mice have a significantly and drastically lower brain content of the N -methyl-d-asparate (NMDA) receptor subunits NR1, NR2A, and NR2B, as well as the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit GluR1, compared to wild-type mice. However, general dysregulation of PI-mediated signaling is not likely responsible, since phospho-AKT and phospho-mTOR pathway regulation was unaffected. Our findings indicate that Lpaat δ deficiency causes deficits in learning and memory associated with reduced NMDA and AMPA receptors. Copyright © 2017 American Society for Microbiology.

Early in vivo changes in calcium ions, oxidative stress markers, and ion channel immunoreactivity following partial injury to the optic nerve.

PubMed

Wells, Jonathan; Kilburn, Matthew R; Shaw, Jeremy A; Bartlett, Carole A; Harvey, Alan R; Dunlop, Sarah A; Fitzgerald, Melinda

2012-03-01

CNS injury is often localized but can be followed by more widespread secondary degenerative events that usually result in greater functional loss. Using a partial transection model in rat optic nerve (ON). we recently demonstrated in vivo increases in the oxidative stress-associated enzyme MnSOD 5 min after injury. However, mechanisms by which early oxidative stress spreads remain unclear. In the present study, we assessed ion distributions, additional oxidative stress indicators, and ion channel immunoreactivity in ON in the first 24 hr after partial transection. Using nanoscale secondary ion mass spectroscopy (NanoSIMS), we demonstrate changes in the distribution pattern of Ca ions following partial ON transection. Regions of elevated Ca ions in normal ON in vivo rapidly decrease following partial ON transection, but there is an increasingly punctate distribution at 5 min and 24 hr after injury. We also show rapid decreases in catalase activity and later increases in immunoreactivity of the advanced glycation end product carboxymethyl lysine in astrocytes. Increased oxidative stress in astrocytes is accompanied by significantly increased immunoreactivity of the AMPA receptor subunit GluR1 and aquaporin 4 (AQP4). Taken together, the results indicate that Ca ion changes and oxidative stress are early events following partial ON injury that are associated with changes in GluR1 AMPA receptor subunits and altered ionic balance resulting from increased AQP4. Copyright © 2011 Wiley Periodicals, Inc.

Glutamate receptors as seen by light: Spectroscopic studies of structure-function relationships

PubMed Central

Mankiewicz, Kimberly A.; Jayaraman, Vasanthi

2010-01-01

Ionotropic glutamate receptors are major excitatory receptors in the central nervous system and also have far reaching influence in other areas of the body. Their modular nature has allowed for the isolation of the ligand binding domain and subsequent structural studies using a variety of spectroscopic techniques. This review will discuss the role of specific ligand:protein interactions in mediating activation in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) subtype of glutamate receptors as established by various spectroscopic investigations of the GluR2 and GluR4 subunits of this receptor. Specifically, this review will provide an introduction of the insight gained from X-ray crystallography and nuclear magnetic resonance (NMR) investigations and then go on to focus on studies utilizing vibrational spectroscopy and fluorescence resonance energy transfer (FRET) to study the behavior of the isolated ligand binding domain in solution and discuss the importance of specific ligand:protein interactions in the mechanism of receptor activation. PMID:17934637

Bacopa monnieri ameliorates memory deficits in olfactory bulbectomized mice: possible involvement of glutamatergic and cholinergic systems.

PubMed

Le, Xoan Thi; Pham, Hang Thi Nguyet; Do, Phuong Thi; Fujiwara, Hironori; Tanaka, Ken; Li, Feng; Van Nguyen, Tai; Nguyen, Khoi Minh; Matsumoto, Kinzo

2013-10-01

This study investigated the effects of alcoholic extract of Bacopa monnieri (L.) Wettst. (BM) on cognitive deficits using olfactory bulbectomized (OBX) mice and the underlying molecular mechanisms of its action. OBX mice were treated daily with BM (50 mg/kg, p.o.) or a reference drug, tacrine (2.5 mg/kg, i.p.), 1 week before and continuously 3 days after OBX. Cognitive performance of the animals was analyzed by the novel object recognition test, modified Y maze test, and fear conditioning test. Brain tissues of OBX animals were used for neurochemical and immunohistochemical studies. OBX impaired non-spatial short-term memory, spatial working memory, and long-term fair memory. BM administration ameliorated these memory disturbances. The effect of BM on short-term memory deficits was abolished by a muscarinic receptor antagonist, scopolamine. OBX downregulated phosphorylation of synaptic plasticity-related signaling proteins: NR1 subunit of N-methyl-D-aspartate receptor, glutamate receptor 1 (GluR1), and calmodulin-dependent kinase II but not cyclic AMP-responsive element binding protein (CREB), and reduced brain-derived neurotrophic factor (BDNF) mRNA in the hippocampus. OBX also reduced choline acetyltransferase in the hippocampus and cholinergic neurons in the medial septum, and enlarged the size of lateral ventricle. BM administration reversed these OBX-induced neurochemical and histological alterations, except the decrease of GluR1 phosphorylation, and enhanced CREB phosphorylation. Moreover, BM treatment inhibited ex vivo activity of acetylcholinesterase in the brain. These results indicate that BM treatment ameliorates OBX-induced cognition dysfunction via a mechanism involving enhancement of synaptic plasticity-related signaling and BDNF transcription and protection of cholinergic systems from OBX-induced neuronal damage.

Immature morphological properties in subcellular-scale structures in the dentate gyrus of Schnurri-2 knockout mice: a model for schizophrenia and intellectual disability.

PubMed

Nakao, Akito; Miyazaki, Naoyuki; Ohira, Koji; Hagihara, Hideo; Takagi, Tsuyoshi; Usuda, Nobuteru; Ishii, Shunsuke; Murata, Kazuyoshi; Miyakawa, Tsuyoshi

2017-12-12

Accumulating evidence suggests that subcellular-scale structures such as dendritic spine and mitochondria may be involved in the pathogenesis/pathophysiology of schizophrenia and intellectual disability. Previously, we proposed mice lacking Schnurri-2 (Shn2; also called major histocompatibility complex [MHC]-binding protein 2 [MBP-2], or human immunodeficiency virus type I enhancer binding protein 2 [HIVEP2]) as a schizophrenia and intellectual disability model with mild chronic inflammation. In the mutants' brains, there are increases in C4b and C1q genes, which are considered to mediate synapse elimination during postnatal development. However, morphological properties of subcellular-scale structures such as dendritic spine in Shn2 knockout (KO) mice remain unknown. In this study, we conducted three-dimensional morphological analyses in subcellular-scale structures in dentate gyrus granule cells of Shn2 KO mice by serial block-face scanning electron microscopy. Shn2 KO mice showed immature dendritic spine morphology characterized by increases in spine length and decreases in spine diameter. There was a non-significant tendency toward decrease in spine density of Shn2 KO mice over wild-type mice, and spine volume was indistinguishable between genotypes. Shn2 KO mice exhibited a significant reduction in GluR1 expression and a nominally significant decrease in SV2 expression, while PSD95 expression had a non-significant tendency to decrease in Shn2 KO mice. There were significant decreases in dendrite diameter, nuclear volume, and the number of constricted mitochondria in the mutants. Additionally, neuronal density was elevated in Shn2 KO mice. These results suggest that Shn2 KO mice serve as a unique tool for investigating morphological abnormalities of subcellular-scale structures in schizophrenia, intellectual disability, and its related disorders.

Soman Induces Ictogenesis in the Amygdala and Interictal Activity in the Hippocampus That Are Blocked by a GluR5 Kainate Receptor Antagonist In Vitro

DTIC Science & Technology

2009-01-01

to organophosphorus nerve agents in- uces brain seizures, which can cause profound brain dam- ge resulting in death or long-term cognitive deficits...The mygdala and the hippocampus are two of the most seizure- rone brain structures, but their relative contribution to the eneration of seizures after...nerve agent exposure is unclear. ere, we report that application of 1 M soman for 30 min, in at coronal brain slices containing both the hippocampus

CORM-A1 prevents blood-brain barrier dysfunction caused by ionotropic glutamate receptor-mediated endothelial oxidative stress and apoptosis.

PubMed

Basuroy, Shyamali; Leffler, Charles W; Parfenova, Helena

2013-06-01

In cerebral microvascular endothelial cells (CMVEC) of newborn pigs, glutamate at excitotoxic concentrations (mM) causes apoptosis mediated by reactive oxygen species (ROS). Carbon monoxide (CO) produced by CMVEC or delivered by a CO-releasing molecule, CORM-A1, has antioxidant properties. We tested the hypothesis that CORM-A1 prevents cerebrovascular endothelial barrier dysfunction caused by glutamate excitotoxicity. First, we identified the glutamate receptors (GluRs) and enzymatic sources of ROS involved in the mechanism of endothelial apoptosis. In glutamate-exposed CMVEC, ROS formation and apoptosis were blocked by rotenone, 2-thenoyltrifluoroacetone (TTFA), and antimycin, indicating that mitochondrial complexes I, II, and III are the major sources of oxidative stress. Agonists of ionotropic GluRs (iGluRs) N-methyl-D-aspartate (NMDA), cis-ACPD, AMPA, and kainate increased ROS production and apoptosis, whereas iGluR antagonists exhibited antiapoptotic properties, suggesting that iGluRs mediate glutamate-induced endothelial apoptosis. The functional consequences of endothelial injury were tested in the model of blood-brain barrier (BBB) composed of CMVEC monolayer on semipermeable membranes. Glutamate and iGluR agonists reduced transendothelial electrical resistance and increased endothelial paracellular permeability to 3-kDa dextran. CORM-A1 exhibited potent antioxidant and antiapoptotic properties in CMVEC and completely prevented BBB dysfunction caused by glutamate and iGluR agonists. Overall, the endothelial component of the BBB is a cellular target for excitotoxic glutamate that, via a mechanism involving a iGluR-mediated activation of mitochondrial ROS production and apoptosis, leads to BBB opening that may be prevented by the antioxidant and antiapoptotic actions of CORMs. Antioxidant CORMs therapy may help preserve BBB functional integrity in neonatal cerebrovascular disease.

Spinal electro-magnetic stimulation combined with transgene delivery of neurotrophin NT-3 and exercise: novel combination therapy for spinal contusion injury

PubMed Central

Petrosyan, Hayk A.; Alessi, Valentina; Hunanyan, Arsen S.; Sisto, Sue A.

2015-01-01

Our recent terminal experiments revealed that administration of a single train of repetitive spinal electromagnetic stimulation (sEMS; 35 min) enhanced synaptic plasticity in spinal circuitry following lateral hemisection spinal cord injury. In the current study, we have examined effects of repetitive sEMS applied as a single train and chronically (5 wk, every other day) following thoracic T10 contusion. Chronic studies involved examination of systematic sEMS administration alone and combined with exercise training and transgene delivery of neurotrophin [adeno-associated virus 10-neurotrophin 3 (AAV10-NT3)]. Electrophysiological intracellular/extracellular recordings, immunohistochemistry, behavioral testing, and anatomical tracing were performed to assess effects of treatments. We found that administration of a single sEMS train induced transient facilitation of transmission through preserved lateral white matter to motoneurons and hindlimb muscles in chronically contused rats with effects lasting for at least 2 h. These physiological changes associated with increased immunoreactivity of GluR1 and GluR2/3 glutamate receptors in lumbar neurons. Systematic administration of sEMS alone for 5 wk, however, was unable to induce cumulative improvements of transmission in spinomuscular circuitry or improve impaired motor function following thoracic contusion. Encouragingly, chronic administration of sEMS, followed by exercise training (running in an exercise ball and swimming), induced the following: 1) sustained strengthening of transmission to lumbar motoneurons and hindlimb muscles, 2) better retrograde transport of anatomical tracer, and 3) improved locomotor function. Greatest improvements were seen in the group that received exercise combined with sEMS and AAV-NT3. PMID:26424579

Spinal electro-magnetic stimulation combined with transgene delivery of neurotrophin NT-3 and exercise: novel combination therapy for spinal contusion injury.

PubMed

Petrosyan, Hayk A; Alessi, Valentina; Hunanyan, Arsen S; Sisto, Sue A; Arvanian, Victor L

2015-11-01

Our recent terminal experiments revealed that administration of a single train of repetitive spinal electromagnetic stimulation (sEMS; 35 min) enhanced synaptic plasticity in spinal circuitry following lateral hemisection spinal cord injury. In the current study, we have examined effects of repetitive sEMS applied as a single train and chronically (5 wk, every other day) following thoracic T10 contusion. Chronic studies involved examination of systematic sEMS administration alone and combined with exercise training and transgene delivery of neurotrophin [adeno-associated virus 10-neurotrophin 3 (AAV10-NT3)]. Electrophysiological intracellular/extracellular recordings, immunohistochemistry, behavioral testing, and anatomical tracing were performed to assess effects of treatments. We found that administration of a single sEMS train induced transient facilitation of transmission through preserved lateral white matter to motoneurons and hindlimb muscles in chronically contused rats with effects lasting for at least 2 h. These physiological changes associated with increased immunoreactivity of GluR1 and GluR2/3 glutamate receptors in lumbar neurons. Systematic administration of sEMS alone for 5 wk, however, was unable to induce cumulative improvements of transmission in spinomuscular circuitry or improve impaired motor function following thoracic contusion. Encouragingly, chronic administration of sEMS, followed by exercise training (running in an exercise ball and swimming), induced the following: 1) sustained strengthening of transmission to lumbar motoneurons and hindlimb muscles, 2) better retrograde transport of anatomical tracer, and 3) improved locomotor function. Greatest improvements were seen in the group that received exercise combined with sEMS and AAV-NT3.

Preservation of long-term memory and synaptic plasticity despite short-term impairments in the Tc1 mouse model of Down syndrome.

PubMed

Morice, Elise; Andreae, Laura C; Cooke, Sam F; Vanes, Lesley; Fisher, Elizabeth M C; Tybulewicz, Victor L J; Bliss, Timothy V P

2008-07-01

Down syndrome (DS) is a genetic disorder arising from the presence of a third copy of the human chromosome 21 (Hsa21). Recently, O'Doherty and colleagues in an earlier study generated a new genetic mouse model of DS (Tc1) that carries an almost complete Hsa21. Since DS is the most common genetic cause of mental retardation, we have undertaken a detailed analysis of cognitive function and synaptic plasticity in Tc1 mice. Here we show that Tc1 mice have impaired spatial working memory (WM) but spared long-term spatial reference memory (RM) in the Morris watermaze. Similarly, Tc1 mice are selectively impaired in short-term memory (STM) but have intact long-term memory (LTM) in the novel object recognition task. The pattern of impaired STM and normal LTM is paralleled by a corresponding phenotype in long-term potentiation (LTP). Freely-moving Tc1 mice exhibit reduced LTP 1 h after induction but normal maintenance over days in the dentate gyrus of the hippocampal formation. Biochemical analysis revealed a reduction in membrane surface expression of the AMPAR (alpha-amino-3-hydroxy-5-methyl-4-propionic acid receptor) subunit GluR1 in the hippocampus of Tc1 mice, suggesting a potential mechanism for the impairment in early LTP. Our observations also provide further evidence that STM and LTM for hippocampus-dependent tasks are subserved by parallel processing streams.

AMPA receptor desensitization mutation results in severe developmental phenotypes and early postnatal lethality

PubMed Central

Christie, Louisa A.; Russell, Theron A.; Xu, Jian; Wood, Lydia; Shepherd, Gordon M. G.; Contractor, Anis

2010-01-01

AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazole-propionate) recep-tors desensitize rapidly and completely in the continued presence of their endogenous ligand glutamate; however, it is not clear what role AMPA receptor desensitization plays in the brain. We generated a knock-in mouse in which a single amino acid residue, which controls desensitization, was mutated in the GluA2 (GluR2) receptor subunit (GluA2L483Y). This mutation was homozygous lethal. However, mice carrying a single mutated allele, GluA2L483Y/wt, survived past birth, but displayed severe and progressive neurological deficits including seizures and, ultimately, increased mortality. The expression of the AMPA receptor subunits GluA1 and GluA2 was decreased, whereas NMDA receptor protein expression was increased in GluA2L483Y/wt mice. Despite this, basal synaptic transmission and plasticity in the hippocampus were largely unaffected, suggesting that neurons preferentially target receptors to synapses to normalize synaptic weight. We found no gross neuroanatomical alterations in GluA2L483Y/wt mice. Moreover, there was no accumulation of AMPA receptor subunits in intracellular compartments, suggesting that folding and assembly of AMPA receptors are not affected by this mutation. Interestingly, EPSC paired pulse ratios in the CA1 were enhanced without a change in synaptic release probability, demonstrating that postsynaptic receptor properties can contribute to facilitation. The dramatic phenotype observed in this study by the introduction of a single amino acid change demonstrates an essential role in vivo for AMPA receptor desensitization. PMID:20439731

Dual-targeted tRNA-dependent amidotransferase ensures both mitochondrial and chloroplastic Gln-tRNAGln synthesis in plants

PubMed Central

Pujol, Claire; Bailly, Marc; Kern, Daniel; Maréchal-Drouard, Laurence; Becker, Hubert; Duchêne, Anne-Marie

2008-01-01

Aminoacyl-tRNAs are generally formed by direct attachment of an amino acid to tRNAs by aminoacyl-tRNA synthetases, but Gln-tRNA is an exception to this rule. Gln-tRNAGln is formed by this direct pathway in the eukaryotic cytosol and in protists or fungi mitochondria but is formed by an indirect transamidation pathway in most of bacteria, archaea, and chloroplasts. We show here that the formation of Gln-tRNAGln is also achieved by the indirect pathway in plant mitochondria. The mitochondrial-encoded tRNAGln, which is the only tRNAGln present in mitochondria, is first charged with glutamate by a nondiscriminating GluRS, then is converted into Gln-tRNAGln by a tRNA-dependent amidotransferase (AdT). The three subunits GatA, GatB, and GatC are imported into mitochondria and assemble into a functional GatCAB AdT. Moreover, the mitochondrial pathway of Gln-tRNAGln formation is shared with chloroplasts as both the GluRS, and the three AdT subunits are dual-imported into mitochondria and chloroplasts. PMID:18441100

Differential Expression of Glutamate Receptors in Avian Neural Pathways for Learned Vocalization

PubMed Central

WADA, KAZUHIRO; SAKAGUCHI, HIRONOBU; JARVIS, ERICH D.; HAGIWARA, MASATOSHI

2008-01-01

Learned vocalization, the substrate for human language, is a rare trait. It is found in three distantly related groups of birds—parrots, hummingbirds, and songbirds. These three groups contain cerebral vocal nuclei for learned vocalization not found in their more closely related vocal nonlearning relatives. Here, we cloned 21 receptor subunits/subtypes of all four glutamate receptor families (AMPA, kainate, NMDA, and metabotropic) and examined their expression in vocal nuclei of songbirds. We also examined expression of a subset of these receptors in vocal nuclei of hummingbirds and parrots, as well as in the brains of dove species as examples of close vocal nonlearning relatives. Among the 21 subunits/subtypes, 19 showed higher and/or lower prominent differential expression in songbird vocal nuclei relative to the surrounding brain subdivisions in which the vocal nuclei are located. This included relatively lower levels of all four AMPA subunits in lMAN, strikingly higher levels of the kainite subunit GluR5 in the robust nucleus of the arcopallium (RA), higher and lower levels respectively of the NMDA subunits NR2A and NR2B in most vocal nuclei and lower levels of the metabotropic group I subtypes (mGluR1 and -5) in most vocal nuclei and the group II subtype (mGluR2), showing a unique expression pattern of very low levels in RA and very high levels in HVC. The splice variants of AMPA subunits showed further differential expression in vocal nuclei. Some of the receptor subunits/subtypes also showed differential expression in hummingbird and parrot vocal nuclei. The magnitude of differential expression in vocal nuclei of all three vocal learners was unique compared with the smaller magnitude of differences found for nonvocal areas of vocal learners and vocal nonlearners. Our results suggest that evolution of vocal learning was accompanied by differential expression of a conserved gene family for synaptic transmission and plasticity in vocal nuclei. They also suggest that neural activity and signal transduction in vocal nuclei of vocal learners will be different relative to the surrounding brain areas. PMID:15236466

Stereochemistry of quinoxaline antagonist binding to a glutamate receptor investigated by Fourier transform infrared spectroscopy.

PubMed

Madden, D R; Thiran, S; Zimmermann, H; Romm, J; Jayaraman, V

2001-10-12

The stereochemistry of the interactions between quinoxaline antagonists and the ligand-binding domain of the glutamate receptor 4 (GluR4) have been investigated by probing their vibrational modes using Fourier transform infrared spectroscopy. In solution, the electron-withdrawing nitro groups of both compounds establish a resonance equilibrium that appears to stabilize the keto form of one of the cyclic amide carbonyl bonds. Changes in the 6,7-dinitro-2,3-dihydroxyquinoxaline vibrational spectra on binding to the glutamate receptor, interpreted within the framework of a published crystal structure, illuminate the stereochemistry of the interaction and suggest that the binding site imposes a more polarized electronic bonding configuration on this antagonist. Similar spectral changes are observed for 6-cyano-7-dinitro-2,3-dihydroxyquinoxaline, confirming that its interactions with the binding site are highly similar to those of 6,7-dinitro-2,3-dihydroxyquinoxaline and leading to a model of the 6-cyano-7-dinitro-2,3-dihydroxyquinoxaline-S1S2 complex, for which no crystal structure is available. Conformational changes within the GluR ligand binding domain were also monitored. Compared with the previously reported spectral changes seen on binding of the agonist glutamate, only a relatively small change is detected on antagonist binding. This correlation between the functional effects of different classes of ligand and the magnitude of the spectroscopic changes they induce suggests that the spectral data reflect physiologically relevant conformational processes.

Molecular mapping of 21 features associated with partial monosomy 21: Involvement of the APP-SODI region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chettouh, Z.; Maunoury, C.; Sinet, P.M.

1995-07-01

We compared the phenotypes, karyotypes, and molecular data for six cases of partial monosomy 21. Regions of chromosome 21, the deletion of which corresponds to particular features of monosomy 21, were thereby defined. Five such regions were identified for 21 features. Ten of the features could be assigned to the region flanked by genes APP and SOD1: six facial features, transverse palmar crease, arthrogryposis-like symptoms, hypertonia, and contribution to mental retardation. This region, covering the interface of bands 21q21-21q22.1, is 4.7-6.4 Mb long and contains the gene encoding the glutamate receptor subunit GluR5 (GRIK1). 82 refs., 5 figs., 1 tab.

Transforming growth factor β-activated kinase 1 negatively regulates interleukin-1α-induced stromal-derived factor-1 expression in vascular smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Bin; Li, Wei; Zheng, Qichang

Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negativemore » effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation.« less

Identification of a cone bipolar cell in cat retina which has input from both rod and cone photoreceptors.

PubMed

Fyk-Kolodziej, Bozena; Qin, Pu; Pourcho, Roberta G

2003-09-08

It has been generally accepted that rod photoreceptor cells in the mammalian retina make synaptic contact with only a single population of rod bipolar cells, whereas cone photoreceptors contact a variety of cone bipolar cells. This assumption has been challenged in rodents by reports of a type of cone bipolar cell which receives input from both rods and cones. Questions remained as to whether similar pathways are present in other mammals. We have used an antiserum against the glutamate transporter GLT1-B to visualize a population of cone bipolar cells in the cat retina which make flat contacts with axon terminals of both rod and cone photoreceptor cells. These cells are identified as OFF-cone bipolar cells and correspond morphologically to type cb1 (CBa2) cone bipolar cells which are a major source of input to OFF-beta ganglion cells in the cat retina. The GLT1-B transporter was also localized to processes making flat contacts with photoreceptor terminals in rat and rabbit retinas. Examination of tissue processed for the GluR1 glutamate receptor subunit showed that cb1 cone bipolar cells, like their rodent counterparts, express this alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)-selective receptor at their contacts with rod spherules. Thus, a direct excitatory pathway from rod photoreceptors to OFF-cone bipolar cells appears to be a common feature of mammalian retinas. Copyright 2003 Wiley-Liss, Inc.

Metformin suppresses CYP1A1 and CYP1B1 expression in breast cancer cells by down-regulating aryl hydrocarbon receptor expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Do, Minh Truong; Kim, Hyung Gyun; Tran, Thi Thu Phuong

2014-10-01

Induction of cytochrome P450 (CYP) 1A1 and CYP1B1 by environmental xenobiotic chemicals or endogenous ligands through the activation of the aryl hydrocarbon receptor (AhR) has been implicated in a variety of cellular processes related to cancer, such as transformation and tumorigenesis. Here, we investigated the effects of the anti-diabetes drug metformin on expression of CYP1A1 and CYP1B1 in breast cancer cells under constitutive and inducible conditions. Our results indicated that metformin down-regulated the expression of CYP1A1 and CYP1B1 in breast cancer cells under constitutive and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced conditions. Down-regulation of AhR expression was required for metformin-mediated decreases in CYP1A1 andmore » CYP1B1 expression, and the metformin-mediated CYP1A1 and CYP1B1 reduction is irrelevant to estrogen receptor α (ERα) signaling. Furthermore, we found that metformin markedly down-regulated Sp1 protein levels in breast cancer cells. The use of genetic and pharmacological tools revealed that metformin-mediated down-regulation of AhR expression was mediated through the reduction of Sp1 protein. Metformin inhibited endogenous AhR ligand-induced CYP1A1 and CYP1B1 expression by suppressing tryptophan-2,3-dioxygenase (TDO) expression in MCF-7 cells. Finally, metformin inhibits TDO expression through a down-regulation of Sp1 and glucocorticoid receptor (GR) protein levels. Our findings demonstrate that metformin reduces CYP1A1 and CYP1B1 expression in breast cancer cells by down-regulating AhR signaling. Metformin would be able to act as a potential chemopreventive agent against CYP1A1 and CYP1B1-mediated carcinogenesis and development of cancer. - Graphical abstract: Schematic of the CYP1A1 and CYP1B1 gene regulation by metformin. - Highlights: • Metformin inhibits CYP1A1 and CYP1B1 expression. • Metformin down-regulates the AhR signaling. • Metformin reduces Sp1 protein expression. • Metformin suppresses TDO expression.« less

Identification of Id4 as a regulator of BRCA1 expression by using a ribozyme-library-based inverse genomics approach

PubMed Central

Beger, Carmela; Pierce, Leigh N.; Krüger, Martin; Marcusson, Eric G.; Robbins, Joan M.; Welcsh, Piri; Welch, Peter J.; Welte, Karl; King, Mary-Claire; Barber, Jack R.; Wong-Staal, Flossie

2001-01-01

Expression of the breast and ovarian cancer susceptibility gene BRCA1 is down-regulated in sporadic breast and ovarian cancer cases. Therefore, the identification of genes involved in the regulation of BRCA1 expression might lead to new insights into the pathogenesis and treatment of these tumors. In the present study, an “inverse genomics” approach based on a randomized ribozyme gene library was applied to identify cellular genes regulating BRCA1 expression. A ribozyme gene library with randomized target recognition sequences was introduced into human ovarian cancer-derived cells stably expressing a selectable marker [enhanced green fluorescence protein (EGFP)] under the control of the BRCA1 promoter. Cells in which BRCA1 expression was upregulated by particular ribozymes were selected through their concomitant increase in EGFP expression. The cellular target gene of one ribozyme was identified to be the dominant negative transcriptional regulator Id4. Modulation of Id4 expression resulted in inversely regulated expression of BRCA1. In addition, increase in Id4 expression was associated with the ability of cells to exhibit anchorage-independent growth, demonstrating the biological relevance of this gene. Our data suggest that Id4 is a crucial gene regulating BRCA1 expression and might therefore be important for the BRCA1 regulatory pathway involved in the pathogenesis of sporadic breast and ovarian cancer. PMID:11136250

Acute inactivation of PSD-95 destabilizes AMPA receptors at hippocampal synapses.

PubMed

Yudowski, Guillermo A; Olsen, Olav; Adesnik, Hillel; Marek, Kurt W; Bredt, David S

2013-01-01

Postsynatptic density protein (PSD-95) is a 95 kDa scaffolding protein that assembles signaling complexes at synapses. Over-expression of PSD-95 in primary hippocampal neurons selectively increases synaptic localization of AMPA receptors; however, mice lacking PSD-95 display grossly normal glutamatergic transmission in hippocampus. To further study the scaffolding role of PSD-95 at excitatory synapses, we generated a recombinant PSD-95-4c containing a tetracysteine motif, which specifically binds a fluorescein derivative and allows for acute and permanent inactivation of PSD-95. Interestingly, acute inactivation of PSD-95 in rat hippocampal cultures rapidly reduced surface AMPA receptor immunostaining, but did not affected NMDA or transferrin receptor localization. Acute photoinactivation of PSD-95 in dissociated neurons causes ∼80% decrease in GluR2 surface staining observed by live-cell microscopy within 15 minutes of PSD-95-4c ablation. These results confirm that PSD-95 stabilizes AMPA receptors at postsynaptic sites and provides insight into the dynamic interplay between PSD-95 and AMPA receptors in live neurons.

Plasticity of calcium-permeable AMPA glutamate receptors in Pro-opiomelanocortin neurons.

PubMed

Suyama, Shigetomo; Ralevski, Alexandra; Liu, Zhong-Wu; Dietrich, Marcelo O; Yada, Toshihiko; Simonds, Stephanie E; Cowley, Michael A; Gao, Xiao-Bing; Diano, Sabrina; Horvath, Tamas L

2017-08-01

POMC neurons integrate metabolic signals from the periphery. Here, we show in mice that food deprivation induces a linear current-voltage relationship of AMPAR-mediated excitatory postsynaptic currents (EPSCs) in POMC neurons. Inhibition of EPSCs by IEM-1460, an antagonist of calcium-permeable (Cp) AMPARs, diminished EPSC amplitude in the fed but not in the fasted state, suggesting entry of GluR2 subunits into the AMPA receptor complex during food deprivation. Accordingly, removal of extracellular calcium from ACSF decreased the amplitude of mEPSCs in the fed but not the fasted state. Ten days of high-fat diet exposure, which was accompanied by elevated leptin levels and increased POMC neuronal activity, resulted in increased expression of Cp-AMPARs on POMC neurons. Altogether, our results show that entry of calcium via Cp-AMPARs is inherent to activation of POMC neurons, which may underlie a vulnerability of these neurons to calcium overload while activated in a sustained manner during over-nutrition.

N-MYC down-regulated-like proteins regulate meristem initiation by modulating auxin transport and MAX2 expression.

PubMed

Mudgil, Yashwanti; Ghawana, Sanjay; Jones, Alan M

2013-01-01

N-MYC down-regulated-like (NDL) proteins interact with the Gβ subunit (AGB1) of the heterotrimeric G protein complex and play an important role in AGB1-dependent regulation of lateral root formation by affecting root auxin transport, auxin gradients and the steady-state levels of mRNA encoding the PIN-FORMED 2 and AUXIN 1 auxin transport facilitators. Auxin transport in aerial tissue follows different paths and utilizes different transporters than in roots; therefore, in the present study, we analyzed whether NDL proteins play an important role in AGB1-dependent, auxin-mediated meristem development. Expression levels of NDL gene family members need to be tightly regulated, and altered expression (both over-expression and down-regulation) confers ectopic growth. Over-expression of NDL1 disrupts vegetative and reproductive organ development. Reduced expression of the NDL gene family members results in asymmetric leaf emergence, twinning of rosette leaves, defects in leaf formation, and abnormal silique distribution. Reduced expression of the NDL genes in the agb1-2 (null allele) mutant rescues some of the abnormal phenotypes, such as silique morphology, silique distribution, and peduncle angle, suggesting that proper levels of NDL proteins are maintained by AGB1. We found that all of these abnormal aerial phenotypes due to altered NDL expression were associated with increases in basipetal auxin transport, altered auxin maxima and altered MAX2 expression within the inflorescence stem. NDL proteins, together with AGB1, act as positive regulators of meristem initiation and branching. AGB1 and NDL1 positively regulate basipetal inflorescence auxin transport and modulate MAX2 expression in shoots, which in turn regulates organ and lateral meristem formation by the establishment and maintenance of auxin gradients.

N-MYC DOWN-REGULATED-LIKE Proteins Regulate Meristem Initiation by Modulating Auxin Transport and MAX2 Expression

PubMed Central

Mudgil, Yashwanti; Ghawana, Sanjay; Jones, Alan M.

2013-01-01

Background N-MYC DOWN-REGULATED-LIKE (NDL) proteins interact with the Gβ subunit (AGB1) of the heterotrimeric G protein complex and play an important role in AGB1-dependent regulation of lateral root formation by affecting root auxin transport, auxin gradients and the steady-state levels of mRNA encoding the PIN-FORMED 2 and AUXIN 1 auxin transport facilitators. Auxin transport in aerial tissue follows different paths and utilizes different transporters than in roots; therefore, in the present study, we analyzed whether NDL proteins play an important role in AGB1-dependent, auxin-mediated meristem development. Methodology/Principal Findings Expression levels of NDL gene family members need to be tightly regulated, and altered expression (both over-expression and down-regulation) confers ectopic growth. Over-expression of NDL1 disrupts vegetative and reproductive organ development. Reduced expression of the NDL gene family members results in asymmetric leaf emergence, twinning of rosette leaves, defects in leaf formation, and abnormal silique distribution. Reduced expression of the NDL genes in the agb1-2 (null allele) mutant rescues some of the abnormal phenotypes, such as silique morphology, silique distribution, and peduncle angle, suggesting that proper levels of NDL proteins are maintained by AGB1. We found that all of these abnormal aerial phenotypes due to altered NDL expression were associated with increases in basipetal auxin transport, altered auxin maxima and altered MAX2 expression within the inflorescence stem. Conclusion/Significance NDL proteins, together with AGB1, act as positive regulators of meristem initiation and branching. AGB1 and NDL1 positively regulate basipetal inflorescence auxin transport and modulate MAX2 expression in shoots, which in turn regulates organ and lateral meristem formation by the establishment and maintenance of auxin gradients. PMID:24223735

Genetic Validation of Aminoacyl-tRNA Synthetases as Drug Targets in Trypanosoma brucei

PubMed Central

Kalidas, Savitha; Cestari, Igor; Monnerat, Severine; Li, Qiong; Regmi, Sandesh; Hasle, Nicholas; Labaied, Mehdi; Parsons, Marilyn; Stuart, Kenneth

2014-01-01

Human African trypanosomiasis (HAT) is an important public health threat in sub-Saharan Africa. Current drugs are unsatisfactory, and new drugs are being sought. Few validated enzyme targets are available to support drug discovery efforts, so our goal was to obtain essentiality data on genes with proven utility as drug targets. Aminoacyl-tRNA synthetases (aaRSs) are known drug targets for bacterial and fungal pathogens and are required for protein synthesis. Here we survey the essentiality of eight Trypanosoma brucei aaRSs by RNA interference (RNAi) gene expression knockdown, covering an enzyme from each major aaRS class: valyl-tRNA synthetase (ValRS) (class Ia), tryptophanyl-tRNA synthetase (TrpRS-1) (class Ib), arginyl-tRNA synthetase (ArgRS) (class Ic), glutamyl-tRNA synthetase (GluRS) (class 1c), threonyl-tRNA synthetase (ThrRS) (class IIa), asparaginyl-tRNA synthetase (AsnRS) (class IIb), and phenylalanyl-tRNA synthetase (α and β) (PheRS) (class IIc). Knockdown of mRNA encoding these enzymes in T. brucei mammalian stage parasites showed that all were essential for parasite growth and survival in vitro. The reduced expression resulted in growth, morphological, cell cycle, and DNA content abnormalities. ThrRS was characterized in greater detail, showing that the purified recombinant enzyme displayed ThrRS activity and that the protein localized to both the cytosol and mitochondrion. Borrelidin, a known inhibitor of ThrRS, was an inhibitor of T. brucei ThrRS and showed antitrypanosomal activity. The data show that aaRSs are essential for T. brucei survival and are likely to be excellent targets for drug discovery efforts. PMID:24562907

Transcription regulation of the Saccharomyces cerevisiae PIS1 gene by inositol and the pleiotropic regulator, Ume6p.

PubMed

Jani, Niketa M; Lopes, John M

2008-12-01

In Saccharomyces cerevisiae, transcription of most of the phospholipid biosynthetic genes (e.g. INO1, CHO1, CHO2 and OPI3) is repressed by growth in the presence of inositol and choline and derepressed in their absence. This regulation requires the Ino2p and Ino4p activators and the Opi1p repressor. The PIS1 structural gene is required for the synthesis of the essential lipid phosphatidylinositol. Previous reports show that PIS1 expression is uncoupled from inositol/choline regulation, but is regulated by carbon source, hypoxia and zinc. However, in this study we found that the expression of PIS1 is induced twofold by inositol. This regulation did not require Ino2p and Ino4p, although Ino4p was required for full expression. Ino4p is a basic helix-loop-helix protein that requires a binding partner. Curiously, none of the other basic helix-loop-helix proteins affected PIS1 expression. Inositol induction did require another general regulator of phospholipid biosynthesis, Ume6p. Ume6p was found to be a positive regulator of PIS1 gene expression. Ume6p, and several associated factors, were required for inositol-mediated induction and chromatin immunoprecipitation analysis showed that Ume6p directly regulates PIS1 expression. Thus, we demonstrate novel regulation of the PIS1 gene by Ume6p.

Phenylbutyrate ameliorates cognitive deficit and reduces tau pathology in an Alzheimer's disease mouse model.

PubMed

Ricobaraza, Ana; Cuadrado-Tejedor, Mar; Pérez-Mediavilla, Alberto; Frechilla, Diana; Del Río, Joaquin; García-Osta, Ana

2009-06-01

Chromatin modification through histone acetylation is a molecular pathway involved in the regulation of transcription underlying memory storage. Sodium 4-phenylbutyrate (4-PBA) is a well-known histone deacetylase inhibitor, which increases gene transcription of a number of genes, and also exerts neuroprotective effects. In this study, we report that administration of 4-PBA reversed spatial learning and memory deficits in an established mouse model of Alzheimer's disease (AD) without altering beta-amyloid burden. We also observed that the phosphorylated form of tau was decreased in the AD mouse brain after 4-PBA treatment, an effect probably due to an increase in the inactive form of the glycogen synthase kinase 3beta (GSK3beta). Interestingly, we found a dramatic decrease in brain histone acetylation in the transgenic mice that may reflect an indirect transcriptional repression underlying memory impairment. The administration of 4-PBA restored brain histone acetylation levels and, as a most likely consequence, activated the transcription of synaptic plasticity markers such as the GluR1 subunit of the AMPA receptor, PSD95, and microtubule-associated protein-2. The results suggest that 4-PBA, a drug already approved for clinical use, may provide a novel approach for the treatment of AD.

Ethanol-mediated facilitation of AMPA receptor function in the dorsomedial striatum: implications for alcohol drinking behavior.

PubMed

Wang, Jun; Ben Hamida, Sami; Darcq, Emmanuel; Zhu, Wenheng; Gibb, Stuart L; Lanfranco, Maria Fe; Carnicella, Sebastien; Ron, Dorit

2012-10-24

We found previously that acute ex vivo as well as repeated cycles of in vivo ethanol exposure and withdrawal, including excessive voluntary consumption of ethanol, produces a long-lasting increase in the activity of NR2B-containing NMDA receptors (NR2B-NMDARs) in the dorsomedial striatum (DMS) of rats (Wang et al., 2010a). Activation of NMDARs is required for the induction of long-term potentiation (LTP) of AMPA receptor (AMPAR)-mediated synaptic response. We therefore examined whether the ethanol-mediated upregulation of NMDAR activity alters the induction of LTP in the DMS. We found that ex vivo acute exposure of striatal slices to, and withdrawal from, ethanol facilitates the induction of LTP in DMS neurons, which is abolished by the inhibition of NR2B-NMDARs. We also report that repeated systemic administration of ethanol causes an NR2B-NMDAR-dependent facilitation of LTP in the DMS. LTP is mediated by the insertion of AMPAR subunits into the synaptic membrane, and we found that repeated systemic administration of ethanol, as well as cycles of excessive ethanol consumption and withdrawal, produced a long-lasting increase in synaptic localization of the GluR1 and GluR2 subunits of AMPARs in the DMS. Importantly, we report that inhibition of AMPARs in the DMS attenuates operant self-administration of ethanol, but not of sucrose. Together, our data suggest that aberrant synaptic plasticity in the DMS induced by repeated cycles of ethanol exposure and withdrawal contributes to the molecular mechanisms underlying the development and/or maintenance of excessive ethanol consumption.

Segregation and Crosstalk of D1 Receptor-Mediated Activation of ERK in Striatal Medium Spiny Neurons upon Acute Administration of Psychostimulants

PubMed Central

Gutierrez-Arenas, Omar; Eriksson, Olivia; Hellgren Kotaleski, Jeanette

2014-01-01

The convergence of corticostriatal glutamate and dopamine from the midbrain in the striatal medium spiny neurons (MSN) triggers synaptic plasticity that underlies reinforcement learning and pathological conditions such as psychostimulant addiction. The increase in striatal dopamine produced by the acute administration of psychostimulants has been found to activate not only effectors of the AC5/cAMP/PKA signaling cascade such as GluR1, but also effectors of the NMDAR/Ca2+/RAS cascade such as ERK. The dopamine-triggered effects on both these cascades are mediated by D1R coupled to Golf but while the phosphorylation of GluR1 is affected by reductions in the available amount of Golf but not of D1R, the activation of ERK follows the opposite pattern. This segregation is puzzling considering that D1R-induced Golf activation monotonically increases with DA and that there is crosstalk from the AC5/cAMP/PKA cascade to the NMDAR/Ca2+/RAS cascade via a STEP (a tyrosine phosphatase). In this work, we developed a signaling model which accounts for this segregation based on the assumption that a common pool of D1R and Golf is distributed in two D1R/Golf signaling compartments. This model integrates a relatively large amount of experimental data for neurons in vivo and in vitro. We used it to explore the crosstalk topologies under which the sensitivities of the AC5/cAMP/PKA signaling cascade to reductions in D1R or Golf are transferred or not to the activation of ERK. We found that the sequestration of STEP by its substrate ERK together with the insensitivity of STEP activity on targets upstream of ERK (i.e. Fyn and NR2B) to PKA phosphorylation are able to explain the experimentally observed segregation. This model provides a quantitative framework for simulation based experiments to study signaling required for long term potentiation in MSNs. PMID:24499932

Regulation of the expression of plant resistance gene SNC1 by a protein with a conserved BAT2 domain.

PubMed

Li, Yingzhong; Tessaro, Mark J; Li, Xin; Zhang, Yuelin

2010-07-01

Plant Resistance (R) genes encode immune receptors that recognize pathogens and activate defense responses. Because of fitness costs associated with maintaining R protein-mediated resistance, expression levels of R genes have to be tightly regulated. However, mechanisms on how R-gene expression is regulated are poorly understood. Here we show that MODIFIER OF snc1, 1 (MOS1) regulates the expression of SUPPRESSOR OF npr1-1, CONSTITUTIVE1 (SNC1), which encodes a Toll/interleukin receptor-nucleotide binding site-leucine-rich repeat type of R protein in Arabidopsis (Arabidopsis thaliana). In the mos1 loss-of-function mutant plants, snc1 expression is repressed and constitutive resistance responses mediated by snc1 are lost. The repression of snc1 expression in mos1 is released by knocking out DECREASE IN DNA METHYLATION1. In mos1 mutants, DNA methylation in a region upstream of SNC1 is altered. Furthermore, expression of snc1 transgenes using the native promoter does not require MOS1, indicating that regulation of SNC1 expression by MOS1 is at the chromatin level. Map-based cloning of MOS1 revealed that it encodes a novel protein with a HLA-B ASSOCIATED TRANSCRIPT2 (BAT2) domain that is conserved in plants and animals. Our study on MOS1 suggests that BAT2 domain-containing proteins may function in regulation of gene expression at chromatin level.

T1R3 and gustducin in gut sense sugars to regulate expression of Na+-glucose cotransporter 1.

PubMed

Margolskee, Robert F; Dyer, Jane; Kokrashvili, Zaza; Salmon, Kieron S H; Ilegems, Erwin; Daly, Kristian; Maillet, Emeline L; Ninomiya, Yuzo; Mosinger, Bedrich; Shirazi-Beechey, Soraya P

2007-09-18

Dietary sugars are transported from the intestinal lumen into absorptive enterocytes by the sodium-dependent glucose transporter isoform 1 (SGLT1). Regulation of this protein is important for the provision of glucose to the body and avoidance of intestinal malabsorption. Although expression of SGLT1 is regulated by luminal monosaccharides, the luminal glucose sensor mediating this process was unknown. Here, we show that the sweet taste receptor subunit T1R3 and the taste G protein gustducin, expressed in enteroendocrine cells, underlie intestinal sugar sensing and regulation of SGLT1 mRNA and protein. Dietary sugar and artificial sweeteners increased SGLT1 mRNA and protein expression, and glucose absorptive capacity in wild-type mice, but not in knockout mice lacking T1R3 or alpha-gustducin. Artificial sweeteners, acting on sweet taste receptors expressed on enteroendocrine GLUTag cells, stimulated secretion of gut hormones implicated in SGLT1 up-regulation. Gut-expressed taste signaling elements involved in regulating SGLT1 expression could provide novel therapeutic targets for modulating the gut's capacity to absorb sugars, with implications for the prevention and/or treatment of malabsorption syndromes and diet-related disorders including diabetes and obesity.

Identification of YB-1 as a regulator of PTP1B expression: implications for regulation of insulin and cytokine signaling

PubMed Central

Fukada, Toshiyuki; Tonks, Nicholas K.

2003-01-01

Changes in expression of PTP1B, the prototypic protein tyrosine phosphatase, have been associated with various human diseases; however, the mechanisms by which PTP1B expression is regulated have not been defined. We have identified an enhancer sequence within the PTP1B promoter which serves as a binding site for the transcription factor Y box-binding protein-1 (YB-1). Overexpression of YB-1 resulted in increased levels of PTP1B. Furthermore, depletion of YB-1 protein, by expression of a specific antisense construct, led to an ∼70% decrease in expression of PTP1B, but no change in the level of its closest relative, TC-PTP. Expression of antisense YB-1 resulted in increased sensitivity to insulin and enhanced signaling through the cytokine receptor gp130, which was suppressed by re-expression of PTP1B. Finally, we observed a correlation between the expression of PTP1B and that of YB-1 in cancer cell lines and an animal model of type II diabetes. Our data reveal an important role for YB-1 as a regulator of PTP1B expression, and further highlight PTP1B as a critical regulator of insulin- and cytokine-mediated signal transduction. PMID:12554649

Regulation of SFRP-1 expression in the rat dental follicle.

PubMed

Liu, Dawen; Yao, Shaomian; Wise, Gary E

2012-01-01

Tooth eruption requires osteoclastogenesis and subsequent bone resorption. Secreted frizzled-related protein-1 (SFRP-1) negatively regulates osteoclastogenesis. Our previous studies indicated that SFRP-1 is expressed in the rat dental follicle (DF), with reduced expression at days 3 and 9 close to the times for the major and minor bursts of osteoclastogenesis, respectively; but it remains unclear as to what molecules contribute to its reduced expression at these critical times. Thus, it was the aim of this study to determine which molecules regulate the expression of SFRP-1 in the DF. To that end, the DF cells were treated with cytokines that are maximally expressed at days 3 or 9, and SFRP-1 expression was determined. Our study indicated that colony-stimulating factor-1 (CSF-1), a molecule maximally expressed in the DF at day 3, down-regulated SFRP-1 expression. As to endothelial monocyte-activating polypeptide II (EMAP-II), a highly expressed molecule in the DF at day 3, it had no effect on the expression of SFRP-1. However, when EMAP-II was knocked down by siRNA, the expression of SFRP-1 was elevated, and this elevated SFRP-1 expression could be reduced by adding recombinant EMAP-II protein. This suggests that EMAP-II maintained a lower level of SFRP-1 in the DF. TNF-α is a molecule maximally expressed at day 9, and this study indicated that it also down-regulated the expression of SFRP-1 in the DF cells. In conclusion, CSF-1 and EMAP-II may contribute to the reduced SFRP-1 expression seen on day 3, while TNF-α may contribute to the reduced SFRP-1 expression at day 9.

Maturation profile of inferior olivary neurons expressing ionotropic glutamate receptors in rats: role in coding linear accelerations.

PubMed

Li, Chuan; Han, Lei; Ma, Chun-Wai; Lai, Suk-King; Lai, Chun-Hong; Shum, Daisy Kwok Yan; Chan, Ying-Shing

2013-07-01

Using sinusoidal oscillations of linear acceleration along both the horizontal and vertical planes to stimulate otolith organs in the inner ear, we charted the postnatal time at which responsive neurons in the rat inferior olive (IO) first showed Fos expression, an indicator of neuronal recruitment into the otolith circuit. Neurons in subnucleus dorsomedial cell column (DMCC) were activated by vertical stimulation as early as P9 and by horizontal (interaural) stimulation as early as P11. By P13, neurons in the β subnucleus of IO (IOβ) became responsive to horizontal stimulation along the interaural and antero-posterior directions. By P21, neurons in the rostral IOβ became also responsive to vertical stimulation, but those in the caudal IOβ remained responsive only to horizontal stimulation. Nearly all functionally activated neurons in DMCC and IOβ were immunopositive for the NR1 subunit of the NMDA receptor and the GluR2/3 subunit of the AMPA receptor. In situ hybridization studies further indicated abundant mRNA signals of the glutamate receptor subunits by the end of the second postnatal week. This is reinforced by whole-cell patch-clamp data in which glutamate receptor-mediated miniature excitatory postsynaptic currents of rostral IOβ neurons showed postnatal increase in amplitude, reaching the adult level by P14. Further, these neurons exhibited subthreshold oscillations in membrane potential as from P14. Taken together, our results support that ionotropic glutamate receptors in the IO enable postnatal coding of gravity-related information and that the rostral IOβ is the only IO subnucleus that encodes spatial orientations in 3-D.

A possible regulatory link between Twist 1 and PPARγ gene regulation in 3T3-L1 adipocytes.

PubMed

Ren, Rui; Chen, Zhufeng; Zhao, Xia; Sun, Tao; Zhang, Yuchao; Chen, Jie; Lu, Sumei; Ma, Wanshan

2016-11-08

Peroxisome proliferator-activated receptor γ (PPARγ) is a critical gene that regulates the function of adipocytes. Therefore, studies on the molecular regulation mechanism of PPARγ are important to understand the function of adipose tissue. Twist 1 is another important functional gene in adipose tissue, and hundreds of genes are regulated by Twist 1. The aim of this study was to investigate the regulation of Twist 1 and PPARγ expression in 3T3-L1 mature adipocytes. We induced differentiation in 3T3-L1 preadipocytes and examined alterations in Twist 1 and PPARγ expression. We used the PPARγ agonist pioglitazone and the PPARγ antagonist T0070907 to investigate the effect of PPARγ on Twist 1 expression. In addition, we utilized retroviral interference and overexpression of Twist 1 to determine the effects of Twist 1 on PPARγ expression. The expression levels of Twist 1 and PPARγ were induced during differentiation in 3T3-L1 adipocytes. Application of either a PPARγ agonist (pioglitazone) or antagonist (T0070907) influenced Twist 1 expression, with up-regulation of Twist 1 under pioglitazone (1 μM, 24 h) and down-regulation of Twist 1 under T0070907 (100 μM, 24 h) exposure. Furthermore, the retroviral interference of Twist 1 decreased the protein and mRNA expression of PPARγ, while Twist 1 overexpression had the opposite effect. There was a possible regulatory link between Twist 1 and PPARγ in 3T3-L1 mature adipocytes. This regulatory link enhanced the regulation of PPARγ and may be a functional mechanism of Twist 1 regulation of adipocyte physiology and pathology.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Zhijie; Jiang, Hequn; Liu, Ying

MicroRNAs (miRNAs) are a class of small non-coding RNAs that function as critical gene regulators by targeting mRNAs for translational repression or degradation. In this study, we showed that the expression level of miR-133b was decreased, while Sirt1 mRNA expression levels were increased in hepatocellular carcinoma (HCC) and cell lines, and we identified Sirt1 as a novel direct target of miR-133b. The over-expression of miR-133b suppressed Sirt1 expression. In addition, miR-133b over-expression resulted in attenuating HCC cell proliferation and invasion together with apoptosis increase in vitro. HepG2 cell transplantation revealed that up-regulation of miR-133b could inhibit HCC tumor genesis inmore » vivo. Forced expression of Sirt1 partly rescued the effect of miR-133b in vitro. Furthermore, our study showed that miR-133b over-expression or Sirt1 down-regulation elevated E-cadherin expression, and repressed glypican-3 (GPC3) and the anti-apoptotic proteins (Bcl-2, Bcl-xL, and Mcl-1) expression. The inhibition of GPC3 expression repressed Bcl-2, Bcl-xL, and Mcl-1 expression, and elevated E-cadherin expression. Moreover, the Sirt1 up-regulation resulted in increases in HCC cell proliferation and invasion together with decreases apoptosis, and increases in the cytosolic accumulation and nuclear translocation of the transcription factor β-catenin in vitro. But the effect of Sirt1 up-regulation was partly reversed by GPC3 down-regulation in vitro. Taken together, these findings provide insight into the role and mechanism of miR-133b in regulating HCC cell proliferation, invasion and apoptosis via the miR-133b/Sirt1/GPC3/Wnt β-catenin axis, and miR-133b may serve as a potential therapeutic target in HCC in the future. - Highlights: • Sirt1 is a direct target of miR-133b in HCC. • miR-133b over-expression suppresses HCC progression in vitro and in vivo. • Sirt1 restoration reverses the effect of miR-133b over-expression on HCC cells. • GPC3 down-regulation reverses the effect of Sirt1 up-regulation on HCC cells. • Sirt1 activates Wnt β-catenin signaling by GPC3 in vitro.« less

FoxM1 Promotes Glioma Cells Progression by Up-Regulating Anxa1 Expression

PubMed Central

Cheng, Shi-Xiang; Tu, Yue; Zhang, Sai

2013-01-01

Forkhead box M1 (FoxM1) is a member of the forkhead transcription factor family and is overexpression in malignant gliomas. However, the molecular mechanisms by which FoxM1lead to glioma carcinogenesis and progression are still not well known. In the present study, we show that Anxa1 was overexpression in gliomas and predicted the poor outcome. Furthermore, Anxa1 closely related to the FoxM1 expression and was a direct transcriptional target of FoxM1. Overexpression of FoxM1 up-regulated Anxa1 expression, whereas suppression of FoxM1 expression down-regulated Anxa1 expression in glioma cells. Finally, FoxM1 enhanced the proliferation, migration, and angiogenesis in Anxa1-dependent manner both in vitro and in vivo. Our findings provide both clinical and mechanistic evidences that FoxM1 contributes to glioma development by directly up-regulating Anxa1 expression. PMID:23991102

Antinociceptive effects of MSVIII-19, a functional antagonist of the GluK1 kainate receptor

PubMed Central

Qiu, Chang-Shen; Wyhe, Leanne Lash-Van; Sasaki, Makoto; Sakai, Ryuichi; Swanson, Geoffrey T.; Gereau, Robert W.

2011-01-01

The ionotropic glutamate receptor subunit, GluK1 (GluR5), is expressed in many regions of nervous system related to sensory transmission. Recently, a selective ligand for the GluK1 receptor, MSVIII-19 (8,9-dideoxy-neodysiherbaine), was synthesized as a derivative of dysiherbaine, a toxin isolated from the marine sponge Lendenfeldia chodrodes. MSVIII-19 potently desensitizes GluK1 receptors without channel activation, rendering it useful as a functional antagonist. Given the high selectivity for GluK1 and the proposed role for this glutamate receptor in nociception, we sought to test the analgesic potential of MSVIII-19 in a series of models of inflammatory, neuropathic, and visceral pain in mice. MSVIII-19 delivered intrathecally (i.t.) dose-dependently reduced formalin-induced spontaneous behaviors and reduced thermal hypersensitivity 3 hours after formalin injection and 24 hours after complete freund’s adjuvant-induced inflammation, but had no effect on mechanical sensitivity in the same models. I.T. MSVIII-19 significantly reduced both thermal hyperalgesia and mechanical hypersensitivity in the chronic constriction injury model of neuropathic pain, but had no effect in the acetic acid model of visceral pain. Peripheral administration of MSVIII-19 had no analgesic efficacy in any of these models. Finally, i.t. MSVIII-19 did not alter responses in tail flick tests or performance on the accelerating RotaRod. These data suggest that spinal administration of MSVIII-19 reverses hypersensitivity in several models of pain in mice, supporting the clinical potential of GluK1 antagonists for the management of pain. PMID:21324591

EFFECT OF HYPOXIA ON THE EXPRESSION OF GENES THAT ENCODE SOME IGFBP AND CCN PROTEINS IN U87 GLIOMA CELLS DEPENDS ON IRE1 SIGNALING.

PubMed

Minchenko, O H; Kharkova, A P; Minchenko, D O; Karbovskyi, L L

2015-01-01

We have studied hypoxic regulation of the expression of different insulin-like growth factor binding protein genes in U87 glioma cells in relation to inhibition of IRE1 (inositol requiring enzyme-1), a central mediator of endoplasmic reticulum stress, which controls cell proliferation and tumor growth. We have demonstrated that hypoxia leads to up-regulation of the expression of IGFBP6, IGFBP7, IGFBP10/CYR61, WISP1, and WISP2 genes and down-regulation--of IGFBP9/NOV gene at the mRNA level in control glioma cells, being more signifcant changes for IGFBP10/CYR61 and WISP2 genes. At the same time, inhibition of IRE1 modifies the effect of hypoxia on the expression of all studied genes: eliminates sensitivity to hypoxia the expression of IGFBP7 and IGFBP9/NOV genes, suppresses effect of hypoxia on IGFBP6, IGFBP10/CYR61, and WISP2 genes, and slightly enhances hypoxic regulation of WISP1 gene expression in glioma cells. We have also demonstrated that the expression of all studied genes in glioma cells is regulated by IRE1 signaling enzyme upon normoxic condition, because inhibition of IRE1 significantly up-regulates IGFBP7, IGFBP10/CYR61, WISP1, and WISP2 genes and down-regulates IGFBP6 and IGFBP9/NOV genes as compared to control glioma cells. The present study demonstrates that hypoxia, which contributes to tumor growth, affects all studied IGFBP and WISP gene expressions and that inhibition of IRE1 preferentially abolishes or suppresses the hypoxic regulation of these gene expressions and thus possibly contributes to slower glioma growth. Moreover, inhibition of IRE1, which correlates with suppression of cell proliferation and glioma growth, is down-regulated expression of pro-proliferative IGFBP genes, attesting to the fact that endoplasmic reticulum stress is a necessary component of malignant tumor growth.

SUMO-Specific Cysteine Protease 1 Promotes Epithelial Mesenchymal Transition of Prostate Cancer Cells via Regulating SMAD4 deSUMOylation.

PubMed

Zhang, Xiaoyan; Wang, Hao; Wang, Hua; Xiao, Fengjun; Seth, Prem; Xu, Weidong; Jia, Qinghua; Wu, Chutse; Yang, Yuefeng; Wang, Lisheng

2017-04-12

In advanced prostate cancer, small ubiquitin-like modifier (SUMO)-specific cysteine protease 1 (SENP1) is up-regulated. However, the role of SENP1 in regulating deSUMOylation of TGF-β/SMADs signaling is unknown. In this study, we developed a lentiviral vector, PLKO.1-shSENP1, to silence SENP1 in prostate cancer cells with high metastatic characteristics (PC3M). Likewise, we also created an adenovirus vector, Ad5/F11p-SENP1 to over-express SENP1 in prostate cancer cells with low metastatic potential (LNCaP). We showed that silencing of SENP1 promoted cellular apoptosis, and inhibited proliferation and migration of PC3M cells. Moreover, SENP1 silencing increased the SMAD4 expression at protein level, up-regulated E-cadherin and down-regulated Vimentin expression, indicating the inhibition of epithelial mesenchymal transition (EMT). Furthermore, SMAD4 interference abolished SENP1-mediated up-regulation of E-cadherin, suggesting that SENP1 regulated E-cadherin expression via SMAD4. SENP1 over-expression in LNCaP cells reduced SMAD4 protein, and promoted EMT via decreasing E-cadherin and increasing Vimentin. Moreover, down-regulation of SMAD4 and E-cadherin were blocked, after transfection with two SUMOylation sites mutated SMAD4, suggesting that SENP1 might reduce SMAD4 levels to regulate E-cadherin expression via deSUMOylation of SMAD4. In conclusion, SENP1 deSUMOylated SMAD4 to promote EMT via up-regulating E-cadherin in prostate cancer cells. Therefore, SENP1 is a potential target for treatment of advanced prostate cancer.

Pim1 kinase regulates c-Kit gene translation.

PubMed

An, Ningfei; Cen, Bo; Cai, Houjian; Song, Jin H; Kraft, Andrew; Kang, Yubin

2016-01-01

Receptor tyrosine kinase, c-Kit (CD117) plays a pivotal role in the maintenance and expansion of hematopoietic stem/progenitor cells (HSPCs). Additionally, over-expression and/or mutational activation of c-Kit have been implicated in numerous malignant diseases including acute myeloid leukemia. However, the translational regulation of c-Kit expression remains largely unknown. We demonstrated that loss of Pim1 led to specific down-regulation of c-Kit expression in HSPCs of Pim1 -/- mice and Pim1 -/- 2 -/- 3 -/- triple knockout (TKO) mice, and resulted in attenuated ERK and STAT3 signaling in response to stimulation with stem cell factor. Transduction of c-Kit restored the defects in colony forming capacity seen in HSPCs from Pim1 -/- and TKO mice. Pharmacologic inhibition and genetic modification studies using human megakaryoblastic leukemia cells confirmed the regulation of c-Kit expression by Pim1 kinase: i.e., Pim1-specific shRNA knockdown down-regulated the expression of c-Kit whereas overexpression of Pim1 up-regulated the expression of c-Kit. Mechanistically, inhibition or knockout of Pim1 kinase did not affect the transcription of c-Kit gene. Pim1 kinase enhanced c-Kit 35 S methionine labeling and increased the incorporation of c-Kit mRNAs into the polysomes and monosomes, demonstrating that Pim1 kinase regulates c-Kit expression at the translational level. Our study provides the first evidence that Pim1 regulates c-Kit gene translation and has important implications in hematopoietic stem cell transplantation and cancer treatment.

Hypoxic regulation of the expression of cell proliferation related genes in U87 glioma cells upon inhibition of ire1 signaling enzyme

PubMed

Minchenko, O H; Tsymbal, D O; Minchenko, D O; Riabovol, O O; Ratushna, O O; Karbovskyi, L L

2016-01-01

We have studied the effect of inhibition of IRE1 (inositol requiring enzyme 1), which is a central mediator of endoplasmic reticulum stress and a controller of cell proliferation and tumor growth, on hypoxic regulation of the expression of different proliferation related genes in U87 glioma cells. It was shown that hypoxia leads to up-regulation of the expression of IL13RA2, CD24, ING1, ING2, ENDOG, and POLG genes and to down-regulation – of KRT18, TRAPPC3, TSFM, and MTIF2 genes at the mRNA level in control glioma cells. Changes for ING1 and CD24 genes were more significant. At the same time, inhibition of IRE1 modifies the effect of hypoxia on the expression of all studied genes. In particular, it increases sensitivity to hypoxia of the expression of IL13RA2, TRAPPC3, ENDOG, and PLOG genes and suppresses the effect of hypoxia on the expression of ING1 gene. Additionally, it eliminates hypoxic regulation of KRT18, CD24, ING2, TSFM, and MTIF2 genes expressions and introduces sensitivity to hypoxia of the expression of BET1 gene in glioma cells. The present study demonstrates that hypoxia, which often contributes to tumor growth, affects the expression of almost all studied genes. Additionally, inhibition of IRE1 can both enhance and suppress the hypoxic regulation of these gene expressions in a gene specific manner and thus possibly contributes to slower glioma growth, but several aspects of this regulation must be further clarified.

Cyclic stretch-induced the cytoskeleton rearrangement and gene expression of cytoskeletal regulators in human periodontal ligament cells.

PubMed

Wu, Yaqin; Zhuang, Jiabao; Zhao, Dan; Zhang, Fuqiang; Ma, Jiayin; Xu, Chun

2017-10-01

This study aimed to explore the mechanism of the stretch-induced cell realignment and cytoskeletal rearrangement by identifying several mechanoresponsive genes related to cytoskeletal regulators in human PDL cells. After the cells were stretched by 1, 10 and 20% strains for 0.5, 1, 2, 4, 6, 12 or 24 h, the changes of the morphology and content of microfilaments were recorded and calculated. Meanwhile, the expression of 84 key genes encoding cytoskeletal regulators after 6 and 24 h stretches with 20% strain was detected by using real-time PCR array. Western blot was applied to identify the protein expression level of several cytoskeletal regulators encoded by these differentially expressed genes. The confocal fluorescent staining results confirmed that stretch-induced realignment of cells and rearrangement of microfilaments. Among the 84 genes screened, one gene was up-regulated while two genes were down-regulated after 6 h stretch. Meanwhile, three genes were up-regulated while two genes were down-regulated after 24 h stretch. These genes displaying differential expression included genes regulating polymerization/depolymerization of microfilaments (CDC42EP2, FNBP1L, NCK2, PIKFYVE, WASL), polymerization/depolymerization of microtubules (STMN1), interacting between microfilaments and microtubules (MACF1), as well as a phosphatase (PPP1R12B). Among the proteins encoded by these genes, the protein expression level of Cdc42 effector protein-2 (encoded by CDC42EP2) and Stathmin-1 (encoded by STMN1) was down-regulated, while the protein expression level of N-WASP (encoded by WASL) was up-regulated. The present study confirmed the cyclic stretch-induced cellular realignment and rearrangement of microfilaments in the human PDL cells and indicated several force-sensitive genes with regard to cytoskeletal regulators.

Estrogens regulate the expression of NHERF1 in normal colon during the reproductive cycle of Wistar rats.

PubMed

Cuello-Carrión, F Darío; Troncoso, Mariana; Guiñazu, Elina; Valdez, Susana R; Fanelli, Mariel A; Ciocca, Daniel R; Kreimann, Erica L

2010-12-01

In breast cancer cell lines, the Na(+)/H(+) exchanger regulator factor 1 (NHERF1) gene is regulated at the transcriptional level by estrogens, the protein expression levels correlate with the presence of estrogen receptors and the effect is blocked by anti-estrogens. However, there is limited information regarding the regulation of NHERF1 by estrogens in normal colon tissue. The NHERF1 protein has an important role in the maintenance of the intestine ultrastructure. NHERF1-deficient mice showed defects in the intestinal microvilli as well as molecular alterations in brush border membrane proteins. Here, we have studied the expression of NHERF1 in normal rat colon and uterus during the reproductive cycle of Wistar rats. We found that NHERF1 expression in rat colon during the estral cycle is modified by estrogen levels: higher expression of NHERF1 was observed during the proestrous and estrous stages and lower expression in diestrous 1 when estrogen levels decreased. In uterus, NHERF1 was expressed in the apical region of the luminal epithelium and glands in all stages of the estral cycle, and in both colon and uterus, the expression was independent of the proliferation status. Our results show that NHERF1 expression is regulated by estrogens in colon during the rat estral cycle.

Pituitary adenylyl cyclase-activating polypeptide (PACAP) and its receptor (PAC1-R) are positioned to modulate afferent signaling in the cochlea.

PubMed

Drescher, M J; Drescher, D G; Khan, K M; Hatfield, J S; Ramakrishnan, N A; Abu-Hamdan, M D; Lemonnier, L A

2006-09-29

Pituitary adenylyl cyclase-activating polypeptide (PACAP), via its specific receptor pituitary adenylyl cyclase-activating polypeptide receptor 1 (PAC1-R), is known to have roles in neuromodulation and neuroprotection associated with glutamatergic and cholinergic neurotransmission, which, respectively, are believed to form the primary basis for afferent and efferent signaling in the organ of Corti. Previously, we identified transcripts for PACAP preprotein and multiple splice variants of its receptor, PAC1-R, in microdissected cochlear subfractions. In the present work, neural localizations of PACAP and PAC1-R within the organ of Corti and spiral ganglion were examined, defining sites of PACAP action. Immunolocalization of PACAP and PAC1-R in the organ of Corti and spiral ganglion was compared with immunolocalization of choline acetyltransferase (ChAT) and synaptophysin as efferent neuronal markers, and glutamate receptor 2/3 (GluR2/3) and neurofilament 200 as afferent neuronal markers, for each of the three cochlear turns. Brightfield microscopy giving morphological detail for individual immunolocalizations was followed by immunofluorescence detection of co-localizations. PACAP was found to be co-localized with ChAT in nerve fibers of the intraganglionic spiral bundle and beneath the inner and outer hair cells within the organ of Corti. Further, evidence was obtained that PACAP is expressed in type I afferent axons leaving the spiral ganglion en route to the auditory nerve, potentially serving as a neuromodulator in axonal terminals. In contrast to the efferent localization of PACAP within the organ of Corti, PAC1-R immunoreactivity was co-localized with afferent dendritic neuronal marker GluR2/3 in nerve fibers passing beneath and lateral to the inner hair cell and in fibers at supranuclear and basal sites on outer hair cells. Given the known association of PACAP with catecholaminergic neurotransmission in sympathoadrenal function, we also re-examined the issue of whether the organ of Corti receives adrenergic innervation. We now demonstrate the existence of nerve fibers within the organ of Corti which are immunoreactive for the adrenergic marker dopamine beta-hydroxylase (DBH). DBH immunoreactivity was particularly prominent in nerve fibers both at the base and near the cuticular plate of outer hair cells of the apical turn, extending to the non-sensory Hensen's cell region. Evidence was obtained for limited co-localization of DBH with PAC1-R and PACAP. In the process of this investigation, we obtained evidence that efferent and afferent nerve fibers, in addition to adrenergic nerve fibers, are present at supranuclear sites on outer hair cells and distributed within the non-sensory epithelium of the apical cochlear turn for rat, based upon immunoreactivity for the corresponding neuronal markers. Overall, PACAP is hypothesized to act within the organ of Corti as an efferent neuromodulator of afferent signaling via PAC1-R that is present on type I afferent dendrites, in position to afford protection from excitotoxicity. Additionally, PACAP/PAC1-R may modulate secretion of catecholamines from adrenergic terminals within the organ of Corti.

Rescuing effects of RXR agonist bexarotene on aging-related synapse loss depend on neuronal LRP1.

PubMed

Tachibana, Masaya; Shinohara, Mitsuru; Yamazaki, Yu; Liu, Chia-Chen; Rogers, Justin; Bu, Guojun; Kanekiyo, Takahisa

2016-03-01

Apolipoprotein E (apoE) plays a critical role in maintaining synaptic integrity by transporting cholesterol to neurons through the low-density lipoprotein receptor related protein-1 (LRP1). Bexarotene, a retinoid X receptor (RXR) agonist, has been reported to have potential beneficial effects on cognition by increasing brain apoE levels and lipidation. To investigate the effects of bexarotene on aging-related synapse loss and the contribution of neuronal LRP1 to the pathway, forebrain neuron-specific LRP1 knockout (nLrp1(-/-)) and littermate control mice were administered with bexarotene-formulated diet (100mg/kg/day) or control diet at the age of 20-24 months for 8 weeks. Upon bexarotene treatment, levels of brain apoE and ATP-binding cassette sub-family A member 1 (ABCA1) were significantly increased in both mice. While levels of PSD95, glutamate receptor 1 (GluR1), and N-methyl-d-aspartate receptor NR1 subunit (NR1), which are key postsynaptic proteins that regulate synaptic plasticity, were decreased with aging, they were restored by bexarotene treatment in the brains of control but not nLrp1(-/-) mice. These results indicate that the beneficial effects of bexarotene on synaptic integrity depend on the presence of neuronal LRP1. However, we also found that bexarotene treatment led to the activation of glial cells, weight loss and hepatomegaly, which are likely due to hepatic failure. Taken together, our results demonstrate that apoE-targeted treatment through the RXR pathway has a potential beneficial effect on synapses during aging; however, the therapeutic application of bexarotene requires extreme caution due to its toxic side effects. Copyright © 2015 Elsevier Inc. All rights reserved.

The CYP2E1 inhibitor DDC up-regulates MMP-1 expression in hepatic stellate cells via an ERK1/2- and Akt-dependent mechanism.

PubMed

Liu, Tianhui; Wang, Ping; Cong, Min; Xu, Youqing; Jia, Jidong; You, Hong

2013-06-05

DDC (diethyldithiocarbamate) could block collagen synthesis in HSC (hepatic stellate cells) through the inhibition of ROS (reactive oxygen species) derived from hepatocyte CYP2E1 (cytochrome P450 2E1). However, the effect of DDC on MMP-1 (matrix metalloproteinase-1), which is the main collagen degrading matrix metalloproteinase, has not been reported. In co-culture experiments, we found that DDC significantly enhanced MMP-1 expression in human HSC (LX-2) that were cultured with hepatocyte C3A cells either expressing or not expressing CYP2E1. The levels of both proenzyme and active MMP-1 enzyme were up-regulated in LX-2 cells, accompanied by elevated enzyme activity of MMP-1 and decreased collagen I, in both LX-2 cells and the culture medium. H2O2 treatment abrogated DDC-induced MMP-1 up-regulation and collagen I decrease, while catalase treatment slightly up-regulated MMP-1 expression. These data suggested that the decrease in ROS by DDC was partially responsible for the MMP-1 up-regulation. ERK1/2 (extracellular signal-regulated kinase 1/2), Akt (protein kinase B) and p38 were significantly activated by DDC. The ERK1/2 inhibitor (U0126) and Akt inhibitor (T3830) abrogated the DDC-induced MMP-1 up-regulation. In addition, a p38 inhibitor (SB203580) improved MMP-1 up-regulation through the stimulation of ERK1/2. Our data indicate that DDC significantly up-regulates the expression of MMP-1 in LX-2 cells which results in greater MMP-1 enzyme activity and decreased collagen I. The enhancement of MMP-1 expression by DDC was associated with H2O2 inhibition and coordinated regulation by the ERK1/2 and Akt pathways. These data provide some new insights into treatment strategies for hepatic fibrosis.

The CYP2E1 inhibitor DDC up-regulates MMP-1 expression in hepatic stellate cells via an ERK1/2- and Akt-dependent mechanism

PubMed Central

Liu, Tianhui; Wang, Ping; Cong, Min; Xu, Youqing; Jia, Jidong; You, Hong

2013-01-01

DDC (diethyldithiocarbamate) could block collagen synthesis in HSC (hepatic stellate cells) through the inhibition of ROS (reactive oxygen species) derived from hepatocyte CYP2E1 (cytochrome P450 2E1). However, the effect of DDC on MMP-1 (matrix metalloproteinase-1), which is the main collagen degrading matrix metalloproteinase, has not been reported. In co-culture experiments, we found that DDC significantly enhanced MMP-1 expression in human HSC (LX-2) that were cultured with hepatocyte C3A cells either expressing or not expressing CYP2E1. The levels of both proenzyme and active MMP-1 enzyme were up-regulated in LX-2 cells, accompanied by elevated enzyme activity of MMP-1 and decreased collagen I, in both LX-2 cells and the culture medium. H2O2 treatment abrogated DDC-induced MMP-1 up-regulation and collagen I decrease, while catalase treatment slightly up-regulated MMP-1 expression. These data suggested that the decrease in ROS by DDC was partially responsible for the MMP-1 up-regulation. ERK1/2 (extracellular signal-regulated kinase 1/2), Akt (protein kinase B) and p38 were significantly activated by DDC. The ERK1/2 inhibitor (U0126) and Akt inhibitor (T3830) abrogated the DDC-induced MMP-1 up-regulation. In addition, a p38 inhibitor (SB203580) improved MMP-1 up-regulation through the stimulation of ERK1/2. Our data indicate that DDC significantly up-regulates the expression of MMP-1 in LX-2 cells which results in greater MMP-1 enzyme activity and decreased collagen I. The enhancement of MMP-1 expression by DDC was associated with H2O2 inhibition and coordinated regulation by the ERK1/2 and Akt pathways. These data provide some new insights into treatment strategies for hepatic fibrosis. PMID:23577625

HAT1 induces lung cancer cell apoptosis via up regulating Fas.

PubMed

Han, Na; Shi, Lei; Guo, Qiuyun; Sun, Wei; Yu, Yang; Yang, Li; Zhang, Xiaoxi; Zhang, Mengxian

2017-10-27

The dysfunction of apoptosis is one of the factors contributing to lung cancer (LC) growth. Histone acetyltransferase HAT1 can up regulate cell apoptosis. This study aims to investigate the mechanism by which HAT1 induces LC cell (LCC) apoptosis via up regulating the expression of Fas. In this study, the surgically removed human LC tissues were collected. LCCs were isolated from the LC tissues and analyzed for the expression of HAT1 and Fas by RT-qPCR and Western blotting. We observed that the expression of Fas was negatively correlated with PAR2 in LCCs. Activation of PAR2 suppressed the expression of Fas in normal lung epithelial cells. The expression of HAT1 was lower and positively correlated with Fas expression and negatively correlated with PAR2 expression in LCCs. Activation of PAR2 suppressed Fas expression in lung epithelial cells via inhibiting HAT1. Restoration of HAT1 expression restored Fas expression in LCCs and induced LCC apoptosis. In conclusion, less expression of HAT1 in LCCs was associated with the pathogenesis of LC. Up regulation of HAT1 expression in LCCs can induce LCCs apoptosis, which may be a potential novel therapy for the treatment of LC.

Expression of NLRR3 orphan receptor gene is negatively regulated by MYCN and Miz-1, and its downregulation is associated with unfavorable outcome in neuroblastoma.

PubMed

Akter, Jesmin; Takatori, Atsushi; Hossain, Md Shamim; Ozaki, Toshinori; Nakazawa, Atsuko; Ohira, Miki; Suenaga, Yusuke; Nakagawara, Akira

2011-11-01

Our previous study showed that expression of NLRR3 is significantly high in favorable neuroblastomas (NBL), whereas that of NLRR1 is significantly high in unfavorable NBLs. However, the molecular mechanism of transcriptional regulation of NLRR3 remains elusive. This study was undertaken to clarify the transcriptional regulation of NLRR3 and its association with the prognosis of NBL. NLRR3 and MYCN expressions in NBL cell lines were analyzed after induction of cell differentiation, MYCN knockdown, and overexpression. The transcriptional regulation of NLRR3 was analyzed by luciferase reporter and chromatin immunoprecipitation assays. Quantitative PCR was used for examining the expression of NLRR3, Miz-1, or MYCN in 87 primary NBLs. The expression of NLRR3 mRNA was upregulated during differentiation of NBL cells induced by retinoic acid, accompanied with reduced expression of MYCN, suggesting that NLRR3 expression was inversely correlated with MYCN in differentiation. Indeed, knockdown of MYCN induced NLRR3 expression, whereas exogenously expressed MYCN reduced cellular NLRR3 expression. We found that Miz-1 was highly expressed in favorable NBLs and NLRR3 was induced by Miz-1 expression in NBL cells. MYCN and Miz-1 complexes bound to NLRR3 promoter and showed a negative regulation of NLRR3 expression. In addition, a combination of low expression of NLRR3 and high expression of MYCN was highly associated with poor prognosis. NLRR3 is a direct target of MYCN, which associates with Miz-1 and negatively regulates NLRR3 expression. NLRR3 may play a role in NBL differentiation and the survival of NBL patients by inversely correlating with MYCN amplification. ©2011 AACR

Transgenic over-expression of YY1 induces pathologic cardiac hypertrophy in a sex-specific manner

PubMed Central

Stauffer, Brian L.; Dockstader, Karen; Russell, Gloria; Hijmans, Jamie; Walker, Lisa; Cecil, Mackenzie; Demos-Davies, Kimberly; Medway, Allen; McKinsey, Timothy A.; Sucharov, Carmen C.

2015-01-01

YY1 can activate or repress transcription of various genes. In cardiac myocytes in culture YY1 has been shown to regulate expression of several genes involved in myocyte pathology. YY1 can also acutely protect the heart against detrimental changes in gene expression. In this study we show that cardiac over-expression of YY1 induces pathologic cardiac hypertrophy in male mice, measured by changes in gene expression and lower ejection fraction/fractional shortening. In contrast, female animals are protected against pathologic gene expression changes and cardiac dysfunction. Furthermore, we show that YY1 regulates, in a sex-specific manner, the expression of mammalian enable (Mena), a factor that regulates cytoskeletal actin dynamics and whose expression is increased in several models of cardiac pathology, and that Mena expression in humans with heart failure is sex-dependent. Finally, we show that sex differences in YY1 expression are also observed in human heart failure. In summary, this is the first work to show that YY1 has a sex-specific effect in the regulation of cardiac pathology. PMID:25935483

AtMYB44 regulates WRKY70 expression and modulates antagonistic interaction between salicylic acid and jasmonic acid signaling.

PubMed

Shim, Jae Sung; Jung, Choonkyun; Lee, Sangjoon; Min, Kyunghun; Lee, Yin-Won; Choi, Yeonhee; Lee, Jong Seob; Song, Jong Tae; Kim, Ju-Kon; Choi, Yang Do

2013-02-01

The role of AtMYB44, an R2R3 MYB transcription factor, in signaling mediated by jasmonic acid (JA) and salicylic acid (SA) is examined. AtMYB44 is induced by JA through CORONATINE INSENSITIVE 1 (COI1). AtMYB44 over-expression down-regulated defense responses against the necrotrophic pathogen Alternaria brassicicola, but up-regulated WRKY70 and PR genes, leading to enhanced resistance to the biotrophic pathogen Pseudomonas syringae pv. tomato DC3000. The knockout mutant atmyb44 shows opposite effects. Induction of WRKY70 by SA is reduced in atmyb44 and npr1-1 mutants, and is totally abolished in atmyb44 npr1-1 double mutants, showing that WRKY70 is regulated independently through both NPR1 and AtMYB44. AtMYB44 over-expression does not change SA content, but AtMYB44 over-expression phenotypes, such as retarded growth, up-regulated PR1 and down-regulated PDF1.2 are reversed by SA depletion. The wrky70 mutation suppressed AtMYB44 over-expression phenotypes, including up-regulation of PR1 expression and down-regulation of PDF1.2 expression. β-estradiol-induced expression of AtMYB44 led to WRKY70 activation and thus PR1 activation. AtMYB44 binds to the WRKY70 promoter region, indicating that AtMYB44 acts as a transcriptional activator of WRKY70 by directly binding to a conserved sequence element in the WRKY70 promoter. These results demonstrate that AtMYB44 modulates antagonistic interaction by activating SA-mediated defenses and repressing JA-mediated defenses through direct control of WRKY70. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.

Protein-disulfide Isomerase Regulates the Thyroid Hormone Receptor-mediated Gene Expression via Redox Factor-1 through Thiol Reduction-Oxidation*

PubMed Central

Hashimoto, Shoko; Imaoka, Susumu

2013-01-01

Protein-disulfide isomerase (PDI) is a dithiol/disulfide oxidoreductase that regulates the redox state of proteins. We previously found that overexpression of PDI in rat pituitary tumor (GH3) cells suppresses 3,3′,5-triiodothyronine (T3)-stimulated growth hormone (GH) expression, suggesting the contribution of PDI to the T3-mediated gene expression via thyroid hormone receptor (TR). In the present study, we have clarified the mechanism of regulation by which TR function is regulated by PDI. Overexpression of wild-type but not redox-inactive mutant PDI suppressed the T3-induced GH expression, suggesting that the redox activity of PDI contributes to the suppression of GH. We considered that PDI regulates the redox state of the TR and focused on redox factor-1 (Ref-1) as a mediator of the redox regulation of TR by PDI. Interaction between Ref-1 and TRβ1 was detected. Overexpression of wild-type but not C64S Ref-1 facilitated the GH expression, suggesting that redox activity of Cys-64 in Ref-1 is involved in the TR-mediated gene expression. Moreover, PDI interacted with Ref-1 and changed the redox state of Ref-1, suggesting that PDI controls the redox state of Ref-1. Our studies suggested that Ref-1 contributes to TR-mediated gene expression and that the redox state of Ref-1 is regulated by PDI. Redox regulation of PDI via Ref-1 is a new aspect of PDI function. PMID:23148211

Polypyrimidine tract-binding protein 1-mediated down-regulation of ATG10 facilitates metastasis of colorectal cancer cells.

PubMed

Jo, Yoon Kyung; Roh, Seon Ae; Lee, Heejin; Park, Na Yeon; Choi, Eun Sun; Oh, Ju-Hee; Park, So Jung; Shin, Ji Hyun; Suh, Young-Ah; Lee, Eun Kyung; Cho, Dong-Hyung; Kim, Jin Cheon

2017-01-28

Autophagy plays complex roles in tumor initiation and development, and the expression of autophagy-related genes (ATGs) is differentially regulated in various cancer cells, depending on their environment. In this study, we analyzed the expressional relationship between polypyrimidine tract-binding protein 1 (PTBP1) and ATG10 in metastatic colorectal cancer. PTBP1 is associated with tumor metastasis in primary colorectal tumors and colorectal cancer liver metastasis (CLM) tissues. In addition, PTPB1 directly interacts with mRNA of ATG10, and regulates ATG10 expression level in colorectal cancer cells. Ectopic expression of PTBP1 decreased ATG10 expression, whereas down-regulation of PTBP1 increased ATG10 level. In contrast to PTBP1, expression of ATG10 was decreased in CLM tissues. Knock down of ATG10 promoted cell migration and invasion of colorectal cancer cells. Moreover, depletion of ATG10 modulated epithelial-mesenchymal transition-associated proteins in colorectal cancer cells: N-cadherin, TCF-8/ZEB1, and CD44 were up-regulated, whereas E-cadherin was down-regulated. Taken together, our findings suggest that expression of ATG10 negatively regulated by PTBP1 is associated with metastasis of colorectal cancer cells. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

SUMO-Specific Cysteine Protease 1 Promotes Epithelial Mesenchymal Transition of Prostate Cancer Cells via Regulating SMAD4 deSUMOylation

PubMed Central

Zhang, Xiaoyan; Wang, Hao; Wang, Hua; Xiao, Fengjun; Seth, Prem; Xu, Weidong; Jia, Qinghua; Wu, Chutse; Yang, Yuefeng; Wang, Lisheng

2017-01-01

In advanced prostate cancer, small ubiquitin-like modifier (SUMO)-specific cysteine protease 1 (SENP1) is up-regulated. However, the role of SENP1 in regulating deSUMOylation of TGF-β/SMADs signaling is unknown. In this study, we developed a lentiviral vector, PLKO.1-shSENP1, to silence SENP1 in prostate cancer cells with high metastatic characteristics (PC3M). Likewise, we also created an adenovirus vector, Ad5/F11p-SENP1 to over-express SENP1 in prostate cancer cells with low metastatic potential (LNCaP). We showed that silencing of SENP1 promoted cellular apoptosis, and inhibited proliferation and migration of PC3M cells. Moreover, SENP1 silencing increased the SMAD4 expression at protein level, up-regulated E-cadherin and down-regulated Vimentin expression, indicating the inhibition of epithelial mesenchymal transition (EMT). Furthermore, SMAD4 interference abolished SENP1-mediated up-regulation of E-cadherin, suggesting that SENP1 regulated E-cadherin expression via SMAD4. SENP1 over-expression in LNCaP cells reduced SMAD4 protein, and promoted EMT via decreasing E-cadherin and increasing Vimentin. Moreover, down-regulation of SMAD4 and E-cadherin were blocked, after transfection with two SUMOylation sites mutated SMAD4, suggesting that SENP1 might reduce SMAD4 levels to regulate E-cadherin expression via deSUMOylation of SMAD4. In conclusion, SENP1 deSUMOylated SMAD4 to promote EMT via up-regulating E-cadherin in prostate cancer cells. Therefore, SENP1 is a potential target for treatment of advanced prostate cancer. PMID:28417919

Testosterone Regulates NUCB2 mRNA Expression in Male Mouse Hypothalamus and Pituitary Gland

PubMed Central

Seon, Sojeong; Jeon, Daun; Kim, Heejeong; Chung, Yiwa; Choi, Narae; Yang, Hyunwon

2017-01-01

ABSTRACT Nesfatin-1/NUCB2 is known to take part in the control of the appetite and energy metabolism. Recently, many reports have shown nesfatin-1/NUCB2 expression and function in various organs. We previously demonstrated that nesfatin-1/NUCB2 expression level is higher in the pituitary gland compared to other organs and its expression is regulated by 17β-estradiol and progesterone secreted from the ovary. However, currently no data exist on the expression of nesfatin-1/NUCB2 and its regulation mechanism in the pituitary of male mouse. Therefore, we examined whether nesfatin-1/NUCB2 is expressed in the male mouse pituitary and if its expression is regulated by testosterone. As a result of PCR and western blotting, we found that a large amount of nesfatin-1/NUCB2 was expressed in the pituitary and hypothalamus. The NUCB2 mRNA expression level in the pituitary was decreased after castration, but not in the hypothalamus. In addition, its mRNA expression level in the pituitary was increased after testosterone treatment in the castrated mice, whereas, the expression level in the hypothalamus was significantly decreased after the treatment with testosterone. The in vitro experiment to elucidate the direct effect of testosterone on NUCB2 mRNA expression showed that NUCB2 mRNA expression was significantly decreased with testosterone in cultured hypothalamus tissue, but increased with testosterone in cultured pituitary gland. The present study demonstrated that nesfatin-1/NUCB2 was highly expressed in the male mouse pituitary and was regulated by testosterone. This data suggests that reproductive-endocrine regulation through hypothalamus-pituitary-testis axis may contribute to NUCB2 mRNA expression in the mouse hypothalamus and pituitary gland. PMID:28484746

Oxygen-glucose deprivation regulates BACE1 expression through induction of autophagy in Neuro-2a/APP695 cells

PubMed Central

Chen, Rong-fu; Zhang, Ting; Sun, Yin-yi; Sun, Ya-meng; Chen, Wen-qi; Shi, Nan; Shen, Fang; Zhang, Yan; Liu, Kang-yong; Sun, Xiao-jiang

2015-01-01

Our previous findings have demonstrated that autophagy regulation can alleviate the decline of learning and memory by eliminating deposition of extracellular beta-amyloid peptide (Aβ) in the brain after stroke, but the exact mechanism is unclear. It is presumed that the regulation of beta-site APP-cleaving enzyme 1 (BACE1), the rate-limiting enzyme in metabolism of Aβ, would be a key site. Neuro-2a/amyloid precursor protein 695 (APP695) cell models of cerebral ischemia were established by oxygen-glucose deprivation to investigate the effects of Rapamycin (an autophagy inducer) or 3-methyladenine (an autophagy inhibitor) on the expression of BACE1. Either oxygen-glucose deprivation or Rapamycin down-regulated the expression of BACE1 while 3-methyladenine up-regulated BACE1 expression. These results confirm that oxygen-glucose deprivation down-regulates BACE1 expression in Neuro-2a/APP695 cells through the introduction of autophagy. PMID:26604904

Autotaxin Expression Is Regulated at the Post-transcriptional Level by the RNA-binding Proteins HuR and AUF1.

PubMed

Sun, Shuhong; Zhang, Xiaotian; Lyu, Lin; Li, Xixi; Yao, Siliang; Zhang, Junjie

2016-12-09

Autotaxin (ATX) is a key enzyme that converts lysophosphatidylcholine (LPC) into lysophosphatidic acid (LPA), a lysophospholipid mediator that regulates cellular activities through its specific G protein-coupled receptors. The ATX-LPA axis plays an important role in various physiological and pathological processes, especially in inflammation and cancer development. Although the transcriptional regulation of ATX has been widely studied, the post-transcriptional regulation of ATX is largely unknown. In this study, we identified conserved adenylate-uridylate (AU)-rich elements in the ATX mRNA 3'-untranslated region (3'UTR). The RNA-binding proteins HuR and AUF1 directly bound to the ATX mRNA 3'UTR and had antagonistic functions in ATX expression. HuR enhanced ATX expression by increasing ATX mRNA stability, whereas AUF1 suppressed ATX expression by promoting ATX mRNA decay. HuR and AUF1 were involved in ATX regulation in Colo320 human colon cancer cells and the LPS-stimulated human monocytic THP-1 cells. HuR knockdown suppressed ATX expression in B16 mouse melanoma cells, leading to inhibition of cell migration. This effect was reversed by AUF1 knockdown to recover ATX expression or by the addition of LPA. These results suggest that the post-transcriptional regulation of ATX expression by HuR and AUF1 modulates cancer cell migration. In summary, we identified HuR and AUF1 as novel post-transcriptional regulators of ATX expression, thereby elucidating a novel mechanism regulating the ATX-LPA axis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Orphan nuclear receptor Nur77 is a novel negative regulator of endothelin-1 expression in vascular endothelial cells.

PubMed

Qin, Qing; Chen, Ming; Yi, Bing; You, Xiaohua; Yang, Ping; Sun, Jianxin

2014-12-01

Endothelin-1 (ET-1) produced by vascular endothelial cells plays essential roles in the regulation of vascular tone and development of cardiovascular diseases. The objective of this study is to identify novel regulators implicated in the regulation of ET-1 expression in vascular endothelial cells (ECs). By using quantitative real-time PCR (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA), we show that either ectopic expression of orphan nuclear receptor Nur77 or pharmacological activation of Nur77 by 6-mercaptopurine (6-MP) substantially inhibits ET-1 expression in human umbilical vein endothelial cells (HUVECs), under both basal and thrombin-stimulated conditions. Furthermore, thrombin-stimulated ET expression is significantly augmented in both Nur77 knockdown ECs and aort from Nur77 knockout mice, suggesting that Nur77 is a negative regulator of ET-1 expression. Inhibition of ET-1 expression by Nur77 occurs at gene transcriptional levels, since Nur77 potently inhibits ET-1 promoter activity, without affecting ET-1 mRNA stability. As shown in electrophoretic mobility shift assay (EMSA), Nur77 overexpression markedly inhibits both basal and thrombin-stimulated transcriptional activity of AP-1. Mechanistically, we demonstrate that Nur77 specially interacts with c-Jun and inhibits AP-1 dependent c-Jun promoter activity, which leads to a decreased expression of c-Jun, a critical component involved in both AP-1 transcriptional activity and ET-1 expression in ECs. These findings demonstrate that Nur77 is a novel negative regulator of ET-1 expression in vascular ECs through an inhibitory interaction with the c-Jun/AP-1 pathway. Activation of Nur77 may represent a useful therapeutic strategy for preventing certain cardiovascular diseases, such as atherosclerosis and pulmonary artery hypertension. Copyright © 2014 Elsevier Ltd. All rights reserved.

Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

PubMed

Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian

2013-01-01

In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.

Rice PLASTOCHRON genes regulate leaf maturation downstream of the gibberellin signal transduction pathway.

PubMed

Mimura, Manaki; Nagato, Yasuo; Itoh, Jun-Ichi

2012-05-01

Rice PLASTOCHRON 1 (PLA1) and PLA2 genes regulate leaf maturation and plastochron, and their loss-of-function mutants exhibit small organs and rapid leaf emergence. They encode a cytochrome P450 protein CYP78A11 and an RNA-binding protein, respectively. Their homologs in Arabidopsis and maize are also associated with plant development/organ size. Despite the importance of PLA genes in plant development, their molecular functions remain unknown. Here, we investigated how PLA1 and PLA2 genes are related to phytohormones. We found that gibberellin (GA) is the major phytohormone that promotes PLA1 and PLA2 expression. GA induced PLA1 and PLA2 expression, and conversely the GA-inhibitor uniconazole suppressed PLA1 and PLA2 expression. In pla1-4 and pla2-1 seedlings, expression levels of GA biosynthesis genes and the signal transduction gene were similar to those in wild-type seedlings. GA treatment slightly down-regulated the GA biosynthesis gene GA20ox2 and up-regulated the GA-catabolizing gene GA2ox4, whereas the GA biosynthesis inhibitor uniconazole up-regulated GA20ox2 and down-regulated GA2ox4 both in wild-type and pla mutants, suggesting that the GA feedback mechanism is not impaired in pla1 and pla2. To reveal how GA signal transduction affects the expression of PLA1 and PLA2, PLA expression in GA-signaling mutants was examined. In GA-insensitive mutant, gid1 and less-sensitive mutant, Slr1-d1, PLA1 and PLA2 expression was down-regulated. On the other hand, the expression levels of PLA1 and PLA2 were highly enhanced in a GA-constitutive-active mutant, slr1-1, causing ectopic overexpression. These results indicate that both PLA1 and PLA2 act downstream of the GA signal transduction pathway to regulate leaf development.

Angiotensin II up-regulates PAX2 oncogene expression and activity in prostate cancer via the angiotensin II type I receptor.

PubMed

Bose, Sudeep K; Gibson, Willietta; Giri, Shailendra; Nath, Narender; Donald, Carlton D

2009-09-01

Paired homeobox 2 gene (PAX2) is a transcriptional regulator, aberrantly expressed in prostate cancer cells and its down-regulation promotes cell death in these cells. The molecular mechanisms of tumor progression by PAX2 over-expression are still unclear. However, it has been reported that angiotensin-II (A-II) induces cell growth in prostate cancer via A-II type 1 receptor (AT1R) and is mediated by the phosphorylation of mitogen activated protein kinase (MAPK) as well as signal transducer and activator of transcription 3 (STAT3). Here we have demonstrated that A-II up-regulates PAX2 expression in prostate epithelial cells and prostate cancer cell lines resulting in increased cell growth. Furthermore, AT1R receptor antagonist losartan was shown to inhibit A-II induced PAX2 expression in prostate cancer. Moreover, analysis using pharmacological inhibitors against MEK1/2, ERK1/2, JAK-II, and phospho-STAT3 demonstrated that AT1R-mediated stimulatory effect of A-II on PAX2 expression was regulated in part by the phosphorylation of ERK1/2, JAK II, and STAT3 pathways. In addition, we have showed that down-regulation of PAX2 by an AT1R antagonist as well as JAK-II and STAT3 inhibitors suppress prostate cancer cell growth. Collectively, these findings show for the first time that the renin-angiotensin system (RAS) may promote prostate tumorigenesis via up-regulation of PAX2 expression. Therefore, PAX2 may be a novel therapeutic target for the treatment of carcinomas such as prostate cancer via the down-regulation of its expression by targeting the AT1R signaling pathways.

Degradation of the HilC and HilD regulator proteins by ATP-dependent Lon protease leads to downregulation of Salmonella pathogenicity island 1 gene expression.

PubMed

Takaya, Akiko; Kubota, Yohsuke; Isogai, Emiko; Yamamoto, Tomoko

2005-02-01

Salmonella pathogenicity island 1 (SPI1) enables infecting Salmonella to cross the small intestinal barrier and to escape phagocytosis by inducing apoptosis. Several environmental signals and transcriptional regulators modulate the expression of hilA, which encodes a protein playing a central role in the regulatory hierarchy of SPI1 gene expression. We have previously shown that Lon, a stress-induced ATP-dependent protease, is a negative regulator of hilA, suggesting that it targets factors required for activating hilA expression. To elucidate the mechanisms by which Lon protease negatively regulates SPI1 transcription, we looked for its substrate proteins. We found that HilC and HilD, which are positive regulators of hilA expression, accumulate in Lon-depleted cells, and that the enhancement of SPI1 expression that occurs in a lon-disrupted mutant is not observed in the lon hilC hilD triple null mutant. Furthermore, we demonstrated that the half-lives of HilC and HilD are, respectively, about 12 times and three times longer in the Lon-depleted mutant, than in the Lon+ cells, suggesting that Lon targets both of HilC and HilD. In view of these findings, we suggest that the regulation of SPI1 expression is negatively controlled through degradation of the HilC and HilD transcriptional regulators by Lon.

Silibinin induces apoptosis of HT29 colon carcinoma cells through early growth response-1 (EGR-1)-mediated non-steroidal anti-inflammatory drug-activated gene-1 (NAG-1) up-regulation.

PubMed

Woo, Seon Min; Min, Kyoung-Jin; Kim, Shin; Park, Jong-Wook; Kim, Dong Eun; Chun, Kyung-Soo; Kim, Young Ho; Lee, Tae-Jin; Kim, Sang Hyun; Choi, Yung Hyun; Chang, Jong-Soo; Kwon, Taeg Kyu

2014-03-25

Silibinin, an effective anti-cancer and chemopreventive agent, has been shown to exert multiple effects on cancer cells, including inhibition of both cell proliferation and migration. However, the molecular mechanisms responsible for these effects are not fully understood. We observed that silibinin significantly induced the expression of the non-steroidal anti-inflammatory drug-activated gene-1 (NAG-1) in both p53 wild-type and p53-null cancer cell lines, suggesting that silibinin-induced NAG-1 up-regulation is p53-independent manner. Silibinin up-regulates early growth response-1 (EGR-1) expression. The ectopic expression of EGR-1 significantly increased NAG-1 promoter activity and NAG-1 protein expression in a dose-dependent manner. Furthermore, down-regulation of EGR-1 expression using siRNA markedly reduced silibinin-mediated NAG-1 expression, suggesting that the expression of EGR-1 is critical for silibinin-induced NAG-1 expression. We also observed that reactive oxygen species (ROS) are generated by silibinin; however, ROS did not affect silibinin-induced NAG-1 expression and apoptosis. In addition, we demonstrated that the mitogen-activated protein kinase (MAP kinase) signal transduction pathway is involved in silibinin-induced NAG-1 expression. Inhibitors of p38 MAP kinase (SB203580) attenuated silibinin-induced NAG-1 expression. Furthermore, we found that siRNA-mediated knockdown of NAG-1 attenuated silibinin-induced apoptosis. Collectively, the results of this study demonstrate for the first time that up-regulation of NAG-1 contributes to silibinin-induced apoptosis in cancer cells. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

SALT-RESPONSIVE ERF1 is a negative regulator of grain filling and gibberellin-mediated seedling establishment in rice.

PubMed

Schmidt, Romy; Schippers, Jos H M; Mieulet, Delphine; Watanabe, Mutsumi; Hoefgen, Rainer; Guiderdoni, Emmanuel; Mueller-Roeber, Bernd

2014-02-01

Grain quality is an important agricultural trait that is mainly determined by grain size and composition. Here, we characterize the role of the rice transcription factor (TF) SALT-RESPONSIVE ERF1 (SERF1) during grain development. Through genome-wide expression profiling and chromatin immunoprecipitation, we found that SERF1 directly regulates RICE PROLAMIN-BOX BINDING FACTOR (RPBF), a TF that functions as a positive regulator of grain filling. Loss of SERF1 enhances RPBF expression resulting in larger grains with increased starch content, while SERF1 overexpression represses RPBF resulting in smaller grains. Consistently, during grain filling, starch biosynthesis genes such as GRANULE-BOUND STARCH SYNTHASEI (GBSSI), STARCH SYNTHASEI (SSI), SSIIIa, and ADP-GLUCOSE PYROPHOSPHORYLASE LARGE SUBUNIT2 (AGPL2) are up-regulated in SERF1 knockout grains. Moreover, SERF1 is a direct upstream regulator of GBSSI. In addition, SERF1 negatively regulates germination by controlling RPBF expression, which mediates the gibberellic acid (GA)-induced expression of RICE AMYLASE1A (RAmy1A). Loss of SERF1 results in more rapid seedling establishment, while SERF1 overexpression has the opposite effect. Our study reveals that SERF1 represents a negative regulator of grain filling and seedling establishment by timing the expression of RPBF.

Burkholderia mallei and Burkholderia pseudomallei Cluster 1 Type VI Secretion System Gene Expression Is Negatively Regulated by Iron and Zinc

PubMed Central

Burtnick, Mary N.; Brett, Paul J.

2013-01-01

Burkholderia mallei is a facultative intracellular pathogen that causes glanders in humans and animals. Previous studies have demonstrated that the cluster 1 type VI secretion system (T6SS-1) expressed by this organism is essential for virulence in hamsters and is positively regulated by the VirAG two-component system. Recently, we have shown that T6SS-1 gene expression is up-regulated following internalization of this pathogen into phagocytic cells and that this system promotes multinucleated giant cell formation in infected tissue culture monolayers. In the present study, we further investigated the complex regulation of this important virulence factor. To assess T6SS-1 expression, B. mallei strains were cultured in various media conditions and Hcp1 production was analyzed by Western immunoblotting. Transcript levels of several VirAG-regulated genes (bimA, tssA, hcp1 and tssM) were also determined using quantitative real time PCR. Consistent with previous observations, T6SS-1 was not expressed during growth of B. mallei in rich media. Curiously, growth of the organism in minimal media (M9G) or minimal media plus casamino acids (M9CG) facilitated robust expression of T6SS-1 genes whereas growth in minimal media plus tryptone (M9TG) did not. Investigation of this phenomenon confirmed a regulatory role for VirAG in this process. Additionally, T6SS-1 gene expression was significantly down-regulated by the addition of iron and zinc to M9CG. Other genes under the control of VirAG did not appear to be as tightly regulated by these divalent metals. Similar results were observed for B. pseudomallei, but not for B. thailandensis. Collectively, our findings indicate that in addition to being positively regulated by VirAG, B. mallei and B. pseudomallei T6SS-1 gene expression is negatively regulated by iron and zinc. PMID:24146925

Burkholderia mallei and Burkholderia pseudomallei cluster 1 type VI secretion system gene expression is negatively regulated by iron and zinc.

PubMed

Burtnick, Mary N; Brett, Paul J

2013-01-01

Burkholderia mallei is a facultative intracellular pathogen that causes glanders in humans and animals. Previous studies have demonstrated that the cluster 1 type VI secretion system (T6SS-1) expressed by this organism is essential for virulence in hamsters and is positively regulated by the VirAG two-component system. Recently, we have shown that T6SS-1 gene expression is up-regulated following internalization of this pathogen into phagocytic cells and that this system promotes multinucleated giant cell formation in infected tissue culture monolayers. In the present study, we further investigated the complex regulation of this important virulence factor. To assess T6SS-1 expression, B. mallei strains were cultured in various media conditions and Hcp1 production was analyzed by Western immunoblotting. Transcript levels of several VirAG-regulated genes (bimA, tssA, hcp1 and tssM) were also determined using quantitative real time PCR. Consistent with previous observations, T6SS-1 was not expressed during growth of B. mallei in rich media. Curiously, growth of the organism in minimal media (M9G) or minimal media plus casamino acids (M9CG) facilitated robust expression of T6SS-1 genes whereas growth in minimal media plus tryptone (M9TG) did not. Investigation of this phenomenon confirmed a regulatory role for VirAG in this process. Additionally, T6SS-1 gene expression was significantly down-regulated by the addition of iron and zinc to M9CG. Other genes under the control of VirAG did not appear to be as tightly regulated by these divalent metals. Similar results were observed for B. pseudomallei, but not for B. thailandensis. Collectively, our findings indicate that in addition to being positively regulated by VirAG, B. mallei and B. pseudomallei T6SS-1 gene expression is negatively regulated by iron and zinc.

On the binding determinants of the glutamate agonist with the glutamate receptor ligand binding domain.

PubMed

Speranskiy, Kirill; Kurnikova, Maria

2005-08-30

Ionotropic glutamate receptors (GluRs) are ligand-gated membrane channel proteins found in the central neural system that mediate a fast excitatory response of neurons. In this paper, we report theoretical analysis of the ligand-protein interactions in the binding pocket of the S1S2 (ligand binding) domain of the GluR2 receptor in the closed conformation. By utilizing several theoretical methods ranging from continuum electrostatics to all-atom molecular dynamics simulations and quantum chemical calculations, we were able to characterize in detail glutamate agonist binding to the wild-type and E705D mutant proteins. A theoretical model of the protein-ligand interactions is validated via direct comparison of theoretical and Fourier transform infrared spectroscopy (FTIR) measured frequency shifts of the ligand's carboxylate group vibrations [Jayaraman et al. (2000) Biochemistry 39, 8693-8697; Cheng et al. (2002) Biochemistry 41, 1602-1608]. A detailed picture of the interactions in the binding site is inferred by analyzing contributions to vibrational frequencies produced by protein residues forming the ligand-binding pocket. The role of mobility and hydrogen-bonding network of water in the ligand-binding pocket and the contribution of protein residues exposed in the binding pocket to the binding and selectivity of the ligand are discussed. It is demonstrated that the molecular surface of the protein in the ligand-free state has mainly positive electrostatic potential attractive to the negatively charged ligand, and the potential produced by the protein in the ligand-binding pocket in the closed state is complementary to the distribution of the electrostatic potential produced by the ligand itself. Such charge complementarity ensures specificity to the unique charge distribution of the ligand.

mRNA-binding protein TIA-1 reduces cytokine expression in human endometrial stromal cells and is down-regulated in ectopic endometrium.

PubMed

Karalok, Hakan Mete; Aydin, Ebru; Saglam, Ozlen; Torun, Aysenur; Guzeloglu-Kayisli, Ozlem; Lalioti, Maria D; Kristiansson, Helena; Duke, Cindy M P; Choe, Gina; Flannery, Clare; Kallen, Caleb B; Seli, Emre

2014-12-01

Cytokines and growth factors play important roles in endometrial function and the pathogenesis of endometriosis. mRNAs encoding cytokines and growth factors undergo rapid turnover; primarily mediated by adenosine- and uridine-rich elements (AREs) located in their 3'-untranslated regions. T-cell intracellular antigen (TIA-1), an mRNA-binding protein, binds to AREs in target transcripts, leading to decreased gene expression. The purpose of this article was to determine whether TIA-1 plays a role in the regulation of endometrial cytokine and growth factor expression during the normal menstrual cycle and whether TIA-1 expression is altered in women with endometriosis. Eutopic endometrial tissue obtained from women without endometriosis (n = 30) and eutopic and ectopic endometrial tissues from women with endometriosis (n = 17) were immunostained for TIA-1. Staining intensities were evaluated by histological scores (HSCOREs). The regulation of endometrial TIA-1 expression by immune factors and steroid hormones was studied by treating primary cultured human endometrial stromal cells (HESCs) with vehicle, lipopolysaccharide, TNF-α, IL-6, estradiol, or progesterone, followed by protein blot analyses. HESCs were engineered to over- or underexpress TIA-1 to test whether TIA-1 regulates IL-6 or TNF-α expression in these cells. We found that TIA-1 is expressed in endometrial stromal and glandular cells throughout the menstrual cycle and that this expression is significantly higher in the perimenstrual phase. In women with endometriosis, TIA-1 expression in eutopic and ectopic endometrium was reduced compared with TIA-1 expression in eutopic endometrium of unaffected control women. Lipopolysaccharide and TNF-α increased TIA-1 expression in HESCs in vitro, whereas IL-6 or steroid hormones had no effect. In HESCs, down-regulation of TIA-1 resulted in elevated IL-6 and TNF-α expression, whereas TIA-1 overexpression resulted in decreased IL-6 and TNF-α expression. Endometrial TIA-1 is regulated throughout the menstrual cycle, TIA-1 modulates the expression of immune factors in endometrial cells, and downregulation of TIA-1 may contribute to the pathogenesis of endometriosis.

mRNA-Binding Protein TIA-1 Reduces Cytokine Expression in Human Endometrial Stromal Cells and Is Down-Regulated in Ectopic Endometrium

PubMed Central

Karalok, Hakan Mete; Aydin, Ebru; Saglam, Ozlen; Torun, Aysenur; Guzeloglu-Kayisli, Ozlem; Lalioti, Maria D.; Kristiansson, Helena; Duke, Cindy M. P.; Choe, Gina; Flannery, Clare; Kallen, Caleb B.

2014-01-01

Background: Cytokines and growth factors play important roles in endometrial function and the pathogenesis of endometriosis. mRNAs encoding cytokines and growth factors undergo rapid turnover; primarily mediated by adenosine- and uridine-rich elements (AREs) located in their 3′-untranslated regions. T-cell intracellular antigen (TIA-1), an mRNA-binding protein, binds to AREs in target transcripts, leading to decreased gene expression. Objective: The purpose of this article was to determine whether TIA-1 plays a role in the regulation of endometrial cytokine and growth factor expression during the normal menstrual cycle and whether TIA-1 expression is altered in women with endometriosis. Methods: Eutopic endometrial tissue obtained from women without endometriosis (n = 30) and eutopic and ectopic endometrial tissues from women with endometriosis (n = 17) were immunostained for TIA-1. Staining intensities were evaluated by histological scores (HSCOREs). The regulation of endometrial TIA-1 expression by immune factors and steroid hormones was studied by treating primary cultured human endometrial stromal cells (HESCs) with vehicle, lipopolysaccharide, TNF-α, IL-6, estradiol, or progesterone, followed by protein blot analyses. HESCs were engineered to over- or underexpress TIA-1 to test whether TIA-1 regulates IL-6 or TNF-α expression in these cells. Results: We found that TIA-1 is expressed in endometrial stromal and glandular cells throughout the menstrual cycle and that this expression is significantly higher in the perimenstrual phase. In women with endometriosis, TIA-1 expression in eutopic and ectopic endometrium was reduced compared with TIA-1 expression in eutopic endometrium of unaffected control women. Lipopolysaccharide and TNF-α increased TIA-1 expression in HESCs in vitro, whereas IL-6 or steroid hormones had no effect. In HESCs, down-regulation of TIA-1 resulted in elevated IL-6 and TNF-α expression, whereas TIA-1 overexpression resulted in decreased IL-6 and TNF-α expression. Conclusions: Endometrial TIA-1 is regulated throughout the menstrual cycle, TIA-1 modulates the expression of immune factors in endometrial cells, and downregulation of TIA-1 may contribute to the pathogenesis of endometriosis. PMID:25140393

Increased TET1 Expression in Inflammatory Microenvironment of Hyperinsulinemia Enhances the Response of Endometrial Cancer to Estrogen by Epigenetic Modulation of GPER

PubMed Central

Lv, Qiao-Ying; Xie, Bing-Ying; Yang, Bing-Yi; Ning, Cheng-Cheng; Shan, Wei-Wei; Gu, Chao; Luo, Xue-Zhen; Chen, Xiao-Jun; Zhang, Zhen-Bo; Feng, You-Ji

2017-01-01

Background: Insulin resistance (IR) has been well studied in the initiation and development of endometrial endometrioid carcinoma (EEC). As yet, it has been largely neglected for estrogen sensitivity in local endometrium in hyperinsulinemia-induced systemic microenvironment. The aim of this study was to investigate the role of insulin in regulating estrogen sensitivity and explore the potential mechanisms in insulin-driven inflammatory microenvironment. Methods: We first investigated the effect of insulin on estradiol-driven endometrial cancer cells proliferation in vitro to address the roles of insulin in modulating estrogen sensitivity. Then GPER, ERα and TET1 in EEC samples with or without insulin resistance were screened by immunohistochemistry to confirm whether insulin resistance regulates estrogen receptors. Further mechanism analysis was carried out to address whether TET1 was mediated epigenetic modulation of GPER in insulin-induced microenvironment. Results: Insulin enhanced estradiol-driven endometrial cancer cells proliferation by up-regulating G-protein-coupled estrogen receptor (GPER) expression, but not ERα or ERβ. Immunohistochemistry of EEC tissues showed that GPER expression was greatly increased in endometrial tissues from EEC subjects with insulin resistance and was positively correlated with Ten-eleven-translocation 1 (TET1) expression. Mechanistically, insulin up-regulates TET1 expression, and the latter, an important DNA hydroxymethylase, could up-regulate GPER expression through epigenetic modulation. Conclusion: This study identified TET1 as the upstream regulator of GPER expression and provides a possible mechanism that insulin-induced positive regulation of estrogen sensitivity in endometrial cancer cells. Increasing expression of GPER through TET1-mediated epigenetic modulation may emerge as the main regulator to enhance the response of endometrial cancer to estrogen in insulin-driven inflammatory microenvironment. PMID:28382153

Increased TET1 Expression in Inflammatory Microenvironment of Hyperinsulinemia Enhances the Response of Endometrial Cancer to Estrogen by Epigenetic Modulation of GPER.

PubMed

Lv, Qiao-Ying; Xie, Bing-Ying; Yang, Bing-Yi; Ning, Cheng-Cheng; Shan, Wei-Wei; Gu, Chao; Luo, Xue-Zhen; Chen, Xiao-Jun; Zhang, Zhen-Bo; Feng, You-Ji

2017-01-01

Background: Insulin resistance (IR) has been well studied in the initiation and development of endometrial endometrioid carcinoma (EEC). As yet, it has been largely neglected for estrogen sensitivity in local endometrium in hyperinsulinemia-induced systemic microenvironment. The aim of this study was to investigate the role of insulin in regulating estrogen sensitivity and explore the potential mechanisms in insulin-driven inflammatory microenvironment. Methods: We first investigated the effect of insulin on estradiol-driven endometrial cancer cells proliferation in vitro to address the roles of insulin in modulating estrogen sensitivity. Then GPER, ERα and TET1 in EEC samples with or without insulin resistance were screened by immunohistochemistry to confirm whether insulin resistance regulates estrogen receptors. Further mechanism analysis was carried out to address whether TET1 was mediated epigenetic modulation of GPER in insulin-induced microenvironment. Results: Insulin enhanced estradiol-driven endometrial cancer cells proliferation by up-regulating G-protein-coupled estrogen receptor (GPER) expression, but not ERα or ERβ. Immunohistochemistry of EEC tissues showed that GPER expression was greatly increased in endometrial tissues from EEC subjects with insulin resistance and was positively correlated with Ten-eleven-translocation 1 (TET1) expression. Mechanistically, insulin up-regulates TET1 expression, and the latter, an important DNA hydroxymethylase, could up-regulate GPER expression through epigenetic modulation. Conclusion: This study identified TET1 as the upstream regulator of GPER expression and provides a possible mechanism that insulin-induced positive regulation of estrogen sensitivity in endometrial cancer cells. Increasing expression of GPER through TET1-mediated epigenetic modulation may emerge as the main regulator to enhance the response of endometrial cancer to estrogen in insulin-driven inflammatory microenvironment.

Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response.

PubMed

Wang, Manyu; Chen, Pei-Yi; Wang, Chien-Hsiang; Lai, Tzu-Ting; Tsai, Pei-I; Cheng, Ying-Ju; Kao, Hsiu-Hua; Chien, Cheng-Ting

2016-10-01

In response to environmental and physiological changes, the synapse manifests plasticity while simultaneously maintains homeostasis. Here, we analyzed mutant synapses of henji, also known as dbo, at the Drosophila neuromuscular junction (NMJ). In henji mutants, NMJ growth is defective with appearance of satellite boutons. Transmission electron microscopy analysis indicates that the synaptic membrane region is expanded. The postsynaptic density (PSD) houses glutamate receptors GluRIIA and GluRIIB, which have distinct transmission properties. In henji mutants, GluRIIA abundance is upregulated but that of GluRIIB is not. Electrophysiological results also support a GluR compositional shift towards a higher IIA/IIB ratio at henji NMJs. Strikingly, dPAK, a positive regulator for GluRIIA synaptic localization, accumulates at the henji PSD. Reducing the dpak gene dosage suppresses satellite boutons and GluRIIA accumulation at henji NMJs. In addition, dPAK associated with Henji through the Kelch repeats which is the domain essential for Henji localization and function at postsynapses. We propose that Henji acts at postsynapses to restrict both presynaptic bouton growth and postsynaptic GluRIIA abundance by modulating dPAK.

Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response

PubMed Central

Wang, Manyu; Chen, Pei-Yi; Wang, Chien-Hsiang; Lai, Tzu-Ting; Tsai, Pei-I; Cheng, Ying-Ju; Kao, Hsiu-Hua; Chien, Cheng-Ting

2016-01-01

In response to environmental and physiological changes, the synapse manifests plasticity while simultaneously maintains homeostasis. Here, we analyzed mutant synapses of henji, also known as dbo, at the Drosophila neuromuscular junction (NMJ). In henji mutants, NMJ growth is defective with appearance of satellite boutons. Transmission electron microscopy analysis indicates that the synaptic membrane region is expanded. The postsynaptic density (PSD) houses glutamate receptors GluRIIA and GluRIIB, which have distinct transmission properties. In henji mutants, GluRIIA abundance is upregulated but that of GluRIIB is not. Electrophysiological results also support a GluR compositional shift towards a higher IIA/IIB ratio at henji NMJs. Strikingly, dPAK, a positive regulator for GluRIIA synaptic localization, accumulates at the henji PSD. Reducing the dpak gene dosage suppresses satellite boutons and GluRIIA accumulation at henji NMJs. In addition, dPAK associated with Henji through the Kelch repeats which is the domain essential for Henji localization and function at postsynapses. We propose that Henji acts at postsynapses to restrict both presynaptic bouton growth and postsynaptic GluRIIA abundance by modulating dPAK. PMID:27736876

CsPLDalpha1 and CsPLDgamma1 are differentially induced during leaf and fruit abscission and diurnally regulated in Citrus sinensis.

PubMed

Malladi, Anish; Burns, Jacqueline K

2008-01-01

Understanding leaf and fruit abscission is essential in order to develop strategies for controlling the process in fruit crops. Mechanisms involved in signalling leaf and fruit abscission upon induction by abscission agents were investigated in Citrus sinensis cv. 'Valencia'. Previous studies have suggested a role for phospholipid signalling; hence, two phospholipase D cDNA sequences, CsPLDalpha1 and CsPLDgamma1, were isolated and their role was examined. CsPLDalpha1 expression was reduced in leaves but unaltered in fruit peel tissue treated with an ethylene-releasing compound (ethephon), or a fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-1H-pyrazole (CMNP). By contrast, CsPLDgamma1 expression was up-regulated within 6 h (leaves) and 24 h (fruit peel) after treatment with ethephon or CMNP, respectively. CsPLDalpha1 expression was diurnally regulated in leaf blade but not fruit peel. CsPLDgamma1 exhibited strong diurnal oscillation in expression in leaves and fruit peel with peak expression around midday. While diurnal fluctuation in CsPLDalpha1 expression appeared to be light-entrained in leaves, CsPLDgamma1 expression was regulated by light and the circadian clock. The diurnal expression of both genes was modulated by ethylene-signalling. The ethephon-induced leaf abscission and the ethephon- and CMNP-induced decrease in fruit detachment force were enhanced by application during rising diurnal expression of CsPLDgamma1. The results indicate differential regulation of CsPLDalpha1 and CsPLDgamma1 in leaves and fruit, and suggest possible roles for PLD-dependent signalling in regulating abscission responses in citrus.

CsPLDα1 and CsPLDγ1 are differentially induced during leaf and fruit abscission and diurnally regulated in Citrus sinensis

PubMed Central

Malladi, Anish; Burns, Jacqueline K.

2008-01-01

Understanding leaf and fruit abscission is essential in order to develop strategies for controlling the process in fruit crops. Mechanisms involved in signalling leaf and fruit abscission upon induction by abscission agents were investigated in Citrus sinensis cv. ‘Valencia’. Previous studies have suggested a role for phospholipid signalling; hence, two phospholipase D cDNA sequences, CsPLDα1 and CsPLDγ1, were isolated and their role was examined. CsPLDα1 expression was reduced in leaves but unaltered in fruit peel tissue treated with an ethylene-releasing compound (ethephon), or a fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-1H-pyrazole (CMNP). By contrast, CsPLDγ1 expression was up-regulated within 6 h (leaves) and 24 h (fruit peel) after treatment with ethephon or CMNP, respectively. CsPLDα1 expression was diurnally regulated in leaf blade but not fruit peel. CsPLDγ1 exhibited strong diurnal oscillation in expression in leaves and fruit peel with peak expression around midday. While diurnal fluctuation in CsPLDα1 expression appeared to be light-entrained in leaves, CsPLDγ1 expression was regulated by light and the circadian clock. The diurnal expression of both genes was modulated by ethylene-signalling. The ethephon-induced leaf abscission and the ethephon- and CMNP-induced decrease in fruit detachment force were enhanced by application during rising diurnal expression of CsPLDγ1. The results indicate differential regulation of CsPLDα1 and CsPLDγ1 in leaves and fruit, and suggest possible roles for PLD-dependent signalling in regulating abscission responses in citrus. PMID:18799715

Epigenetic regulation of REG1A and chemosensitivity of cutaneous melanoma

PubMed Central

Sato, Yusuke; Marzese, Diego M; Ohta, Katsuya; Huang, Sharon K; Sim, Myung Shin; Chong, Kelly; Hoon, Dave SB

2013-01-01

Regenerating gene 1A (REG1A) plays an important role in tissue regeneration and in cell proliferation in epithelium origin tumors; however, its role in melanoma has not been explored in details. The objective of this study was to identify whether REG1A is expressed in cutaneous melanoma and if REG1A expression status can predict prognosis in cutaneous melanoma patients with metastasis. We also determined whether epigenetic regulation of the promoter region regulates REG1A expression. AJCC stage III cutaneous melanoma specimens with clinically well annotated stage III lymph node melanoma metastasis tissue microarray were assessed by IHC. MALDI-TOF-mass spectrometry and HM450K array were used to identify REG1A promoter region CpG site methylation. Chemotherapeutic agent response by melanoma cells as related to REG1A protein expression was assessed. Post-surgery melanoma patients followed by adjuvant chemotherapy with high REG1A expression had a significantly better prognosis (disease-specific survival) compared with patients with low REG1A expression (log rank test; p = 0.0013). The demethylating reagent 5-Aza-2′-deoxycytidine activated REG1A promoter region resulting in enhanced REG1A mRNA and protein expression in melanoma cell lines. Promoter region CpG methylation was shown to regulate REG1A expression in melanoma cells. Moreover, melanoma lines with high REG1A mRNA expression were more susceptible to Dacarbazine and Cisplatin, as compared with those with low REG1A mRNA expression. In conclusion, REG1A expression status may be useful as a biomarker in melanoma patients for sensitivity to these chemotherapeutic agents. The epigenetic regulation of the REG1A promoter region may offer a potential therapeutic approach to improve chemotherapy for metastatic melanoma patients. PMID:23903855

Modulation of extracellular matrix/adhesion molecule expression by BRG1 is associated with increased melanoma invasiveness.

PubMed

Saladi, Srinivas Vinod; Keenen, Bridget; Marathe, Himangi G; Qi, Huiling; Chin, Khew-Voon; de la Serna, Ivana L

2010-10-22

Metastatic melanoma is an aggressive malignancy that is resistant to therapy and has a poor prognosis. The progression of primary melanoma to metastatic disease is a multi-step process that requires dynamic regulation of gene expression through currently uncharacterized epigenetic mechanisms. Epigenetic regulation of gene expression often involves changes in chromatin structure that are catalyzed by chromatin remodeling enzymes. Understanding the mechanisms involved in the regulation of gene expression during metastasis is important for developing an effective strategy to treat metastatic melanoma. SWI/SNF enzymes are multisubunit complexes that contain either BRG1 or BRM as the catalytic subunit. We previously demonstrated that heterogeneous SWI/SNF complexes containing either BRG1 or BRM are epigenetic modulators that regulate important aspects of the melanoma phenotype and are required for melanoma tumorigenicity in vitro. To characterize BRG1 expression during melanoma progression, we assayed expression of BRG1 in patient derived normal skin and in melanoma specimen. BRG1 mRNA levels were significantly higher in stage IV melanomas compared to stage III tumors and to normal skin. To determine the role of BRG1 in regulating the expression of genes involved in melanoma metastasis, we expressed BRG1 in a melanoma cell line that lacks BRG1 expression and examined changes in extracellular matrix and adhesion molecule expression. We found that BRG1 modulated the expression of a subset of extracellular matrix remodeling enzymes and adhesion proteins. Furthermore, BRG1 altered melanoma adhesion to different extracellular matrix components. Expression of BRG1 in melanoma cells that lack BRG1 increased invasive ability while down-regulation of BRG1 inhibited invasive ability in vitro. Activation of metalloproteinase (MMP) 2 expression greatly contributed to the BRG1 induced increase in melanoma invasiveness. We found that BRG1 is recruited to the MMP2 promoter and directly activates expression of this metastasis associated gene. We provide evidence that BRG1 expression increases during melanoma progression. Our study has identified BRG1 target genes that play an important role in melanoma metastasis and we show that BRG1 promotes melanoma invasive ability in vitro. These results suggest that increased BRG1 levels promote the epigenetic changes in gene expression required for melanoma metastasis to proceed.

Regulation of Kiss1 Expression by Sex Steroids in the Amygdala of the Rat and Mouse

PubMed Central

Kim, Joshua; Semaan, Sheila J.; Clifton, Donald K.; Steiner, Robert A.; Dhamija, Sangeeta

2011-01-01

Kisspeptin (encoded by the Kiss1 gene) is an important regulator of reproduction. In rodents, Kiss1 is expressed in two hypothalamic regions, the arcuate nucleus and anteroventral periventricular/ periventricular continuum, where it is regulated by sex steroids. However, the distribution, regulation, and functional significance of neural kisspeptin outside of the hypothalamus have not been studied and are poorly understood. Here, we report the expression of Kiss1 in the amygdala, predominantly in the medial nucleus of the amygdala (MeA), a region implicated in social and emotional behaviors as well as various aspects of reproduction. In gonadally intact rats and mice, Kiss1-expressing neurons were identified in the MeA of both sexes, with higher Kiss1 expression levels in adult males than females in diestrus. In rats, Kiss1 expression in the MeA changed as a function of the estrous cycle, with highest levels at proestrus. Next, we tested whether Kiss1 in the MeA is regulated by the circulating sex steroid milieu. Kiss1 levels in the MeA were low in gonadectomized mice and rats of both sexes, and treatment with either testosterone or estradiol amplified Kiss1 expression in this region. Testosterone's inductive effect on Kiss1 expression in the MeA likely occurs via estrogen receptor-dependent pathways, not through the androgen receptor, because dihydrotestosterone (a nonaromatizable androgen) did not affect MeA Kiss1 levels. Thus, in rodents, Kiss1 is expressed and regulated by sex steroids in the MeA of both sexes and may play a role in modulating reproduction or brain functions that extend beyond reproduction. PMID:21363930

Regulation of DREAM Expression by Group I mGluR

PubMed Central

Lee, Jinu; Kim, Insook; Oh, So Ra; Ko, Suk Jin; Lim, Mi Kyung; Kim, Dong Goo

2011-01-01

DREAM (downstream regulatory element antagonistic modulator) is a calcium-binding protein that regulates dynorphin expression, promotes potassium channel surface expression, and enhances presenilin processing in an expression level-dependent manner. However, no molecular mechanism has yet explained how protein levels of DREAM are regulated. Here we identified group I mGluR (mGluR1/5) as a positive regulator of DREAM protein expression. Overexpression of mGluR1/5 increased the cellular level of DREAM. Up-regulation of DREAM resulted in increased DREAM protein in both the nucleus and cytoplasm, where the protein acts as a transcriptional repressor and a modulator of its interacting proteins, respectively. DHPG (3,5-dihydroxyphenylglycine), a group I mGluR agonist, also up-regulated DREAM expression in cortical neurons. These results suggest that group I mGluR is the first identified receptor that may regulate DREAM activity in neurons. PMID:21660149

TGFβ2 regulates hypothalamic Trh expression through the TGFβ inducible early gene-1 (TIEG1) during fetal development

PubMed Central

Martínez-Armenta, Miriam; de León-Guerrero, Sol Díaz; Catalán, Ana; Alvarez-Arellano, Lourdes; Uribe, Rosa Maria; Subramaniam, Malayannan; Charli, Jean-Louis; Pérez-Martínez, Leonor

2015-01-01

The hypothalamus regulates the homeostasis of the organism by controlling hormone secretion from the pituitary. The molecular mechanisms that regulate the differentiation of the hypothalamic thyrotropin-releasing hormone (TRH) phenotype are poorly understood. We have previously shown that Klf10 or TGFβ inducible early gene-1 (TIEG1) is enriched in fetal hypothalamic TRH neurons. Here, we show that expression of TGFβ isoforms (1–3) and both TGFβ receptors (TβRI and II) occurs in the hypothalamus concomitantly with the establishment of TRH neurons during late embryonic development. TGFβ2 induces Trh expression via a TIEG1 dependent mechanism. TIEG1 regulates Trh expression through an evolutionary conserved GC rich sequence on the Trh promoter. Finally, in mice deficient in TIEG1, Trh expression is lower than in wild type animals at embryonic day 17. These results indicate that TGFβ signaling, through the upregulation of TIEG1, plays an important role in the establishment of Trh expression in the embryonic hypothalamus. PMID:25448845

Sugar regulation of SUGAR TRANSPORTER PROTEIN 1 (STP1) expression in Arabidopsis thaliana

PubMed Central

Cordoba, Elizabeth; Aceves-Zamudio, Denise Lizeth; Hernández-Bernal, Alma Fabiola; Ramos-Vega, Maricela; León, Patricia

2015-01-01

Sugars regulate the expression of many genes at the transcriptional level. In Arabidopsis thaliana, sugars induce or repress the expression of >1800 genes, including the STP1 (SUGAR TRANSPORTER PROTEIN 1) gene, which encodes an H+/monosaccharide cotransporter. STP1 transcript levels decrease more rapidly after the addition of low concentrations of sugars than the levels of other repressed genes, such as DIN6 (DARK-INDUCED 6). We found that this regulation is exerted at the transcriptional level and is initiated by phosphorylatable sugars. Interestingly, the sugar signal that modulates STP1 expression is transmitted through a HEXOKINASE 1-independent signalling pathway. Finally, analysis of the STP1 5′ regulatory region allowed us to delimit a region of 309bp that contains the cis elements implicated in the glucose regulation of STP1 expression. Putative cis-acting elements involved in this response were identified. PMID:25281700

Regulation of Hyaluronan (HA) Metabolism Mediated by HYBID (Hyaluronan-binding Protein Involved in HA Depolymerization, KIAA1199) and HA Synthases in Growth Factor-stimulated Fibroblasts.

PubMed

Nagaoka, Aya; Yoshida, Hiroyuki; Nakamura, Sachiko; Morikawa, Tomohiko; Kawabata, Keigo; Kobayashi, Masaki; Sakai, Shingo; Takahashi, Yoshito; Okada, Yasunori; Inoue, Shintaro

2015-12-25

Regulation of hyaluronan (HA) synthesis and degradation is essential to maintenance of extracellular matrix homeostasis. We recently reported that HYBID (HYaluronan-Binding protein Involved in hyaluronan Depolymerization), also called KIAA1199, plays a key role in HA depolymerization in skin and arthritic synovial fibroblasts. However, regulation of HA metabolism mediated by HYBID and HA synthases (HASs) under stimulation with growth factors remains obscure. Here we report that TGF-β1, basic FGF, EGF, and PDGF-BB commonly enhance total amount of HA in skin fibroblasts through up-regulation of HAS expression, but molecular size of newly produced HA is dependent on HYBID expression levels. Stimulation of HAS1/2 expression and suppression of HYBID expression by TGF-β1 were abrogated by blockade of the MAPK and/or Smad signaling and the PI3K-Akt signaling, respectively. In normal human skin, expression of the TGF-β1 receptors correlated positively with HAS2 expression and inversely with HYBID expression. On the other hand, TGF-β1 up-regulated HAS1/2 expression but exerted only a slight suppressive effect on HYBID expression in synovial fibroblasts from the patients with osteoarthritis or rheumatoid arthritis, resulting in the production of lower molecular weight HA compared with normal skin and synovial fibroblasts. These data demonstrate that although TGF-β1, basic FGF, EGF, and PDGF-BB enhance HA production in skin fibroblasts, TGF-β1 most efficiently contributes to production of high molecular weight HA by HAS up-regulation and HYBID down-regulation and suggests that inefficient down-regulation of HYBID by TGF-β1 in arthritic synovial fibroblasts may be linked to accumulation of depolymerized HA in synovial fluids in arthritis patients. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Transcription of G-protein coupled receptors in corporal smooth muscle is regulated by sialorphin (an endogenous neutral endopeptidase inhibitor)

PubMed Central

Tong, Yuehong; Tiplitsky, Scott I.; Tar, Moses; Melman, Arnold; Davies, Kelvin P.

2009-01-01

Purpose Several reports have suggested the rat Vcsa1 gene is down-regulated in models of erectile dysfunction (ED). Vcsa’s protein product, sialorphin, is an endogenous neutral endopeptidase (NEP), and its down-regulation could result in prolonged activation of G-protein activated signaling pathways by their peptide agonists. We investigated if down- regulation of Vcsa1 could result in adaptive change in the expression of G-protein coupled receptors (GPCR). Materials and Methods Gene expression in cultured rat corporal smooth muscle cells (CSM) following treatment with siRNA directed against Vcsa1 or the NEP gene was analyzed using microarray and quantitative RT-PCR. In rats Vcsa1 is one of the most down-regulated genes following bilateral transection of the cavernosal nerves. Using that animal model, we also investigated whether the down-regulation of Vcsa1 is accompanied by similar changes in gene expression observed in the CSM cells where Vcsa1 was knocked-down in vitro. Results Microarray analysis and quantitative RT-PCR demonstrated that CSM cells treated in vitro with siRNA against Vcsa1 resulted in up-regulation of GPCR as a functional group. In contrast, treatment of CSM cells that lowered NEP activity resulted in decreases in GPCR expression. These results suggest that the peptide product of Vcsa1, sialorphin, can effect GPCR expression by acting on NEP. In animals with bilaterally transected cavernous nerves the reduced expression of Vcsa1 is accompanied by increased GPCR expression in cavernosal tissue. Conclusions These experiments suggest that the mechanism by which Vcsa1 modulates erectile function is partly mediated through changes in GPCR expression. PMID:18554633

Transcription of G-protein coupled receptors in corporeal smooth muscle is regulated by the endogenous neutral endopeptidase inhibitor sialorphin.

PubMed

Tong, Yuehong; Tiplitsky, Scott I; Tar, Moses; Melman, Arnold; Davies, Kelvin P

2008-08-01

Several reports suggest that the rat Vcsa1 gene is down-regulated in models of erectile dysfunction. The Vcsa protein product sialorphin is an endogenous neutral endopeptidase inhibitor and its down-regulation could result in prolonged activation of G-protein activated signaling pathways by their peptide agonists. We investigated whether Vcsa1 down-regulation could result in an adaptive change in GPCR (G-protein coupled receptor) expression. Gene expression in cultured rat corporeal smooth muscle cells following treatment with siRNA directed against Vcsa1 or the neutral endopeptidase gene was analyzed using microarray and quantitative reverse transcriptase-polymerase chain reaction. In rats Vcsa1 is one of the most down-regulated genes following bilateral transection of the cavernous nerves. In that animal model we also investigated whether Vcsa1 down-regulation was accompanied by similar changes in gene expression in corporeal smooth muscle cells in which Vcsa1 was knocked down in vitro. Microarray analysis and quantitative reverse transcriptase-polymerase chain reaction demonstrated that corporeal smooth muscle cells treated in vitro with siRNA against Vcsa1 resulted in GPCR up-regulation as a functional group. In contrast, treatment of corporeal smooth muscle cells that lowered neutral endopeptidase activity resulted in decreased GPCR expression. These results suggest that the peptide product of Vcsa1, sialorphin, can effect GPCR expression by acting on neutral endopeptidase. In animals with bilaterally transected cavernous nerves the decreased Vcsa1 expression is accompanied by increased GPCR expression in cavernous tissue. These experiments suggest that the mechanism by which Vcsa1 modulates erectile function is partly mediated through changes in GPCR expression.

MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells

PubMed Central

Riepsaame, Joey; van Oudenaren, Adri; den Broeder, Berlinda J. H.; van IJcken, Wilfred F. J.; Pothof, Joris; Leenen, Pieter J. M.

2013-01-01

Dendritic cell (DC) maturation is a tightly regulated process that requires coordinated and timed developmental cues. Here we investigate whether microRNAs are involved in this process. We identify microRNAs in mouse GM-CSF-generated, monocyte-related DC (GM-DC) that are differentially expressed during both spontaneous and LPS-induced maturation and characterize M-CSF receptor (M-CSFR), encoded by the Csf1r gene, as a key target for microRNA-mediated regulation in the final step toward mature DC. MicroRNA-22, -34a, and -155 are up-regulated in mature MHCIIhi CD86hi DC and mediate Csf1r mRNA and protein down-regulation. Experimental inhibition of Csf1r-targeting microRNAs in vitro results not only in sustained high level M-CSFR protein expression but also in impaired DC maturation upon stimulation by LPS. Accordingly, over-expression of Csf1r in GM-DC inhibits terminal differentiation. Taken together, these results show that developmentally regulated microRNAs control Csf1r expression, supplementing previously identified mechanisms that regulate its transcription and protein surface expression. Furthermore, our data indicate a novel function for Csf1r in mouse monocyte-derived DC, showing that down-regulation of M-CSFR expression is essential for final DC maturation. PMID:24198819

miR-1271 inhibits migration, invasion and epithelial-mesenchymal transition by targeting ZEB1 and TWIST1 in pancreatic cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Huaize; Wang, Han; Liu, Xiaoxiao

Pancreatic cancer (PC) remains one of the most lethal types of cancer in adults. The purpose of this study was to determine the role of miR-1271 in regulation of epithelial mesenchymal transition (EMT) and metastasis of pancreatic cancer cells. miR-1271 was identified to be significantly down-regulated in PC tissues by miRNA array. Also, an increase of EMT-regulators ZEB1 and TWIST1 expression level is accompanied by a decrease of miR-1271. We showed that expression of miR-1271 was significantly down-regulated in PC tissues as compared with that in normal tissues. In addition, our results showed that miR-1271 expression levels were decreased whilemore » ZEB1 and TWIST1 expression levels were increased in detected PC cell lines. Moreover, ectopic expression of miR-1271 suppressed and antagomiR-1271 promoted proliferation, migration, and invasion in SW1990 and PANC-1 cells. Bioinformatics coupled with luciferase and Western blot assays also revealed that miR-1271 inhibited expression of ZEB1 and TWIST1, which are master regulators of tumor metastasis. Our study first indicates that miR-1271 functions as a suppressor in regulating of pancreatic cancer EMT by targeting ZEB1 and TWIST1, and it promise as a therapeutic target and prognostic marker for metastatic pancreatic cancer. - Highlights: • miR-1271 is downregulated in pancreatic cancer tissues and cell lines. • miR-1271 regulates cell metastasis ability and EMT marker expression. . • miR-1271 directly targets ZEB1 and TWIST1. • ZEB1 and TWIST1 are functionally related to the effects of miR-1271.« less

Analysis of Snail1 function and regulation by Twist1 in palatal fusion.

PubMed

Yu, Wenli; Zhang, Yanping; Ruest, L Bruno; Svoboda, Kathy K H

2013-01-01

Palatal fusion is a tightly controlled process which comprises multiple cellular events, including cell movement and differentiation. Midline epithelial seam (MES) degradation is essential to palatal fusion. In this study, we analyzed the function of Snail1 during the degradation of the MES. We also analyzed the mechanism regulating the expression of the Snail1 gene in palatal shelves. Palatal explants treated with Snail1 siRNA did not degrade the MES and E-cadherin was not repressed leading to failure of palatal fusion. Transforming growth factor beta 3 (Tgfβ3) regulated Snail1 mRNA, as Snail1 expression decreased in response to Tgfβ3 neutralizing antibody and a PI-3 kinase (PI3K) inhibitor. Twist1, in collaboration with E2A factors, regulated the expression of Snail1. Twist1/E47 dimers bond to the Snail1 promoter to activate expression. Without E47, Twist1 repressed Snail1 expression. These results support the hypothesis that Tgfβ3 may signal through Twist1 and then Snail1 to downregulate E-cadherin expression during palatal fusion.

PU.1 regulates TCR expression by modulating GATA-3 activity

PubMed Central

Chang, Hua-Chen; Han, Ling; Jabeen, Rukhsana; Carotta, Sebastian; Nutt, Stephen L.; Kaplan, Mark H.

2009-01-01

The Ets transcription factor PU.1 is a master regulator for the development of multiple lineages during hematopoiesis. The expression pattern of PU.1 is dynamically regulated during early T lineage development in the thymus. We previously revealed that PU.1 delineates heterogeneity of effector Th2 populations. In this study, we further define the function of PU.1 on the Th2 phenotype using mice that specifically lack PU.1 in T cells using an lck-Cre transgene with a conditional Sfpi1 allele (Sfpi1lck-/-). While deletion of PU.1 by the lck-Cre transgene does not affect T cell development, Sfpi1lck-/- T cells have a lower activation threshold than wild type T cells. When TCR engagement is limiting, Sfpi1lck-/- T cells cultured in Th2 polarizing conditions secrete higher levels of Th2 cytokines and have greater cytokine homogeneity than wild type cells. We show that PU.1 modulates the levels of TCR expression in CD4+ T cells by regulating the DNA-binding activity of GATA-3 and limiting GATA-3 regulation of TCR gene expression. GATA-3 dependent regulation of TCR expression is also observed in Th1 and Th2 cells. In CD4+ T cells, PU.1 expression segregates into subpopulations of cells that have lower levels of surface TCR, suggesting that PU.1 contributes to the heterogeneity of TCR expression. Thus, we have identified a mechanism whereby increased GATA-3 function in the absence of the antagonizing activity of PU.1 leads to increased TCR expression, a reduced activation threshold and increased homogeneity in Th2 populations. PMID:19801513

UP-REGULATION OF IL-6, IL-8 AND CCL2 GENE EXPRESSION AFTER ACUTE INFLAMMATION: CORRELATION TO CLINICAL PAIN

PubMed Central

Wang, Xiao-Min; Hamza, May; Wu, Tai-Xia; Dionne, Raymond A.

2012-01-01

Tissue injury initiates a cascade of inflammatory mediators and hyperalgesic substances including prostaglandins, cytokines and chemokines. Using microarray and qRT-PCR gene expression analyses, the present study evaluated changes in gene expression of a cascade of cytokines following acute inflammation and the correlation between the changes in the gene expression level and pain intensity in the oral surgery clinical model of acute inflammation. Tissue injury resulted in a significant up-regulation in the gene expression of Interleukin-6 (IL-6; 63.3-fold), IL-8 (8.1-fold), chemokine (C-C motif) ligand 2 (CCL2; 8.9-fold), chemokine (C-X-C motif) ligand 1 (CXCL1; 30.5-fold), chemokine (C-X-C motif) ligand 2 (CXCL2; 26-fold) and annexin A1 (ANXA1; 12-fold). The up-regulation of IL-6 gene expression was significantly correlated to the up-regulation on the gene expression of IL-8, CCL2, CXCL1 and CXCL2. Interestingly, the tissue injury induced up-regulation of IL-6 gene expression, IL-8 and CCL2 were positively correlated to pain intensity at 3 hours post-surgery, the onset of acute inflammatory pain. However, ketorolac treatment did not have a significant effect on the gene expression of IL-6, IL-8, CCL2, CXCL2 and ANXA1 at the same time point of acute inflammation. These results demonstrate that up-regulation of IL-6, IL-8 and CCL2 gene expression contributes to the development of acute inflammation and inflammatory pain. The lack of effect for ketorolac on the expression of these gene products may be related to the ceiling analgesic effects of non-steroidal anti-inflammatory drugs. PMID:19233564

Regulation of Msx-1, Msx-2, Bmp-2 and Bmp-4 during foetal and postnatal mammary gland development.

PubMed

Phippard, D J; Weber-Hall, S J; Sharpe, P T; Naylor, M S; Jayatalake, H; Maas, R; Woo, I; Roberts-Clark, D; Francis-West, P H; Liu, Y H; Maxson, R; Hill, R E; Dale, T C

1996-09-01

Expression of the Msx-1 and Msx-2 homeobox genes have been shown to be coordinately regulated with the Bmp-2 and Bmp-4 ligands in a variety of developing tissues. Here we report that transcripts from all four genes are developmentally regulated during both foetal and postnatal mammary gland development. The location and time-course of the Bmp and Msx expression point to a role for Msx and Bmp gene products in the control of epithelial-mesenchymal interactions. Expression of Msx-2, but not Msx-1, Bmp-2 or Bmp-4 was decreased following ovariectomy, while expression of the human Msx-2 homologue was regulated by 17beta-oestradiol in the MCF-7 breast cancer cell line. The regulation of Msx-2 expression by oestrogen raises the possibility that hormonal regulation of mammary development is mediated through the control of epithelial-mesenchymal interactions.

Epigenetic and SP1-mediated regulation is involved in the repression of galactokinase 1 gene in the liver of neonatal piglets born to betaine-supplemented sows.

PubMed

Cai, Demin; Yuan, Mengjie; Liu, Haoyu; Han, Zhengqiang; Pan, Shifeng; Yang, Yang; Zhao, Ruqian

2017-08-01

In this study, we sought to investigate the effects of maternal betaine supplementation on the expression and regulation of GALK1 gene in the liver of neonatal piglets. Sixteen sows of two groups were fed control or betaine-supplemented diets (3 g/kg), respectively, throughout the pregnancy. Newborn piglets were individually weighed immediately after birth, and one male piglet close to mean body weight from the same litter was selected and killed before suckling. Serum samples of newborn piglets were analyzed for biochemical indexes, hormone and amino acid levels. Liver samples were analyzed for GALK1 expression by real-time PCR and western blotting, while GALK1 regulational mechanism was analyzed by methylated DNA immunoprecipitation, chromatin immunoprecipitation and microRNAs expression. Betaine-exposed neonatal piglets had lower serum concentration of galactose, which was associated with significantly down-regulated hepatic GALK1 expression. The repression of GALK1 mRNA expression was associated with DNA hypermethylation and more enriched repression histone mark H3K27me3 on its promoter. Binding sites of SP1, GR and STAT3 were predicted on GALK1 promoter, and decreased SP1 protein content and lower SP1 binding to GALK1 promoter were detected in the liver of betaine-exposed piglets. Furthermore, the expression of miRNA-149 targeting GALK1 was up-regulated in the liver of betaine-exposed piglets, along with elevated miRNAs-processing enzymes Dicer and Ago2. Our results suggest that maternal dietary betaine supplementation during gestation suppresses GALK1 expression in the liver of neonatal piglets, which involves complex gene regulation mechanisms including DNA methylation, histone modification, miRNAs expression and SP1-mediated transcriptional modulation.

TrkB activation by 7, 8-dihydroxyflavone increases synapse AMPA subunits and ameliorates spatial memory deficits in a mouse model of Alzheimer's disease.

PubMed

Gao, Lei; Tian, Mi; Zhao, Hong-Yun; Xu, Qian-Qian; Huang, Yu-Ming; Si, Qun-Cao; Tian, Qing; Wu, Qing-Ming; Hu, Xia-Min; Sun, Li-Bo; McClintock, Shawn M; Zeng, Yan

2016-02-01

We recently demonstrated that activation of tyrosine receptor kinase B (TrkB) by 7, 8-dihydroxyflavone (7, 8-DHF), the selective TrkB agonist, increased surface alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors (AMPARs) AMPA receptor subunit GluR1 (GluA1) subunit expression at the synapses of Fragile X Syndrome mutant mice. This present study investigated the effects of 7, 8-DHF on both memory function and synapse structure in relation to the synapse protein level of AMPARs in the Tg2576 Alzheimer's disease (AD) mouse model. The study found that chronic oral administration of 7, 8-DHF significantly improved spatial memory and minimized dendrite loss in the hippocampus of Tg2576 mice. A key feature of 7, 8-DHF action was the increased expression of both GluA1 and GluA2 at synapses. Interestingly, 7, 8-DHF had no effect on the attenuation of amyloid precursor protein or Aβ exhibiting in the Tg2576 AD brains, yet it activated the phosphorylation of TrkB receptors and its downstream signals including CaMKII, Akt, Erk1/2, and cAMP-response element-binding protein. Importantly, cyclotraxin B (a TrkB inhibitor), U0126 (a Ras-ERK pathway inhibitor), Wortmannin (an Akt phosphorylation inhibitor), and KN-93 (a CaMKII inhibitor) counteracted the enhanced expression and phosphorylation of AMPAR subunits induced by 7, 8-DHF. Collectively, our results demonstrated that 7, 8-DHF acted on TrkB and resolved learning and memory impairments in the absence of reduced amyloid in amyloid precursor protein transgenic mice partially through improved synaptic structure and enhanced synaptic AMPARs. The findings suggest that the application of 7, 8-DHF may be a promising new approach to improve cognitive abilities in AD. We provided extensive data demonstrating that 7, 8-dihydroflavone, the TrkB agonist, improved Tg2576 mice spatial memory. This improvement is correlated with a reversion to normal values of GluA1 and GluA2 AMPA receptor subunits and dendritic spines in CA1. This work suggests that 7, 8-DHF is a suitable drug to potentiate in vivo Tropomyosin receptor kinase B (TrkB) signaling in the Alzheimer's disease mice model. © 2015 International Society for Neurochemistry.

The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zuloaga, R.; Fuentes, E.N.; Molina, A.

2013-10-18

Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP{sub 3}/calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1more » during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation.« less

Individual stress vulnerability is predicted by short-term memory and AMPA receptor subunit ratio in the hippocampus.

PubMed

Schmidt, Mathias V; Trümbach, Dietrich; Weber, Peter; Wagner, Klaus; Scharf, Sebastian H; Liebl, Claudia; Datson, Nicole; Namendorf, Christian; Gerlach, Tamara; Kühne, Claudia; Uhr, Manfred; Deussing, Jan M; Wurst, Wolfgang; Binder, Elisabeth B; Holsboer, Florian; Müller, Marianne B

2010-12-15

Increased vulnerability to aversive experiences is one of the main risk factors for stress-related psychiatric disorders as major depression. However, the molecular bases of vulnerability, on the one hand, and stress resilience, on the other hand, are still not understood. Increasing clinical and preclinical evidence suggests a central involvement of the glutamatergic system in the pathogenesis of major depression. Using a mouse paradigm, modeling increased stress vulnerability and depression-like symptoms in a genetically diverse outbred strain, and we tested the hypothesis that differences in AMPA receptor function may be linked to individual variations in stress vulnerability. Vulnerable and resilient animals differed significantly in their dorsal hippocampal AMPA receptor expression and AMPA receptor binding. Treatment with an AMPA receptor potentiator during the stress exposure prevented the lasting effects of chronic social stress exposure on physiological, neuroendocrine, and behavioral parameters. In addition, spatial short-term memory, an AMPA receptor-dependent behavior, was found to be predictive of individual stress vulnerability and response to AMPA potentiator treatment. Finally, we provide evidence that genetic variations in the AMPA receptor subunit GluR1 are linked to the vulnerable phenotype. Therefore, we propose genetic variations in the AMPA receptor system to shape individual stress vulnerability. Those individual differences can be predicted by the assessment of short-term memory, thereby opening up the possibility for a specific treatment by enhancing AMPA receptor function.

Differential regulation of Hes/Hey genes during inner ear development.

PubMed

Petrovic, Jelena; Gálvez, Hector; Neves, Joana; Abelló, Gina; Giraldez, Fernando

2015-07-01

Notch signaling plays a crucial role during inner ear development and regeneration. Hes/Hey genes encode for bHLH transcription factors identified as Notch targets. We have studied the expression and regulation of Hes/Hey genes during inner ear development in the chicken embryo. Among several Hes/Hey genes examined, only Hey1 and Hes5 map to the sensory regions, although with salient differences. Hey1 expression follows Jag1 expression except at early prosensory stages while Hes5 expression corresponds well to Dl1 expression throughout otic development. Although Hey1 and Hes5 are direct Notch downstream targets, they differ in the level of Notch required for activation. Moreover, they also differ in mRNA stability, showing different temporal decays after Notch blockade. In addition, Bmp, Wnt and Fgf pathways also modify Hey1 and Hes5 expression in the inner ear. Particularly, the Wnt pathway modulates Hey1 and Jag1 expression. Finally, gain of function experiments show that Hey1 and Hes5 cross-regulate each other in a complex manner. Both Hey1 and Hes5 repress Dl1 and Hes5 expression, suggesting that they prevent the transition to differentiation stages, probably by preventing Atoh1 expression. In spite of its association with Jag1, Hey1 does not seem to be instrumental for lateral induction as it does not promote Jag1 expression. We suggest that, besides being both targets of Notch, Hey1 and Hes5 are subject to a rather complex regulation that includes the stability of their transcripts, cross regulation and other signaling pathways. © 2014 Wiley Periodicals, Inc.

Exendin-4 Upregulates Adiponectin Level in Adipocytes via Sirt1/Foxo-1 Signaling Pathway

PubMed Central

Wang, Anping; Li, Ting; An, Ping; Yan, Wenhua; Zheng, Hua; Wang, Baoan; Mu, Yiming

2017-01-01

Glucagon-like peptide-1 (GLP-1) receptor plays an essential role in regulating glucose metabolism. GLP-1 receptor agonists have been widely used for treating diabetes and other insulin resistance-related diseases. However, mechanisms underlying the anti-diabetic effects of GLP-1 receptor agonists remain largely unknown. In this study, we investigated the effects of GLP-1 agonist exendin-4 on the expression of adiponectin, an insulin sensitizing hormone. We found that exendin-4 increased the expression and secretion of adiponectin both in vitro and in vivo. Our data showed that exendin-4 upregulated adiponectin expression at both mRNA and protein levels in adipocytes and adipose tissues. The effects of exendin-4 on adiponectin expression were dependent on the GLP-1 receptor. We further demonstrated important roles of Sirt1 and transcriptional factor Foxo-1 in mediating the function of exendin-4 in regulating adiponectin expression. Suppression of Sirt1 or Foxo-1 expression significantly impaired exendin-4-induced adiponectin expression. Consistently, exendin-4 up-regulated Sirt1 and Foxo-1 expression in vivo. Our work is the first study demonstrating the role of Sirt1/Foxo-1 in regulating the regulatory function of a GLP-1 receptor agonist in adiponectin expression both in vitro and in vivo. The results provide important information for the mechanism underlying the function of GLP-1R on improving insulin resistance and related diseases. PMID:28122026

Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

PubMed Central

Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y.

2013-01-01

Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF-Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrfl attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. PMID:23623971

H3K9me3 Inhibition Improves Memory, Promotes Spine Formation, and Increases BDNF Levels in the Aged Hippocampus

PubMed Central

Prieto, G. Aleph; Petrosyan, Arpine; Loertscher, Brad M.; Dieskau, André P.; Overman, Larry E.; Cotman, Carl W.

2016-01-01

An increasing number of studies show that an altered epigenetic landscape may cause impairments in regulation of learning and memory-related genes within the aged hippocampus, eventually resulting in cognitive deficits in the aged brain. One such epigenetic repressive mark is trimethylation of H3K9 (H3K9me3), which is typically implicated in gene silencing. Here, we identify, for the first time, an essential role for H3K9me3 and its histone methyl transferase (SUV39H1) in mediating hippocampal memory functions. Pharmacological inhibition of SUV39H1 using a novel and selective inhibitor decreased levels of H3K9me3 in the hippocampus of aged mice, and improved performance in the objection location memory and fear conditioning tasks and in a complex spatial environment learning task. The inhibition of SUV39H1 induced an increase in spine density of thin and stubby but not mushroom spines in the hippocampus of aged animals and increased surface GluR1 levels in hippocampal synaptosomes, a key index of spine plasticity. Furthermore, there were changes at BDNF exon I gene promoter, in concert with overall BDNF levels in the hippocampus of drug-treated animals compared with control animals. Together, these data demonstrate that SUV39H1 inhibition and the concomitant H3K9me3 downregulation mediate gene transcription in the hippocampus and reverse age-dependent deficits in hippocampal memory. SIGNIFICANCE STATEMENT Cognitive decline is a debilitating condition associated with not only neurodegenerative diseases but also aging in general. However, effective treatments have been slow to emerge so far. In this study, we demonstrate that epigenetic regulation of key synaptic proteins may be an underlying, yet reversible, cause of this decline. Our findings suggest that histone 3 trimethylation is a probable target for pharmacological intervention that can counteract cognitive decline in the aging brain. Finally, we provide support to the hypothesis that, by manipulating the enzyme that regulates H3K9me3 (using a newly developed specific inhibitor of SUV39H1), it is possible to alter the chromatin state of subjects and restore memory and synaptic function in the aging brain. PMID:27013689

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tan, Min; Wu, Junjie, E-mail: wujunjiesh@126.com; State Key Laboratory of Genetic Engineering and Ministry of Education Key Laboratory of Contemporary Anthropology, School of Life Sciences, Fudan University, Shanghai 200433

Highlights: •Dnmt3A and Dnmt3B are involved in the down-regulation of WIF-1 expression in non-small-cell lung cancer. •MiR-29 family members could restore WIF-1 expression through demethylation. •MiR-29s suppress Wnt/β-catenin signaling pathway and inhibit tumor growth. •The expression of miR-29a and miR-29b could be regulated partially in a positive feedback loop. -- Abstract: Wnt inhibitory factor-1 (WIF-1) silencing induced by promoter hypermethylation is a common mechanism of aberrant activation of the Wnt signaling pathway in non-small-cell lung cancer (NSCLC). However, the activity of regulators associated with the methylation of the WIF-1 gene remains unclear. Here, we investigated the role of three DNAmore » methyltransferases (DNMT1, DNMT3A and DNMT3B) in the expression of WIF-1. The three DNMTs were up-regulated in NSCLC tumor tissues and suppression of DNMT3A and DNMT3B restored the expression of WIF-1 in NSCLC cells. The miR-29 family (miR-29a, -29b, and -29c), which negatively regulates DNMT3A and DNMT3B, was examined in association with the Wnt/β-catenin signaling pathway. A positive correlation between the expression of WIF-1 and that of MiR-29s was observed in NSCLC tissues. Methylation-specific PCR and Western blotting indicated that miR-29s positively regulate WIF-1 expression by inhibiting the methylation of its promoter. Furthermore, miR-29 overexpression downregulated β-catenin expression, inhibited cell proliferation and induced apoptosis. The expression of miR-29a and miR-29b was partially regulated by DNMT3A and DNMT3B in a positive feedback loop. Taken together, our findings show that miR-29s suppress the Wnt signaling pathway through demethylation of WIF-1 in NSCLC.« less

Long noncoding RNA MALAT1 promotes osterix expression to regulate osteogenic differentiation by targeting miRNA-143 in human bone marrow-derived mesenchymal stem cells.

PubMed

Gao, Yuan; Xiao, Fei; Wang, Chenglong; Wang, Chuandong; Cui, Penglei; Zhang, Xiaoling; Chen, Xiaodong

2018-05-09

Osteogenic differentiation of human bone marrow-derived mesenchymal stem cells (hBMSCs) is essential for the human bone formation, and emerging evidence shows that long non-coding RNAs (lncRNAs) play important roles in hBMSC osteogenic differentiation. MALAT1 is often regarded as a tumor-related lncRNA, but its function in mesenchymal stem cell differentiation remains to be defined. In this study, we aimed to investigate whether MALAT1 regulates Osterix (Osx) expression by sponging miR-143 to promote hBMSC osteogenic differentiation. Firstly, we found that the expression of MALAT1 was much lower in hBMSCs from osteoporosis patients and miR-143 was contrarily higher. In addition, MALAT1 expression increased, and miR-143 decreased when hBMSCs were treated with osteogenic induction. Then, we used short hairpin RNAs to knockdown MALAT1, and the results showed that hBMSC osteogenic differentiation decreased significantly, indicating that MALAT1 is a positive regulator of osteogenic differentiation in hBMSCs. Furthermore, by luciferase assays, we found that MALAT1 could directly bind to miR-143 and negatively regulate its expression. Similarly, miR-143 could directly bind to the target site on the Osx 3'-UTR and then inhibit Osx expression. Knockdown of MALAT1 decreased Osx expression, and co-transfection of miR-143 inhibitor could rescue Osx mRNA expression. While Osx expression was increased in MALAT1-overexpressing hBMSCs, it was reversed by the miR-143 mimics. Moreover, Osx silencing decreased ALP, OCN, and OPN mRNA expression induced by the miR-143 inhibitor. Altogether, our findings suggest that MALAT1 acts to regulate Osx expression through targeting miR-143; thus, it is considered as a positive regulator in hBMSC osteogenic differentiation. © 2018 Wiley Periodicals, Inc.

Dmrta1 regulates proneural gene expression downstream of Pax6 in the mammalian telencephalon.

PubMed

Kikkawa, Takako; Obayashi, Takeshi; Takahashi, Masanori; Fukuzaki-Dohi, Urara; Numayama-Tsuruta, Keiko; Osumi, Noriko

2013-08-01

The transcription factor Pax6 balances cell proliferation and neuronal differentiation in the mammalian developing neocortex by regulating the expression of target genes. Using microarray analysis, we observed the down-regulation of Dmrta1 (doublesex and mab-3-related transcription factor-like family A1) in the telencephalon of Pax6 homozygous mutant rats (rSey(2) /rSey(2) ). Dmrta1 expression was restricted to the neural stem/progenitor cells of the dorsal telencephalon. Overexpression of Dmrta1 induced the expression of the proneural gene Neurogenin2 (Neurog2) and conversely repressed Ascl1 (Mash1), a proneural gene expressed in the ventral telencephalon. We found that another Dmrt family molecule, Dmrt3, induced Neurog2 expression in the dorsal telencephalon. Our novel findings suggest that dual regulation of proneural genes mediated by Pax6 and Dmrt family members is crucial for cortical neurogenesis. © 2013 The Authors Genes to Cells © 2013 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Sijeong; Kwon, Hwang; Yoon, Hyemin

The sine oculis homeobox 1 (SIX1) is a member of the Six gene family. SIX1 is involved in tissue development by regulating proliferation, apoptosis, and differentiation. However, function of SIX1 in the uterus remains unknown. Here, we found that Six1 expression is regulated along the estrous cycle in mouse uterus. Six1 expression was significantly increased at estrus stage and decreased at the rest of stages. SIX1 is detected in the luminal and glandular epithelium of uterine endometrium at the estrus stage. Estrogen injection increased Six1 expression in the ovariectomized mouse uterus, whereas progesterone had no effect on its expression. Estrogenmore » receptor antagonist inhibited estrogen-induced Six1 expression. Our findings imply that SIX1 may play a role as an important regulator to orchestrate the dynamic of uterine endometrium in response to estrogen level during the estrous cycle. These results will give us a better understanding of uterine biology. - Highlights: • Six1 expression is regulated during the estrous cycle in mouse uterus. • Six1 is highly expressed at the estrus stage of estrous cycle. • SIX1 is detected in luminal/glandular epithelium of the uterus at the estrus stage. • Estrogen stimulates Six1 expression in an estrogen receptor-dependent manner.« less

PKA, novel PKC isoforms, and ERK is mediating PACAP auto-regulation via PAC1R in human neuroblastoma NB-1 cells.

PubMed

Georg, Birgitte; Falktoft, Birgitte; Fahrenkrug, Jan

2016-12-01

The neuropeptide PACAP is expressed throughout the central and peripheral nervous system where it modulates diverse physiological functions including neuropeptide gene expression. We here report that in human neuroblastoma NB-1 cells PACAP transiently induces its own expression. Maximal PACAP mRNA expression was found after stimulation with PACAP for 3h. PACAP auto-regulation was found to be mediated by activation of PACAP specific PAC 1 Rs as PACAP had >100-fold higher efficacy than VIP, and the PAC 1 R selective agonist Maxadilan potently induced PACAP gene expression. Experiments with pharmacological kinase inhibitors revealed that both PKA and novel but not conventional PKC isozymes were involved in the PACAP auto-regulation. Inhibition of MAPK/ERK kinase (MEK) also impeded the induction, and we found that PKA, novel PKC and ERK acted in parallel and were thus not part of the same pathways. The expression of the transcription factor EGR1 previously ascribed as target of PACAP signalling was found to be transiently induced by PACAP and pharmacological inhibition of either PKC or MEK1/2 abolished PACAP mediated EGR1 induction. In contrast, inhibition of PKA mediated increased PACAP mediated EGR1 induction. Experiments using siRNA against EGR1 to lower the expression did however not affect the PACAP auto-regulation indicating that this immediate early gene product is not part of PACAP auto-regulation in NB-1 cells. We here reveal that in NB-1 neuroblastoma cells, PACAP induces its own expression by activation of PAC 1 R, and that the signalling is different from the PAC 1 R signalling mediating induction of VIP in the same cells. PACAP auto-regulation depends on parallel activation of PKA, novel PKC isoforms, and ERK, while EGR1 does not seem to be part of the PACAP auto-regulation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Klotho down-regulates Egr-1 by inhibiting TGF-β1/Smad3 signaling in high glucose treated human mesangial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yang; Department of Geriatrics, Zhu Jiang Hospital, Southern Medical University, Guangzhou, Guangdong; Hu, Fang

Diabetic kidney disease (DKD) has become the leading cause of end-stage renal disease worldwide and is associated with glomerular mesangial cell (MC) proliferation and excessive extracellular matrix (ECM) production. Klotho can attenuate renal fibrosis in part by inhibiting TGF-β1/Smad3 signaling in DKD. Early growth response factor 1 (Egr-1) has been shown to play a key role in renal fibrosis in part by facilitating the formation of a positive feedback loop involving TGF-β1. However, whether Klotho down-regulates Egr-1 by inhibiting TGF-β1/Smad3 signaling in DKD is unclear. In the present study, we assessed human MCs that were incubated under high-glucose conditions tomore » mimic diabetes. Then, we transfected the cells with Klotho plasmid or siRNA to overexpress or knock down Klotho gene and protein expression. Klotho, Egr-1, fibronectin (FN), collagen type I (Col I), Smad3 and phosphorylated Smad3 (p-Smad3) gene and protein expression levels were determined by RT-qPCR and western blotting respectively. High glucose time-dependently down-regulated Klotho mRNA and protein expression in cultured human MCs. pcDNA3.1-Klotho transfection-mediated Klotho overexpression down-regulated Egr-1, FN and Col I expression and the p-Smad3/Smad3 ratio in human MCs. Conversely, siRNA-mediated Klotho silencing up-regulated Egr-1, FN, and Col I expression and the p-Smad3/Smad3 ratio. Moreover, the effects of si-Klotho on Egr-1 expression were abolished by the TGF-β1 inhibitor SB-431542. Klotho overexpression can prevent mesangial ECM production in high-glucose-treated human MCs, an effect that has been partially attributed to Egr-1 down-regulation facilitated by TGF-β1/Smad3 signaling inhibition. - Highlights: • High glucose time-dependently down-regulated Klotho mRNA and protein expression in cultured human MCs. • Klotho overexpression down-regulated Egr-1 and prevented mesangial ECM production in high-glucose-treated human MCs. • Klotho down-regulated Egr-1 by inhibiting TGF-β1/Smad3 signaling in high-glucose-treated human MCs.« less

Shikonin regulates C-MYC and GLUT1 expression through the MST1-YAP1-TEAD1 axis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vališ, Karel, E-mail: karel.valis@biomed.cas.cz; Faculty of Science, Charles University, Prague; Talacko, Pavel

The general mechanism underlying the tumor suppressor activity of the Hippo signaling pathway remains unclear. In this study, we explore the molecular mechanisms connecting the Hippo signaling pathway with glucose metabolism. We have found that two key regulators of glycolysis, C-MYC and GLUT1, are targets of the Hippo signaling pathway in human leukemia cells. Our results revealed that activation of MST1 by the natural compound shikonin inhibited the expression of GLUT1 and C-MYC. Furthermore, RNAi experiments confirmed the regulation of GLUT1 and C-MYC expression via the MST1-YAP1-TEAD1 axis. Surprisingly, YAP1 was found to positively regulate C-MYC mRNA levels in complexmore » with TEAD1, while it negatively regulates C-MYC levels in cooperation with MST1. Hence, YAP1 serves as a rheostat for C-MYC, which is regulated by MST1. In addition, depletion of MST1 stimulates lactate production, whereas the specific depletion of TEAD1 has an opposite effect. The inhibition of lactate production and cellular proliferation induced by shikonin also depends on the Hippo pathway activity. Finally, a bioinformatic analysis revealed conserved TEAD-binding motifs in the C-MYC and GLUT1 promoters providing another molecular data supporting our observations. In summary, regulation of glucose metabolism could serve as a new tumor suppressor mechanism orchestrated by the Hippo signaling pathway. - Highlights: • Shikonin inhibits C-MYC and GLUT1 expression in MST1 and YAP1 dependent manner. • YAP1-TEAD1 interaction activates C-MYC and GLUT1 expression. • MST1 in cooperation with YAP1 inhibits C-MYC and GLUT1 expression. • MST1-YAP1-TEAD1 axis regulates lactate production by leukemic cells. • MST1 and YAP1 proteins block proliferation of leukemic cells.« less

Macrophage migration inhibitory factor counter-regulates dexamethasone-induced annexin 1 expression and influences the release of eicosanoids in murine macrophages.

PubMed

Sun, Yu; Wang, Yu; Li, Jia-Hui; Zhu, Shi-Hui; Tang, Hong-Tai; Xia, Zhao-Fan

2013-10-01

Macrophage migration inhibitory factor (MIF), a pro-inflammatory cytokine and glucocorticoid (GC) counter-regulator, has emerged as an important modulator of inflammatory responses. However, the molecular mechanisms of MIF counter-regulation of GC still remain incomplete. In the present study, we investigated whether MIF mediated the counter-regulation of the anti-inflammatory effect of GC by affecting annexin 1 in RAW 264.7 macrophages. We found that stimulation of RAW 264.7 macrophages with lipopolysaccharide (LPS) resulted in down-regulation of annexin 1, while GC dexamethasone (Dex) or Dex plus LPS led to significant up-regulation of annexin 1 expression. RNA interference-mediated knockdown of intracellular MIF increased annexin 1 expression with or without incubation of Dex, whereas Dex-induced annexin 1 expression was counter-regulated by the exogenous application of recombinant MIF. Moreover, recombinant MIF counter-regulated, in a dose-dependent manner, inhibition of cytosolic phospholipase A2α (cPLA2α) activation and prostaglandin E2 (PGE2 ) and leukotriene B4 (LTB4 ) release by Dex in RAW 264.7 macrophages stimulated with LPS. Endogenous depletion of MIF enhanced the effects of Dex, reflected by further decease of cPLA2α expression and lower PGE2 and LTB4 release in RAW 264.7 macrophages. Based on these data, we suggest that MIF counter-regulates Dex-induced annexin 1 expression, further influencing the activation of cPLA2α and the release of eicosanoids. These findings will add new insights into the mechanisms of MIF counter-regulation of GC. © 2013 John Wiley & Sons Ltd.

Ethylene and cold participate in the regulation of LeCBF1 gene expression in postharvest tomato fruits.

PubMed

Zhao, Danying; Shen, Lin; Fan, Bei; Yu, Mengmeng; Zheng, Yang; Lv, Shengnan; Sheng, Jiping

2009-10-20

C-repeat/dehydration-responsive element binding factor (CBF) is a transcription factor regulating cold response in plants, of which little is known in fruits. We showed a double-peak expression pattern of Lycopersicon esculentum putative transcriptional activator CBF1 (LeCBF1) in mature green fruit. The peaks appeared at 2 and 16 h after subjection to cold storage (2 degrees C). The second peak was coincident with, and thus caused by a peak in endogenous ethylene production. We showed that LeCBF1 expression was regulated by exogenous ethylene and 1-methylcyclopropene, and was not expressed without cold induction. LeCBF1 expression was different in the five maturation stages of fruits, but expression peaked at 2 h at all stages.

Mechanisms for Antagonistic Regulation of AMPA and NMDA-D1 Receptor Complexes at Postsynaptic Sites

NASA Technical Reports Server (NTRS)

Schumann, Johann; Scheler, Gabriele

2004-01-01

From the analysis of these pathways we conclude that postsynaptic processes that regulate synaptic transmission undergo significant cross-talk with respect to glutamatergic and neuromodulatory (dopamine) signals. The main hypothesis is that of a compensatory regulation, a competitive switch between the induction of increased AMPA conductance by CaMKII-dependent phosphorylation and reduced expression of PP2A, and increased D1 receptor sensitivity and expression by increased PKA, PP2A and decreased PP-1/calcineurin expression. Both types of plasticity are induced by NMDA receptor activation and increased internal calcium, they require different internal conditions to become expressed. Specifically we propose that AMPA regulation and D1 regulation are inversely coupled;The net result may be a bifurcation of synaptic state into predominantly AMPA or NMDA-D1 synapses. This could have functional consequences: stable connections for AMPA and conditional gating for NMDA-D1 synapses.

miR-133 regulates Evi1 expression in AML cells as a potential therapeutic target.

PubMed

Yamamoto, Haruna; Lu, Jun; Oba, Shigeyoshi; Kawamata, Toyotaka; Yoshimi, Akihide; Kurosaki, Natsumi; Yokoyama, Kazuaki; Matsushita, Hiromichi; Kurokawa, Mineo; Tojo, Arinobu; Ando, Kiyoshi; Morishita, Kazuhiro; Katagiri, Koko; Kotani, Ai

2016-01-12

The Ecotropic viral integration site 1 (Evi1) is a zinc finger transcription factor, which is located on chromosome 3q26, over-expression in some acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS). Elevated Evi1 expression in AML is associated with unfavorable prognosis. Therefore, Evi1 is one of the strong candidate in molecular target therapy for the leukemia. MicroRNAs (miRNAs) are small non-coding RNAs, vital to many cell functions that negatively regulate gene expression by translation or inducing sequence-specific degradation of target mRNAs. As a novel biologics, miRNAs is a promising therapeutic target due to its low toxicity and low cost. We screened miRNAs which down-regulate Evi1. miR-133 was identified to directly bind to Evi1 to regulate it. miR-133 increases drug sensitivity specifically in Evi1 expressing leukemic cells, but not in Evi1-non-expressing cells The results suggest that miR-133 can be promising therapeutic target for the Evi1 dysregulated poor prognostic leukemia.

DREAM Mediated Regulation of GCM1 in the Human Placental Trophoblast

PubMed Central

Baczyk, Dora; Kibschull, Mark; Mellstrom, Britt; Levytska, Khrystyna; Rivas, Marcos; Drewlo, Sascha; Lye, Stephen J.; Naranjo, Jose R.; Kingdom, John C. P.

2013-01-01

The trophoblast transcription factor glial cell missing-1 (GCM1) regulates differentiation of placental cytotrophoblasts into the syncytiotrophoblast layer in contact with maternal blood. Reduced placental expression of GCM1 and abnormal syncytiotrophoblast structure are features of hypertensive disorder of pregnancy – preeclampsia. In-silico techniques identified the calcium-regulated transcriptional repressor – DREAM (Downstream Regulatory Element Antagonist Modulator) - as a candidate for GCM1 gene expression. Our objective was to determine if DREAM represses GCM1 regulated syncytiotrophoblast formation. EMSA and ChIP assays revealed a direct interaction between DREAM and the GCM1 promoter. siRNA-mediated DREAM silencing in cell culture and placental explant models significantly up-regulated GCM1 expression and reduced cytotrophoblast proliferation. DREAM calcium dependency was verified using ionomycin. Furthermore, the increased DREAM protein expression in preeclamptic placental villi was predominantly nuclear, coinciding with an overall increase in sumolylated DREAM and correlating inversely with GCM1 levels. In conclusion, our data reveal a calcium-regulated pathway whereby GCM1-directed villous trophoblast differentiation is repressed by DREAM. This pathway may be relevant to disease prevention via calcium-supplementation. PMID:23300953

RD26 mediates crosstalk between drought and brassinosteroid signalling pathways

PubMed Central

Ye, Huaxun; Liu, Sanzhen; Tang, Buyun; Chen, Jiani; Xie, Zhouli; Nolan, Trevor M.; Jiang, Hao; Guo, Hongqing; Lin, Hung-Ying; Li, Lei; Wang, Yanqun; Tong, Hongning; Zhang, Mingcai; Chu, Chengcai; Li, Zhaohu; Aluru, Maneesha; Aluru, Srinivas; Schnable, Patrick S.; Yin, Yanhai

2017-01-01

Brassinosteroids (BRs) regulate plant growth and stress responses via the BES1/BZR1 family of transcription factors, which regulate the expression of thousands of downstream genes. BRs are involved in the response to drought, however the mechanistic understanding of interactions between BR signalling and drought response remains to be established. Here we show that transcription factor RD26 mediates crosstalk between drought and BR signalling. When overexpressed, BES1 target gene RD26 can inhibit BR-regulated growth. Global gene expression studies suggest that RD26 can act antagonistically to BR to regulate the expression of a subset of BES1-regulated genes, thereby inhibiting BR function. We show that RD26 can interact with BES1 protein and antagonize BES1 transcriptional activity on BR-regulated genes and that BR signalling can also repress expression of RD26 and its homologues and inhibit drought responses. Our results thus reveal a mechanism coordinating plant growth and drought tolerance. PMID:28233777

AHCYL1 Is Mediated by Estrogen-Induced ERK1/2 MAPK Cell Signaling and MicroRNA Regulation to Effect Functional Aspects of the Avian Oviduct

PubMed Central

Ahn, Suzie E.; Lee, Sang In; Bazer, Fuller W.; Han, Jae Yong; Song, Gwonhwa

2012-01-01

S-adenosylhomocysteine hydrolase-like protein 1 (AHCYL1), also known as IP3 receptor-binding protein released with IP3 (IRBIT), regulates IP3-induced Ca2+ release into the cytoplasm of cells. AHCYL1 is a critical regulator of early developmental stages in zebrafish, but little is known about the function of AHCYL1 or hormonal regulation of expression of the AHCYL1 gene in avian species. Therefore, we investigated differential expression profiles of the AHCYL1 gene in various adult organs and in oviducts from estrogen-treated chickens. Chicken AHCYL1 encodes for a protein of 540 amino acids that is highly conserved and has considerable homology to mammalian AHCYL1 proteins (>94% identity). AHCYL1 mRNA was expressed abundantly in various organs of chickens. Further, the synthetic estrogen agonist induced AHCYL1 mRNA and protein predominantly in luminal and glandular epithelial cells of the chick oviduct. In addition, estrogen activated AHCYL1 through the ERK1/2 signal transduction cascade and that activated expression of AHCYL1 regulated genes affecting oviduct development in chicks as well as calcium release in epithelial cells of the oviduct. Also, microRNAs, miR-124a, miR-1669, miR-1710 and miR-1782 influenced AHCYL1 expression in vitro via its 3′-UTR which suggests that post-transcriptional events are involved in the regulation of AHCYL1 expression in the chick oviduct. In conclusion, these results indicate that AHCYL1 is a novel estrogen-stimulated gene expressed in epithelial cells of the chicken oviduct that likely affects growth, development and calcium metabolism of the mature oviduct of hens via an estrogen-mediated ERK1/2 MAPK cell signaling pathway. PMID:23145124

GBF1 differentially regulates CAT2 and PAD4 transcription to promote pathogen defense in Arabidopsis thaliana.

PubMed

Giri, Mrunmay K; Singh, Nidhi; Banday, Zeeshan Z; Singh, Vijayata; Ram, Hathi; Singh, Deepjyoti; Chattopadhyay, Sudip; Nandi, Ashis K

2017-09-01

G-BOX BINDING FACTOR 1 (GBF1) influences light-regulated seedling development in Arabidopsis, and inhibits CATALASE 2 (CAT2) expression during senescence. CAT2 functions as a scavenger of hydrogen peroxide. The role of GBF1 in the defense response is not known. We report here that GBF1 positively influences the defense against virulent and avirulent strains of Pseudomonas syringae. The gbf1 mutants are susceptible, whereas GBF1 over-expresser transgenic plants are resistant to bacterial pathogens. GBF1 negatively regulates pathogen-induced CAT2 expression and thereby positively regulates the hypersensitive response. In addition to CAT2 promoter, GBF1 binds to the G-box-like element present in the intron of PHYTOALEXIN DEFICIENT 4 (PAD4). This association of GBF1 with PAD4 intron is enhanced upon pathogenesis. GBF1 positively regulates PAD4 transcription in an intron-dependent manner. GBF1-mediated positive regulation of PAD4 expression is also evident in gbf1 mutant and GBF1 over-expression lines. Similar to pad4 mutants, pathogen-induced camalexin and salicylic acid (SA) accumulation, and expression of SA-inducible PATHOGENESIS RELATED1 (PR1) gene are compromised in the gbf1 mutant. Exogenous application of SA rescues the loss-of-defense phenotypes of gbf1 mutant. Thus, altogether, our results demonstrate that GBF1 is an important component of the plant defense response that functions upstream of SA accumulation and, by oppositely regulating CAT2 and PAD4, promotes disease resistance in Arabidopsis. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

The spatial expression and regulation of transcription factors IDEF1 and IDEF2

PubMed Central

Kobayashi, Takanori; Ogo, Yuko; Aung, May Sann; Nozoye, Tomoko; Itai, Reiko Nakanishi; Nakanishi, Hiromi; Yamakawa, Takashi; Nishizawa, Naoko K.

2010-01-01

Background and Aims Under conditions of low iron availability, rice plants induce genes involved in iron uptake and utilization. The iron deficiency-responsive cis-acting element binding factors 1 and 2 (IDEF1 and IDEF2) regulate transcriptional response to iron deficiency in rice roots. Clarification of the functions of IDEF1 and IDEF2 could uncover the gene regulation mechanism. Methods Spatial patterns of IDEF1 and IDEF2 expression were analysed by histochemical staining of IDEF1 and IDEF2 promoter-GUS transgenic rice lines. Expression patterns of the target genes of IDEF1 and IDEF2 were analysed using transformants with induced or repressed expression of IDEF1 or IDEF2 grown in iron-rich or in iron-deficient solutions for 1 d. Key Results IDEF1 and IDEF2 were highly expressed in the basal parts of the lateral roots and vascular bundles. IDEF1 and IDEF2 expression was dominant in leaf mesophyll and vascular cells, respectively. These expression patterns were similar under both iron-deficient and iron-sufficient conditions. IDEF1 was strongly expressed in pollen, ovaries, the aleurone layer and embryo. IDEF2 was expressed in pollen, ovaries and the dorsal vascular region of the endosperm. During seed germination, IDEF1 and IDEF2 were expressed in the endosperm and embryo. Expression of IDEF1 target genes was regulated in iron-rich roots similar to early iron-deficiency stages. In addition, the expression patterns of IDEF2 target genes were similar between iron-rich conditions and early or subsequent iron deficiency. Conclusions IDEF1 and IDEF2 are constitutively expressed during both vegetative and reproductive stages. The spatial expression patterns of IDEF1 and IDEF2 overlap with their target genes in restricted cell types, but not in all cells. The spatial expression patterns and gene regulation of IDEF1 and IDEF2 in roots are generally conserved under conditions of iron sufficiency and deficiency, suggesting complicated interactions with unknown factors for sensing and transmitting iron-deficiency signals. PMID:20197292

The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis.

PubMed

Zhao, D; Yu, Q; Chen, M; Ma, H

2001-07-01

The Arabidopsis floral regulatory genes APETALA3 (AP3) and PISTILLATA (PI) are required for the B function according to the ABC model for floral organ identity. AP3 and PI expression are positively regulated by the LEAFY (LFY) and UNUSUAL FLORAL ORGANS (UFO) genes. UFO encodes an F-box protein, and we have shown previously that UFO genetically interacts with the ASK1 gene encoding a SKP1 homologue; both the F-box containing protein and SKP1 are subunits of ubiquitin ligases. We show here that the ask1-1 mutation can enhance the floral phenotypes of weak lfy and ap3 mutants; therefore, like UFO, ASK1 also interacts with LFY and AP3 genetically. Furthermore, our results from RNA in situ hybridizations indicate that ASK1 regulates early AP3 and PI expression. These results support the idea that UFO and ASK1 together positively regulate AP3 and PI expression. We propose that the UFO and ASK1 proteins are components of a ubiquitin ligase that mediates the proteolysis of a repressor of AP3 and PI expression. Our genetic studies also indicate that ASK1 and UFO play a role in regulating the number of floral organ primordia, and we discuss possible mechanisms for such a regulation.

Repression of myoblast proliferation and fibroblast growth factor receptor 1 promoter activity by KLF10 protein.

PubMed

Parakati, Rajini; DiMario, Joseph X

2013-05-10

FGFR1 gene expression regulates myoblast proliferation and differentiation, and its expression is controlled by Krüppel-like transcription factors. KLF10 interacts with the FGFR1 promoter, repressing its activity and cell proliferation. KLF10 represses FGFR1 promoter activity and thereby myoblast proliferation. A model of transcriptional control of chicken FGFR1 gene regulation during myogenesis is presented. Skeletal muscle development is controlled by regulation of myoblast proliferation and differentiation into muscle fibers. Growth factors such as fibroblast growth factors (FGFs) and their receptors (FGFRs) regulate cell proliferation and differentiation in numerous tissues, including skeletal muscle. Transcriptional regulation of FGFR1 gene expression is developmentally regulated by the Sp1 transcription factor, a member of the Krüppel-like factor (KLF) family of transcriptional regulators. Here, we show that another KLF transcription factor, KLF10, also regulates myoblast proliferation and FGFR1 promoter activity. Expression of KLF10 reduced myoblast proliferation by 86%. KLF10 expression also significantly reduced FGFR1 promoter activity in myoblasts and Sp1-mediated FGFR1 promoter activity in Drosophila SL2 cells. Southwestern blot, electromobility shift, and chromatin immunoprecipitation assays demonstrated that KLF10 bound to the proximal Sp factor binding site of the FGFR1 promoter and reduced Sp1 complex formation with the FGFR1 promoter at that site. These results indicate that KLF10 is an effective repressor of myoblast proliferation and represses FGFR1 promoter activity in these cells via an Sp1 binding site.

Prostate Androgen-Regulated Mucin-Like protein 1: A Novel Regulator of Progesterone Metabolism

PubMed Central

Park, Ji Yeon; Jang, Hyein; Curry, Thomas E.; Sakamoto, Aiko

2013-01-01

The LH surge reprograms preovulatory follicular cells to become terminally differentiated luteal cells which produce high levels of progesterone and become resistant to apoptosis. PARM1 (prostate androgen regulated mucin-like protein 1) has been implicated in cell differentiation and cell survival in nonovarian cells, but little is known about PARM1 in the ovary. This study demonstrated that the LH surge induced a dramatic increase in Parm1 expression in periovulatory follicles and newly forming CL in both cycling and immature rat models. We further demonstrated that hCG increases Parm1 expression in granulosa cell cultures. The in vitro up-regulation of Parm1 expression was mediated by hCG-activated multiple signaling pathways and transcriptional activation of this gene. Parm1 knockdown increased the viability of cultured granulosa cells but resulted in a decrease in progesterone levels. The inhibitory effect of Parm1 silencing on progesterone was reversed by adenoviral mediated add-back expression of Parm1. Parm1 silencing had little effect on the expression of genes involved in progesterone biosynthesis and metabolism such as Scarb1, Ldlr, Vldlr, Scp2, Star, Cyp11a1, Hsd3b, and Srd5a1, while decreasing the expression of Akr1c3. Analyses of culture media steroid levels revealed that Parm1 knockdown had no effect on pregnenolone levels, while resulting in time-dependent decreases in progesterone and 20α-dihydroprogesterone and accelerated accumulation of 5α-pregnanediol. This study revealed that the up-regulation of Parm1 expression promotes progesterone and 20α-dihydroprogesterone accumulation in luteinizing granulosa cells by inhibiting progesterone catabolism to 5α-pregnanediol. PARM1 contributes to ovulation and/or luteal function by acting as a novel regulator of progesterone metabolism. PMID:24085821

Nitric oxide signaling pathway regulates potassium chloride cotransporter-1 mRNA expression in vascular smooth muscle cells.

PubMed

Di Fulvio, M; Lauf, P K; Adragna, N C

2001-11-30

Rat vascular smooth muscle cells (VSMCs) express at least two mRNAs for K-Cl cotransporters (KCC): KCC1 and KCC3. cGMP-dependent protein kinase I regulates KCC3 mRNA expression in these cells. Here, we show evidence implicating the nitric oxide (NO)/cGMP signaling pathway in the expression of KCC1 mRNA, considered to be the major cell volume regulator. VSMCs, expressing soluble guanylyl cyclase (sGC) and PKG-I isoforms showed a time- and concentration-dependent increase in KCC1 mRNA levels after treatment with sodium nitroprusside as demonstrated by semiquantitative RT-PCR. sGC-dependent regulation of KCC1 mRNA expression was confirmed using YC-1, a NO-independent sGC stimulator. The sGC inhibitor LY83583 blocked the effects of sodium nitroprusside and YC-1. Moreover, 8-Br-cGMP increased KCC1 mRNA expression in a concentration- and time-dependent fashion. The 8-Br-cGMP effect was partially blocked by KT5823 but not by actinomycin D. However, actinomycin D and cycloheximide increased basal KCC1 mRNA in an additive manner, suggesting different mechanisms of action for both drugs. These findings suggest that in VSMCs, the NO/cGMP-signaling pathway participates in KCC1 mRNA regulation at the post-transcriptional level.

CB1 Cannabinoid Receptor Expression in the Striatum: Association with Corticostriatal Circuits and Developmental Regulation

PubMed Central

Van Waes, Vincent; Beverley, Joel A.; Siman, Homayoun; Tseng, Kuei Y.; Steiner, Heinz

2012-01-01

Corticostriatal circuits mediate various aspects of goal-directed behavior and are critically important for basal ganglia-related disorders. Activity in these circuits is regulated by the endocannabinoid system via stimulation of CB1 cannabinoid receptors. CB1 receptors are highly expressed in projection neurons and select interneurons of the striatum, but expression levels vary considerably between different striatal regions (functional domains). We investigated CB1 receptor expression within specific corticostriatal circuits by mapping CB1 mRNA levels in striatal sectors defined by their cortical inputs in rats. We also assessed changes in CB1 expression in the striatum during development. Our results show that CB1 expression is highest in juveniles (P25) and then progressively decreases toward adolescent (P40) and adult (P70) levels. At every age, CB1 receptors are predominantly expressed in sensorimotor striatal sectors, with considerably lower expression in associative and limbic sectors. Moreover, for most corticostriatal circuits there is an inverse relationship between cortical and striatal expression levels. Thus, striatal sectors with high CB1 expression (sensorimotor sectors) tend to receive inputs from cortical areas with low expression, while striatal sectors with low expression (associative/limbic sectors) receive inputs from cortical regions with higher expression (medial prefrontal cortex). In so far as CB1 mRNA levels reflect receptor function, our findings suggest differential CB1 signaling between different developmental stages and between sensorimotor and associative/limbic circuits. The regional distribution of CB1 receptor expression in the striatum further suggests that, in sensorimotor sectors, CB1 receptors mostly regulate GABA inputs from local axon collaterals of projection neurons, whereas in associative/limbic sectors, CB1 regulation of GABA inputs from interneurons and glutamate inputs may be more important. PMID:22416230

Malat1 as an evolutionarily conserved lncRNA, plays a positive role in regulating proliferation and maintaining undifferentiated status of early-stage hematopoietic cells.

PubMed

Ma, Xian-Yong; Wang, Jian-Hui; Wang, Jing-Lan; Ma, Charles X; Wang, Xiao-Chun; Liu, Feng-Song

2015-09-03

The metastasis-associated lung adenocarcinoma transcription 1 (Malat1) is a highly conserved long non-coding RNA (lncRNA) gene. Previous studies showed that Malat1 is abundantly expressed in many tissues and involves in promoting tumor growth and metastasis by modulating gene expression and target protein activities. However, little is known about the biological function and regulation mechanism of Malat1 in normal cell proliferation. In this study we conformed that Malat1 is highly conserved across vast evolutionary distances amongst 20 species of mammals in terms of sequence, and found that mouse Malat1 expresses in tissues of liver, kidney, lung, heart, testis, spleen and brain, but not in skeletal muscle. After treating erythroid myeloid lymphoid (EML) cells with All-trans Retinoic Acid (ATRA), we investigated the expression and regulation of Malat1 during hematopoietic differentiation, the results showed that ATRA significantly down regulates Malat1 expression during the differentiation of EML cells. Mouse LRH (Lin-Rhodamine(low) Hoechst(low)) cells that represent the early-stage progenitor cells show a high level of Malat1 expression, while LRB (Lin - Hoechst(Low) Rhodamine(Bright)) cells that represent the late-stage progenitor cells had no detectable expression of Malat1. Knockdown experiment showed that depletion of Malat1 inhibits the EML cell proliferation. Along with the down regulation of Malat1, the tumor suppressor gene p53 was up regulated during the differentiation. Interestingly, we found two p53 binding motifs with help of bioinformatic tools, and the following chromatin immunoprecipitation (ChIP) test conformed that p53 acts as a transcription repressor that binds to Malat1's promoter. Furthermore, we testified that p53 over expression in EML cells causes down regulation of Malat1. In summary, this study indicates Malat1 plays a critical role in maintaining the proliferation potential of early-stage hematopoietic cells. In addition to its biological function, the study also uncovers the regulation pattern of Malat1 expression mediated by p53 in hematopoietic differentiation. Our research shed a light on exploring the Malat1 biological role including therapeutic significance to inhibit the proliferation potential of malignant cells.

PPARα agonist fenofibrate attenuates TNF-α-induced CD40 expression in 3T3-L1 adipocytes via the SIRT1-dependent signaling pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Weirong; Lin, Qinqin; Lin, Rong, E-mail: linrong63@yahoo.com.cn

2013-06-10

The ligand-activated transcription factor peroxisome proliferator-activated receptor-α (PPARα) participates in the regulation of cellular inflammation. More recent studies indicated that sirtuin1 (SIRT1), a NAD{sup +}-dependent deacetylase, regulates the inflammatory response in adipocytes. However, whether the role of PPARα in inflammation is mediated by SIRT1 remains unclear. In this study, we aimed to determine the effect of PPARα agonist fenofibrate on the expressions of SIRT1 and pro-inflammatory cytokine CD40 and underlying mechanisms in 3T3-L1 adipocytes. We found that fenofibrate inhibited CD40 expression and up-regulated SIRT1 expression in tumor necrosis factor-α (TNF-α)-stimulated adipocytes, and these effects of fenofibrate were reversed by PPARαmore » antagonist GW6471. Moreover, SIRT1 inhibitors sirtinol/nicotinamide (NAM) or knockdown of SIRT1 could attenuate the effect of fenofibrate on TNF-α-induced CD40 expression in adipocytes. Importantly, NF-κB inhibitor pyrrolidine dithiocarbamate (PDTC) augmented the effect of fenofibrate on CD40 expression in adipocytes. Further study found that fenofibrate decreased the expression of acetylated-NF-κB p65 (Ac-NF-κB p65) in TNF-α-stimulated adipocytes, and the effect of fenofibrate was abolished by SIRT1 inhibition. In addition, fenofibrate up-regulated SIRT1 expression through AMPK in TNF-α-stimulated adipocytes. Taken together, these findings indicate that PPARα agonist fenofibrate inhibits TNF-α-induced CD40 expression in 3T3-L1 adipocytes via the SIRT1-dependent signaling pathway. -- Highlights: • Fenofibrate up-regulates SIRT1 expression in TNF-α-stimulated adipocytes. • Fenofibrate inhibits CD40 expression through SIRT1 in adipocytes. • The effects of fenofibrate on CD40 and SIRT1 expressions are dependent on PPARα. • Fenofibrate inhibits CD40 expression via SIRT1-dependent deacetylation of NF-κB. • Fenofibrate increases SIRT1 expression through PPARα and AMPK in adipocytes.« less

Involvement of SIRT1 in hypoxic down-regulation of c-Myc and β-catenin and hypoxic preconditioning effect of polyphenols

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Kyung-Soo; Research Center for Ischemic Tissue regeneration, Pusan National University School of Medicine, Yangsan; Park, Jun-Ik

2012-03-01

SIRT1 has been found to function as a Class III deacetylase that affects the acetylation status of histones and other important cellular nonhistone proteins involved in various cellular pathways including stress responses and apoptosis. In this study, we investigated the role of SIRT1 signaling in the hypoxic down-regulations of c-Myc and β-catenin and hypoxic preconditioning effect of the red wine polyphenols such as piceatannol, myricetin, quercetin and resveratrol. We found that the expression of SIRT1 was significantly increased in hypoxia-exposed or hypoxic preconditioned HepG2 cells, which was closely associated with the up-regulation of HIF-1α and down-regulation of c-Myc and β-cateninmore » expression via deacetylation of these proteins. In addition, blockade of SIRT1 activation using siRNA or amurensin G, a new potent SIRT1 inhibitor, abolished hypoxia-induced HIF-1α expression but increased c-Myc and β-catenin expression. SIRT1 was also found to stabilize HIF-1α protein and destabilize c-Myc, β-catenin and PHD2 under hypoxia. We also found that myricetin, quercetin, piceatannol and resveratrol up-regulated HIF-1α and down-regulated c-Myc, PHD2 and β-catenin expressions via SIRT1 activation, in a manner that mimics hypoxic preconditioning. This study provides new insights of the molecular mechanisms of hypoxic preconditioning and suggests that polyphenolic SIRT1 activators could be used to mimic hypoxic/ischemic preconditioning. -- Graphical abstract: Polyphenols mimicked hypoxic preconditioning by up-regulating HIF-1α and SIRT1 and down-regulating c-Myc, PHD2, and β-catenin. HepG2 cells were pretreated with the indicated doses of myricetin (MYR; A), quercetin (QUR; B), or piceatannol (PIC; C) for 4 h and then exposed to hypoxia for 4 h. Levels of HIF-1α, SIRT1, c-Myc, β-catenin, and PHD2 were determined by western blot analysis. The data are representative of three individual experiments. Highlights: ► SIRT1 expression is increased in hypoxia-exposed or hypoxic preconditioned cells. ► SIRT1 deacetylates c-Myc and β-catenin ► HIF-1α is up-regulated by down-regulation of c-Myc and β-catenin expression. ► Polyphenolic SIRT1 activators mimics hypoxic preconditioning.« less

Microarray Analysis of Gene Expression Alteration in Human Middle Ear Epithelial Cells Induced by Asian Sand Dust.

PubMed

Go, Yoon Young; Park, Moo Kyun; Kwon, Jee Young; Seo, Young Rok; Chae, Sung-Won; Song, Jae-Jun

2015-12-01

The primary aim of this study is to evaluate the gene expression profile of Asian sand dust (ASD)-treated human middle ear epithelial cell (HMEEC) using microarray analysis. The HMEEC was treated with ASD (400 µg/mL) and total RNA was extracted for microarray analysis. Molecular pathways among differentially expressed genes were further analyzed. For selected genes, the changes in gene expression were confirmed by real-time polymerase chain reaction. A total of 1,274 genes were differentially expressed by ASD. Among them, 1,138 genes were 2 folds up-regulated, whereas 136 genes were 2 folds down-regulated. Up-regulated genes were mainly involved in cellular processes, including apoptosis, cell differentiation, and cell proliferation. Down-regulated genes affected cellular processes, including apoptosis, cell cycle, cell differentiation, and cell proliferation. The 10 genes including ADM, CCL5, EDN1, EGR1, FOS, GHRL, JUN, SOCS3, TNF, and TNFSF10 were identified as main modulators in up-regulated genes. A total of 11 genes including CSF3, DKK1, FOSL1, FST, TERT, MMP13, PTHLH, SPRY2, TGFBR2, THBS1, and TIMP1 acted as main components of pathway associated with 2-fold down regulated genes. We identified the differentially expressed genes in ASD-treated HMEEC. Our work indicates that air pollutant like ASD, may play an important role in the pathogenesis of otitis media.

miR-140-5p regulates hypoxia-mediated human pulmonary artery smooth muscle cell proliferation, apoptosis and differentiation by targeting Dnmt1 and promoting SOD2 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanwei; Xu, Jing, E-mail: xujingdoc@163.com

miR-140-5p is down-regulated in patients with pulmonary arterial hypertension (PAH) and experimental models of PAH, and inhibits hypoxia-mediated pulmonary artery smooth muscle cell (PASMC) proliferation in vitro. Delivery of synthetic miR-140-5p prevents and treats established, experimental PAH. DNA methyltransferase 1 (Dnmt1) is up-regulated in PAH associated human PASMCs (HPASMCs), which promotes the development of PAH by hypermethylation of CpG islands within the promoter for superoxide dismutase 2 (SOD2) and down-regulating SOD2 expression. We searched for miR-140-5p targets using TargetScan, PicTar and MiRanda tools, and found that Dnmt1 is a potential target of miR-140-5p. Based on these findings, we speculated that miR-140-5pmore » might target Dnmt1 and regulate SOD2 expression to regulate hypoxia-mediated HPASMC proliferation, apoptosis and differentiation. We detected the expression of miR-140-5p, Dnmt1 and SOD2 by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot assays, respectively, and found down-regulation of miR-140-5p and SOD2 and up-regulation of Dnmt1 exist in PAH tissues and hypoxia-mediated HPASMCs. Cell proliferation, apoptosis and differentiation detection showed that miR-140-5p inhibits proliferation and promotes apoptosis and differentiation of HPASMCs in hypoxia, while the effect of Dnmt1 on hypoxia-mediated HPASMCs is reversed. Luciferase assay confirmed that miR-140-5p targets Dnmt1 directly. An inverse correlation is also found between miR-140-5p and Dnmt1 in HPASMCs. In addition, we further investigated whether miR-140-5p and Dnmt1 regulate HPASMC proliferation, apoptosis and differentiation by regulating SOD2 expression, and the results confirmed our speculation. Taken together, these results indicated that miR-140-5p at least partly targets Dnmt1 and regulates SOD2 expression to inhibit proliferation and promote apoptosis and differentiation of HPASMCs in hypoxia. - Highlights: • miR-140-5p and SOD2 are down-regulated in PAH tissues and hypoxia-mediated HPASMCs. • Dnmt1 is up-regulated in PAH tissues and hypoxia-mediated HPASMCs. • miR-140-5p regulates HPASMC proliferation, apoptosis and differentiation. • Dnmt1 and SOD2 regulates HPASMC proliferation, apoptosis and differentiation. • miR-140-5p targets Dnmt1 and regulates SOD2 expression.« less

GDSL LIPASE1 Modulates Plant Immunity through Feedback Regulation of Ethylene Signaling1[W

PubMed Central

Kim, Hye Gi; Kwon, Sun Jae; Jang, Young Jin; Nam, Myung Hee; Chung, Joo Hee; Na, Yun-Cheol; Guo, Hongwei; Park, Ohkmae K.

2013-01-01

Ethylene is a key signal in the regulation of plant defense responses. It is required for the expression and function of GDSL LIPASE1 (GLIP1) in Arabidopsis (Arabidopsis thaliana), which plays an important role in plant immunity. Here, we explore molecular mechanisms underlying the relationship between GLIP1 and ethylene signaling by an epistatic analysis of ethylene response mutants and GLIP1-overexpressing (35S:GLIP1) plants. We show that GLIP1 expression is regulated by ethylene signaling components and, further, that GLIP1 expression or application of petiole exudates from 35S:GLIP1 plants affects ethylene signaling both positively and negatively, leading to ETHYLENE RESPONSE FACTOR1 activation and ETHYLENE INSENSITIVE3 (EIN3) down-regulation, respectively. Additionally, 35S:GLIP1 plants or their exudates increase the expression of the salicylic acid biosynthesis gene SALICYLIC ACID INDUCTION-DEFICIENT2, known to be inhibited by EIN3 and EIN3-LIKE1. These results suggest that GLIP1 regulates plant immunity through positive and negative feedback regulation of ethylene signaling, and this is mediated by its activity to accumulate a systemic signal(s) in the phloem. We propose a model explaining how GLIP1 regulates the fine-tuning of ethylene signaling and ethylene-salicylic acid cross talk. PMID:24170202

Effects of rhynchophylline on GluN1 and GluN2B expressions in primary cultured hippocampal neurons.

PubMed

He, Yan; Zeng, Sheng-Ya; Zhou, Shi-Wen; Qian, Gui-Sheng; Peng, Kang; Mo, Zhi-Xian; Zhou, Ji-Yin

2014-10-01

N-methyl-d-aspartate (NMDA) receptor subunits GluN1 and GluN2B in hippocampal neurons play key roles in anxiety. Our previous studies show that rhynchophylline, an active component of the Uncaria species, down-regulates GluN2B expression in the hippocampal CA1 area of amphetamine-induced rat. The effects of rhynchophylline on expressions of GluN1 and GluN2B in primary hippocampal neurons in neonatal rats in vitro were investigated. Neonatal hippocampal neurons were cultured with neurobasal-A medium. After incubation for 6h or 48 h with rhynchophylline (non-competitive NMDAR antagonist) and MK-801 (non-competitive NMDAR antagonist with anxiolytic effect, as the control drug) from day 6, neuron toxicity, mRNA and protein expressions of GluN1 and GluN2B were analyzed. GluN1 is mainly distributed on neuronal axons and dendritic trunks, cytoplasm and cell membrane near axons and dendrites. GluN2B is mainly distributed on the membrane, dendrites, and axon membranes. GluN1 and GluN2B are codistributed on dendritic trunks and dendritic spines. After 48 h incubation, a lower concentration of rhynchophylline (lower than 400 μmol/L) and MK-801 (lower than 200 μmol/L) have no toxicity on neonatal hippocampal neurons. Rhynchophylline up-regulated GluN1 mRNA expression at 6h and mRNA and protein expressions at 48h, but down-regulated GluN2B mRNA and protein expressions at 48 h. However, GluN1 and GluN2B mRNA expressions were down-regulated at 6h, and mRNA and protein expressions were both up-regulated by MK-801 at 48h. These findings show that rhynchophylline reciprocally regulates GluN1 and GluN2B expressions in hippocampal neurons, indicating a potential anxiolytic property for rhynchophylline. Copyright © 2014 Elsevier B.V. All rights reserved.

Down-regulation of cancer/testis antigen OY-TES-1 attenuates malignant behaviors of hepatocellular carcinoma cells in vitro.

PubMed

Fu, Jun; Luo, Bin; Guo, Wen-Wen; Zhang, Qing-Mei; Shi, Lei; Hu, Qi-Ping; Chen, Fang; Xiao, Shao-Wen; Xie, Xiao-Xun

2015-01-01

Cancer/testis (CT) antigens are normally expressed in testis and overexpressed in various tumor types. However, their biological function is largely unknown. OY-TES-1, one of cancer/testis (CT) antigens, is reported overexpression in hepatocellular carcinoma (HCC). And we assumed that OY-TES-1 contribute to oncogenesis and progression of HCC. In this study, we knocked down OY-TES-1 by small interference RNA (siRNA) in HCC cell lines (HepG2 and BEL-7404) to verify this assumption and evaluate its potential as therapeutic targets for HCC. We showed that down regulation of OY-TES-1 decreased cell growth, induced the G0/G1 arrest and apoptosis, and prevented migration and invasion in the two HCC cell lines. Further analysis revealed that down regulation of OY-TES-1 increased expression of apoptosis-regulated protein caspase-3, and decreased expression of cell cycle-regulated protein cyclin E, migration/invasion-regulated proteins MMP2 and MMP9. These findings may shed light on the gene therapy about the OY-TES-1 expression in HCC cells.

Down-regulation of cancer/testis antigen OY-TES-1 attenuates malignant behaviors of hepatocellular carcinoma cells in vitro

PubMed Central

Fu, Jun; Luo, Bin; Guo, Wen-Wen; Zhang, Qing-Mei; Shi, Lei; Hu, Qi-Ping; Chen, Fang; Xiao, Shao-Wen; Xie, Xiao-Xun

2015-01-01

Cancer/testis (CT) antigens are normally expressed in testis and overexpressed in various tumor types. However, their biological function is largely unknown. OY-TES-1, one of cancer/testis (CT) antigens, is reported overexpression in hepatocellular carcinoma (HCC). And we assumed that OY-TES-1 contribute to oncogenesis and progression of HCC. In this study, we knocked down OY-TES-1 by small interference RNA (siRNA) in HCC cell lines (HepG2 and BEL-7404) to verify this assumption and evaluate its potential as therapeutic targets for HCC. We showed that down regulation of OY-TES-1 decreased cell growth, induced the G0/G1 arrest and apoptosis, and prevented migration and invasion in the two HCC cell lines. Further analysis revealed that down regulation of OY-TES-1 increased expression of apoptosis-regulated protein caspase-3, and decreased expression of cell cycle-regulated protein cyclin E, migration/invasion-regulated proteins MMP2 and MMP9. These findings may shed light on the gene therapy about the OY-TES-1 expression in HCC cells. PMID:26339343

miR-200a controls hepatic stellate cell activation and fibrosis via SIRT1/Notch1 signal pathway.

PubMed

Yang, Jing-Jing; Tao, Hui; Liu, Li-Ping; Hu, Wei; Deng, Zi-Yu; Li, Jun

2017-04-01

miR-200a has been established as a key regulator of HSC activation processes in liver fibrosis. Epigenetic silencing of miR-200a contributing to SIRT1 over-expression has been discussed in breast cancer; however, whether miR-200a controls SIRT1 gene expression in hepatic fibrosis is still unknown. We analyzed miR-200a regulation of SIRT1 expression in CCl 4 -induced liver fibrosis and TGF-β1-mediated activation of HSC. miR-200a, SIRT1, α-SMA, Col1A1, Notch1 and NICD expression were estimated by Western blotting, qRT-PCR and Immunohistochemistry. HSCs were transfected with miR-200a mimic, miR-200a inhibitor and SIRT1-RNAi. Luciferase reporter assays further confirmed the interaction between miR-200a and the SIRT1 mRNA 3'-UTR. Cell proliferation ability was assessed by MTT and cell cycle. We found that treatment activated HSC with miR-200a mimics, restored miR-200a expression and reduced SIRT1 levels. Conversely, treatment activated HSC with miR-200a inhibitors, decreased miR-200a expression and up-regulated SIRT1 levels. Restoration of miR-200a or the knockdown of SIRT1 prevented HSC activation and proliferation. We have established the SIRT1 transcript as subject to regulation by miR-200a, through miR-200a targeting of SIRT1 3'-UTR. Finally, HSC transfected with SIRT1-siRNA increased the levels of Notch1 protein and mRNA expression. Our study demonstrated that miR-200a regulates SIRT1/Notch1 expression during HSC activation and fibrosis.

The antagonistic regulation of abscisic acid-inhibited root growth by brassinosteroids is partially mediated via direct suppression of ABSCISIC ACID INSENSITIVE 5 expression by BRASSINAZOLE RESISTANT 1.

PubMed

Yang, Xiaorui; Bai, Yang; Shang, Jianxiu; Xin, Ruijiao; Tang, Wenqiang

2016-09-01

Brassinosteroids (BRs) and abscisic acid (ABA) are plant hormones that antagonistically regulate many aspects of plant growth and development; however, the mechanisms that regulate the crosstalk of these two hormones are still not well understood. BRs regulate plant growth and development by activating BRASSINAZOLE RESISTANT 1 (BZR1) family transcription factors. Here we show that the crosstalk between BRs and ABA signalling is partially mediated by BZR1 regulated gene expression. bzr1-1D is a dominant mutant with enhanced BR signalling; our results showed that bzr1-1D mutant is less sensitive to ABA-inhibited primary root growth. By RNA sequencing, a subset of BZR1 regulated ABA-responsive root genes were identified. Of these genes, the expression of a major ABA signalling component ABA INSENSITIVE 5 (ABI5) was found to be suppressed by BR and by BZR1. Additional evidences showed that BZR1 could bind strongly with several G-box cis-elements in the promoter of ABI5, suppress the expression of ABI5 and make plants less sensitive to ABA. Our study demonstrated that ABI5 is a direct target gene of BZR1, and modulating the expression of ABI5 by BZR1 plays important roles in regulating the crosstalk between the BR and ABA signalling pathways. © 2016 John Wiley & Sons Ltd.

[Expression and clinical significance of BCL6 corepressor-like 1 in non-small cell lung cancer].

PubMed

Zhao, Xu; Tuo, Hang; Si, Meili; Wang, Lei; Liang, Ping

2015-12-01

To detect the expression of BCL6 corepressor-like 1 (BCORL1) in tumor tissues of human non-small cell lung cancer (NSCLC) and determine the effect of BCORL1 on cell migration and invasion in A549 cells by knockdown of BCORL1. Sixty-eight pairs of NSCLC and nontumor tissues were collected and the expressions of BCORL1 and E-cadherin in them were detected using immunohistochemical staining. The expression of BCORL1 was knocked down by siRNA in A549 cells. Transwell(TM) assays were performed to test NSCLC cell migration and invasion in vitro. The expression of BCORL1 in NSCLC was significantly higher than that in paired noncancerous tissues, while E-cadherin was down-regulated in NSCLC as compared with nontumor tissues. Pearson correlation coefficient analysis suggested that BCORL1 was negatively correlated with E-cadherin expression in NSCLC tissues. Clinical association analysis suggested that the elevated expression of BCORL1 was evidently associated with the higher incidence of lymph node metastasis and more advanced TNM stage. When the expression of BCORL1 was down-regulated by a specific siRNA, E-cadherin was up-regulated, and BCORL1 knockdown obviously inhibited cell migration and invasion in A549 cells. BCORL1 is overexpressed in NSCLC tissues and it is negatively correlated with E-cadherin expression. Its high expression is correlated with poor prognostic features. BCORL1 knockdown up-regulates E-cadherin expression and subsequently inhibits cell migration and invasion of lung cancer cells.

Negative feedback regulation of Homer 1a on norepinephrine-dependent cardiac hypertrophy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiarello, Carmelina; Bortoloso, Elena; Carpi, Andrea

2013-07-15

Homers are scaffolding proteins that modulate diverse cell functions being able to assemble signalling complexes. In this study, the presence, sub-cellular distribution and function of Homer 1 was investigated. Homer 1a and Homer 1b/c are constitutively expressed in cardiac muscle of both mouse and rat and in HL-1 cells, a cardiac cell line. As judged by confocal immunofluorescence microscopy, Homer 1a displays sarcomeric and peri-nuclear localization. In cardiomyocytes and cultured HL-1 cells, the hypertrophic agonist norepinephrine (NE) induces α{sub 1}-adrenergic specific Homer 1a over-expression, with a two-to-three-fold increase within 1 h, and no up-regulation of Homer 1b/c, as judged bymore » Western blot and qPCR. In HL-1 cells, plasmid-driven over-expression of Homer 1a partially antagonizes activation of ERK phosphorylation and ANF up-regulation, two well-established, early markers of hypertrophy. At the morphometric level, NE-induced increase of cell size is likewise and partially counteracted by exogenous Homer 1a. Under the same experimental conditions, Homer 1b/c does not have any effect on ANF up-regulation nor on cell hypertrophy. Thus, Homer 1a up-regulation is associated to early stages of cardiac hypertrophy and appears to play a negative feedback regulation on molecular transducers of hypertrophy. -- Highlights: • Homer 1a is constitutively expressed in cardiac tissue. • In HL-1 cells, norepinephrine activates signaling pathways leading to hypertrophy. • Homer 1a up-regulation is an early event of norepinephrine-induced hypertrophy. • Homer 1a plays a negative feedback regulation modulating pathological hypertrophy. • Over-expression of Homer 1a per se does not induce hypertrophy.« less

Progesterone and 17β-estradiol regulate expression of nesfatin-1/NUCB2 in mouse pituitary gland.

PubMed

Chung, Yiwa; Kim, Jinhee; Im, Eunji; Kim, Heejeong; Yang, Hyunwon

2015-01-01

Nesfatin-1 was first shown to be involved in the control of appetite and energy metabolism in the hypothalamus. Many recent reports have shown nesfatin-1 expression in various tissues including the pituitary gland, but its expression and regulation mechanisms in the pituitary gland are unclear. Therefore, first, we investigated the mRNA and protein expression of nesfatin-1 in the pituitary using qRT-PCR and Western blotting, respectively. Expression of NUCB2 mRNA and nesfatin-1 protein was higher in the pituitary gland than in other organs, and nesfatin-1 protein was localized in many cells in the anterior pituitary gland. Next, we investigated whether NUCB2 mRNA expression in the pituitary gland was regulated by sex steroid hormones secreted by the ovary. Mice were ovariectomized and injected with progesterone (P4) and 17β-estradiol (E2). The expression of NUCB2 in the pituitary gland was dramatically decreased after ovariectomy and increased with injection of P4 and E2, respectively. The in vitro experiment to elucidate the direct effect of P4 and E2 on NUCB2 mRNA expression showed NUCB2 mRNA expression was significantly increased with E2 and decreased with P4 alone and P4 plus E2 in cultured pituitary tissue. The present study demonstrated that nesfatin-1/NUCB2 was highly expressed in the mouse pituitary and was regulated by P4 and E2. These data suggest that reproductive-endocrine regulation through hypothalamus-pituitary-ovary axis may contribute to nesfatin-1/NUCB2 expression in the pituitary gland. Copyright © 2014 Elsevier Inc. All rights reserved.

Yak IGF2 Promotes Fibroblast Proliferation Via Suppression of IGF1R and PI3KCG Expression

PubMed Central

Wang, Qi; Gong, Jishang; Du, Jiaxing; Zhang, Yong; Zhao, Xingxu

2018-01-01

Insulin-like growth factor 2 (IGF2) recapitulates many of the activities of insulin and promotes differentiation of myoblasts and osteoblasts, which likely contribute to genetic variations of growth potential. However, little is known about the functions and signaling properties of IGF2 variants in yaks. The over-expression vector and knockdown sequence of yak IGF2 were transfected into yak fibroblasts, and the effects were detected by a series of assays. IGF2 expression in yak muscle tissues was significantly lower than that of other tissues. In yak fibroblasts, the up-regulated expression of IGF2 inhibits expression of IGF1 and insulin-like growth factor 2 receptor (IGF2R) and significantly up-regulates expression of IGF1R. Inhibition of IGF2 expression caused the up-regulates expression of IGF1, IGF1R and IGF2R. Both over-expression and knockdown of IGF2 resulted in up-regulation of threonine protein kinase 1 (Akt1) expression and down-regulation of phosphatidylinositol 3-kinase, catalytic subunit gamma (PIK3CG). Cell cycle and cell proliferation assays revealed that over-expression of IGF2 enhanced the DNA synthesis phase and promoted yak fibroblasts proliferation. Conversely, knockdown of IGF2 decreased DNA synthesis and inhibited proliferation. These results suggested that IGF2 was negatively correlated with IGF1R and PIK3CG and demonstrated an association with the IGFs-PI3K-Akt (IGFs-phosphatidylinositol 3-kinase- threonine protein kinase) pathway in cell proliferation and provided evidence supporting the functional role of IGF2 for use in improving the production performance of yaks. PMID:29558395

Comprehensive Gene Expression Analysis of Rice Aleurone Cells: Probing the Existence of an Alternative Gibberellin Receptor1

PubMed Central

Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto

2015-01-01

Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. PMID:25511432

ERK1/2 mediates glucose-regulated POMC gene expression in hypothalamic neurons.

PubMed

Zhang, Juan; Zhou, Yunting; Chen, Cheng; Yu, Feiyuan; Wang, Yun; Gu, Jiang; Ma, Lian; Ho, Guyu

2015-04-01

Hypothalamic glucose-sensing neurons regulate the expression of genes encoding feeding-related neuropetides POMC, AgRP, and NPY - the key components governing metabolic homeostasis. AMP-activated protein kinase (AMPK) is postulated to be the molecular mediator relaying glucose signals to regulate the expression of these neuropeptides. Whether other signaling mediator(s) plays a role is not clear. In this study, we investigated the role of ERK1/2 using primary hypothalamic neurons as the model system. The primary neurons were differentiated from hypothalamic progenitor cells. The differentiated neurons possessed the characteristic neuronal cell morphology and expressed neuronal post-mitotic markers as well as leptin-regulated orexigenic POMC and anorexigenic AgRP/NPY genes. Treatment of cells with glucose dose-dependently increased POMC and decreased AgRP/NPY expression with a concurrent suppression of AMPK phosphorylation. In addition, glucose treatment dose-dependently increased the ERK1/2 phosphorylation. Blockade of ERK1/2 activity with its specific inhibitor PD98059 partially (approximately 50%) abolished glucose-induced POMC expression, but had little effect on AgRP/NPY expression. Conversely, blockade of AMPK activity with its specific inhibitor produced a partial (approximately 50%) reversion of low-glucose-suppressed POMC expression, but almost completely blunted the low-glucose-induced AgRP/NPY expression. The results indicate that ERK1/2 mediated POMC but not AgRP/NPY expression. Confirming the in vitro findings, i.c.v. administration of PD98059 in rats similarly attenuated glucose-induced POMC expression in the hypothalamus, but again had little effect on AgRP/NPY expression. The results are indicative of a novel role of ERK1/2 in glucose-regulated POMC expression and offer new mechanistic insights into hypothalamic glucose sensing. © 2015 Society for Endocrinology.

PABPN1-Dependent mRNA Processing Induces Muscle Wasting

PubMed Central

Raz, Yotam; van Putten, Maaike; Paniagua-Soriano, Guillem; Krom, Yvonne D.; Florea, Bogdan I.; Raz, Vered

2016-01-01

Poly(A) Binding Protein Nuclear 1 (PABPN1) is a multifunctional regulator of mRNA processing, and its expression levels specifically decline in aging muscles. An expansion mutation in PABPN1 is the genetic cause of oculopharyngeal muscle dystrophy (OPMD), a late onset and rare myopathy. Moreover, reduced PABPN1 expression correlates with symptom manifestation in OPMD. PABPN1 regulates alternative polyadenylation site (PAS) utilization. However, the impact of PAS utilization on cell and tissue function is poorly understood. We hypothesized that altered PABPN1 expression levels is an underlying cause of muscle wasting. To test this, we stably down-regulated PABPN1 in mouse tibialis anterior (TA) muscles by localized injection of adeno-associated viruses expressing shRNA to PABPN1 (shPab). We found that a mild reduction in PABPN1 levels causes muscle pathology including myofiber atrophy, thickening of extracellular matrix and myofiber-type transition. Moreover, reduced PABPN1 levels caused a consistent decline in distal PAS utilization in the 3’-UTR of a subset of OPMD-dysregulated genes. This alternative PAS utilization led to up-regulation of Atrogin-1, a key muscle atrophy regulator, but down regulation of proteasomal genes. Additionally reduced PABPN1 levels caused a reduction in proteasomal activity, and transition in MyHC isotope expression pattern in myofibers. We suggest that PABPN1-mediated alternative PAS utilization plays a central role in aging-associated muscle wasting. PMID:27152426

Regulation of the yeast EKI1-encoded ethanolamine kinase by inositol and choline.

PubMed

Kersting, Michael C; Choi, Hyeon-Son; Carman, George M

2004-08-20

Regulation of the EKI1-encoded ethanolamine kinase by inositol and choline was examined in Saccharomyces cerevisiae. Transcription of the EKI1 gene was monitored by following the expression of beta-galactosidase activity driven by a P(EKI1)-lacZ reporter gene. The addition of inositol to the growth medium resulted in a dose-dependent decrease in EKI1 expression. Supplementation of choline to inositol-containing growth medium brought about a further decrease in expression, whereas choline supplementation alone had no effect. Analysis of EKI1 expression in ino2Delta, ino4Delta, and opi1Delta mutants indicated that the transcription factors Ino2p, Ino4p, and Opi1p played a role in this regulation. Moreover, mutational analysis showed that the UAS(INO) element in the EKI1 promoter was required for the inositol-mediated regulation. The regulation of EKI1 expression by inositol and choline was confirmed by corresponding changes in ethanolamine kinase mRNA, protein, and activity levels. The repression of ethanolamine kinase by inositol supplementation correlated with a decrease in the incorporation of ethanolamine into CDP-ethanolamine pathway intermediates and into phosphatidylethanolamine and phosphatidylcholine.

Inflammatory cytokines IL-17 and TNF-α up-regulate PD-L1 expression in human prostate and colon cancer cells

PubMed Central

Wang, Xun; Yang, Lingyun; Huang, Feng; Zhang, Qiuyang; Liu, Sen; Ma, Lin; You, Zongbing

2017-01-01

Programmed cell death protein 1 (PD-1) acts on PD-1 ligands (PD-L1 and PD-L2) to suppress activation of cytotoxic T lymphocytes. Interleukin-17 (IL-17) and tumor necrosis factor-α (TNF-α) are co-expressed by T helper 17 (TH17) cells in many tumors. The purpose of this study was to test if IL-17 and TNF-α may synergistically induce PD-L1 expression in human prostate cancer LNCaP and human colon cancer HCT116 cell lines. We found that IL-17 did not induce PD-L1 mRNA expression, but up-regulated PD-L1 protein expression in HCT116 and LNCaP cells. TNF-α induced PD-L1 mRNA and protein expression in both cell lines. Neither IL-17 nor TNF-α induced PD-L2 mRNA or protein expression. IL-17 and TNF-α acted individually rather than cooperatively in induction of PD-L1 expression. IL-17 and/or TNF-α activated AKT, nuclear factor-κB (NF-κB), and extracellular signal-regulated kinases 1/2 (ERK1/2) signaling pathways in HCT116 cells, whereas only NF-κB signaling was activated in LNCaP cells. NF-κB inhibitor could diminish PD-L1 protein expression induced by IL-17 and/or TNF-α in both HCT116 and LNCaP cell lines. ERK1/2 inhibitor could also reduce PD-L1 protein expression induced by IL-17 and/or TNF-α in HCT116 cells, while AKT inhibitor could abolish PD-L1 protein expression induced by IL-17 and/or TNF-α in LNCaP cells. These results suggest that IL-17 and TNF-α act individually rather than cooperatively through activation of NF-κB and ERK1/2 signaling to up-regulate PD-L1 expression in HCT116 cells, while the two inflammatory cytokines act through activation of NF-κB signaling, in the presence of AKT activity, to up-regulate PD-L1 expression in LNCaP cells. PMID:28223102

Selenium effect on selenoprotein transcriptome in chondrocytes.

PubMed

Yan, Jidong; Zheng, Yuewen; Min, Zixin; Ning, Qilan; Lu, Shemin

2013-04-01

Selenium is an essential micronutrient and exerts its biological functions predominantly through selenoproteins. Selenium deficiency is associated with cartilage function. This study demonstrated that all 24 selenoprotein transcripts in mouse genome were detectable in ATDC5 chondrocytes except deiodinase 1 (DIO1), DIO2, and selenoprotein V (Sel V), while all 25 selenoprotein transcripts in human genome were detectable in C28/I2 chondrocytes except glutathione peroxidase 6 (GPx6) and DIO1. In addition, gene expression of five selenoproteins (GPx1, Sel H, Sel N, Sel P, and Sel W) was up-regulated and two selenoproteins (SPS2 and Sel O) was down-regulated by sodium selenite (Se) in both ATDC5 and C28/I2 cells. Gene expression of six selenoproteins (TrxR1, Sel I, Sel M, Sel R, Sel S, Sel T) and one selenoprotein (GPx3) was up-regulated by Se in ATDC5 and C28/I2 cells, respectively. Gene expression of one selenoprotein (TrxR2) was down-regulated by Se only in ATDC5 cells. Further transcription inhibition assay showed that both transcriptional and posttranscriptional mechanisms involved in Se-regulated gene expression of GPx1, TrxR1, TrxR2, SPS2, Sel O, and Sel S. However, Se-regulated gene expression of Sel H, Sel I, Sel M, Sel N, Sel P, Sel R, Sel T, and Sel W mainly at posttranscriptional level. Moreover, new protein synthesis inhibition assay indicated that Se-mediated new protein synthesis also played roles in Se-regulated gene expression of GPx1, TrxR1, TrxR2, Sel H, Sel O, Sel P, Sel R, and Sel W. In summary, this study described the selenoprotein transcriptome, Se-regulated selenoproteins and possible mechanisms involved in chondrocytes.

Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

PubMed

Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

2014-07-01

Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

Active Hexose-correlated Compound Down-regulates Heat Shock Factor 1, a Transcription Factor for HSP27, in Gemcitabine-resistant Human Pancreatic Cancer Cells.

PubMed

Tokunaga, Masayuki; Baron, Byron; Kitagawa, Takao; Tokuda, Kazuhiro; Kuramitsu, Yasuhiro

2015-11-01

Active hexose-correlated compound (AHCC) is an extract of a basidiomycete mushroom that enhances the therapeutic effects and reduces the side-effects of chemotherapy. Our previous studies demonstrated that heat-shock protein 27 (HSP27) was involved in gemcitabine-resistance of pancreatic cancer cells and it was down-regulated by AHCC-treatment. However, how AHCC down-regulated HSP27 is unknown. In the present study, we focused on two transcription factors reported to induce HSP27, heat shock factor 1 (HSF1) and high-mobility group box 1 (HMGB1) and investigated the effect of AHCC on their expression. KLM1-R cells were treated with AHCC and the protein expression of HSF1 and HMGB1 were analyzed by western blotting. The protein expression of HSF1 in KLM1-R was down-regulated by AHCC treatment. On the other hand, the protein expression of HMGB1 was not reduced in KLM1-R cells after AHCC treatment. The possibility that AHCC down-regulated HSP27 through down-regulation of the HSF1, was herein shown. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Autoimmune Regulator (AIRE) Is Expressed in Spermatogenic Cells, and It Altered the Expression of Several Nucleic-Acid-Binding and Cytoskeletal Proteins in Germ Cell 1 Spermatogonial (GC1-spg) Cells.

PubMed

Radhakrishnan, Karthika; Bhagya, Kongattu P; Kumar, Anil Tr; Devi, Anandavalli N; Sengottaiyan, Jeeva; Kumar, Pradeep G

2016-08-01

Autoimmune regulator (AIRE) is a gene associated with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). AIRE is expressed heavily in the thymic epithelial cells and is involved in maintaining self-tolerance through regulating the expression of tissue-specific antigens. The testes are the most predominant extrathymic location where a heavy expression of AIRE is reported. Homozygous Aire-deficient male mice were infertile, possibly due to impaired spermatogenesis, deregulated germ cell apoptosis, or autoimmunity. We report that AIRE is expressed in the testes of neonatal, adolescent, and adult mice. AIRE expression was detected in glial cell derived neurotrophic factor receptor alpha (GFRα)(+) (spermatogonia), GFRα(-)/synaptonemal complex protein (SCP3)(+) (meiotic), and GFRα(-)/Phosphoglycerate kinase 2 (PGK2)(+) (postmeiotic) germ cells in mouse testes. GC1-spg, a germ-cell-derived cell line, did not express AIRE. Retinoic acid induced AIRE expression in GC1-spg cells. Ectopic expression of AIRE in GC1-spg cells using label-free LC-MS/MS identified a total of 371 proteins that were differentially expressed. 100 proteins were up-regulated, and 271 proteins were down-regulated. Data are available via ProteomeXchange with identifier PXD002511. Functional analysis of the differentially expressed proteins showed increased levels of various nucleic-acid-binding proteins and transcription factors and a decreased level of various cytoskeletal and structural proteins in the AIRE overexpressing cells as compared with the empty vector-transfected controls. The transcripts of a select set of the up-regulated proteins were also elevated. However, there was no corresponding decrease in the mRNA levels of the down-regulated set of proteins. Molecular function network analysis indicated that AIRE influenced gene expression in GC1-spg cells by acting at multiple levels, including transcription, translation, RNA processing, protein transport, protein localization, and protein degradation, thus setting the foundation in understanding the functional role of AIRE in germ cell biology. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Sildenafil prevents the up-regulation of transient receptor potential canonical channels in the development of cardiomyocyte hypertrophy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiso, Hironori; Ohba, Takayoshi; Iino, Kenji

2013-07-05

Highlights: •Transient receptor potential canonical (TRPC1, 3 and 6) are up-regulated by ET-1. •Sildenafil inhibited hypertrophic responses (BNP, Ca entry, NFAT activation). •Sildenafil suppressed TRPC1, 3 and 6 expression. -- Abstract: Background: Transient receptor potential canonical (TRPCs) channels are up-regulated in the development of cardiac hypertrophy. Sildenafil inhibits TRPC6 activation and expression, leading to the prevention of cardiac hypertrophy. However, the effects of sildenafil on the expression of other TRPCs remain unknown. We hypothesized that in addition to its effects of TRPC6, sildenafil blocks the up-regulation of other TRPC channels to suppress cardiomyocyte hypertrophy. Methods and results: In cultured neonatalmore » rat cardiomyocytes, a 48 h treatment with 10 nM endothelin (ET)-1 induced hypertrophic responses characterized by nuclear factor of activated T cells activation and enhancement of brain natriuretic peptide expression and cell surface area. Co-treatment with sildenafil (1 μM, 48 h) inhibited these ET-1-induced hypertrophic responses. Although ET-1 enhanced the gene expression of TRPCs, sildenafil inhibited the enhanced gene expression of TRPC1, C3 and C6. Moreover, co-treatment with sildenafil abolished the augmentation of SOCE in the hypertrophied cardiomyocytes. Conclusions: These results suggest that sildenafil inhibits cardiomyocyte hypertrophy by suppressing the up-regulation of TRPC expression.« less

Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biswas, Madhurima; Kwong, Erick K.; Park, Eujean

2013-08-01

Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 frommore » phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.« less

Opiorphin is a master regulator of the hypoxic response in corporal smooth muscle cells

PubMed Central

Fu, Shibo; Tar, Moses Tarndie; Melman, Arnold; Davies, Kelvin Paul

2014-01-01

Men with sickle cell disease (SCD) risk developing priapism. Recognizing that SCD is a disease of hypoxia, we investigated the effect of hypoxia on gene expression in corporal smooth muscle (CSM) cells. Rat CSM cells in vitro were treated with CoCl2 or low oxygen tension to mimic hypoxia. Hypoxic conditions increased expression of genes previously associated with priapism in animal models. Variable coding sequence a1 (Vcsa1; the rat opiorphin homologue, sialorphin), hypoxia-inducible factor 1a (Hif-1a), and A2B adenosine receptor (a2br) were increased by 10-, 4-, and 6-fold, respectively, by treatment with CoCl2, whereas low oxygen tension caused increases in expression of 3-, 4-, and 1.5-fold, respectively. Sialorphin-treated CSM cells increased expression of Hif-1a and a2br by 4-fold, and vcsa1-siRNA treatment reduced expression by ∼50%. Using a Hif-1a inhibitor, we demonstrated up-regulation of a2br by sialorphin is dependent on Hif-1a, and knockdown of vcsa1 expression with vcsa1-siRNA demonstrated that hypoxic-up-regulation of Hif-1a is dependent on vcsa1. In CSM from a SCD mouse, there was 15-fold up-regulation of opiorphin at a life stage prior to priapism. We conclude that in CSM, opiorphins are master regulators of the hypoxic response. Opiorphin up-regulation in response to SCD-associated hypoxia activates CSM “relaxant” pathways; excessive activation of these pathways results in priapism.—Fu, S., Tar, M. T., Melman, A., Davies, K. P. Opiorphin is a master regulator of the hypoxic response in corporal smooth muscle cells. PMID:24803544

Rapamycin up-regulates triglycerides in hepatocytes by down-regulating Prox1.

PubMed

Kwon, Sora; Jeon, Ji-Sook; Kim, Su Bin; Hong, Young-Kwon; Ahn, Curie; Sung, Jung-Suk; Choi, Inho

2016-02-27

Although the prolonged use of rapamycin may cause unwanted side effects such as hyperlipidemia, the underlying mechanism remains unknown. Prox1 is a transcription factor responsible for the development of several tissues including lymphatics and liver. There is growing evidences that Prox1 participates in metabolism in addition to embryogenesis. However, whether Prox1 is directly related to lipid metabolism is currently unknown. HepG2 human hepatoma cells were treated with rapamycin and total lipids were analyzed by thin layer chromatography. The effect of rapamycin on the expression of Prox1 was determined by western blotting. To investigate the role of Prox1 in triglycerides regulation, siRNA and overexpression system were employed. Rapamycin was injected into mice for 2 weeks and total lipids and proteins in liver were measured by thin layer chromatography and western blot analysis, respectively. Rapamycin up-regulated the amount of triglyceride and down-regulated the expression of Prox1 in HepG2 cells by reducing protein half-life but did not affect its transcript. The loss-of-function of Prox1 was coincident with the increase of triglycerides in HepG2 cells treated with rapamycin. The up-regulation of triglycerides by rapamycin in HepG2 cells reverted to normal levels by the compensation of Prox1 using the overexpression system. Rapamycin also down-regulated Prox1 expression but increased triglycerides in mouse liver. This study suggests that rapamycin can increase the amount of triglycerides by down-regulating Prox1 expression in hepatocytes, which means that the mammalian target of rapamycin (mTOR) signaling is important for the regulation of triglycerides by maintaining Prox1 expression.

Substance P regulates the expression of matrix metalloproteinases and tissue inhibitors of metalloproteinase in cultured human gingival fibroblasts.

PubMed

Cury, P R; Canavez, F; de Araújo, V C; Furuse, C; de Araújo, N S

2008-06-01

Substance P may play a role in the pathogenesis of periodontal disease; however, its mechanisms of modulation are not clear. This study evaluated the effect of two concentrations of Substance P on the expression of matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) in cultured human gingival fibroblasts. Fibroblasts were stimulated for 48 h with 10(-4) or 10(-9) m Substance P; untreated fibroblasts served as controls. The expression of MMP-1, -2, -3, -7 and -11 and of TIMP-1 and -2 was evaluated using real-time polymerase chain reaction and western blotting. There was a significant, concentration-dependent stimulatory effect of Substance P on MMP-1, -2, -3 and -7 and TIMP-2 gene expression (p < 0.05), and a probable effect on MMP-11 (p = 0.06). At the higher concentration (10(-4) m Substance P), MMP-1, -2, -3, -7 and -11 and TIMP-2 showed the greatest up-regulation; at the lower concentration (10(-9) m Substance P), MMP-1, -3 and -7 and TIMP-2 exhibited diminished up-regulation, with MMP-2 and -11 showing down-regulation (p < 0.05). Expression of TIMP-1 was not affected by Substance P (p > 0.05). Western blotting confirmed that Substance P up-regulated MMP-1, -2, -3 and -11 and TIMP-2. MMP-1, -3 and -11 and TIMP-2 showed greater up-regulation at the higher Substance P concentration and diminished up-regulation at the lower concentration. MMP-2 was up-regulated to a similar degree at both Substance P concentrations. In gingival fibroblast cells, Substance P at the higher concentration (10(-4) m) induced greater up-regulation of MMP-1, -3 and -11 and TIMP-2 expression, but at the lower concentration (10(-9) m) induced diminished up-regulation, which may represent a mechanism for modulating periodontal breakdown.

DCGL v2.0: an R package for unveiling differential regulation from differential co-expression.

PubMed

Yang, Jing; Yu, Hui; Liu, Bao-Hong; Zhao, Zhongming; Liu, Lei; Ma, Liang-Xiao; Li, Yi-Xue; Li, Yuan-Yuan

2013-01-01

Differential co-expression analysis (DCEA) has emerged in recent years as a novel, systematic investigation into gene expression data. While most DCEA studies or tools focus on the co-expression relationships among genes, some are developing a potentially more promising research domain, differential regulation analysis (DRA). In our previously proposed R package DCGL v1.0, we provided functions to facilitate basic differential co-expression analyses; however, the output from DCGL v1.0 could not be translated into differential regulation mechanisms in a straightforward manner. To advance from DCEA to DRA, we upgraded the DCGL package from v1.0 to v2.0. A new module named "Differential Regulation Analysis" (DRA) was designed, which consists of three major functions: DRsort, DRplot, and DRrank. DRsort selects differentially regulated genes (DRGs) and differentially regulated links (DRLs) according to the transcription factor (TF)-to-target information. DRrank prioritizes the TFs in terms of their potential relevance to the phenotype of interest. DRplot graphically visualizes differentially co-expressed links (DCLs) and/or TF-to-target links in a network context. In addition to these new modules, we streamlined the codes from v1.0. The evaluation results proved that our differential regulation analysis is able to capture the regulators relevant to the biological subject. With ample functions to facilitate differential regulation analysis, DCGL v2.0 was upgraded from a DCEA tool to a DRA tool, which may unveil the underlying differential regulation from the observed differential co-expression. DCGL v2.0 can be applied to a wide range of gene expression data in order to systematically identify novel regulators that have not yet been documented as critical. DCGL v2.0 package is available at http://cran.r-project.org/web/packages/DCGL/index.html or at our project home page http://lifecenter.sgst.cn/main/en/dcgl.jsp.

Angiotensin II modulates interleukin-1{beta}-induced inflammatory gene expression in vascular smooth muscle cells via interfering with ERK-NF-{kappa}B crosstalk

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Shanqin; Zhi, Hui; Hou, Xiuyun

2011-07-08

Highlights: {yields} We examine how angiotensin II modulates ERK-NF-{kappa}B crosstalk and gene expression. {yields} Angiotensin II suppresses IL-1{beta}-induced prolonged ERK and NF-{kappa}B activation. {yields} ERK-RSK1 signaling is required for IL-1{beta}-induced prolonged NF-{kappa}B activation. {yields} Angiotensin II modulates NF-{kappa}B responsive genes via regulating ERK-NF-{kappa}B crosstalk. {yields} ERK-NF-{kappa}B crosstalk is a novel mechanism regulating inflammatory gene expression. -- Abstract: Angiotensin II is implicated in cardiovascular diseases, which is associated with a role in increasing vascular inflammation. The present study investigated how angiotensin II modulates vascular inflammatory signaling and expression of inducible nitric oxide synthase (iNOS) and vascular cell adhesion molecule (VCAM)-1. Inmore » cultured rat aortic vascular smooth muscle cells (VSMCs), angiotensin II suppressed interleukin-1{beta}-induced prolonged phosphorylation of extracellular signal-regulated kinase (ERK) and ribosomal S6 kinase (RSK)-1, and nuclear translocation of nuclear factor (NF)-{kappa}B, leading to decreased iNOS but enhanced VCAM-1 expression, associated with an up-regulation of mitogen-activated protein kinase phosphatase-1 expression. Knock-down of RSK1 selectively down regulated interleukin-1{beta}-induced iNOS expression without influencing VCAM-1 expression. In vivo experiments showed that interleukin-1{beta}, iNOS, and VCAM-1 expression were detectable in the aortic arches of both wild-type and apolipoprotein E-deficient (ApoE{sup -/-}) mice. VCAM-1 and iNOS expression were higher in ApoE{sup -/-} than in wild type mouse aortic arches. Angiotensin II infusion (3.2 mg/kg/day, for 6 days, via subcutaneous osmotic pump) in ApoE{sup -/-} mice enhanced endothelial and adventitial VCAM-1 and iNOS expression, but reduced medial smooth muscle iNOS expression associated with reduced phosphorylation of ERK and RSK-1. These results indicate that angiotensin II can differentially modulate inflammatory gene expression in aortic smooth muscle cells through influencing ERK-NF-{kappa}B crosstalk, which may contribute to angiotensin II-induced inflammatory disorders related to cardiovascular diseases.« less

Regulation of CD93 cell surface expression by protein kinase C isoenzymes.

PubMed

Ikewaki, Nobunao; Kulski, Jerzy K; Inoko, Hidetoshi

2006-01-01

Human CD93, also known as complement protein 1, q subcomponent, receptor (C1qRp), is selectively expressed by cells with a myeloid lineage, endothelial cells, platelets, and microglia and was originally reported to be involved in the complement protein 1, q subcomponent (C1q)-mediated enhancement of phagocytosis. The intracellular molecular events responsible for the regulation of its expression on the cell surface, however, have not been determined. In this study, the effect of protein kinases in the regulation of CD93 expression on the cell surface of a human monocyte-like cell line (U937), a human NK-like cell line (KHYG-1), and a human umbilical vein endothelial cell line (HUV-EC-C) was investigated using four types of protein kinase inhibitors, the classical protein kinase C (cPKC) inhibitor Go6976, the novel PKC (nPKC) inhibitor Rottlerin, the protein kinase A (PKA) inhibitor H-89 and the protein tyrosine kinase (PTK) inhibitor herbimycin A at their optimum concentrations for 24 hr. CD93 expression was analyzed using flow cytometry and glutaraldehyde-fixed cellular enzyme-linked immunoassay (EIA) techniques utilizing a CD93 monoclonal antibody (mAb), mNI-11, that was originally established in our laboratory as a CD93 detection probe. The nPKC inhibitor Rottlerin strongly down-regulated CD93 expression on the U937 cells in a dose-dependent manner, whereas the other inhibitors had little or no effect. CD93 expression was down-regulated by Go6976, but not by Rottlerin, in the KHYG-1 cells and by both Rottlerin and Go6976 in the HUV-EC-C cells. The PKC stimulator, phorbol myristate acetate (PMA), strongly up-regulated CD93 expression on the cell surface of all three cell-lines and induced interleukin-8 (IL-8) production by the U937 cells and interferon-gamma (IFN-gamma) production by the KHYG-1 cells. In addition, both Go6976 and Rottlerin inhibited the up-regulation of CD93 expression induced by PMA and IL-8 or IFN-gamma production in the respective cell-lines. Whereas recombinant tumor necrosis factor-alpha (rTNF-alpha) slightly up-regulated CD93 expression on the U937 cells, recombinant interleukin-1beta (rIL-1beta), recombinant interleukin-2 (rIL-2), recombinant interferon-gamma (rIFN-gamma) and lipopolysaccharide (LPS) had no effect. Taken together, these findings indicate that the regulation of CD93 expression on these cells involves the PKC isoenzymes.

Intermittent Fasting Alleviates the Increase of Lipoprotein Lipase Expression in Brain of a Mouse Model of Alzheimer's Disease: Possibly Mediated by β-hydroxybutyrate.

PubMed

Zhang, Jingzhu; Li, Xinhui; Ren, Yahao; Zhao, Yue; Xing, Aiping; Jiang, Congmin; Chen, Yanqiu; An, Li

2018-01-01

Intermittent fasting has been demonstrated to protect against Alzheimer's disease (AD), however, the mechanism is unclear. Histone acetylation and lipoprotein lipase (LPL) are involved in AD progression. Importantly, LPL has been documented to be regulated by histone deacetylases (HDACs) inhibitors (increase histone acetylation level) in adipocyte and mesenchymal stem cells, or by fasting in adipose and muscle tissues. In brain, however, whether histone acetylation or fasting regulates LPL expression is unknown. This study was designed to demonstrate intermittent fasting may protect against AD through increasing β-hydroxybutyrate, a HDACs inhibitor, to regulate LPL. We also investigated microRNA-29a expression associating with regulation of LPL and histone acetylation. The results showed LPL mRNA expression was increased and microRNA-29a expression was decreased in the cerebral cortex of AD model mice (APP/PS1), which were alleviated by intermittent fasting. No significant differences were found in the total expression of LPL protein (brain-derived and located in capillary endothelial cells from peripheral tissues) in the cerebral cortex of APP/PS1 mice. Further study indicated that LPL located in capillary endothelial cells was decreased in the cerebral cortex of APP/PS1 mice, which was alleviated by intermittent fasting. LPL and microRNA-29a expression were separately increased and down-regulated in 2 μM Aβ 25-35 -exposed SH-SY5Y cells, but respectively decreased and up-regulated in 10 μM Aβ 25-35 -exposed cells, which were all reversed by β-hydroxybutyrate. The increase of HDAC2/3 expression and the decrease of acetylated H3K9 and H4K12 levels were alleviated in APP/PS1 mice by intermittent fasting treatment, as well in 2 or 10 μM Aβ 25-35 -exposed cells by β-hydroxybutyrate treatment. These findings above suggested the results from APP/PS1 mice were consistent with those from cells treated with 2 μM Aβ 25-35 . Interestingly, LPL expression was reduced (0.2-folds) and microRNA-29a expression was up-regulated (1.7-folds) in HDAC2-silenced cells, but respectively increased (1.3-folds) and down-regulated (0.8-folds) in HDAC3-silenced cells. Furthermore, LPL expression was decreased in cells treated with microRNA-29a mimic and increased with inhibitor treatment. In conclusion, intermittent fasting inhibits the increase of brain-derived LPL expression in APP/PS1 mice partly through β-hydroxybutyrate-mediated down-regulation of microRNA-29a expression. HDAC2/3 may be implicated in the effect of β-hydroxybutyrate on microRNA-29a expression.

Comparative Study of Early Cold-Regulated Proteins by Two-Dimensional Difference Gel Electrophoresis Reveals a Key Role for Phospholipase Dα1 in Mediating Cold Acclimation Signaling Pathway in Rice.

PubMed

Huo, Chenmin; Zhang, Baowen; Wang, Hui; Wang, Fawei; Liu, Meng; Gao, Yingjie; Zhang, Wenhua; Deng, Zhiping; Sun, Daye; Tang, Wenqiang

2016-04-01

To understand the early signaling steps that regulate cold responses in rice, two-dimensional difference gel electrophoresis (2-D DIGE)(1)was used to study early cold-regulated proteins in rice seedlings. Using mass spectrometry, 32 spots, which represent 26 unique proteins that showed an altered expression level within 5 min of cold treatment were identified. Among these proteins, Western blot analyses confirmed that the cellular phospholipase D α1 (OsPLDα1) protein level was increased as early as 1 min after cold treatment. Genetic studies showed that reducing the expression ofOsPLDα1makes rice plants more sensitive to chilling stress as well as cold acclimation increased freezing tolerance. Correspondingly, cold-regulated proteomic changes and the expression of the cold-responsive C repeat/dehydration-responsive element binding 1 (OsDREB1) family of transcription factors were inhibited in thepldα1mutant. We also found that the expression ofOsPLDα1is directly regulated by OsDREB1A. This transcriptional regulation ofOsPLDα1could provide positive feedback regulation of the cold signal transduction pathway in rice. OsPLDα1 hydrolyzes phosphatidylcholine to produce the signal molecule phosphatidic acid (PA). By lipid-overlay assay, we demonstrated that the rice cold signaling proteins, MAP kinase 6 (OsMPK6) and OsSIZ1, bind directly to PA. Taken together, our results suggest that OsPLDα1 plays a key role in transducing cold signaling in rice by producing PA and regulatingOsDREB1s' expression by OsMPK6, OsSIZ1, and possibly other PA-binding proteins. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Global gene expression analysis using RNA-seq uncovered a new role for SR1/CAMTA3 transcription factor in salt stress

PubMed Central

Prasad, Kasavajhala V. S. K.; Abdel-Hameed, Amira A. E.; Xing, Denghui; Reddy, Anireddy S. N.

2016-01-01

Abiotic and biotic stresses cause significant yield losses in all crops. Acquisition of stress tolerance in plants requires rapid reprogramming of gene expression. SR1/CAMTA3, a member of signal responsive transcription factors (TFs), functions both as a positive and a negative regulator of biotic stress responses and as a positive regulator of cold stress-induced gene expression. Using high throughput RNA-seq, we identified ~3000 SR1-regulated genes. Promoters of about 60% of the differentially expressed genes have a known DNA binding site for SR1, suggesting that they are likely direct targets. Gene ontology analysis of SR1-regulated genes confirmed previously known functions of SR1 and uncovered a potential role for this TF in salt stress. Our results showed that SR1 mutant is more tolerant to salt stress than the wild type and complemented line. Improved tolerance of sr1 seedlings to salt is accompanied with the induction of salt-responsive genes. Furthermore, ChIP-PCR results showed that SR1 binds to promoters of several salt-responsive genes. These results suggest that SR1 acts as a negative regulator of salt tolerance by directly repressing the expression of salt-responsive genes. Overall, this study identified SR1-regulated genes globally and uncovered a previously uncharacterized role for SR1 in salt stress response. PMID:27251464

Identification of distinct molecular phenotypes in acute megakaryoblastic leukemia by gene expression profiling

PubMed Central

Bourquin, Jean-Pierre; Subramanian, Aravind; Langebrake, Claudia; Reinhardt, Dirk; Bernard, Olivier; Ballerini, Paola; Baruchel, André; Cavé, Hélène; Dastugue, Nicole; Hasle, Henrik; Kaspers, Gertjan L.; Lessard, Michel; Michaux, Lucienne; Vyas, Paresh; van Wering, Elisabeth; Zwaan, Christian M.; Golub, Todd R.; Orkin, Stuart H.

2006-01-01

Individuals with Down syndrome (DS) are predisposed to develop acute megakaryoblastic leukemia (AMKL), characterized by expression of truncated GATA1 transcription factor protein (GATA1s) due to somatic mutation. The treatment outcome for DS-AMKL is more favorable than for AMKL in non-DS patients. To gain insight into gene expression differences in AMKL, we compared 24 DS and 39 non-DS AMKL samples. We found that non-DS-AMKL samples cluster in two groups, characterized by differences in expression of HOX/TALE family members. Both of these groups are distinct from DS-AMKL, independent of chromosome 21 gene expression. To explore alterations of the GATA1 transcriptome, we used cross-species comparison with genes regulated by GATA1 expression in murine erythroid precursors. Genes repressed after GATA1 induction in the murine system, most notably GATA-2, MYC, and KIT, show increased expression in DS-AMKL, suggesting that GATA1s fail to repress this class of genes. Only a subset of genes that are up-regulated upon GATA1 induction in the murine system show increased expression in DS-AMKL, including GATA1 and BACH1, a probable negative regulator of megakaryocytic differentiation located on chromosome 21. Surprisingly, expression of the chromosome 21 gene RUNX1, a known regulator of megakaryopoiesis, was not elevated in DS-AMKL. Our results identify relevant signatures for distinct AMKL entities and provide insight into gene expression changes associated with these related leukemias. PMID:16492768

Neuropilin 1 Receptor Is Up-Regulated in Dysplastic Epithelium and Oral Squamous Cell Carcinoma.

PubMed

Shahrabi-Farahani, Shokoufeh; Gallottini, Marina; Martins, Fabiana; Li, Erik; Mudge, Dayna R; Nakayama, Hironao; Hida, Kyoko; Panigrahy, Dipak; D'Amore, Patricia A; Bielenberg, Diane R

2016-04-01

Neuropilins are receptors for disparate ligands, including proangiogenic factors such as vascular endothelial growth factor and inhibitory class 3 semaphorin (SEMA3) family members. Differentiated cells in skin epithelium and cutaneous squamous cell carcinoma highly express the neuropilin-1 (NRP1) receptor. We examined the expression of NRP1 in human and mouse oral mucosa. NRP1 was significantly up-regulated in oral epithelial dysplasia and oral squamous cell carcinoma (OSCC). NRP1 receptor localized to the outer suprabasal epithelial layers in normal tongue, an expression pattern similar to the normal skin epidermis. However, dysplastic tongue epithelium and OSCC up-regulated NRP1 in basal and proliferating epithelial layers, a profile unseen in cutaneous squamous cell carcinoma. NRP1 up-regulation is observed in a mouse carcinogen-induced OSCC model and in human tongue OSCC biopsies. Human OSCC cell lines express NRP1 protein in vitro and in mouse tongue xenografts. Sites of capillary infiltration into orthotopic OSCC tumors correlate with high NRP1 expression. HSC3 xenografts, which express the highest NRP1 levels of the cell lines examined, showed massive intratumoral lymphangiogenesis. SEMA3A inhibited OSCC cell migration, suggesting that the NRP1 receptor was bioactive in OSCC. In conclusion, NRP1 is regulated in the oral epithelium and is selectively up-regulated during epithelial dysplasia. NRP1 may function as a reservoir to sequester proangiogenic ligands within the neoplastic compartment, thereby recruiting neovessels toward tumor cells. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Transcriptome changes associated with delayed flower senescence on transgenic petunia by inducing expression of etr1-1, a mutant ethylene receptor.

PubMed

Wang, Hong; Stier, Genevieve; Lin, Jing; Liu, Gang; Zhang, Zhen; Chang, Youhong; Reid, Michael S; Jiang, Cai-Zhong

2013-01-01

Flowers of ethylene-sensitive ornamental plants transformed with ethylene-insensitive 1-1(etr1-1), a mutant ethylene receptor first isolated from Arabidopsis, are known to have longer shelf lives. We have generated petunia plants in which the etr1-1 gene was over-expressed under the control of a chemically-inducible promoter, which would allow expression of etr1-1 to be initiated at the desired time and stage of development. Here, we showed that transgenic plants grew and developed normally without a chemical inducer. Semi-quantitative RT-PCR demonstrated that the abundance of transcripts of Arabidopsis etr1-1 gene was substantially induced in flowers with 30 μM dexamethasone (DEX). Consequently, t he life of the flowers was almost doubled and the peak of ethylene production was delayed. We compared gene expression changes of petals with DEX to those without DEX at 24 h and 48 h by microarray. Our results indicated that transcripts of many putative genes encoding transcription factors were down-regulated by etr1-1 induced expression at the early stage. In addition, putative genes involved in gibberellin biosynthesis, response to jasmonic acid/gibberellins stimulus, cell wall modification, ethylene biosynthesis, and cell death were down-regulated associating with etr1-1 induced expression. We investigated time-course gene expression profiles and found two profiles which displayed totally opposite expression patterns under these two treatments. In these profiles, 'the regulation of transcription' was predominant in GO categories. Taking all results together, we concluded those transcription factors down-regulated at early stage might exert a major role in regulating the senescence process which were consequently characterized by cell wall modification and cell death.

Transcriptome Changes Associated with Delayed Flower Senescence on Transgenic Petunia by Inducing Expression of etr1-1, a Mutant Ethylene Receptor

PubMed Central

Lin, Jing; Liu, Gang; Zhang, Zhen; Chang, Youhong; Reid, Michael S.; Jiang, Cai-Zhong

2013-01-01

Flowers of ethylene-sensitive ornamental plants transformed with ethylene-insensitive 1-1(etr1-1), a mutant ethylene receptor first isolated from Arabidopsis, are known to have longer shelf lives. We have generated petunia plants in which the etr1-1 gene was over-expressed under the control of a chemically-inducible promoter, which would allow expression of etr1-1 to be initiated at the desired time and stage of development. Here, we showed that transgenic plants grew and developed normally without a chemical inducer. Semi-quantitative RT-PCR demonstrated that the abundance of transcripts of Arabidopsis etr1-1 gene was substantially induced in flowers with 30 μM dexamethasone (DEX). Consequently, t he life of the flowers was almost doubled and the peak of ethylene production was delayed. We compared gene expression changes of petals with DEX to those without DEX at 24 h and 48 h by microarray. Our results indicated that transcripts of many putative genes encoding transcription factors were down-regulated by etr1-1 induced expression at the early stage. In addition, putative genes involved in gibberellin biosynthesis, response to jasmonic acid/gibberellins stimulus, cell wall modification, ethylene biosynthesis, and cell death were down-regulated associating with etr1-1 induced expression. We investigated time-course gene expression profiles and found two profiles which displayed totally opposite expression patterns under these two treatments. In these profiles, ‘the regulation of transcription’ was predominant in GO categories. Taking all results together, we concluded those transcription factors down-regulated at early stage might exert a major role in regulating the senescence process which were consequently characterized by cell wall modification and cell death. PMID:23874385

The expression of genes involved in myometrial contractility changes during ex situ culture of pregnant human uterine smooth muscle tissue.

PubMed

Ilicic, Marina; Butler, Trent; Zakar, Tamas; Paul, Jonathan W

2017-01-01

Ex situ analyses of human myometrial tissue has been used to investigate the regulation of uterine quiescence and transition to a contractile phenotype. Following concerns about the validity of cultured primary cells, we examined whether myometrial tissue undergoes culture-induced changes ex situ that may affect the validity of in vitro models. To determine whether human myometrial tissue undergoes culture-induced changes ex situ in Estrogen receptor 1 (ESR1), Prostaglandin-endoperoxide synthase 2 (PTGS2) and Oxytocin receptor (OXTR) expression. Additionally, to determine whether culture conditions approaching the in vivo environment influence the expression of these key genes. Term non-laboring human myometrial tissues were cultured in the presence of specific treatments, including; serum supplementation, progesterone and estrogen, cAMP, PMA, stretch or NF-κB inhibitors. ESR1, PTGS2 and OXTR mRNA abundance after 48 h culture was determined using quantitative RT-PCR. Myometrial tissue in culture exhibited culture-induced up-regulation of ESR1 and PTGS2 and down-regulation of OXTR mRNA expression. Progesterone prevented culture-induced increase in ESR1 expression. Estrogen further up-regulated PTGS2 expression. Stretch had no direct effect, but blocked the effects of progesterone and estrogen on ESR1 and PTGS2 expression. cAMP had no effect whereas PMA further up-regulated PTGS2 expression and prevented decline of OXTR expression. Human myometrial tissue in culture undergoes culture-induced gene expression changes consistent with transition toward a laboring phenotype. Changes in ESR1, PTGS2 and OXTR expression could not be controlled simultaneously. Until optimal culture conditions are determined, results of in vitro experiments with myometrial tissues should be interpreted with caution.

Atorvastatin Upregulates the Expression of miR-126 in Apolipoprotein E-knockout Mice with Carotid Atherosclerotic Plaque.

PubMed

Pan, Xudong; Hou, Rongyao; Ma, Aijun; Wang, Ting; Wu, Mei; Zhu, Xiaoyan; Yang, Shaonan; Xiao, Xing

2017-01-01

Carotid atherosclerosis (AS) is a chronic inflammatory disease of the carotid arterial wall, which is very important in terms of the occurrence of cerebral vascular accidents. Studies have demonstrated that microRNAs (miRNAs) and their target genes are involved in the formation of atherosclerosis and that atorvastatin might reduce atherosclerotic plaques by regulating the expression of miRNAs. However, the related mechanism is not yet known. In this study, we first investigated the effects of atorvastatin on miR-126 and its target gene, i.e., vascular cell adhesion molecule-1 (VCAM-1) in apolipoprotein E-knockout (ApoE-/-) mice with carotid atherosclerotic plaque in vivo. We compared the expressions of miR-126 and VCAM-1 between the control, atherosclerotic model and atorvastatin treatment groups of ApoE-/- mice using RT-PCR and Western blot. We found the miR-126 expression was significantly down-regulated, and the VCAM-1 expression was significantly up-regulated in the atherosclerotic model group, which accelerated the progression of atherosclerosis in the ApoE-/- mice. These results following atorvastatin treatment indicated that miR-126 expression was significantly up-regulated, VCAM-1 expression was significantly down-regulated and atherosclerotic lesions were reduced. The present results might explain the mechanism by which miR-126 is involved in the formation of atherosclerosis in vivo. Our study first indicated that atorvastatin might exert its anti-inflammatory effects in atherosclerosis by regulating the expressions of miR-126 and VCAM-1 in vivo.

Rev-erb beta regulates the Srebp-1c promoter and mRNA expression in skeletal muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramakrishnan, Sathiya N.; Lau, Patrick; Crowther, Lisa M.

2009-10-30

The nuclear hormone receptor, Rev-erb beta operates as a transcriptional silencer. We previously demonstrated that exogenous expression of Rev-erb{beta}{Delta}E in skeletal muscle cells increased Srebp-1c mRNA expression. We validated these in vitro observations by injection of an expression vector driving Rev-erb{beta}{Delta}E expression into mouse tibialis muscle that resulted in increased Srebp-1c mRNA expression. Paradoxically, Rev-erb{beta} siRNA expression in skeletal muscle cells repressed Srebp-1c expression, and indicated that Rev-erb{beta} expression was necessary for Srebp-1c expression. ChIP analysis demonstrated that Rev-erb{beta} was recruited to the Srebp-1c promoter. Moreover, Rev-erb{beta} trans-activated the Srebp-1c promoter, in contrast, Rev-erb{beta} efficiently repressed the Rev-erb{alpha} promoter, amore » previously characterized target gene. Finally, treatment with the Rev-erb agonist (hemin) (i) increased the trans-activation of the Srebp-1c promoter by Rev-erb{beta}; and (ii) increased Rev-erb{beta} and Srebp-1c mRNA expression. These data suggest that Rev-erb{beta} has the potential to activate gene expression, and is a positive regulator of Srebp-1c, a regulator of lipogenesis.« less

miR-135A Regulates Preimplantation Embryo Development through Down-Regulation of E3 Ubiquitin Ligase Seven in Absentia Homolog 1A (SIAH1A) Expression

PubMed Central

Leung, Carmen O. N.; Ye, Tian-Min; Kwan, Peter C. K.; Lee, Kai-Fai; Yeung, William S. B.

2011-01-01

Background MicroRNAs (miRNAs) are small non-coding RNA molecules capable of regulating transcription and translation. Previously, a cluster of miRNAs that are specifically expressed in mouse zygotes but not in oocytes or other preimplantation stages embryos are identified by multiplex real-time polymerase chain reaction-based miRNA profiling. The functional role of one of these zygote-specific miRNAs, miR-135a, in preimplantation embryo development was investigated. Methodology/Principal Findings Microinjection of miR-135a inhibitor suppressed first cell cleavage in more than 30% of the zygotes. Bioinformatics analysis identified E3 Ubiquitin Ligase Seven In Absentia Homolog 1A (Siah1a) as a predicted target of miR-135a. Western blotting and 3′UTR luciferase functional assays demonstrated that miR-135a down-regulated the expression of Siah1 in HeLa cells and in mouse zygotes. Siah1a was expressed in preimplantation embryos and its expression pattern negatively correlated with that of miR-135a. Co-injection of Siah1a-specific antibody with miR-135a inhibitor partially nullified the effect of miR-135a inhibition. Proteasome inhibition by MG-132 revealed that miR-135a regulated proteasomal degradation and potentially controlled the expression of chemokinesin DNA binding protein (Kid). Conclusions/Significance The present study demonstrated for the first time that zygotic specific miRNA modulates the first cell cleavage through regulating expression of Siah1a. PMID:22132158

Zebrafish E-cadherin: expression during early embryogenesis and regulation during brain development.

PubMed

Babb, S G; Barnett, J; Doedens, A L; Cobb, N; Liu, Q; Sorkin, B C; Yelick, P C; Raymond, P A; Marrs, J A

2001-06-01

Zebrafish E-cadherin (cdh1) cell adhesion molecule cDNAs were cloned. We investigated spatial and temporal expression of cdh1 during early embryogenesis. Expression was observed in blastomeres, the anterior mesoderm during gastrulation, and developing epithelial structures. In the developing nervous system, cdh1 was detected at the pharyngula stage (24 hpf) in the midbrain-hindbrain boundary (MHB). Developmental regulation of MHB formation involves wnt1 and pax2.1. wnt1 expression preceded cdh1 expression during MHB formation, and cdh1 expression in the MHB was dependent on normal development of this structure. Copyright 2001 Wiley-Liss, Inc.

Nuclear factor of activated T-cells 5 increases intestinal goblet cell differentiation through an mTOR/Notch signaling pathway

PubMed Central

Zhou, Yuning; Wang, Qingding; Weiss, Heidi L.; Evers, B. Mark

2014-01-01

The intestinal mucosa undergoes a continual process of proliferation, differentiation, and apoptosis that is regulated by multiple signaling pathways. Previously, we have shown that the nuclear factor of activated T-cells 5 (NFAT5) is involved in the regulation of intestinal enterocyte differentiation. Here we show that treatment with sodium chloride (NaCl), which activates NFAT5 signaling, increased mTORC1 repressor regulated in development and DNA damage response 1 (REDD1) protein expression and inhibited mTOR signaling; these alterations were attenuated by knockdown of NFAT5. Knockdown of NFAT5 activated mammalian target of rapamycin (mTOR) signaling and significantly inhibited REDD1 mRNA expression and protein expression. Consistently, overexpression of NFAT5 increased REDD1 expression. In addition, knockdown of REDD1 activated mTOR and Notch signaling, whereas treatment with mTOR inhibitor rapamycin repressed Notch signaling and increased the expression of the goblet cell differentiation marker mucin 2 (MUC2). Moreover, knockdown of NFAT5 activated Notch signaling and decreased MUC2 expression, while overexpression of NFAT5 inhibited Notch signaling and increased MUC2 expression. Our results demonstrate a role for NFAT5 in the regulation of mTOR signaling in intestinal cells. Importantly, these data suggest that NFAT5 participates in the regulation of intestinal homeostasis via the suppression of mTORC1/Notch signaling pathway. PMID:25057011

Post-transcriptional regulation of Pabpn1 by the RNA binding protein HuR.

PubMed

Phillips, Brittany L; Banerjee, Ayan; Sanchez, Brenda J; Di Marco, Sergio; Gallouzi, Imed-Eddine; Pavlath, Grace K; Corbett, Anita H

2018-06-25

RNA processing is critical for proper spatial and temporal control of gene expression. The ubiquitous nuclear polyadenosine RNA binding protein, PABPN1, post-transcriptionally regulates multiple steps of gene expression. Mutations in the PABPN1 gene expanding an N-terminal alanine tract in the PABPN1 protein from 10 alanines to 11-18 alanines cause the muscle-specific disease oculopharyngeal muscular dystrophy (OPMD), which affects eyelid, pharynx, and proximal limb muscles. Previous work revealed that the Pabpn1 transcript is unstable, contributing to low steady-state Pabpn1 mRNA and protein levels in vivo, specifically in skeletal muscle, with even lower levels in muscles affected in OPMD. Thus, low levels of PABPN1 protein could predispose specific tissues to pathology in OPMD. However, no studies have defined the mechanisms that regulate Pabpn1 expression. Here, we define multiple cis-regulatory elements and a trans-acting factor, HuR, which regulate Pabpn1 expression specifically in mature muscle in vitro and in vivo. We exploit multiple models including C2C12 myotubes, primary muscle cells, and mice to determine that HuR decreases Pabpn1 expression. Overall, we have uncovered a mechanism in mature muscle that negatively regulates Pabpn1 expression in vitro and in vivo, which could provide insight to future studies investigating therapeutic strategies for OPMD treatment.

Regulation of HSD17B1 and SRD5A1 in lymphocytes.

PubMed

Zhou, Z; Speiser, P W

1999-11-01

We previously reported lymphocyte expression of genes encoding enzymes required for steroid metabolism; however, only 17beta-HSD and 5alpha-reductase showed significant enzyme activity. We now investigate regulation of lymphocyte expression for genes encoding 17beta-HSD and 5alpha-reductase. Cultured human T and B lymphoid cell lines and peripheral blood mononuclear cells were treated with known regulators of steroidogenic gene expression including forskolin, PMA, ionomycin, various steroids, interleukin (IL)-4, and IL-6. Treatment with 10 or 50 microM forskolin resulted in a 20-60% reduction of expression for HSD17B1 (encoding 17beta-HSD I) in T and B lymphoid cell lines and peripheral blood mononuclear cells, although such a change was not observed in the expression of SRD5A1 (encoding 5alpha-reductase I). No significant changes were found when cells were treated for 24 h with various concentrations of PMA or ionomycin. Incubation with 10(-9) to 10(-7) M androstenedione or estradiol increased expression of HSD17B1, while testosterone decreased the expression of this gene. SRD5A1 expression was increased in the presence of 5alpha-DHT although no consistent changes were observed when the cells were treated with testosterone. Other steroids, including dexamethasone, progesterone, and 6-hydroxypregnanolone, produced no effects on expression of either HSD17B1 or SRD5A1. Treatment with 0.1-10 ng/ml of IL-4 or IL-6 also did not effect significant changes in gene expression. These data implicate the involvement of the cAMP-protein kinase signal transduction pathway in regulating lymphocyte expression of HSD17B1. Furthermore, it appears that lymphocyte HSD17B1 and SRD5A1 are regulated to some extent by specific steroids. Copyright 1999 Academic Press.

Opiorphin is a master regulator of the hypoxic response in corporal smooth muscle cells.

PubMed

Fu, Shibo; Tar, Moses Tarndie; Melman, Arnold; Davies, Kelvin Paul

2014-08-01

Men with sickle cell disease (SCD) risk developing priapism. Recognizing that SCD is a disease of hypoxia, we investigated the effect of hypoxia on gene expression in corporal smooth muscle (CSM) cells. Rat CSM cells in vitro were treated with CoCl2 or low oxygen tension to mimic hypoxia. Hypoxic conditions increased expression of genes previously associated with priapism in animal models. Variable coding sequence a1 (Vcsa1; the rat opiorphin homologue, sialorphin), hypoxia-inducible factor 1a (Hif-1a), and A2B adenosine receptor (a2br) were increased by 10-, 4-, and 6-fold, respectively, by treatment with CoCl2, whereas low oxygen tension caused increases in expression of 3-, 4-, and 1.5-fold, respectively. Sialorphin-treated CSM cells increased expression of Hif-1a and a2br by 4-fold, and vcsa1-siRNA treatment reduced expression by ∼50%. Using a Hif-1a inhibitor, we demonstrated up-regulation of a2br by sialorphin is dependent on Hif-1a, and knockdown of vcsa1 expression with vcsa1-siRNA demonstrated that hypoxic-up-regulation of Hif-1a is dependent on vcsa1. In CSM from a SCD mouse, there was 15-fold up-regulation of opiorphin at a life stage prior to priapism. We conclude that in CSM, opiorphins are master regulators of the hypoxic response. Opiorphin up-regulation in response to SCD-associated hypoxia activates CSM "relaxant" pathways; excessive activation of these pathways results in priapism. © FASEB.

Changes in gene expression of DOR and other thyroid hormone receptors in rat liver during acute-phase response

PubMed Central

Baumgartner, Bernhard G.; Naz, Naila; Sheikh, Nadeem; Moriconi, Federico; Ramadori, Giuliano

2010-01-01

Non-thyroidal illness is characterized by low tri-iodothyronine (T3) serum level under acute-phase conditions. We studied hepatic gene expression of the newly identified thyroid hormone receptor (TR) cofactor DOR/TP53INP2 together with TRs in a rat model of aseptic abscesses induced by injecting intramuscular turpentine-oil into each hind limb. A fast (4-6 h) decrease in the serum level of free thyroxine and free T3 was observed. By immunohistology, abundant DOR protein expression was detected in the nuclei of hepatocytes and ED-1+ (mononuclear phagocytes), CK-19+ (biliary cells), and SMA+ (mesenchymal cells of the portal tract) cells. DOR signal was reduced with a minimum at 6-12 h after the acute-phase reaction (APR). Immunohistology also showed a similar pattern of protein expression in TRα1 but without a significant change during APR. Transcripts specific for DOR, nuclear receptor co-repressor 1 (NCoR-1), and TRβ1 were down-regulated with a minimum at 6-12 h, whereas expression for TRα1 and TRα2 was slightly and significantly up-regulated, respectively, with a maximum at 24 h after APR was initiated. In cultured hepatocytes, acute-phase cytokines interleukin-1β (IL-1β) and IL-6 down-regulated DOR and TRβ1 at the mRNA level. Moreover, gene expression of DOR and TRs (TRα1, TRα2, and TRβ1) was up-regulated in hepatocytes by adding T3 to the culture medium; this up-regulation was almost completely blocked by treating the cells with IL-6. Thus, TRβ1, NCoR-1, and the recently identified DOR/TP53INP2 are abundantly expressed and down-regulated in liver cells during APR. Their down-regulation is attributable to the decreased serum level of thyroid hormones and most probably also to the direct action of the main acute-phase cytokines. PMID:20949361

Genetic and environmental risk factors for atherosclerosis regulate transcription of phosphatase and actin regulating gene PHACTR1.

PubMed

Reschen, Michael E; Lin, Da; Chalisey, Anil; Soilleux, Elizabeth J; O'Callaghan, Christopher A

2016-07-01

Coronary artery disease (CAD) risk is associated with non-coding genetic variants at the phosphatase and actin regulating protein 1(PHACTR1) gene locus. The PHACTR1 gene encodes an actin-binding protein with phosphatase regulating activity. The mechanism whereby PHACTR1 influences CAD risk is unknown. We hypothesized that PHACTR1 would be expressed in human cell types relevant to CAD and regulated by atherogenic or genetic factors. Using immunohistochemistry, we demonstrate that PHACTR1 protein is expressed strongly in human atherosclerotic plaque macrophages, lipid-laden foam cells, adventitial lymphocytes and endothelial cells. Using a combination of genomic analysis and molecular techniques, we demonstrate that PHACTR1 is expressed as multiple previously uncharacterized transcripts in macrophages, foam cells, lymphocytes and endothelial cells. Immunoblotting confirmed a total absence of PHACTR1 in vascular smooth muscle cells. Real-time quantitative PCR showed that PHACTR1 is regulated by atherogenic and inflammatory stimuli. In aortic endothelial cells, oxLDL and TNF-alpha both upregulated an intermediate length transcript. A short transcript expressed only in immune cells was upregulated in macrophages by oxidized low-density lipoprotein, and oxidized phospholipids but suppressed by lipopolysaccharide or TNF-alpha. In primary human macrophages, we identified a novel expression quantitative trait locus (eQTL) specific for this short transcript, whereby the risk allele at CAD risk SNP rs9349379 is associated with reduced PHACTR1 expression, similar to the effect of an inflammatory stimulus. Our data demonstrate that PHACTR1 is a key atherosclerosis candidate gene since it is regulated by atherogenic stimuli in macrophages and endothelial cells and we identify an effect of the genetic risk variant on PHACTR1 expression in macrophages that is similar to that of an inflammatory stimulus. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Changes in gene expression of DOR and other thyroid hormone receptors in rat liver during acute-phase response.

PubMed

Malik, Ihtzaz Ahmed; Baumgartner, Bernhard G; Naz, Naila; Sheikh, Nadeem; Moriconi, Federico; Ramadori, Giuliano

2010-11-01

Non-thyroidal illness is characterized by low tri-iodothyronine (T3) serum level under acute-phase conditions. We studied hepatic gene expression of the newly identified thyroid hormone receptor (TR) cofactor DOR/TP53INP2 together with TRs in a rat model of aseptic abscesses induced by injecting intramuscular turpentine-oil into each hind limb. A fast (4-6 h) decrease in the serum level of free thyroxine and free T3 was observed. By immunohistology, abundant DOR protein expression was detected in the nuclei of hepatocytes and ED-1(+) (mononuclear phagocytes), CK-19(+) (biliary cells), and SMA(+) (mesenchymal cells of the portal tract) cells. DOR signal was reduced with a minimum at 6-12 h after the acute-phase reaction (APR). Immunohistology also showed a similar pattern of protein expression in TRα1 but without a significant change during APR. Transcripts specific for DOR, nuclear receptor co-repressor 1 (NCoR-1), and TRβ1 were down-regulated with a minimum at 6-12 h, whereas expression for TRα1 and TRα2 was slightly and significantly up-regulated, respectively, with a maximum at 24 h after APR was initiated. In cultured hepatocytes, acute-phase cytokines interleukin-1β (IL-1β) and IL-6 down-regulated DOR and TRβ1 at the mRNA level. Moreover, gene expression of DOR and TRs (TRα1, TRα2, and TRβ1) was up-regulated in hepatocytes by adding T3 to the culture medium; this up-regulation was almost completely blocked by treating the cells with IL-6. Thus, TRβ1, NCoR-1, and the recently identified DOR/TP53INP2 are abundantly expressed and down-regulated in liver cells during APR. Their down-regulation is attributable to the decreased serum level of thyroid hormones and most probably also to the direct action of the main acute-phase cytokines.

N-Myc Differentially Regulates Expression of MXI1 Isoforms in Neuroblastoma1

PubMed Central

Armstrong, Michael B; Mody, Rajen J; Ellis, D Christian; Hill, Adam B; Erichsen, David A; Wechsler, Daniel S

2013-01-01

Amplification of the MYCN proto-oncogene is associated with a poor prognosis in patients with metastatic neuroblastoma (NB). MYCN encodes the N-Myc protein, a transcriptional regulator that dimerizes with the Max transcription factor, binds to E-box DNA sequences, and regulates genes involved in cell growth and apoptosis. Overexpression of N-Myc leads to transcriptional activation and an increase in NB cell proliferation. Mxi1, a member of the Myc family of transcriptional regulators, also binds to Max. However, Mxi1 is a transcriptional repressor and inhibits proliferation of NB cells, suggesting that Mxi1 functions as an N-Myc antagonist. Our laboratory previously identified Mxi1-0, an alternatively transcribed Mxi1 isoform. Mxi1-0 has properties distinct from those of Mxi1; in contrast to Mxi1, Mxi1-0 is unable to suppress c-Myc-dependent transcription. We now show that Mxi1-0 expression increases in response to MYCN overexpression in NB cells, with a positive correlation between MYCN and MXI1-0 RNA levels. We also show that N-Myc expression differentially regulates the MXI1 and MXI1-0 promoters: Increased MYCN expression suppresses MXI1 promoter activity while enhancing transcription through the MXI1-0 promoter. Finally, induction of Mxi1-0 leads to increased proliferation, whereas expression of Mxi1 inhibits cell growth, indicating differential roles for these two proteins. These data suggest that N-Myc differentially regulates the expression of MXI1 and MXI1-0 and can alter the balance between the two transcription factors. Furthermore, MXI1-0 appears to be a downstream target of MYCN-dependent signaling pathways and may contribute to N-Myc-dependent cell growth and proliferation. PMID:24403858

Regulation of a transcription factor network by Cdk1 coordinates late cell cycle gene expression

PubMed Central

Landry, Benjamin D; Mapa, Claudine E; Arsenault, Heather E; Poti, Kristin E; Benanti, Jennifer A

2014-01-01

To maintain genome stability, regulators of chromosome segregation must be expressed in coordination with mitotic events. Expression of these late cell cycle genes is regulated by cyclin-dependent kinase (Cdk1), which phosphorylates a network of conserved transcription factors (TFs). However, the effects of Cdk1 phosphorylation on many key TFs are not known. We find that elimination of Cdk1-mediated phosphorylation of four S-phase TFs decreases expression of many late cell cycle genes, delays mitotic progression, and reduces fitness in budding yeast. Blocking phosphorylation impairs degradation of all four TFs. Consequently, phosphorylation-deficient mutants of the repressors Yox1 and Yhp1 exhibit increased promoter occupancy and decreased expression of their target genes. Interestingly, although phosphorylation of the transcriptional activator Hcm1 on its N-terminus promotes its degradation, phosphorylation on its C-terminus is required for its activity, indicating that Cdk1 both activates and inhibits a single TF. We conclude that Cdk1 promotes gene expression by both activating transcriptional activators and inactivating transcriptional repressors. Furthermore, our data suggest that coordinated regulation of the TF network by Cdk1 is necessary for faithful cell division. PMID:24714560

Regulation of a transcription factor network by Cdk1 coordinates late cell cycle gene expression.

PubMed

Landry, Benjamin D; Mapa, Claudine E; Arsenault, Heather E; Poti, Kristin E; Benanti, Jennifer A

2014-05-02

To maintain genome stability, regulators of chromosome segregation must be expressed in coordination with mitotic events. Expression of these late cell cycle genes is regulated by cyclin-dependent kinase (Cdk1), which phosphorylates a network of conserved transcription factors (TFs). However, the effects of Cdk1 phosphorylation on many key TFs are not known. We find that elimination of Cdk1-mediated phosphorylation of four S-phase TFs decreases expression of many late cell cycle genes, delays mitotic progression, and reduces fitness in budding yeast. Blocking phosphorylation impairs degradation of all four TFs. Consequently, phosphorylation-deficient mutants of the repressors Yox1 and Yhp1 exhibit increased promoter occupancy and decreased expression of their target genes. Interestingly, although phosphorylation of the transcriptional activator Hcm1 on its N-terminus promotes its degradation, phosphorylation on its C-terminus is required for its activity, indicating that Cdk1 both activates and inhibits a single TF. We conclude that Cdk1 promotes gene expression by both activating transcriptional activators and inactivating transcriptional repressors. Furthermore, our data suggest that coordinated regulation of the TF network by Cdk1 is necessary for faithful cell division.

The role of hypoxia and HIF1α in the regulation of STAR-mediated steroidogenesis in granulosa cells.

PubMed

Kowalewski, Mariusz Pawel; Gram, Aykut; Boos, Alois

2015-02-05

The adaptive responses to hypoxia are mediated by hypoxia-inducible factor 1 alpha (HIF1α). Its role, however, in regulating steroidogenesis remains poorly understood. We examined the role of hypoxia and HIF1α in regulating steroid acute regulatory protein (STAR) expression and steroidogenesis in immortalized (KK1) mouse granulosa cells under progressively lowering O2 concentrations (20%, 15%, 10%, 5%, 1%). Basal and dbcAMP-stimulated progesterone synthesis was decreased under severe hypoxia (1% and 5% O2). The partial hypoxia revealed opposing effects, with a significant increase in steroidogenic response at 10% O2 in dbcAMP-treated cells: Star-promoter activity, mRNA and protein expression were increased. The hypoxia-stimulated STAR expression was PKA-dependent. Binding of HIF1α to the Star-promoter was potentiated under partial hypoxia. Inhibition of the transcriptional activity or expression of HIF1α suppressed STAR-expression. HIF1α appears to be a positive regulator of basal and stimulated STAR-expression, which under partial hypoxia is capable of increasing the steroidogenic capacity of granulosa cells. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Mef2c Regulates Transcription of the Extracellular Matrix Protein Cartilage Link Protein 1 in the Developing Murine Heart

PubMed Central

Phelps, Aimee L.; Ghatnekar, Angela V.; Barth, Jeremy L.; Norris, Russell A.; Wessels, Andy

2013-01-01

Cartilage Link Protein 1 (Crtl1) is an extracellular matrix (ECM) protein that stabilizes the interaction between hyaluronan and versican and is expressed in endocardial and endocardially-derived cells in the developing heart, including cells in the atrioventricular (AV) and outflow tract (OFT) cushions. Previous investigations into the transcriptional regulation of the Crtl1 gene have shown that Sox9 regulates Crtl1 expression in both cartilage and the AV valves. The cardiac transcription factor Mef2c is involved in the regulation of gene expression in cardiac and skeletal muscle cell lineages. In this study we have investigated the potential role of Mef2c in the regulation of ECM production in the endocardial and mesenchymal cell lineages of the developing heart. We demonstrate that the Crtl1 5′ flanking region contains two highly conserved Mef2 binding sites and that Mef2c is able to bind to these sites in vivo during cardiovascular development. Additionally, we show that Crtl1 transcription is dependent on Mef2c expression in fetal mitral valve interstitial cells (VICs). Combined, these findings highlight a new role for Mef2c in cardiac development and the regulation of cardiac extracellular matrix protein expression. PMID:23468913

Trek2a regulates gnrh3 expression under control of melatonin receptor Mt1 and α2-adrenoceptor.

PubMed

Loganathan, Kavinash; Moriya, Shogo; Parhar, Ishwar S

2018-02-12

Gonadotrophin-releasing hormone (GnRH) expression is associated with the two-pore domain potassium ion (K + ) channel-related K + (TREK) channel trek2a expression and melatonin levels. We aimed to investigate correlation of trek2a expression with gnrh3 expression, and regulatory mechanisms of trek2a expression by the melatonin receptor Mt1 and α 2 -adrenoceptor which are regulated by melatonin. trek2a specific siRNA, Mt1 antagonist luzindole and α 2 -adrenoceptor antagonist prazosin were administered into the adult zebrafish brain and gene expressions were examined by real-time PCR. trek2a specific siRNA administration significantly reduced expression levels of trek2a, gnrh3 and mt1. Luzindole administration suppressed trek2a and gnrh3 expressions. Prazosin administration reduced trek2a and gnrh3 expressions. It is suggested that Trek2a regulates gnrh3 expression under the control of Mt1 and α 2 -adrenoceptor. Copyright © 2018 Elsevier Inc. All rights reserved.

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

Circadian clock gene LATE ELONGATED HYPOCOTYL directly regulates the timing of floral scent emission in Petunia

PubMed Central

Fenske, Myles P.; Hewett Hazelton, Kristen D.; Hempton, Andrew K.; Shim, Jae Sung; Yamamoto, Breanne M.; Riffell, Jeffrey A.; Imaizumi, Takato

2015-01-01

Flowers present a complex display of signals to attract pollinators, including the emission of floral volatiles. Volatile emission is highly regulated, and many species restrict emissions to specific times of the day. This rhythmic emission of scent is regulated by the circadian clock; however, the mechanisms have remained unknown. In Petunia hybrida, volatile emissions are dominated by products of the floral volatile benzenoid/phenylpropanoid (FVBP) metabolic pathway. Here we demonstrate that the circadian clock gene P. hybrida LATE ELONGATED HYPOCOTYL (LHY; PhLHY) regulates the daily expression patterns of the FVBP pathway genes and floral volatile production. PhLHY expression peaks in the morning, antiphasic to the expression of P. hybrida GIGANTEA (PhGI), the master scent regulator ODORANT1 (ODO1), and many other evening-expressed FVBP genes. Overexpression phenotypes of PhLHY in Arabidopsis caused an arrhythmic clock phenotype, which resembles those of LHY overexpressors. In Petunia, constitutive expression of PhLHY depressed the expression levels of PhGI, ODO1, evening-expressed FVBP pathway genes, and FVBP emission in flowers. Additionally, in the Petunia lines in which PhLHY expression was reduced, the timing of peak expression of PhGI, ODO1, and the FVBP pathway genes advanced to the morning. Moreover, PhLHY protein binds to cis-regulatory elements called evening elements that exist in promoters of ODO1 and other FVBP genes. Thus, our results imply that PhLHY directly sets the timing of floral volatile emission by restricting the expression of ODO1 and other FVBP genes to the evening in Petunia. PMID:26124104

Circadian clock gene LATE ELONGATED HYPOCOTYL directly regulates the timing of floral scent emission in Petunia.

PubMed

Fenske, Myles P; Hewett Hazelton, Kristen D; Hempton, Andrew K; Shim, Jae Sung; Yamamoto, Breanne M; Riffell, Jeffrey A; Imaizumi, Takato

2015-08-04

Flowers present a complex display of signals to attract pollinators, including the emission of floral volatiles. Volatile emission is highly regulated, and many species restrict emissions to specific times of the day. This rhythmic emission of scent is regulated by the circadian clock; however, the mechanisms have remained unknown. In Petunia hybrida, volatile emissions are dominated by products of the floral volatile benzenoid/phenylpropanoid (FVBP) metabolic pathway. Here we demonstrate that the circadian clock gene P. hybrida LATE ELONGATED HYPOCOTYL (LHY; PhLHY) regulates the daily expression patterns of the FVBP pathway genes and floral volatile production. PhLHY expression peaks in the morning, antiphasic to the expression of P. hybrida GIGANTEA (PhGI), the master scent regulator ODORANT1 (ODO1), and many other evening-expressed FVBP genes. Overexpression phenotypes of PhLHY in Arabidopsis caused an arrhythmic clock phenotype, which resembles those of LHY overexpressors. In Petunia, constitutive expression of PhLHY depressed the expression levels of PhGI, ODO1, evening-expressed FVBP pathway genes, and FVBP emission in flowers. Additionally, in the Petunia lines in which PhLHY expression was reduced, the timing of peak expression of PhGI, ODO1, and the FVBP pathway genes advanced to the morning. Moreover, PhLHY protein binds to cis-regulatory elements called evening elements that exist in promoters of ODO1 and other FVBP genes. Thus, our results imply that PhLHY directly sets the timing of floral volatile emission by restricting the expression of ODO1 and other FVBP genes to the evening in Petunia.

Stress Marker Signatures in Lesion Mimic Single and Double Mutants Identify a Crucial Leaf Age-Dependent Salicylic Acid Related Defense Signal.

PubMed

Kaurilind, Eve; Brosché, Mikael

2017-01-01

Plants are exposed to abiotic and biotic stress conditions throughout their lifespans that activates various defense programs. Programmed cell death (PCD) is an extreme defense strategy the plant uses to manage unfavorable environments as well as during developmentally induced senescence. Here we investigated the role of leaf age on the regulation of defense gene expression in Arabidopsis thaliana. Two lesion mimic mutants with misregulated cell death, catalase2 (cat2) and defense no death1 (dnd1) were used together with several double mutants to dissect signaling pathways regulating defense gene expression associated with cell death and leaf age. PCD marker genes showed leaf age dependent expression, with the highest expression in old leaves. The salicylic acid (SA) biosynthesis mutant salicylic acid induction deficient2 (sid2) had reduced expression of PCD marker genes in the cat2 sid2 double mutant demonstrating the importance of SA biosynthesis in regulation of defense gene expression. While the auxin- and jasmonic acid (JA)- insensitive auxin resistant1 (axr1) double mutant cat2 axr1 also led to decreased expression of PCD markers; the expression of several marker genes for SA signaling (ISOCHORISMATE SYNTHASE 1, PR1 and PR2) were additionally decreased in cat2 axr1 compared to cat2. The reduced expression of these SA markers genes in cat2 axr1 implicates AXR1 as a regulator of SA signaling in addition to its known role in auxin and JA signaling. Overall, the current study reinforces the important role of SA signaling in regulation of leaf age-related transcript signatures.

Transgenic expression of BRCA1 disturbs hematopoietic stem and progenitor cells quiescence and function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bai, Lin; Shi, Guiying; Zhang, Xu

The balance between quiescence and proliferation of HSCs is an important regulator of hematopoiesis. Loss of quiescence frequently results in HSCs exhaustion, which underscores the importance of tight regulation of proliferation in these cells. Studies have indicated that cyclin-dependent kinases are involved in the regulation of quiescence in HSCs. BRCA1 plays an important role in the repair of DNA double-stranded breaks, cell cycle, apoptosis and transcription. BRCA1 is expressed in the bone marrow. However, the function of BRCA1 in HSCs is unknown. In our study, we generated BRCA1 transgenic mice to investigate the effects of BRCA1 on the mechanisms ofmore » quiescence and differentiation in HSCs. The results demonstrate that over-expression of BRCA1 in the bone marrow impairs the development of B lymphocytes. Furthermore, BRCA1 induced an increase in the number of LSKs, LT-HSCs, ST-HSCs and MPPs. A competitive transplantation assay found that BRCA1 transgenic mice failed to reconstitute hematopoiesis. Moreover, BRCA1 regulates the expression of p21{sup waf1}/cip1 and p57{sup kip2}, which results in a loss of quiescence in LSKs. Together, over-expression of BRCA1 in bone marrow disrupted the quiescent of LSKs, induced excessive accumulation of LSKs, and disrupted differentiation of the HSCs, which acts through the down-regulated of p21{sup waf1}/cip1 and p57{sup kip2}. - Highlights: • Over-expression of BRCA1 results in impaired B lymphocyte development. • BRCA1 transgenic mice disrupted the quiescent of LSKs, induced excessive accumulation of LSKs. • BRCA1 impairs the function of HSCs through the down-regulated of p21{sup waf1/cip1} and p57{sup kip2}.« less

AGEs-RAGE system down-regulates Sirt1 through the ubiquitin-proteasome pathway to promote FN and TGF-β1 expression in male rat glomerular mesangial cells.

PubMed

Huang, Kai-Peng; Chen, Cheng; Hao, Jie; Huang, Jun-Ying; Liu, Pei-Qing; Huang, He-Qing

2015-01-01

We previously demonstrated that advanced glycation-end products (AGEs) promote the pathological progression of diabetic nephropathy by decreasing silent information regulator 2-related protein 1 (Sirt1) expression in glomerular mesangial cells (GMCs). Here, we investigated whether AGEs-receptor for AGEs (RAGE) system down-regulated Sirt1 expression through ubiquitin-proteasome pathway and whether Sirt1 ubiquitination affected fibronectin (FN) and TGF-β1, 2 fibrotic indicators in GMCs. Sirt1 was polyubiquitinated and subsequently degraded by proteasome. AGEs increased Sirt1 ubiquitination and proteasome-mediated degradation, shortened Sirt1 half-life, and promoted FN and TGF-β1 expression. Ubiquitin-specific protease 22 (USP22) reduced Sirt1 ubiquitination and degradation and decreased FN and TGF-β1 expression in GMCs under both basal and AGEs-treated conditions. USP22 depletion enhanced Sirt1 degradation and displayed combined effects with AGEs to further promote FN and TGF-β1 expression. RAGE functioned crucial mediating roles in these processes via its C-terminal cytosolic domain. Inhibiting Sirt1 by EX-527 substantially suppressed the down-regulation of FN and TGF-β1 resulting from USP22 overexpression under both normal and AGEs-treated conditions, eventually leading to their up-regulation in GMCs. These results indicated that the AGEs-RAGE system increased the ubiquitination and subsequent proteasome-mediated degradation of Sirt1 by reducing USP22 level, and AGEs-RAGE-USP22-Sirt1 formed a cascade pathway that regulated FN and TGF-β1 level, which participated in the pathological progression of diabetic nephropathy.

Specificity Protein (Sp) Transcription Factors and Metformin Regulate Expression of the Long Non-coding RNA HULC

EPA Science Inventory

There is evidence that specificity protein 1 (Sp1) transcription factor (TF) regulates expression of long non-coding RNAs (lncRNAs) in hepatocellular carcinoma (HCC) cells. RNA interference (RNAi) studies showed that among several lncRNAs expressed in HepG2, SNU-449 and SK-Hep-1...

Co-expression of the transcription factors CEH-14 and TTX-1 regulates AFD neuron-specific genes gcy-8 and gcy-18 in C. elegans.

PubMed

Kagoshima, Hiroshi; Kohara, Yuji

2015-03-15

A wide variety of cells are generated by the expression of characteristic sets of genes, primarily those regulated by cell-specific transcription. To elucidate the mechanism regulating cell-specific gene expression in a highly specialized cell, AFD thermosensory neuron in Caenorhabditis elegans, we analyzed the promoter sequences of guanylyl cyclase genes, gcy-8 and gcy-18, exclusively expressed in AFD. In this study, we showed that AFD-specific expression of gcy-8 and gcy-18 requires the co-expression of homeodomain proteins, CEH-14/LHX3 and TTX-1/OTX1. We observed that mutation of ttx-1 or ceh-14 caused a reduction in the expression of gcy-8 and gcy-18 and that the expression was completely lost in double mutants. This synergy effect was also observed with other AFD marker genes, such as ntc-1, nlp-21and cng-3. Electrophoretic mobility shift assays revealed direct interaction of CEH-14 and TTX-1 proteins with gcy-8 and gcy-18 promoters in vitro. The binding sites of CEH-14 and TTX-1 proteins were confirmed to be essential for AFD-specific expression of gcy-8 and gcy-18 in vivo. We also demonstrated that forced expression of CEH-14 and TTX-1 in AWB chemosensory neurons induced ectopic expression of gcy-8 and gcy-18 reporters in this neuron. Finally, we showed that the regulation of gcy-8 and gcy-18 expression by ceh-14 and ttx-1 is evolutionally conserved in five Caenorhabditis species. Taken together, ceh-14 and ttx-1 expression determines the fate of AFD as terminal selector genes at the final step of cell specification. Copyright © 2015 Elsevier Inc. All rights reserved.

Effect of TAK1 on osteogenic differentiation of mesenchymal stem cells by regulating BMP-2 via Wnt/β-catenin and MAPK pathway.

PubMed

Yang, Hongpeng; Guo, Yue; Wang, Dawei; Yang, Xiaofei; Ha, Chengzhi

2018-01-02

Mesenchymal stem cells (MSCs) have the ability to differentiate into osteoblasts and chondrocytes. In vitro osteogenic differentiation is critical but the molecular mechanism has yet to be further clarified. The role of TGF-β activated kinase 1 (TAK1) in MSCs osteogenesis differentiation has not been reported. By adding si-TAK1 and rhTAK1, the osteogenic differentiation of MSCs was measured. Expression levels of the osteoblastic marker genes during osteogenic differentiation of MSCs were checked. As well as molecules involved in BMP and Wnt/β-catenin signaling pathways. The phosphorylation of p38 and JNK was also checked. TAK1 is essential for mineralization of MSCs at low concentration, but excessive rhTAK1 inhibits mineralization of MSCs. It up regulates the expression levels of bone sialoprotein (BSP), osteocalcin (OSC), Alkaline phosphatase (ALP), and RUNX2 during osteogenic differentiation of MSCs. It can also promote TGF-β/BMP-2 gene expression and β-catenin expression, and down regulate GSK-3β expression. Meanwhile, TAK1 promotes the phosphorylation of p38 and JNK. Additionally, TAK1 up regulates the expression of BMP-2 at all concentration under the inhibition of p38 and JNK. Our results suggested that TAK1 is essential in MSCs osteogenesis differentiation, and functions as a double-edged sword, probably through regulation of β-catenin and p38/JNK.

Metastatic Melanoma Secreted IL-10 Down-Regulates CD1 Molecules on Dendritic Cells in Metastatic Tumor Lesions

PubMed Central

Gerlini, Gianni; Tun-Kyi, Adrian; Dudli, Christa; Burg, Günter; Pimpinelli, Nicola; Nestle, Frank O.

2004-01-01

CD1 molecules are expressed by antigen-presenting cells such as dendritic cells and mediate primary immune responses to lipids and glycolipids which have been shown to be expressed by various tumors. Glycolipids are expressed by melanoma cells but, despite their immunogenicity, no efficient spontaneous immune responses are elicited. As IL-10 has previously been shown to down-regulate CD1a on dendritic cells and is known to be expressed by various melanoma cell lines, we investigated if melanoma-derived IL-10 could down-regulate CD1 molecule expression on dendritic cells as a possible way to circumvent immune recognition. We found that CD1a, CD1b, CD1c, and CD1d were significantly down-regulated on dendritic cells in metastatic (n = 10) but not in primary melanoma lesions (n = 10). We further detected significantly higher IL-10 protein levels in metastatic than in primary melanomas. Moreover, supernatants from metastatic melanomas were significantly more effective in down-regulating CD1 molecules on dendritic cells than supernatants from primary melanoma cultures. This effect was blocked using a neutralizing IL-10 antibody in a dose dependent manner. Our findings suggest that metastatic but not primary melanomas can down-regulate CD1 molecules on infiltrating dendritic cells by secreting IL-10 which may represent a novel way to escape the immune response directed against the tumor. PMID:15579430

Folic acid protects against arsenic-mediated embryo toxicity by up-regulating the expression of Dvr1

PubMed Central

Ma, Yan; Zhang, Chen; Gao, Xiao-Bo; Luo, Hai-Yan; Chen, Yang; Li, Hui-hua; Ma, Xu; Lu, Cai-Ling

2015-01-01

As a nutritional factor, folic acid can prevent cardiac and neural defects during embryo development. Our previous study showed that arsenic impairs embryo development by down-regulating Dvr1/GDF1 expression in zebrafish. Here, we investigated whether folic acid could protect against arsenic-mediated embryo toxicity. We found that folic acid supplementation increases hatching and survival rates, decreases malformation rate and ameliorates abnormal cardiac and neural development of zebrafish embryos exposed to arsenite. Both real-time PCR analysis and whole in-mount hybridization showed that folic acid significantly rescued the decrease in Dvr1 expression caused by arsenite. Subsequently, our data demonstrated that arsenite significantly decreased cell viability and GDF1 mRNA and protein levels in HEK293ET cells, while folic acid reversed these effects. Folic acid attenuated the increase in subcellular reactive oxygen species (ROS) levels and oxidative adaptor p66Shc protein expression in parallel with the changes in GDF1 expression and cell viability. P66Shc knockdown significantly inhibited the production of ROS and the down-regulation of GDF1 induced by arsenite. Our data demonstrated that folic acid supplementation protected against arsenic-mediated embryo toxicity by up-regulating the expression of Dvr1/GDF1, and folic acid enhanced the expression of GDF1 by decreasing p66Shc expression and subcellular ROS levels. PMID:26537450

BMP6 down-regulates GDNF expression through SMAD1/5 and ERK1/2 signaling pathways in human granulosa-lutein cells.

PubMed

Zhang, Xin-Yue; Chang, Hsun-Ming; Taylor, Elizabeth L; Leung, Peter C K; Liu, Rui-Zhi

2018-05-09

Bone morphogenetic protein 6 (BMP6) is a critical regulator of follicular development that is expressed in mammalian oocytes and granulosa cells. Glial cell line-derived neurotrophic factor (GDNF) is an intraovarian neurotrophic factor that plays an essential role in regulating mammalian oocyte maturation. The aim of this study was to investigate the effect of BMP6 on the regulation of GDNF expression and the potential underlying mechanisms. We used an established immortalized human granulosa cell line (SVOG cells) and primary human granulosa-lutein cells as in vitro cell models. Our results showed that BMP6 significantly down-regulated the expression of GDNF in both SVOG and primary human granulosa-lutein cells. Using dual inhibition approaches (kinase receptor inhibitor and small interfering RNA knockdown), our results showed that both ALK2 and ALK3 are involved in BMP6-induced down-regulation of GDNF. In addition, BMP6 induced the phosphorylation of SMAD1/5/8 and ERK1/2 but not AKT or p38. Among three downstream mediators, both SMAD1 and SMAD5 are involved in BMP6-induced down-regulation of GDNF. Moreover, concomitant knockdown of endogenous SMAD4 and inhibition of ERK1/2 activity completely reversed BMP6-induced down-regulation of GDNF, indicating that both SMAD and ERK1/2 signaling pathways are required for the regulatory effect of BMP6 on GDNF expression. Our findings suggest an additional role for an intrafollicular growth factor in regulating follicular function through their paracrine interactions in human granulosa cells.

Two MYB-related transcription factors play opposite roles in sugar signaling in Arabidopsis.

PubMed

Chen, Yi-Shih; Chao, Yi-Chi; Tseng, Tzu-Wei; Huang, Chun-Kai; Lo, Pei-Ching; Lu, Chung-An

2017-02-01

Sugar regulation of gene expression has profound effects at all stages of the plant life cycle. Although regulation at the transcriptional level is one of the most prominent mechanisms by which gene expression is regulated, only a few transcription factors have been identified and demonstrated to be involved in the regulation of sugar-regulated gene expression. OsMYBS1, an R1/2-type MYB transcription factor, has been demonstrated to be involved in sugar- and hormone-regulated α-amylase gene expression in rice. Arabidopsis contains two OsMYBS1 homologs. In the present study, we investigate MYBS1 and MYBS2 in sugar signaling in Arabidopsis. Our results indicate that MYBS1 and MYBS2 play opposite roles in regulating glucose and ABA signaling in Arabidopsis during seed germination and early seedling development. MYB proteins have been classified into four subfamilies: R2R3-MYB, R1/2-MYB, 3R-MYB, and 4R-MYB. An R1/2-type MYB transcription factor, OsMYBS1, has been demonstrated to be involved in sugar- and hormone-regulated α-amylase genes expression in rice. In this study, two genes homologous to OsMYBS1, MYBS1 and MYBS2, were investigated in Arabidopsis. Subcellular localization analysis showed that MYBS1 and MYBS2 were localized in the nucleus. Rice embryo transient expression assays indicated that both MYBS1 and MYBS2 could recognize the sugar response element, TA-box, in the promoter and induced promoter activity. mybs1 mutant exhibited hypersensitivity to glucose, whereas mybs2 seedlings were hyposensitive to it. MYBS1 and MYBS2 are involved in the control of glucose-responsive gene expression, as the mybs1 mutant displayed increased expression of a hexokinase gene (HXK1), chlorophyll a/b-binding protein gene (CAB1), ADP-glucose pyrophosphorylase gene (APL3), and chalcone synthase gene (CHS), whereas the mybs2 mutant exhibited decreased expression of these genes. mybs1 also showed an enhanced response to abscisic acid (ABA) in the seed germination and seedling growth stages, while mybs2 showed reduced responses. The ABA biosynthesis inhibitor fluridone rescued the mybs1 glucose-hypersensitive phenotype. Moreover, the mRNA levels of three ABA biosynthesis genes, ABA1, NCED9, and AAO3, and three ABA signaling genes, ABI3, ABI4, and ABI5, were increased upon glucose treatment of mybs1 seedlings, but were decreased in mybs2 seedlings. These results indicate that MYBS1 and MYBS2 play opposite roles in regulating glucose and ABA signaling in Arabidopsis during seed germination and early seedling development.

miR-215 functions as an oncogene in high-grade glioma by regulating retinoblastoma 1.

PubMed

Meng, Xiaofeng; Shi, Baozhong

2017-09-01

To investigate the roles of miR-215 in high-grade glioma and to clarify the regulation of retinoblastoma 1 (RB1) by miR-215. miR-215 is frequently up-regulated in high-grade glioma tissues. Increased miR-215 expression is significantly associated with World Health Organization grade (P < 0.01) tumor size (P < 0.05) and poor prognosis (P < 0.01). Over-expression of miR-215 promoted cell proliferation and knockdown of miR-215 inhibited cell proliferation in vitro. RB1 was identified as a direct and functional target of miR-215. RB1 is generally down-regulated in glioma tissues and its expression inversely correlated with miR-215, which is up-regulated in high-grade glioma tissues, and its expression was negatively correlated with miR-215. The new miR-215/RB1 axis provides new insights into the molecular mechanism and treatment for glioma.

Sigmar1 regulates endoplasmic reticulum stress-induced C/EBP-homologous protein expression in cardiomyocytes.

PubMed

Alam, Shafiul; Abdullah, Chowdhury S; Aishwarya, Richa; Orr, A Wayne; Traylor, James; Miriyala, Sumitra; Panchatcharam, Manikandan; Pattillo, Christopher B; Bhuiyan, Md Shenuarin

2017-08-31

C/EBP-homologous protein (CHOP) is a ubiquitously expressed stress-inducible transcription factor robustly induced by maladaptive endoplasmic reticulum (ER) stresses in a wide variety of cells. Here, we examined a novel function of Sigma 1 receptor (Sigmar1) in regulating CHOP expression under ER stress in cardiomyocytes. We also defined Sigmar1-dependent activation of the adaptive ER-stress pathway in regulating CHOP expression. We used adenovirus-mediated Sigmar1 overexpression as well as Sigmar1 knockdown by siRNA in neonatal rat ventricular cardiomyocytes (NRCs); to induce ER stress, cardiomyocytes were treated with tunicamycin. Sigmar1-siRNA knockdown significantly increased the expression of CHOP and significantly induced cellular toxicity by sustained activation of ER stress in cardiomyocytes. Sigmar1 overexpression decreased the expression of CHOP and significantly decreased cellular toxicity in cells. Using biochemical and immunocytochemical experiments, we also defined the specific ER-stress pathway associated with Sigmar1-dependent regulation of CHOP expression and cellular toxicity. We found that Sigmar1 overexpression significantly increased inositol requiring kinase 1α (IRE1α) phosphorylation and increased spliced X-box-binding proteins (XBP1s) expression as well as nuclear localization. In contrast, Sigmar1 knockdown significantly decreased IRE1α phosphorylation and decreased XBP1s expression as well as nuclear transport. Taken together, these results indicate that Sigmar1-dependent activation of IRE1α-XBP1s ER-stress response pathways are associated with inhibition of CHOP expression and suppression of cellular toxicity. Hence, Sigmar1 is an essential component of the adaptive ER-stress response pathways eliciting cellular protection in cardiomyocytes. © 2017 The Author(s).

Sigmar1 regulates endoplasmic reticulum stress-induced C/EBP-homologous protein expression in cardiomyocytes

PubMed Central

Alam, Shafiul; Abdullah, Chowdhury S.; Aishwarya, Richa; Orr, A. Wayne; Traylor, James; Miriyala, Sumitra; Panchatcharam, Manikandan; Pattillo, Christopher B.

2017-01-01

C/EBP-homologous protein (CHOP) is a ubiquitously expressed stress-inducible transcription factor robustly induced by maladaptive endoplasmic reticulum (ER) stresses in a wide variety of cells. Here, we examined a novel function of Sigma 1 receptor (Sigmar1) in regulating CHOP expression under ER stress in cardiomyocytes. We also defined Sigmar1-dependent activation of the adaptive ER-stress pathway in regulating CHOP expression. We used adenovirus-mediated Sigmar1 overexpression as well as Sigmar1 knockdown by siRNA in neonatal rat ventricular cardiomyocytes (NRCs); to induce ER stress, cardiomyocytes were treated with tunicamycin. Sigmar1-siRNA knockdown significantly increased the expression of CHOP and significantly induced cellular toxicity by sustained activation of ER stress in cardiomyocytes. Sigmar1 overexpression decreased the expression of CHOP and significantly decreased cellular toxicity in cells. Using biochemical and immunocytochemical experiments, we also defined the specific ER-stress pathway associated with Sigmar1-dependent regulation of CHOP expression and cellular toxicity. We found that Sigmar1 overexpression significantly increased inositol requiring kinase 1α (IRE1α) phosphorylation and increased spliced X-box-binding proteins (XBP1s) expression as well as nuclear localization. In contrast, Sigmar1 knockdown significantly decreased IRE1α phosphorylation and decreased XBP1s expression as well as nuclear transport. Taken together, these results indicate that Sigmar1-dependent activation of IRE1α-XBP1s ER-stress response pathways are associated with inhibition of CHOP expression and suppression of cellular toxicity. Hence, Sigmar1 is an essential component of the adaptive ER-stress response pathways eliciting cellular protection in cardiomyocytes. PMID:28667101

Molecular Insights on Post-chemotherapy Retinoblastoma by Microarray Gene Expression Analysis

PubMed Central

Nalini, Venkatesan; Segu, Ramya; Deepa, Perinkulam Ravi; Khetan, Vikas; Vasudevan, Madavan; Krishnakumar, Subramanian

2013-01-01

Purpose Management of Retinoblastoma (RB), a pediatric ocular cancer is limited by drug-resistance and drug-dosage related side effects during chemotherapy. Molecular de-regulation in post-chemotherapy RB tumors was investigated. Materials and Methods cDNA microarray analysis of two post-chemotherapy and one pre-chemotherapy RB tumor tissues was performed, followed by Principle Component Analysis, Gene ontology, Pathway Enrichment analysis and Biological Analysis Network (BAN) modeling. The drug modulation role of two significantly up-regulated genes (p≤0.05) − Ect2 (Epithelial-cell-transforming-sequence-2), and PRAME (preferentially-expressed-Antigen-in-Melanoma) was assessed by qRT-PCR, immunohistochemistry and cell viability assays. Results Differential up-regulation of 1672 genes and down-regulation of 2538 genes was observed in RB tissues (relative to normal adult retina), while 1419 genes were commonly de-regulated between pre-chemotherapy and post- chemotherapy RB. Twenty one key gene ontology categories, pathways, biomarkers and phenotype groups harboring 250 differentially expressed genes were dys-regulated (EZH2, NCoR1, MYBL2, RB1, STAMN1, SYK, JAK1/2, STAT1/2, PLK2/4, BIRC5, LAMN1, Ect2, PRAME and ABCC4). Differential molecular expressions of PRAME and Ect2 in RB tumors with and without chemotherapy were analyzed. There was neither up- regulation of MRP1, nor any significant shift in chemotherapeutic IC50, in PRAME over-expressed versus non-transfected RB cells. Conclusion Cell cycle regulatory genes were dys-regulated post-chemotherapy. Ect2 gene was expressed in response to chemotherapy-induced stress. PRAME does not contribute to drug resistance in RB, yet its nuclear localization and BAN information, points to its possible regulatory role in RB. PMID:24092970

Human microRNA-1245 down-regulates the NKG2D receptor in natural killer cells and impairs NKG2D-mediated functions

PubMed Central

Espinoza, J. Luis; Takami, Akiyoshi; Yoshioka, Katsuji; Nakata, Katsuya; Sato, Tokiharu; Kasahara, Yoshihito; Nakao, Shinji

2012-01-01

Background NKG2D is an activating receptor expressed by natural killer and T cells, which have crucial functions in tumor and microbial immunosurveillance. Several cytokines have been identified as modulators of NKG2D receptor expression. However, little is known about NKG2D gene regulation. In this study, we found that microRNA 1245 attenuated the expression of NKG2D in natural killer cells. Design and Methods We investigated the potential interactions between the 3′-untranslated region of the NKG2D gene and microRNA as well as their functional roles in the regulation of NKG2D expression and cytotoxicity in natural killer cells. Results Transforming growth factor-β1, a major negative regulator of NKG2D expression, post-transcriptionally up-regulated mature microRNA-1245 expression, thus down-regulating NKG2D expression and impairing NKG2D-mediated immune responses in natural killer cells. Conversely, microRNA-1245 down-regulation significantly increased the expression of NKG2D expression in natural killer cells, resulting in more efficient NKG2D-mediated cytotoxicity. Conclusions These results reveal a novel NKG2D regulatory pathway mediated by microRNA-1245, which may represent one of the mechanisms used by transforming growth factor-β1 to attenuate NKG2D expression in natural killer cells. PMID:22491735

Regulator of G protein signaling 4 is a novel target of GATA-6 transcription factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yonggang; Li, Fang; Xiao, Xiao

GATA transcription factors regulate an array of genes important in cell proliferation and differentiation. Here we report the identification of regulator of G protein signaling 4 (RGS4) as a novel target for GATA-6 transcription factor. Although three sites (a, b, c) within the proximal region of rabbit RGS4 promoter for GATA transcription factors were predicted by bioinformatics analysis, only GATA-a site (16 bp from the core TATA box) is essential for RGS4 transcriptional regulation. RT-PCR analysis demonstrated that only GATA-6 was highly expressed in rabbit colonic smooth muscle cells but GATA-4/6 were expressed in cardiac myocytes and GATA-1/2/3 expressed inmore » blood cells. Adenovirus-mediated expression of GATA-6 but not GATA-1 significantly increased the constitutive and IL-1β-induced mRNA expression of the endogenous RGS4 in colonic smooth muscle cells. IL-1β stimulation induced GATA-6 nuclear translocation and increased GATA-6 binding to RGS4 promoter. These data suggest that GATA factor could affect G protein signaling through regulating RGS4 expression, and GATA signaling may develop as a future therapeutic target for RGS4-related diseases. - Highlights: • GATA-6 is highly expressed in colonic smooth muscle cells. • RGS4 is a novel target for GATA-6 transcription factor. • GATA-a response element is essential to regulate the core promoter of RGS4. • GATA-6 regulates IL-1β-induced RGS4 upregulation.« less

Cocaine-and Amphetamine Regulated Transcript (CART) Peptide Is Expressed in Precursor Cells and Somatotropes of the Mouse Pituitary Gland

PubMed Central

Mortensen, Amanda H.

2016-01-01

Cocaine-and Amphetamine Regulated Transcript (CART) peptide is expressed in the brain, endocrine and neuroendocrine systems and secreted into the serum. It is thought to play a role in regulation of hypothalamic pituitary functions. Here we report a spatial and temporal analysis of Cart expression in the pituitaries of adult and developing normal and mutant mice with hypopituitarism. We found that Prop1 is not necessary for initiation of Cart expression in the fetal pituitary at e14.5, but it is required indirectly for maintenance of Cart expression in the postnatal anterior pituitary gland. Pou1f1 deficiency has no effect on Cart expression before or after birth. There is no 1:1 correspondence between CART and any particular cell type. In neonates, CART is detected primarily in non-proliferating, POU1F1-positive cells. CART is also found in some cells that express TSH and GH suggesting a correspondence with committed progenitors of the POU1F1 lineage. In summary, we have characterized the normal temporal and cell specific expression of CART in mouse development and demonstrate that postnatal CART expression in the pituitary gland requires PROP1. PMID:27685990

MicroRNA-9 up-regulates E-cadherin through inhibition of NF-κB1-Snail1 pathway in melanoma.

PubMed

Liu, Shujing; Kumar, Suresh M; Lu, Hezhe; Liu, Aihua; Yang, Ruifeng; Pushparajan, Anitha; Guo, Wei; Xu, Xiaowei

2012-01-01

MicroRNAs (miRNAs) are short non-coding RNAs that post-transcriptionally regulate gene expression. Hsa-miR-9 has been shown to have opposite functions in different tumour types; however, the underlying mechanism is unclear. Here we show that hsa-miR-9 is down-regulated in metastatic melanomas compared to primary melanomas. Overexpression of miR-9 in melanoma cells resulted in significantly decreased cell proliferation and migratory capacity with decreased F-actin polymerization and down-regulation of multiple GTPases involved in cytoskeleton remodelling. miR-9 overexpression induced significant down-regulation of Snail1 with a concomitant increase in E-cadherin expression. In contrast, knockdown of miR-9 increased Snail1 expression as well as melanoma cell proliferation and migration capacity. Mechanistically, miR-9 expression down-regulated NF-κB1 in melanoma and the effect was abolished by mutations in the putative miR-9 binding sites within the 3'-untranslated region (UTR) of NF-κB1. Anti-miR-9 miRNA inhibitor also increased the expression of NF-κB1. The effects of miR-9 on Snail1 expression and melanoma cell proliferation and migration were rescued by overexpression of NF-κB1 in these cells. Furthermore, miR-9 overexpression resulted in significantly decreased melanoma growth and metastasis in vivo. In summary, miR-9 inhibits melanoma proliferation and metastasis through down-regulation of the NF-κB1-Snail1 pathway. This study finds a new mechanism that miR-9 utilizes to decrease E-cadherin expression and inhibit melanoma progression. The results suggest that function of microRNAs is context and tumour type-specific. Copyright © 2011 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Deleted in breast cancer 1 (DBC1) protein regulates hepatic gluconeogenesis.

PubMed

Nin, Veronica; Chini, Claudia C S; Escande, Carlos; Capellini, Verena; Chini, Eduardo N

2014-02-28

Liver gluconeogenesis is essential to provide energy to glycolytic tissues during fasting periods. However, aberrant up-regulation of this metabolic pathway contributes to the progression of glucose intolerance in individuals with diabetes. Phosphoenolpyruvate carboxykinase (PEPCK) expression plays a critical role in the modulation of gluconeogenesis. Several pathways contribute to the regulation of PEPCK, including the nuclear receptor Rev-erbα and the histone deacetylase SIRT1. Deleted in breast cancer 1 (DBC1) is a nuclear protein that binds to and regulates both Rev-erbα and SIRT1 and, therefore, is a candidate to participate in the regulation of PEPCK. In this work, we provide evidence that DBC1 regulates glucose metabolism and the expression of PEPCK. We show that DBC1 levels decrease early in the fasting state. Also, DBC1 KO mice display higher gluconeogenesis in a normal and a high-fat diet. DBC1 absence leads to an increase in PEPCK mRNA and protein expression. Conversely, overexpression of DBC1 results in a decrease in PEPCK mRNA and protein levels. DBC1 regulates the levels of Rev-erbα, and manipulation of Rev-erbα activity or levels prevents the effect of DBC1 on PEPCK. In addition, Rev-erbα levels decrease in the first hours of fasting. Finally, knockdown of the deacetylase SIRT1 eliminates the effect of DBC1 knockdown on Rev-erbα levels and PEPCK expression, suggesting that the mechanism of PEPCK regulation is, at least in part, dependent on the activity of this enzyme. Our results point to DBC1 as a novel regulator of gluconeogenesis.

Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene

PubMed Central

2012-01-01

Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease. PMID:23061798

Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene.

PubMed

Fourtounis, Jimmy; Wang, I-Ming; Mathieu, Marie-Claude; Claveau, David; Loo, Tenneille; Jackson, Aimee L; Peters, Mette A; Therien, Alex G; Boie, Yves; Crackower, Michael A

2012-10-12

Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease.

Epigallocatechin-3-O-gallate modulates global microRNA expression in interleukin-1β-stimulated human osteoarthritis chondrocytes: potential role of EGCG on negative co-regulation of microRNA-140-3p and ADAMTS5.

PubMed

Rasheed, Zafar; Rasheed, Naila; Al-Shaya, Osama

2018-04-01

MicroRNAs (miRNAs) are short, non-coding RNAs involved in almost all cellular processes. Epigallocatechin-3-O-gallate (EGCG) is a green tea polyphenol and is known to exert anti-arthritic effects by inhibiting genes associated with osteoarthritis (OA). This study was undertaken to investigate the global effect of EGCG on interleukin-1β (IL-1β)-induced expression of miRNAs in human chondrocytes. Human chondrocytes were derived from OA cartilage and then treated with EGCG and IL-1β. Human miRNA microarray technology was used to determine the expression profile of 1347 miRNAs. Microarray results were verified by taqman assays and transfection of chondrocytes with miRNA inhibitors. Out of 1347 miRNAs, EGCG up-regulated expression of 19 miRNAs and down-regulated expression of 17 miRNAs, whereas expression of 1311 miRNAs remains unchanged in IL-1β-stimulated human OA chondrocytes. Bioinformatics approach showed that 3`UTR of ADAMTS5 mRNA contains the 'seed-matched-sequence' for hsa-miR-140-3p. IL-1β-induced expression of ADAMTS5 correlated with down-regulation of hsa-miR-140-3p. Importantly, EGCG inhibited IL-1β-induced ADAMTS5 expression and up-regulated the expression of hsa-miR-140-3p. This EGCG-induced co-regulation between ADAMTS5 and hsa-miR-140-3p becomes reversed in OA chondrocytes transfected with anti-miR-140-3p. This study provides an important insight into the molecular basis of the reported anti-arthritic effects of EGCG. Our data indicate that the potential of EGCG in OA chondrocytes may be related to its ability to globally inhibit inflammatory response via modulation of miRNAs expressions.

Netrin-1 regulates the inflammatory response of neutrophils and macrophages, and suppresses ischemic acute kidney injury by inhibiting COX-2 mediated PGE2 production

PubMed Central

Ranganathan, Punithavathi Vilapakkam; Jayakumar, Calpurnia; Mohamed, Riyaz; Dong, Zheng; Ramesh, Ganesan

2012-01-01

Netrin-1 regulates inflammation but the mechanism by which this occurs is unknown. Here we explore the role of netrin-1 in regulating the production of the prostanoid metabolite PGE2 from neutrophils in in vitro and in vivo disease models. Ischemia reperfusion in wild-type and RAG-1 knockout mice induced severe kidney injury that was associated with a large increase in neutrophil infiltration and COX-2 expression in the infiltrating leukocytes. Administration of netrin-1 suppressed COX-2 expression, PGE2 and thromboxane production, and neutrophil infiltration into the kidney. This was associated with reduced apoptosis, inflammatory cytokine and chemokine expression, and improved kidney function. Treatment with the PGE2 receptor EP4 agonist enhanced neutrophil infiltration and renal injury which was not inhibited by netrin-1. Consistent with in vivo data, both LPS and IFNγ-induced inflammatory cytokine production in macrophages and IL-17-induced IFNγ production in neutrophils were suppressed by netrin-1 in vitro by suppression of COX-2 expression. Moreover, netrin-1 regulates COX-2 expression at the transcriptional level through the regulation of NFκB activation. Thus, netrin-1 regulates the inflammatory response of neutrophils and macrophages through suppression of COX-2 mediated PGE2 production. This could be a potential drug for treating many inflammatory immune disorders. PMID:23447066

Estrogen Receptor-Related Receptor α Mediates Up-Regulation of Aromatase Expression by Prostaglandin E2 in Prostate Stromal Cells

PubMed Central

Miao, Lin; Shi, Jiandang; Wang, Chun-Yu; Zhu, Yan; Du, Xiaoling; Jiao, Hongli; Mo, Zengnan; Klocker, Helmut; Lee, Chung; Zhang, Ju

2010-01-01

Estrogen receptor-related receptor α (ERRα) is an orphan member of the nuclear receptor superfamily of transcription factors. ERRα is highly expressed in the prostate, especially in prostate stromal cells. However, little is known about the regulation and function of ERRα, which may contribute to the progression of prostatic diseases. We previously found that prostaglandin E2 (PGE2) up-regulated the expression of aromatase in prostate stromal cells. Here we show that PGE2 also up-regulates the expression of ERRα, which, as a transcription factor, further mediates the regulatory effects of PGE2 on the expression of aromatase. ERRα expression was up-regulated by PGE2 in prostate stromal cell line WPMY-1, which was mediated mainly through the protein kinase A signaling pathway by PGE2 receptor EP2. Suppression of ERRα activity by chlordane (an antagonist of ERRα) or small interfering RNA knockdown of ERRα blocked the increase of expression and promoter activity of aromatase induced by PGE2. Overexpression of ERRα significantly increased aromatase expression and promoter activity, which were further augmented by PGE2. Chromatin immunoprecipitation assay demonstrated that ERRα directly bound to the aromatase promoter in vivo, and PGE2 enhanced the recruitment of ERRα and promoted transcriptional regulatory effects on aromatase expression in WPMY-1. 17β-Estradiol concentration in WPMY-1 medium was up-regulated by ERRα expression, and that was further increased by PGE2. Our results provided evidence that ERRα contributed to local estrogen production by up-regulating aromatase expression in response to PGE2 and provided further insights into the potential role of ERRα in estrogen-related prostatic diseases. PMID:20351196

DUSP5 functions as a feedback regulator of TNFα-induced ERK1/2 dephosphorylation and inflammatory gene expression in adipocytes.

PubMed

Habibian, Justine S; Jefic, Mitra; Bagchi, Rushita A; Lane, Robert H; McKnight, Robert A; McKinsey, Timothy A; Morrison, Ron F; Ferguson, Bradley S

2017-10-10

Adipose tissue inflammation is a central pathological element that regulates obesity-mediated insulin resistance and type II diabetes. Evidence demonstrates that extracellular signal-regulated kinase (ERK 1/2) activation (i.e. phosphorylation) links tumor necrosis factor α (TNFα) to pro-inflammatory gene expression in the nucleus. Dual specificity phosphatases (DUSPs) inactivate ERK 1/2 through dephosphorylation and can thus inhibit inflammatory gene expression. We report that DUSP5, an ERK1/2 phosphatase, was induced in epididymal white adipose tissue (WAT) in response to diet-induced obesity. Moreover, DUSP5 mRNA expression increased during obesity development concomitant to increases in TNFα expression. Consistent with in vivo findings, DUSP5 mRNA expression increased in adipocytes in response to TNFα, parallel with ERK1/2 dephosphorylation. Genetic loss of DUSP5 exacerbated TNFα-mediated ERK 1/2 signaling in 3T3-L1 adipocytes and in adipose tissue of mice. Furthermore, inhibition of ERK 1/2 and c-Jun N terminal kinase (JNK) signaling attenuated TNFα-induced DUSP5 expression. These data suggest that DUSP5 functions in the feedback inhibition of ERK1/2 signaling in response to TNFα, which resulted in increased inflammatory gene expression. Thus, DUSP5 potentially acts as an endogenous regulator of adipose tissue inflammation; although its role in obesity-mediated inflammation and insulin signaling remains unclear.

Expression of stanniocalcin 1 in thyroid side population cells and thyroid cancer cells.

PubMed

Hayase, Suguru; Sasaki, Yoshihito; Matsubara, Tsutomu; Seo, Daekwan; Miyakoshi, Masaaki; Murata, Tsubasa; Ozaki, Takashi; Kakudo, Kennichi; Kumamoto, Kensuke; Ylaya, Kris; Cheng, Sheue-yann; Thorgeirsson, Snorri S; Hewitt, Stephen M; Ward, Jerrold M; Kimura, Shioko

2015-04-01

Mouse thyroid side population (SP) cells consist of a minor population of mouse thyroid cells that may have multipotent thyroid stem cell characteristics. However the nature of thyroid SP cells remains elusive, particularly in relation to thyroid cancer. Stanniocalcin (STC) 1 and 2 are secreted glycoproteins known to regulate serum calcium and phosphate homeostasis. In recent years, the relationship of STC1/2 expression to cancer has been described in various tissues. Microarray analysis was carried out to determine genes up- and down-regulated in thyroid SP cells as compared with non-SP cells. Among genes up-regulated, stanniocalcin 1 (STC1) was chosen for study because of its expression in various thyroid cells by Western blotting and immunohistochemistry. Gene expression analysis revealed that genes known to be highly expressed in cancer cells and/or involved in cancer invasion/metastasis were markedly up-regulated in SP cells from both intact as well as partial thyroidectomized thyroids. Among these genes, expression of STC1 was found in five human thyroid carcinoma-derived cell lines as revealed by analysis of mRNA and protein, and its expression was inversely correlated with the differentiation status of the cells. Immunohistochemical analysis demonstrated higher expression of STC1 in the thyroid tumor cell line and thyroid tumor tissues from humans and mice. These results suggest that SP cells contain a population of cells that express genes also highly expressed in cancer cells including Stc1, which warrants further study on the role of SP cells and/or STC1 expression in thyroid cancer.

Expression of Stanniocalcin 1 in Thyroid Side Population Cells and Thyroid Cancer Cells

PubMed Central

Hayase, Suguru; Sasaki, Yoshihito; Matsubara, Tsutomu; Seo, Daekwan; Miyakoshi, Masaaki; Murata, Tsubasa; Ozaki, Takashi; Kakudo, Kennichi; Kumamoto, Kensuke; Ylaya, Kris; Cheng, Sheue-yann; Thorgeirsson, Snorri S.; Hewitt, Stephen M.; Ward, Jerrold M.

2015-01-01

Background: Mouse thyroid side population (SP) cells consist of a minor population of mouse thyroid cells that may have multipotent thyroid stem cell characteristics. However the nature of thyroid SP cells remains elusive, particularly in relation to thyroid cancer. Stanniocalcin (STC) 1 and 2 are secreted glycoproteins known to regulate serum calcium and phosphate homeostasis. In recent years, the relationship of STC1/2 expression to cancer has been described in various tissues. Method: Microarray analysis was carried out to determine genes up- and down-regulated in thyroid SP cells as compared with non-SP cells. Among genes up-regulated, stanniocalcin 1 (STC1) was chosen for study because of its expression in various thyroid cells by Western blotting and immunohistochemistry. Results: Gene expression analysis revealed that genes known to be highly expressed in cancer cells and/or involved in cancer invasion/metastasis were markedly up-regulated in SP cells from both intact as well as partial thyroidectomized thyroids. Among these genes, expression of STC1 was found in five human thyroid carcinoma–derived cell lines as revealed by analysis of mRNA and protein, and its expression was inversely correlated with the differentiation status of the cells. Immunohistochemical analysis demonstrated higher expression of STC1 in the thyroid tumor cell line and thyroid tumor tissues from humans and mice. Conclusion: These results suggest that SP cells contain a population of cells that express genes also highly expressed in cancer cells including Stc1, which warrants further study on the role of SP cells and/or STC1 expression in thyroid cancer. PMID:25647164

Chronology and regulation of gene expression of RANKL in the rat dental follicle.

PubMed

Liu, D; Yao, S; Pan, F; Wise, G E

2005-10-01

Tooth eruption in the rat requires bone resorption resulting from a major burst of osteoclastogenesis on postnatal day 3 and a minor burst of osteoclastogenesis on postnatal day 10 in the alveolar bone of the first mandibular molar. The dental follicle regulates the major burst on postnatal day 3 by down-regulating its osteoprotegerin (OPG) gene expression to enable osteoclastogenesis to occur. To determine the role of receptor activator of nuclear factor-kappa B ligand (RANKL) in tooth eruption, its gene expression was measured on postnatal days 1-11 in the dental follicle. The results show that RANKL expression was significantly elevated on postnatal days 9-11 in comparison to low expression levels at earlier time-points. As OPG expression is high at this latter time-point, this increase in RANKL expression would be needed for stimulating the minor burst of osteoclastogenesis. Tumor necrosis factor-alpha enhances RANKL gene expression in vitro and it may be responsible for up-regulating RANKL in vivo. Transforming growth factor-beta1 and interleukin-1alpha also enhance RANKL gene expression in vitro but probably have no effect in vivo because they are maximally expressed early. Bone morphogenetic protein-2 acts to down-regulate RANKL expression in vitro and, in vivo, may promote alveolar bone growth in the basal region of the tooth.

Effect of Ppd-1 on the expression of flowering-time genes in vegetative and reproductive growth stages of wheat.

PubMed

Kitagawa, Satoshi; Shimada, Sanae; Murai, Koji

2012-01-01

The photoperiod sensitivity gene Ppd-1 influences the timing of flowering in temperate cereals such as wheat and barley. The effect of Ppd-1 on the expression of flowering-time genes was assessed by examining the expression levels of the vernalization genes VRN1 and VRN3/WFT and of two CONSTANS-like genes, WCO1 and TaHd1, during vegetative and reproductive growth stages. Two near-isogenic lines (NILs) were used: the first carried a photoperiod-insensitive allele of Ppd-1 (Ppd-1a-NIL), the other, a photoperiod-sensitive allele (Ppd-1b-NIL). We found that the expression pattern of VRN1 was similar in Ppd-1a-NIL and Ppd-1b-NIL plants, suggesting that VRN1 is not regulated by Ppd-1. Under long day conditions, VRN3/WFT showed similar expression patterns in Ppd-1a-NIL and Ppd-1b-NIL plants. However, expression differed greatly under short day conditions: VRN3/WFT expression was detected in Ppd-1a-NIL plants at the 5-leaf stage when they transited from vegetative to reproductive growth; very low expression was present in Ppd-1b-NIL throughout all growth stages. Thus, the Ppd-1b allele acts to down-regulate VRN3/WFT under short day conditions. WCO1 showed high levels of expression at the vegetative stage, which decreased during the phase transition and reproductive growth stages in both Ppd-1a-NIL and Ppd-1b-NIL plants under short day conditions. By contrast to WCO1, TaHd1 was up-regulated during the reproductive stage. The level of TaHd1 expression was much higher in Ppd-1a-NIL than the Ppd-1b-NIL plants, suggesting that the Ppd-1b allele down-regulates TaHd1 under short day conditions. The present study indicates that down-regulation of VRN3/WFT together with TaHd1 is the cause of late flowering in the Ppd-1b-NIL plants under short day conditions.

Epigenetic Induction of EGR-1 Expression by the Amyloid Precursor Protein during Exposure to Novelty

PubMed Central

Hendrickx, Aurélie; Pierrot, Nathalie; Tasiaux, Bernadette; Schakman, Olivier; Brion, Jean-Pierre; Kienlen-Campard, Pascal; De Smet, Charles; Octave, Jean-Noël

2013-01-01

Following transcriptome comparison of primary cultures isolated from brain of mice expressing or not the amyloid precursor protein APP, we found transcription of the EGR-1 gene to be regulated by APP. In primary cultures of cortical neurons, APP significantly down regulated EGR-1 expression at both mRNA and protein levels in a γ-secretase independent manner. The intracellular domain of APP did not interact with EGR-1 gene promoter, but enrichment of acetylated histone H4 at the EGR-1 promoter region was measured in APP-/- neurons, as well as in brain of APP-/- mice, in which increase in EGR-1 expression was also measured. These results argue for an important function of APP in the epigenetic regulation of EGR-1 gene transcription both in vitro and in vivo. In APP-/- mice, constitutive overexpression of EGR-1 in brain impaired epigenetic induction of this early transcriptional regulator during exposure to novelty. Altogether, these results indicate an important function of APP in the epigenetic regulation of the transcription of EGR-1, known to be important for memory formation. PMID:24066134

Long non-coding RNA GAS5 aggravates hypoxia injury in PC-12 cells via down-regulating miR-124.

PubMed

Hu, Xiaoli; Liu, Juan; Zhao, Gang; Zheng, Jiaping; Qin, Xia

2018-05-08

One important feature of cerebral ischemia is hypoxia injury in nerve cells. Growth arrest-specific transcript 5 (GAS5) is widely reported as a tumor suppressor gene; however, the investigations about its role in cerebrovascular disease are relatively rare. This study was aimed to explore the impact of GAS5 on hypoxia response in nervous cells. PC-12 cells were incubated under anoxic condition to induce hypoxia injury. Regulatory effects of GAS5 on miR-124 and miR-124 on ICAM-1 expression were assessed by qRT-PCR and/or Western blot. Targeting effect of miR-124 on ICAM-1 3'-untranslated regions (UTR) was evaluated through dual luciferase activity assay. The potential regulatory mechanism on hypoxia injury in PC-12 cells was assessed by detecting key elements of NF-κB and Notch signaling pathways using Western blot. GAS5 ectopic expression accentuated hypoxia injury in PC-12 cells. miR-124 expression was negatively regulated by GAS5 expression. Cells with overexpressions of GAS5 and miR-124 alleviated hypoxia injury as in compassion with cells only with GAS5 overexpression. ICAM-1 expression was negatively regulated by miR-124 expression. ICAM-1 was a functional target of miR-124. ICAM-1 overexpression aggravated hypoxia injury, but inversely, ICAM-1 silence diminished hypoxia damage. Besides, ICAM-1 expression was negatively related with activation of NF-κB and Notch pathways. GAS5-miR-124-ICAM-1 axis could regulate hypoxia injury in PC-12 cells. GAS5 might aggravate hypoxia injury via down-regulating miR-124, then up-regulating ICAM-1, and further enhancing activations of NF-κB and Notch pathways. © 2018 Wiley Periodicals, Inc.

Protein Kinase D1 Signaling in Angiogenic Gene Expression and VEGF-Mediated Angiogenesis.

PubMed

Ren, Bin

2016-01-01

Protein kinase D 1 (PKD-1) is a signaling kinase important in fundamental cell functions including migration, proliferation, and differentiation. PKD-1 is also a key regulator of gene expression and angiogenesis that is essential for cardiovascular development and tumor progression. Further understanding molecular aspects of PKD-1 signaling in the regulation of angiogenesis may have translational implications in obesity, cardiovascular disease, and cancer. The author will summarize and provide the insights into molecular mechanisms by which PKD-1 regulates transcriptional expression of angiogenic genes, focusing on the transcriptional regulation of CD36 by PKD-1-FoxO1 signaling axis along with the potential implications of this axis in arterial differentiation and morphogenesis. He will also discuss a new concept of dynamic balance between proangiogenic and antiangiogenic signaling in determining angiogenic switch, and stress how PKD-1 signaling regulates VEGF signaling-mediated angiogenesis.

Protein Kinase D1 Signaling in Angiogenic Gene Expression and VEGF-Mediated Angiogenesis

PubMed Central

Ren, Bin

2016-01-01

Protein kinase D 1 (PKD-1) is a signaling kinase important in fundamental cell functions including migration, proliferation, and differentiation. PKD-1 is also a key regulator of gene expression and angiogenesis that is essential for cardiovascular development and tumor progression. Further understanding molecular aspects of PKD-1 signaling in the regulation of angiogenesis may have translational implications in obesity, cardiovascular disease, and cancer. The author will summarize and provide the insights into molecular mechanisms by which PKD-1 regulates transcriptional expression of angiogenic genes, focusing on the transcriptional regulation of CD36 by PKD-1-FoxO1 signaling axis along with the potential implications of this axis in arterial differentiation and morphogenesis. He will also discuss a new concept of dynamic balance between proangiogenic and antiangiogenic signaling in determining angiogenic switch, and stress how PKD-1 signaling regulates VEGF signaling-mediated angiogenesis. PMID:27200349

Repetitive ischemia increases myocardial dimethylarginine dimethylaminohydrolase 1 expression.

PubMed

Zhang, Ping; Fassett, John T; Zhu, Guangshuo; Li, Jingxin; Hu, Xinli; Xu, Xin; Chen, Yingjie; Bache, Robert J

2017-06-01

Pharmacologic inhibition of nitric oxide production inhibits growth of coronary collateral vessels. Dimethylarginine dimethylaminohydrolase 1 (DDAH1) is the major enzyme that degrades asymmetric dimethylarginine (ADMA), a potent inhibitor of nitric oxide synthase. Here we examined regulation of the ADMA-DDAH1 pathway in a canine model of recurrent myocardial ischemia during the time when coronary collateral growth is known to occur. Under basal conditions, DDAH1 expression was non-uniform across the left ventricular (LV) wall, with expression strongest in the subepicardium. In response to ischemia, DDAH1 expression was up-regulated in the midmyocardium of the ischemic zone, and this was associated with a significant reduction in myocardial interstitial fluid (MIF) ADMA. The decrease in MIF ADMA during ischemia was likely due to increased DDAH1 because myocardial protein arginine N-methyl transferase 1 (PRMT1) and the methylated arginine protein content (the source of ADMA) were unchanged or increased, respectively, at this time. The inflammatory mediators interleukin (IL-1β) and tumor necrosis factor (TNF-α) were also elevated in the midmyocardium where DDAH1 expression was increased. Both of these factors significantly up-regulated DDAH1 expression in cultured human coronary artery endothelial cells. Taken together, these results suggest that inflammatory factors expressed in response to myocardial ischemia contributed to up-regulation of DDAH1, which was responsible for the decrease in MIF ADMA.

Cyclophosphamide Alters the Gene Expression Profile in Patients Treated with High Doses Prior to Stem Cell Transplantation

PubMed Central

El-Serafi, Ibrahim; Abedi-Valugerdi, Manuchehr; Potácová, Zuzana; Afsharian, Parvaneh; Mattsson, Jonas; Moshfegh, Ali; Hassan, Moustapha

2014-01-01

Background Hematopoietic stem cell transplantation is a curative treatment for several haematological malignancies. However, treatment related morbidity and mortality still is a limiting factor. Cyclophosphamide is widely used in condition regimens either in combination with other chemotherapy or with total body irradiation. Methods We present the gene expression profile during cyclophosphamide treatment in 11 patients conditioned with cyclophosphamide for 2 days followed by total body irradiation prior to hematopoietic stem cell transplantation. 299 genes were identified as specific for cyclophosphamide treatment and were arranged into 4 clusters highly down-regulated genes, highly up-regulated genes, early up-regulated but later normalized genes and moderately up-regulated genes. Results Cyclophosphamide treatment down-regulated expression of several genes mapped to immune/autoimmune activation and graft rejection including CD3, CD28, CTLA4, MHC II, PRF1, GZMB and IL-2R, and up-regulated immune-related receptor genes, e.g. IL1R2, IL18R1, and FLT3. Moreover, a high and significant expression of ANGPTL1 and c-JUN genes was observed independent of cyclophosphamide treatment. Conclusion This is the first investigation to provide significant information about alterations in gene expression following cyclophosphamide treatment that may increase our understanding of the cyclophosphamide mechanism of action and hence, in part, avoid its toxicity. Furthermore, ANGPTL1 remained highly expressed throughout the treatment and, in contrast to several other alkylating agents, cyclophosphamide did not influence c-JUN expression. PMID:24466173

Cyclophosphamide alters the gene expression profile in patients treated with high doses prior to stem cell transplantation.

PubMed

El-Serafi, Ibrahim; Abedi-Valugerdi, Manuchehr; Potácová, Zuzana; Afsharian, Parvaneh; Mattsson, Jonas; Moshfegh, Ali; Hassan, Moustapha

2014-01-01

Hematopoietic stem cell transplantation is a curative treatment for several haematological malignancies. However, treatment related morbidity and mortality still is a limiting factor. Cyclophosphamide is widely used in condition regimens either in combination with other chemotherapy or with total body irradiation. We present the gene expression profile during cyclophosphamide treatment in 11 patients conditioned with cyclophosphamide for 2 days followed by total body irradiation prior to hematopoietic stem cell transplantation. 299 genes were identified as specific for cyclophosphamide treatment and were arranged into 4 clusters highly down-regulated genes, highly up-regulated genes, early up-regulated but later normalized genes and moderately up-regulated genes. Cyclophosphamide treatment down-regulated expression of several genes mapped to immune/autoimmune activation and graft rejection including CD3, CD28, CTLA4, MHC II, PRF1, GZMB and IL-2R, and up-regulated immune-related receptor genes, e.g. IL1R2, IL18R1, and FLT3. Moreover, a high and significant expression of ANGPTL1 and c-JUN genes was observed independent of cyclophosphamide treatment. This is the first investigation to provide significant information about alterations in gene expression following cyclophosphamide treatment that may increase our understanding of the cyclophosphamide mechanism of action and hence, in part, avoid its toxicity. Furthermore, ANGPTL1 remained highly expressed throughout the treatment and, in contrast to several other alkylating agents, cyclophosphamide did not influence c-JUN expression.

The PBX1 lupus susceptibility gene regulates CD44 expression

PubMed Central

Niu, Yuxin; Sengupta, Mayami; Titov, Anton A.; Choi, Seung-Chul; Morel, Laurence

2017-01-01

PBX1-d is novel splice isoform of pre-B-cell leukemia homeobox 1 (PBX1) that lacks its DNA-binding and Hox-binding domains, and functions as a dominant negative. We have shown that PBX1-d expression in CD4+ T cells is associated with systemic lupus erythematosus (SLE) in a mouse model as well as in human subjects. More specifically, PBX1-d expression leads to the production of autoreactive activated CD4+ T cells, a reduced frequency and function of Foxp3+ regulatory T (Treg) cells and an expansion of follicular helper T (Tfh) cells. Very little is known about the function of PBX1 in T cells, except that it directly regulates the expression of miRNAs associated with Treg and Tfh homeostasis. In the present study, we show that PBX1 directly regulated the expression of CD44, a marker of T cell activation. Two PBX1 binding sites in the promoter directly regulated CD44 expression, with PBX1-d driving a higher expression than the normal isoform PBX1-b. In addition, mutations in each of the two binding sites had different effects of PBX1-b and PBX1-d. Finally, we showed that an enhanced recruitment of co-factor MEIS by PBX1-d over PBX1-b, while there was no difference for co-factor PREP1 recruitment. Therefore, this study demonstrates that the lupus-associated PBX1-d isoform directly transactivates CD44, a marker of CD44 activation and memory, and that it has different DNA binding and co-factor recruitment relative to the normal isoform. Taken together, these results confirm that PBX1 directly regulates genes related to T cell activation and show that the lupus-associated isoform PBX1-d has unique molecular functions. PMID:28257976

The nuclear receptor NR2E1/TLX controls senescence.

PubMed

O'Loghlen, Ana; Martin, Nadine; Krusche, Benjamin; Pemberton, Helen; Alonso, Marta M; Chandler, Hollie; Brookes, Sharon; Parrinello, Simona; Peters, Gordon; Gil, Jesús

2015-07-30

The nuclear receptor NR2E1 (also known as TLX or tailless) controls the self-renewal of neural stem cells (NSCs) and has been implied as an oncogene which initiates brain tumors including glioblastomas. Despite NR2E1 regulating targets like p21(CIP1) or PTEN we still lack a full explanation for its role in NSC self-renewal and tumorigenesis. We know that polycomb repressive complexes also control stem cell self-renewal and tumorigenesis, but so far, no formal connection has been established between NR2E1 and PRCs. In a screen for transcription factors regulating the expression of the polycomb protein CBX7, we identified NR2E1 as one of its more prominent regulators. NR2E1 binds at the CBX7 promoter, inducing its expression. Notably CBX7 represses NR2E1 as part of a regulatory loop. Ectopic NR2E1 expression inhibits cellular senescence, extending cellular lifespan in fibroblasts via CBX7-mediated regulation of p16(INK4a) and direct repression of p21(CIP1). In addition NR2E1 expression also counteracts oncogene-induced senescence. The importance of NR2E1 to restrain senescence is highlighted through the process of knocking down its expression, which causes premature senescence in human fibroblasts and epithelial cells. We also confirmed that NR2E1 regulates CBX7 and restrains senescence in NSCs. Finally, we observed that the expression of NR2E1 directly correlates with that of CBX7 in human glioblastoma multiforme. Overall we identified control of senescence and regulation of polycomb action as two possible mechanisms that can join those so far invoked to explain the role of NR2E1 in control of NSC self-renewal and cancer.

SEMI-ROLLED LEAF1 Encodes a Putative Glycosylphosphatidylinositol-Anchored Protein and Modulates Rice Leaf Rolling by Regulating the Formation of Bulliform Cells1[W][OA

PubMed Central

Xiang, Jing-Jing; Zhang, Guang-Heng; Qian, Qian; Xue, Hong-Wei

2012-01-01

Leaf rolling is an important agronomic trait in rice (Oryza sativa) breeding and moderate leaf rolling maintains the erectness of leaves and minimizes shadowing between leaves, leading to improved photosynthetic efficiency and grain yields. Although a few rolled-leaf mutants have been identified and some genes controlling leaf rolling have been isolated, the molecular mechanisms of leaf rolling still need to be elucidated. Here we report the isolation and characterization of SEMI-ROLLED LEAF1 (SRL1), a gene involved in the regulation of leaf rolling. Mutants srl1-1 (point mutation) and srl1-2 (transferred DNA insertion) exhibit adaxially rolled leaves due to the increased numbers of bulliform cells at the adaxial cell layers, which could be rescued by complementary expression of SRL1. SRL1 is expressed in various tissues and is expressed at low levels in bulliform cells. SRL1 protein is located at the plasma membrane and predicted to be a putative glycosylphosphatidylinositol-anchored protein. Moreover, analysis of the gene expression profile of cells that will become epidermal cells in wild type but probably bulliform cells in srl1-1 by laser-captured microdissection revealed that the expression of genes encoding vacuolar H+-ATPase (subunits A, B, C, and D) and H+-pyrophosphatase, which are increased during the formation of bulliform cells, were up-regulated in srl1-1. These results provide the transcript profile of rice leaf cells that will become bulliform cells and demonstrate that SRL1 regulates leaf rolling through inhibiting the formation of bulliform cells by negatively regulating the expression of genes encoding vacuolar H+-ATPase subunits and H+-pyrophosphatase, which will help to understand the mechanism regulating leaf rolling. PMID:22715111

Regulated expression of the Ras effector Rin1 in forebrain neurons

PubMed Central

Dzudzor, Bartholomew; Huynh, Lucia; Thai, Minh; Bliss, Joanne M.; Nagaoka, Yoshiko; Wang, Ying; Ch'ng, Toh Hean; Jiang, Meisheng; Martin, Kelsey C.; Colicelli, John

2009-01-01

The Ras effector Rin1 is induced concomitant with synaptogenesis in forebrain neurons, where it inhibits fear conditioning and amygdala LTP. In epithelial cells, lower levels of Rin1 orchestrate receptor endocytosis. A 945bp Rin1 promoter fragment was active in hippocampal neurons and directed accurate tissue-specific and temporal expression in transgenic mice. Regulated expression in neurons and epithelial cells was mediated in part by Snail transcriptional repressors: mutation of a conserved Snail site increased expression and endogenous Snai1 was detected at the Rin1 promoter. We also describe an element closely related to, but distinct from, the consensus site for REST, a master repressor of neuronal genes. Conversion to a consensus REST sequence reduced expression in both cell types. These results provide insight into regulated expression of a neuronal Ras effector, define a promoter useful in telencephalic neuron studies, and describe a novel REST site variant directing expression to mature neurons. PMID:19837165

SKP2 siRNA inhibits the degradation of P27kip1 and down-regulates the expression of MRP in HL-60/A cells.

PubMed

Xiao, Jie; Yin, Songmei; Li, Yiqing; Xie, Shuangfeng; Nie, Danian; Ma, Liping; Wang, Xiuju; Wu, Yudan; Feng, Jianhong

2009-08-01

S-phase kinase-associated protein 2 (SKP2) gene is a tumor suppressor gene, and is involved in the ubiquitin-mediated degradation of P27kip1. SKP2 and P27kip1 affect the proceeding and prognosis of leukemia through regulating the proliferation, apoptosis and differentiation of leukemia cells. In this study, we explored the mechanism of reversing of HL-60/A drug resistance through SKP2 down-regulation. HL-60/A cells were nucleofected by Amaxa Nucleofector System with SKP2 siRNA. The gene and protein expression levels of Skp2, P27kip1, and multi-drug resistance associated protein (MRP) were determined by reverse transcription-polymerase chain reaction and western blot analysis, respectively. The cell cycle was analyzed by flow cytometry. The 50% inhibitory concentration value was calculated using cytotoxic analysis according to the death rate of these two kinds of cells under different concentrations of chemotherapeutics to compare the sensitivity of the cells. HL-60/A cells showed multi-drug resistance phenotype characteristic by cross-resistance to adriamycin, daunorubicin, and arabinosylcytosine, due to the expression of MRP. We found that the expression of SKP2 was higher in HL-60/A cells than in HL-60 cells, but the expression of P27kip1 was lower. The expression of SKP2 in HL-60/A cells nucleofected by SKP2 siRNA was down-regulated whereas the protein level of P27kip1 was up-regulated. Compared with the MRP expression level in the control group (nucleofected by control siRNA), the mRNA and protein expression levels of MRP in HL-60/A cells nucleofected by SKP2 siRNA were lower, and the latter cells were more sensitive to adriamycin, daunorubicin, and arabinosylcytosine. Down-regulating the SKP2 expression and arresting cells in the G0/G1 phase improve drug sensitivity of leukemia cells with down-regulated MRP expression.

Transactivation of micrornA-320 by microRNA-383 regulates granulosa cell functions by targeting E2F1 and SF-1 proteins.

PubMed

Yin, Mianmian; Wang, Xiaorong; Yao, Guidong; Lü, Mingrong; Liang, Meng; Sun, Yingpu; Sun, Fei

2014-06-27

Our previous studies have shown that microRNA-320 (miR-320) is one of the most down-regulated microRNAs (miRNA) in mouse ovarian granulosa cells (GCs) after TGF-β1 treatment. However, the underlying mechanisms of miR-320 involved in GC function during follicular development remain unknown. In this study, we found that pregnant mare serum gonadotropin treatment resulted in the suppression of miR-320 expression in a time-dependent manner. miR-320 was mainly expressed in GCs and oocytes of mouse ovarian follicles in follicular development. Overexpression of miR-320 inhibited estradiol synthesis and proliferation of GCs through targeting E2F1 and SF-1. E2F1/SF-1 mediated miR-320-induced suppression of GC proliferation and of GC steroidogenesis. FSH down-regulated the expression of miR-320 and regulated the function of miR-320 in mouse GCs. miR-383 promoted the expression of miR-320 and enhanced miR-320-mediated suppression of GC proliferation. Injection of miR-320 into the ovaries of mice partially promoted the production of testosterone and progesterone but inhibited estradiol release in vivo. Moreover, the expression of miR-320 and miR-383 was up-regulated in the follicular fluid of polycystic ovarian syndrome patients, although the expression of E2F1 and SF-1 was down-regulated in GCs. These data demonstrated that miR-320 regulates the proliferation and steroid production by targeting E2F1 and SF-1 in the follicular development. Understanding the regulation of miRNA biogenesis and function in the follicular development will potentiate the usefulness of miRNA in the treatment of reproduction and some steroid-related disorders. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Yin yang 1 is a novel regulator of pulmonary fibrosis.

PubMed

Lin, Xin; Sime, Patricia J; Xu, Haodong; Williams, Marc A; LaRussa, Larry; Georas, Steve N; Guo, Jia

2011-06-15

The differentiation of fibroblasts into myofibroblasts is a cardinal feature of idiopathic pulmonary fibrosis (IPF). The transcription factor Yin Yang 1 (YY1) plays a role in the proliferation and differentiation of diverse cell types, but its role in fibrotic lung diseases is not known. To elucidate the mechanism by which YY1 regulates fibroblast differentiation and lung fibrosis. Lung fibroblasts were cultured with transforming growth factor (TGF)-β or tumor necrosis factor-α. Nuclear factor (NF)-κB, YY1, and α-smooth muscle actin (SMA) were determined in protein, mRNA, and promoter reporter level. Lung fibroblasts and lung fibrosis were assessed in a partial YY1-deficient mouse and a YY1(f/f) conditional knockout mouse after being exposed to silica or bleomycin. TGF-β and tumor necrosis factor-α up-regulated YY1 expression in lung fibroblasts. TGF-β-induced YY1 expression was dramatically decreased by an inhibitor of NF-κB, which blocked I-κB degradation. YY1 is significantly overexpressed in both human IPF and murine models of lung fibrosis, including in the aggregated pulmonary fibroblasts of fibrotic foci. Furthermore, the mechanism of fibrogenesis is that YY1 can up-regulate α-SMA expression in pulmonary fibroblasts. YY1-deficient (YY1(+/-)) mice were significantly protected from lung fibrosis, which was associated with attenuated α-SMA and collagen expression. Finally, decreasing YY1 expression through instilled adenovirus-cre in floxed-YY1(f/f) mice reduced lung fibrosis. YY1 is overexpressed in fibroblasts in both human IPF and murine models in a NF-κB-dependent manner, and YY1 regulates fibrogenesis at least in part by increasing α-SMA and collagen expression. Decreasing YY1 expression may provide a new therapeutic strategy for pulmonary fibrosis.

PGC1α -1 Nucleosome Position and Splice Variant Expression and Cardiovascular Disease Risk in Overweight and Obese Individuals.

PubMed

Henagan, Tara M; Stewart, Laura K; Forney, Laura A; Sparks, Lauren M; Johannsen, Neil; Church, Timothy S

2014-01-01

PGC1α, a transcriptional coactivator, interacts with PPARs and others to regulate skeletal muscle metabolism. PGC1α undergoes splicing to produce several mRNA variants, with the NTPGC1α variant having a similar biological function to the full length PGC1α (FLPGC1α). CVD is associated with obesity and T2D and a lower percentage of type 1 oxidative fibers and impaired mitochondrial function in skeletal muscle, characteristics determined by PGC1α expression. PGC1α expression is epigenetically regulated in skeletal muscle to determine mitochondrial adaptations, and epigenetic modifications may regulate mRNA splicing. We report in this paper that skeletal muscle PGC1α  -1 nucleosome (-1N) position is associated with splice variant NTPGC1α but not FLPGC1α expression. Division of participants based on the -1N position revealed that those individuals with a -1N phased further upstream from the transcriptional start site (UP) expressed lower levels of NTPGC1α than those with the -1N more proximal to TSS (DN). UP showed an increase in body fat percentage and serum total and LDL cholesterol. These findings suggest that the -1N may be a potential epigenetic regulator of NTPGC1α splice variant expression, and -1N position and NTPGC1α variant expression in skeletal muscle are linked to CVD risk. This trial is registered with clinicaltrials.gov, identifier NCT00458133.

Regulation of fibrillins and modulators of TGFβ in fetal bovine and human ovaries.

PubMed

Bastian, Nicole A; Bayne, Rosemary A; Hummitzsch, Katja; Hatzirodos, Nicholas; Bonner, Wendy M; Hartanti, Monica D; Irving-Rodgers, Helen F; Anderson, Richard A; Rodgers, Raymond J

2016-08-01

Fibrillins 1-3 are stromal extracellular matrix proteins that play important roles in regulating TGFβ activity, which stimulates fibroblasts to proliferate and synthesize collagen. In the developing ovary, the action of stroma is initially necessary for the formation of ovigerous cords and subsequently for the formation of follicles and the surface epithelium of the ovary. FBN3 is highly expressed only in early ovarian development and then it declines. In contrast, FBN1 and 2 are upregulated in later ovarian development. We examined the expression of FBN1-3 in bovine and human fetal ovaries. We used cell dispersion and monolayer culture, cell passaging and tissue culture. Cells were treated with growth factors, hormones or inhibitors to assess the regulation of expression of FBN1-3 When bovine fetal ovarian tissue was cultured, FBN3 expression declined significantly. Treatment with TGFβ-1 increased FBN1 and FBN2 expression in bovine fibroblasts, but did not affect FBN3 expression. Additionally, in cultures of human fetal ovarian fibroblasts (9-17weeks gestational age), the expression of FBN1 and FBN2 increased with passage, whereas FBN3 dramatically decreased. Treatment with activin A and a TGFβ family signaling inhibitor, SB431542, differentially regulated the expression of a range of modulators of TGFβ signaling and of other growth factors in cultured human fetal ovarian fibroblasts suggesting that TGFβ signaling is differentially involved in the regulation of ovarian fibroblasts. Additionally, since the changes in FBN1-3 expression that occur in vitro are those that occur with increasing gestational age in vivo, we suggest that the fetal ovarian fibroblasts mature in vitro. © 2016 Society for Reproduction and Fertility.

MicroRNA-363 negatively regulates the left ventricular determining transcription factor HAND1 in human embryonic stem cell-derived cardiomyocytes.

PubMed

Wagh, Vilas; Pomorski, Alexander; Wilschut, Karlijn J; Piombo, Sebastian; Bernstein, Harold S

2014-06-06

Posttranscriptional control of mRNA by microRNA (miRNA) has been implicated in the regulation of diverse biologic processes from directed differentiation of stem cells through organism development. We describe a unique pathway by which miRNA regulates the specialized differentiation of cardiomyocyte (CM) subtypes. We differentiated human embryonic stem cells (hESCs) to cardiac progenitor cells and functional CMs, and characterized the regulated expression of specific miRNAs that target transcriptional regulators of left/right ventricular-subtype specification. From >900 known human miRNAs in hESC-derived cardiac progenitor cells and functional CMs, a subset of differentially expressed cardiac miRNAs was identified, and in silico analysis predicted highly conserved binding sites in the 3'-untranslated regions (3'UTRs) of Hand-and-neural-crest-derivative-expressed (HAND) genes 1 and 2 that are involved in left and right ventricular development. We studied the temporal and spatial expression patterns of four miRNAs in differentiating hESCs, and found that expression of miRNA (miR)-363, miR-367, miR-181a, and miR-181c was specific for stage and site. Further analysis showed that miR-363 overexpression resulted in downregulation of HAND1 mRNA and protein levels. A dual luciferase reporter assay demonstrated functional interaction of miR-363 with the full-length 3'UTR of HAND1. Expression of anti-miR-363 in-vitro resulted in enrichment for HAND1-expressing CM subtype populations. We also showed that BMP4 treatment induced the expression of HAND2 with less effect on HAND1, whereas miR-363 overexpression selectively inhibited HAND1. These data show that miR-363 negatively regulates the expression of HAND1 and suggest that suppression of miR-363 could provide a novel strategy for generating functional left-ventricular CMs.

Zinc finger protein 267 is up-regulated in hepatocellular carcinoma and promotes tumor cell proliferation and migration.

PubMed

Schnabl, Bernd; Valletta, Daniela; Kirovski, Georgi; Hellerbrand, Claus

2011-12-01

Zinc finger protein 267 (ZNF267) belongs to the family of Kruppel-like transcription factors, which regulates diverse biological processes that include development, proliferation, and differentiation. We have previously demonstrated that ZNF267 mRNA is up-regulated in liver cirrhosis, which is the main risk factor for hepatocellular carcinoma (HCC). Here, we analyzed the expression of ZNF267 in human HCC cells and tissue specimens and found a significant up-regulation compared to primary human hepatocytes and corresponding non-tumorous liver tissue. Over-expression of the transcription factor Ets-1 further enhanced ZNF267 expression, and reporter gene assays revealed that mutation of the Ets-1 binding site to the ZNF267 promotor markedly inhibited ZNF267 promotor activity. Hypoxic conditions induced Ets-1 in HCC cells via HIF1alpha activation, and hypoxia induced ZNF267 expression while HIF1alpha inhibition significantly reduced both hypoxia-induced as well as basal ZNF267 expression in HCC cells. It is known that hypoxic conditions in tumorous tissues induce the formation of reactive oxygen species (ROS), and ROS have been identified as important factor in the regulation of Ets-1 expression in tumor cells. Here, we found that ROS induction induced and ROS scavenging reduced ZNF267 expression in HCC cells, respectively. Loss and gain of function analysis applying siRNA directed against ZNF267 or transient transfection revealed that ZNF267 promotes proliferation and migration of HCC cells in vitro. These findings indicate Ets-1 and HIF1alpha as critical regulators of basal and hypoxia- or ROS-induced ZNF267 expression in HCC, and further suggest that the pro-tumorigenic effect of these factors is at least in part mediated via increased ZNF267 expression in HCC. Since ZNF267 is already elevated in cirrhosis, ZNF267 appears as promising target for both prevention as well as treatment of HCC in patients with chronic liver disease. Copyright © 2011 Elsevier Inc. All rights reserved.

Zinc finger protein 267 is up-regulated in hepatocellular carcinoma and promotes tumor cell proliferation and migration

PubMed Central

Schnabl, Bernd; Valletta, Daniela; Kirovski, Georgi; Hellerbrand, Claus

2012-01-01

Zinc finger protein 267 (ZNF267) belongs to the family of Kruppel-like transcription factors, which regulates diverse biological processes that include development, proliferation, and differentiation. We have previously demonstrated that ZNF267 mRNA is up-regulated in liver cirrhosis, which is the main risk factor for hepatocellular carcinoma (HCC). Here, we analyzed the expression of ZNF267 in human HCC cells and tissue specimens and found a significant up-regulation compared to primary human hepatocytes and corresponding non-tumorous liver tissue. Over-expression of the transcription factor Ets-1 further enhanced ZNF267 expression, and reporter gene assays revealed that mutation of the Ets-1 binding site to the ZNF267 promotor markedly inhibited ZNF267 promotor activity. Hypoxic conditions induced Ets-1 in HCC cells via HIF1alpha activation, and hypoxia induced ZNF267 expression while HIF1alpha inhibition significantly reduced both hypoxia-induced as well as basal ZNF267 expression in HCC cells. It is known that hypoxic conditions in tumorous tissues induce the formation of reactive oxygen species (ROS), and ROS have been identified as important factor in the regulation of Ets-1 expression in tumor cells. Here, we found that ROS induction induced and ROS scavenging reduced ZNF267 expression in HCC cells, respectively. Loss and gain of function analysis applying siRNA directed against ZNF267 or transient transfection revealed that ZNF267 promotes proliferation and migration of HCC cells in vitro. These findings indicate Ets-1 and HIF1alpha as critical regulators of basal and hypoxia- or ROS-induced ZNF267 expression in HCC, and further suggest that the pro-tumorigenic effect of these factors is at least in part mediated via increased ZNF267 expression in HCC. Since ZNF267 is already elevated in cirrhosis, ZNF267 appears as promising target for both prevention as well as treatment of HCC in patients with chronic liver disease. PMID:21840307

Fibroblast growth factor 7 inhibits cholesterol 7{alpha}-hydroxylase gene expression in hepatocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Zhichao; Yu, Xuemei; Wu, Weibin

2012-07-13

Highlights: Black-Right-Pointing-Pointer FGF7 strongly and rapidly down-regulates the expression of CYP7A1 in hepatocytes. Black-Right-Pointing-Pointer FGF7 suppresses the expression of CYP7A1 via FGFR2 and downstream JNK activation. Black-Right-Pointing-Pointer Blocking FGF7 abrogates HSC-induced inhibition of CYP7A1 expression in hepatocytes. -- Abstract: Cholesterol 7{alpha}-hydroxylase (CYP7A1) is the initial and rate-limiting enzyme for bile acid synthesis. Transcription of the CYP7A1 gene is regulated by bile acids, nuclear receptors and cytokines. Fibroblast growth factor 7 (FGF7) secreted from activated hepatic stellate cells (HSC) during chronic liver fibrosis regulates hepatocyte survival and liver regeneration. In the carbon tetrachloride (CCl{sub 4})-induced fibrotic mouse liver, we demonstrated thatmore » the expression of CYP7A1 was largely decreased while the expression of FGF7 was significantly increased. We further demonstrated that FGF7 inhibited CYP7A1 gene expression in hepatocytes. Knockdown study by short interfering RNA, kinase inhibition and phosphorylation assays revealed that the suppression of CYP7A1 expression by FGF7 was mediated by FGFR2 and its downstream JNK signaling cascade. The FGF7 neutralizing antibody restored CYP7A1 expression in Hep3B cells treated with conditioned medium from HSC. In summary, the data suggest that FGF7 is a novel regulator of CYP7A1 expression in hepatocytes and may prevent hepatocytes from accumulating toxic bile acids during liver injury and fibrosis.« less

Overexpression of Prdx1 in hilar cholangiocarcinoma: a predictor for recurrence and prognosis.

PubMed

Zhou, Jie; Shen, Weiwen; He, Xiaojing; Qian, Jing; Liu, Shiyuan; Yu, Guanzhen

2015-01-01

Prdx1 is an important member of peroxiredoxins (Prdxs) regulating various cellular signaling and differentiation. Prdx1 confers an aggressive survival phenotype of cancer cells and drug-resistance, yet its role in hilar cholangiocarcinoma is not fully investigated. In present study, we detected the expression profile of Prdx1 in 88 hilar cholangiocarcinoma by tissue arrays and immunohistochemistry. Prdx1 level was down-regulated by specific Prdx1-shRNA in vitro and the possible mechanism was investigated. Overexpression of Prdx1 was observed in 53 of 88 cases (60.2%). Prdx1 expression was significantly associated with tumor invasion, nodal metastasis, advanced disease stage. Down-regulation of Prdx1 inhibited cell proliferation and colony formation of QBC939 cells and reduced the level of SNAT1 expression. Patients with Prdx1 overexpression had a shorter disease-free survival and overall survival than those without Prdx1 expression. Multivariate analysis showed that Prdx1 was an independent prognostic factor for patients with hilar cholangiocarcinoma. The data indicate that Prdx1 may contribute to the development and progression of hilar cholangiocarcinoma, partially through regulating SNAT1 expression, and may be used as a biomarker in predicting the outcome of patients with hilar cholangiocarcinoma.

Ketogenic diet does not impair spatial ability controlled by the hippocampus in male rats.

PubMed

Fukushima, Atsushi; Ogura, Yuji; Furuta, Miyako; Kakehashi, Chiaki; Funabashi, Toshiya; Akema, Tatsuo

2015-10-05

A ketogenic diet was recently shown to reduce glutamate accumulation in synaptic vesicles, decreasing glutamate transmission. We questioned whether a ketogenic diet affects hippocampal function, as glutamate transmission is critically involved in visuospatial ability. In the present study, male Wistar rats were maintained on a ketogenic diet containing 10% protein and 90% fat with complements for 3 weeks to change their energy expenditure from glucose-dependent to fat-dependent. Control rats were fed a diet containing 10% protein, 10% fat, and 80% carbohydrates. The fat-dependent energy expenditure induced by the ketogenic diet led to decreased body weight and increased blood ketone production, though the rats in the two groups consumed the same number of calories. The ketogenic diet did not alter food preferences for the control or high-fat diet containing 10% protein, 45% fat, and 45% carbohydrates. Anxiety in the open field was not altered by ingestion the ketogenic diet. However, rats fed the ketogenic diet performed better in the Y-maze test than rats fed the control diet. No difference was observed between the two groups in the Morris water maze test. Finally, Western blot revealed that the hippocampal expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-type glutamate receptor subunit 1 (GluR1) was significantly increased in mice fed a ketogenic diet. These results suggest that hippocampal function is not impaired by a ketogenic diet and we speculate that the fat-dependent energy expenditure does not impair visuospatial ability. Copyright © 2015 Elsevier B.V. All rights reserved.

Lead Exposure Impairs Hippocampus Related Learning and Memory by Altering Synaptic Plasticity and Morphology During Juvenile Period.

PubMed

Wang, Tao; Guan, Rui-Li; Liu, Ming-Chao; Shen, Xue-Feng; Chen, Jing Yuan; Zhao, Ming-Gao; Luo, Wen-Jing

2016-08-01

Lead (Pb) is an environmental neurotoxic metal. Pb exposure may cause neurobehavioral changes, such as learning and memory impairment, and adolescence violence among children. Previous animal models have largely focused on the effects of Pb exposure during early development (from gestation to lactation period) on neurobehavior. In this study, we exposed Sprague-Dawley rats during the juvenile stage (from juvenile period to adult period). We investigated the synaptic function and structural changes and the relationship of these changes to neurobehavioral deficits in adult rats. Our results showed that juvenile Pb exposure caused fear-conditioned memory impairment and anxiety-like behavior, but locomotion and pain behavior were indistinguishable from the controls. Electrophysiological studies showed that long-term potentiation induction was affected in Pb-exposed rats, and this was probably due to excitatory synaptic transmission impairment in Pb-exposed rats. We found that NMDA and AMPA receptor-mediated current was inhibited, whereas the GABA synaptic transmission was normal in Pb-exposed rats. NR2A and phosphorylated GluR1 expression decreased. Moreover, morphological studies showed that density of dendritic spines declined by about 20 % in the Pb-treated group. The spine showed an immature form in Pb-exposed rats, as indicated by spine size measurements. However, the length and arborization of dendrites were unchanged. Our results suggested that juvenile Pb exposure in rats is associated with alterations in the glutamate receptor, which caused synaptic functional and morphological changes in hippocampal CA1 pyramidal neurons, thereby leading to behavioral changes.

Regulated expression of homeobox genes Msx-1 and Msx-2 in mouse mammary gland development suggests a role in hormone action and epithelial-stromal interactions.

PubMed

Friedmann, Y; Daniel, C W

1996-07-10

The murine homeobox genes Msx-1 and Msx-2 are related to the Drosophila msh gene and are expressed in a variety of tissues during mouse embryogenesis. We now report the developmentally regulated expression of Msx-1 and Msx-2 in the mouse mammary gland and show that their expression patterns point toward significant functional roles. Msx-1 and Msx-2 transcripts were present in glands of virgin mice and in glands of mice in early pregnancy, but transcripts decreased dramatically during late pregnancy. Low levels of Msx-1 transcripts were detected in glands from lactating animals and during the first days of involution, whereas Msx-2 expression was not detected during lactation or early involution. Expression of both genes increased gradually as involution progressed. Msx-2 but not Msx-1 expression was decreased following ovariectomy or following exposure to anti-estrogen implanted directly into the gland. Hormonal regulation of Msx-2 expression was confirmed when transcripts returned to normal levels after estrogen was administered to ovariectomized animals. In situ molecular hybridization for Msx-1 showed transcripts localized to the mammary epithelium, whereas Msx-2 expression was confined to the periductal stroma. Mammary stroma from which mammary epithelium had been removed did not transcribe detectable amounts of Msx-2, showing that expression is regulated by contiguous mammary epithelium, and indicating a role for these homeobox genes in mesenchymal-epithelial interactions during mammary development.

MiR-144 regulates hematopoiesis and vascular development by targeting meis1 during zebrafish development.

PubMed

Su, Zhenhong; Si, Wenxia; Li, Lei; Zhou, Bisheng; Li, Xiuchun; Xu, Yan; Xu, Chengqi; Jia, Haibo; Wang, Qing K

2014-04-01

Hematopoiesis is a dynamic process by which peripheral blood lineages are developed. It is a process tightly regulated by many intrinsic and extrinsic factors, including transcriptional factors and signaling molecules. However, the epigenetic regulation of hematopoiesis, for example, regulation via microRNAs (miRNAs), remains incompletely understood. Here we show that miR-144 regulates hematopoiesis and vascular development in zebrafish. Overexpression of miR-144 inhibited primitive hematopoiesis as demonstrated by a reduced number of circulating blood cells, reduced o-dianisidine staining of hemoglobin, and reduced expression of hbαe1, hbβe1, gata1 and pu.1. Overexpression of miR-144 also inhibited definitive hematopoiesis as shown by reduced expression of runx1 and c-myb. Mechanistically, miR-144 regulates hematopoiesis by repressing expression of meis1 involved in hematopoiesis. Both real-time RT-PCR and Western blot analyses showed that overexpression of miR-144 repressed expression of meis1. Bioinformatic analysis predicts a target binding sequence for miR-144 at the 3'-UTR of meis1. Deletion of the miR-144 target sequence eliminated the repression of meis1 expression mediated by miR-144. The miR-144-mediated abnormal phenotypes were partially rescued by co-injection of meis1 mRNA and could be almost completely rescued by injection of both meis1 and gata1 mRNA. Finally, because meis1 is involved in vascular development, we tested the effect of miR-144 on vascular development. Overexpression of miR-144 resulted in abnormal vascular development of intersegmental vessels in transgenic zebrafish with Flk1p-EGFP, and the defect was rescued by co-injection of meis1 mRNA. These findings establish miR-144 as a novel miRNA that regulates hematopoiesis and vascular development by repressing expression of meis1. Copyright © 2014 Elsevier Ltd. All rights reserved.

Live-cell monitoring of periodic gene expression in synchronous human cells identifies Forkhead genes involved in cell cycle control

PubMed Central

Grant, Gavin D.; Gamsby, Joshua; Martyanov, Viktor; Brooks, Lionel; George, Lacy K.; Mahoney, J. Matthew; Loros, Jennifer J.; Dunlap, Jay C.; Whitfield, Michael L.

2012-01-01

We developed a system to monitor periodic luciferase activity from cell cycle–regulated promoters in synchronous cells. Reporters were driven by a minimal human E2F1 promoter with peak expression in G1/S or a basal promoter with six Forkhead DNA-binding sites with peak expression at G2/M. After cell cycle synchronization, luciferase activity was measured in live cells at 10-min intervals across three to four synchronous cell cycles, allowing unprecedented resolution of cell cycle–regulated gene expression. We used this assay to screen Forkhead transcription factors for control of periodic gene expression. We confirmed a role for FOXM1 and identified two novel cell cycle regulators, FOXJ3 and FOXK1. Knockdown of FOXJ3 and FOXK1 eliminated cell cycle–dependent oscillations and resulted in decreased cell proliferation rates. Analysis of genes regulated by FOXJ3 and FOXK1 showed that FOXJ3 may regulate a network of zinc finger proteins and that FOXK1 binds to the promoter and regulates DHFR, TYMS, GSDMD, and the E2F binding partner TFDP1. Chromatin immunoprecipitation followed by high-throughput sequencing analysis identified 4329 genomic loci bound by FOXK1, 83% of which contained a FOXK1-binding motif. We verified that a subset of these loci are activated by wild-type FOXK1 but not by a FOXK1 (H355A) DNA-binding mutant. PMID:22740631

HA117 endows HL60 cells with a stem-like signature by inhibiting the degradation of DNMT1 via its ability to down-regulate expression of the GGL domain of RGS6

PubMed Central

Li, Shuangshuang; Wu, Huan; Wang, Yi; Li, Xiaoqing; Guo, Yuxia; Liang, Shaoyan

2017-01-01

All-trans retinoic acid (ATRA) induces complete remission in almost all patients with acute promyelocytic leukemia (APL) via its ability to induce the in vivo differentiation of APL blasts. However, prolonged ATRA treatment can result in drug resistance. In previous studies, we generated a multi-drug-resistant HL60/ATRA cell line and found it to contain a new drug resistance-related gene segment, HA117. In this study, we demonstrate that ATRA induces multi-drug-resistant subpopulations of HL60 cells with a putative stem-like signature by up-regulating the expression of the new gene segment HA117. Western blot analysis and quantitative real-time PCR demonstrated that HA117 causes alternative splicing of regulator of G-protein signaling 6 (RGS6) and down-regulation of the expression of the GGL domain of RGS6, which plays an important role in DNA methyltransferase 1 (DNMT1) degradation. Moreover, DNMT1 expression was increased in multi-drug resistance HL60/ATRA cells. Knockdown of HA117 restored expression of the GGL domain and blocked DNMT1 expression. Moreover, resistant cells displayed a putative stem-like signature with increased expression of cancer steam cell markers CD133 and CD123. The stem cell marker, Nanog, was significantly up-regulated. In conclusion, our study shows that HA117 potentially promotes the stem-like signature of the HL60/ATRA cell line by inhibiting by the ubiquitination and degradation of DNMT1 and by down-regulating the expression of the GGL domain of RGS6. These results throw light on the cellular events associated with the ATRA-induced multi-drug resistance phenotype in acute leukemia. PMID:28665981

Tazarotene-Induced Gene 1 Interacts with DNAJC8 and Regulates Glycolysis in Cervical Cancer Cells.

PubMed

Wang, Chun-Hua; Shyu, Rong-Yaun; Wu, Chang-Chieh; Chen, Mao-Liang; Lee, Ming-Cheng; Lin, Yi-Yin; Wang, Lu-Kai; Jiang, Shun-Yuan; Tsai, Fu-Ming

2018-06-14

The tazarotene-induced gene 1 (TIG1) protein is a retinoidinducible growth regulator and is considered a tumor suppressor. Here, we show that DnaJ heat shock protein family member C8 (DNAJC8) is a TIG1 target that regulates glycolysis. Ectopic DNAJC8 expression induced the translocation of pyruvate kinase M2 (PKM2) into the nucleus, subsequently inducing glucose transporter 1 (GLUT1) expression to promote glucose uptake. Silencing either DNAJC8 or PKM2 alleviated the upregulation of GLUT1 expression and glucose uptake induced by ectopic DNAJC8 expression. TIG1 interacted with DNAJC8 in the cytosol, and this interaction completely blocked DNAJC8-mediated PKM2 translocation and inhibited glucose uptake. Furthermore, increased glycose uptake was observed in cells in which TIG1 was silenced. In conclusion, TIG1 acts as a pivotal repressor of DNAJC8 to enhance glucose uptake by partially regulating PKM2 translocation.

Role of fibroblast growth factor receptors (FGFR) and FGFR like-1 (FGFRL1) in mesenchymal stromal cell differentiation to osteoblasts and adipocytes.

PubMed

Kähkönen, T E; Ivaska, K K; Jiang, M; Büki, K G; Väänänen, H K; Härkönen, P L

2018-02-05

Fibroblast growth factors (FGF) and their receptors (FGFRs) regulate many developmental processes including differentiation of mesenchymal stromal cells (MSC). We developed two MSC lines capable of differentiating to osteoblasts and adipocytes and studied the role of FGFRs in this process. We identified FGFR2 and fibroblast growth factor receptor like-1 (FGFRL1) as possible actors in MSC differentiation with gene microarray and qRT-PCR. FGFR2 and FGFRL1 mRNA expression strongly increased during MSC differentiation to osteoblasts. FGF2 treatment, resulting in downregulation of FGFR2, or silencing FGFR2 expression with siRNAs inhibited osteoblast differentiation. During adipocyte differentiation expression of FGFR1 and FGFRL1 increased and was down-regulated by FGF2. FGFR1 knockdown inhibited adipocyte differentiation. Silencing FGFR2 and FGFR1 in MSCs was associated with decreased FGFRL1 expression in osteoblasts and adipocytes, respectively. Our results suggest that FGFR1 and FGFR2 regulate FGFRL1 expression. FGFRL1 may mediate or modulate FGFR regulation of MSC differentiation together with FGFR2 in osteoblastic and FGFR1 in adipocytic lineage. Copyright © 2017 Elsevier B.V. All rights reserved.

Orphan nuclear receptor ERRγ is a key regulator of human fibrinogen gene expression

PubMed Central

Zhang, Yaochen; Kim, Don-Kyu; Lu, Yan; Jung, Yoon Seok; Lee, Ji-min; Kim, Young-Hoon; Lee, Yong Soo; Kim, Jina; Dewidar, Bedair; Jeong, Won-IL; Lee, In-Kyu; Cho, Sung Jin; Dooley, Steven; Lee, Chul-Ho; Li, Xiaoying

2017-01-01

Fibrinogen, 1 of 13 coagulation factors responsible for normal blood clotting, is synthesized by hepatocytes. Detailed roles of the orphan nuclear receptors regulating fibrinogen gene expression have not yet been fully elucidated. Here, we identified estrogen-related receptor gamma (ERRγ) as a novel transcriptional regulator of human fibrinogen gene expression. Overexpression of ERRγ specially increased fibrinogen expression in human hepatoma cell line. Cannabinoid receptor types 1(CB1R) agonist arachidonyl-2'-chloroethylamide (ACEA) up-regulated transcription of fibrinogen via induction of ERRγ, whereas knockdown of ERRγ attenuated fibrinogen expression. Deletion analyses of the fibrinogen γ (FGG) gene promoter and ChIP assays revealed binding sites of ERRγ on human fibrinogen γ gene promoter. Moreover, overexpression of ERRγ was sufficient to increase fibrinogen gene expression, whereas treatment with GSK5182, a selective inverse agonist of ERRγ led to its attenuation in cell culture. Finally, fibrinogen and ERRγ gene expression were elevated in liver tissue of obese patients suggesting a conservation of this mechanism. Overall, this study elucidates a molecular mechanism linking CB1R signaling, ERRγ expression and fibrinogen gene transcription. GSK5182 may have therapeutic potential to treat hyperfibrinogenemia. PMID:28750085

HDAC1 and HDAC2 are Differentially Expressed in Endometriosis

PubMed Central

Colón-Díaz, Maricarmen; Báez-Vega, Perla; García, Miosotis; Ruiz, Abigail; Monteiro, Janice B.; Fourquet, Jessica; Bayona, Manuel; Alvarez-Garriga, Carolina; Achille, Alexandra; Seto, Edward; Flores, Idhaliz

2012-01-01

Epigenetic mechanisms have been ascribed important roles in endometriosis. Covalent histone modifications at lysine residues have been shown to regulate gene expression and thus contribute to pathological states in many diseases. In endometriosis, histone deacetylase inhibition (HDACi) resulted in reactivation of E-cadherin, attenuation of invasion, decreased proliferation of endometriotic cells, and caused lesion regression in an animal model. This study was conducted to assess basal and hormone-regulated gene expression levels of HDAC1 and HDAC2 (HDAC1/2) in cell lines and protein expression levels in tissues. Basal and steroid hormone-regulated HDAC1/2 gene expression levels were determined by quantitative polymerase chain reaction in cell lines and tissues. Protein levels were measured by immunohistochemistry (IHC) in tissues on an endometriosis tissue microarray (TMA). Basal HDAC1/2 gene expression levels were significantly higher in endometriotic versus endometrial stromal cells, which was confirmed by Western blot analysis. Estradiol (E2) and progesterone (P4) significantly downregulated HDAC1 expression in endometrial epithelial cells. Levels of HDAC2 were upregulated by E2 and downregulated by E2 + P4 in endometrial stromal cells. Hormone modulation of HDAC1/2 gene expression was lost in the endometriotic cell line. Immunohistochemistry showed that HDAC1/2 proteins were expressed in a substantial proportion of lesions and endometrium from patients, and their expression levels varied according to lesion localization. The highest proportion of strong HDAC1 immunostaining was seen in ovarian, skin, and gastrointestinal lesions, and of HDAC2 in skin lesions and endometrium from patients with endometriosis. These studies suggest that endometriosis etiology may be partially explained by epigenetic regulation of gene expression due to dysregulations in the expression of HDACs. PMID:22344732

LGR4 and Its Ligands, R-Spondin 1 and R-Spondin 3, Regulate Food Intake in the Hypothalamus of Male Rats

PubMed Central

Li, Ji-Yao; Chai, Biaoxin; Zhang, Weizhen; Fritze, Danielle M.; Zhang, Chao

2014-01-01

The hypothalamus plays a key role in the regulation of feeding behavior. Several hypothalamic nuclei, including the arcuate nucleus (ARC), paraventricular nucleus, and ventromedial nucleus of the hypothalamus (VMH), are involved in energy homeostasis. Analysis of microarray data derived from ARC revealed that leucine-rich repeat-containing G protein-coupled receptor 4 (LGR4) is highly expressed. LGR4, LGR5, and LGR6 form a subfamily of closely related receptors. Recently, R-spondin (Rspo) family proteins were identified as ligands of the LGR4 subfamily. In the present study, we investigated the distribution and function of LGR4–LGR6 and Rspos (1–4) in the brain of male rat. In situ hybridization showed that LGR4 is expressed in the ARC, VMH, and median eminence of the hypothalamus. LGR4 colocalizes with neuropeptide Y, proopiomelanocortin, and brain-derived neurotrophic factor neurons. LGR5 is not detectable with in situ hybridization; LGR6 is only expressed in the epithelial lining of the lower portion of the third ventricle and median eminence. Rspo1 is expressed in the VMH and down-regulated with fasting. Rspo3 is expressed in the paraventricular nucleus and also down-regulated with fasting. Rspos 1 and 3 colocalize with the neuronal marker HuD, indicating that they are expressed by neurons. Injection of Rspo1 or Rspo3 into the third brain ventricle inhibited food intake. Rspo1 decreased neuropeptide Y and increased proopiomelanocortin expression in the ARC. Rspo1 and Rspo3 mRNA is up-regulated by insulin. These data indicate that Rspo1 and Rspo3 and their receptor LGR4 form novel circuits in the brain to regulate energy homeostasis. PMID:24280058

LGR4 and its ligands, R-spondin 1 and R-spondin 3, regulate food intake in the hypothalamus of male rats.

PubMed

Li, Ji-Yao; Chai, Biaoxin; Zhang, Weizhen; Fritze, Danielle M; Zhang, Chao; Mulholland, Michael W

2014-02-01

The hypothalamus plays a key role in the regulation of feeding behavior. Several hypothalamic nuclei, including the arcuate nucleus (ARC), paraventricular nucleus, and ventromedial nucleus of the hypothalamus (VMH), are involved in energy homeostasis. Analysis of microarray data derived from ARC revealed that leucine-rich repeat-containing G protein-coupled receptor 4 (LGR4) is highly expressed. LGR4, LGR5, and LGR6 form a subfamily of closely related receptors. Recently, R-spondin (Rspo) family proteins were identified as ligands of the LGR4 subfamily. In the present study, we investigated the distribution and function of LGR4-LGR6 and Rspos (1-4) in the brain of male rat. In situ hybridization showed that LGR4 is expressed in the ARC, VMH, and median eminence of the hypothalamus. LGR4 colocalizes with neuropeptide Y, proopiomelanocortin, and brain-derived neurotrophic factor neurons. LGR5 is not detectable with in situ hybridization; LGR6 is only expressed in the epithelial lining of the lower portion of the third ventricle and median eminence. Rspo1 is expressed in the VMH and down-regulated with fasting. Rspo3 is expressed in the paraventricular nucleus and also down-regulated with fasting. Rspos 1 and 3 colocalize with the neuronal marker HuD, indicating that they are expressed by neurons. Injection of Rspo1 or Rspo3 into the third brain ventricle inhibited food intake. Rspo1 decreased neuropeptide Y and increased proopiomelanocortin expression in the ARC. Rspo1 and Rspo3 mRNA is up-regulated by insulin. These data indicate that Rspo1 and Rspo3 and their receptor LGR4 form novel circuits in the brain to regulate energy homeostasis.

TET1-GPER-PI3K/AKT pathway is involved in insulin-driven endometrial cancer cell proliferation.

PubMed

Xie, Bing-Ying; Lv, Qiao-Ying; Ning, Cheng-Cheng; Yang, Bing-Yi; Shan, Wei-Wei; Cheng, Ya-Li; Gu, Chao; Luo, Xue-Zhen; Zhang, Zhen-Bo; Chen, Xiao-Jun; Xi, Xiao-Wei; Feng, You-Ji

2017-01-22

Large amount of clinical evidence has demonstrated that insulin resistance is closely related to oncogenesis of endometrial cancer (EC). Despite recent studies showed the up-regulatory role of insulin in G protein-coupled estrogen receptor (GPER/GPR30) expression, GPER expression was not decreased compared to control when insulin receptor was blocked even in insulin treatment. The purpose of this study was to explore the possible mechanism by which insulin up-regulates GPER that drives EC cell proliferation. For this purpose, we first investigated the GPER expression in tissues of endometrial lesions, further explored the effect of GPER on EC cell proliferation in insulin resistance context. Then we analyzed the role of Ten-Eleven Translocation 1 (TET1) in insulin-induced GEPR expression and EC cell proliferation. The results showed that GPER was highly expressed in endometrial atypical hyperplasia and EC tissues. Mechanistically, insulin up-regulated TET1 expression and the latter played an important role in up-regulating GPER expression and activating PI3K/AKT signaling pathway. TET1 mediated GPER up-regulation was another mechanism that insulin promotes EC cell proliferation. Copyright © 2016 Elsevier Inc. All rights reserved.

Inflammatory cytokines IL-17 and TNF-α up-regulate PD-L1 expression in human prostate and colon cancer cells.

PubMed

Wang, Xun; Yang, Lingyun; Huang, Feng; Zhang, Qiuyang; Liu, Sen; Ma, Lin; You, Zongbing

2017-04-01

Programmed cell death protein 1 (PD-1) acts on PD-1 ligands (PD-L1 and PD-L2) to suppress activation of cytotoxic T lymphocytes. Interleukin-17 (IL-17) and tumor necrosis factor-α (TNF-α) are co-expressed by T helper 17 (T H 17) cells in many tumors. The purpose of this study was to test if IL-17 and TNF-α may synergistically induce PD-L1 expression in human prostate cancer LNCaP and human colon cancer HCT116 cell lines. We found that IL-17 did not induce PD-L1 mRNA expression, but up-regulated PD-L1 protein expression in HCT116 and LNCaP cells. TNF-α induced PD-L1 mRNA and protein expression in both cell lines. Neither IL-17 nor TNF-α induced PD-L2 mRNA or protein expression. IL-17 and TNF-α acted individually rather than cooperatively in induction of PD-L1 expression. IL-17 and/or TNF-α activated AKT, nuclear factor-κB (NF-κB), and extracellular signal-regulated kinases 1/2 (ERK1/2) signaling pathways in HCT116 cells, whereas only NF-κB signaling was activated in LNCaP cells. NF-κB inhibitor could diminish PD-L1 protein expression induced by IL-17 and/or TNF-α in both HCT116 and LNCaP cell lines. ERK1/2 inhibitor could also reduce PD-L1 protein expression induced by IL-17 and/or TNF-α in HCT116 cells, while AKT inhibitor could abolish PD-L1 protein expression induced by IL-17 and/or TNF-α in LNCaP cells. These results suggest that IL-17 and TNF-α act individually rather than cooperatively through activation of NF-κB and ERK1/2 signaling to up-regulate PD-L1 expression in HCT116 cells, while the two inflammatory cytokines act through activation of NF-κB signaling, in the presence of AKT activity, to up-regulate PD-L1 expression in LNCaP cells. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

Hepcidin suppression in β-thalassemia is associated with the down-regulation of atonal homolog 8.

PubMed

Upanan, Supranee; McKie, Andrew T; Latunde-Dada, Gladys O; Roytrakul, Sittiruk; Uthaipibull, Chairat; Pothacharoen, Peraphan; Kongtawelert, Prachya; Fucharoen, Suthat; Srichairatanakool, Somdet

2017-08-01

Atonal homolog 8 (ATOH8) is defined as a positive regulator of hepcidin transcription, which links erythropoietic activity with iron-sensing molecules. In the present study, we investigated the association between hepcidin and ATOH8 expression in β-thalassemia. We found that inhibition of hepcidin expression in β-thalassemia is correlated with reduced ATOH8 expression. Hepatic hepcidin 1 (Hamp1) and Atoh8 mRNA expression were down-regulated in β-thalassemic mice. Hepcidin (HAMP) and ATOH8 mRNA expression were consistently suppressed in Huh7 cells cultured in medium supplemented with β-thalassemia patient serum. The Huh7 cells, which were transfected with ATOH8-FLAG expression plasmid and cultured in the supplemented medium, exhibited increased levels of ATOH8 mRNA, ATOH8-FLAG protein, pSMAD1,5,8, and HAMP mRNA. Interestingly, over-expression of ATOH8 reversed the effects of hepcidin suppression induced by the β-thalassemia patient sera. In conclusion, hepcidin suppression in β-thalassemia is associated with the down-regulation of ATOH8 in response to anemia. We, therefore, suggest that ATOH8 is an important transcriptional regulator of hepcidin in β-thalassemia.

Effect of hypoxia on the expression of genes encoding insulin-like growth factors and some related proteins in U87 glioma cells without IRE1 function.

PubMed

Minchenko, Dmytro O; Kharkova, A P; Halkin, O V; Karbovskyi, L L; Minchenko, O H

2016-04-01

The aim of the present study was to investigate the effect of hypoxia on the expression of genes encoding insulin-like growth factors (IGF1 and IGF2), their receptor (IGF1R), binding protein-4 (IGFBP4), and stanniocalcin 2 (STC2) in U87 glioma cells in relation to inhibition of endoplasmic reticulum stress signaling mediated by IRE1 (inositol requiring enzyme 1) for evaluation of their possible significance in the control of tumor growth. The expression of IGF1, IGF2, IGF1R, IGFBP4, and STC2 genes in U87 glioma cells transfected by empty vector pcDNA3.1 (control) and cells without IRE1 signaling enzyme function (transfected by dnIRE1) upon hypoxia was studied by qPCR. The expression of IGF1 and IGF2 genes is down-regulated in glioma cells without IRE1 signaling enzyme function in comparison with the control cells. At the same time, the expression of IGF1R, IGFBP4, and STC2 genes was up-regulated in glioma cells upon inhibition of IRE1, with more significant changes for IGFBP4 and STC2 genes. We also showed that hypoxia does not change significantly the expression of IGF1, IGF2, and IGF1R genes but up-regulated IGFBP4 and STC2 genes expression in control glioma cells. Moreover, the inhibition of both enzymatic activities (kinase and endoribonuclease) of IRE1 in glioma cells does not change significantly the effect of hypoxia on the expression of IGF1, IGF1R, and IGFBP4 genes but introduces sensitivity of IGF2 gene to hypoxic condition. Thus, the expression of IGF2 gene is resistant to hypoxia only in control glioma cells and significantly down-regulated in cells without functional activity of IRE1 signaling enzyme, which is central mediator of the unfolded protein response and an important component of the tumor growth as well as metabolic diseases. Results of this study demonstrate that the expression of IGF1 and IGF1R genes is resistant to hypoxic condition both in control U87 glioma cells and cells without IRE1 signaling enzyme function. However, hypoxia significantly up-regulates the expression of IGFBP4 gene independently on the inhibition of IRE1 enzyme. These data show that proteins encoded by these genes are resistant to hypoxia except IGFBP4 and participate in the regulation of metabolic and proliferative processes through IRE1 signaling.

The POU Transcription Factor Oct-1 Represses Virus-Induced Interferon A Gene Expression

PubMed Central

Mesplède, Thibault; Island, Marie-Laure; Christeff, Nicolas; Petek, Fahrettin; Doly, Janine; Navarro, Sébastien

2005-01-01

Alpha interferon (IFN-α) and IFN-β are able to interfere with viral infection. They exert a vast array of biologic functions, including growth arrest, cell differentiation, and immune system regulation. This regulation extends from innate immunity to cellular and humoral adaptive immune responses. A strict control of expression is needed to prevent detrimental effects of unregulated IFN. Multiple IFN-A subtypes are coordinately induced in human and mouse cells infected by virus and exhibit differences in expression of their individual mRNAs. We demonstrated that the weakly expressed IFN-A11 gene is negatively regulated after viral infection, due to a distal negative regulatory element, binding homeoprotein pituitary homeobox 1 (Pitx1). Here we show that the POU protein Oct-1 binds in vitro and in vivo to the IFN-A11 promoter and represses IFN-A expression upon interferon regulatory factor overexpression. Furthermore, we show that Oct-1-deficient MEFs exhibit increased in vivo IFN-A gene expression and increased antiviral activity. Finally, the IFN-A expression pattern is modified in Oct-1-deficient MEFs. The broad representation of effective and potent octamer-like sequences within IFN-A promoters suggests an important role for Oct-1 in IFN-A regulation. PMID:16166650

Up-regulated expression of substance P in CD8+ T cells and NK1R on monocytes of atopic dermatitis.

PubMed

Zhang, Zenan; Zheng, Wenjiao; Xie, Hua; Chai, Ruonan; Wang, Junling; Zhang, Huiyun; He, Shaoheng

2017-05-01

Large numbers of CD8 + T cells were observed in atopic dermatitis (AD) skin, and monocytes from AD patients showed increased prostaglandin E2 production. However, little is known about the expression of substance P (SP) and its receptor NK1R in blood leukocytes of patients with AD. To explore the expression of SP and NK1R in leukocytes of AD and the influence of allergens on SP and NK1R expression. The expression levels of SP and NK1R in patients with AD were examined by flow cytometry, ELISA and a mouse AD model. The plasma SP level was 4.9-fold higher in patients with AD than in HC subjects. Both the percentage of SP expression in the population and mean fluorescence intensity (MFI) of SP expression were elevated in CD8 + T cells in the blood of AD patients. However, both the CD14 + NK1R + population and MFI of NK1R expression on CD14 + cells were enhanced in the blood of AD patients. Allergens ASWE, HDME and PPE failed to up-regulate SP expression in CD8 + T cells. However, allergens ASWE and HDME both enhanced NK1R expression on CD14 + blood leukocytes regardless of AD or HC subjects. OVA-sensitized AD mice showed an elevated proportion and MFI of SP-expressing CD8 + T cells in the blood, which agrees with the SP expression situation in human AD blood. Injection of SP into mouse skin did not up-regulate NK1R expression on monocytes. An elevated plasma SP level, up-regulated expression of SP and NK1R indicate that the SP/NK1R complex is important in the development of AD. Therefore, SP and NK1R antagonist or blocker agents may help to treat patients with AD. Trial registration Registration number: ChiCTR-BOC-16010279; Registration date: Dec., 28, 2016; retrospectively registered.

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

miR-34a screened by miRNA profiling negatively regulates Wnt/β-catenin signaling pathway in Aflatoxin B1 induced hepatotoxicity

PubMed Central

Zhu, Liye; Gao, Jing; Huang, Kunlun; Luo, Yunbo; Zhang, Boyang; Xu, Wentao

2015-01-01

Aflatoxin-B1 (AFB1), a hepatocarcinogenic mycotoxin, was demonstrated to induce the high rate of hepatocellular carcinoma (HCC). MicroRNAs (miRNAs) participate in the regulation of several biological processes in HCC. However, the function of miRNAs in AFB1-induced HCC has received a little attention. Here, we applied Illumina deep sequencing technology for high-throughout profiling of microRNAs in HepG2 cells lines after treatment with AFB1. Analysis of the differential expression profile of miRNAs in two libraries, we identified 9 known miRNAs and 1 novel miRNA which exhibited abnormal expression. KEGG analysis indicated that predicted target genes of differentially expressed miRNAs are involved in cancer-related pathways. Down-regulated of Drosha, DGCR8 and Dicer 1 indicated an impairment of miRNA biogenesis in response to AFB1. miR-34a was up-regulated significantly, down-regulating the expression of Wnt/β-catenin signaling pathway by target gene β-catenin. Anti-miR-34a can significantly relieved the down-regulated β-catenin and its downstream genes, c-myc and Cyclin D1, and the S-phase arrest in cell cycle induced by AFB1 can also be relieved. These results suggested that AFB1 might down-regulate Wnt/β-catenin signaling pathway in HepG2 cells by up-regulating miR-34a, which may involve in the mechanism of liver tumorigenesis. PMID:26567713

Trophoblast expression of the minor histocompatibility antigen HA-1 is regulated by oxygen and is increased in placentas from preeclamptic women.

PubMed

Linscheid, C; Heitmann, E; Singh, P; Wickstrom, E; Qiu, L; Hodes, H; Nauser, T; Petroff, M G

2015-08-01

Maternal T-cells reactive towards paternally inherited fetal minor histocompatibility antigens are expanded during pregnancy. Placental trophoblast cells express at least four fetal antigens, including human minor histocompatibility antigen 1 (HA-1). We investigated oxygen as a potential regulator of HA-1 and whether HA-1 expression is altered in preeclamptic placentas. Expression and regulation of HA-1 mRNA and protein were examined by qRT-PCR and immunohistochemistry, using first, second, and third trimester placentas, first trimester placental explant cultures, and term purified cytotrophoblast cells. Low oxygen conditions were achieved by varying ambient oxygen, and were mimicked using cobalt chloride. HA-1 mRNA and protein expression levels were evaluated in preeclamptic and control placentas. HA-1 protein expression was higher in the syncytiotrophoblast of first trimester as compared to second trimester and term placentas (P<0.01). HA-1 mRNA was increased in cobalt chloride-treated placental explants and purified cytotrophoblast cells (P = 0.04 and P<0.01, respectively) and in purified cytotrophoblast cells cultured under 2% as compared to 8% and 21% oxygen (P<0.01). HA-1 mRNA expression in preeclamptic vs. control placentas was increased 3.3-fold (P = 0.015). HA-1 protein expression was increased in syncytial nuclear aggregates and the syncytiotrophoblast of preeclamptic vs. control placentas (P = 0.02 and 0.03, respectively). Placental HA-1 expression is regulated by oxygen and is increased in the syncytial nuclear aggregates and syncytiotrophoblast of preeclamptic as compared to control placentas. Increased HA-1 expression, combined with increased preeclamptic syncytiotrophoblast deportation, provides a novel potential mechanism for exposure of the maternal immune system to increased fetal antigenic load during preeclampsia. Published by Elsevier Ltd.

Blockade of anoctamin-1 in injured and uninjured nerves reduces neuropathic pain.

PubMed

García, Guadalupe; Martínez-Rojas, Vladimir A; Oviedo, Norma; Murbartián, Janet

2018-06-02

The aim of this study was to determine the participation of anoctamin-1 in 2 models of neuropathic pain in rats (L5/L6 spinal nerve ligation [SNL] and L5 spinal nerve transection [SNT]). SNL and SNT diminished withdrawal threshold in rats. Moreover, SNL up-regulated anoctamin-1 protein expression in injured L5 and uninjured L4 DRG whereas that it enhanced activating transcription factor 3 (ATF-3) and caspase-3 expression only in injured L5 DRG. In marked contrast, SNT enhanced ATF-3 and caspase-3, but not anoctamin-1, expression in injured L5 DRG but it did not modify anoctamin-1, ATF-3 nor caspase-3 expression in uninjured L4 DRG. Accordingly, repeated (3 times) intrathecal injection of the anoctamin-1 blocker T16A inh-A01 (0.1-1 µg) or MONNA (1-10 µg) partially reverted SNL-induced mechanical allodynia in a dose-dependent manner. In contrast, anoctamin-1 blockers only produced a modest effect in SNT-induced mechanical allodynia. Interestingly, intrathecal injection of T16A inh-A01 (1 µg) or MONNA (10 µg) prevented SNL-induced up-regulation of anoctamin-1, ATF-3 and caspase-3 in injured L5 DRG. Repeated intrathecal injection of T16A inh-A01 or MONNA also reduced SNT-induced up-regulation of ATF-3 in injured L5 DRG. In contrast, T16A inh-A01 and MONNA did not affect SNT-induced up-regulation of caspase-3 expression in L5 DRG. Likewise, gabapentin (100 µg) diminished SNL-induced up-regulation of anoctamin-1, ATF-3 and caspase-3 expression in injured L5 DRG. These data suggest that spinal anoctamin-1 in injured and uninjured DRG participates in the maintenance of neuropathic pain in rats. Our data also indicate that expression of anoctamin-1 in DRG is differentially regulated depending on the neuropathic pain model. Copyright © 2018. Published by Elsevier B.V.

Reciprocal Regulation of Reactive Oxygen Species and Phospho-CREB Regulates Voltage Gated Calcium Channel Expression during Mycobacterium tuberculosis Infection

PubMed Central

Selvakumar, Arti; Antony, Cecil; Singhal, Jhalak; Tiwari, Brijendra K.; Singh, Yogendra; Natarajan, Krishnamurthy

2014-01-01

Our previous work has demonstrated the roles played by L-type Voltage Gated Calcium Channels (VGCC) in regulating Mycobacterium tuberculosis (M. tb) survival and pathogenesis. Here we decipher mechanisms and pathways engaged by the pathogen to regulate VGCC expression in macrophages. We show that M. tb and its antigen Rv3416 use phospho-CREB (pCREB), Reactive Oxygen Species (ROS), Protein Kinase C (PKC) and Mitogen Activated Protein Kinase (MAPK) to modulate VGCC expression in macrophages. siRNA mediated knockdown of MyD88, IRAK1, IRAK2 or TRAF6 significantly inhibited antigen mediated VGCC expression. Inhibiting Protein Kinase C (PKC) or MEK-ERK1/2 further increased VGCC expression. Interestingly, inhibiting intracellular calcium release upregulated antigen mediated VGCC expression, while inhibiting extracellular calcium influx had no significant effect. siRNA mediated knockdown of transcription factors c-Jun, SOX5 and CREB significantly inhibited Rv3416 mediated VGCC expression. A dynamic reciprocal cross-regulation between ROS and pCREB was observed that in turn governed VGCC expression with ROS playing a limiting role in the process. Further dissection of the mechanisms such as the interplay between ROS and pCREB would improve our understanding of the regulation of VGCC expression during M. tb infection. PMID:24797940

Comprehensive analysis of lncRNAs microarray profile and mRNA-lncRNA co-expression in oncogenic HPV-positive cervical cancer cell lines.

PubMed

Yang, LingYun; Yi, Ke; Wang, HongJing; Zhao, YiQi; Xi, MingRong

2016-08-02

Long non-coding RNAs are emerging to be novel regulators in gene expression. In current study, lncRNAs microarray and lncRNA-mRNA co-expression analysis were performed to explore the alternation and function of lncRNAs in cervical cancer cells. We identified that 4750 lncRNAs (15.52%) were differentially expressed in SiHa (HPV-16 positive) (2127 up-regulated and 2623 down-regulated) compared with C-33A (HPV negative), while 5026 lncRNAs (16.43%) were differentially expressed in HeLa (HPV-18 positive) (2218 up-regulated and 2808 down-regulated) respectively. There were 5008 mRNAs differentially expressed in SiHa and 4993 in HeLa, which were all cataloged by GO terms and KEGG pathway. With the help of mRNA-lncRNA co-expression network, we found that ENST00000503812 was significantly negative correlated with RAD51B and IL-28A expression in SiHa, while ENST00000420168, ENST00000564977 and TCONS_00010232 had significant correlation with FOXQ1 and CASP3 expression in HeLa. Up-regulation of ENST00000503812 may inhibit RAD51B and IL-28A expression and result in deficiency of DNA repair pathway and immune responses in HPV-16 positive cervical cancer cell. Up-regulation of ENST00000420168, ENST00000564977 and down-regulation of TCONS_00010232 might stimulate FOXQ1 expression and suppress CASP3 expression in HPV-18 positive cervical cancer cell, which lead to HPV-induced proliferation and deficiency in apoptosis. These results indicate that changes of lncRNAs and related mRNAs might impact on several cellular pathways and involve in HPV-induced proliferation, which enriches our understanding of lncRNAs and coding transcripts anticipated in HPV oncogenesis of cervical cancer.

Identification of miR-185 as a regulator of de novo cholesterol biosynthesis and low density lipoprotein uptake

PubMed Central

Yang, Muhua; Liu, Weidong; Pellicane, Christina; Sahyoun, Christine; Joseph, Biny K.; Gallo-Ebert, Christina; Donigan, Melissa; Pandya, Devanshi; Giordano, Caroline; Bata, Adam; Nickels, Joseph T.

2014-01-01

Dysregulation of cholesterol homeostasis is associated with various metabolic diseases, including atherosclerosis and type 2 diabetes. The sterol response element binding protein (SREBP)-2 transcription factor induces the expression of genes involved in de novo cholesterol biosynthesis and low density lipoprotein (LDL) uptake, thus it plays a crucial role in maintaining cholesterol homeostasis. Here, we found that overexpressing microRNA (miR)-185 in HepG2 cells repressed SREBP-2 expression and protein level. miR-185-directed inhibition caused decreased SREBP-2-dependent gene expression, LDL uptake, and HMG-CoA reductase activity. In addition, we found that miR-185 expression was tightly regulated by SREBP-1c, through its binding to a single sterol response element in the miR-185 promoter. Moreover, we found that miR-185 expression levels were elevated in mice fed a high-fat diet, and this increase correlated with an increase in total cholesterol level and a decrease in SREBP-2 expression and protein. Finally, we found that individuals with high cholesterol had a 5-fold increase in serum miR-185 expression compared with control individuals. Thus, miR-185 controls cholesterol homeostasis through regulating SREBP-2 expression and activity. In turn, SREBP-1c regulates miR-185 expression through a complex cholesterol-responsive feedback loop. Thus, a novel axis regulating cholesterol homeostasis exists that exploits miR-185-dependent regulation of SREBP-2 and requires SREBP-1c for function. PMID:24296663

Microarray analysis of thyroid stimulating hormone, insulin-like growth factor-1, and insulin-induced gene expression in FRTL-5 thyroid cells.

PubMed

Lee, You Jin; Park, Do Joon; Shin, Chan Soo; Park, Kyong Soo; Kim, Seong Yeon; Lee, Hong Kyu; Park, Young Joo; Cho, Bo Youn

2007-10-01

To determine which genes are regulated by thyroid stimulating hormone (thyrotropin, TSH), insulin and insulin-like growth factor-1 (IGF-1) in the rat thyroid, we used the microarray technology and observed the changes in gene expression. The expressions of genes for bone morphogenetic protein 6, the glucagon receptor, and cyclin D1 were increased by both TSH and IGF-1; for cytochrome P450, 2c37, the expression was decreased by both. Genes for cholecystokinin, glucuronidase, beta, demethyl-Q 7, and cytochrome c oxidase, subunit VIIIa, were up-regulated; the genes for ribosomal protein L37 and ribosomal protein L4 were down-regulated by TSH and insulin. However, there was no gene observed to be regulated by all three: TSH, IGF-1, and insulin molecules studied. These findings suggest that TSH, IGF-1, and insulin stimulate different signal pathways, which can interact with one another to regulate the proliferation of thyrocytes, and thereby provide additional influence on the process of cellular proliferation.

Microarray Analysis of Thyroid Stimulating Hormone, Insulin-Like Growth Factor-1, and Insulin-Induced Gene Expression in FRTL-5 Thyroid Cells

PubMed Central

Lee, You Jin; Park, Do Joon; Shin, Chan Soo; Park, Kyong Soo; Kim, Seong Yeon; Lee, Hong Kyu; Cho, Bo Youn

2007-01-01

To determine which genes are regulated by thyroid stimulating hormone (thyrotropin, TSH), insulin and insulin-like growth factor-1 (IGF-1) in the rat thyroid, we used the microarray technology and observed the changes in gene expression. The expressions of genes for bone morphogenetic protein 6, the glucagon receptor, and cyclin D1 were increased by both TSH and IGF-1; for cytochrome P450, 2c37, the expression was decreased by both. Genes for cholecystokinin, glucuronidase, beta, demethyl-Q 7, and cytochrome c oxidase, subunit VIIIa, were up-regulated; the genes for ribosomal protein L37 and ribosomal protein L4 were down-regulated by TSH and insulin. However, there was no gene observed to be regulated by all three: TSH, IGF-1, and insulin molecules studied. These findings suggest that TSH, IGF-1, and insulin stimulate different signal pathways, which can interact with one another to regulate the proliferation of thyrocytes, and thereby provide additional influence on the process of cellular proliferation. PMID:17982240

Gill structural integrity changes in fish deficient or excessive in dietary isoleucine: Towards the modulation of tight junction protein, inflammation, apoptosis and antioxidant defense via NF-κB, TOR and Nrf2 signaling pathways.

PubMed

Feng, Lin; Gan, Lu; Jiang, Wei-Dan; Wu, Pei; Liu, Yang; Jiang, Jun; Tang, Ling; Kuang, Sheng-Yao; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu

2017-04-01

This study firstly aimed to test the impact of dietary isoleucine (Ile) on tight junction protein, inflammation, apoptosis, antioxidant defense and related signaling molecule gene expression in the gill of fish. Young grass carp (Ctenopharyngodon idella) (weighing 256.8 ± 3.5 g) were fed six diets containing graded levels of Ile, namely, 3.8, 6.6, 9.3, 12.5, 15.2 and 18.5 g/kg diet for 8 weeks. The results firstly revealed that Ile deficiency down-regulated the mRNA expressions of claudin-3, claudin-b, claudin-c, occludin and zonula occludens-1 (ZO-1) and up-regulated the mRNA expression of claudin-12, which led to the intercellular structure damage of fish gill. These effects were partially ascribed to the up-regulation of pro-inflammatory cytokines [interleukin 1β (IL-1β), interleukin 8 (IL-8) and tumor necrosis factor-α (TNF-α)] mRNA expressions that referring to up-regulated nuclear factor κB P65 (NF-κB P65) mRNA expression and down-regulated inhibitor factor κBα (IκBα) mRNA expression, and the down-regulation of anti-inflammatory cytokines [interleukin 10 (IL-10) and transforming growth factor β1 (TGF-β1)] mRNA expressions that referring to the down-regulated TOR and S6K1 mRNA expression. Interestingly, no change in claudin 15 mRNA level was observed among every treatment. At the same time, the results firstly indicated that Ile deficiency also resulted in the cellular structure damage of fish gill: (1) DNA fragmentation partially due to the up-regulation of caspase-3, caspase-8 and caspase-9 mRNA expression; (2) increase in protein carbonyl (PC), malondialdehyde (MDA) and ROS contents, which may be partially attributed to the impaired antioxidant defense [indicated by decreased glutathione (GSH) level and depressed anti-superoxide anion (ASA), anti-hydroxyl radical (a-HR), copper/zinc superoxide dismutase (Cu/Zn-SOD), catalase (CAT) and glutathione peroxidase (GPx) activities] that referring to the down-regulation of corresponding antioxidant enzyme mRNA expressions and the related signaling molecules Nrf2 mRNA expression. Ile excess caused similar negative effects that observed in Ile-deficient group, whereas these negative effects were reversed with appropriate Ile supplementation. In conclusion, our results indicated that Ile deficiency or excess disrupted the structural integrity of fish gill, partially due to the trigger of apoptosis, the impairment of antioxidant defense, and the regulation of tight junction protein, inflammatory cytokines, apoptosis-related, antioxidant enzymes and related signaling molecules mRNA expressions in the fish gill. Copyright © 2017 Elsevier Ltd. All rights reserved.

Differential regulation of CD44 expression by lipopolysaccharide (LPS) and TNF-alpha in human monocytic cells: distinct involvement of c-Jun N-terminal kinase in LPS-induced CD44 expression.

PubMed

Gee, Katrina; Lim, Wilfred; Ma, Wei; Nandan, Devki; Diaz-Mitoma, Francisco; Kozlowski, Maya; Kumar, Ashok

2002-11-15

Alterations in the regulation of CD44 expression play a critical role in modulating cell adhesion, migration, and inflammation. LPS, a bacterial cell wall component, regulates CD44 expression and may modulate CD44-mediated biological effects in monocytic cells during inflammation and immune responses. In this study, we show that in normal human monocytes, LPS and LPS-induced cytokines IL-10 and TNF-alpha enhance CD44 expression. To delineate the mechanism underlying LPS-induced CD44 expression, we investigated the role of the mitogen-activated protein kinases (MAPKs), p38, p42/44 extracellular signal-regulated kinase, and c-Jun N-terminal kinase (JNK) by using their specific inhibitors. We demonstrate the involvement, at least in part, of p38 MAPK in TNF-alpha-induced CD44 expression in both monocytes and promonocytic THP-1 cells. However, neither p38 nor p42/44 MAPKs were involved in IL-10-induced CD44 expression in monocytes. To further dissect the TNF-alpha and LPS-induced signaling pathways regulating CD44 expression independent of IL-10-mediated effects, we used IL-10 refractory THP-1 cells as a model system. Herein, we show that CD44 expression induced by the LPS-mediated pathway predominantly involved JNK activation. This conclusion was based on results derived by transfection of THP-1 cells with a dominant-negative mutant of stress-activated protein/extracellular signal-regulated kinase kinase 1, and by exposure of cells to JNK inhibitors dexamethasone and SP600125. All these treatments prevented CD44 induction in LPS-stimulated, but not in TNF-alpha-stimulated, THP-1 cells. Furthermore, we show that CD44 induction may involve JNK-dependent early growth response gene activation in LPS-stimulated monocytic cells. Taken together, these results suggest a predominant role of JNK in LPS-induced CD44 expression in monocytic cells.

ERECTA signaling controls Arabidopsis inflorescence architecture through chromatin-mediated activation of PRE1 expression.

PubMed

Cai, Hanyang; Zhao, Lihua; Wang, Lulu; Zhang, Man; Su, Zhenxia; Cheng, Yan; Zhao, Heming; Qin, Yuan

2017-06-01

Flowering plants display a remarkable diversity in inflorescence architecture, and pedicel length is one of the key contributors to this diversity. In Arabidopsis thaliana, the receptor-like kinase ERECTA (ER) mediated signaling pathway plays important roles in regulating inflorescence architecture by promoting cell proliferation. However, the regulating mechanism remains elusive in the pedicel. Genetic interactions between ERECTA signaling and the chromatin remodeling complex SWR1 in the control of inflorescence architecture were studied. Comparative transcriptome analysis was applied to identify downstream components. Chromatin immunoprecipitation and nucleosome occupancy was further investigated. The results indicated that the chromatin remodeler SWR1 coordinates with ERECTA signaling in regulating inflorescence architecture by activating the expression of PRE1 family genes and promoting pedicel elongation. It was found that SWR1 is required for the incorporation of the H2A.Z histone variant into nucleosomes of the whole PRE1 gene family and the ERECTA controlled expression of PRE1 gene family through regulating nucleosome dynamics. We propose that utilization of a chromatin remodeling complex to regulate gene expression is a common theme in developmental control across kingdoms. These findings shed light on the mechanisms through which chromatin remodelers orchestrate complex transcriptional regulation of gene expression in coordination with a developmental cue. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

AP-1-mediated chromatin looping regulates ZEB2 transcription: new insights into TNFα-induced epithelial-mesenchymal transition in triple-negative breast cancer.

PubMed

Qiao, Yichun; Shiue, Chiou-Nan; Zhu, Jian; Zhuang, Ting; Jonsson, Philip; Wright, Anthony P H; Zhao, Chunyan; Dahlman-Wright, Karin

2015-04-10

The molecular determinants of malignant cell behaviour in triple-negative breast cancer (TNBC) are poorly understood. Recent studies have shown that regulators of epithelial-mesenchymal transition (EMT) are potential therapeutic targets for TNBC. In this study, we demonstrate that the inflammatory cytokine TNFα induces EMT in TNBC cells via activation of AP-1 signaling and subsequently induces expression of the EMT regulator ZEB2. We also show that TNFα activates both the PI3K/Akt and MAPK/ERK pathways, which act upstream of AP-1. We further investigated in detail AP-1 regulation of ZEB2 expression. We show that two ZEB2 transcripts derived from distinct promoters are both expressed in breast cancer cell lines and breast tumor samples. Using the chromosome conformation capture assay, we demonstrate that AP-1, when activated by TNFα, binds to a site in promoter 1b of the ZEB2 gene where it regulates the expression of both promoter 1b and 1a, the latter via mediating long range chromatin interactions. Overall, this work provides a plausible mechanism for inflammation-induced metastatic potential in TNBC, involving a novel regulatory mechanism governing ZEB2 isoform expression.

AP-1-mediated chromatin looping regulates ZEB2 transcription: new insights into TNFα-induced epithelial–mesenchymal transition in triple-negative breast cancer

PubMed Central

Qiao, Yichun; Shiue, Chiou-Nan; Zhu, Jian; Zhuang, Ting; Jonsson, Philip; Wright, Anthony P.H.; Zhao, Chunyan; Dahlman-Wright, Karin

2015-01-01

The molecular determinants of malignant cell behaviour in triple-negative breast cancer (TNBC) are poorly understood. Recent studies have shown that regulators of epithelial-mesenchymal transition (EMT) are potential therapeutic targets for TNBC. In this study, we demonstrate that the inflammatory cytokine TNFα induces EMT in TNBC cells via activation of AP-1 signaling and subsequently induces expression of the EMT regulator ZEB2. We also show that TNFα activates both the PI3K/Akt and MAPK/ERK pathways, which act upstream of AP-1. We further investigated in detail AP-1 regulation of ZEB2 expression. We show that two ZEB2 transcripts derived from distinct promoters are both expressed in breast cancer cell lines and breast tumor samples. Using the chromosome conformation capture assay, we demonstrate that AP-1, when activated by TNFα, binds to a site in promoter 1b of the ZEB2 gene where it regulates the expression of both promoter 1b and 1a, the latter via mediating long range chromatin interactions. Overall, this work provides a plausible mechanism for inflammation-induced metastatic potential in TNBC, involving a novel regulatory mechanism governing ZEB2 isoform expression. PMID:25762639

A Phosphatidylinositol 3-kinase-regulated Akt-independent signaling promotes cigarette smoke-induced FRA-1 expression.

PubMed

Zhang, Qin; Adiseshaiah, Pavan; Kalvakolanu, Dhananjaya V; Reddy, Sekhar P

2006-04-14

The FRA-1 proto-oncogene is overexpressed in a variety of human tumors and is known to up-regulate the expression of genes involved in tumor progression and invasion. The phosphatidylinositol 3-kinase (PI3K)-Akt pathway is also known to regulate these cellular processes. More importantly, respiratory toxicants and carcinogens activate both the PI3K-Akt pathway and FRA-1 expression in human bronchial epithelial (HBE) cells. In this study we investigated a potential link between the PI3K-Akt pathway and the cigarette smoke (CS)-stimulated epidermal growth factor receptor-mediated FRA-1 induction in non-oncogenic HBE cells. Treatment of cells with LY294002, an inhibitor of the PI3K-Akt pathway, completely blocked CS-induced FRA-1 expression. Surprisingly pharmacological inhibition of Akt had no significant effect on CS-induced FRA-1 expression. Likewise the inhibition of protein kinase C zeta, which is a known downstream effector of PI3K, did not alter FRA-1 expression. We found that the PI3K through p21-activated kinase 1 regulates FRA-1 proto-oncogene induction by CS and the subsequent activation of the Elk1 and cAMP-response element-binding protein transcription factors that are bound to the promoter in HBE cells.

Interferon-γ biphasically regulates angiotensinogen expression via a JAK-STAT pathway and suppressor of cytokine signaling 1 (SOCS1) in renal proximal tubular cells

PubMed Central

Satou, Ryousuke; Miyata, Kayoko; Gonzalez-Villalobos, Romer A.; Ingelfinger, Julie R.; Navar, L. Gabriel; Kobori, Hiroyuki

2012-01-01

Renal inflammation modulates angiotensinogen (AGT) production in renal proximal tubular cells (RPTCs) via inflammatory cytokines, including interleukin-6, tumor necrosis factor α, and interferon-γ (IFN-γ). Among these, the effects of IFN-γ on AGT regulation in RPTCs are incompletely delineated. This study aimed to elucidate mechanisms by which IFN-γ regulates AGT expression in RPTCs. RPTCs were incubated with or without IFN-γ up to 48 h. AGT expression, STAT1 and STAT3 activities, and SOCS1 expression were evaluated. RNA interference studies against STAT1, SOCS1, and STAT3 were performed to elucidate a signaling cascade. IFN-γ decreased AGT expression at 6 h (0.61±0.05, ratio to control) and 12 h (0.47±0.03). In contrast, longer exposure for 24 and 48 h increased AGT expression (1.76±0.18, EC50=3.4 ng/ml, and 1.45±0.08, respectively). IFN-γ treatment for 6 h strongly induced STAT1 phosphorylation and SOCS1 augmentation, and decreased STAT3 activity. However, STAT1 phosphorylation and SOCS1 augmentation waned at 24 h, while STAT3 activity increased. RNA interference studies revealed that activation of STAT1-SOCS1 axis decreased STAT3 activity. Thus, IFN-γ biphasically regulates AGT expression in RPTCs via STAT3 activity modulated by STAT1-SOCS1 axis, suggesting the STAT1-SOCS1 axis is important in IFN-γ-induced activation of the intrarenal renin-angiotensin system.—Satou, R., Miyata, K., Gonzalez-Villalobos, R. A., Ingelfinger, J. R., Navar, L. G., Kobori, H. Interferon-γ biphasically regulates angiotensinogen expression via a JAK-STAT pathway and suppressor of cytokine signaling 1 (SOCS1) in renal proximal tubular cells. PMID:22302831

Investigating the Control of Chlorophyll Degradation by Genomic Correlation Mining.

PubMed

Ghandchi, Frederick P; Caetano-Anolles, Gustavo; Clough, Steven J; Ort, Donald R

2016-01-01

Chlorophyll degradation is an intricate process that is critical in a variety of plant tissues at different times during the plant life cycle. Many of the photoactive chlorophyll degradation intermediates are exceptionally cytotoxic necessitating that the pathway be carefully coordinated and regulated. The primary regulatory step in the chlorophyll degradation pathway involves the enzyme pheophorbide a oxygenase (PAO), which oxidizes the chlorophyll intermediate pheophorbide a, that is eventually converted to non-fluorescent chlorophyll catabolites. There is evidence that PAO is differentially regulated across different environmental and developmental conditions with both transcriptional and post-transcriptional components, but the involved regulatory elements are uncertain or unknown. We hypothesized that transcription factors modulate PAO expression across different environmental conditions, such as cold and drought, as well as during developmental transitions to leaf senescence and maturation of green seeds. To test these hypotheses, several sets of Arabidopsis genomic and bioinformatic experiments were investigated and re-analyzed using computational approaches. PAO expression was compared across varied environmental conditions in the three separate datasets using regression modeling and correlation mining to identify gene elements co-expressed with PAO. Their functions were investigated as candidate upstream transcription factors or other regulatory elements that may regulate PAO expression. PAO transcript expression was found to be significantly up-regulated in warm conditions, during leaf senescence, and in drought conditions, and in all three conditions significantly positively correlated with expression of transcription factor Arabidopsis thaliana activating factor 1 (ATAF1), suggesting that ATAF1 is triggered in the plant response to these processes or abiotic stresses and in result up-regulates PAO expression. The proposed regulatory network includes the freezing, senescence, and drought stresses modulating factor ATAF1 and various other transcription factors and pathways, which in turn act to regulate chlorophyll degradation by up-regulating PAO expression.

Specificity protein 1 regulates topoisomerase IIβ expression in SH-SY5Y cells during neuronal differentiation.

PubMed

Guo, Hui; Cao, Cuili; Chi, Xueqian; Zhao, Junxia; Liu, Xia; Zhou, Najing; Han, Shuo; Yan, Yongxin; Wang, Yanling; Xu, Yannan; Yan, Yunli; Cui, Huixian; Sun, Hongxia

2014-10-01

Topoisomerase IIβ (top IIβ) is a nuclear enzyme with an essential role in neural development. The regulation of top IIβ gene expression during neural differentiation is poorly understood. Functional analysis of top IIβ gene structure displayed a GC box sequence in its transcription promoter, which binds the nuclear transcription factor specificity protein 1 (Sp1). Sp1 regulates gene expression via multiple mechanisms and is essential for early embryonic development. This study seeks to determine whether Sp1 regulates top IIβ gene expression during neuronal differentiation. For this purpose, human neuroblastoma SH-SY5Y cells were induced to neuronal differentiation in the presence of all-trans retinoic acid (RA) for 5 days. After incubation with 10 μM RA for 3-5 days, a majority of the cells exited the cell cycle to become postmitotic neurons, characterized by the presence of longer neurite outgrowths and expression of the neuronal marker microtubule-associated protein-2 (MAP2). Elevated Sp1 and top IIβ mRNA and protein levels were detected and found to be positively correlated with the differentiation stage. Chromatin immunoprecipitation assay demonstrated an increased recruitment of Sp1 to the top IIβ promoter after RA treatment. Mithramycin A, a compound that interferes with Sp1 binding to GC-rich DNA sequences, downregulated the expression of top IIβ, resulting in reduced expression of MAP2 and decreased neurite length compared with the control group. Our results indicate that Sp1 regulates top IIβ expression by binding to the GC box of the gene promoter during neuronal differentiation in SH-SY5Y cells. © 2014 Wiley Periodicals, Inc.

Expression of NUCB2/nesfatin-1 in the taste buds of rats.

PubMed

Cao, Xun; Zhou, Xiao; Cao, Yang; Liu, Xiao-Min; Zhou, Li-Hong

2016-01-01

Nesfatin-1, an anorexigenic peptide derived from nucleobindin 2 (NUCB2), is closely involved in feeding behavior, glycometabolism, and satiety regulation. Some studies show that NUCB2/nesfatin-1 is highly expressed and interacts with many appetite-regulating peptides that are co-expressed in the gastrointestinal tract. However, it remains unclear whether nesfatin-1 is expressed and interacts similarly in taste buds. Glucagon-like peptide-1 (GLP-1), a well-known appetite down-regulating peptide, is associated with changes in the expression of nesfatin-1. Therefore, we measured the expression of the NUCB2 gene and the distribution of nesfatin-1-immunoreactive cells and investigated whether these variables change in taste buds of circumvallate papillae (CV) from rats with type 2 diabetes (T2DM) after treatment with liraglutide, a GLP-1 receptor agonist. The results showed that nesfatin-1 immunoreactive cells were localized in the taste buds of rat CV. Quantitative RT-PCR showed a significantly lower expression of NUCB2 mRNA in the taste buds of diabetic control rats (T2DM-C) than in those of the normal control group (NC) and a higher level of NUCB2 in the liraglutide treated group (T2DM + LIR) than either the T2DM-C or the NC groups. Changes in the expression of NUCB2 in the rat hypothalamus were opposite to those in CV taste buds. In summary, we found that rat CV taste buds express NUCB2/nesfatin-1, and that this expression decreases significantly in T2DM and increases after treatment with liraglutide in rat CV. This indicates that nesfatin-1 could be an important factor in the regulation of gustatory function, feeding and perhaps energy homeostasis.

Interaction of KLF6 and Sp1 regulates basigin-2 expression mediated proliferation, invasion and metastasis in hepatocellular carcinoma

PubMed Central

Dong, Ya-Lu; Zhang, Jing; Wang, Yong-Qiang; Liu, Lili; Zhang, He-Long; Huang, Jian-Guo; Liao, Cheng-Gong

2016-01-01

Accumulating evidence suggests that the tumor suppressor gene Krüppel-like factor 6 (KLF6) plays important roles in both development and progression of cancer. However, the role of KLF6 in hepatocellular carcinoma (HCC) remains unclear. Cancer-related molecule basigin-2 plays an important role in HCC progression and metastasis. Sp1, one of Sp/KLFs family members, regulates basigin-2 expression in HCC. The involvement of KLFs in basigin-2 regulation and HCC progression and metastasis has not been investigated. We first measured KLF6 expression levels in 50 pairs of HCC and adjacent normal tissues (ANTs) by immunohistochemistry. Specifically, low KLF6 expression but high Sp1 and basigin-2 expression were found in HCC tissues. By contrast, the ANTs showed high KLF6 expression but low Sp1 and basigin-2 expression. Kaplan–Meier analysis showed that higher expression of KLF6 was associated with better overall survival. The survival rate of KLF6-negative patients was lower than that of KLF6-positive patients (P = 0.015). We also found that KLF6 binds to the basigin-2 and Sp1 promoters and decreases their expression. Thus, we identified a microcircuitry mechanism in which KLF6 can repress basigin-2 expression directly by binding to its promoter or indirectly by inhibiting the expression of the transcription factor Sp1 to block gene expression. Additionally, overexpression of KLF6 suppressed the invasion, metastasis and proliferation of HCC cells in vitro and in vivo by targeting basigin-2. Our study provides new evidence that interaction of KLF6 and Sp1 regulates basigin-2 expression in HCC and that KLF6 represses the invasive and metastatic capacities of HCC through basigin-2. PMID:27057625

Feeding State, Insulin and NPR-1 Modulate Chemoreceptor Gene Expression via Integration of Sensory and Circuit Inputs

PubMed Central

Gruner, Matthew; Nelson, Dru; Winbush, Ari; Hintz, Rebecca; Ryu, Leesun; Chung, Samuel H.; Kim, Kyuhyung; Gabel, Chrisopher V.; van der Linden, Alexander M.

2014-01-01

Feeding state and food availability can dramatically alter an animals' sensory response to chemicals in its environment. Dynamic changes in the expression of chemoreceptor genes may underlie some of these food and state-dependent changes in chemosensory behavior, but the mechanisms underlying these expression changes are unknown. Here, we identified a KIN-29 (SIK)-dependent chemoreceptor, srh-234, in C. elegans whose expression in the ADL sensory neuron type is regulated by integration of sensory and internal feeding state signals. We show that in addition to KIN-29, signaling is mediated by the DAF-2 insulin-like receptor, OCR-2 TRPV channel, and NPR-1 neuropeptide receptor. Cell-specific rescue experiments suggest that DAF-2 and OCR-2 act in ADL, while NPR-1 acts in the RMG interneurons. NPR-1-mediated regulation of srh-234 is dependent on gap-junctions, implying that circuit inputs regulate the expression of chemoreceptor genes in sensory neurons. Using physical and genetic manipulation of ADL neurons, we show that sensory inputs from food presence and ADL neural output regulate srh-234 expression. While KIN-29 and DAF-2 act primarily via the MEF-2 (MEF2) and DAF-16 (FOXO) transcription factors to regulate srh-234 expression in ADL neurons, OCR-2 and NPR-1 likely act via a calcium-dependent but MEF-2- and DAF-16-independent pathway. Together, our results suggest that sensory- and circuit-mediated regulation of chemoreceptor genes via multiple pathways may allow animals to precisely regulate and fine-tune their chemosensory responses as a function of internal and external conditions. PMID:25357003

Egr-1: A Candidate Transcription Factor Involved in Molecular Processes Underlying Time-Memory.

PubMed

Shah, Aridni; Jain, Rikesh; Brockmann, Axel

2018-01-01

In honey bees, continuous foraging is accompanied by a sustained up-regulation of the immediate early gene Egr-1 (early growth response protein-1) and candidate downstream genes involved in learning and memory. Here, we present a series of feeder training experiments indicating that Egr-1 expression is highly correlated with the time and duration of training even in the absence of the food reward. Foragers that were trained to visit a feeder over the whole day and then collected on a day without food presentation showed Egr-1 up-regulation over the whole day with a peak expression around 14:00. When exposed to a time-restricted feeder presentation, either 2 h in the morning or 2 h in the evening, Egr-1 expression in the brain was up-regulated only during the hours of training. Foragers that visited a feeder in the morning as well as in the evening showed two peaks of Egr-1 expression. Finally, when we prevented time-trained foragers from leaving the colony using artificial rain, Egr-1 expression in the brains was still slightly but significantly up-regulated around the time of feeder training. In situ hybridization studies showed that active foraging and time-training induced Egr-1 up-regulation occurred in the same brain areas, preferentially the small Kenyon cells of the mushroom bodies and the antennal and optic lobes. Based on these findings we propose that foraging induced Egr-1 expression can get regulated by the circadian clock after time-training over several days and Egr-1 is a candidate transcription factor involved in molecular processes underlying time-memory.

Quantitative Proteomics Reveals the Regulatory Networks of Circular RNA CDR1as in Hepatocellular Carcinoma Cells.

PubMed

Yang, Xue; Xiong, Qian; Wu, Ying; Li, Siting; Ge, Feng

2017-10-06

Circular RNAs (circRNAs), a class of widespread endogenous RNAs, play crucial roles in diverse biological processes and are potential biomarkers in diverse human diseases and cancers. Cerebellar-degeneration-related protein 1 antisense RNA (CDR1as), an oncogenic circRNA, is involved in human tumorigenesis and is dysregulated in hepatocellular carcinoma (HCC). However, the molecular mechanisms underlying CDR1as functions in HCC remain unclear. Here we explored the functions of CDR1as and searched for CDR1as-regulated proteins in HCC cells. A quantitative proteomics strategy was employed to globally identify CDR1as-regulated proteins in HCC cells. In total, we identified 330 differentially expressed proteins (DEPs) upon enhanced CDR1as expression in HepG2 cells, indicating that they could be proteins regulated by CDR1as. Bioinformatic analysis revealed that many DEPs were involved in cell proliferation and the cell cycle. Further functional studies of epidermal growth factor receptor (EGFR) found that CDR1as exerts its effects on cell proliferation at least in part through the regulation of EGFR expression. We further confirmed that CDR1as could inhibit the expression of microRNA-7 (miR-7). EGFR is a validated target of miR-7; therefore, CDR1as may exert its function by regulating EGFR expression via targeting miR-7 in HCC cells. Taken together, we revealed novel functions and underlying mechanisms of CDR1as in HCC cells. This study serves as the first proteome-wide analysis of a circRNA-regulated protein in cells and provides a reliable and highly efficient method for globally identifying circRNA-regulated proteins.

[Endoplasmic reticulum stress in INS-1-3 cell associated with the expression changes of MODY gene pathway].

PubMed

Liu, Y T; Li, S R; Wang, Z; Xiao, J Z

2016-09-13

Objective: To profile the gene expression changes associated with endoplasmic reticulum stress in INS-1-3 cells induced by thapsigargin (TG) and tunicamycin (TM). Methods: Normal cultured INS-1-3 cells were used as a control. TG and TM were used to induce endoplasmic reticulum stress in INS-1-3 cells. Digital gene expression profiling technique was used to detect differentially expressed gene. The changes of gene expression were detected by expression pattern clustering analysis, gene ontology (GO) function and pathway enrichment analysis. Real time polymerase chain reaction (RT-PCR) was used to verify the key changes of gene expression. Results: Compared with the control group, there were 57 (45 up-regulated, 12 down-regulated) and 135 (99 up-regulated, 36 down-regulated) differentially expressed genes in TG and TM group, respectively. GO function enrichment analyses indicated that the main enrichment was in the endoplasmic reticulum. In signaling pathway analysis, the identified pathways were related with endoplasmic reticulum stress, antigen processing and presentation, protein export, and most of all, the maturity onset diabetes of the young (MODY) pathway. Conclusion: Under the condition of endoplasmic reticulum stress, the related expression changes of transcriptional factors in MODY signaling pathway may be related with the impaired function in islet beta cells.

Nucleo-cytoplasmic shuttling dynamics of the transcriptional regulators XYR1 and CRE1 under conditions of cellulase and xylanase gene expression in Trichoderma reesei

PubMed Central

Lichius, Alexander; Seidl-Seiboth, Verena; Seiboth, Bernhard; Kubicek, Christian P

2014-01-01

Trichoderma reesei is a model for investigating the regulation of (hemi-)cellulase gene expression. Cellulases are formed adaptively, and the transcriptional activator XYR1 and the carbon catabolite repressor CRE1 are main regulators of their expression. We quantified the nucleo-cytoplasmic shuttling dynamics of GFP-fusion proteins of both transcription factors under cellulase and xylanase inducing conditions, and correlated their nuclear presence/absence with transcriptional changes. We also compared their subcellular localization in conidial germlings and mature hyphae. We show that cellulase gene expression requires de novo biosynthesis of XYR1 and its simultaneous nuclear import, whereas carbon catabolite repression is regulated through preformed CRE1 imported from the cytoplasmic pool. Termination of induction immediately stopped cellulase gene transcription and was accompanied by rapid nuclear degradation of XYR1. In contrast, nuclear CRE1 rapidly decreased upon glucose depletion, and became recycled into the cytoplasm. In mature hyphae, nuclei containing activated XYR1 were concentrated in the colony center, indicating that this is the main region of XYR1 synthesis and cellulase transcription. CRE1 was found to be evenly distributed throughout the entire mycelium. Taken together, our data revealed novel aspects of the dynamic shuttling and spatial bias of the major regulator of (hemi-)cellulase gene expression, XYR1, in T. reesei. PMID:25302561

Rice ABI5-Like1 Regulates Abscisic Acid and Auxin Responses by Affecting the Expression of ABRE-Containing Genes1[W][OA

PubMed Central

Yang, Xi; Yang, Ya-Nan; Xue, Liang-Jiao; Zou, Mei-Juan; Liu, Jian-Ying; Chen, Fan; Xue, Hong-Wei

2011-01-01

Abscisic acid (ABA) regulates plant development and is crucial for plant responses to biotic and abiotic stresses. Studies have identified the key components of ABA signaling in Arabidopsis (Arabidopsis thaliana), some of which regulate ABA responses by the transcriptional regulation of downstream genes. Here, we report the functional identification of rice (Oryza sativa) ABI5-Like1 (ABL1), which is a basic region/leucine zipper motif transcription factor. ABL1 is expressed in various tissues and is induced by the hormones ABA and indole-3-acetic acid and stress conditions including salinity, drought, and osmotic pressure. The ABL1 deficiency mutant, abl1, shows suppressed ABA responses, and ABL1 expression in the Arabidopsis abi5 mutant rescued the ABA sensitivity. The ABL1 protein is localized to the nucleus and can directly bind ABA-responsive elements (ABREs; G-box) in vitro. A gene expression analysis by DNA chip hybridization confirms that a large proportion of down-regulated genes of abl1 are involved in stress responses, consistent with the transcriptional activating effects of ABL1. Further studies indicate that ABL1 regulates the plant stress responses by regulating a series of ABRE-containing WRKY family genes. In addition, the abl1 mutant is hypersensitive to exogenous indole-3-acetic acid, and some ABRE-containing genes related to auxin metabolism or signaling are altered under ABL1 deficiency, suggesting that ABL1 modulates ABA and auxin responses by directly regulating the ABRE-containing genes. PMID:21546455

Comprehensive gene expression analysis of rice aleurone cells: probing the existence of an alternative gibberellin receptor.

PubMed

Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto

2015-02-01

Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. © 2015 American Society of Plant Biologists. All Rights Reserved.

Akt1 Controls the Timing and Amplitude of Vascular Circadian Gene Expression

PubMed Central

Luciano, Amelia K.; Santana, Jeans M.; Velazquez, Heino; Sessa, William C.

2017-01-01

The AKT signaling pathway is important for circadian rhythms in mammals and flies (Drosophila). However, AKT signaling in mammals is more complicated since there are 3 isoforms of AKT, each performing slightly different functions. Here we study the most ubiquitous AKT isoform, Akt1, and its role at the organismal level in the central and vascular peripheral clocks. Akt1−/− mice exhibit relatively normal behavioral rhythms with only minor differences in circadian gene expression in the liver and heart. However, circadian gene expression in the Akt1−/− aorta, compared with control aorta, follows a distinct pattern. In the Akt1−/− aorta, positive regulators of circadian transcription have lower amplitude rhythms and peak earlier in the day, and negative circadian regulators are expressed at higher amplitudes and peak later in the day. In endothelial cells, negative circadian regulators exhibit an increased amplitude of expression, while the positive circadian regulators are arrhythmic with a decreased amplitude of expression. This indicates that Akt1 conditions the normal circadian rhythm in the vasculature more so than in other peripheral tissues where other AKT isoforms or kinases might be important for daily rhythms. PMID:28452287

Akt1 Controls the Timing and Amplitude of Vascular Circadian Gene Expression.

PubMed

Luciano, Amelia K; Santana, Jeans M; Velazquez, Heino; Sessa, William C

2017-06-01

The AKT signaling pathway is important for circadian rhythms in mammals and flies ( Drosophila). However, AKT signaling in mammals is more complicated since there are 3 isoforms of AKT, each performing slightly different functions. Here we study the most ubiquitous AKT isoform, Akt1, and its role at the organismal level in the central and vascular peripheral clocks. Akt1 -/- mice exhibit relatively normal behavioral rhythms with only minor differences in circadian gene expression in the liver and heart. However, circadian gene expression in the Akt1 -/- aorta, compared with control aorta, follows a distinct pattern. In the Akt1 -/- aorta, positive regulators of circadian transcription have lower amplitude rhythms and peak earlier in the day, and negative circadian regulators are expressed at higher amplitudes and peak later in the day. In endothelial cells, negative circadian regulators exhibit an increased amplitude of expression, while the positive circadian regulators are arrhythmic with a decreased amplitude of expression. This indicates that Akt1 conditions the normal circadian rhythm in the vasculature more so than in other peripheral tissues where other AKT isoforms or kinases might be important for daily rhythms.

Chromatin looping defines expression of TAL1, its flanking genes, and regulation in T-ALL.

PubMed

Zhou, Yan; Kurukuti, Sreenivasulu; Saffrey, Peter; Vukovic, Milica; Michie, Alison M; Strogantsev, Ruslan; West, Adam G; Vetrie, David

2013-12-19

TAL1 is an important regulator of hematopoiesis and its expression is tightly controlled despite complexities in its genomic organization. It is frequently misregulated in T-cell acute lymphoblastic leukemia (T-ALL), often due to deletions between TAL1 and the neighboring STIL gene. To better understand the events that lead to TAL1 expression in hematopoiesis and in T-ALL, we studied looping interactions at the TAL1 locus. In TAL1-expressing erythroid cells, the locus adopts a looping "hub" which brings into close physical proximity all known TAL1 cis-regulatory elements including CTCF-bound insulators. Loss of GATA1 results in disassembly of the hub and loss of CTCF/RAD21 from one of its insulators. Genes flanking TAL1 are partly dependent on hub integrity for their transcriptional regulation. We identified looping patterns unique to TAL1-expressing T-ALL cells, and, intriguingly, loops occurring between the TAL1 and STIL genes at the common TAL1/STIL breakpoints found in T-ALL. These findings redefine how TAL1 and neighboring genes communicate within the nucleus, and indicate that looping facilitates both normal and aberrant TAL1 expression and may predispose to structural rearrangements in T-ALL. We also propose that GATA1-dependent looping mechanisms may facilitate the conservation of TAL1 regulation despite cis-regulatory remodeling during vertebrate evolution.

Expression of endogenous retroviruses is negatively regulated by the pluripotency marker Rex1/Zfp42

PubMed Central

Guallar, D.; Pérez-Palacios, R.; Climent, M.; Martínez-Abadía, I.; Larraga, A.; Fernández-Juan, M.; Vallejo, C.; Muniesa, P.; Schoorlemmer, J.

2012-01-01

Rex1/Zfp42 is a Yy1-related zinc-finger protein whose expression is frequently used to identify pluripotent stem cells. We show that depletion of Rex1 levels notably affected self-renewal of mouse embryonic stem (ES) cells in clonal assays, in the absence of evident differences in expression of marker genes for pluripotency or differentiation. By contrast, marked differences in expression of several endogenous retroviral elements (ERVs) were evident upon Rex1 depletion. We demonstrate association of REX1 to specific elements in chromatin-immunoprecipitation assays, most strongly to muERV-L and to a lower extent to IAP and musD elements. Rex1 regulates muERV-L expression in vivo, as we show altered levels upon transient gain-and-loss of Rex1 function in pre-implantation embryos. We also find REX1 can associate with the lysine-demethylase LSD1/KDM1A, suggesting they act in concert. Similar to REX1 binding to retrotransposable elements (REs) in ES cells, we also detected binding of the REX1 related proteins YY1 and YY2 to REs, although the binding preferences of the two proteins were slightly different. Altogether, we show that Rex1 regulates ERV expression in mouse ES cells and during pre-implantation development and suggest that Rex1 and its relatives have evolved as regulators of endogenous retroviral transcription. PMID:22844087

Integrin Expression Regulates Neuroblastoma Attachment and Migration1

PubMed Central

Meyer, Amy; van Golen, Cynthia M.; Kim, Bhumsoo; van Golen, Kenneth L.; Feldman, Eva L.

2004-01-01

Abstract Neuroblastoma (NBL) is the most common malignant disease of infancy, and children with bone metastasis have a mortality rate greater than 90%. Two major classes of proteins, integrins and growth factors, regulate the metastatic process. We have previously shown that tumorigenic NBL cells express higher levels of the type I insulin-like growth factor receptor (IGF-IR) and that β1 integrin expression is inversely proportional to tumorigenic potential in NBL. In the current study, we analyze the effect of β1 integrin and IGF-IR on NBL cell attachment and migration. Nontumorigenic S-cells express high levels of β1 integrin, whereas tumorigenic N-cells express little β1 integrin. Alterations in β1 integrin are due to regulation at the protein level, as translation is decreased in N-type cells. Moreover, inhibition of protein synthesis shows that β1 integrin is degraded more slowly in S-type cells (SHEP) than in N-type cells (SH-SY5Y and IMR32). Inhibition of α5β1 integrin prevents SHEP (but not SH-SY5Y or IMR32) cell attachment to fibronectin and increases SHEP cell migration. Increases in IGF-IR decrease β1 integrin expression, and enhance SHEP cell migration, potentially through increased expression of αvβ3. These data suggest that specific classes of integrins in concert with IGF-IR regulate NBL attachment and migration. PMID:15256055

Contextual Information Drives the Reconsolidation-Dependent Updating of Retrieved Fear Memories

PubMed Central

Jarome, Timothy J; Ferrara, Nicole C; Kwapis, Janine L; Helmstetter, Fred J

2015-01-01

Stored memories enter a temporary state of vulnerability following retrieval known as ‘reconsolidation', a process that can allow memories to be modified to incorporate new information. Although reconsolidation has become an attractive target for treatment of memories related to traumatic past experiences, we still do not know what new information triggers the updating of retrieved memories. Here, we used biochemical markers of synaptic plasticity in combination with a novel behavioral procedure to determine what was learned during memory reconsolidation under normal retrieval conditions. We eliminated new information during retrieval by manipulating animals' training experience and measured changes in proteasome activity and GluR2 expression in the amygdala, two established markers of fear memory lability and reconsolidation. We found that eliminating new contextual information during the retrieval of memories for predictable and unpredictable fear associations prevented changes in proteasome activity and glutamate receptor expression in the amygdala, indicating that this new information drives the reconsolidation of both predictable and unpredictable fear associations on retrieval. Consistent with this, eliminating new contextual information prior to retrieval prevented the memory-impairing effects of protein synthesis inhibitors following retrieval. These results indicate that under normal conditions, reconsolidation updates memories by incorporating new contextual information into the memory trace. Collectively, these results suggest that controlling contextual information present during retrieval may be a useful strategy for improving reconsolidation-based treatments of traumatic memories associated with anxiety disorders such as post-traumatic stress disorder. PMID:26062788

Piezo type mechanosensitive ion channel component 1 functions as a regulator of the cell fate determination of mesenchymal stem cells.

PubMed

Sugimoto, Asuna; Miyazaki, Aya; Kawarabayashi, Keita; Shono, Masayuki; Akazawa, Yuki; Hasegawa, Tomokazu; Ueda-Yamaguchi, Kimiko; Kitamura, Takamasa; Yoshizaki, Keigo; Fukumoto, Satoshi; Iwamoto, Tsutomu

2017-12-18

The extracellular environment regulates the dynamic behaviors of cells. However, the effects of hydrostatic pressure (HP) on cell fate determination of mesenchymal stem cells (MSCs) are not clearly understood. Here, we established a cell culture chamber to control HP. Using this system, we found that the promotion of osteogenic differentiation by HP is depend on bone morphogenetic protein 2 (BMP2) expression regulated by Piezo type mechanosensitive ion channel component 1 (PIEZO1) in MSCs. The PIEZO1 was expressed and induced after HP loading in primary MSCs and MSC lines, UE7T-13 and SDP11. HP and Yoda1, an activator of PIEZO1, promoted BMP2 expression and osteoblast differentiation, whereas inhibits adipocyte differentiation. Conversely, PIEZO1 inhibition reduced osteoblast differentiation and BMP2 expression. Furthermore, Blocking of BMP2 function by noggin inhibits HP induced osteogenic maker genes expression. In addition, in an in vivo model of medaka with HP loading, HP promoted caudal fin ray development whereas inhibition of piezo1 using GsMTx4 suppressed its development. Thus, our results suggested that PIEZO1 is responsible for HP and could functions as a factor for cell fate determination of MSCs by regulating BMP2 expression.

A Clb/Cdk1-mediated regulation of Fkh2 synchronizes CLB expression in the budding yeast cell cycle.

PubMed

Linke, Christian; Chasapi, Anastasia; González-Novo, Alberto; Al Sawad, Istabrak; Tognetti, Silvia; Klipp, Edda; Loog, Mart; Krobitsch, Sylvia; Posas, Francesc; Xenarios, Ioannis; Barberis, Matteo

2017-01-01

Precise timing of cell division is achieved by coupling waves of cyclin-dependent kinase (Cdk) activity with a transcriptional oscillator throughout cell cycle progression. Although details of transcription of cyclin genes are known, it is unclear which is the transcriptional cascade that modulates their expression in a timely fashion. Here, we demonstrate that a Clb/Cdk1-mediated regulation of the Fkh2 transcription factor synchronizes the temporal mitotic CLB expression in budding yeast. A simplified kinetic model of the cyclin/Cdk network predicts a linear cascade where a Clb/Cdk1-mediated regulation of an activator molecule drives CLB3 and CLB2 expression. Experimental validation highlights Fkh2 as modulator of CLB3 transcript levels, besides its role in regulating CLB2 expression. A Boolean model based on the minimal number of interactions needed to capture the information flow of the Clb/Cdk1 network supports the role of an activator molecule in the sequential activation, and oscillatory behavior, of mitotic Clb cyclins. This work illustrates how transcription and phosphorylation networks can be coupled by a Clb/Cdk1-mediated regulation that synchronizes them.

Activation of 5-HT7 serotonin receptors reverses metabotropic glutamate receptor-mediated synaptic plasticity in wild-type and Fmr1 knockout mice, a model of Fragile X syndrome.

PubMed

Costa, Lara; Spatuzza, Michela; D'Antoni, Simona; Bonaccorso, Carmela M; Trovato, Chiara; Musumeci, Sebastiano A; Leopoldo, Marcello; Lacivita, Enza; Catania, Maria V; Ciranna, Lucia

2012-12-01

Fragile X syndrome (FXS) is a genetic cause of intellectual disability and autism. Fmr1 knockout (Fmr1 KO) mice, an animal model of FXS, exhibit spatial memory impairment and synapse malfunctioning in the hippocampus, with abnormal enhancement of long-term depression mediated by metabotropic glutamate receptors (mGluR-LTD). The neurotransmitter serotonin (5-HT) modulates hippocampal-dependent learning through serotonin 1A (5-HT1A) and serotonin 7 (5-HT7) receptors; the underlying mechanisms are unknown. We used electrophysiology to test the effects of 5-HT on mGluR-LTD in wild-type and Fmr1 KO mice and immunocytochemistry and biotinylation assay to study related changes of 2-amino-3-(5-methyl-3-oxo-1,2-oxazol-4-yl)propanoic acid (AMPA) glutamate receptor surface expression. Application of 5-HT or 8-OH-DPAT (a mixed 5-HT1A/5-HT7 agonist) reversed mGluR-LTD in hippocampal slices. Reversal of mGluR-LTD by 8-OH-DPAT persisted in the presence of the 5-HT1A receptor antagonist WAY-100635, was abolished by SB-269970 (5-HT7 receptor antagonist), and was mimicked by LP-211, a novel selective 5-HT7 receptor agonist. Consistently, 8-OH-DPAT decreased mGluR-mediated reduction of AMPA glutamate receptor 2 (GluR2) subunit surface expression in hippocampal slices and cultured hippocampal neurons, an effect mimicked by LP-211 and blocked by SB-269970. In Fmr1 KO mice, mGluR-LTD was abnormally enhanced; similarly to wild-type, 8-OH-DPAT reversed mGluR-LTD and decreased mGluR-induced reduction of surface AMPA receptors, an effect antagonized by SB-269970. Serotonin 7 receptor activation reverses metabotropic glutamate receptor-induced AMPA receptor internalization and LTD both in wild-type and in Fmr1 KO mice, correcting excessive mGluR-LTD. Therefore, selective activation of 5-HT7 receptors may represent a novel strategy in the therapy of FXS. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma.

PubMed

Chen, Jiamin; Feilotter, Harriet E; Paré, Geneviève C; Zhang, Xiao; Pemberton, Joshua G W; Garady, Cherif; Lai, Dulcie; Yang, Xiaolong; Tron, Victor A

2010-05-01

Cutaneous melanoma is an aggressive form of human skin cancer characterized by high metastatic potential and poor prognosis. To better understand the role of microRNAs (miRNAs) in melanoma, the expression of 470 miRNAs was profiled in tissue samples from benign nevi and metastatic melanomas. We identified 31 miRNAs that were differentially expressed (13 up-regulated and 18 down-regulated) in metastatic melanomas relative to benign nevi. Notably, miR-193b was significantly down-regulated in the melanoma tissues examined. To understand the role of miR-193b in melanoma, functional studies were undertaken. Overexpression of miR-193b in melanoma cell lines repressed cell proliferation. Gene expression profiling identified 314 genes down-regulated by overexpression of miR-193b in Malme-3M cells. Eighteen of these down-regulated genes, including cyclin D1 (CCND1), were also identified as putative miR-193b targets by TargetScan. Overexpression of miR-193b in Malme-3M cells down-regulated CCND1 mRNA and protein by > or = 50%. A luciferase reporter assay confirmed that miR-193b directly regulates CCND1 by binding to the 3'untranslated region of CCND1 mRNA. These studies indicate that miR-193b represses cell proliferation and regulates CCND1 expression and suggest that dysregulation of miR-193b may play an important role in melanoma development.

MicroRNA-193b Represses Cell Proliferation and Regulates Cyclin D1 in Melanoma

PubMed Central

Chen, Jiamin; Feilotter, Harriet E.; Paré, Geneviève C.; Zhang, Xiao; Pemberton, Joshua G.W.; Garady, Cherif; Lai, Dulcie; Yang, Xiaolong; Tron, Victor A.

2010-01-01

Cutaneous melanoma is an aggressive form of human skin cancer characterized by high metastatic potential and poor prognosis. To better understand the role of microRNAs (miRNAs) in melanoma, the expression of 470 miRNAs was profiled in tissue samples from benign nevi and metastatic melanomas. We identified 31 miRNAs that were differentially expressed (13 up-regulated and 18 down-regulated) in metastatic melanomas relative to benign nevi. Notably, miR-193b was significantly down-regulated in the melanoma tissues examined. To understand the role of miR-193b in melanoma, functional studies were undertaken. Overexpression of miR-193b in melanoma cell lines repressed cell proliferation. Gene expression profiling identified 314 genes down-regulated by overexpression of miR-193b in Malme-3M cells. Eighteen of these down-regulated genes, including cyclin D1 (CCND1), were also identified as putative miR-193b targets by TargetScan. Overexpression of miR-193b in Malme-3M cells down-regulated CCND1 mRNA and protein by ≥50%. A luciferase reporter assay confirmed that miR-193b directly regulates CCND1 by binding to the 3′untranslated region of CCND1 mRNA. These studies indicate that miR-193b represses cell proliferation and regulates CCND1 expression and suggest that dysregulation of miR-193b may play an important role in melanoma development. PMID:20304954

A novel role of Yin-Yang-1 in pulmonary tuberculosis through the regulation of the chemokine CCL4.

PubMed

Rangel-Santiago, Jesus F; Baay-Guzman, Guillermina J; Duran-Padilla, Marco A; Lopez-Bochm, Karla A; Garcia-Romero, Beatriz L; Hernandez-Cueto, Daniel D; Pantoja-Escobar, Gerardo; Vega, Mario I; Hernandez-Pando, Rogelio; Huerta-Yepez, Sara

2016-01-01

Mycobacterium tuberculosis (M. tb) is the etiological agent of pulmonary tuberculosis (TB); this disease remains a worldwide health problem. Yin-Yang-1 (YY1) plays a major role in the maintenance and progression of some pulmonary diseases, including pulmonary fibrosis. However, the role of YY1 in TB remains unknown. The aim of this study was to elucidate the role of YY1 in the regulation of CCL4 and its implication in TB. We determined whether YY1 regulates CCL4 using reporter plasmids, ChIP and siRNA assays. Immunohistochemistry and digital pathology were used to measure the expression of YY1 and CCL4 in a mouse model of TB. A retrospective comparison of patients with TB and control subjects was used to measure the expression of YY1 and CCL4 using tissue microarrays. Our results showed that YY1 regulates the transcription of CCL4; moreover, YY1, CCL4 and TGF-β were overexpressed in the lung tissues of mice with TB during the late stages of the disease and the tissues of TB patients. The expression of CCL4 and TGF-β correlated with YY1 expression. In conclusion, YY1 regulates CCL4 transcription; moreover, YY1 is overexpressed in experimental and human TB and is positively correlated with CCL4 and TGF-β expression. Therefore, treatments that decrease YY1 expression may be a new therapeutic strategy against TB. Copyright © 2015 Elsevier Ltd. All rights reserved.

Androgen-androgen receptor system improves chronic inflammatory conditions by suppressing monocyte chemoattractant protein-1 gene expression in adipocytes via transcriptional regulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morooka, Nobukatsu, E-mail: amorooka@gunma-u.ac.jp; Ueguri, Kei; Yee, Karen Kar Lye

Age-related decreases in sex hormones are closely related to chronic inflammation in obesity and metabolic diseases. Particularly, the molecular basis of androgen activity in regulating inflammation and controlling metabolism remains largely unknown. Obese adipocytes secrete monocyte chemoattractant protein-1 (MCP-1), a key chemokine that promotes the infiltration of monocytes/macrophages into adipose tissue, thereby leading to metabolic disorders. Here, we studied the role of androgen-androgen receptor (AR) action in regulating MCP-1 expression in adipose tissue. We observed the induction of Mcp-1 expression in 3T3-L1 adipocytes co-cultured with RAW264.7 macrophages. Additionally, Mcp-1 expression was upregulated by culturing in conditioned medium derived from inflammatorymore » macrophages (M1-Mφ) containing tumor necrosis factor-alpha (TNF-α). We found that sex hormones downregulated TNF-α-induced Mcp-1 and interleukin (Il)-6 expression in 3T3-L1 adipocytes. Furthermore, luciferase-reporter analysis indicated that MCP-1 promoter activity was predominantly suppressed by dihydrotestosterone (DHT)-AR interactions through functional canonical nuclear factor-kappa B (NF-κB) sites, whereas non-canonical NF-κB site containing important flanking sequences exhibited minor contributions to DHT-AR transcriptional repression. These findings suggested that androgen-AR suppressed obesity-induced chronic inflammation in adipose tissue. - Highlights: • DHT, non-aromatizable androgen suppresses Mcp-1 expression in adipocytes. • Mcp-1 transcription was negatively regulated by DHT-AR action. • DHT-AR selectively regulates Mcp-1 transcription through distinct NF-κB sites.« less

Regulation of Hepatic ApoC3 Expression by PGC-1β Mediates Hypolipidemic Effect of Nicotinic Acid

PubMed Central

Hernandez, Carlos; Molusky, Matthew; Li, Yaqiang; Li, Siming; Lin, Jiandie D.

2010-01-01

SUMMARY Peroxisome-proliferator activated receptor (PPAR) γ coactivator-1β (PGC-1β) is a transcriptional coactivator that induces hypertriglyceridemia in response to dietary fats through activating hepatic lipogenesis and lipoprotein secretion. The expression of PGC-1β is regulated by free fatty acids. Here we show that PGC-1β regulates plasma triglyceride metabolism through stimulating apolipoprotein C3 (APOC3) expression and elevating APOC3 levels in circulation. Remarkably, liver-specific knockdown of APOC3 significantly ameliorates PGC-1β-induced hypertriglyceridemia in mice. Hepatic expression of PGC-1β and APOC3 is reduced in response to acute and chronic treatments with nicotinic acid, a widely prescribed drug for lowering plasma triglycerides. Adenoviral-mediated knockdown of PGC-1β or APOC3 in the liver recapitulates the hypolipidemic effect of nicotinic acid. Proteomic analysis of hepatic PGC-1β transcriptional complex indicates that it stimulates APOC3 expression through coactivating orphan nuclear receptor ERRα and recruiting chromatin-remodeling cofactors. Together, these studies identify PGC-1β as an important regulator of the APOC3 gene cluster and reveal a mechanism through which nicotinic acid achieves its therapeutic effects. PMID:20889132

Regulation of hepatic ApoC3 expression by PGC-1β mediates hypolipidemic effect of nicotinic acid.

PubMed

Hernandez, Carlos; Molusky, Matthew; Li, Yaqiang; Li, Siming; Lin, Jiandie D

2010-10-06

Peroxisome proliferator-activated receptor (PPAR) γ coactivator-1β (PGC-1β) is a transcriptional coactivator that induces hypertriglyceridemia in response to dietary fats through activating hepatic lipogenesis and lipoprotein secretion. The expression of PGC-1β is regulated by free fatty acids. Here we show that PGC-1β regulates plasma triglyceride metabolism through stimulating apolipoprotein C3 (APOC3) expression and elevating APOC3 levels in circulation. Remarkably, liver-specific knockdown of APOC3 significantly ameliorates PGC-1β-induced hypertriglyceridemia in mice. Hepatic expression of PGC-1β and APOC3 is reduced in response to acute and chronic treatments with nicotinic acid, a widely prescribed drug for lowering plasma triglycerides. Adenoviral-mediated knockdown of PGC-1β or APOC3 in the liver recapitulates the hypolipidemic effect of nicotinic acid. Proteomic analysis of hepatic PGC-1β transcriptional complex indicates that it stimulates APOC3 expression through coactivating orphan nuclear receptor ERRα and recruiting chromatin-remodeling cofactors. Together, these studies identify PGC-1β as an important regulator of the APOC3 gene cluster and reveal a mechanism through which nicotinic acid achieves its therapeutic effects. Copyright © 2010 Elsevier Inc. All rights reserved.

Ubiquitin carboxyl terminal hydrolase L1 negatively regulates TNF{alpha}-mediated vascular smooth muscle cell proliferation via suppressing ERK activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ichikawa, Tomonaga; Li, Jinqing; Dong, Xiaoyu

2010-01-01

Deubiquitinating enzymes (DUBs) appear to be critical regulators of a multitude of processes such as proliferation, apoptosis, differentiation, and inflammation. We have recently demonstrated that a DUB of ubiquitin carboxyl terminal hydrolase L1 (UCH-L1) inhibits vascular lesion formation via suppressing inflammatory responses in vasculature. However, the precise underlying mechanism remains to be defined. Herein, we report that a posttranscriptional up-regulation of UCH-L1 provides a negative feedback to tumor necrosis factor alpha (TNF{alpha})-mediated activation of extracellular signal-regulated kinases (ERK) and proliferation in vascular smooth muscle cells (VSMCs). In rat adult VSMCs, adenoviral over-expression of UCH-L1 inhibited TNF{alpha}-induced activation of ERK andmore » DNA synthesis. In contrast, over-expression of UCH-L1 did not affect platelet derived growth factor (PDGF)-induced VSMC proliferation and activation of growth stimulating cascades including ERK. TNF{alpha} hardly altered UCH-L1 mRNA expression and stability; however, up-regulated UCH-L1 protein expression via increasing UCH-L1 translation. These results uncover a novel mechanism by which UCH-L1 suppresses vascular inflammation.« less

MiR-17/20/93/106 promote hematopoietic cell expansion by targeting sequestosome 1–regulated pathways in mice

PubMed Central

Meenhuis, Annemarie; van Veelen, Peter A.; de Looper, Hans; van Boxtel, Nicole; van den Berge, Iris J.; Sun, Su M.; Taskesen, Erdogan; Stern, Patrick; de Ru, Arnoud H.; van Adrichem, Arjan J.; Demmers, Jeroen; Jongen-Lavrencic, Mojca; Löwenberg, Bob; Touw, Ivo P.; Sharp, Phillip A.

2011-01-01

MicroRNAs (miRNAs) are pivotal for regulation of hematopoiesis but their critical targets remain largely unknown. Here, we show that ectopic expression of miR-17, -20,-93 and -106, all AAAGUGC seed-containing miRNAs, increases proliferation, colony outgrowth and replating capacity of myeloid progenitors and results in enhanced P-ERK levels. We found that these miRNAs are endogenously and abundantly expressed in myeloid progenitors and down-regulated in mature neutrophils. Quantitative proteomics identified sequestosome 1 (SQSTM1), an ubiquitin-binding protein and regulator of autophagy-mediated protein degradation, as a major target for these miRNAs in myeloid progenitors. In addition, we found increased expression of Sqstm1 transcripts during CSF3-induced neutrophil differentiation of 32D-CSF3R cells and an inverse correlation of SQSTM1 protein levels and miR-106 expression in AML samples. ShRNA-mediated silencing of Sqstm1 phenocopied the effects of ectopic miR-17/20/93/106 expression in hematopoietic progenitors in vitro and in mice. Further, SQSTM1 binds to the ligand-activated colony-stimulating factor 3 receptor (CSF3R) mainly in the late endosomal compartment, but not in LC3 positive autophagosomes. SQSTM1 regulates CSF3R stability and ligand-induced mitogen-activated protein kinase signaling. We demonstrate that AAAGUGC seed-containing miRNAs promote cell expansion, replating capacity and signaling in hematopoietic cells by interference with SQSTM1-regulated pathways. PMID:21628417

Ethanol extracts of black pepper or turmeric down-regulated SIRT1 protein expression in Daudi culture cells.

PubMed

Nishimura, Yuri; Kitagishi, Yasuko; Yoshida, Hitomi; Okumura, Naoko; Matsuda, Satoru

2011-01-01

SIRT1 is a mammalian candidate molecule involved in longevity and diverse metabolic processes. The present study aimed to determine the effects of certain herbs and spices on SIRT1 expression. Human cell lines Daudi, Jurkat, U937 and K562 were cultured in RPMI-1640. Herb and spice powders were prepared and the supernatants were collected. RT-PCR was used to quantify the expression level of the gene. Protein samples were then analyzed by Western blotting. Western blotting revealed the down-regulation of SIRT1 protein expression in Daudi cells treated with extracts of black pepper or turmeric. On the other hand, the effect on the SIRT1 gene expression examined by reverse transcription polymerase chain reaction was unaltered. In conclusion, component(s) of certain herbs and spices may induce the down-regulation of SIRT1 protein.

Inhibition of spontaneous recovery of fear by mGluR5 after prolonged extinction training.

PubMed

Mao, Sheng-Chun; Chang, Chih-Hua; Wu, Chia-Chen; Orejarena, M Juliana; Orejanera, Maria Juliana; Manzoni, Olivier J; Gean, Po-Wu

2013-01-01

Fear behavior is vital for survival and involves learning contingent associations of non-threatening cues with aversive stimuli. In contrast, excessive levels of fear can be maladaptive and lead to anxiety disorders. Generally, extensive sessions of extinction training correlates with reduced spontaneous recovery. The molecular mechanisms underlying the long-term inhibition of fear recovery following repeated extinction training are not fully understood. Here we show that in rats, prolonged extinction training causes greater reduction in both fear-potentiated startle and spontaneous recovery. This effect was specifically blocked by metabotropic glutamate receptor 5 (mGluR5), but not by mGluR1 antagonists and by a protein synthesis inhibitor. Similar inhibition of memory recovery following prolonged extinction training was also observed in mice. In agreement with the instrumental role of mGluR5 in the prolonged inhibition of fear recovery, we found that FMR1-/- mice which exhibit enhanced mGluR5-mediated signaling exhibit lower spontaneous recovery of fear after extinction training than wild-type littermates. At the molecular level, we discovered that prolonged extinction training reversed the fear conditioning-induced increase in surface expression of GluR1, AMPA/NMDA ratio, postsynaptic density-95 (PSD-95) and synapse-associated protein-97 (SAP97). Accordingly, delivery of Tat-GluR2(3Y), a synthetic peptide that blocks AMPA receptor endocytosis, inhibited prolonged extinction training-induced inhibition of fear recovery. Together, our results demonstrate that prolonged extinction training results in the mGluR5-dependent long-term inhibition of fear recovery. This effect may involve the degradation of original memory and may explain the beneficial effects of prolonged exposure therapy for the treatment of phobias.

miR-152 regulated glioma cell proliferation and apoptosis via Runx2 mediated by DNMT1.

PubMed

Zhang, Peng; Sun, Hongwei; Yang, Bo; Luo, Wenzheng; Liu, Zengjin; Wang, Junkuan; Zuo, Yuchao

2017-08-01

Aberrant DNA methylation is associated with tumor onset and progression. Study has verified that the DNA methylation of miR-152 was mediated in many tumors, but whether it involved in glioblastomas was still unclear. This study enrolled 20 patients with glioma to analyze the expression pattern of miR-152. Real-time PCR and western blot were used to detect the mRNA or protein expression level, respectively. The relationship between miR-152 and runx2 was detected by Luciferase reporter assay. The methylation level of miR-152 was determined by methylation-specific PCR. Cell proliferation and apoptosis were detected by MTT and Annexin-FITC/PI assay. The expression of miR-152 was down-regulated while the expression of DNMT1 was up-regulated in both glioma tissue and cell lines. MiR-152 was hypermethylated and its expression was negatively correlated with DNMT in glioma cell lines. DNMT1 knockdown promoted the expression of miR-152, however, DNMT1 overexpression suppressed the expression of miR-152. MiR-152 overexpression promoted glioma cell apoptosis while miR-152 knockdown promoted cell proliferation. MiR-152 targets Runx2 to regulate its expression, Runx2 overexpression abolished the effects of miR-152 overexpression. MiR-152 regulated cell proliferation and apoptosis of glioma mediated by Runx2, while the mechanism of down regulated miR-152 in glioma tissues and cells was its hypermethylation. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

ZEB1 limits adenoviral infectability by transcriptionally repressing the Coxsackie virus and Adenovirus Receptor

PubMed Central

2011-01-01

Background We have previously reported that RAS-MEK (Cancer Res. 2003 May 1;63(9):2088-95) and TGF-β (Cancer Res. 2006 Feb 1;66(3):1648-57) signaling negatively regulate coxsackie virus and adenovirus receptor (CAR) cell-surface expression and adenovirus uptake. In the case of TGF-β, down-regulation of CAR occurred in context of epithelial-to-mesenchymal transition (EMT), a process associated with transcriptional repression of E-cadherin by, for instance, the E2 box-binding factors Snail, Slug, SIP1 or ZEB1. While EMT is crucial in embryonic development, it has been proposed to contribute to the formation of invasive and metastatic carcinomas by reducing cell-cell contacts and increasing cell migration. Results Here, we show that ZEB1 represses CAR expression in both PANC-1 (pancreatic) and MDA-MB-231 (breast) human cancer cells. We demonstrate that ZEB1 physically associates with at least one of two closely spaced and conserved E2 boxes within the minimal CAR promoter here defined as genomic region -291 to -1 relative to the translational start ATG. In agreement with ZEB1's established role as a negative regulator of the epithelial phenotype, silencing its expression in MDA-MB-231 cells induced a partial Mesenchymal-to-Epithelial Transition (MET) characterized by increased levels of E-cadherin and CAR, and decreased expression of fibronectin. Conversely, knockdown of ZEB1 in PANC-1 cells antagonized both the TGF-β-induced down-regulation of E-cadherin and CAR and the reduction of adenovirus uptake. Interestingly, even though ZEB1 clearly contributes to the TGF-β-induced mesenchymal phenotype of PANC-1 cells, TGF-β did not seem to affect ZEB1's protein levels or subcellular localization. These findings suggest that TGF-β may inhibit CAR expression by regulating factor(s) that cooperate with ZEB1 to repress the CAR promoter, rather than by regulating ZEB1 expression levels. In addition to the negative E2 box-mediated regulation the minimal CAR promoter is positively regulated through conserved ETS and CRE elements. Conclusions This report provides evidence that inhibition of ZEB1 may improve adenovirus uptake of cancer cells that have undergone EMT and for which ZEB1 is necessary to maintain the mesenchymal phenotype. Targeting of ZEB1 may reverse some aspects of EMT including the down-regulation of CAR. PMID:21791114

Activation of GPR30 attenuates chronic pain-related anxiety in ovariectomized mice.

PubMed

Liu, Shui-bing; Tian, Zhen; Guo, Yan-yan; Zhang, Nan; Feng, Bin; Zhao, Ming-gao

2015-03-01

Estrogen regulates neuroendocrine and inflammatory processes that play critical roles in neuroinflammation, anxiety, and chronic pain. Patients suffering from chronic pain often complain of anxiety. However, limited information is available regarding the neural circuitry of chronic pain-related anxiety and the related function of estrogen. Hindpaw injection of complete Freund's adjuvant (CFA) and chronic constriction injury (CCI) of the sciatic nerve induced notable pain sensitization and anxiety-like behavior in ovariectomized (OVX) mice. We found that the level of G-protein-coupled receptor 30 (GPR30), a membrane estrogen receptor, was significantly increased in the basolateral amygdala (BLA) of ovariectomized (OVX) mice suffering from chronic inflammatory and neuropathic pain. Subcutaneous injection or BLA local infusion of the GPR30 agonist G1 significantly reduced anxiety-like behavior in CFA-injected and CCI-OVX mice; however, this treatment did not alter the nociceptive threshold. GPR30 knock down by shRNA in the BLA of OVX mice inhibited the anxiolytic effects of GPR30 activation. G1 administration reversed the upregulation of GluR1 subunit in AMPA and NR2A-containing NMDA receptors and the downregulation of GABAA receptors in the BLA of CFA-injected and CCI-OVX mice. Electrophysiological recording revealed that GPR30 activation could prevent imbalance between excitatory and inhibitory transmissions in the BLA synapses of CFA-injected OVX mice. In conclusion, GPR30 activation induced anxiolytic effects but did not affect the nociceptive threshold of mice under chronic pain. The anxiolytic effects of GPR30 were partially due to maintaining the balance between excitatory and inhibitory transmissions in the BLA. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification of the putative goldfish (Carassius auratus) magnesium transporter SLC41a1 and functional regulation in the gill, kidney, and intestine in response to dietary and environmental manipulations.

PubMed

Kodzhahinchev, Vladimir; Kovacevic, Drago; Bucking, Carol

2017-04-01

While magnesium requirements for teleost fish highlight the physiological importance of this cation for homeostasis, little is known regarding the molecular identity of transporters responsible for magnesium absorption or secretion. The recent characterization of the vertebrate magnesium transporter solute carrier 41a1 (SLC41a1) in the kidney of a euryhaline fish has provided a glimpse of possible moieties involved in piscine magnesium regulation. The present study obtained a novel SLC41a1 coding sequence for Carassius auratus and demonstrated ubiquitous expression in all tissues examined. Transcriptional regulation of SLC41a1 in response to dietary and environmental magnesium concentrations was observed across tissues. Specifically, decreased environmental magnesium correlated with decreased expression of SLC41a1 in the intestine, whereas the gill and kidney were unaffected. Dietary magnesium restriction correlated with decreased expression of SLC41a1 in the intestine and gill, while again no effects were detected in the kidney. Finally, elevated dietary magnesium correlated with increased expression of SLC41a1 in the kidney, while expression in the intestine and gill remained stable. Plasma magnesium was maintained in all treatments, and dietary assimilation efficiency increased with decreased dietary magnesium. Consumption of a single meal failed to impact SLC41a1 expression, and transcript abundance remained stable over the course of digestion in all treatments. Transcriptional regulation occurred between 7 and 14days following dietary and environmental manipulations and short-term regulation (e.g. <24h) was not observed. Overall the data supports transcriptional regulation of SLC41a1 reflecting a possible role in magnesium loss or secretion across tissues in fish. Copyright © 2017 Elsevier Inc. All rights reserved.

Ras-dva Is a Novel Pit-1- and Glucocorticoid-Regulated Gene in the Embryonic Anterior Pituitary Gland

PubMed Central

Ellestad, Laura E.

2013-01-01

Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5′-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5′-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland. PMID:23161868

Ras-dva is a novel Pit-1- and glucocorticoid-regulated gene in the embryonic anterior pituitary gland.

PubMed

Ellestad, Laura E; Porter, Tom E

2013-01-01

Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5'-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5'-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland.

Expression of Fushi tarazu factor 1 homolog and Pit-1 genes in the pituitaries of pre-spawning chum and sockeye salmon.

PubMed

Higa, M; Ando, H; Urano, A

2001-06-01

Fushi tarazu factor-1 (FTZ-F1) and Pit-1 are major pituitary transcription factors, controlling expression of genes coding for gonadotropin (GTH) subunits and growth hormone/prolactin/somatolactin family hormone, respectively. As a first step to investigate physiological factors regulating gene expression of these transcription factors, we determined their mRNA levels in the pituitaries of chum salmon (Oncorhynchus keta) at different stages of sexual maturation. FTZ-F1 gene expression was increased in males at the stage before spermiation, where the levels of GTH alpha and IIbeta subunit mRNAs were elevated. Pit-1 mRNA showed maximum levels at the final stage of sexual maturation in both sexes, when expression of somatolactin gene peaked. To clarify whether gonadotropin-releasing hormone (GnRH) is involved in these increases in FTZ-F1 and Pit-1 gene expression, we examined effects of GnRH analog (GnRHa) administration on their gene expression in maturing sockeye salmon (Oncorhynchus nerka). GnRHa stimulated Pit-1 gene expression in females only, but failed to stimulate FTZ-F1 gene expression in both sexes. The up-regulated expression of FTZ-F1 and Pit-1 genes at the pre-spawning stages suggest that the two transcription factors have roles in sexual maturation of salmonids. Physiological factors regulating gene expression of FTZ-F1 and Pit-1 are discussed in this review.

CHIP mediates down-regulation of nucleobindin-1 in preosteoblast cell line models.

PubMed

Xue, Fuying; Wu, Yanping; Zhao, Xinghui; Zhao, Taoran; Meng, Ying; Zhao, Zhanzhong; Guo, Junwei; Chen, Wei

2016-08-01

Nucleobindin-1 (NUCB1), also known as Calnuc, is a highly conserved, multifunctional protein widely expressed in tissues and cells. It contains two EF-hand motifs which have been shown to play a crucial role in binding Ca(2+) ions. In this study, we applied comparative two-dimensional gel electrophoresis to characterize differentially expressed proteins in HA-CHIP over-expressed and endogenous CHIP depleted MC3T3-E1 stable cell lines, identifying NUCB1 as a novel CHIP/Stub1 targeted protein. NUCB1 interacts with and is down-regulated by CHIP by both proteasomal dependent and independent pathways, suggesting that CHIP-mediated down-regulation of nucleobindin-1 might play a role in osteoblast differentiation. The chaperone protein Hsp70 was found to be important for CHIP and NUCB1 interaction as well as CHIP-mediated NUCB1 down-regulation. Our findings provide new insights into understanding the stability regulation of NUCB1. Copyright © 2016 Elsevier Inc. All rights reserved.

PcToll3 was involved in anti-Vibrio response by regulating the expression of antimicrobial peptides in red swamp crayfish, Procambarus clarkii.

PubMed

Lan, Jiang-Feng; Wei, Shun; Wang, Yu-Qing; Dai, Yun-Jia; Tu, Jia-Gang; Zhao, Li-Juan; Li, Xin-Cang; Qin, Qi-Wei; Chen, Nan; Lin, Li

2016-10-01

Tolls and Toll-like receptors (TLRs) play an important role in host immune defenses by regulating the expression of antimicrobial peptides (AMPs) and cytokines, but the functional differences of crustacean Tolls from Drosophila Tolls or Mammal TLRs are largely unknown. A novel Toll receptor, named PcToll3, was identified from red swamp crayfish, Procambarus clarkii. It was widely expressed in all detected tissues, and its transcript in hemocytes was up-regulated at 12 h after Vibrio parahemolyticus (Vibrio) injection or at 24 h post white spot syndrome virus (WSSV) challenge. After knockdown of PcToll3, the activity of bacterial clearance was inhibited, and the expression levels of AMPs including Crustin1 (Cru1), Anti-lippopolysaccharide factor 1 (ALF1), and Lysozymes1 (Lys1), which could be up-regulated by Vibrio, were all affected. Meanwhile, PcToll3 silencing influenced the expression of myeloid differentiation factor 88 (PcMyd88), tumor necrosis factor-associated factor 6 (PcTRAF6), and PcDorsal, which were the counterparts of Drosophila Toll signaling pathway. Interestingly, PcToll3 silencing inhibited translocation of PcDorsal from cytoplasm to nucleus. Furthermore, the knockdown of PcDorsal also impaired the expression of AMPs after Vibrio challenge. Hence, we concluded that, besides participating in antiviral immunity, PcToll3 might also regulate the expression of Cru1 and Lys1 to participate in anti-Vibrio immune responses by promoting PcDorsal translocation into nucleus. Copyright © 2016 Elsevier Ltd. All rights reserved.

Calcineurin signaling and PGC-1alpha expression are suppressed during muscle atrophy due to diabetes.

PubMed

Roberts-Wilson, Tiffany K; Reddy, Ramesh N; Bailey, James L; Zheng, Bin; Ordas, Ronald; Gooch, Jennifer L; Price, S Russ

2010-08-01

PGC-1alpha is a transcriptional coactivator that controls energy homeostasis through regulation of glucose and oxidative metabolism. Both PGC-1alpha expression and oxidative capacity are decreased in skeletal muscle of patients and animals undergoing atrophy, suggesting that PGC-1alpha participates in the regulation of muscle mass. PGC-1alpha gene expression is controlled by calcium- and cAMP-sensitive pathways. However, the mechanism regulating PGC-1alpha in skeletal muscle during atrophy remains unclear. Therefore, we examined the mechanism responsible for decreased PGC-1alpha expression using a rodent streptozotocin (STZ) model of chronic diabetes and atrophy. After 21days, the levels of PGC-1alpha protein and mRNA were decreased. We examined the activation state of CREB, a potent activator of PGC-1alpha transcription, and found that phospho-CREB was paradoxically high in muscle of STZ-rats, suggesting that the cAMP pathway was not involved in PGC-1alpha regulation. In contrast, expression of calcineurin (Cn), a calcium-dependent phosphatase, was suppressed in the same muscles. PGC-1alpha expression is regulated by two Cn substrates, MEF2 and NFATc. Therefore, we examined MEF2 and NFATc activity in muscles from STZ-rats. Target genes MRF4 and MCIP1.4 mRNAs were both significantly reduced, consistent with reduced Cn signaling. Moreover, levels of MRF4, MCIP1.4, and PGC-1alpha were also decreased in muscles of CnAalpha-/- and CnAbeta-/- mice without diabetes indicating that decreased Cn signaling, rather than changes in other calcium- or cAMP-sensitive pathways, were responsible for decreased PGC-1alpha expression. These findings demonstrate that Cn activity is a major determinant of PGC-1alpha expression in skeletal muscle during diabetes and possibly other conditions associated with loss of muscle mass.

Calcineurin signaling and PGC-1α expression are suppressed during muscle atrophy due to diabetes

PubMed Central

Roberts-Wilson, Tiffany K.; Reddy, Ramesh N.; Bailey, James L.; Zheng, Bin; Ordas, Ronald; Gooch, Jennifer L.; Price, S. Russ

2010-01-01

PGC-1α is a transcriptional coactivator that controls energy homeostasis through regulation of glucose and oxidative metabolism. Both PGC-1α expression and oxidative capacity are decreased in skeletal muscle of patients and animals undergoing atrophy, suggesting that PGC-1α participates in the regulation of muscle mass. PGC-1α gene expression is controlled by calcium- and cAMP-sensitive pathways. However, the mechanism regulating PGC-1α in skeletal muscle during atrophy remains unclear. Therefore, we examined the mechanism responsible for decreased PGC-1α expression using a rodent streptozotocin (STZ) model of chronic diabetes and atrophy. After 21d, the levels of PGC-1α protein and mRNA were decreased. We examined the activation state of CREB, a potent activator of PGC-1α transcription, and found that phospho-CREB was paradoxically high in muscle of STZ-rats, suggesting that the cAMP pathway was not involved in PGC-1α regulation. In contrast, expression of calcineurin (Cn), a calcium-dependent phosphatase, was suppressed in the same muscles. PGC-1α expression is regulated by two Cn substrates, MEF2 and NFATc. Therefore, we examined MEF2 and NFATc activity in muscles from STZ-rats. Target genes MRF4 and MCIP1.4 were both significantly reduced, consistent with reduced Cn signaling. Moreover, levels of MRF4, MCIP1.4, and PGC-1α were also decreased in muscles of CnAα-/- and CnAβ-/- mice without diabetes indicating that decreased Cn signaling, rather than changes in other calcium- or cAMP-sensitive pathways, were responsible for decreased PGC-1α expression. These findings demonstrate that Cn activity is a major determinant of PGC-1α expression in skeletal muscle during diabetes and possibly other conditions associated with loss of muscle mass. PMID:20359506