Associations between toddler-age communication and kindergarten-age self-regulatory skills.
Aro, Tuija; Laakso, Marja-Leena; Määttä, Sira; Tolvanen, Asko; Poikkeus, Anna-Maija
2014-08-01
In this study, the authors aimed at gaining understanding on the associations of different types of early language and communication profiles with later self-regulation skills by using longitudinal data from toddler age to kindergarten age. Children with early language profiles representing expressive delay, broad delay (i.e., expressive, social, and/or symbolic), and typical language development were compared in domains of kindergarten-age executive and regulative skills (attentional/executive functions, regulation of emotions and behavioral activity, and social skills) assessed with parental questionnaires. Children with delay in toddler-age language development demonstrated poorer kindergarten-age self-regulation skills than children with typical early language development. Broad early language delays were associated with compromised social skills and attentional/executive functions, and early expressive delays were associated with a generally lower level of kindergarten-age executive and regulative skills. Regression analyses showed that both earlier and concurrent language had an effect especially on the attentional/executive functions. The findings suggest that different aspects of toddler-age language have differential associations with later self-regulation. Possible mechanisms linking early language development to later self-regulative development are discussed.
Discovery of time-delayed gene regulatory networks based on temporal gene expression profiling
Li, Xia; Rao, Shaoqi; Jiang, Wei; Li, Chuanxing; Xiao, Yun; Guo, Zheng; Zhang, Qingpu; Wang, Lihong; Du, Lei; Li, Jing; Li, Li; Zhang, Tianwen; Wang, Qing K
2006-01-01
Background It is one of the ultimate goals for modern biological research to fully elucidate the intricate interplays and the regulations of the molecular determinants that propel and characterize the progression of versatile life phenomena, to name a few, cell cycling, developmental biology, aging, and the progressive and recurrent pathogenesis of complex diseases. The vast amount of large-scale and genome-wide time-resolved data is becoming increasing available, which provides the golden opportunity to unravel the challenging reverse-engineering problem of time-delayed gene regulatory networks. Results In particular, this methodological paper aims to reconstruct regulatory networks from temporal gene expression data by using delayed correlations between genes, i.e., pairwise overlaps of expression levels shifted in time relative each other. We have thus developed a novel model-free computational toolbox termed TdGRN (Time-delayed Gene Regulatory Network) to address the underlying regulations of genes that can span any unit(s) of time intervals. This bioinformatics toolbox has provided a unified approach to uncovering time trends of gene regulations through decision analysis of the newly designed time-delayed gene expression matrix. We have applied the proposed method to yeast cell cycling and human HeLa cell cycling and have discovered most of the underlying time-delayed regulations that are supported by multiple lines of experimental evidence and that are remarkably consistent with the current knowledge on phase characteristics for the cell cyclings. Conclusion We established a usable and powerful model-free approach to dissecting high-order dynamic trends of gene-gene interactions. We have carefully validated the proposed algorithm by applying it to two publicly available cell cycling datasets. In addition to uncovering the time trends of gene regulations for cell cycling, this unified approach can also be used to study the complex gene regulations related to the development, aging and progressive pathogenesis of a complex disease where potential dependences between different experiment units might occurs. PMID:16420705
Tang, Qinghuang; Li, Liwen; Lee, Min-Jung; Ge, Qing; Lee, Jong-Min; Jung, Han-Sung
2016-03-01
Retinoic acid (RA)-induced cleft palate results from both extrinsic obstructions by the tongue and internal factors within the palatal shelves. Our previous study showed that the spatiotemporal expression of Rac1 regulates the fibronectin (FN) arrangement through cell density alterations that play an important role in palate development. In this study, we investigate the involvement of the Rac1 regulation of the FN arrangement in RA-induced cleft palate. Our results demonstrate that RA-induced intrinsic alterations in palatal shelves, including a delayed progress of cell condensation, delay palate development, even after the removal of the tongue. Further analysis shows that RA treatment diminishes the region-distinctive expression of Rac1 within the palatal shelves, which reversely alters the fibrillar arrangement of FN. Furthermore, RA treatment disrupts the formation of lamellipodia, which are indicative structures of cell migration that are regulated by Rac1. These results suggest that the Rac1 regulation of the FN arrangement is involved in RA-induced cleft palate through the regulation of cell migration, which delays the progress of cell condensation and subsequently influences the FN arrangement, inducing a delay in palate development. Our study provides new insights into the RA-induced impairment of palatal shelf elevation based on cell migration dynamics.
Wang, Jian-Hui; Liu, Jian-Jun; Chen, Ke-Ling; Li, Hong-Wen; He, Jian; Guan, Bin; He, Li
2017-12-21
Transcriptome and proteome analyses on fruit pulp from the blood orange 'Zaohong' and the navel orange 'twenty-first century' were performed to study Citrus sinensis quality-related molecular changes during consecutive developmental periods, including young fruit, fruit-coloring onset and fruit delayed-harvest for two months, during which fruit remained on the trees. The time-course analysis for the fruit developmental periods indicated a complex, dynamic gene expression pattern, with the numbers of differentially expressed genes (DEGs) between the two cultivars being 119, 426 and 904 at the three continuous stages tested during fruit development and ripening. The continuous increase in total soluble solids over the course of fruit development was correlated with up-regulated sucrose phosphate synthase (SPS) transcription levels in both cultivars. Eleven differentially expressed genes between the two cultivars involved in the flavonoid pathway were significantly enriched at the onset of the fruit-coloring stage when anthocyanins were detected in blood orange alone. Among 5185 proteins, 65 up-regulated and 29 down-regulated proteins were co-expressed with their cognate mRNAs with significant transcription and protein expression levels when the fruits from the two cultivars were compared at the fruit delayed-harvest stage. Additionally, important genes participating in the γ-aminobutyric acid (GABA) shunt were activated in blood orange at two significant expression levels in the fruit delayed-harvest stage. Thus, organic acids in fruit continuously decreased during this stage. This research was the first to provide a more comprehensive understanding of the differentially expressed genes involved in anthocyanin, sucrose and citrate metabolism at the transcriptome and proteome levels in C. sinensis, especially during the fruit delayed-harvest stage.
Diallo, Amadou; Kane, Ndjido; Agharbaoui, Zahra; Badawi, Mohamed; Sarhan, Fathey
2010-01-13
The vernalization gene 2 (VRN2), is a major flowering repressor in temperate cereals that is regulated by low temperature and photoperiod. Here we show that the gene from Triticum aestivum (TaVRN2) is also regulated by salt, heat shock, dehydration, wounding and abscissic acid. Promoter analysis indicates that TaVRN2 regulatory region possesses all the specific responsive elements to these stresses. This suggests pleiotropic effects of TaVRN2 in wheat development and adaptability to the environment. To test if TaVRN2 can act as a flowering repressor in species different from the temperate cereals, the gene was ectopically expressed in the model plant Arabidopsis. Transgenic plants showed no alteration in morphology, but their flowering time was significantly delayed compared to controls plants, indicating that TaVRN2, although having no ortholog in Brassicaceae, can act as a flowering repressor in these species. To identify the possible mechanism by which TaVRN2 gene delays flowering in Arabidopsis, the expression level of several genes involved in flowering time regulation was determined. The analysis indicates that the late flowering of the 35S::TaVRN2 plants was associated with a complex pattern of expression of the major flowering control genes, FCA, FLC, FT, FVE and SOC1. This suggests that heterologous expression of TaVRN2 in Arabidopsis can delay flowering by modulating several floral inductive pathways. Furthermore, transgenic plants showed higher freezing tolerance, likely due to the accumulation of CBF2, CBF3 and the COR genes. Overall, our data suggests that TaVRN2 gene could modulate a common regulator of the two interacting pathways that regulate flowering time and the induction of cold tolerance. The results also demonstrate that TaVRN2 could be used to manipulate flowering time and improve cold tolerance in other species.
Anuradha; Krishna, Amitabh
2017-11-01
Cynopterus sphinx, a fruit bat, undergoes delayed embryonic development during the winter months, a period that corresponds to low levels of progesterone and estradiol synthesis by the ovary. Kisspeptins (KPs) are a group of neuropeptide hormones that act via G-protein coupled receptor 54 (GPR54) to stimulate hypothalamic secretion of Gonadotropin-releasing hormone, thereby regulating ovarian steroidogenesis, folliculogenesis, and ovulation. GPR54 is also expressed in the ovary, suggesting a direct role for KPs in ovarian steroidogenesis. The aim of present study was to determine if a low serum level of KP is responsible for reduced progesterone and estradiol levels during the period of delayed embryonic development in C. sphinx. Indeed, low serum KP abundance corresponded to reduced expression of GPR54 in ovarian luteal cells during the period of delayed development compared to normal development. In vitro and in vivo treatment with KP increased GPR54 abundance, via Extracellular signal regulated kinase and its downstream mediators, leading to increased progesterone synthesis in the ovary during delayed embryonic development. KP treatment also increased cholesterol uptake and elevated expression of Luteinizing hormone receptor and Steroid acute regulatory protein in the ovary, suggesting that elevation in circulating KP during delayed embryonic development may reactivate luteal activity. KPs may also enhance cell survival (BCL-2, reduced Caspase 3 activity) and angiogenesis (Vascular endothelium growth factor) during this period. The findings of this study thus demonstrate a regulatory role for KPs in the maintenance of luteal steroidogenesis during pregnancy in C. sphinx. © 2017 Wiley Periodicals, Inc.
Regulation of gene expression in plasmid ColE1: delayed expression of the kil gene.
Zhang, S P; Yan, L F; Zubay, G
1988-01-01
cea, imm, and kil are a cluster of three functionally related genes of the plasmid ColE1. The cea and kil genes are in the same inducible operon, with transcription being initiated from a promoter adjacent to the cea gene. The imm gene is located between the cea and kil genes, but it is transcribed in the opposite direction. Complementary interaction between the imm mRNA and the anti-imm sequences in the middle of the cea-kil transcript causes a pronounced delay in expression of the kil gene when the cea-kil operon is induced. A segment in the overlapping region between the cea and imm genes causes delayed expression of the kil gene in the absence of imm gene transcription. This delay effect increases the yields of colicin synthesized in induced cells. Images PMID:3142845
Zhang, Gui-Zhi; Jin, Shang-Hui; Li, Pan; Jiang, Xiao-Yi; Li, Yan-Jie; Hou, Bing-Kai
2017-12-01
Ectopic expression of auxin glycosyltransferase UGT84A2 in Arabidopsis can delay flowering through increased indole-3-butyric acid and suppressed transcription of ARF6, ARF8 and flowering-related genes FT, SOC1, AP1 and LFY. Auxins are critical regulators for plant growth and developmental processes. Auxin homeostasis is thus an important issue for plant biology. Here, we identified an indole-3-butyric acid (IBA)-specific glycosyltransferase, UGT84A2, and characterized its role in Arabidopsis flowering development. UGT84A2 could catalyze the glycosylation of IBA, but not indole-3-acetic acid (IAA). UGT84A2 transcription expression was clearly induced by IBA. When ectopically expressing in Arabidopsis, UGT84A2 caused obvious delay in flowering. Correspondingly, the increase of IBA level, the down-regulation of AUXIN RESPONSE FACTOR 6 (ARF6) and ARF8, and the down-regulation of flowering-related genes such as FLOWERING LOCUS T (FT), SUPPRESSOR OF OVEREXPRESSION OF CO1(SOC1), APETALA1 (AP1), and LEAFY(LFY) were observed in transgenic plants. When exogenously applying IBA to wild-type plants, the late flowering phenotype, the down-regulation of ARF6, ARF8 and flowering-related genes recurred. We examined the arf6arf8 double mutants and found that the expression of flowering-related genes was also substantially decreased in these mutants. Together, our results suggest that glycosyltransferase UGT84A2 may be involved in flowering regulation through indole-3-butyric acid-mediated transcriptional repression of ARF6, ARF8 and downstream flowering pathway genes.
Dong, Xiangshu; Kim, Wan Kyu; Lim, Yong-Pyo; Kim, Yeon-Ki; Hur, Yoonkang
2013-02-01
We investigated the mechanism regulating cytoplasmic male sterility (CMS) in Brassica rapa ssp. pekinensis using floral bud transcriptome analyses of Ogura-CMS Chinese cabbage and its maintainer line in B. rapa 300-K oligomeric probe (Br300K) microarrays. Ogura-CMS Chinese cabbage produced few and infertile pollen grains on indehiscent anthers. Compared to the maintainer line, CMS plants had shorter filaments and plant growth, and delayed flowering and pollen development. In microarray analysis, 4646 genes showed different expression, depending on floral bud size, between Ogura-CMS and its maintainer line. We found 108 and 62 genes specifically expressed in Ogura-CMS and its maintainer line, respectively. Ogura-CMS line-specific genes included stress-related, redox-related, and B. rapa novel genes. In the maintainer line, genes related to pollen coat and germination were specifically expressed in floral buds longer than 3mm, suggesting insufficient expression of these genes in Ogura-CMS is directly related to dysfunctional pollen. In addition, many nuclear genes associated with auxin response, ATP synthesis, pollen development and stress response had delayed expression in Ogura-CMS plants compared to the maintainer line, which is consistent with the delay in growth and development of Ogura-CMS plants. Delayed expression may reduce pollen grain production and/or cause sterility, implying that mitochondrial, retrograde signaling delays nuclear gene expression. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Wu, Mingzhu; Huang, Jingjing; Xu, Sheng; Ling, Tengfang; Xie, Yanjie; Shen, Wenbiao
2011-01-01
Haem oxygenase-1 (HO-1) confers protection against a variety of oxidant-induced cell and tissue injury in animals and plants. In this report, it is confirmed that programmed cell death (PCD) in wheat aleurone layers is stimulated by GA and prevented by ABA. Meanwhile, HO activity and HO-1 protein expression exhibited lower levels in GA-treated layers, whereas the hydrogen peroxide (H2O2) content was apparently increased. The pharmacology approach illustrated that scavenging or accumulating H2O2 either delayed or accelerated GA-induced PCD. Furthermore, pretreatment with the HO-1 specific inhibitor, zinc protoporphyrin IX (ZnPPIX), before exposure to GA, not only decreased HO activity but also accelerated GA-induced PCD significantly. The application of the HO-1 inducer, haematin, and the enzymatic reaction product of HO, carbon monoxide (CO) aqueous solution, both of which brought about a noticeable induction of HO expression, substantially prevented GA-induced PCD. These effects were reversed when ZnPPIX was added, suggesting that HO in vivo played a role in delaying PCD. Meanwhile, catalase (CAT) and ascorbate peroxidase (APX) activities or transcripts were enhanced by haematin, CO, or bilirubin (BR), the catalytic by-product of HO. This enhancement resulted in a decrease in H2O2 production and a delay in PCD. In addition, the antioxidants butylated hydroxytoluene (BHT), dithiothreitol (DTT), and ascorbic acid (AsA) were able not only to delay PCD but also to mimic the effects of haematin and CO on HO up-regulation. Overall, the above results suggested that up-regulation of HO expression delays PCD through the down-regulation of H2O2 production. PMID:20797999
A common haplotype lowers PU.1 expression in myeloid cells and delays onset of Alzheimer's disease.
Huang, Kuan-Lin; Marcora, Edoardo; Pimenova, Anna A; Di Narzo, Antonio F; Kapoor, Manav; Jin, Sheng Chih; Harari, Oscar; Bertelsen, Sarah; Fairfax, Benjamin P; Czajkowski, Jake; Chouraki, Vincent; Grenier-Boley, Benjamin; Bellenguez, Céline; Deming, Yuetiva; McKenzie, Andrew; Raj, Towfique; Renton, Alan E; Budde, John; Smith, Albert; Fitzpatrick, Annette; Bis, Joshua C; DeStefano, Anita; Adams, Hieab H H; Ikram, M Arfan; van der Lee, Sven; Del-Aguila, Jorge L; Fernandez, Maria Victoria; Ibañez, Laura; Sims, Rebecca; Escott-Price, Valentina; Mayeux, Richard; Haines, Jonathan L; Farrer, Lindsay A; Pericak-Vance, Margaret A; Lambert, Jean Charles; van Duijn, Cornelia; Launer, Lenore; Seshadri, Sudha; Williams, Julie; Amouyel, Philippe; Schellenberg, Gerard D; Zhang, Bin; Borecki, Ingrid; Kauwe, John S K; Cruchaga, Carlos; Hao, Ke; Goate, Alison M
2017-08-01
A genome-wide survival analysis of 14,406 Alzheimer's disease (AD) cases and 25,849 controls identified eight previously reported AD risk loci and 14 novel loci associated with age at onset. Linkage disequilibrium score regression of 220 cell types implicated the regulation of myeloid gene expression in AD risk. The minor allele of rs1057233 (G), within the previously reported CELF1 AD risk locus, showed association with delayed AD onset and lower expression of SPI1 in monocytes and macrophages. SPI1 encodes PU.1, a transcription factor critical for myeloid cell development and function. AD heritability was enriched within the PU.1 cistrome, implicating a myeloid PU.1 target gene network in AD. Finally, experimentally altered PU.1 levels affected the expression of mouse orthologs of many AD risk genes and the phagocytic activity of mouse microglial cells. Our results suggest that lower SPI1 expression reduces AD risk by regulating myeloid gene expression and cell function.
Wang, Hong; Liu, Gang; Li, Chunxia; Powell, Ann L T; Reid, Michael S; Zhang, Zhen; Jiang, Cai-Zhong
2013-06-01
Ethylene and jasmonate (JA) have powerful effects when plants are challenged by pathogens. The inducible promoter-regulated expression of the Arabidopsis ethylene receptor mutant ethylene-insensitive1-1 (etr1-1) causes ethylene insensitivity in petunia. To investigate the molecular mechanisms involved in transgenic petunia responses to Botrytis cinerea related to the ethylene and JA pathways, etr1-1-expressing petunia plants were inoculated with Botrytis cinerea. The induced expression of etr1-1 by a chemical inducer dexamethasone resulted in retarded senescence and reduced disease symptoms on detached leaves and flowers or intact plants. The extent of decreased disease symptoms correlated positively with etr1-1 expression. The JA pathway, independent of the ethylene pathway, activated petunia ethylene response factor (PhERF) expression and consequent defence-related gene expression. These results demonstrate that ethylene induced by biotic stress influences senescence, and that JA in combination with delayed senescence by etr1-1 expression alters tolerance to pathogens. © 2013 BSPP AND JOHN WILEY & SONS LTD.
Aguilar, Claudio; Vlamakis, Hera; Guzman, Alejandra; Losick, Richard; Kolter, Roberto
2010-05-18
Bacillus subtilis cells form multicellular biofilm communities in which spatiotemporal regulation of gene expression occurs, leading to differentiation of multiple coexisting cell types. These cell types include matrix-producing and sporulating cells. Extracellular matrix production and sporulation are linked in that a mutant unable to produce matrix is delayed for sporulation. Here, we show that the delay in sporulation is not due to a growth advantage of the matrix-deficient mutant under these conditions. Instead, we show that the link between matrix production and sporulation is through the Spo0A signaling pathway. Both processes are regulated by the phosphorylated form of the master transcriptional regulator Spo0A. When cells have low levels of phosphorylated Spo0A (Spo0A~P), matrix genes are expressed; however, at higher levels of Spo0A~P, sporulation commences. We have found that Spo0A~P levels are maintained at low levels in the matrix-deficient mutant, thereby delaying expression of sporulation-specific genes. This is due to the activity of one of the components of the Spo0A phosphotransfer network, KinD. A deletion of kinD suppresses the sporulation defect of matrix mutants, while its overproduction delays sporulation. Our data indicate that KinD displays a dual role as a phosphatase or a kinase and that its activity is linked to the presence of extracellular matrix in the biofilms. We propose a novel role for KinD in biofilms as a checkpoint protein that regulates the onset of sporulation by inhibiting the activity of Spo0A until matrix, or a component therein, is sensed.
Aguilar, Claudio; Vlamakis, Hera; Guzman, Alejandra; Losick, Richard; Kolter, Roberto
2010-01-01
ABSTRACT Bacillus subtilis cells form multicellular biofilm communities in which spatiotemporal regulation of gene expression occurs, leading to differentiation of multiple coexisting cell types. These cell types include matrix-producing and sporulating cells. Extracellular matrix production and sporulation are linked in that a mutant unable to produce matrix is delayed for sporulation. Here, we show that the delay in sporulation is not due to a growth advantage of the matrix-deficient mutant under these conditions. Instead, we show that the link between matrix production and sporulation is through the Spo0A signaling pathway. Both processes are regulated by the phosphorylated form of the master transcriptional regulator Spo0A. When cells have low levels of phosphorylated Spo0A (Spo0A~P), matrix genes are expressed; however, at higher levels of Spo0A~P, sporulation commences. We have found that Spo0A~P levels are maintained at low levels in the matrix-deficient mutant, thereby delaying expression of sporulation-specific genes. This is due to the activity of one of the components of the Spo0A phosphotransfer network, KinD. A deletion of kinD suppresses the sporulation defect of matrix mutants, while its overproduction delays sporulation. Our data indicate that KinD displays a dual role as a phosphatase or a kinase and that its activity is linked to the presence of extracellular matrix in the biofilms. We propose a novel role for KinD in biofilms as a checkpoint protein that regulates the onset of sporulation by inhibiting the activity of Spo0A until matrix, or a component therein, is sensed. PMID:20689749
Associations between Toddler-Age Communication and Kindergarten-Age Self-Regulatory Skills
ERIC Educational Resources Information Center
Aro, Tuija; Laakso, Marja-Leena; Määttä, Sira; Tolvanen, Asko; Poikkeus, Anna-Maija
2014-01-01
Purpose: In this study, the authors aimed at gaining understanding on the associations of different types of early language and communication profiles with later self-regulation skills by using longitudinal data from toddler age to kindergarten age. Method: Children with early language profiles representing expressive delay, broad delay (i.e.,…
Seo, Eunyoung; Yeom, Seon-In; Jo, Sunghwan; Jeong, Heejin; Kang, Byoung-Cheorl; Choi, Doil
2012-04-01
Secreted proteins are known to have multiple roles in plant development, metabolism, and stress response. In a previous study to understand the roles of secreted proteins, Capsicum annuum secreted proteins (CaS) were isolated by yeast secretion trap. Among the secreted proteins, we further characterized Capsicum annuum senescence-delaying 1 (CaSD1), a gene encoding a novel secreted protein that is present only in the genus Capsicum. The deduced CaSD1 contains multiple repeats of the amino acid sequence KPPIHNHKPTDYDRS. Interestingly, the number of repeats varied among cultivars and species in the Capsicum genus. CaSD1 is constitutively expressed in roots, and Agrobacterium-mediated transient overexpression of CaSD1 in Nicotiana benthamiana leaves resulted in delayed senescence with a dramatically increased number of trichomes and enlarged epidermal cells. Furthermore, senescence- and cell division-related genes were differentially regulated by CaSD1-overexpressing plants. These observations imply that the pepper-specific cell wall protein CaSD1 plays roles in plant growth and development by regulating cell division and differentiation.
The chromatin remodeling factor CHD7 controls cerebellar development by regulating reelin expression
Whittaker, Danielle E.; Riegman, Kimberley L.H.; Kasah, Sahrunizam; Mohan, Conor; Yu, Tian; Sala, Blanca Pijuan; Hebaishi, Husam; Caruso, Angela; Marques, Ana Claudia; Michetti, Caterina; Smachetti, María Eugenia Sanz; Shah, Apar; Sabbioni, Mara; Kulhanci, Omer; Tee, Wee-Wei; Reinberg, Danny; Scattoni, Maria Luisa; McGonnell, Imelda; Wardle, Fiona C.; Fernandes, Cathy
2017-01-01
The mechanisms underlying the neurodevelopmental deficits associated with CHARGE syndrome, which include cerebellar hypoplasia, developmental delay, coordination problems, and autistic features, have not been identified. CHARGE syndrome has been associated with mutations in the gene encoding the ATP-dependent chromatin remodeler CHD7. CHD7 is expressed in neural stem and progenitor cells, but its role in neurogenesis during brain development remains unknown. Here we have shown that deletion of Chd7 from cerebellar granule cell progenitors (GCps) results in reduced GCp proliferation, cerebellar hypoplasia, developmental delay, and motor deficits in mice. Genome-wide expression profiling revealed downregulated expression of the gene encoding the glycoprotein reelin (Reln) in Chd7-deficient GCps. Recessive RELN mutations have been associated with severe cerebellar hypoplasia in humans. We found molecular and genetic evidence that reductions in Reln expression contribute to GCp proliferative defects and cerebellar hypoplasia in GCp-specific Chd7 mouse mutants. Finally, we showed that CHD7 is necessary for maintaining an open, accessible chromatin state at the Reln locus. Taken together, this study shows that Reln gene expression is regulated by chromatin remodeling, identifies CHD7 as a previously unrecognized upstream regulator of Reln, and provides direct in vivo evidence that a mammalian CHD protein can control brain development by modulating chromatin accessibility in neuronal progenitors. PMID:28165338
Wang, Hong; Stier, Genevieve; Lin, Jing; Liu, Gang; Zhang, Zhen; Chang, Youhong; Reid, Michael S; Jiang, Cai-Zhong
2013-01-01
Flowers of ethylene-sensitive ornamental plants transformed with ethylene-insensitive 1-1(etr1-1), a mutant ethylene receptor first isolated from Arabidopsis, are known to have longer shelf lives. We have generated petunia plants in which the etr1-1 gene was over-expressed under the control of a chemically-inducible promoter, which would allow expression of etr1-1 to be initiated at the desired time and stage of development. Here, we showed that transgenic plants grew and developed normally without a chemical inducer. Semi-quantitative RT-PCR demonstrated that the abundance of transcripts of Arabidopsis etr1-1 gene was substantially induced in flowers with 30 μM dexamethasone (DEX). Consequently, t he life of the flowers was almost doubled and the peak of ethylene production was delayed. We compared gene expression changes of petals with DEX to those without DEX at 24 h and 48 h by microarray. Our results indicated that transcripts of many putative genes encoding transcription factors were down-regulated by etr1-1 induced expression at the early stage. In addition, putative genes involved in gibberellin biosynthesis, response to jasmonic acid/gibberellins stimulus, cell wall modification, ethylene biosynthesis, and cell death were down-regulated associating with etr1-1 induced expression. We investigated time-course gene expression profiles and found two profiles which displayed totally opposite expression patterns under these two treatments. In these profiles, 'the regulation of transcription' was predominant in GO categories. Taking all results together, we concluded those transcription factors down-regulated at early stage might exert a major role in regulating the senescence process which were consequently characterized by cell wall modification and cell death.
Lin, Jing; Liu, Gang; Zhang, Zhen; Chang, Youhong; Reid, Michael S.; Jiang, Cai-Zhong
2013-01-01
Flowers of ethylene-sensitive ornamental plants transformed with ethylene-insensitive 1-1(etr1-1), a mutant ethylene receptor first isolated from Arabidopsis, are known to have longer shelf lives. We have generated petunia plants in which the etr1-1 gene was over-expressed under the control of a chemically-inducible promoter, which would allow expression of etr1-1 to be initiated at the desired time and stage of development. Here, we showed that transgenic plants grew and developed normally without a chemical inducer. Semi-quantitative RT-PCR demonstrated that the abundance of transcripts of Arabidopsis etr1-1 gene was substantially induced in flowers with 30 μM dexamethasone (DEX). Consequently, t he life of the flowers was almost doubled and the peak of ethylene production was delayed. We compared gene expression changes of petals with DEX to those without DEX at 24 h and 48 h by microarray. Our results indicated that transcripts of many putative genes encoding transcription factors were down-regulated by etr1-1 induced expression at the early stage. In addition, putative genes involved in gibberellin biosynthesis, response to jasmonic acid/gibberellins stimulus, cell wall modification, ethylene biosynthesis, and cell death were down-regulated associating with etr1-1 induced expression. We investigated time-course gene expression profiles and found two profiles which displayed totally opposite expression patterns under these two treatments. In these profiles, ‘the regulation of transcription’ was predominant in GO categories. Taking all results together, we concluded those transcription factors down-regulated at early stage might exert a major role in regulating the senescence process which were consequently characterized by cell wall modification and cell death. PMID:23874385
Describing-function analysis of a ripple regulator with slew-rate limits and time delays
NASA Technical Reports Server (NTRS)
Wester, Gene W.
1990-01-01
The effects of time delays and slew-rate limits on the steady-state operating points and performance of a free-running ripple regulator are evaluated using describing-function analysis. The describing function of an ideal comparator (no time delays or slew rate limits) has no phase shift and is independent of frequency. It is found that turn-on delay and turn-off delay have different effects on gain and phase and cannot be combined. Comparator hysteresis affects both gain and phase; likewise, time delays generally affect both gain and phase. It is found that the effective time delay around the feedback loop is one half the sum of turn-on and turn-off delays, regardless of whether the delays are caused by storage time or slew rate limits. Expressions are formulated for the switching frequency, switch duty ratio, dc output, and output ripple. For the case of no hysteresis, a simple, graphical solution for the switching frequency is possible, and the resulting switching frequency is independent of first-order variations of input or load.
Veatch, Olivia J; Pendergast, Julie S; Allen, Melissa J; Leu, Roberta M; Johnson, Carl Hirschie; Elsea, Sarah H; Malow, Beth A
2015-01-01
Sleep disruption is common in individuals with autism spectrum disorder (ASD). Genes whose products regulate endogenous melatonin modify sleep patterns and have been implicated in ASD. Genetic factors likely contribute to comorbid expression of sleep disorders in ASD. We studied a clinically unique ASD subgroup, consisting solely of children with comorbid expression of sleep onset delay. We evaluated variation in two melatonin pathway genes, acetylserotonin O-methyltransferase (ASMT) and cytochrome P450 1A2 (CYP1A2). We observed higher frequencies than currently reported (p < 0.04) for variants evidenced to decrease ASMT expression and related to decreased CYP1A2 enzyme activity (p ≤ 0.0007). We detected a relationship between genotypes in ASMT and CYP1A2 (r(2) = 0.63). Our results indicate that expression of sleep onset delay relates to melatonin pathway genes.
Ko, Hyun-Ja; Kinkel, Sarah A; Hubert, François-Xavier; Nasa, Zeyad; Chan, James; Siatskas, Christopher; Hirubalan, Premila; Toh, Ban-Hock; Scott, Hamish S; Alderuccio, Frank
2010-12-01
The autoimmune regulator (AIRE) promotes "promiscuous" expression of tissue-restricted antigens (TRA) in thymic medullary epithelial cells to facilitate thymic deletion of autoreactive T-cells. Here, we show that AIRE-deficient mice showed an earlier development of myelin oligonucleotide glycoprotein (MOG)-induced experimental autoimmune encephalomyelitis (EAE). To determine the outcome of ectopic Aire expression, we used a retroviral transduction system to over-express Aire in vitro, in cell lines and in bone marrow (BM). In the cell lines that included those of thymic medullary and dendritic cell origin, ectopically expressed Aire variably promoted expression of TRA including Mog and Ins2 (proII) autoantigens associated, respectively, with the autoimmune diseases multiple sclerosis and type 1 diabetes. BM chimeras generated from BM transduced with a retrovirus encoding Aire displayed elevated levels of Mog and Ins2 expression in thymus and spleen. Following induction of EAE with MOG(35-55), transplanted mice displayed significant delay in the onset of EAE compared with control mice. To our knowledge, this is the first example showing that in vivo ectopic expression of AIRE can modulate TRA expression and alter autoimmune disease development. Copyright © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Expression of a nitric oxide degrading enzyme induces a senescence programme in Arabidopsis.
Mishina, Tatiana E; Lamb, Chris; Zeier, Jürgen
2007-01-01
Nitric oxide (NO) has been proposed to act as a factor delaying leaf senescence and fruit maturation in plants. Here we show that expression of a NO degrading dioxygenase (NOD) in Arabidopsis thaliana initiates a senescence-like phenotype, an effect that proved to be more pronounced in older than in younger leaves. This senescence phenotype was preceded by a massive switch in gene expression in which photosynthetic genes were down-regulated, whereas many senescence-associated genes (SAGs) and the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene ACS6 involved in ethylene synthesis were up-regulated. External fumigation of NOD plants with NO as well as environmental conditions known to stimulate endogenous NO production attenuated the induced senescence programme. For instance, both high light conditions and nitrate feeding reduced the senescence phenotype and attenuated the down-regulation of photosynthetic genes as well as the up-regulation of SAGs. Treatment of plants with the cytokinin 6-benzylaminopurin (BAP) reduced the down-regulation of photosynthesis, although it had no consistent effect on SAG expression. Metabolic changes during NOD-induced senescence comprehended increases in salicylic acid (SA) levels, accumulation of the phytoalexin camalexin and elevation of leaf gamma-tocopherol contents, all of which occurred during natural senescence in Arabidopsis leaves as well. Moreover, NO fumigation delayed the senescence process induced by darkening individual Arabidopsis Columbia-0 (Col-0) leaves. Our data thus support the notion that NO acts as a negative regulator of leaf senescence.
Grieb, Brian C; Boyd, Kelli; Mitra, Ramkrishna; Eischen, Christine M
2016-10-30
Alterations of specific genes can modulate aging. Myc, a transcription factor that regulates the expression of many genes involved in critical cellular functions was shown to have a role in controlling longevity. Decreased expression of Myc inhibited many of the deleterious effects of aging and increased lifespan in mice. Without altering Myc expression, reduced levels of Mtbp, a recently identified regulator of Myc, limit Myc transcriptional activity and proliferation, while increased levels promote Myc-mediated effects. To determine the contribution of Mtbp to the effects of Myc on aging, we studied a large cohort of Mtbp heterozygous mice and littermate matched wild-type controls. Mtbp haploinsufficiency significantly increased longevity and maximal survival in mice. Reduced levels of Mtbp did not alter locomotor activity, litter size, or body size, but Mtbp heterozygous mice did exhibit elevated markers of metabolism, particularly in the liver. Mtbp +/- mice also had a significant delay in spontaneous cancer development, which was most prominent in the hematopoietic system, and an altered tumor spectrum compared to Mtbp +/+ mice. Therefore, the data suggest Mtbp is a regulator of longevity in mice that mimics some, but not all, of the properties of Myc in aging.
Oscillatory regulation of Hes1: Discrete stochastic delay modelling and simulation.
Barrio, Manuel; Burrage, Kevin; Leier, André; Tian, Tianhai
2006-09-08
Discrete stochastic simulations are a powerful tool for understanding the dynamics of chemical kinetics when there are small-to-moderate numbers of certain molecular species. In this paper we introduce delays into the stochastic simulation algorithm, thus mimicking delays associated with transcription and translation. We then show that this process may well explain more faithfully than continuous deterministic models the observed sustained oscillations in expression levels of hes1 mRNA and Hes1 protein.
Sawarkar, Ritwick; Visweswariah, Sandhya S; Nellen, Wolfgang; Nanjundiah, Vidyanand
2009-09-04
Epigenetic modifications of histones regulate gene expression and lead to the establishment and maintenance of cellular phenotypes during development. Histone acetylation depends on a balance between the activities of histone acetyltransferases and histone deacetylases (HDACs) and influences transcriptional regulation. In this study, we analyse the roles of HDACs during growth and development of one of the cellular slime moulds, the social amoeba Dictyostelium discoideum. The inhibition of HDAC activity by trichostatin A results in histone hyperacetylation and a delay in cell aggregation and differentiation. Cyclic AMP oscillations are normal in starved amoebae treated with trichostatin A but the expression of a subset of cAMP-regulated genes is delayed. Bioinformatic analysis indicates that there are four genes encoding putative HDACs in D. discoideum. Using biochemical, genetic and developmental approaches, we demonstrate that one of these four genes, hdaB, is dispensable for growth and development under laboratory conditions. A knockout of the hdaB gene results in a social context-dependent phenotype: hdaB(-) cells develop normally but sporulate less efficiently than the wild type in chimeras. We infer that HDAC activity is important for regulating the timing of gene expression during the development of D. discoideum and for defining aspects of the phenotype that mediate social behaviour in genetically heterogeneous groups.
Irx1 regulates dental outer enamel epithelial and lung alveolar type II epithelial differentiation
Yu, Wenjie; Li, Xiao; Eliason, Steven; Romero-Bustillos, Miguel; Ries, Ryan J.; Cao, Huojun; Amendt, Brad A.
2017-01-01
The Iroquois genes (Irx) appear to regulate fundamental processes that lead to cell proliferation, differentiation, and maturation during development. In this report, the Iroquois homeobox 1 (Irx1) transcription factor was functionally disrupted using a LacZ insert and LacZ expression demonstrated stage-specific expression during embryogenesis. Irx1 is highly expressed in the brain, lung, digits, kidney, testis and developing teeth. Irx1 null mice are neonatal lethal and this lethality it due to pulmonary immaturity. Irx1−/− mice show delayed lung maturation characterized by defective surfactant protein secretion and Irx1 marks a population of SP-C expressing alveolar type II cells. Irx1 is specifically expressed in the outer enamel epithelium (OEE), stellate reticulum (SR) and stratum intermedium (SI) layers of the developing tooth. Irx1 mediates dental epithelial cell differentiation in the lower incisors resulting in delayed growth of the lower incisors. Irx1 is specifically and temporally expressed during developmental stages and we have focused on lung and dental development in this report. Irx1+ cells are unique to the development of the incisor outer enamel epithelium, patterning of Lef-1+ and Sox2+ cells as well as a new marker for lung alveolar type II cells. Mechanistically, Irx1 regulates Foxj1 and Sox9 to control cell differentiation during development. PMID:28746823
Irx1 regulates dental outer enamel epithelial and lung alveolar type II epithelial differentiation.
Yu, Wenjie; Li, Xiao; Eliason, Steven; Romero-Bustillos, Miguel; Ries, Ryan J; Cao, Huojun; Amendt, Brad A
2017-09-01
The Iroquois genes (Irx) appear to regulate fundamental processes that lead to cell proliferation, differentiation, and maturation during development. In this report, the Iroquois homeobox 1 (Irx1) transcription factor was functionally disrupted using a LacZ insert and LacZ expression demonstrated stage-specific expression during embryogenesis. Irx1 is highly expressed in the brain, lung, digits, kidney, testis and developing teeth. Irx1 null mice are neonatal lethal and this lethality it due to pulmonary immaturity. Irx1 -/- mice show delayed lung maturation characterized by defective surfactant protein secretion and Irx1 marks a population of SP-C expressing alveolar type II cells. Irx1 is specifically expressed in the outer enamel epithelium (OEE), stellate reticulum (SR) and stratum intermedium (SI) layers of the developing tooth. Irx1 mediates dental epithelial cell differentiation in the lower incisors resulting in delayed growth of the lower incisors. Irx1 is specifically and temporally expressed during developmental stages and we have focused on lung and dental development in this report. Irx1+ cells are unique to the development of the incisor outer enamel epithelium, patterning of Lef-1+ and Sox2+ cells as well as a new marker for lung alveolar type II cells. Mechanistically, Irx1 regulates Foxj1 and Sox9 to control cell differentiation during development. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
2012-01-01
Background Understanding gene interactions is a fundamental question in systems biology. Currently, modeling of gene regulations using the Bayesian Network (BN) formalism assumes that genes interact either instantaneously or with a certain amount of time delay. However in reality, biological regulations, both instantaneous and time-delayed, occur simultaneously. A framework that can detect and model both these two types of interactions simultaneously would represent gene regulatory networks more accurately. Results In this paper, we introduce a framework based on the Bayesian Network (BN) formalism that can represent both instantaneous and time-delayed interactions between genes simultaneously. A novel scoring metric having firm mathematical underpinnings is also proposed that, unlike other recent methods, can score both interactions concurrently and takes into account the reality that multiple regulators can regulate a gene jointly, rather than in an isolated pair-wise manner. Further, a gene regulatory network (GRN) inference method employing an evolutionary search that makes use of the framework and the scoring metric is also presented. Conclusion By taking into consideration the biological fact that both instantaneous and time-delayed regulations can occur among genes, our approach models gene interactions with greater accuracy. The proposed framework is efficient and can be used to infer gene networks having multiple orders of instantaneous and time-delayed regulations simultaneously. Experiments are carried out using three different synthetic networks (with three different mechanisms for generating synthetic data) as well as real life networks of Saccharomyces cerevisiae, E. coli and cyanobacteria gene expression data. The results show the effectiveness of our approach. PMID:22691450
Seo, Eunyoung; Yeom, Seon-In; Jo, SungHwan; Jeong, Heejin; Kang, Byoung-Cheorl; Choi, Doil
2012-01-01
Secreted proteins are known to have multiple roles in plant development, metabolism, and stress response. In a previous study to understand the roles of secreted proteins, Capsicum annuum secreted proteins (CaS) were isolated by yeast secretion trap. Among the secreted proteins, we further characterized Capsicum annuum senescence-delaying 1 (CaSD1), a gene encoding a novel secreted protein that is present only in the genus Capsicum. The deduced CaSD1 contains multiple repeats of the amino acid sequence KPPIHNHKPTDYDRS. Interestingly, the number of repeats varied among cultivars and species in the Capsicum genus. CaSD1 is constitutively expressed in roots, and Agrobacterium-mediated transient overexpression of CaSD1 in Nicotiana benthamiana leaves resulted in delayed senescence with a dramatically increased number of trichomes and enlarged epidermal cells. Furthermore, senescence- and cell division-related genes were differentially regulated by CaSD1-overexpressing plants. These observations imply that the pepper-specific cell wall protein CaSD1 plays roles in plant growth and development by regulating cell division and differentiation. PMID:22441673
Oscillatory Regulation of Hes1: Discrete Stochastic Delay Modelling and Simulation
Barrio, Manuel; Burrage, Kevin; Leier, André; Tian, Tianhai
2006-01-01
Discrete stochastic simulations are a powerful tool for understanding the dynamics of chemical kinetics when there are small-to-moderate numbers of certain molecular species. In this paper we introduce delays into the stochastic simulation algorithm, thus mimicking delays associated with transcription and translation. We then show that this process may well explain more faithfully than continuous deterministic models the observed sustained oscillations in expression levels of hes1 mRNA and Hes1 protein. PMID:16965175
Makwana, Kuldeep; Patel, Sonal Arvind; Velingkaar, Nikkhil; Ebron, Jey Sabith; Shukla, Girish C; Kondratov, Roman V Kondratov V
2017-07-31
Calorie restriction (CR) is a dietary intervention known to delay aging. In order, to understand molecular mechanisms of CR, we analyzed the expression of 983 MicroRNAs (miRNAs) in the liver of female mice after 2 years of 30% CR using micro-array. 16 miRNAs demonstrated significant changes in their expression upon CR in comparison with age-matched control. mmu-miR-125a-5p (miR-125a-5p) was significantly upregulated upon CR, and in agreement with this, the expression of mRNAs for its three predicted target genes: Stat3, Casp2, and Stard13 was significantly downregulated in the liver of CR animals. The expression of precursor miRNA for miR-125a-5p was also upregulated upon CR, which suggests its regulation at the level of transcription. Upon aging miR-125a-5p expression was downregulated while the expression of its target genes was upregulated. Thus, CR prevented age-associated changes in the expression of miR-125a-5p and its targets. We propose that miR-125a-5p dependent downregulation of Stat3, Casp2, and Stard13 contributes to the calorie restriction-mediated delay of aging.
CONSTANS-like 9 (COL9) delays the flowering time in Oryza sativa by repressing the Ehd1 pathway.
Liu, Hao; Gu, Fengwei; Dong, Shuangyu; Liu, Wei; Wang, Hui; Chen, Zhiqiang; Wang, Jiafeng
2016-10-14
Flowering or heading is one of most important agronomic traits in rice. It has been characterized that CONSTANS (CO) and CONSTANS-like (COL) proteins are critical flowering regulators in response to photoperiodic stress in plants. We have previously identified that the COL family member OsCOL9 can positively enhance the rice blast resistance. In the present study, we aimed to explore the functional role of OsCOL9 in modulating the photoperiodic flowering. Our data showed that overexpression of OsCOL9 delayed the flowering time under both short-day (SD) and long-day (LD) conditions, leading to suppressed expressions of EHd1, RFT and Hd3a at the mRNA Level. OsCOL9 expression exhibited two types of circadian patterns under different daylight conditions, and it could delay the heading date by suppressing the Ehd1 photoperiodic flowering pathway. In contrast, the expressions of previously reported flowering regulators were not significantly changed in OsCOL9 transgenic plants, indicating that OsCOL9 functioned independently of other flowering pathways. In addition, OsCOL9 served as a potential yield gene, and its deficiency reduced the grain number of main panicle in plants. Furthermore, yeast two-hybrid assay indicated that OsCOL9 physically interacted with Receptor for Activated C-kinase 1 (OsRACK1). Rhythmic pattern analysis suggested that OsRACK1 responded to the change of daylight, which was regulated by the circadian clock. Taken together, our results revealed that OsCOL9 could delay the flowering time in rice by repressing the Ehd1 pathway. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
X chromosome regulation: diverse patterns in development, tissues and disease
Deng, Xinxian; Berletch, Joel B.; Nguyen, Di K.; Disteche, Christine M.
2014-01-01
Genes on the mammalian X chromosome are present in one copy in males and two copies in females. The complex mechanisms that regulate the X chromosome lead to evolutionary and physiological variability in gene expression between species, the sexes, individuals, developmental stages, tissues and cell types. In early development, delayed and incomplete X chromosome inactivation (XCI) in some species causes variability in gene expression. Additional diversity stems from escape from XCI and from mosaicism or XCI skewing in females. This causes sex-specific differences that manifest as differential gene expression and associated phenotypes. Furthermore, the complexity and diversity of X dosage regulation affect the severity of diseases caused by X-linked mutations. PMID:24733023
PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induce...
Kuai, Le; Zhang, Jing-Ting; Deng, Yu; Xu, Shun; Xu, Xun-Zhe; Wu, Min-Feng; Guo, Dong-Jie; Chen, Yu; Wu, Ren-Jie; Zhao, Xing-Qiang; Nian, Hua; Li, Bin; Li, Fu-Lun
2018-01-29
Sheng-ji Hua-yu(SJHY) formula is one of the most useful Traditional Chinese medicine (TCM) in the treatment of the delayed diabetic wound. However, elucidating the related molecular biological mechanism of how the SJHY Formula affects excessive inflammation in the process of re-epithelialization of diabetic wound healing is a task urgently needed to be fulfilled. The objectives of this study is to evaluate the effect of antagonisic expression of pro-/anti-inflammatory factors on transforming growth factor-β(TGF-β) superfamily (activin and follistatin) in the process of re-epithelialization of diabetic wound healing in vivo, and to characterize the involvement of the activin/follistatin protein expression regulation, phospho-Smad (pSmad2), and Nuclear factor kappa B p50 (NF-kB) p50 in the diabetic wound healing effects of SJHY formula. SJHY Formula was prepared by pharmaceutical preparation room of Yueyang Hospital of Integrated Traditional Chinese and Western Medicine. Diabetic wound healing activity was evaluated by circular excision wound models. Wound healing activity was examined by macroscopic evaluation. Activin/follistatin expression regulation, protein expression of pSmad2 and NF-kB p50 in skin tissue of wounds were analyzed by Real Time PCR, Western blot, immunohistochemistry and hematoxylin and eosin (H&E) staining. Macroscopic evaluation analysis showed that wound healing of diabetic mice was delayed, and SJHY Formula accelerated wound healing time of diabetic mice. Real Time PCR analysis showed higher mRNA expression of activin/follistatin in diabetic delayed wound versus the wound in normal mice. Western Blot immunoassay analysis showed reduction of activin/follistatin proteins levels by SJHY Formula treatment 15 days after injury. Immunohistochemistry investigated the reduction of pSmad2 and NF-kB p50 nuclear staining in the epidermis of diabetic SJHY versus diabetic control mice on day 15 after wounding. H&E staining revealed that SJHY Formula accelerated re-epithelialization of diabetic wound healing. The present study found that diabetic delayed wound healing time is closely related to the high expression level of activin/follistatin, which leads to excessive inflammation in the process of re-epithelization. SJHY Formula accelerates re-epithelialization and healing time of diabetic wounds through decreasing the high expression of activin/follistatin.
NASA Astrophysics Data System (ADS)
Cariveau, Mickael J.
2005-07-01
Molecular responses to radiation-induced DNA double strand breaks (DSB) are mediated by the phosphorylation of the histone variant H2AX which forms identifiable gamma-H2AX foci at the site of the DSB. This event is thought to be linked with the down-regulation of signaling proteins contributing to the checkpoints regulating cell cycle progression and, vis-a-vis , the induction of cell division delay. However, it is unclear whether this division delay is directly related to the number of DSB (gamma-H2AX foci) sustained by an irradiated cell and, if so, whether this number drives cells into cell cycle delay or apoptosis. For this reason, studies were conducted in the immortalized NIH/3T3 fibroblast cell in order to establish correlations between the temporal appearance of the gamma-H2AX foci (a DSB) and the expression of the cell cycle regulatory proteins, cyclin E, A, B1, and their cyclin kinase inhibitor, p21. Cell cycle kinetics and flow cytometry were used to establish radiation-induced division delay over a dose range of 1--6 Gy where a mitotic delay of 2.65 min/cGy was established. Correlations between the expression of cyclin E, A, B1, p21, and the generation of DSB were established in NIH/3T3 cells exposed to 2 or 4 Gy x-irradiation. The data suggest that the G1/S and S phase delay (cyclin E and cyclin A protein levels) are dependent on the dose of radiation while the G2/M (cyclin B1 protein levels) delay is dependent on the quantity of DSB sustained by the irradiated cell.
Elder, B. Laurel; Arlian, Larry G.; Morgan, Marjorie S.
2007-01-01
The inflammatory and immune responses seen with the worldwide disease scabies (caused by the mite Sarcoptes scabiei) are complex. Clinical symptoms are delayed for weeks in patients when they are infested with scabies for the first time. This study was undertaken to elucidate the role of the human dermal microvascular endothelial cell (HMVEC-D) in modulating the inflammatory and immune responses in the skin to S. scabiei. Extracts of S. scabiei were incubated with HMVEC-D and the expression of adhesion molecules and chemokine receptors on the cells and the secretion of selected cytokines were determined by ELISA. S. scabiei extract was found to inhibit HMVEC-D expression of E-selectin and vascular cell adhesion molecule-1 (VCAM-1) although not intercellular adhesion molecule-1 (ICAM-1). The secretion of interleukin-8 (IL-8) was also inhibited by S. scabiei extract. S. scabiei extract increased expression of the chemokine receptor CXCR-1, and both down-regulated and up-regulated expression of CXCR-2 depending on the concentration tested. These findings help explain the delayed inflammatory reaction to infestation with S. scabiei. PMID:17017228
Rindler, Tara N.; Lasko, Valerie M.; Nieman, Michelle L.; Okada, Motoi; Lorenz, John N.
2013-01-01
The α2-isoform of the Na,K-ATPase (α2) is the minor isoform of the Na,K-ATPase expressed in the cardiovascular system and is thought to play a critical role in the regulation of cardiovascular hemodynamics. However, the organ system/cell type expressing α2 that is required for this regulation has not been fully defined. The present study uses a heart-specific knockout of α2 to further define the tissue-specific role of α2 in the regulation of cardiovascular hemodynamics. To accomplish this, we developed a mouse model using the Cre/loxP system to generate a tissue-specific knockout of α2 in the heart using β-myosin heavy chain Cre. We have achieved a 90% knockout of α2 expression in the heart of the knockout mice. Interestingly, the heart-specific knockout mice exhibit normal basal cardiac function and systolic blood pressure, and in addition, these mice develop ACTH-induced hypertension in response to ACTH treatment similar to control mice. Surprisingly, the heart-specific knockout mice display delayed onset of cardiac dysfunction compared with control mice in response to pressure overload induced by transverse aortic constriction; however, the heart-specific knockout mice deteriorated to control levels by 9 wk post-transverse aortic constriction. These results suggest that heart expression of α2 does not play a role in the regulation of basal cardiovascular function or blood pressure; however, heart expression of α2 plays a role in the hypertrophic response to pressure overload. This study further emphasizes that the tissue localization of α2 determines its unique roles in the regulation of cardiovascular function. PMID:23436327
Christiansen, Michael W.; Matthewman, Colette; Podzimska-Sroka, Dagmara; O’Shea, Charlotte; Lindemose, Søren; Møllegaard, Niels Erik; Holme, Inger B.; Hebelstrup, Kim; Skriver, Karen; Gregersen, Per L.
2016-01-01
The plant-specific NAC transcription factors have attracted particular attention because of their involvement in stress responses, senescence, and nutrient remobilization. The HvNAC005 gene of barley encodes a protein belonging to subgroup NAC-a6 of the NAC family. This study shows that HvNAC005 is associated with developmental senescence. It was significantly up-regulated following ABA treatment, supported by ABA-responsive elements in its promoter, but it was not up-regulated during dark-induced senescence. The C-termini of proteins closely related to HvNAC005 showed overall high divergence but also contained conserved short motifs. A serine- and leucine-containing central motif was essential for transcriptional activity of the HvNAC005 C-terminus in yeast. Over-expression of HvNAC005 in barley resulted in a strong phenotype with delayed development combined with precocious senescence. The over-expressing plants showed up-regulation of genes involved with secondary metabolism, hormone metabolism, stress, signalling, development, and transport. Up-regulation of senescence markers and hormone metabolism and signalling genes supports a role of HvNAC005 in the cross field of different hormone and signalling pathways. Binding of HvNAC005 to promoter sequences of putative target genes containing the T[G/A]CGT core motif was shown by direct protein–DNA interactions of HvNAC005 with promoters for two of the up-regulated genes. In conclusion, HvNAC005 was shown to be a strong positive regulator of senescence and so is an obvious target for the fine-tuning of gene expression in future attempts to improve nutrient remobilization related to the senescence process in barley. PMID:27436280
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kokusho, Ryuhei, E-mail: kokusho@ss.ab.a.u-tokyo.a
2016-11-15
Bombyx mori nucleopolyhedrovirus (BmNPV) orf5 (Bm5) is a core gene of lepidopteran baculoviruses and encodes the protein with the conserved amino acid residues (DUF3627) in its C-terminus. Here, we found that Bm5 disruption resulted in lower titers of budded viruses and fewer numbers of occlusion bodies (OBs) in B. mori cultured cells and larvae, although viral genome replication was not affected. Bm5 disruption also caused aberrant expression of various viral genes at the very late stage of infection. Immunocytochemical analysis revealed that BM5 localized to the nuclear membrane. We also found that DUF3627 is important for OB production, transcriptional regulationmore » of viral genes, and subcellular localization of BM5. Compared with wild-type BmNPV infection, larval death was delayed when B. mori larvae were infected with Bm5 mutants. These results suggest that BM5 is involved in progeny virus production and regulation of viral gene expression at the very late stage of infection. -- Highlights: •The role of BmNPV BM5 protein was examined in B. mori cultured cells and larvae. •BM5 contributes to efficient production of budded viruses and occlusion bodies. •BM5 regulates viral gene expression at the very late stage of infection. •BM5 dominantly localizes to the nuclear membrane. •Bm5 mutant showed v-cath down-regulation and resulting delay of larval death.« less
Baek, Wook-Young; Park, Seung-Yoon; Kim, Yeo Hyang; Lee, Min-A; Kwon, Tae-Hwan; Park, Kwon-Moo; de Crombrugghe, Benoit; Kim, Jung-Eun
2013-01-01
Osterix (Osx) is an essential transcription factor for osteoblast differentiation and bone formation. Osx knockout show a complete absence of bone formation, whereas Osx conditional knockout in osteoblasts produce an osteopenic phenotype after birth. Here, we questioned whether Osx has a potential role in regulating physiological homeostasis. In Osx heterozygotes expressing low levels of Osx in bones, the expression levels of pro-inflammatory cytokines were significantly elevated, indicating that reduced Osx expression may reflect an inflammatory-prone state. In particular, the expression of interleukin-6, a key mediator of chronic inflammation, was increased in Osx heterozygotes and decreased in Osx overexpressing osteoblasts, and transcriptionally down-regulated by Osx. Although no significant differences were revealed in renal morphology and function between Osx heterozygotes and wild-type under normoxic conditions, recovery of kidneys after ischemic damage was remarkably delayed in Osx heterozygotes, as indicated by elevated blood urea nitrogen and creatinine levels, and by morphological alterations consistent with acute tubular necrosis. Eventually, protracted low Osx expression level caused an inflammatory-prone state in the body, resulting in the enhanced susceptibility to renal injury and the delayed renal repair after ischemia/reperfusion. This study suggests that the maintenance of Osx expression in bone is important in terms of preventing the onset of an inflammatory-prone state. PMID:23922826
Timescales and bottlenecks in miRNA-dependent gene regulation.
Hausser, Jean; Syed, Afzal Pasha; Selevsek, Nathalie; van Nimwegen, Erik; Jaskiewicz, Lukasz; Aebersold, Ruedi; Zavolan, Mihaela
2013-12-03
MiRNAs are post-transcriptional regulators that contribute to the establishment and maintenance of gene expression patterns. Although their biogenesis and decay appear to be under complex control, the implications of miRNA expression dynamics for the processes that they regulate are not well understood. We derived a mathematical model of miRNA-mediated gene regulation, inferred its parameters from experimental data sets, and found that the model describes well time-dependent changes in mRNA, protein and ribosome density levels measured upon miRNA transfection and induction. The inferred parameters indicate that the timescale of miRNA-dependent regulation is slower than initially thought. Delays in miRNA loading into Argonaute proteins and the slow decay of proteins relative to mRNAs can explain the typically small changes in protein levels observed upon miRNA transfection. For miRNAs to regulate protein expression on the timescale of a day, as miRNAs involved in cell-cycle regulation do, accelerated miRNA turnover is necessary.
Bartrina, Isabel; Otto, Elisabeth; Strnad, Miroslav; Werner, Tomáš; Schmülling, Thomas
2011-01-01
The size and activity of the shoot apical meristem is regulated by transcription factors and low molecular mass signals, including the plant hormone cytokinin. The cytokinin status of the meristem depends on different factors, including metabolic degradation of the hormone, which is catalyzed by cytokinin oxidase/dehydrogenase (CKX) enzymes. Here, we show that CKX3 and CKX5 regulate the activity of the reproductive meristems of Arabidopsis thaliana. CKX3 is expressed in the central WUSCHEL (WUS) domain, while CKX5 shows a broader meristematic expression. ckx3 ckx5 double mutants form larger inflorescence and floral meristems. An increased size of the WUS domain and enhanced primordia formation indicate a dual function for cytokinin in defining the stem cell niche and delaying cellular differentiation. Consistent with this, mutation of a negative regulator gene of cytokinin signaling, ARABIDOPSIS HISTIDINE PHOSPHOTRANSFER PROTEIN 6, which is expressed at the meristem flanks, caused a further delay of differentiation. Terminal cellular differentiation was also retarded in ckx3 ckx5 flowers, which formed more cells and became larger, corroborating the role of cytokinin in regulating flower organ size. Furthermore, higher activity of the ckx3 ckx5 placenta tissue established supernumerary ovules leading to an increased seed set per silique. Together, the results underpin the important role of cytokinin in reproductive development. The increased cytokinin content caused an ~55% increase in seed yield, highlighting the relevance of sink strength as a yield factor. PMID:21224426
Ay, Ahmet; Holland, Jack; Sperlea, Adriana; Devakanmalai, Gnanapackiam Sheela; Knierer, Stephan; Sangervasi, Sebastian; Stevenson, Angel; Özbudak, Ertuğrul M.
2014-01-01
The vertebrate segmentation clock is a gene expression oscillator controlling rhythmic segmentation of the vertebral column during embryonic development. The period of oscillations becomes longer as cells are displaced along the posterior to anterior axis, which results in traveling waves of clock gene expression sweeping in the unsegmented tissue. Although various hypotheses necessitating the inclusion of additional regulatory genes into the core clock network at different spatial locations have been proposed, the mechanism underlying traveling waves has remained elusive. Here, we combined molecular-level computational modeling and quantitative experimentation to solve this puzzle. Our model predicts the existence of an increasing gradient of gene expression time delays along the posterior to anterior direction to recapitulate spatiotemporal profiles of the traveling segmentation clock waves in different genetic backgrounds in zebrafish. We validated this prediction by measuring an increased time delay of oscillatory Her1 protein production along the unsegmented tissue. Our results refuted the need for spatial expansion of the core feedback loop to explain the occurrence of traveling waves. Spatial regulation of gene expression time delays is a novel way of creating dynamic patterns; this is the first report demonstrating such a control mechanism in any tissue and future investigations will explore the presence of analogous examples in other biological systems. PMID:25336742
Arabidopsis AGAMOUS Regulates Sepal Senescence by Driving Jasmonate Production
Jibran, Rubina; Tahir, Jibran; Cooney, Janine; Hunter, Donald A.; Dijkwel, Paul P.
2017-01-01
The signal that initiates the age-regulated senescence program in flowers is still unknown. Here we propose for the ephemeral Arabidopsis thaliana flower that it dies because of continued expression of the MADS-box transcription factor AGAMOUS (AG). AG is necessary for specifying the reproductive structures of the flower. Flowers of ag-1, which lack AG, exhibited delayed sepal senescence and abscission. The flowers also had reduced jasmonic acid (JA) content. Other anther-defective sterile mutants deficient in JA, defective in anther dehiscence 1 (dad1) and delayed dehiscence 2 (dde2), exhibited delayed sepal senescence and abscission as well. Manually pollinated dad1 flowers produced siliques but still had delayed senescence, demonstrating that absence of pollination does not cause delayed senescence. When ag-1, dad1 and dde2 flowers were sprayed with 100 μM methyl jasmonate, the sepal senescence and abscission phenotypes were rescued, suggesting that JA has a role in these processes. Our study uncovers a novel role for AG in determining the timing of death of the flower it helps develop and highlights a role for JA in sepal senescence. PMID:29312374
Xu, M T; Sun, S; Zhang, L; Xu, F; Du, S L; Zhang, X D; Wang, D W
2016-01-01
Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.
Celesnik, Helena; Ali, Gul S.; Robison, Faith M.; Reddy, Anireddy S. N.
2013-01-01
Summary Transition to flowering in plants is tightly controlled by environmental cues, which regulate the photoperiod and vernalization pathways, and endogenous signals, which mediate the autonomous and gibberellin pathways. In this work, we investigated the role of two Zn2+-finger transcription factors, the paralogues AtVOZ1 and AtVOZ2, in Arabidopsis thaliana flowering. Single atvoz1-1 and atvoz2-1 mutants showed no significant phenotypes as compared to wild type. However, atvoz1-1 atvoz2-1 double mutant plants exhibited several phenotypes characteristic of flowering-time mutants. The double mutant displayed a severe delay in flowering, together with additional pleiotropic phenotypes. Late flowering correlated with elevated expression of FLOWERING LOCUS C (FLC), which encodes a potent floral repressor, and decreased expression of its target, the floral promoter FD. Vernalization rescued delayed flowering of atvoz1-1 atvoz2-1 and reversed elevated FLC levels. Accumulation of FLC transcripts in atvoz1-1 atvoz2-1 correlated with increased expression of several FLC activators, including components of the PAF1 and SWR1 chromatin-modifying complexes. Additionally, AtVOZs were shown to bind the promoter of MOS3/SAR3 and directly regulate expression of this nuclear pore protein, which is known to participate in the regulation of flowering time, suggesting that AtVOZs exert at least some of their flowering regulation by influencing the nuclear pore function. Complementation of atvoz1-1 atvoz2-1 with AtVOZ2 reversed all double mutant phenotypes, confirming that the observed morphological and molecular changes arise from the absence of functional AtVOZ proteins, and validating the functional redundancy between AtVOZ1 and AtVOZ2. PMID:23616927
Circadian Rhythm Regulates Development of Enamel in Mouse Mandibular First Molar
Tao, Jiang; Zhai, Yue; Park, Hyun; Han, Junli; Dong, Jianhui; Xie, Ming; Gu, Ting; Lewi, Keidren; Ji, Fang; Jia, William
2016-01-01
Rhythmic incremental growth lines and the presence of melatonin receptors were discovered in tooth enamel, suggesting possible role of circadian rhythm. We therefore hypothesized that circadian rhythm may regulate enamel formation through melatonin receptors. To test this hypothesis, we examined expression of melatonin receptors (MTs) and amelogenin (AMELX), a maker of enamel formation, during tooth germ development in mouse. Using qRT-PCR and immunocytochemistry, we found that mRNA and protein levels of both MTs and AMELX in normal mandibular first molar tooth germs increased gradually after birth, peaked at 3 or 4 day postnatal, and then decreased. Expression of MTs and AMELX by immunocytochemistry was significantly delayed in neonatal mice raised in all-dark or all-light environment as well as the enamel development. Furthermore, development of tooth enamel was also delayed showing significant immature histology in those animals, especially for newborn mice raised in all daylight condition. Interestingly, disruption in circadian rhythm in pregnant mice also resulted in delayed enamel development in their babies. Treatment with melatonin receptor antagonist 4P-PDOT in pregnant mice caused underexpression of MTs and AMELX associated with long-lasting deficiency in baby enamel tissue. Electromicroscopic evidence demonstrated increased necrosis and poor enamel mineralization in ameloblasts. The above results suggest that circadian rhythm is important for normal enamel development at both pre- and postnatal stages. Melatonin receptors were partly responsible for the regulation. PMID:27494172
Circadian Rhythm Regulates Development of Enamel in Mouse Mandibular First Molar.
Tao, Jiang; Zhai, Yue; Park, Hyun; Han, Junli; Dong, Jianhui; Xie, Ming; Gu, Ting; Lewi, Keidren; Ji, Fang; Jia, William
2016-01-01
Rhythmic incremental growth lines and the presence of melatonin receptors were discovered in tooth enamel, suggesting possible role of circadian rhythm. We therefore hypothesized that circadian rhythm may regulate enamel formation through melatonin receptors. To test this hypothesis, we examined expression of melatonin receptors (MTs) and amelogenin (AMELX), a maker of enamel formation, during tooth germ development in mouse. Using qRT-PCR and immunocytochemistry, we found that mRNA and protein levels of both MTs and AMELX in normal mandibular first molar tooth germs increased gradually after birth, peaked at 3 or 4 day postnatal, and then decreased. Expression of MTs and AMELX by immunocytochemistry was significantly delayed in neonatal mice raised in all-dark or all-light environment as well as the enamel development. Furthermore, development of tooth enamel was also delayed showing significant immature histology in those animals, especially for newborn mice raised in all daylight condition. Interestingly, disruption in circadian rhythm in pregnant mice also resulted in delayed enamel development in their babies. Treatment with melatonin receptor antagonist 4P-PDOT in pregnant mice caused underexpression of MTs and AMELX associated with long-lasting deficiency in baby enamel tissue. Electromicroscopic evidence demonstrated increased necrosis and poor enamel mineralization in ameloblasts. The above results suggest that circadian rhythm is important for normal enamel development at both pre- and postnatal stages. Melatonin receptors were partly responsible for the regulation.
Butyrate Infusions in the Ovine Fetus Delay the Biologic Clock for Globin Gene Switching
NASA Astrophysics Data System (ADS)
Perrine, Susan P.; Rudolph, Abraham; Faller, Douglas V.; Roman, Christine; Cohen, Ruth A.; Chen, Shao-Jing; Kan, Yuet Wai
1988-11-01
The switch from fetal to adult hemoglobin expression is regulated in many mammalian species by a developmental clock-like mechanism and determined by the gestational age of the fetus. Prolonging fetal globin gene expression is of considerable interest for therapeutic potential in diseases caused by abnormal β -globin genes. Butyric acid, which is found in increased plasma concentrations in infants of diabetic mothers who have delayed globin gene switching, was infused into catheterized fetal lambs in utero during the time of the normal globin gene switch period. The globin gene switch was significantly delayed in three of four butyrate-treated fetuses compared with controls and was entirely prevented in one fetus in whom the infusion was begun before the globin switch was under way. These data provide a model for investigating and arresting the biologic clock of hemoglobin switching.
Koul, Sweaty; Huang, Meiyi; Bhat, Sidarth; Maroni, Paul; Meacham, Randall B; Koul, Hari K
2008-02-01
We investigated the effects of oxalate on immediate early genes (IEGs) and stress protein HSP 70, commonly induced genes in response to a variety of stresses. LLC-PK1 cells were exposed to oxalate. Gene transcription and translation were monitored by Northern and Western blot analysis. RNA and DNA synthesis were assessed by [(3)H]-uridine and [(3)H]-thymidine incorporation, respectively. Oxalate exposure selectively increased the levels of mRNA encoding IEGs c-myc and c-jun as well as stress protein HSP 70. While expression of c-myc and c-jun was rapid (within 15 min to 2 h) and transient, HSP 70 expression was delayed (approximately 8 h) and stable. Furthermore, oxalate exposure resulted in delayed induction of generalized transcription by 18 h and reinitiation of the DNA synthesis by 24 h of oxalate exposure. Moreover, we show that prior induction of HSP 70 by mild hypertonic exposure protected the cells from oxalate toxicity. To the best of our knowledge this is the first study to demonstrate rapid IEG response and delayed heat-shock response to oxalate toxicity and protective role of HSP 70 against oxalate toxicity to renal epithelial cells. Oxalate, a metabolic end product, induces IEGs c-myc and c-jun and a delayed HSP 70 expression; While IEG expression may regulate additional genetic responses to oxalate, increased HSP 70 expression would serve an early protective role during oxalate stress.
Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A
2009-05-01
Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.
Delayed inflammatory mRNA and protein expression after spinal cord injury
2011-01-01
Background Spinal cord injury (SCI) induces secondary tissue damage that is associated with inflammation. We have previously demonstrated that inflammation-related gene expression after SCI occurs in two waves - an initial cluster that is acutely and transiently up-regulated within 24 hours, and a more delayed cluster that peaks between 72 hours and 7 days. Here we extend the microarray analysis of these gene clusters up to 6 months post-SCI. Methods Adult male rats were subjected to mild, moderate or severe spinal cord contusion injury at T9 using a well-characterized weight-drop model. Tissue from the lesion epicenter was obtained 4 hours, 24 hours, 7 days, 28 days, 3 months or 6 months post-injury and processed for microarray analysis and protein expression. Results Anchor gene analysis using C1qB revealed a cluster of genes that showed elevated expression through 6 months post-injury, including galectin-3, p22PHOX, gp91PHOX, CD53 and progranulin. The expression of these genes occurred primarily in microglia/macrophage cells and was confirmed at the protein level using both immunohistochemistry and western blotting. As p22PHOX and gp91PHOX are components of the NADPH oxidase enzyme, enzymatic activity and its role in SCI were assessed and NADPH oxidase activity was found to be significantly up-regulated through 6 months post-injury. Further, treating rats with the nonspecific, irreversible NADPH oxidase inhibitor diphenylene iodinium (DPI) reduced both lesion volume and expression of chronic gene cluster proteins one month after trauma. Conclusions These data demonstrate that inflammation-related genes are chronically up-regulated after SCI and may contribute to further tissue loss. PMID:21975064
Parker, Grace A; Sumners, Lindsay H; Zhao, Xiaoling; Honaker, Christa F; Siegel, Paul B; Cline, Mark A; Gilbert, Elizabeth R
2015-11-01
Chickens selected for low (LWS) and high (HWS) juvenile body weight (BW) for 55 generations differ in BW by 10-fold at selection age. High (HWR) and low (LWR) body weight-relaxed lines have been random-bred since the 46th generation. Our objective was to evaluate the developmental and nutritional regulation of pancreatic mRNA abundance of pancreatic and duodenal homeobox 1 (PDX1), preproinsulin (PPI), preproglucagon (PPG), and glucose transporter 2 (GLUT2). At day of hatch (DOH) and days 1, 3, 7, and 15 (D1, 3, 7 and 15, respectively), pancreas was collected and real time PCR was performed in Experiment 1. In Experiment 2, HWS and LWS were fed or delayed access to food for 72 h post-hatch, and pancreas collected at D15. There was an interaction of line and age for GLUT2 (P=0.001), PPI (P<0.0001), PPG (P=0.034), and PDX1 (P<0.0001). Expression was greater in chicks from LWR and LWS than HWR and HWS. There was an interaction of line and nutrition on PPG (P<0.0001) and GLUT2 (P=0.001) mRNA, where expression was similar among chicks that were fed but greater in LWS than HWS when chicks were delayed access to food. Thus, the first two weeks is important for maturation of pancreatic endocrine function. Long-term selection for BW is associated with differences in pancreas development, and delaying access to food at hatch may have persisting effects on glucose regulatory function. Copyright © 2015 Elsevier Inc. All rights reserved.
MicroRNA858 Is a Potential Regulator of Phenylpropanoid Pathway and Plant Development1
Sharma, Deepika; Tiwari, Manish; Pandey, Ashutosh; Bhatia, Chitra; Sharma, Ashish; Trivedi, Prabodh Kumar
2016-01-01
MicroRNAs (miRNAs) are endogenous, noncoding small RNAs that function as critical regulators of gene expression. In plants, miRNAs have shown their potential as regulators of growth, development, signal transduction, and stress tolerance. Although the miRNA-mediated regulation of several processes is known, the involvement of miRNAs in regulating secondary plant product biosynthesis is poorly understood. In this study, we functionally characterized Arabidopsis (Arabidopsis thaliana) miR858a, which putatively targets R2R3-MYB transcription factors involved in flavonoid biosynthesis. Overexpression of miR858a in Arabidopsis led to the down-regulation of several MYB transcription factors regulating flavonoid biosynthesis. In contrast to the robust growth and early flowering of miR858OX plants, reduction of plant growth and delayed flowering were observed in Arabidopsis transgenic lines expressing an artificial miRNA target mimic (MIM858). Genome-wide expression analysis using transgenic lines suggested that miR858a targets a number of regulatory factors that modulate the expression of downstream genes involved in plant development and hormonal and stress responses. Furthermore, higher expression of MYBs in MIM858 lines leads to redirection of the metabolic flux towards the synthesis of flavonoids at the cost of lignin synthesis. Altogether, our study has established the potential role of light-regulated miR858a in flavonoid biosynthesis and plant growth and development. PMID:27208307
Speca, David J.; Ogata, Genki; Mandikian, Danielle; Bishop, Hannah I.; Wiler, Steve W.; Eum, Kenneth; Wenzel, H. Jürgen; Doisy, Emily T.; Matt, Lucas; Campi, Katharine L.; Golub, Mari S.; Nerbonne, Jeanne M.; Hell, Johannes W.; Trainor, Brian C.; Sack, Jon T.; Schwartzkroin, Philip A.; Trimmer, James S.
2014-01-01
The Kv2.1 delayed rectifier potassium channel exhibits high-level expression in both principal and inhibitory neurons throughout the central nervous system, including prominent expression in hippocampal neurons. Studies of in vitro preparations suggest that Kv2.1 is a key yet conditional regulator of intrinsic neuronal excitability, mediated by changes in Kv2.1 expression, localization and function via activity-dependent regulation of Kv2.1 phosphorylation. Here we identify neurological and behavioral deficits in mutant (Kv2.1−/−) mice lacking this channel. Kv2.1−/− mice have grossly normal characteristics. No impairment in vision or motor coordination was apparent, although Kv2.1−/− mice exhibit reduced body weight. The anatomic structure and expression of related Kv channels in the brains of Kv2.1−/− mice appears unchanged. Delayed rectifier potassium current is diminished in hippocampal neurons cultured from Kv2.1−/− animals. Field recordings from hippocampal slices of Kv2.1−/− mice reveal hyperexcitability in response to the convulsant bicuculline, and epileptiform activity in response to stimulation. In Kv2.1−/− mice, long-term potentiation at the Schaffer collateral – CA1 synapse is decreased. Kv2.1−/− mice are strikingly hyperactive, and exhibit defects in spatial learning, failing to improve performance in a Morris Water Maze task. Kv2.1−/− mice are hypersensitive to the effects of the convulsants flurothyl and pilocarpine, consistent with a role for Kv2.1 as a conditional suppressor of neuronal activity. Although not prone to spontaneous seizures, Kv2.1−/− mice exhibit accelerated seizure progression. Together, these findings suggest homeostatic suppression of elevated neuronal activity by Kv2.1 plays a central role in regulating neuronal network function. PMID:24494598
Regulation of a transcription factor network by Cdk1 coordinates late cell cycle gene expression
Landry, Benjamin D; Mapa, Claudine E; Arsenault, Heather E; Poti, Kristin E; Benanti, Jennifer A
2014-01-01
To maintain genome stability, regulators of chromosome segregation must be expressed in coordination with mitotic events. Expression of these late cell cycle genes is regulated by cyclin-dependent kinase (Cdk1), which phosphorylates a network of conserved transcription factors (TFs). However, the effects of Cdk1 phosphorylation on many key TFs are not known. We find that elimination of Cdk1-mediated phosphorylation of four S-phase TFs decreases expression of many late cell cycle genes, delays mitotic progression, and reduces fitness in budding yeast. Blocking phosphorylation impairs degradation of all four TFs. Consequently, phosphorylation-deficient mutants of the repressors Yox1 and Yhp1 exhibit increased promoter occupancy and decreased expression of their target genes. Interestingly, although phosphorylation of the transcriptional activator Hcm1 on its N-terminus promotes its degradation, phosphorylation on its C-terminus is required for its activity, indicating that Cdk1 both activates and inhibits a single TF. We conclude that Cdk1 promotes gene expression by both activating transcriptional activators and inactivating transcriptional repressors. Furthermore, our data suggest that coordinated regulation of the TF network by Cdk1 is necessary for faithful cell division. PMID:24714560
Regulation of a transcription factor network by Cdk1 coordinates late cell cycle gene expression.
Landry, Benjamin D; Mapa, Claudine E; Arsenault, Heather E; Poti, Kristin E; Benanti, Jennifer A
2014-05-02
To maintain genome stability, regulators of chromosome segregation must be expressed in coordination with mitotic events. Expression of these late cell cycle genes is regulated by cyclin-dependent kinase (Cdk1), which phosphorylates a network of conserved transcription factors (TFs). However, the effects of Cdk1 phosphorylation on many key TFs are not known. We find that elimination of Cdk1-mediated phosphorylation of four S-phase TFs decreases expression of many late cell cycle genes, delays mitotic progression, and reduces fitness in budding yeast. Blocking phosphorylation impairs degradation of all four TFs. Consequently, phosphorylation-deficient mutants of the repressors Yox1 and Yhp1 exhibit increased promoter occupancy and decreased expression of their target genes. Interestingly, although phosphorylation of the transcriptional activator Hcm1 on its N-terminus promotes its degradation, phosphorylation on its C-terminus is required for its activity, indicating that Cdk1 both activates and inhibits a single TF. We conclude that Cdk1 promotes gene expression by both activating transcriptional activators and inactivating transcriptional repressors. Furthermore, our data suggest that coordinated regulation of the TF network by Cdk1 is necessary for faithful cell division.
Zhao, Minglei; Yang, Songguang; Liu, Xuncheng; Wu, Keqiang
2015-01-01
Seed dormancy controls germination and plays a critical role in regulating the beginning of the life cycle of plants. Seed dormancy is established and maintained during seed maturation and is gradually broken during dry storage (after-ripening). The plant hormone abscisic acid (ABA) and DELAY OF GERMINATION1 (DOG1) protein are essential regulators of seed dormancy. Recent studies revealed that chromatin modifications are also involved in the transcription regulation of seed dormancy. Here, we showed that two Arabidopsis histone demethylases, LYSINESPECIFIC DEMETHYLASE LIKE 1 and 2 (LDL1 and LDL2) act redundantly in repressing of seed dormancy. LDL1 and LDL2 are highly expressed in the early silique developing stage. The ldl1 ldl2 double mutant displays increased seed dormancy, whereas overexpression of LDL1 or LDL2 in Arabidopsis causes reduced dormancy. Furthermore, we showed that LDL1 and LDL2 repress the expression of seed dormancy-related genes, including DOG1, ABA2 and ABI3 during seed dormancy establishment. Furthermore, genetic analysis revealed that the repression of seed dormancy by LDL1 and LDL2 requires DOG1, ABA2, and ABI3. Taken together, our findings revealed that LDL1 and LDL2 play an essential role in seed dormancy.
TERRA and the histone methyltransferase Dot1 cooperate to regulate senescence in budding yeast
Wanat, Jennifer J.; Logsdon, Glennis A.; Driskill, Jordan H.; Deng, Zhong; Lieberman, Paul M.
2018-01-01
The events underlying senescence induced by critical telomere shortening are not fully understood. Here we provide evidence that TERRA, a non-coding RNA transcribed from subtelomeres, contributes to senescence in yeast lacking telomerase (tlc1Δ). Levels of TERRA expressed from multiple telomere ends appear elevated at senescence, and expression of an artificial RNA complementary to TERRA (anti-TERRA) binds TERRA in vivo and delays senescence. Anti-TERRA acts independently from several other mechanisms known to delay senescence, including those elicited by deletions of EXO1, TEL1, SAS2, and genes encoding RNase H enzymes. Further, it acts independently of the senescence delay provided by RAD52-dependent recombination. However, anti-TERRA delays senescence in a fashion epistatic to inactivation of the conserved histone methyltransferase Dot1. Dot1 associates with TERRA, and anti-TERRA disrupts this interaction in vitro and in vivo. Surprisingly, the anti-TERRA delay is independent of the C-terminal methyltransferase domain of Dot1 and instead requires only its N-terminus, which was previously found to facilitate release of telomeres from the nuclear periphery. Together, these data suggest that TERRA and Dot1 cooperate to drive senescence. PMID:29649255
Parametric Sensitivity Analysis of Oscillatory Delay Systems with an Application to Gene Regulation.
Ingalls, Brian; Mincheva, Maya; Roussel, Marc R
2017-07-01
A parametric sensitivity analysis for periodic solutions of delay-differential equations is developed. Because phase shifts cause the sensitivity coefficients of a periodic orbit to diverge, we focus on sensitivities of the extrema, from which amplitude sensitivities are computed, and of the period. Delay-differential equations are often used to model gene expression networks. In these models, the parametric sensitivities of a particular genotype define the local geometry of the evolutionary landscape. Thus, sensitivities can be used to investigate directions of gradual evolutionary change. An oscillatory protein synthesis model whose properties are modulated by RNA interference is used as an example. This model consists of a set of coupled delay-differential equations involving three delays. Sensitivity analyses are carried out at several operating points. Comments on the evolutionary implications of the results are offered.
Qin, Na; Wei, Liwei; Li, Wuyin; Yang, Wei; Cai, Litao; Qian, Zhuang; Wu, Shufang
2017-07-01
Autophagy is an essential cellular homeostasis mechanism that was found to be compromised in aging and osteoarthritis (OA) cartilage. Previous studies showed that resveratrol can effectively regulate autophagy in other cells. The purpose of this study was to determine whether the chondroprotective effect of resveratrol was related to chondrocyte autophagy and to elucidate underlying mechanisms. OA model was induced by destabilization of the medial meniscus (DMM) in 10-week-old male mice. OA mice were treated with resveratrol with/without 3-MA for 8 weeks beginning 4 weeks after surgery. The local intra-articular injection of resveratrol delayed articular cartilage degradation in DMM-induced OA by OARSI scoring systems and Safranin O-fast green. Resveratrol treatment increased Unc-51-like kinase1, Beclin1, microtubule-associated protein light chain 3, hypoxia inducible factor-1α, phosphorylated AMPK, collagen-2A1, Aggrecan expressions, but decreased hypoxia inducible factor-2α, phosphorylated mTOR, matrix metalloproteinases13 and a disintegrin and metalloproteinase with thrombospondin motifs 5 expressions. The effects of resveratrol were obviously blunted by 3-MA except HIF and AMPK. These findings indicate that resveratrol intra-articular injection delayed articular cartilage degeneration and promoted chondrocyte autophagy in an experimental model of surgical DMM-induced OA, in part via balancing HIF-1α and HIF-2α expressions and thereby regulating AMPK/mTOR signaling pathway. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.
MyoR Modulates Cardiac Conduction by Repressing Gata4
Harris, John P.; Bhakta, Minoti; Bezprozvannaya, Svetlana; Wang, Lin; Lubczyk, Christina; Olson, Eric N.
2014-01-01
The cardiac conduction system coordinates electrical activation through a series of interconnected structures, including the atrioventricular node (AVN), the central connection point that delays impulse propagation to optimize cardiac performance. Although recent studies have uncovered important molecular details of AVN formation, relatively little is known about the transcriptional mechanisms that regulate AV delay, the primary function of the mature AVN. We identify here MyoR as a novel transcription factor expressed in Cx30.2+ cells of the AVN. We show that MyoR specifically inhibits a Cx30.2 enhancer required for AVN-specific gene expression. Furthermore, we demonstrate that MyoR interacts directly with Gata4 to mediate transcriptional repression. Our studies reveal that MyoR contains two nonequivalent repression domains. While the MyoR C-terminal repression domain inhibits transcription in a context-dependent manner, the N-terminal repression domain can function in a heterologous context to convert the Hand2 activator into a repressor. In addition, we show that genetic deletion of MyoR in mice increases Cx30.2 expression by 50% and prolongs AV delay by 13%. Taken together, we conclude that MyoR modulates a Gata4-dependent regulatory circuit that establishes proper AV delay, and these findings may have wider implications for the variability of cardiac rhythm observed in the general population. PMID:25487574
Jeong, Da-Un; Choi, Je-Yong; Kim, Dae-Won
2017-01-01
Nkx3.2, the vertebrate homologue of Drosophila bagpipe, has been implicated as playing a role in chondrogenic differentiation. In brief, Nkx3.2 is initially expressed in chondrocyte precursor cells and later during cartilage maturation, its expression is diminished in hypertrophic chondrocytes. In addition to Nkx3.2 expression analyses, previous studies using ex vivo chick embryo cultures and in vitro cell cultures have suggested that Nkx3.2 can suppress chondrocyte hypertrophy. However, it has never been demonstrated that Nkx3.2 functions in regulating chondrocyte hypertrophy during cartilage development in vivo. Here, we show that cartilage-specific and Cre-dependent Nkx3.2 overexpression in mice results in significant postnatal dwarfism in endochondral skeletons, while intramembranous bones remain unaltered. Further, we observed significant delays in cartilage hypertrophy in conditional transgenic ciTg-Nkx3.2 mice. Together, these findings confirm that Nkx3.2 is capable of controlling hypertrophic maturation of cartilage in vivo, and this regulation plays a significant role in endochondral ossification and longitudinal bone growth. J. Cell. Physiol. 232: 78-90, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Wang, Ping; Sun, Xun; Chang, Cong; Feng, Fengjuan; Liang, Dong; Cheng, Lailiang; Ma, Fengwang
2013-11-01
Melatonin has an important anti-aging role in plant physiology. We tested the effects of long-term melatonin exposure on metabolic status and protein degradation during natural leaf senescence in trees of Malus hupehensis Rehd. The 2-month regular supplement of 100 μm melatonin to the soil once every 6 days altered the metabolic status and delayed protein degradation. For example, leaves from treated plants had significantly higher photosynthetic activity, chlorophyll concentrations, and levels of three photosynthetic end products (sorbitol, sucrose, and starch) when compared with the control. The significant inhibition of hexose (fructose and glucose) accumulation possibly regulated the signaling of MdHXK1, a gene for which expression was also repressed by melatonin during senescence. The plants also exhibited better preservation of their nitrogen, total soluble protein, and Rubisco protein concentrations than the control. The slower process of protein degradation might be a result of melatonin-linked inhibition on the expression of apple autophagy-related genes (ATGs). Our results are the first to provide evidence for this delay in senescence based on the metabolic alteration and protein degradation. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Faunes, Fernando; Gundermann, Daniel G; Muñoz, Rosana; Bruno, Renzo; Larraín, Juan
2017-05-15
Metamorphosis is a classic example of developmental transition, which involves important morphological and physiological changes that prepare the organism for the adult life. It has been very well established that amphibian metamorphosis is mainly controlled by Thyroid Hormone (TH). Here, we show that the heterochronic gene Lin28 is downregulated during Xenopus laevis metamorphosis. Lin28 overexpression before activation of TH signaling delays metamorphosis and inhibits the expression of TH target genes. The delay in metamorphosis is rescued by incubation with exogenous TH, indicating that Lin28 works upstream or parallel to TH. High-throughput analyses performed before any delay on metamorphosis or change in TH signaling showed that overexpression of Lin28 reduces transcript levels of several hormones secreted by the pituitary, including the Thyroid-Stimulating Hormone (TSH), and regulates the expression of proteins involved in TH transport, metabolism and signaling, showing that Lin28 disrupts TH function at different levels. Our data demonstrates that the role of Lin28 in controlling developmental transitions is evolutionary conserved and establishes a functional interaction between Lin28 and thyroid hormone function introducing a new regulatory step in perinatal development with implications for our understanding of endocrine disorders. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Lactic acid delays the inflammatory response of human monocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peter, Katrin, E-mail: katrin.peter@ukr.de; Rehli, Michael, E-mail: michael.rehli@ukr.de; RCI Regensburg Center for Interventional Immunology, University Hospital Regensburg, Franz-Josef-Strauß-Allee 11, 93053 Regensburg
2015-02-13
Lactic acid (LA) accumulates under inflammatory conditions, e.g. in wounds or tumors, and influences local immune cell functions. We previously noted inhibitory effects of LA on glycolysis and TNF secretion of human LPS-stimulated monocytes. Here, we globally analyze the influence of LA on gene expression during monocyte activation. To separate LA-specific from lactate- or pH-effects, monocytes were treated for one or four hours with LPS in the presence of physiological concentrations of LA, sodium lactate (NaL) or acidic pH. Analyses of global gene expression profiles revealed striking effects of LA during the early stimulation phase. Up-regulation of most LPS-induced genesmore » was significantly delayed in the presence of LA, while this inhibitory effect was attenuated in acidified samples and not detected after incubation with NaL. LA targets included genes encoding for important monocyte effector proteins like cytokines (e.g. TNF and IL-23) or chemokines (e.g. CCL2 and CCL7). LA effects were validated for several targets by quantitative RT-PCR and/or ELISA. Further analysis of LPS-signaling pathways revealed that LA delayed the phosphorylation of protein kinase B (AKT) as well as the degradation of IκBα. Consistently, the LPS-induced nuclear accumulation of NFκB was also diminished in response to LA. These results indicate that the broad effect of LA on gene expression and function of human monocytes is at least partially caused by its interference with immediate signal transduction events after activation. This mechanism might contribute to monocyte suppression in the tumor environment. - Highlights: • Lactic acid broadly delays LPS-induced gene expression in human monocytes. • Expression of important monocyte effector molecules is affected by lactic acid. • Interference of lactic acid with TLR signaling causes the delayed gene expression. • The profound effect of lactic acid might contribute to immune suppression in tumors.« less
Huo, Heqiang; Wei, Shouhui; Bradford, Kent J.
2016-01-01
Seed germination and flowering, two critical developmental transitions in plant life cycles, are coordinately regulated by genetic and environmental factors to match plant establishment and reproduction to seasonal cues. The DELAY OF GERMINATION1 (DOG1) gene is involved in regulating seed dormancy in response to temperature and has also been associated genetically with pleiotropic flowering phenotypes across diverse Arabidopsis thaliana accessions and locations. Here we show that DOG1 can regulate seed dormancy and flowering times in lettuce (Lactuca sativa, Ls) and Arabidopsis through an influence on levels of microRNAs (miRNAs) miR156 and miR172. In lettuce, suppression of LsDOG1 expression enabled seed germination at high temperature and promoted early flowering in association with reduced miR156 and increased miR172 levels. In Arabidopsis, higher miR156 levels resulting from overexpression of the MIR156 gene enhanced seed dormancy and delayed flowering. These phenotypic effects, as well as conversion of MIR156 transcripts to miR156, were compromised in DOG1 loss-of-function mutant plants, especially in seeds. Overexpression of MIR172 reduced seed dormancy and promoted early flowering in Arabidopsis, and the effect on flowering required functional DOG1. Transcript levels of several genes associated with miRNA processing were consistently lower in dry seeds of Arabidopsis and lettuce when DOG1 was mutated or its expression was reduced; in contrast, transcript levels of these genes were elevated in a DOG1 gain-of-function mutant. Our results reveal a previously unknown linkage between two critical developmental phase transitions in the plant life cycle through a DOG1–miR156–miR172 interaction. PMID:27035986
RNA splicing regulates the temporal order of TNF-induced gene expression.
Hao, Shengli; Baltimore, David
2013-07-16
When cells are induced to express inflammatory genes by treatment with TNF, the mRNAs for the induced genes appear in three distinct waves, defining gene groups I, II, and III, or early, intermediate, and late genes. To examine the basis for these different kinetic classes, we have developed a PCR-based procedure to distinguish pre-mRNAs from mRNAs. It shows that the three groups initiate transcription virtually simultaneously but that delays in splicing characterize groups II and III. We also examined the elongation times, concluding that pre-mRNA synthesis is coordinate but splicing differences directly regulate the timing of mRNA production.
Direct induction of T lymphocyte-specific gene expression by the mammalian Notch signaling pathway
Reizis, Boris; Leder, Philip
2002-01-01
The Notch signaling pathway regulates the commitment and early development of T lymphocytes. We studied Notch-mediated induction of the pre-T cell receptor α (pTa) gene, a T-cell-specific transcriptional target of Notch. The pTa enhancer was activated by Notch signaling and contained binding sites for its nuclear effector, CSL. Mutation of the CSL-binding sites abolished enhancer induction by Notch and delayed the up-regulation of pTa transgene expression during T cell lineage commitment. These results show a direct mechanism of stage- and tissue-specific gene induction by the mammalian Notch/CSL signaling pathway. PMID:11825871
Transcriptional profiling reveals regulated genes in the hippocampus during memory formation
NASA Technical Reports Server (NTRS)
Donahue, Christine P.; Jensen, Roderick V.; Ochiishi, Tomoyo; Eisenstein, Ingrid; Zhao, Mingrui; Shors, Tracey; Kosik, Kenneth S.
2002-01-01
Transcriptional profiling (TP) offers a powerful approach to identify genes activated during memory formation and, by inference, the molecular pathways involved. Trace eyeblink conditioning is well suited for the study of regional gene expression because it requires the hippocampus, whereas the highly parallel task, delay conditioning, does not. First, we determined when gene expression was most regulated during trace conditioning. Rats were exposed to 200 trials per day of paired and unpaired stimuli each day for 4 days. Changes in gene expression were most apparent 24 h after exposure to 200 trials. Therefore, we profiled gene expression in the hippocampus 24 h after 200 trials of trace eyeblink conditioning, on multiple arrays using additional animals. Of 1,186 genes on the filter array, seven genes met the statistical criteria and were also validated by real-time polymerase chain reaction. These genes were growth hormone (GH), c-kit receptor tyrosine kinase (c-kit), glutamate receptor, metabotropic 5 (mGluR5), nerve growth factor-beta (NGF-beta), Jun oncogene (c-Jun), transmembrane receptor Unc5H1 (UNC5H1), and transmembrane receptor Unc5H2 (UNC5H2). All these genes, except for GH, were downregulated in response to trace conditioning. GH was upregulated; therefore, we also validated the downregulation of the GH inhibitor, somatostatin (SST), even though it just failed to meet criteria on the arrays. By during situ hybridization, GH was expressed throughout the cell layers of the hippocampus in response to trace conditioning. None of the genes regulated in trace eyeblink conditioning were similarly affected by delay conditioning, a task that does not require the hippocampus. These findings demonstrate that transcriptional profiling can exhibit a repertoire of genes sensitive to the formation of hippocampal-dependent associative memories.
Functional Characterization of Phalaenopsis aphrodite Flowering Genes PaFT1 and PaFD
Jang, Seonghoe; Choi, Sang-Chul; Li, Hsing-Yi; An, Gynheung; Schmelzer, Elmon
2015-01-01
We show that the key flowering regulators encoded by Phalaenopsis aphrodite FLOWERING LOCUS T1 (PaFT1) and PaFD share high sequence homologies to these from long-day flowering Arabidopsis and short-day flowering rice. Interestingly, PaFT1 is specifically up-regulated during flowering inductive cooling treatment but is not subjected to control by photoperiod in P. aphrodite. Phloem or shoot apex-specific expression of PaFT1 restores the late flowering of Arabidopsis ft mutants. Moreover, PaFT1 can suppress the delayed flowering caused by SHORT VEGATATIVE PHASE (SVP) overexpression as well as an active FRIGIDA (FRI) allele, indicating the functional conservation of flowering regulatory circuit in different plant species. PaFT1 promoter:GUS in Arabidopsis showed similar staining pattern to that of Arabidopsis FT in the leaves and guard cells but different in the shoot apex. A genomic clone or heat shock-inducible expression of PaFT1 is sufficient to the partial complementation of the ft mutants. Remarkably, ectopic PaFT1 expression also triggers precocious heading in rice. To further demonstrate the functional conservation of the flowering regulators, we show that PaFD, a bZIP transcription factor involved in flowering promotion, interacts with PaFT1, and PaFD partially complemented Arabidopsis fd mutants. Transgenic rice expressing PaFD also flowered early with increased expression of rice homologues of APETALA1 (AP1). Consistently, PaFT1 knock-down Phalaenopsis plants generated by virus-induced gene silencing exhibit delayed spiking. These studies suggest functional conservation of FT and FD genes, which may have evolved and integrated into distinct regulatory circuits in monopodial orchids, Arabidopsis and rice that promote flowering under their own inductive conditions. PMID:26317412
A Heme-responsive Regulator Controls Synthesis of Staphyloferrin B in Staphylococcus aureus*♦
Laakso, Holly A.; Marolda, Cristina L.; Pinter, Tyler B.; Stillman, Martin J.; Heinrichs, David E.
2016-01-01
Staphylococcus aureus possesses a multitude of mechanisms by which it can obtain iron during growth under iron starvation conditions. It expresses an effective heme acquisition system (the iron-regulated surface determinant system), it produces two carboxylate-type siderophores staphyloferrin A and staphyloferrin B (SB), and it expresses transporters for many other siderophores that it does not synthesize. The ferric uptake regulator protein regulates expression of genes encoding all of these systems. Mechanisms of fine-tuning expression of iron-regulated genes, beyond simple iron regulation via ferric uptake regulator, have not been uncovered in this organism. Here, we identify the ninth gene of the sbn operon, sbnI, as encoding a ParB/Spo0J-like protein that is required for expression of genes in the sbn operon from sbnD onward. Expression of sbnD–I is drastically decreased in an sbnI mutant, and the mutant does not synthesize detectable SB during early phases of growth. Thus, SB-mediated iron acquisition is impaired in an sbnI mutant strain. We show that the protein forms dimers and tetramers in solution and binds to DNA within the sbnC coding region. Moreover, we show that SbnI binds heme and that heme-bound SbnI does not bind DNA. Finally, we show that providing exogenous heme to S. aureus growing in an iron-free medium results in delayed synthesis of SB. This is the first study in S. aureus that identifies a DNA-binding regulatory protein that senses heme to control gene expression for siderophore synthesis. PMID:26534960
Newborn Mouse Lens Proteome and Its Alteration by Lysine 6 Mutant Ubiquitin
2015-01-01
Ubiquitin is a tag that often initiates degradation of proteins by the proteasome in the ubiquitin proteasome system. Targeted expression of K6W mutant ubiquitin (K6W-Ub) in the lens results in defects in lens development and cataract formation, suggesting critical functions for ubiquitin in lens. To study the developmental processes that require intact ubiquitin, we executed the most extensive characterization of the lens proteome to date. We quantified lens protein expression changes in multiple replicate pools of P1 wild-type and K6W-Ub-expressing mouse lenses. Lens proteins were digested with trypsin, peptides were separated using strong cation exchange and reversed-phase liquid chromatography, and tandem mass (MS/MS) spectra were collected with a linear ion trap. Transgenic mice that expressed low levels of K6W-Ub (low expressers) had normal, clear lenses at birth, whereas the lenses that expressed high levels of K6W-Ub (higher expressers) had abnormal lenses and cataracts at birth. A total of 2052 proteins were identified, of which 996 were reliably quantified and compared between wild-type and K6W-Ub transgenic mice. Consistent with a delayed developmental program, fiber-cell-specific proteins, such as γ-crystallins (γA, γB, γC, and γE), were down-regulated in K6W-Ub higher expressers. Up-regulated proteins were involved in energy metabolism, signal transduction, and proteolysis. The K6W-Ub low expressers exhibited delayed onset and milder cataract consistent with smaller changes in protein expression. Because lens protein expression changes occurred prior to lens morphological abnormalities and cataract formation in K6W-Ub low expressers, it appears that expression of K6W-Ub sets in motion a process of altered protein expression that results in developmental defects and cataract. PMID:24450463
Murakami, Shunichi; Balmes, Gener; McKinney, Sandra; Zhang, Zhaoping; Givol, David; de Crombrugghe, Benoit
2004-01-01
We generated transgenic mice that express a constitutively active mutant of MEK1 in chondrocytes. These mice showed a dwarf phenotype similar to achondroplasia, the most common human dwarfism, caused by activating mutations in FGFR3. These mice displayed incomplete hypertrophy of chondrocytes in the growth plates and a general delay in endochondral ossification, whereas chondrocyte proliferation was unaffected. Immunohistochemical analysis of the cranial base in transgenic embryos showed reduced staining for collagen type X and persistent expression of Sox9 in chondrocytes. These observations indicate that the MAPK pathway inhibits hypertrophic differentiation of chondrocytes and negatively regulates bone growth without inhibiting chondrocyte proliferation. Expression of a constitutively active mutant of MEK1 in chondrocytes of Fgfr3-deficient mice inhibited skeletal overgrowth, strongly suggesting that regulation of bone growth by FGFR3 is mediated at least in part by the MAPK pathway. Although loss of Stat1 restored the reduced chondrocyte proliferation in mice expressing an achondroplasia mutant of Fgfr3, it did not rescue the reduced hypertrophic zone, the delay in formation of secondary ossification centers, and the achondroplasia-like phenotype. These observations suggest a model in which Fgfr3 signaling inhibits bone growth by inhibiting chondrocyte differentiation through the MAPK pathway and by inhibiting chondrocyte proliferation through Stat1. PMID:14871928
Novel role of prostate apoptosis response-4 tumor suppressor in B-cell chronic lymphocytic leukemia.
McKenna, Mary K; Noothi, Sunil K; Alhakeem, Sara S; Oben, Karine Z; Greene, Joseph T; Mani, Rajeswaran; Perry, Kathryn L; Collard, James P; Rivas, Jacqueline R; Hildebrandt, Gerhard; Fleischman, Roger; Durbin, Eric B; Byrd, John C; Wang, Chi; Muthusamy, Natarajan; Rangnekar, Vivek M; Bondada, Subbarao
2018-04-25
Prostate apoptosis response-4 (Par-4), a pro-apoptotic tumor suppressor protein, is down regulated in many cancers including renal cell carcinoma, glioblastoma, endometrial and breast cancer. Par-4 induces apoptosis selectively in various types of cancer cells but not normal cells. We found that chronic lymphocytic leukemia (CLL) cells from human patients and from the Eµ-Tcl1 mice constitutively express Par-4 in greater amounts than normal B-1 or B-2 cells. Interestingly, knockdown of Par-4 in human CLL derived Mec-1 cells results in a robust increase in p21/WAF1 expression and decreased growth due to delayed G1 to S cell cycle transition. Lack of Par-4 also increased the expression of p21 and delayed CLL growth in Eμ-Tcl1 mice. Par-4 expression in CLL cells required constitutively active B-cell receptor (BCR) signaling, as inhibition of BCR signaling with FDA approved drugs caused a decrease in Par-4 mRNA and protein, and an increase in apoptosis. In particular, activities of Lyn, a Src family kinase, spleen tyrosine kinase and Bruton's tyrosine kinase are required for Par-4 expression in CLL cells, suggesting a novel regulation of Par-4 through BCR signaling. Together, these results suggest that Par-4 may play a novel pro-growth rather than pro-apoptotic role in CLL and could be targeted to enhance the therapeutic effects of BCR signaling inhibitors. Copyright © 2018 American Society of Hematology.
Khaddam, Mayssam; Huet, Eric; Vallée, Benoît; Bensidhoum, Morad; Le Denmat, Dominique; Filatova, Anna; Jimenez-Rojo, Lucia; Ribes, Sandy; Lorenz, Georg; Morawietz, Maria; Rochefort, Gael Y; Kiesow, Andreas; Mitsiadis, Thimios A; Poliard, Anne; Petzold, Matthias; Gabison, Eric E; Menashi, Suzanne; Chaussain, Catherine
2014-09-01
Tooth development is regulated by a series of reciprocal inductive signaling between the dental epithelium and mesenchyme, which culminates with the formation of dentin and enamel. EMMPRIN/CD147 is an Extracellular Matrix MetalloPRoteinase (MMP) INducer that mediates epithelial-mesenchymal interactions in cancer and other pathological processes and is expressed in developing teeth. Here we used EMMPRIN knockout (KO) mice to determine the functional role of EMMPRIN on dental tissue formation. We report a delay in enamel deposition and formation that is clearly distinguishable in the growing incisor and associated with a significant reduction of MMP-3 and MMP-20 expression in tooth germs of KO mice. Insufficient basement membrane degradation is evidenced by a persistent laminin immunostaining, resulting in a delay of both odontoblast and ameloblast differentiation. Consequently, enamel volume and thickness are decreased in adult mutant teeth but enamel maturation and tooth morphology are normal, as shown by micro-computed tomographic (micro-CT), nanoindentation, and scanning electron microscope analyses. In addition, the dentino-enamel junction appears as a rough calcified layer of approximately 10±5μm thick (mean±SD) in both molars and growing incisors of KO adult mice. These results indicate that EMMPRIN is involved in the epithelial-mesenchymal cross-talk during tooth development by regulating the expression of MMPs. The mild tooth phenotype observed in EMMPRIN KO mice suggests that the direct effect of EMMPRIN may be limited to a short time window, comprised between basement membrane degradation allowing direct cell contact and calcified matrix deposition. Copyright © 2014 Elsevier Inc. All rights reserved.
Lv, Yankun; Bai, Song; Zhang, Hua; Zhang, Hongxue; Meng, Jing; Li, Li; Xu, Yanfang
2015-12-01
There is emerging evidence that the mineralocorticoid hormone aldosterone is associated with arrhythmias in cardiovascular disease. However, the effect of aldosterone on the slowly activated delayed rectifier potassium current (IK s ) remains poorly understood. The present study was designed to investigate the modulation of IK s by aldosterone. Adult guinea pigs were treated with aldosterone for 28 days via osmotic pumps. Standard glass microelectrode recordings and whole-cell patch-clamp techniques were used to record action potentials in papillary muscles and IK s in ventricular cardiomyocytes. The aldosterone-treated animals exhibited a prolongation of the QT interval and action potential duration with a higher incidence of early afterdepolarizations. Patch-clamp recordings showed a significant down-regulation of IK s density in the ventricular myocytes of these treated animals. These aldosterone-induced electrophysiological changes were fully prevented by a combined treatment with spironolactone, a mineralocorticoid receptor (MR) antagonist. In addition, in in vitro cultured ventricular cardiomyocytes, treatment with aldosterone (sustained exposure for 24 h) decreased the IK s density in a concentration-dependent manner. Furthermore, a significant corresponding reduction in the mRNA/protein expression of IKs channel pore and auxiliary subunits, KCNQ1 and KCNE1 was detected in ventricular tissue from the aldosterone-treated animals. Aldosterone down-regulates IK s by inhibiting the expression of KCNQ1 and KCNE1, thus delaying the ventricular repolarization. These results provide new insights into the mechanism underlying K(+) channel remodelling in heart disease and may explain the highly beneficial effects of MR antagonists in HF. © 2015 The British Pharmacological Society.
Zheng, Zhigang; Yang, Xiaoming; Fu, Yaping; Zhu, Longfei; Wei, Hantian; Lin, Xinchun
2017-01-01
Because of the long and unpredictable flowering period in bamboo, the molecular mechanism of bamboo flowering is unclear. Recent study showed that Arabidopsis PIN1-type parvulin 1 (Pin1At) is an important floral activator and regulates floral transition by facilitating the cis/trans isomerization of the phosphorylated Ser/Thr residues preceding proline motifs in suppressor of overexpression of CO 1 (SOC1) and agamous-like 24 (AGL24). Whether bamboo has a Pin1 homolog and whether it works in bamboo flowering are still unknown. In this study, we cloned PvPin1, a homolog of Pin1At, from Phyllostachys violascens (Bambusoideae). Bioinformatics analysis showed that PvPin1 is closely related to Pin1-like proteins in monocots. PvPin1 was widely expressed in all tested bamboo tissues, with the highest expression in young leaf and lowest in floral bud. Moreover, PvPin1 expression was high in leaves before bamboo flowering then declined during flower development. Overexpression of PvPin1 significantly delayed flowering time by downregulating SOC1 and AGL24 expression in Arabidopsis under greenhouse conditions and conferred a significantly late flowering phenotype by upregulating OsMADS56 in rice under field conditions. PvPin1 showed subcellular localization in both the nucleus and cytolemma. The 1500-bp sequence of the PvPin1 promoter was cloned, and cis-acting element prediction showed that ABRE and TGACG-motif elements, which responded to abscisic acid (ABA) and methyl jasmonate (MeJA), respectively, were characteristic of P. violascens in comparison with Arabidopsis. On promoter activity analysis, exogenous ABA and MeJA could significantly inhibit PvPin1 expression. These findings suggested that PvPin1 may be a repressor in flowering, and its delay of flowering time could be regulated by ABA and MeJA in bamboo. PMID:28951734
Zheng, Zhigang; Yang, Xiaoming; Fu, Yaping; Zhu, Longfei; Wei, Hantian; Lin, Xinchun
2017-01-01
Because of the long and unpredictable flowering period in bamboo, the molecular mechanism of bamboo flowering is unclear. Recent study showed that Arabidopsis PIN1-type parvulin 1 (Pin1At) is an important floral activator and regulates floral transition by facilitating the cis/trans isomerization of the phosphorylated Ser/Thr residues preceding proline motifs in suppressor of overexpression of CO 1 (SOC1) and agamous-like 24 (AGL24). Whether bamboo has a Pin1 homolog and whether it works in bamboo flowering are still unknown. In this study, we cloned PvPin1 , a homolog of Pin1At , from Phyllostachys violascens (Bambusoideae). Bioinformatics analysis showed that PvPin1 is closely related to Pin1-like proteins in monocots. PvPin1 was widely expressed in all tested bamboo tissues, with the highest expression in young leaf and lowest in floral bud. Moreover, PvPin1 expression was high in leaves before bamboo flowering then declined during flower development. Overexpression of PvPin1 significantly delayed flowering time by downregulating SOC1 and AGL24 expression in Arabidopsis under greenhouse conditions and conferred a significantly late flowering phenotype by upregulating OsMADS56 in rice under field conditions. PvPin1 showed subcellular localization in both the nucleus and cytolemma. The 1500-bp sequence of the PvPin1 promoter was cloned, and cis -acting element prediction showed that ABRE and TGACG-motif elements, which responded to abscisic acid (ABA) and methyl jasmonate (MeJA), respectively, were characteristic of P. violascens in comparison with Arabidopsis . On promoter activity analysis, exogenous ABA and MeJA could significantly inhibit PvPin1 expression. These findings suggested that PvPin1 may be a repressor in flowering, and its delay of flowering time could be regulated by ABA and MeJA in bamboo.
Pajaud, J; Ribault, C; Ben Mosbah, I; Rauch, C; Henderson, C; Bellaud, P; Aninat, C; Loyer, P; Morel, F; Corlu, A
2015-01-01
Glutathione transferases (GST) are phase II enzymes catalyzing the detoxification of endogenous noxious compounds and xenobiotics. They also regulate phosphorylation activities of MAPKinases in a catalytic-independent manner. Previous studies have demonstrated the regulation of JNK-dependent pathway by GSTP1/2. Considering the crucial role of JNK in the early steps of the hepatocyte cell cycle, we sought to determine whether GSTP1/2 were essential for hepatocyte proliferation following partial hepatectomy (PH). Using a conventional double knockout mouse model for the Gstp1 and Gstp2 genes, we found that the lack of GSTP1/P2 reduced the rate of DNA replication and mitotic index during the first wave of hepatocyte proliferation. The lowered proliferation was associated with the decrease in TNFalpha and IL-6 plasma concentrations, reduced hepatic HGF expression and delayed and/or altered activation of STAT3, JNK and ERK1/2 signaling pathways. In addition, the expression and/or activation of cell cycle regulators such as Cyclin D1, CDK4, E2F1 and MCM7 was postponed demonstrating that the absence of GSTP1/2 delayed the entry into and progression through the G1 phase of the cell cycle and impaired the synchrony of proliferation in hepatocytes following PH. Furthermore, while JNK and its downstream targets c-Jun and ATF2 were activated during the early steps of the liver regeneration in wild-type animals, the constitutively active JNK found in the quiescent liver of Gstp1/2 knockout mice underwent a decrease in its activity after PH. Transient induction of antioxidant enzymes and nitric oxide synthase were also delayed or repressed during the regenerative response. Altogether our results demonstrate that GSTP1/2 are a critical regulators of hepatocyte proliferation in the initial phases of liver regeneration. PMID:25590808
Role of voltage-gated K(+) channels in regulating Ca(2+) entry in rat cortical astrocytes.
Wu, King-Chuen; Kuo, Chang-Shin; Chao, Chia-Chia; Huang, Chieh-Chen; Tu, Yuan-Kun; Chan, Paul; Leung, Yuk-Man
2015-03-01
Astrocytes have multiple functions such as provision of nourishment and mechanical support to the nervous system, helping to clear extracellular metabolites of neurons and modulating synaptic transmission by releasing gliotransmitters. In excitable cells, voltage-gated K(+) (Kv) channels serve to repolarize during action potentials. Astrocytes are considered non-excitable cells since they are not able to generate action potentials. There is an abundant expression of various Kv channels in astrocytes but the functions of these Kv channels remain unclear. We examined whether these astrocyte Kv channels regulate astrocyte "excitability" in the form of cytosolic Ca(2+) signaling. Electrophysiological examination revealed that neonatal rat cortical astrocytes possessed both delayed rectifier type and A-type Kv channels. Pharmacological blockade of both delayed rectifier Kv channels by TEA and A-type Kv channels by quinidine significantly suppressed store-operated Ca(2+) influx; however, TEA alone or quinidine alone did not suffice to cause such suppression. TEA and quinidine together dramatically enhanced current injection-triggered membrane potential overshoot (depolarization); either drug alone caused much smaller enhancements. Taken together, the results suggest both delayed rectifier and A-type Kv channels regulate astrocyte Ca(2+) signaling via controlling membrane potential.
Unfair "Housing Regulation of Major Construction" in the Russian Federation
ERIC Educational Resources Information Center
Goncharov, Alexander I.; Inshakova, Agnessa O.; Kazachenok, Olesya P.; Dikarev, Ilya S.
2016-01-01
This research analyzes the illegal and unreasonable practice of court rulings that aim to accelerate the major construction of problematic long-delayed apartment blocks in the Russian Federation. The authors express their critical attitude to the widespread wrongful approach that violates the laws in effect and allows courts to apply…
Glucocorticoid-mediated Period2 induction delays the phase of circadian rhythm
Cheon, Solmi; Park, Noheon; Cho, Sehyung; Kim, Kyungjin
2013-01-01
Glucocorticoid (GC) signaling synchronizes the circadian rhythm of individual peripheral cells and induces the expression of circadian genes, including Period1 (Per1) and Period2 (Per2). However, no GC response element (GRE) has been reported in the Per2 promoter region. Here we report the molecular mechanisms of Per2 induction by GC signaling and its relevance to the regulation of circadian timing. We found that GC prominently induced Per2 expression and delayed the circadian phase. The overlapping GRE and E-box (GE2) region in the proximal Per2 promoter was responsible for GC-mediated Per2 induction. The GRE in the Per2 promoter was unique in that brain and muscle ARNT-like protein-1 (BMAL1) was essential for GC-induced Per2 expression, whereas other GRE-containing promoters, such as Per1 and mouse mammary tumor virus, responded to dexamethasone in the absence of BMAL1. This specialized regulatory mechanism was mediated by BMAL1-dependent binding of the GC receptor to GRE in Per2 promoter. When Per2 induction was abrogated by the mutation of the GRE or E-box, the circadian oscillation phase failed to be delayed compared with that of the wild-type. Therefore, the current study demonstrates that the rapid Per2 induction mediated by GC is crucial for delaying the circadian rhythm. PMID:23620290
A Novel Role for Banana MaASR in the Regulation of Flowering Time in Transgenic Arabidopsis
Yu, Xiaomeng; Jia, Caihong; Liu, Juhua; Zhang, Jianbin; Wang, Jingyi; Wang, Zhuo; Wang, Anbang; Xu, Biyu; Jin, Zhiqiang
2016-01-01
The abscisic acid (ABA)-, stress-, and ripening-induced (ASR) protein is a plant-specific hydrophilic transcriptional factor involved in fruit ripening and the abiotic stress response. To date, there have been no studies on the role of ASR genes in delayed flowering time. Here, we found that the ASR from banana, designated as MaASR, was preferentially expressed in the banana female flowers from the eighth, fourth, and first cluster of the inflorescence. MaASR transgenic lines (L14 and L38) had a clear delayed-flowering phenotype. The number of rosette leaves, sepals, and pedicel trichomes in L14 and L38 was greater than in the wild type (WT) under long day (LD) conditions. The period of buds, mid-flowers, and full bloom of L14 and L38 appeared later than the WT. cDNA microarray and quantitative real-time PCR (qRT-PCR) analyses revealed that overexpression of MaASR delays flowering through reduced expression of several genes, including photoperiod pathway genes, vernalization pathway genes, gibberellic acid pathway genes, and floral integrator genes, under short days (SD) for 28 d (from vegetative to reproductive transition stage); however, the expression of the autonomous pathway genes was not affected. This study provides the first evidence of a role for ASR genes in delayed flowering time in plants. PMID:27486844
A Novel Role for Banana MaASR in the Regulation of Flowering Time in Transgenic Arabidopsis.
Sun, Peiguang; Miao, Hongxia; Yu, Xiaomeng; Jia, Caihong; Liu, Juhua; Zhang, Jianbin; Wang, Jingyi; Wang, Zhuo; Wang, Anbang; Xu, Biyu; Jin, Zhiqiang
2016-01-01
The abscisic acid (ABA)-, stress-, and ripening-induced (ASR) protein is a plant-specific hydrophilic transcriptional factor involved in fruit ripening and the abiotic stress response. To date, there have been no studies on the role of ASR genes in delayed flowering time. Here, we found that the ASR from banana, designated as MaASR, was preferentially expressed in the banana female flowers from the eighth, fourth, and first cluster of the inflorescence. MaASR transgenic lines (L14 and L38) had a clear delayed-flowering phenotype. The number of rosette leaves, sepals, and pedicel trichomes in L14 and L38 was greater than in the wild type (WT) under long day (LD) conditions. The period of buds, mid-flowers, and full bloom of L14 and L38 appeared later than the WT. cDNA microarray and quantitative real-time PCR (qRT-PCR) analyses revealed that overexpression of MaASR delays flowering through reduced expression of several genes, including photoperiod pathway genes, vernalization pathway genes, gibberellic acid pathway genes, and floral integrator genes, under short days (SD) for 28 d (from vegetative to reproductive transition stage); however, the expression of the autonomous pathway genes was not affected. This study provides the first evidence of a role for ASR genes in delayed flowering time in plants.
Gu, Yan; Zhang, Xuan; Yang, Qian; Wang, Jian-mei; He, Ya-ping; Sun, Zhao-gui; Zhang, Hui-qin; Wang, Jian
2015-05-27
N-myc down-regulated gene 2 (NDRG2) is a tumor suppressor involved in cell proliferation and differentiation. The aim of this study was to determine the uterine expression pattern of this gene during early pregnancy in mice. Uterine NDRG2 mRNA and protein expression levels were determined by RT-PCR and Western blot analyses, respectively, during the peri-implantation period in mice. Immunohistochemical (IHC) analysis was performed to examine the spatial localization of NDRG2 expression in mouse uterine tissues. The in vitro decidualization model of mouse endometrial stromal cells (ESCs) was used to evaluate decidualization of ESCs following NDRG2 knock down by small interfering RNA (siRNA). Statistical significance was analyzed by one-way ANOVA using SPSS 19.0 software. Uterine NDRG2 gene expression was significantly up-regulated and was predominantly localized to the secondary decidual zone on days 5 and 8 of pregnancy in mice. Its increased expression was associated with artificial decidualization as well as the activation of delayed implantation. Furthermore, uterine NDRG2 expression was induced by estrogen and progesterone treatments. The in vitro decidualization of mouse ESCs was accompanied by up-regulation of NDRG2 expression, and knock down of its expression in these cells by siRNA inhibited the decidualization process. These results suggest that NDRG2 might play an important role in the process of decidualization during early pregnancy.
Lenis, Andrew T.; Kuang, Mei; Woo, Lynn L.; Hijaz, Adonis; Penn, Marc S.; Butler, Robert S.; Rackley, Raymond; Damaser, Margot S.; Wood, Hadley M.
2015-01-01
Purpose Human childbirth simulated by vaginal distention is known to increase the expression of chemokines and receptors involved in stem cell homing and tissue repair. We hypothesized that pregnancy and parturition in rats contributes to the expression of chemokines and receptors after vaginal distention. Materials and Methods We used 72 age matched female Lewis rats, including virgin rats with and without vaginal distention, and delivered rats with and without vaginal distention. Each rat was sacrificed immediately, or 3 or 7 days after vaginal distention and/or parturition, and the urethra was harvested. Relative expression of chemokines and receptors was determined by real-time polymerase chain reaction. Mixed models were used with the Bonferroni correction for multiple comparisons. Results Vaginal distention up-regulated urethral expression of CCL7 immediately after injury in virgin and postpartum rats. Hypoxia inducible factor-1α and vascular endothelial growth factor were up-regulated only in virgin rats immediately after vaginal distention. CD191 expression was immediately up-regulated in postpartum rats without vaginal distention compared to virgin rats without vaginal distention. CD195 was up-regulated in virgin rats 3 days after vaginal distention compared to virgin rats without vaginal distention. CD193 and CXCR4 showed delayed up-regulation in virgin rats 7 days after vaginal distention. CXCL12 was up-regulated in virgin rats 3 days after vaginal distention compared to immediately after vaginal distention. Interleukin-8 and CD192 showed no differential expression. Conclusions Vaginal distention results in up-regulation of the chemokines and receptors expressed during tissue injury, which may facilitate the spontaneous functional recovery previously noted. Pregnancy and delivery up-regulated CD191 and attenuated the expression of hypoxia inducible factor-1α and vascular endothelial growth factor in the setting of vaginal distention, likely by decreasing hypoxia. PMID:23022009
Phytotoxic effects of Sicyos deppei (Cucurbitaceae) in germinating tomato seeds.
Lara-Núñez, Aurora; Sánchez-Nieto, Sobeida; Luisa Anaya, Ana; Cruz-Ortega, Rocio
2009-06-01
The phytotoxic effect of allelochemicals is referred to as allelochemical stress and it is considered a biotic stress. Sicyos deppei G. Don (Cucurbitaceae) is an allelopathic weed that causes phytotoxicity in Lycopersicon esculentum, delaying seed germination and severely inhibiting radicle growth. This paper reports in in vitro conditions, the effects of the aqueous leachate of S. deppei-throughout tomato germination times-on (1) the dynamics of starch and sugars metabolism, (2) activity and expression of the cell wall enzymes involved in endosperm weakening that allows the protrusion of the radicle, and (3) whether abscisic acid (ABA) is involved in this altered metabolic processes. Results showed that S. deppei leachate on tomato seed germination mainly caused: (1) delay in starch degradation as well as in sucrose hydrolysis; (2) lower activity of sucrose phosphate synthase, cell wall invertase, and alpha-amylase; being sucrose phosphate synthase (SPS) gene expression down-regulated, and the last two up regulated; (3) also, lower activity of endo beta-mannanase, beta-1,3 glucanase, alpha-galactosidase, and exo-polygalacturonase with altered gene expression; and (4) higher content of ABA during all times of germination. The phytotoxic effect of S. deppei aqueous leachate is because of the sum of many metabolic processes affected during tomato seed germination that finally is evidenced by a strong inhibition of radicle growth.
Bit-1 is an essential regulator of myogenic differentiation
Griffiths, Genevieve S.; Doe, Jinger; Jijiwa, Mayumi; Van Ry, Pam; Cruz, Vivian; de la Vega, Michelle; Ramos, Joe W.; Burkin, Dean J.; Matter, Michelle L.
2015-01-01
Muscle differentiation requires a complex signaling cascade that leads to the production of multinucleated myofibers. Genes regulating the intrinsic mitochondrial apoptotic pathway also function in controlling cell differentiation. How such signaling pathways are regulated during differentiation is not fully understood. Bit-1 (also known as PTRH2) mutations in humans cause infantile-onset multisystem disease with muscle weakness. We demonstrate here that Bit-1 controls skeletal myogenesis through a caspase-mediated signaling pathway. Bit-1-null mice exhibit a myopathy with hypotrophic myofibers. Bit-1-null myoblasts prematurely express muscle-specific proteins. Similarly, knockdown of Bit-1 expression in C2C12 myoblasts promotes early differentiation, whereas overexpression delays differentiation. In wild-type mice, Bit-1 levels increase during differentiation. Bit-1-null myoblasts exhibited increased levels of caspase 9 and caspase 3 without increased apoptosis. Bit-1 re-expression partially rescued differentiation. In Bit-1-null muscle, Bcl-2 levels are reduced, suggesting that Bcl-2-mediated inhibition of caspase 9 and caspase 3 is decreased. Bcl-2 re-expression rescued Bit-1-mediated early differentiation in Bit-1-null myoblasts and C2C12 cells with knockdown of Bit-1 expression. These results support an unanticipated yet essential role for Bit-1 in controlling myogenesis through regulation of Bcl-2. PMID:25770104
Osteopontin plays a pivotal role in increasing severity of respiratory syncytial virus infection
Sampayo-Escobar, Viviana; Green, Ryan; Cheung, Michael B.; Bedi, Raminder; Mohapatra, Subhra
2018-01-01
The molecular mechanisms underlying susceptibility to severe respiratory syncytial virus (RSV) infection remain poorly understood. Herein, we report on the role of osteopontin (OPN) in regulation of RSV infection in human epithelial cells and how interleukin-1 beta (IL-1β), a cytokine secreted soon after RSV infection, when persistently expressed can induce OPN expression leading to increased viral infection. We first compared OPN expression in two human epithelial cell lines: HEK-293 and HEp-2. In contrast to HEp-2, HEK-293 expresses low levels of pro-caspase-1 resulting in decreased IL-1β expression in response to RSV infection. We found a correlation between low IL-1β levels and a delay in induction of OPN expression in RSV-infected HEK-293 cells compared to HEp-2. This phenomenon could partially explain the high susceptibility of HEp-2 cells to RSV infection versus the moderate susceptibility of HEK-293 cells. Also, HEK-293 cells expressing low levels of pro-caspase-1 exhibit decreased IL-1β expression and delayed OPN expression in response to RSV infection. HEK-293 cells incubated with human rIL-1β showed a dose-dependent increase in OPN expression upon RSV infection. Also, incubation with rOPN increased RSV viral load. Moreover, HEp-2 cells or mice infected with a mucogenic RSV strain RSV-L19F showed elevated levels of OPN in contrast to mice infected with the laboratory RSV strain rA2. This correlated with elevated levels of OPN following infection with RSV-L19F compared to rA2. Together, these results demonstrate that increased OPN expression is regulated in part by IL-1β, and the interplay between IL-1β and OPN signaling may play a pivotal role in the spread of RSV infection. PMID:29677209
Cooper, Nichola H; Balachandra, Jeya P; Hardman, Matthew J
2015-12-01
The skin's mechanical integrity is maintained by an organized and robust dermal extracellular matrix (ECM). Resistance to mechanical disruption hinges primarily on homeostasis of the dermal collagen fibril architecture, which is regulated, at least in part, by members of the small leucine-rich proteoglycan (SLRP) family. Here we present data linking protein kinase C alpha (PKCα) to the regulated expression of multiple ECM components including SLRPs. Global microarray profiling reveals deficiencies in ECM gene expression in PKCα-/- skin correlating with abnormal collagen fibril morphology, disorganized dermal architecture, and reduced skin strength. Detailed analysis of the skin and wounds from wild-type and PKCα-/- mice reveals a failure to upregulate collagen and other ECM components in response to injury, resulting in delayed granulation tissue deposition in PKCα-/- wounds. Thus, our data reveal a previously unappreciated role for PKCα in the regulation of ECM structure and deposition during skin wound healing.
Regulation of cytokine receptors by Golgi N-glycan processing and endocytosis.
Partridge, Emily A; Le Roy, Christine; Di Guglielmo, Gianni M; Pawling, Judy; Cheung, Pam; Granovsky, Maria; Nabi, Ivan R; Wrana, Jeffrey L; Dennis, James W
2004-10-01
The Golgi enzyme beta1,6 N-acetylglucosaminyltransferase V (Mgat5) is up-regulated in carcinomas and promotes the substitution of N-glycan with poly N-acetyllactosamine, the preferred ligand for galectin-3 (Gal-3). Here, we report that expression of Mgat5 sensitized mouse cells to multiple cytokines. Gal-3 cross-linked Mgat5-modified N-glycans on epidermal growth factor and transforming growth factor-beta receptors at the cell surface and delayed their removal by constitutive endocytosis. Mgat5 expression in mammary carcinoma was rate limiting for cytokine signaling and consequently for epithelial-mesenchymal transition, cell motility, and tumor metastasis. Mgat5 also promoted cytokine-mediated leukocyte signaling, phagocytosis, and extravasation in vivo. Thus, conditional regulation of N-glycan processing drives synchronous modification of cytokine receptors, which balances their surface retention against loss via endocytosis.
Erbb2 up-regulation of ADAM12 expression accelerates skin cancer progression.
Rao, Velidi H; Vogel, Kristen; Yanagida, Jodi K; Marwaha, Nitin; Kandel, Amrit; Trempus, Carol; Repertinger, Susan K; Hansen, Laura A
2015-10-01
Solar ultraviolet (UV) radiation can cause severe damage to the skin and is the primary cause of most skin cancer. UV radiation causes DNA damage leading to mutations and also activates the Erbb2/HER2 receptor through indirect mechanisms involving reactive oxygen species. We hypothesized that Erbb2 activation accelerates the malignant progression of UV-induced skin cancer. Following the induction of benign squamous papillomas by UV exposure of v-ras(Ha) transgenic Tg.AC mice, mice were treated topically with the Erbb2 inhibitor AG825 and tumor progression monitored. AG825 treatment reduced tumor volume, increased tumor regression, and delayed the development of malignant squamous cell carcinoma (SCC). Progression to malignancy was associated with increased Erbb2 and ADAM12 (A Disintegin And Metalloproteinase 12) transcripts and protein, while inhibition of Erbb2 blocked the increase in ADAM12 message upon malignant progression. Similarly, human SCC and SCC cell lines had increased ADAM12 protein and transcripts when compared to normal controls. To determine whether Erbb2 up-regulation of ADAM12 contributed to malignant progression of skin cancer, Erbb2 expression was modulated in cultured SCC cells using forced over-expression or siRNA targeting, demonstrating up-regulation of ADAM12 by Erbb2. Furthermore, ADAM12 transfection or siRNA targeting revealed that ADAM12 increased both the migration and invasion of cutaneous SCC cells. Collectively, these results suggest Erbb2 up-regulation of ADAM12 as a novel mechanism contributing to the malignant progression of UV-induced skin cancer. Inhibition of Erbb2/HER2 reduced tumor burden, increased tumor regression, and delayed the progression of benign skin tumors to malignant SCC in UV-exposed mice. Inhibition of Erbb2 suppressed the increase in metalloproteinase ADAM12 expression in skin tumors, which in turn increased migration and tumor cell invasiveness. © 2014 Wiley Periodicals, Inc.
ERIC Educational Resources Information Center
Veatch, Olivia J.; Pendergast, Julie S.; Allen, Melissa J.; Leu, Roberta M.; Johnson, Carl Hirschie; Elsea, Sarah H.; Malow, Beth A.
2015-01-01
Sleep disruption is common in individuals with autism spectrum disorder (ASD). Genes whose products regulate endogenous melatonin modify sleep patterns and have been implicated in ASD. Genetic factors likely contribute to comorbid expression of sleep disorders in ASD. We studied a clinically unique ASD subgroup, consisting solely of children with…
Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher
2012-07-01
PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.
Rossi, Giuliana; Antonini, Stefania; Bonfanti, Chiara; Monteverde, Stefania; Vezzali, Chiara; Tajbakhsh, Shahragim; Cossu, Giulio; Messina, Graziella
2016-03-08
Nfix belongs to a family of four highly conserved proteins that act as transcriptional activators and/or repressors of cellular and viral genes. We previously showed a pivotal role for Nfix in regulating the transcriptional switch from embryonic to fetal myogenesis. Here, we show that Nfix directly represses the Myostatin promoter, thus controlling the proper timing of satellite cell differentiation and muscle regeneration. Nfix-null mice display delayed regeneration after injury, and this deficit is reversed upon in vivo Myostatin silencing. Conditional deletion of Nfix in satellite cells results in a similar delay in regeneration, confirming the functional requirement for Nfix in satellite cells. Moreover, mice lacking Nfix show reduced myofiber cross sectional area and a predominant slow twitching phenotype. These data define a role for Nfix in postnatal skeletal muscle and unveil a mechanism for Myostatin regulation, thus providing insights into the modulation of its complex signaling pathway. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Suzuki, N; Nadano, D; Paria, B C; Kupriyanov, S; Sugihara, K; Fukuda, M N
2000-11-01
Trophinin mediates apical cell adhesion between two human cell lines, trophoblastic teratocarcinoma and endometrial adenocarcinoma. In humans, trophinin is specifically expressed in cells involved in implantation and early placentation. The present study was undertaken to establish trophinin expression by the mouse uterus. In the pregnant mouse uterus, trophinin transcripts are expressed during the time which coincides with the timing of blastocyst implantation. Trophinin is also expressed in the nonpregnant mouse uterus at estrus stage. Uteri from ovariectomized mice did not express trophinin, whereas strong expression was induced by estrogen but not by progesterone. Trophinin transcripts and protein were found in the pseudopregnant mouse uterus. No differences were detected in trophinin expression by the uteri in the pregnant, pseudopregnant, and pseudopregnant received blastocysts. In delayed implantation model, trophinin proteins were found in both luminal and glandular epithelium, whereas dormant blastocysts were negative for trophinin. Upon activation with estrogen, however, no significant changes were detected either in the blastocyst or in the uterus. These results indicate that ovarian hormones regulate trophinin expression by the mouse uterus, and that an implanting blastocyst has no effect on trophinin expression in the surrounding endometrial luminal epithelial cells.
48 CFR 42.1304 - Government delay of work.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Government delay of work. 42.1304 Section 42.1304 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Government Delay of Work 42.1304 Government delay of work. (a) The clause at 52.242-17, Government Delay of...
48 CFR 42.1304 - Government delay of work.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 48 Federal Acquisition Regulations System 1 2014-10-01 2014-10-01 false Government delay of work. 42.1304 Section 42.1304 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Government Delay of Work 42.1304 Government delay of work. (a) The clause at 52.242-17, Government Delay of...
S100A9 Interaction with TLR4 Promotes Tumor Growth
Källberg, Eva; Vogl, Thomas; Liberg, David; Olsson, Anders; Björk, Per; Wikström, Pernilla; Bergh, Anders; Roth, Johannes; Ivars, Fredrik; Leanderson, Tomas
2012-01-01
By breeding TRAMP mice with S100A9 knock-out (S100A9−/−) animals and scoring the appearance of palpable tumors we observed a delayed tumor growth in animals devoid of S100A9 expression. CD11b+ S100A9 expressing cells were not observed in normal prostate tissue from control C57BL/6 mice but were readily detected in TRAMP prostate tumors. Also, S100A9 expression was observed in association with CD68+ macrophages in biopsies from human prostate tumors. Delayed growth of TRAMP tumors was also observed in mice lacking the S100A9 ligand TLR4. In the EL-4 lymphoma model tumor growth inhibition was observed in S100A9−/− and TLR4−/−, but not in RAGE−/− animals lacking an alternative S100A9 receptor. When expression of immune-regulating genes was analyzed using RT-PCR the only common change observed in mice lacking S100A9 and TLR4 was a down-regulation of TGFβ expression in splenic CD11b+ cells. Lastly, treatment of mice with a small molecule (ABR-215050) that inhibits S100A9 binding to TLR4 inhibited EL4 tumor growth. Thus, S100A9 and TLR4 appear to be involved in promoting tumor growth in two different tumor models and pharmacological inhibition of S100A9-TLR4 interactions is a novel and promising target for anti-tumor therapies. PMID:22470535
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kobashigawa, Shinko, E-mail: kobashin@nagasaki-u.ac.jp; Suzuki, Keiji; Yamashita, Shunichi
2011-11-04
Highlights: Black-Right-Pointing-Pointer We report first time that ionizing radiation induces mitochondrial dynamic changes. Black-Right-Pointing-Pointer Radiation-induced mitochondrial fission was caused by Drp1 localization. Black-Right-Pointing-Pointer We found that radiation causes delayed ROS from mitochondria. Black-Right-Pointing-Pointer Down regulation of Drp1 rescued mitochondrial dysfunction after radiation exposure. -- Abstract: Ionizing radiation is known to increase intracellular level of reactive oxygen species (ROS) through mitochondrial dysfunction. Although it has been as a basis of radiation-induced genetic instability, the mechanism involving mitochondrial dysfunction remains unclear. Here we studied the dynamics of mitochondrial structure in normal human fibroblast like cells exposed to ionizing radiation. Delayed mitochondrial O{submore » 2}{sup {center_dot}-} production was peaked 3 days after irradiation, which was coupled with accelerated mitochondrial fission. We found that radiation exposure accumulated dynamin-related protein 1 (Drp1) to mitochondria. Knocking down of Drp1 expression prevented radiation induced acceleration of mitochondrial fission. Furthermore, knockdown of Drp1 significantly suppressed delayed production of mitochondrial O{sub 2}{sup {center_dot}-}. Since the loss of mitochondrial membrane potential, which was induced by radiation was prevented in cells knocking down of Drp1 expression, indicating that the excessive mitochondrial fission was involved in delayed mitochondrial dysfunction after irradiation.« less
Semwal, Vimal Kumar; Singh, Bhupinder; Khanna-Chopra, Renu
2014-04-01
Reproductive sinks regulate monocarpic senescence in crop plants. Monocarpic senescence was studied in wheat fertile (cv. HW 2041) and its isonuclear cytoplasmic male sterile (CMS) line. CMS plants exhibited slower rate of senescence accompanied by longer green leaf area duration and slower deceleration in chlorophyll, protein content, PN and rubisco content coupled with lower protease activities than fertile (F) plants. CMS plants also exhibited lower ROS levels and less membrane damage than F plants. CMS plants maintained better antioxidant defense, less oxidative damage in chloroplast and higher transcript levels of both rbcL and rbcS genes during senescence than F plants. F plants exhibited early induction and higher expression of SAGs like serine and cysteine proteases, glutamine synthetases GS1 and GS2, WRKY53 transcription factor and decline in transcript levels of CAT1 and CAT2 genes than CMS plants. Hence, using genetically fertile and its CMS line of wheat it is confirmed that delayed senescence in the absence of reproductive sinks is linked with slower protein oxidation, rubisco degradation and delayed activation of SAGs. Better antioxidant defense in chloroplasts at later stages of senescence was able to mitigate the deleterious effects of ROS in CMS plants. We propose that delayed increase in ROS in cytoplasmic male sterile wheat plants resulted in delayed activation of WRKY53, SAGs and the associated biochemical changes than fertile plants.
Liu, Xi-Qiong; Liu, Zhi-Quan; Yu, Cheng-Yu; Dong, Jun-Gang; Hu, Sheng-Wu; Xu, Ai-Xia
2017-01-01
The thermo-sensitive genic male sterility (TGMS) line SP2S is a spontaneous rapeseed mutation with several traits that are favorable for the production of two-line hybrids. To uncover the key cellular events and genetic regulation associated with TGMS expression, a combined study using cytological observation, transcriptome profiling, and gene expression analysis was conducted for SP2S and its near-isogenic line SP2F grown under warm conditions. Asynchronous microsporocyte meiosis and abnormal tapetal plastids and elaioplasts were demonstrated in the anther of SP2S. The tetrad microspore did not undergo mitosis before the cytoplasm degenerated. Delayed degradation of the tetrad wall, which led to tetrad microspore aggregation, resulted in postponement of sexine (outer layer of pollen exine) formation and sexine fusion in the tetrad. The nexine (foot layer of exine) was also absent. The delay of tetrad wall degradation and abnormality of the exine structure suggested that the defective tapetum lost important functions. Based on transcriptomic comparisons between young flower buds of SP2S and SP2F plants, a total of 465 differentially expressed transcripts (DETs) were identified, including 303 up-regulated DETs and 162 down-regulated DETs in SP2S. Several genes encoding small RNA degrading nuclease 2, small RNA 2′-O-methyltransferase, thioredoxin reductase 2, regulatory subunit A alpha isoform of serine/threonine-protein phosphatase 2A, glycine rich protein 1A, transcription factor bHLH25, leucine-rich repeat receptor kinase At3g14840 like, and fasciclin-like arabinogalactan proteins FLA19 and FLA20 were greatly depressed in SP2S. Interestingly, a POLLENLESS3-LIKE 2 gene encoding the Arabidopsis MS5 homologous protein, which is necessary for microsporocyte meiosis, was down-regulated in SP2S. Other genes that were up-regulated in SP2S encoded glucanase A6, ethylene-responsive transcription factor 1A-like, pollen-specific SF3, stress-associated endoplasmic reticulum protein 2, WRKY transcription factors and pentatricopeptide repeat (PPR) protein At1g07590. The tapetum-development-related genes, including BnEMS1, BnDYT1, and BnAMS, were slightly up-regulated in 3-mm-long flower buds or their anthers, and their downstream genes, BnMS1 and BnMYB80, which affect callose dissolution and exine formation, were greatly up-regulated in SP2S. This aberrant genetic regulation corresponded well with the cytological abnormalities. The results suggested that expression of TGMS associates with complex transcriptional regulation. PMID:28775729
Shang‐Guan, Yangfan; Ma, Jing; Hu, Hang; Wang, Linlong; Magdalou, Jacques; Chen, Liaobin
2016-01-01
Abstract Background and Purpose Prenatal exposure to dexamethasone slows down fetal linear growth and bone mineralization but the regulatory mechanism remains unknown. Here we assessed how dexamethasone regulates bone development in the fetus. Experimental Approach Dexamethasone (1 mg·kg−1·day−1) was injected subcutaneously every morning in pregnant rats from gestational day (GD)9 to GD20. Fetal femurs and tibias were harvested at GD20 for histological and gene expression analysis. Femurs of 12‐week‐old female offspring were harvested for microCT (μCT) measurement. Primary chondrocytes were treated with dexamethasone (10, 50, 250 and 1000 nM). Key Results Prenatal dexamethasone exposure resulted in accumulation of hypertrophic chondrocytes and delayed formation of the primary ossification centre in fetal long bone. The retardation was accompanied by reduced maturation of hypertrophic chondrocytes, decreased osteoclast number and down‐regulated expression of osteocalcin and bone sialoprotein in long bone. In addition, the mitogen‐inducible gene‐6 (Mig6) and osteoprotegerin (OPG) expression were stimulated, and the receptor activator of NF‐κB ligand (RANKL) expression was repressed. Moreover, dexamethasone activated OPG and repressed RANKL expression in both primary chondrocytes and primary osteoblasts, and the knockdown of Mig6 abolished the effect of dexamethasone on OPG expression. Further, μCT measurement showed loss of bone mass in femur of 12‐week‐old offspring with prenatal dexamethasone exposure. Conclusions and Implications Prenatal dexamethasone exposure delays endochondral ossification by suppressing chondrocyte maturation and osteoclast differentiation, which may be partly mediated by Mig6 activation in bone. Bone development retardation in the fetus may be associated with reduced bone mass in later life. PMID:27128203
Effects of seawater acidification on gene expression: resolving broader-scale trends in sea urchins.
Evans, Tyler G; Watson-Wynn, Priscilla
2014-06-01
Sea urchins are ecologically and economically important calcifying organisms threatened by acidification of the global ocean caused by anthropogenic CO2 emissions. Propelled by the sequencing of the purple sea urchin (Strongylocentrotus purpuratus) genome, profiling changes in gene expression during exposure to high pCO2 seawater has emerged as a powerful and increasingly common method to infer the response of urchins to ocean change. However, analyses of gene expression are sensitive to experimental methodology, and comparisons between studies of genes regulated by ocean acidification are most often made in the context of major caveats. Here we perform meta-analyses as a means of minimizing experimental discrepancies and resolving broader-scale trends regarding the effects of ocean acidification on gene expression in urchins. Analyses across eight studies and four urchin species largely support prevailing hypotheses about the impact of ocean acidification on marine calcifiers. The predominant expression pattern involved the down-regulation of genes within energy-producing pathways, a clear indication of metabolic depression. Genes with functions in ion transport were significantly over-represented and are most plausibly contributing to intracellular pH regulation. Expression profiles provided extensive evidence for an impact on biomineralization, epitomized by the down-regulation of seven spicule matrix proteins. In contrast, expression profiles provided limited evidence for CO2-mediated developmental delay or induction of a cellular stress response. Congruence between studies of gene expression and the ocean acidification literature in general validates the accuracy of gene expression in predicting the consequences of ocean change and justifies its continued use in future studies. © 2014 Marine Biological Laboratory.
The Genetic Control of Reproductive Development under High Ambient Temperature.
Ejaz, Mahwish; von Korff, Maria
2017-01-01
Ambient temperature has a large impact on reproductive development and grain yield in temperate cereals. However, little is known about the genetic control of development under different ambient temperatures. Here, we demonstrate that in barley (Hordeum vulgare), high ambient temperatures accelerate or delay reproductive development depending on the photoperiod response gene PHOTOPERIOD1 (Ppd-H1) and its upstream regulator EARLY FLOWERING3 (HvELF3). A natural mutation in Ppd-H1 prevalent in spring barley delayed floral development and reduced the number of florets and seeds per spike, while the wild-type Ppd-H1 or a mutant Hvelf3 allele accelerated floral development and maintained the seed number under high ambient temperatures. High ambient temperature delayed the expression phase and reduced the amplitude of clock genes and repressed the floral integrator gene FLOWERING LOCUS T1 independently of the genotype. Ppd-H1-dependent variation in flowering time under different ambient temperatures correlated with relative expression levels of the BARLEY MADS-box genes VERNALIZATION1 (HvVRN1), HvBM3, and HvBM8 in the leaf. Finally, we show that Ppd-H1 interacts with regulatory variation at HvVRN1. Ppd-H1 only accelerated floral development in the background of a spring HvVRN1 allele with a deletion in the regulatory intron. The full-length winter Hvvrn1 allele was strongly down-regulated, and flowering was delayed by high temperatures irrespective of Ppd-H1 Our findings demonstrate that the photoperiodic and vernalization pathways interact to control flowering time and floret fertility in response to ambient temperature in barley. © 2017 American Society of Plant Biologists. All Rights Reserved.
The Genetic Control of Reproductive Development under High Ambient Temperature1[OPEN
2017-01-01
Ambient temperature has a large impact on reproductive development and grain yield in temperate cereals. However, little is known about the genetic control of development under different ambient temperatures. Here, we demonstrate that in barley (Hordeum vulgare), high ambient temperatures accelerate or delay reproductive development depending on the photoperiod response gene PHOTOPERIOD1 (Ppd-H1) and its upstream regulator EARLY FLOWERING3 (HvELF3). A natural mutation in Ppd-H1 prevalent in spring barley delayed floral development and reduced the number of florets and seeds per spike, while the wild-type Ppd-H1 or a mutant Hvelf3 allele accelerated floral development and maintained the seed number under high ambient temperatures. High ambient temperature delayed the expression phase and reduced the amplitude of clock genes and repressed the floral integrator gene FLOWERING LOCUS T1 independently of the genotype. Ppd-H1-dependent variation in flowering time under different ambient temperatures correlated with relative expression levels of the BARLEY MADS-box genes VERNALIZATION1 (HvVRN1), HvBM3, and HvBM8 in the leaf. Finally, we show that Ppd-H1 interacts with regulatory variation at HvVRN1. Ppd-H1 only accelerated floral development in the background of a spring HvVRN1 allele with a deletion in the regulatory intron. The full-length winter Hvvrn1 allele was strongly down-regulated, and flowering was delayed by high temperatures irrespective of Ppd-H1. Our findings demonstrate that the photoperiodic and vernalization pathways interact to control flowering time and floret fertility in response to ambient temperature in barley. PMID:28049855
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Er-Wen; Department of Forensic Pathology, Zhongshan School of Medicine, Sun Yat-Sen University, Guangzhou; Xue, Sheng-Jiang
Highlights: • Levels of EEN expression paralleled with the rate of cell proliferation. • EEN was involved in the proliferation and survival of multiple myeloma (MM) cells. • EEN regulated the activity of IGF-1-Akt/mTOR pathway. • EEN regulated proliferation and survival of MM cells by enhancing IGF-1 secretion. - Abstract: The molecular mechanisms of multiple myeloma are not well defined. EEN is an endocytosis-regulating molecule. Here we report that EEN regulates the proliferation and survival of multiple myeloma cells, by regulating IGF-1 secretion. In the present study, we observed that EEN expression paralleled with cell proliferation, EEN accelerated cell proliferation,more » facilitated cell cycle transition from G1 to S phase by regulating cyclin-dependent kinases (CDKs) pathway, and delayed cell apoptosis via Bcl2/Bax-mitochondrial pathway. Mechanistically, we found that EEN was indispensable for insulin-like growth factor-1 (IGF-1) secretion and the activation of protein kinase B-mammalian target of rapamycin (Akt-mTOR) pathway. Exogenous IGF-1 overcame the phenotype of EEN depletion, while IGF-1 neutralization overcame that of EEN over-expression. Collectively, these data suggest that EEN may play a pivotal role in excessive cell proliferation and insufficient cell apoptosis of bone marrow plasma cells in multiple myeloma. Therefore, EEN may represent a potential diagnostic marker or therapeutic target for multiple myeloma.« less
Features of CRISPR-Cas Regulation Key to Highly Efficient and Temporally-Specific crRNA Production.
Rodic, Andjela; Blagojevic, Bojana; Djordjevic, Magdalena; Severinov, Konstantin; Djordjevic, Marko
2017-01-01
Bacterial immune systems, such as CRISPR-Cas or restriction-modification (R-M) systems, affect bacterial pathogenicity and antibiotic resistance by modulating horizontal gene flow. A model system for CRISPR-Cas regulation, the Type I-E system from Escherichia coli , is silent under standard laboratory conditions and experimentally observing the dynamics of CRISPR-Cas activation is challenging. Two characteristic features of CRISPR-Cas regulation in E. coli are cooperative transcription repression of cas gene and CRISPR array promoters, and fast non-specific degradation of full length CRISPR transcripts (pre-crRNA). In this work, we use computational modeling to understand how these features affect the system expression dynamics. Signaling which leads to CRISPR-Cas activation is currently unknown, so to bypass this step, we here propose a conceptual setup for cas expression activation, where cas genes are put under transcription control typical for a restriction-modification (R-M) system and then introduced into a cell. Known transcription regulation of an R-M system is used as a proxy for currently unknown CRISPR-Cas transcription control, as both systems are characterized by high cooperativity, which is likely related to similar dynamical constraints of their function. We find that the two characteristic CRISPR-Cas control features are responsible for its temporally-specific dynamical response, so that the system makes a steep (switch-like) transition from OFF to ON state with a time-delay controlled by pre-crRNA degradation rate. We furthermore find that cooperative transcription regulation qualitatively leads to a cross-over to a regime where, at higher pre-crRNA processing rates, crRNA generation approaches the limit of an infinitely abrupt system induction. We propose that these dynamical properties are associated with rapid expression of CRISPR-Cas components and efficient protection of bacterial cells against foreign DNA. In terms of synthetic applications, the setup proposed here should allow highly efficient expression of small RNAs in a narrow time interval, with a specified time-delay with respect to the signal onset.
New Technologies in Using Recombinant Attenuated Salmonella Vaccine Vectors
Curtiss, Roy; Xin, Wei; Li, Yuhua; Kong, Wei; Wanda, Soo-Young; Gunn, Bronwyn; Wang, Shifeng
2014-01-01
Recombinant attenuated Salmonella vaccines (RASVs) have been constructed to deliver antigens from other pathogens to induce immunity to those pathogens in vaccinated hosts. The attenuation means should ensure that the vaccine survives following vaccination to colonize lymphoid tissues without causing disease symptoms. This necessitates that attenuation and synthesis of recombinant gene encoded protective antigens do not diminish the ability of orally administered vaccines to survive stresses encountered in the gastrointestinal tract. We have eliminated these problems by using RASVs with regulated delayed expression of attenuation and regulated delayed synthesis of recombinant antigens. These changes result in RASVs that colonize effector lymphoid tissues efficiently to serve as “factories” to synthesize protective antigens that induce higher protective immune responses than achieved when using previously constructed RASVs. We have devised a biological containment system with regulated delayed lysis to preclude RASV persistence in vivo and survival if excreted. Attributes were added to reduce the mild diarrhea sometimes experienced with oral live RASVs and to ensure complete safety in newborns. These collective technologies have been used to develop a novel, low-cost, RASV-synthesizing, multiple-protective Streptococcus pneumoniae antigens that will be safe for newborns/infants and will induce protective immunity to diverse S. pneumoniae serotypes after oral immunization. PMID:20370633
Transcriptome analysis provides insights into the delayed sticky disease symptoms in Carica papaya.
Madroñero, Johana; Rodrigues, Silas P; Antunes, Tathiana F S; Abreu, Paolla M V; Ventura, José A; Fernandes, A Alberto R; Fernandes, Patricia Machado Bueno
2018-03-21
Global gene expression analysis indicates host stress responses, mainly those mediated by SA, associated to the tolerance to sticky disease symptoms at pre-flowering stage in Carica papaya. Carica papaya plants develop the papaya sticky disease (PSD) as a result of the combined infection of papaya meleira virus (PMeV) and papaya meleira virus 2 (PMeV2), or PMeV complex. PSD symptoms appear only after C. papaya flowers. To understand the mechanisms involved in this phenomenon, the global gene expression patterns of PMeV complex-infected C. papaya at pre-and post-flowering stages were assessed by RNA-Seq. The result was 633 and 88 differentially expressed genes at pre- and post-flowering stages, respectively. At pre-flowering stage, genes related to stress and transport were up-regulated while metabolism-related genes were down-regulated. It was observed that induction of several salicylic acid (SA)-activated genes, including PR1, PR2, PR5, WRKY transcription factors, ROS and callose genes, suggesting SA signaling involvement in the delayed symptoms. In fact, pre-flowering C. papaya treated with exogenous SA showed a tendency to decrease the PMeV and PMeV2 loads when compared to control plants. However, pre-flowering C. papaya also accumulated transcripts encoding a NPR1-inhibitor (NPR1-I/NIM1-I) candidate, genes coding for UDP-glucosyltransferases (UGTs) and several genes involved with ethylene pathway, known to be negative regulators of SA signaling. At post-flowering, when PSD symptoms appeared, the down-regulation of PR-1 encoding gene and the induction of BSMT1 and JA metabolism-related genes were observed. Hence, SA signaling likely operates at the pre-flowering stage of PMeV complex-infected C. papaya inhibiting the development of PSD symptoms, but the induction of its negative regulators prevents the full-scale and long-lasting tolerance.
Shu, Kai; Zhang, Huawei; Wang, Shengfu; Chen, Mingluan; Wu, Yaorong; Tang, Sanyuan; Liu, Chunyan; Feng, Yuqi; Cao, Xiaofeng; Xie, Qi
2013-01-01
Seed dormancy is an important economic trait for agricultural production. Abscisic acid (ABA) and Gibberellins (GA) are the primary factors that regulate the transition from dormancy to germination, and they regulate this process antagonistically. The detailed regulatory mechanism involving crosstalk between ABA and GA, which underlies seed dormancy, requires further elucidation. Here, we report that ABI4 positively regulates primary seed dormancy, while negatively regulating cotyledon greening, by mediating the biogenesis of ABA and GA. Seeds of the Arabidopsis abi4 mutant that were subjected to short-term storage (one or two weeks) germinated significantly more quickly than Wild-Type (WT), and abi4 cotyledons greened markedly more quickly than WT, while the rates of germination and greening were comparable when the seeds were subjected to longer-term storage (six months). The ABA content of dry abi4 seeds was remarkably lower than that of WT, but the amounts were comparable after stratification. Consistently, the GA level of abi4 seeds was increased compared to WT. Further analysis showed that abi4 was resistant to treatment with paclobutrazol (PAC), a GA biosynthesis inhibitor, during germination, while OE-ABI4 was sensitive to PAC, and exogenous GA rescued the delayed germination phenotype of OE-ABI4. Analysis by qRT-PCR showed that the expression of genes involved in ABA and GA metabolism in dry and germinating seeds corresponded to hormonal measurements. Moreover, chromatin immunoprecipitation qPCR (ChIP-qPCR) and transient expression analysis showed that ABI4 repressed CYP707A1 and CYP707A2 expression by directly binding to those promoters, and the ABI4 binding elements are essential for this repression. Accordingly, further genetic analysis showed that abi4 recovered the delayed germination phenotype of cyp707a1 and cyp707a2 and further, rescued the non-germinating phenotype of ga1-t. Taken together, this study suggests that ABI4 is a key factor that regulates primary seed dormancy by mediating the balance between ABA and GA biogenesis. PMID:23818868
Liao, W; Bisgrove, B W; Sawyer, H; Hug, B; Bell, B; Peters, K; Grunwald, D J; Stainier, D Y
1997-01-01
The zebrafish cloche mutation affects both the endothelial and hematopoietic lineages at a very early stage (Stainier, D. Y. R., Weinstein, B. M., Detrich, H. W., Zon, L. I. and Fishman, M. C. (1995). Development 121, 3141-3150). The most striking vascular phenotype is the absence of endocardial cells from the heart. Microscopic examination of mutant embryos reveals the presence of endothelial-like cells in the lower trunk and tail regions while head vessels appear to be missing, indicating a molecular diversification of the endothelial lineage. Cell transplantation experiments show that cloche acts cell-autonomously within the endothelial lineage. To analyze further the role of cloche in regulating endothelial cell differentiation, we have examined the expression of flk-1 and tie, two receptor tyrosine kinase genes expressed early and sequentially in the endothelial lineage. In wild-type fish, flk-1-positive cells are found throughout the embryo and differentiate to form the nascent vasculature. In cloche mutants, flk-1-positive cells are found only in the lower trunk and tail regions, and this expression is delayed as compared to wild-type. Unlike the flk-1-positive cells in wild-type embryos, those in cloche mutants do not go on to express tie, suggesting that their differentiation is halted at an early stage. We also find that the cloche mutation is not linked to flk-1. These data indicate that cloche affects the differentiation of all endothelial cells and that it acts at a very early stage, either by directly regulating flk-1 expression or by controlling the differentiation of cells that normally develop to express flk-1. cloche mutants also have a blood deficit and their hematopoietic tissues show no expression of the hematopoietic transcription factor genes GATA-1 or GATA-2 at early stages. Because the appearance of distinct levels of flk-1 expression is delayed in cloche mutants, we examined GATA-1 expression at late embryonic stages and found some blood cell differentiation that appears to be limited to the region lined by the flk-1-expressing cells. The spatial restriction of blood in the ventroposterior-most region of cloche mutant embryos may be indicative of a ventral source of signal(s) controlling hematopoietic differentiation. In addition, the restricted colocalization of blood and endothelium in cloche mutants suggests that important interactions occur between these two lineages during normal development.
Guo, Jun; Wang, Tingzhong; Yang, Tonghua; Xu, Jianmin; Li, Wentao; Fridman, Michael D; Fisher, John T; Zhang, Shetuan
2011-10-07
Cardiac repolarization is controlled by the rapidly (I(Kr)) and slowly (I(Ks)) activating delayed rectifier potassium channels. The human ether-a-go-go-related gene (hERG) encodes I(Kr), whereas KCNQ1 and KCNE1 together encode I(Ks). Decreases in I(Kr) or I(Ks) cause long QT syndrome (LQTS), a cardiac disorder with a high risk of sudden death. A reduction in extracellular K(+) concentration ([K(+)](o)) induces LQTS and selectively causes endocytic degradation of mature hERG channels from the plasma membrane. In the present study, we investigated whether I(Ks) compensates for the reduced I(Kr) under low K(+) conditions. Our data show that when hERG and KCNQ1 were expressed separately in human embryonic kidney (HEK) cells, exposure to 0 mM K(+) for 6 h completely eliminated the mature hERG channel expression but had no effect on KCNQ1. When hERG and KCNQ1 were co-expressed, KCNQ1 significantly delayed 0 mM K(+)-induced hERG reduction. Also, hERG degradation led to a significant reduction in KCNQ1 in 0 mM K(+) conditions. An interaction between hERG and KCNQ1 was identified in hERG+KCNQ1-expressing HEK cells. Furthermore, KCNQ1 preferentially co-immunoprecipitated with mature hERG channels that are localized in the plasma membrane. Biophysical and pharmacological analyses indicate that although hERG and KCNQ1 closely interact with each other, they form distinct hERG and KCNQ1 channels. These data extend our understanding of delayed rectifier potassium channel trafficking and regulation, as well as the pathology of LQTS.
Key changes in denervated muscles and their impact on regeneration and reinnervation
Wu, Peng; Chawla, Aditya; Spinner, Robert J.; Yu, Cong; Yaszemski, Michael J.; Windebank, Anthony J.; Wang, Huan
2014-01-01
The neuromuscular junction becomes progressively less receptive to regenerating axons if nerve repair is delayed for a long period of time. It is difficult to ascertain the denervated muscle's residual receptivity by time alone. Other sensitive markers that closely correlate with the extent of denervation should be found. After a denervated muscle develops a fibrillation potential, muscle fiber conduction velocity, muscle fiber diameter, muscle wet weight, and maximal isometric force all decrease; remodeling increases neuromuscular junction fragmentation and plantar area, and expression of myogenesis-related genes is initially up-regulated and then down-regulated. All these changes correlate with both the time course and degree of denervation. The nature and time course of these denervation changes in muscle are reviewed from the literature to explore their roles in assessing both the degree of detrimental changes and the potential success of a nerve repair. Fibrillation potential amplitude, muscle fiber conduction velocity, muscle fiber diameter, mRNA expression levels of myogenic regulatory factors and nicotinic acetylcholine receptor could all reflect the severity and length of denervation and the receptiveness of denervated muscle to regenerating axons, which could possibly offer an important clue for surgical choices and predict the outcomes of delayed nerve repair. PMID:25422641
Age-Dependent Schwann Cell Phenotype Regulation Following Peripheral Nerve Injury.
Chen, Wayne A; Luo, T David; Barnwell, Jonathan C; Smith, Thomas L; Li, Zhongyu
2017-12-01
Schwann cells are integral to the regenerative capacity of the peripheral nervous system, which declines after adolescence. The mechanisms underlying this decline are poorly understood. This study sought to compare the protein expression of Notch, c-Jun, and Krox-20 after nerve crush injury in adolescent and young adult rats. We hypothesized that these Schwann cell myelinating regulatory factors are down-regulated after nerve injury in an age-dependent fashion. Adolescent (2 months old) and young adult (12 months old) rats (n = 48) underwent sciatic nerve crush injury. Protein expression of Notch, c-Jun, and Krox-20 was quantified by Western blot analysis at 1, 3, and 7 days post-injury. Functional recovery was assessed in a separate group of animals (n = 8) by gait analysis (sciatic functional index) and electromyography (compound motor action potential) over an 8-week post-injury period. Young adult rats demonstrated a trend of delayed onset of the dedifferentiating regulatory factors, Notch and c-Jun, corresponding to the delayed functional recovery observed in young adult rats compared to adolescent rats. Compound motor action potential area was significantly greater in adolescent rats relative to young adult rats, while amplitude and velocity trended toward statistical significance. The process of Schwann cell dedifferentiation following peripheral nerve injury shows different trends with age. These trends of delayed onset of key regulatory factors responsible for Schwann cell myelination may be one of many possible factors mediating the significant differences in functional recovery between adolescent and young adult rats following peripheral nerve injury.
Li, Qiang; Ramírez-Bergeron, Diana L.; Dunwoodie, Sally L.; Yang, Yu-Chung
2012-01-01
Cited2 (CBP/p300-interacting transactivator with glutamic acid (E)/aspartic acid (D)-rich tail 2) is a transcriptional modulator critical for the development of multiple organs. Although many Cited2-mediated phenotypes and molecular events have been well characterized using in vivo genetic murine models, Cited2-directed cell fate decision in embryonic stem cells (ESCs) remains elusive. In this study, we examined the role of Cited2 in the maintenance of stemness and pluripotency of murine ESCs by a gene-targeting approach. Cited2 knock-out (Cited2Δ/−, KO) ESCs display defective differentiation. Loss of Cited2 in differentiating ESCs results in delayed silencing of the genes involved in the maintenance of pluripotency and self-renewal of stem cells (Oct4, Klf4, Sox2, and c-Myc) and the disturbance in cardiomyocyte, hematopoietic, and neuronal differentiation. In addition, Cited2 KO ESCs experience a delayed induction of cardiomyocyte differentiation-associated proteins, NFAT3 (along with the reduced expression of NFAT3 target genes, Nkx2.5 and β-MHC), N-cadherin, and smooth muscle actin. CITED2 is recruited to the Oct4 promoter to regulate its expression during early ESC differentiation. This is the first demonstration that Cited2 controls ESC pluripotency and differentiation via direct regulation of Oct4 gene expression. PMID:22761414
Jeon, Yeong Ha; Park, Yong Hwan; Lee, Jea Hwang; Hong, Jeong-Ho; Kim, Ick Young
2014-07-01
Selenoprotein W (SelW) is expressed in various tissues, particularly in skeletal muscle. We have previously reported that SelW is up-regulated during C2C12 skeletal muscle differentiation and inhibits binding of 14-3-3 to its target proteins. 14-3-3 reduces myogenic differentiation by inhibiting nuclear translocation of transcriptional co-activator with PDZ-binding motif (TAZ). Phosphorylation of TAZ at Ser89 is required for binding to 14-3-3, leading to cytoplasmic retention of TAZ and a delay in myogenic differentiation. Here, we show that myogenic differentiation was delayed in SelW-knockdown C2C12 cells. Down-regulation of SelW also increased TAZ binding to 14-3-3, which eventually resulted in decreasing translocation of TAZ to the nucleus. However, phosphorylation of TAZ at Ser89 was not affected. Although phosphorylation of TAZ at Ser89 was sustained by the phosphatase inhibitor okadaic acid, nuclear translocation of TAZ was increased by ectopic expression of SelW. This result was due to decreased binding of TAZ to 14-3-3. We also found that the interaction between TAZ and MyoD was increased by ectopic expression of SelW. Taken together, these findings strongly demonstrate that SelW enhances C2C12 cell differentiation by inhibiting TAZ binding to 14-3-3. Copyright © 2014 Elsevier B.V. All rights reserved.
Baviskar, Sandhya N; Shields, Malcolm S
2010-01-01
Glucose-regulated 94 kDa protein (Grp94) is a resident of the endoplasmic reticulum (ER) of multicellular eukaryotes. It is a constitutively expressed protein that is overexpressed in certain abnormal conditions of the cell such as depletion of glucose and calcium, and low oxygen and pH. The protein is also implicated in diseased conditions like cancer and Alzheimer's disease. In this study, the consequences of downregulation of Grp94 were investigated at both unicellular and multicellular stages of Dictyostelium discoideum. Previous studies have shown the expression of Dd-Grp94 (Dictyostelium discoideum glucose-regulated 94 kDa protein) in wild-type cells varies during development, and overexpression of Dd-Grp94 leads to abnormal cell shape and inhibition of development (i.e., formation of fruiting bodies). Grp94 is a known calcium binding protein and an efficient calcium buffer. Therefore, in the present study we hypothesized that downregulation of Dd-Grp94 protein would affect Dictyostelium cell structure, growth, and development. We found that Dd-grp94 RNAi recombinants exhibited reduced growth rate, cell size, and a subtle change in cell motility compared to the parental cells. The recombinants also exhibited a delay in development and small fruiting bodies. These results establish that Dd-grp94 plays a crucial role in determining normal cell structure, growth and differentiation.
Antosova, Barbora; Smolikova, Jana; Borkovcova, Romana; Strnad, Hynek; Lachova, Jitka; Machon, Ondrej; Kozmik, Zbynek
2013-01-01
The Wnt/β-catenin signaling pathway controls many processes during development, including cell proliferation, cell differentiation and tissue homeostasis, and its aberrant regulation has been linked to various pathologies. In this study we investigated the effect of ectopic activation of Wnt/β-catenin signaling during lens fiber cell differentiation. To activate Wnt/β-catenin signaling in lens fiber cells, the transgenic mouse referred to as αA-CLEF was generated, in which the transactivation domain of β-catenin was fused to the DNA-binding protein LEF1, and expression of the transgene was controlled by αA-crystallin promoter. Constitutive activation of Wnt/β-catenin signaling in lens fiber cells of αA-CLEF mice resulted in abnormal and delayed fiber cell differentiation. Moreover, adult αA-CLEF mice developed cataract, microphthalmia and manifested downregulated levels of γ-crystallins in lenses. We provide evidence of aberrant expression of cell cycle regulators in embryonic lenses of αA-CLEF transgenic mice resulting in the delay in cell cycle exit and in the shift of fiber cell differentiation to the central fiber cell compartment. Our results indicate that precise regulation of the Wnt/β-catenin signaling activity during later stages of lens development is essential for proper lens fiber cell differentiation and lens transparency. PMID:24205179
Liu, Shan; Zheng, Zhaodi; Ji, Shuhua; Liu, Tingting; Hou, Yanhan; Li, Shasha; Li, Guorong
2018-06-13
Senescent cells display a senescence-associated secretory phenotype (SASP), which contributes to aging. Resveratrol, an activator of SIRT1, has anti-aging, anti-inflammatory, anti-oxidant, anti-free radical and other pharmacological effects. The genus of the annual fish Nothobranchius has become an emerging animal model for studying aging. However, the underlying mechanism for resveratrol to delay aging by SASP regulation has not been elucidated in vertebrates. In this study, the annual fish N. guentheri were fed with resveratrol for long-term treatment. The results showed that resveratrol reversed intensive senescence-associated β-galactosidase activity with aging process, down-regulated levels of SASP-associated proinflammatory cytokines IL-8 and TNFα, and up-regulated expression of anti-inflammatory cytokine IL-10 in gut of the fish. Resveratrol increased SIRT1 expression, and inhibited NF-κB by decreasing RelA/p65, Ac-RelA/p65 and p-IκBα levels and by increasing the interaction between SIRT1 and RelA/p65. Moreover, resveratrol reversed the decline of intestinal epithelial cells (IECs) and intestinal stem cells (ISCs) caused by aging in gut of the fish. Together, our results implied that resveratrol inhibited SASP through SIRT1/NF-κB signaling pathway and delayed aging of the annual fish N. guentheri. Copyright © 2018. Published by Elsevier Ltd.
RIP2: A novel player in the regulation of keratinocyte proliferation and cutaneous wound repair?
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adams, Stephanie; Valchanova, Ralitsa S.; Munz, Barbara, E-mail: barbara.munz@charite.de
2010-03-10
We could recently demonstrate an important role of receptor interacting protein 4 (RIP4) in the regulation of keratinocyte differentiation. Now, we analyzed a potential role of the RIP4 homolog RIP2 in keratinocytes. Specifically, we demonstrate here that rip2 expression is induced by scratch-wounding and after the induction of differentiation in these cells. Furthermore, serum growth factors and cytokines can induce rip2, with TNF-{alpha}-dependent induction being dependent on p38 MAPK. In addition, we demonstrate that scratch-induced upregulation of rip2 expression is completely blocked by the steroid dexamethasone. Since we also show that RIP2 is an important player in the regulation ofmore » keratinocyte proliferation, these data suggest that inhibition of rip2 upregulation after wounding might contribute to the reduced and delayed wound re-epithelialization phenotype seen in glucocorticoid-treated patients.« less
Rolfe, Rebecca A; Nowlan, Niamh C; Kenny, Elaine M; Cormican, Paul; Morris, Derek W; Prendergast, Patrick J; Kelly, Daniel; Murphy, Paula
2014-01-20
Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus into a transcriptional response. This work identifies key developmental regulatory genes impacted by altered mechanical stimulation, sheds light on the molecular mechanisms that interpret mechanical stimulation during skeletal development and provides valuable resources for further investigation of the mechanistic basis of mechanoregulation. In particular it highlights the Wnt signalling pathway as a potential point of integration of mechanical and molecular signalling and cytoskeletal components as mediators of the response.
2014-01-01
Background Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. Results We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus into a transcriptional response. Conclusions This work identifies key developmental regulatory genes impacted by altered mechanical stimulation, sheds light on the molecular mechanisms that interpret mechanical stimulation during skeletal development and provides valuable resources for further investigation of the mechanistic basis of mechanoregulation. In particular it highlights the Wnt signalling pathway as a potential point of integration of mechanical and molecular signalling and cytoskeletal components as mediators of the response. PMID:24443808
Laguesse, Sophie; Close, Pierre; Van Hees, Laura; Chariot, Alain; Malgrange, Brigitte; Nguyen, Laurent
2017-01-01
The Elongator complex is required for proper development of the cerebral cortex. Interfering with its activity in vivo delays the migration of postmitotic projection neurons, at least through a defective α-tubulin acetylation. However, this complex is already expressed by cortical progenitors where it may regulate the early steps of migration by targeting additional proteins. Here we report that connexin-43 (Cx43), which is strongly expressed by cortical progenitors and whose depletion impairs projection neuron migration, requires Elongator expression for its proper acetylation. Indeed, we show that Cx43 acetylation is reduced in the cortex of Elp3cKO embryos, as well as in a neuroblastoma cell line depleted of Elp1 expression, suggesting that Cx43 acetylation requires Elongator in different cellular contexts. Moreover, we show that histones deacetylase 6 (HDAC6) is a deacetylase of Cx43. Finally, we report that acetylation of Cx43 regulates its membrane distribution in apical progenitors of the cerebral cortex. PMID:28507509
Frey, Anne; Boutin, Jean-Pierre; Sotta, Bruno; Mercier, Raphaël; Marion-Poll, Annie
2006-08-01
Abscisic acid (ABA) is derived from epoxycarotenoid cleavage and regulates seed development and maturation. A detailed carotenoid analysis was undertaken to study the contribution of epoxycarotenoid synthesis to the regulation of ABA accumulation in Nicotiana plumbaginifolia developing seeds. Maximal accumulation of xanthophylls occurred at mid-development in wild type seeds, when total ABA levels also peaked. In contrast, in ABA-deficient mutants xanthophyll synthesis was delayed, in agreement with the retardation in seed maturation. Seed dormancy was restored in mutants impaired in the conversion of zeaxanthin into violaxanthin by zeaxanthin epoxidase (ZEP), by the introduction of the Arabidopsis AtZEP gene under the control of promoters inducing expression during later stages of seed development compared to wild type NpZEP, and in dry and imbibed seeds. Alterations in the timing and level of ZEP expression did not highly affect the temporal regulation of ABA accumulation in transgenic seeds, despite notable perturbations in xanthophyll accumulation. Therefore, major regulatory control of ABA accumulation might occur downstream of epoxycarotenoid synthesis.
Richards, Mark P; Proszkowiec-Weglarz, Monika; Rosebrough, Robert W; McMurtry, John P; Angel, Roselina
2010-12-01
The embryo to neonate transition is a critical period of development that has significant impact on broiler production. During this time important genetic programs governing metabolism and growth are established. The goal of this work was to study the effects of early post-hatch (PH) development and the time of initiation of feeding on activation of the genetic program regulating hepatic lipogenesis. A comparison of liver total RNA samples at hatch and 7 days PH was performed using oligonucleotide-based (Affymetrix GeneChip®) chicken genome microarrays. During the first week PH there was significant up-regulation of key lipogenic genes including: ATP citrate lyase (ACL), malic enzyme (ME), fatty acid synthase (FAS), acetyl-CoA carboxylase alpha (ACCα), stearoyl-CoA desaturase-1 (SCD-1), sterol regulatory element binding protein-2 (SREBP-2) and thyroid hormone responsive spot 14α (Spot 14α) among others. These findings were confirmed using gene-specific RT-PCR assays. In a follow-up study, we investigated the effects of withholding feed for the first 48 h PH (delayed feeding, DF) on lipogenic gene expression through 8 days PH. Body weight gain was significantly depressed by DF. Plasma levels of the major metabolic hormones that regulate lipogenic gene expression (insulin, glucagon and T(3)) changed significantly during PH development, but were largely unaffected by DF. Plasma glucose was significantly lower in the DF group at 24h PH but recovered thereafter. In general, DF inhibited the up-regulation of lipogenic genes until feeding was initiated. Delayed up-regulation was also observed for the lipogenic transcription factor genes, SREBP-1, SREBP-2 and peroxisome proliferator-activated receptor gamma (PPARγ), but not for carbohydrate response element binding protein (ChREB) or liver X receptor (LXR). Our results offer additional insight into the transcriptional programming of hepatic lipogenesis in response to the transition from high fat (yolk) to high carbohydrate (feed) nutrition that occurs during early PH development. Published by Elsevier Inc.
Laskowska-Macios, Karolina; Nys, Julie; Hu, Tjing-Tjing; Zapasnik, Monika; Van der Perren, Anke; Kossut, Malgorzata; Burnat, Kalina; Arckens, Lutgarde
2015-08-14
Binocular pattern deprivation from eye opening (early BD) delays the maturation of the primary visual cortex. This delay is more pronounced for the peripheral than the central visual field representation within area 17, particularly between the age of 2 and 4 months [Laskowska-Macios, Cereb Cortex, 2014]. In this study, we probed for related dynamic changes in the cortical proteome. We introduced age, cortical region and BD as principal variables in a 2-D DIGE screen of area 17. In this way we explored the potential of BD-related protein expression changes between central and peripheral area 17 of 2- and 4-month-old BD (2BD, 4BD) kittens as a valid parameter towards the identification of brain maturation-related molecular processes. Consistent with the maturation delay, distinct developmental protein expression changes observed for normal kittens were postponed by BD, especially in the peripheral region. These BD-induced proteomic changes suggest a negative regulation of neurite outgrowth, synaptic transmission and clathrin-mediated endocytosis, thereby implicating these processes in normal experience-induced visual cortex maturation. Verification of the expression of proteins from each of the biological processes via Western analysis disclosed that some of the transient proteomic changes correlate to the distinct behavioral outcome in adult life, depending on timing and duration of the BD period [Neuroscience 2013;255:99-109]. Taken together, the plasticity potential to recover from BD, in relation to ensuing restoration of normal visual input, appears to rely on specific protein expression changes and cellular processes induced by the loss of pattern vision in early life.
Estradiol-induced gene expression in largemouth bass (Micropterus salmoides)
Bowman, C.J.; Kroll, K.J.; Gross, T.G.; Denslow, N.D.
2002-01-01
Vitellogenin (Vtg) and estrogen receptor (ER) gene expression levels were measured in largemouth bass to evaluate the activation of the ER-mediated pathway by estradiol (E2). Single injections of E2 ranging from 0.0005 to 5 mg/kg up-regulated plasma Vtg in a dose-dependent manner. Vtg and ER mRNAs were measured using partial cDNA sequences corresponding to the C-terminal domain for Vtg and the ligand-binding domain of ER?? sequences. After acute E2-exposures (2 mg/kg), Vtg and ER mRNAs and plasma Vtg levels peaked after 2 days. The rate of ER mRNA accumulation peaked 36-42 h earlier than Vtg mRNA. The expression window for ER defines the primary response to E2 in largemouth bass and that for Vtg a delayed primary response. The specific effect of E2 on other estrogen-regulated genes was tested during these same time windows using differential display RT-PCR. Specific up-regulated genes that are expressed in the same time window as Vtg were ERp72 (a membrane-bound disulfide isomerase) and a gene with homology to an expressed gene identified in zebrafish. Genes that were expressed in a pattern that mimics the ER include the gene for zona radiata protein ZP2, and a gene with homology to an expressed gene found in winter flounder. One gene for fibrinogen ?? was down-regulated and an unidentified gene was transiently up-regulated after 12 h of exposure and returned to basal levels by 48 h. Taken together these studies indicate that the acute molecular response to E2 involves a complex network of responses over time. ?? 2002 Elsevier Science Ireland Ltd. All rights reserved.
Influence of hatch time and access to feed on intramuscular adipose tissue deposition in broilers.
Powell, D J; Velleman, S G; Cowieson, A J; Singh, M; Muir, W I
2016-06-01
The effect of hatch time and subsequent access to feed on intramuscular adipose tissue deposition was studied in the pectoralis major muscle of male Ross 308 broiler chickens. Based on their hatch time chicks were classified as early (EH), midterm (MH), or late (LH) hatchers, with an average incubation duration of 497.7 h for EH, 508.8 h for MH, and 514.5 h for LH birds. Chicks were provided access to feed either immediately at hatch, or 24 h after the conclusion of the hatch window. Expression of the adipogenic regulatory genes peroxisome proliferator-activated receptor gamma (PPARγ), and stearoyl-CoA desaturase (SCD), were measured at the time of hatch, and zero, one, 4, 7, 28, and 40 d. Intramuscular adipocyte cell width and visualization of adipose tissue deposition was observed at 28 and 40 d. Expression of PPARγ was increased in the pectoralis major of LH birds at the time of hatch, zero, and one d. The expression of PPARγ at one and 7 d, and SCD at 7 d were increased in all birds that received delayed access to feed. At 28 d, adipocyte cell width was increased in LH birds with delayed access to feed, compared to EH and MH birds with delayed access to feed and LH birds with immediate access to feed. At 40 d, adipocyte cell width was increased in all birds that received delayed access to feed. Also at 40 d, there was a trend (P = 0.078) for more extensive intramuscular adipose tissue deposition in LH than EH birds, and in birds with delayed access to feed (P = 0.075). These data indicate delayed access to feed increases intramuscular adipose tissue deposition in the pectoralis major muscle, and suggest that hatch time influences this regulation. © 2016 Poultry Science Association Inc.
Schuster, Martin; Greenberg, E Peter
2007-08-22
Quorum-sensing regulation of gene expression in Pseudomonas aeruginosa is complex. Two interconnected acyl-homoserine lactone (acyl-HSL) signal-receptor pairs, 3-oxo-dodecanoyl-HSL-LasR and butanoyl-HSL-RhlR, regulate more than 300 genes. The induction of most of the genes is delayed during growth of P. aeruginosa in complex medium, cannot be advanced by addition of exogenous signal, and requires additional regulatory components. Many of these late genes can be induced by addition of signals early by using specific media conditions. While several factors super-regulate the quorum receptors, others may co-regulate target promoters or may affect expression posttranscriptionally. To better understand the contributions of super-regulation and co-regulation to quorum-sensing gene expression, and to better understand the general structure of the quorum sensing network, we ectopically expressed the two receptors (in the presence of their cognate signals) and another component that affects quorum sensing, the stationary phase sigma factor RpoS, early in growth. We determined the effect on target gene expression by microarray and real-time PCR analysis. Our results show that many target genes (e.g. lasB and hcnABC) are directly responsive to receptor protein levels. Most genes (e.g. lasA, lecA, and phnAB), however, are not significantly affected, although at least some of these genes are directly regulated by quorum sensing. The majority of promoters advanced by RhlR appeared to be regulated directly, which allowed us to build a RhlR consensus sequence. The direct responsiveness of many quorum sensing target genes to receptor protein levels early in growth confirms the role of super-regulation in quorum sensing gene expression. The observation that the induction of most target genes is not affected by signal or receptor protein levels indicates that either target promoters are co-regulated by other transcription factors, or that expression is controlled posttranscriptionally. This architecture permits the integration of multiple signaling pathways resulting in quorum responses that require a "quorum" but are otherwise highly adaptable and receptive to environmental conditions.
Possible linkage of SP6 transcriptional activity with amelogenesis by protein stabilization.
Utami, Trianna W; Miyoshi, Keiko; Hagita, Hiroko; Yanuaryska, Ryna Dwi; Horiguchi, Taigo; Noma, Takafumi
2011-01-01
Ameloblasts produce enamel matrix proteins such as amelogenin, ameloblastin, and amelotin during tooth development. The molecular mechanisms of ameloblast differentiation (amelogenesis) are currently not well understood. SP6 is a transcription factor of the Sp/KLF family that was recently found to regulate cell proliferation in a cell-type-specific manner. Sp6-deficient mice demonstrate characteristic tooth anomalies such as delayed eruption of the incisors and supernumerary teeth with disorganized amelogenesis. However, it remains unclear how Sp6 controls amelogenesis. In this study, we used SP6 high producer cells to identify SP6 target genes. Based on the observations that long-term culture of SP6 high producer cells reduced SP6 protein expression but not Sp6 mRNA expression, we found that SP6 is short lived and specifically degraded through a proteasome pathway. We established an in vitro inducible SP6 expression system coupled with siRNA knockdown and found a possible linkage between SP6 and amelogenesis through the regulation of amelotin and Rock1 gene expression by microarray analysis. Our findings suggest that the regulation of SP6 protein stability is one of the crucial steps in amelogenesis.
Possible Linkage of SP6 Transcriptional Activity with Amelogenesis by Protein Stabilization
Utami, Trianna W.; Miyoshi, Keiko; Hagita, Hiroko; Yanuaryska, Ryna Dwi; Horiguchi, Taigo; Noma, Takafumi
2011-01-01
Ameloblasts produce enamel matrix proteins such as amelogenin, ameloblastin, and amelotin during tooth development. The molecular mechanisms of ameloblast differentiation (amelogenesis) are currently not well understood. SP6 is a transcription factor of the Sp/KLF family that was recently found to regulate cell proliferation in a cell-type-specific manner. Sp6-deficient mice demonstrate characteristic tooth anomalies such as delayed eruption of the incisors and supernumerary teeth with disorganized amelogenesis. However, it remains unclear how Sp6 controls amelogenesis. In this study, we used SP6 high producer cells to identify SP6 target genes. Based on the observations that long-term culture of SP6 high producer cells reduced SP6 protein expression but not Sp6 mRNA expression, we found that SP6 is short lived and specifically degraded through a proteasome pathway. We established an in vitro inducible SP6 expression system coupled with siRNA knockdown and found a possible linkage between SP6 and amelogenesis through the regulation of amelotin and Rock1 gene expression by microarray analysis. Our findings suggest that the regulation of SP6 protein stability is one of the crucial steps in amelogenesis. PMID:22046099
Asefa, Benyam; Dermott, Jonathan M; Kaldis, Philipp; Stefanisko, Karen; Garfinkel, David J; Keller, Jonathan R
2006-02-20
p205 is a member of the interferon-inducible p200 family of proteins that regulate cell proliferation. Over-expression of p205 inhibits cell growth, although its mechanism of action is currently unknown. Therefore, we evaluated the effect of p205 on the p53 and Rb-dependent pathways of cell cycle regulation. p205 expression results in elevated levels of p21, and activates the p21 promoter in vitro in a p53-dependent manner. In addition, p205 induces increased expression of Rb, and binds directly to Rb and p53. Interestingly, p205 also induces growth inhibition independent of p53 and Rb by delaying G2/M progression in proliferating cells, and is a substrate for Cdk2 kinase activity. Finally, we have identified other binding partners of p205 by a yeast two-hybrid screen, including the paired homeodomain protein HoxB2. Taken together, our results indicate that p205 induces growth arrest by interaction with multiple transcription factors that regulate the cell cycle, including but not entirely dependent on the Rb- and p53-mediated pathways of growth inhibition.
Shibuya, Kenichi; Shimizu, Keiichi; Niki, Tomoko; Ichimura, Kazuo
2014-09-01
In flowering plants, floral longevity is species-specific and is closely linked to reproductive strategy; petal senescence, a type of programmed cell death (PCD), is a highly regulated developmental process. However, little is known about regulatory pathways for cell death in petal senescence, which is developmentally controlled in an age-dependent manner. Here, we show that a NAC transcription factor, designated EPHEMERAL1 (EPH1), positively regulates PCD during petal senescence in the ephemeral flowers of Japanese morning glory (Ipomoea nil). EPH1 expression is induced independently of ethylene signaling, and suppression of EPH1 resulted in Japanese morning glory flowers that are in bloom until the second day. The suppressed expression of EPH1 delays progression of PCD, possibly through suppression of the expression of PCD-related genes, including genes for plant caspase and autophagy in the petals. Our data further suggest that EPH1 is involved in the regulation of ethylene-accelerated petal senescence. In this study, we identified a key regulator of PCD in petal senescence, which will facilitate further elucidation of the regulatory network of petal senescence. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Renal PGC1α May Be Associated with Recovery after Delayed Graft Function.
Drury, Erika R; Zsengeller, Zsuzsanna K; Stillman, Isaac E; Khankin, Eliyahu V; Pavlakis, Martha; Parikh, Samir M
2018-01-01
Delayed renal graft function (DGF) contributes to the determination of length of hospitalization, risk of acute rejection, and graft loss. Existing tools aid the diagnosis of specific DGF etiologies such as antibody-mediated rejection, but markers of recovery have been elusive. The peroxisome proliferator gamma co-activator-1-alpha (PGC1α) is highly expressed in the renal tubule, regulates mitochondrial biogenesis, and promotes recovery from experimental acute kidney injury. We aimed to determine the association between renal allograft PGC1α expression and recovery from delayed graft function. We retrospectively analyzed patients undergoing renal transplantation at a single center from January 1, 2008 to June 30, 2014. PGC1α expression was assessed by immunostaining and ultrastructural characteristics by transmission electron microscopy. Of 34 patients who underwent renal biopsy for DGF within 30 days of transplant, 21 were included for analysis. Low PGC1α expression was associated with a significantly longer time on dialysis after transplant (median of 35.5 vs. 16 days, p < 0.05) and a significantly higher serum creatinine (sCr) at 4 weeks after transplantation among those who discontinued dialysis (5 vs. 1.65 mg/dL, p < 0.0001). Low PGC1α expression was not associated with higher sCr at 12 weeks after transplantation. Ultrastructural characteristics including apical membrane blebbing and necrotic luminal debris were not informative regarding clinical outcomes. These data suggest that higher PGC1α expression is associated with faster and more complete recovery from DGF. Mitochondrial biogenesis may be a therapeutic target for DGF. Larger studies are needed to validate these findings. © 2017 S. Karger AG, Basel.
Wei, Guanyun; Sun, Lianjie; Li, Ruimin; Li, Lei; Xu, Jiao; Ma, Fei
2018-04-01
Pathogen bacteria infections can lead to dynamic changes of microRNA (miRNA) and mRNA expression profiles, which may control synergistically the outcome of immune responses. To reveal the role of dynamic miRNA-mRNA regulation in Drosophila innate immune responses, we have detailedly analyzed the paired miRNA and mRNA expression profiles at three time points during Drosophila adult males with Micrococcus luteus (M. luteus) infection using RNA- and small RNA-seq data. Our results demonstrate that differentially expressed miRNAs and mRNAs represent extensively dynamic changes over three time points during Drosophila with M. luteus infection. The pathway enrichment analysis indicates that differentially expressed genes are involved in diverse signaling pathways, including Toll and Imd as well as orther signaling pathways at three time points during Drosophila with M. luteus infection. Remarkably, the dynamic change of miRNA expression is delayed by compared to mRNA expression change over three time points, implying that the "time" parameter should be considered when the function of miRNA/mRNA is further studied. In particular, the dynamic miRNA-mRNA regulatory networks have shown that miRNAs may synergistically regulate gene expressions of different signaling pathways to promote or inhibit innate immune responses and maintain homeostasis in Drosophila, and some new regulators involved in Drosophila innate immune response have been identified. Our findings strongly suggest that miRNA regulation is a key mechanism involved in fine-tuning cooperatively gene expressions of diverse signaling pathways to maintain innate immune response and homeostasis in Drosophila. Taken together, the present study reveals a novel role of dynamic miRNA-mRNA regulation in immune response to bacteria infection, and provides a new insight into the underlying molecular regulatory mechanism of Drosophila innate immune responses. Copyright © 2017 Elsevier Ltd. All rights reserved.
Micheli, Laura; Leonardi, Luca; Conti, Filippo; Maresca, Giovanna; Colazingari, Sandra; Mattei, Elisabetta; Lira, Sergio A.; Farioli-Vecchioli, Stefano; Caruso, Maurizia; Tirone, Felice
2011-01-01
In skeletal muscle cells, the PC4 (Tis7/Ifrd1) protein is known to function as a coactivator of MyoD by promoting the transcriptional activity of myocyte enhancer factor 2C (MEF2C). In this study, we show that up-regulation of PC4 in vivo in adult muscle significantly potentiates injury-induced regeneration by enhancing myogenesis. Conversely, we observe that PC4 silencing in myoblasts causes delayed exit from the cell cycle, accompanied by delayed differentiation, and we show that such an effect is MyoD-dependent. We provide evidence revealing a novel mechanism underlying the promyogenic actions of PC4, by which PC4 functions as a negative regulator of NF-κB, known to inhibit MyoD expression post-transcriptionally. In fact, up-regulation of PC4 in primary myoblasts induces the deacetylation, and hence the inactivation and nuclear export of NF-κB p65, in concomitance with induction of MyoD expression. On the contrary, PC4 silencing in myoblasts induces the acetylation and nuclear import of p65, in parallel with a decrease of MyoD levels. We also observe that PC4 potentiates the inhibition of NF-κB transcriptional activity mediated by histone deacetylases and that PC4 is able to form trimolecular complexes with p65 and HDAC3. This suggests that PC4 stimulates deacetylation of p65 by favoring the recruitment of HDAC3 to p65. As a whole, these results indicate that PC4 plays a role in muscle differentiation by controlling the MyoD pathway through multiple mechanisms, and as such, it positively regulates regenerative myogenesis. PMID:21127072
Arabidopsis DREB2C modulates ABA biosynthesis during germination.
Je, Jihyun; Chen, Huan; Song, Chieun; Lim, Chae Oh
2014-09-12
Plant dehydration-responsive element binding factors (DREBs) are transcriptional regulators of the APETELA2/Ethylene Responsive element-binding Factor (AP2/ERF) family that control expression of abiotic stress-related genes. We show here that under conditions of mild heat stress, constitutive overexpression seeds of transgenic DREB2C overexpression Arabidopsis exhibit delayed germination and increased abscisic acid (ABA) content compared to untransformed wild-type (WT). Treatment with fluridone, an inhibitor of the ABA biosynthesis abrogated these effects. Expression of an ABA biosynthesis-related gene, 9-cis-epoxycarotenoid dioxygenase 9 (NCED9) was up-regulated in the DREB2C overexpression lines compared to WT. DREB2C was able to trans-activate expression of NCED9 in Arabidopsis leaf protoplasts in vitro. Direct and specific binding of DREB2C to a complete DRE on the NCED9 promoter was observed in electrophoretic mobility shift assays. Exogenous ABA treatment induced DREB2C expression in germinating seeds of WT. Vegetative growth of transgenic DREB2C overexpression lines was more strongly inhibited by exogenous ABA compared to WT. These results suggest that DREB2C is a stress- and ABA-inducible gene that acts as a positive regulator of ABA biosynthesis in germinating seeds through activating NCED9 expression. Copyright © 2014 Elsevier Inc. All rights reserved.
RNA-binding Protein Quaking Stabilizes Sirt2 mRNA during Oligodendroglial Differentiation*
Thangaraj, Merlin P.; Furber, Kendra L.; Gan, Jotham K.; Ji, Shaoping; Sobchishin, Larhonda; Doucette, J. Ronald; Nazarali, Adil J.
2017-01-01
Myelination is controlled by timely expression of genes involved in the differentiation of oligodendrocyte precursor cells (OPCs) into myelinating oligodendrocytes (OLs). Sirtuin 2 (SIRT2), a NAD+-dependent deacetylase, plays a critical role in OL differentiation by promoting both arborization and downstream expression of myelin-specific genes. However, the mechanisms involved in regulating SIRT2 expression during OL development are largely unknown. The RNA-binding protein quaking (QKI) plays an important role in myelination by post-transcriptionally regulating the expression of several myelin specific genes. In quaking viable (qkv/qkv) mutant mice, SIRT2 protein is severely reduced; however, it is not known whether these genes interact to regulate OL differentiation. Here, we report for the first time that QKI directly binds to Sirt2 mRNA via a common quaking response element (QRE) located in the 3′ untranslated region (UTR) to control SIRT2 expression in OL lineage cells. This interaction is associated with increased stability and longer half-lives of Sirt2.1 and Sirt2.2 transcripts leading to increased accumulation of Sirt2 transcripts. Consistent with this, overexpression of qkI promoted the expression of Sirt2 mRNA and protein. However, overexpression of the nuclear isoform qkI-5 promoted the expression of Sirt2 mRNA, but not SIRT2 protein, and delayed OL differentiation. These results suggest that the balance in the subcellular distribution and temporal expression of QKI isoforms control the availability of Sirt2 mRNA for translation. Collectively, our study demonstrates that QKI directly plays a crucial role in the post-transcriptional regulation and expression of Sirt2 to facilitate OL differentiation. PMID:28188285
Melatonin regulates delayed embryonic development in the short-nosed fruit bat, Cynopterus sphinx.
Banerjee, Arnab; Meenakumari, K J; Udin, S; Krishna, A
2009-12-01
The aim of the present study was to evaluate the seasonal variation in serum melatonin levels and their relationship to the changes in the serum progesterone level, ovarian steroidogenesis, and embryonic development during two successive pregnancies of Cynopterus sphinx. Circulating melatonin concentrations showed two peaks; one coincided with the period of low progesterone synthesis and delayed embryonic development, whereas the second peak coincided with regressing corpus luteum. This finding suggests that increased serum melatonin level during November-December may be responsible for delayed embryonic development by suppressing progesterone synthesis. The study showed increased melatonin receptors (MTNR1A and MTNR1B) in the corpus luteum and in the utero-embryonic unit during the period of delayed embryonic development. The in vitro study showed that a high dose of melatonin suppressed progesterone synthesis, whereas a lower dose of melatonin increased progesterone synthesis by the ovary. The effects of melatonin on ovarian steroidogenesis are mediated through changes in the expression of peripheral-type benzodiazepine receptor, P450 side chain cleavage enzyme, and LH receptor proteins. This study further showed a suppressive impact of melatonin on the progesterone receptor (PGR) in the utero-embryonic unit; this effect might contribute to delayed embryonic development in C. sphinx. The results of the present study thus suggest that a high circulating melatonin level has a dual contribution in retarding embryonic development in C. sphinx by impairing progesterone synthesis as well as by inhibiting progesterone action by reducing expression of PGR in the utero-embryonic unit.
Zhu, Mingku; Chen, Guoping; Zhou, Shuang; Tu, Yun; Wang, Yi; Dong, Tingting; Hu, Zongli
2014-01-01
Fruit ripening in tomato (Solanum lycopersicum) is a complicated development process affected by both endogenous hormonal and genetic regulators and external signals. Although the role of NOR, a member of the NAC domain family, in mediating tomato fruit ripening has been established, its underlying molecular mechanisms remain unclear. To explore further the role of NAC transcription factors in fruit ripening, we characterized a new tomato NAC domain protein, named SlNAC4, which shows high accumulation in sepal and at the onset of fruit ripening. Various stress treatments including wounding, NaCl, dehydration and low temperature significantly increased the expression of SlNAC4. Reduced expression of SlNAC4 by RNA interference (RNAi) in tomato resulted in delayed fruit ripening, suppressed Chl breakdown and decreased ethylene synthesis mediated mainly through reduced expression of ethylene biosynthesis genes of system-2, and reduced carotenoids by alteration of the carotenoid pathway flux. Transgenic tomato fruits also displayed significant down-regulation of multiple ripening-associated genes, indicating that SlNAC4 functions as a positive regulator of fruit ripening by affecting ethylene synthesis and carotenoid accumulation. Moreover, we also noted that SlNAC4 could not be induced by ethylene and may function upstream of the ripening regulator RIN and positively regulate its expression. Yeast two-hybrid assay further revealed that SlNAC4 could interact with both RIN and NOR protein. These results suggested that ethylene-dependent and -independent processes are regulated by SlNAC4 in the fruit ripening regulatory network.
Genome-Wide Analysis of the Complex Transcriptional Networks of Rice Developing Seeds
Xue, Liang-Jiao; Zhang, Jing-Jing; Xue, Hong-Wei
2012-01-01
Background The development of rice (Oryza sativa) seed is closely associated with assimilates storage and plant yield, and is fine controlled by complex regulatory networks. Exhaustive transcriptome analysis of developing rice embryo and endosperm will help to characterize the genes possibly involved in the regulation of seed development and provide clues of yield and quality improvement. Principal Findings Our analysis showed that genes involved in metabolism regulation, hormone response and cellular organization processes are predominantly expressed during rice development. Interestingly, 191 transcription factor (TF)-encoding genes are predominantly expressed in seed and 59 TFs are regulated during seed development, some of which are homologs of seed-specific TFs or regulators of Arabidopsis seed development. Gene co-expression network analysis showed these TFs associated with multiple cellular and metabolism pathways, indicating a complex regulation of rice seed development. Further, by employing a cold-resistant cultivar Hanfeng (HF), genome-wide analyses of seed transcriptome at normal and low temperature reveal that rice seed is sensitive to low temperature at early stage and many genes associated with seed development are down-regulated by low temperature, indicating that the delayed development of rice seed by low temperature is mainly caused by the inhibition of the development-related genes. The transcriptional response of seed and seedling to low temperature is different, and the differential expressions of genes in signaling and metabolism pathways may contribute to the chilling tolerance of HF during seed development. Conclusions These results provide informative clues and will significantly improve the understanding of rice seed development regulation and the mechanism of cold response in rice seed. PMID:22363552
Marko, Victoria A; Kilmury, Sara L N; MacNeil, Lesley T; Burrows, Lori L
2018-05-18
Type IV pili are expressed by a wide range of prokaryotes, including the opportunistic pathogen Pseudomonas aeruginosa. These flexible fibres mediate twitching motility, biofilm maturation, surface adhesion, and virulence. The pilus is composed mainly of major pilin subunits while the low abundance minor pilins FimU-PilVWXE and the putative adhesin PilY1 prime pilus assembly and are proposed to form the pilus tip. The minor pilins and PilY1 are encoded in an operon that is positively regulated by the FimS-AlgR two-component system. Independent of pilus assembly, PilY1 was proposed to be a mechanosensory component that-in conjunction with minor pilins-triggers up-regulation of acute virulence phenotypes upon surface attachment. Here, we investigated the link between the minor pilins/PilY1 and virulence. pilW, pilX, and pilY1 mutants had reduced virulence towards Caenorhabditis elegans relative to wild type or a major pilin mutant, implying a role in pathogenicity that is independent of pilus assembly. We hypothesized that loss of specific minor pilins relieves feedback inhibition on FimS-AlgR, increasing transcription of the AlgR regulon and delaying C. elegans killing. Reporter assays confirmed that FimS-AlgR were required for increased expression of the minor pilin operon upon loss of select minor pilins. Overexpression of AlgR or its hyperactivation via a phosphomimetic mutation reduced virulence, and the virulence defects of pilW, pilX, and pilY1 mutants required FimS-AlgR expression and activation. We propose that PilY1 and the minor pilins inhibit their own expression, and that loss of these proteins leads to FimS-mediated activation of AlgR that suppresses expression of acute-phase virulence factors and delays killing. This mechanism could contribute to adaptation of P. aeruginosa in chronic lung infections, as mutations in the minor pilin operon result in the loss of piliation and increased expression of AlgR-dependent virulence factors-such as alginate-that are characteristic of such infections.
Lxr-driven enterocyte lipid droplet formation delays transport of ingested lipids.
Cruz-Garcia, Lourdes; Schlegel, Amnon
2014-09-01
Liver X receptors (Lxrs) are master regulators of cholesterol catabolism, driving the elimination of cholesterol from the periphery to the lumen of the intestine. Development of pharmacological agents to activate Lxrs has been hindered by synthetic Lxr agonists' induction of hepatic lipogenesis and hypertriglyceridemia. Elucidating the function of Lxrs in regulating enterocyte lipid handling might identify novel aspects of lipid metabolism that are pharmacologically amenable. We took a genetic approach centered on the single Lxr gene nr1h3 in zebrafish to study the role of Lxr in enterocyte lipid metabolism. Loss of nr1h3 function causes anticipated gene regulatory changes and cholesterol intolerance, collectively reflecting high evolutionary conservation of zebrafish Lxra function. Intestinal nr1h3 activation delays transport of absorbed neutral lipids, with accumulation of neutral lipids in enterocyte cytoplasmic droplets. This delay in transport of ingested neutral lipids protects animals from hypercholesterolemia and hepatic steatosis induced by a high-fat diet. On a gene regulatory level, Lxra induces expression of acsl3a, which encodes acyl-CoA synthetase long-chain family member 3a, a lipid droplet-anchored protein that directs fatty acyl chains into lipids. Forced overexpression of acls3a in enterocytes delays, in part, the appearance of neutral lipids in the vasculature of zebrafish larvae. Activation of Lxr in the intestine cell-autonomously regulates the rate of delivery of absorbed lipids by inducting a temporary lipid intestinal droplet storage depot. Copyright © 2014 by the American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Serrano, Isabel; Diez-Marques, Maria L.; Rodriguez-Puyol, Manuel
2012-11-15
Integrin-linked kinase (ILK) is an intracellular effector of cell-matrix interactions and regulates many cellular processes, including growth, proliferation, survival, differentiation, migration, invasion and angiogenesis. The present work analyzes the role of ILK in wound healing in adult animals using a conditional knock-out of the ILK gene generated with the tamoxifen-inducible Cre-lox system (CRE-LOX mice). Results show that ILK deficiency leads to retarded wound closure in skin. Intracellular mechanisms involved in this process were analyzed in cultured mouse embryonic fibroblast (MEF) isolated from CRE-LOX mice and revealed that wounding promotes rapid activation of phosphatidylinositol 3-kinase (PI3K) and ILK. Knockdown of ILKmore » resulted in a retarded wound closure due to a decrease in cellular proliferation and loss of HGF protein expression during the healing process, in vitro and in vivo. Alterations in cell proliferation and wound closure in ILK-deficient MEF or mice could be rescued by exogenous administration of human HGF. These data demonstrate, for the first time, that the activation of PI3K and ILK after skin wounding are critical for HGF-dependent tissue repair and wound healing. -- Highlights: Black-Right-Pointing-Pointer ILK deletion results in decreased HGF expression and delayed scratch wound repair. Black-Right-Pointing-Pointer PI3K/ILK/AKT pathway signals through HGF to regulate wound healing. Black-Right-Pointing-Pointer An ILK-dependent increase in HGF expression is responsible for wound healing in vivo. Black-Right-Pointing-Pointer ILK-KO mice are used to confirm the requirement for ILK function in wound healing. Black-Right-Pointing-Pointer Human HGF treatment restores delayed wound closure in vitro and in vivo.« less
Regulation of infection efficiency in a globally abundant marine Bacteriodetes virus
Howard-Varona, Cristina; Roux, Simon; Dore, Hugo; ...
2016-05-17
Microbes impact human health and disease, industrial processes and natural ecosystems, but do so under the influence of viruses. Problematically, knowledge of viral infection efficiencies and outcomes (e.g. lysis, lysogeny) derives from few model systems that over-represent efficient, lytic infections and under-represent virus-host natural diversity. Here we sought to understand how infection efficiency is regulated in an environmental Bacteroidetes virus that represents a globally abundant viral group and has drastically different infection efficiencies when infecting two nearly identical bacterial strains. To this end, we quantified bacterial virus (phage) and host DNA, transcripts and phage particles throughout the infection of bothmore » bacterial hosts. While the phage transcriptome was similar during both infections, host transcriptional differences appeared to have altered infection efficiency. Specifically, host transcriptomes suggested that the phage failed to repress early host expression in the inefficient nfection, thereby allowing the host to respond against infection by delaying phage DNA replication and protein translation. Further measurements showed that phage DNA and particle production were delayed (by >30 minutes) and reduced (by >50%) in the inefficient versus efficient infection as the host over-expressed DNA degradation genes and under-expressed translation genes, respectively. Together these results suggest that multiple levels of regulation can impact infection efficiencies as failure to repress host transcription allowed the host to defend against both phage DNA and protein production. Given that this phage type is ubiquitous and abundant in the global oceans and that variably efficient viral infections are likely common in any ecosystem with varying phage-host abundances and physiological states, these data provide a critically needed foundation for understanding and modeling viral infection efficiency in nature.« less
Regulation of infection efficiency in a globally abundant marine Bacteriodetes virus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Howard-Varona, Cristina; Roux, Simon; Dore, Hugo
Microbes impact human health and disease, industrial processes and natural ecosystems, but do so under the influence of viruses. Problematically, knowledge of viral infection efficiencies and outcomes (e.g. lysis, lysogeny) derives from few model systems that over-represent efficient, lytic infections and under-represent virus-host natural diversity. Here we sought to understand how infection efficiency is regulated in an environmental Bacteroidetes virus that represents a globally abundant viral group and has drastically different infection efficiencies when infecting two nearly identical bacterial strains. To this end, we quantified bacterial virus (phage) and host DNA, transcripts and phage particles throughout the infection of bothmore » bacterial hosts. While the phage transcriptome was similar during both infections, host transcriptional differences appeared to have altered infection efficiency. Specifically, host transcriptomes suggested that the phage failed to repress early host expression in the inefficient nfection, thereby allowing the host to respond against infection by delaying phage DNA replication and protein translation. Further measurements showed that phage DNA and particle production were delayed (by >30 minutes) and reduced (by >50%) in the inefficient versus efficient infection as the host over-expressed DNA degradation genes and under-expressed translation genes, respectively. Together these results suggest that multiple levels of regulation can impact infection efficiencies as failure to repress host transcription allowed the host to defend against both phage DNA and protein production. Given that this phage type is ubiquitous and abundant in the global oceans and that variably efficient viral infections are likely common in any ecosystem with varying phage-host abundances and physiological states, these data provide a critically needed foundation for understanding and modeling viral infection efficiency in nature.« less
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630
EARLY BUD-BREAK 1 (EBB1) is a regulator of release from seasonal dormancy in poplar trees
Yordanov, Yordan S.; Ma, Cathleen; Strauss, Steven H.; Busov, Victor B.
2014-01-01
Trees from temperate latitudes transition between growth and dormancy to survive dehydration and freezing stress during winter months. We used activation tagging to isolate a dominant mutation affecting release from dormancy and identified the corresponding gene EARLY BUD-BREAK 1 (EBB1). We demonstrate through positioning of the tag, expression analysis, and retransformation experiments that EBB1 encodes a putative APETALA2/Ethylene responsive factor transcription factor. Transgenic up-regulation of the gene caused early bud-flush, whereas down-regulation delayed bud-break. Native EBB1 expression was highest in actively growing apices, undetectable during the dormancy period, but rapidly increased before bud-break. The EBB1 transcript was localized in the L1/L2 layers of the shoot meristem and leaf primordia. EBB1-overexpressing transgenic plants displayed enlarged shoot meristems, open and poorly differentiated buds, and a higher rate of cell division in the apex. Transcriptome analyses of the EBB1 transgenics identified 971 differentially expressed genes whose expression correlated with the EBB1 expression changes in the transgenic plants. Promoter analysis among the differentially expressed genes for the presence of a canonical EBB1-binding site identified 65 putative target genes, indicative of a broad regulatory context of EBB1 function. Our results suggest that EBB1 has a major and integrative role in reactivation of meristem activity after winter dormancy. PMID:24951507
Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas
2010-03-01
Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.
48 CFR 3442.7003 - Delays clause.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Delays clause. 3442.7003 Section 3442.7003 Federal Acquisition Regulations System DEPARTMENT OF EDUCATION ACQUISITION REGULATION CONTRACT MANAGEMENT CONTRACT ADMINISTRATION Contract Monitoring 3442.7003 Delays clause. The contracting...
Park, In-Hyun; Chen, Jie
2005-09-09
Skeletal myogenesis is a well orchestrated cascade of events regulated by multiple signaling pathways, one of which is recently characterized by its sensitivity to the bacterial macrolide rapamycin. Previously we reported that the mammalian target of rapamycin (mTOR) regulates the initiation of the differentiation program in mouse C2C12 myoblasts by controlling the expression of insulin-like growth factor-II in a kinase-independent manner. Here we provide experimental evidence suggesting that a different mode of mTOR signaling regulates skeletal myogenesis at a later stage. In the absence of endogenous mTOR function in C2C12 cells treated with rapamycin, a kinase-inactive mTOR fully supports myogenin expression, but causes a delay in contractile protein expression. Myoblasts fuse to form nascent myotubes in the absence of kinase-active mTOR, whereas the formation of mature myotubes by further fusion requires the catalytic activity of mTOR. Therefore, the two stages of myocyte fusion are molecularly separable at the level of mTOR signaling. In addition, our data suggest that a factor secreted into the culture medium is responsible for mediating the function of mTOR in regulating the late-stage fusion leading to mature myotubes. Furthermore, taking advantage of the unique features of cells stably expressing a mutant mTOR, we have performed cDNA microarray analysis to compare global gene expression profiles between mature and nascent myotubes, the results of which have implicated classes of genes and revealed candidate regulators in myotube maturation or functions of mature myotubes.
Increased dosage of DYRK1A and DSCR1 delays neuronal differentiation in neocortical progenitor cells
Kurabayashi, Nobuhiro; Sanada, Kamon
2013-01-01
Down's syndrome (DS), a major genetic cause of mental retardation, arises from triplication of genes on human chromosome 21. Here we show that DYRK1A (dual-specificity tyrosine-phosphorylated and -regulated kinase 1A) and DSCR1 (DS critical region 1), two genes lying within human chromosome 21 and encoding for a serine/threonine kinase and calcineurin regulator, respectively, are expressed in neural progenitors in the mouse developing neocortex. Increasing the dosage of both proteins in neural progenitors leads to a delay in neuronal differentiation, resulting ultimately in alteration of their laminar fate. This defect is mediated by the cooperative actions of DYRK1A and DSCR1 in suppressing the activity of the transcription factor NFATc. In Ts1Cje mice, a DS mouse model, dysregulation of NFATc in conjunction with increased levels of DYRK1A and DSCR1 was observed. Furthermore, counteracting the dysregulated pathway ameliorates the delayed neuronal differentiation observed in Ts1Cje mice. In sum, our findings suggest that dosage of DYRK1A and DSCR1 is critical for proper neurogenesis through NFATc and provide a potential mechanism to explain the neurodevelopmental defects in DS. PMID:24352425
Vu, Wendy T; Chang, Peter L; Moriuchi, Ken S; Friesen, Maren L
2015-04-01
Transgenerational plasticity provides phenotypic variation that contributes to adaptation. For plants, the timing of seed germination is critical for offspring survival in stressful environments, as germination timing can alter the environmental conditions a seedling experiences. Stored seed transcripts are important determinants of seed germination, but have not previously been linked with transgenerational plasticity of germination behavior. In this study we used RNAseq and growth chamber experiments of the model legume M. trucantula to test whether parental exposure to salinity stress influences the expression of stored seed transcripts and early offspring traits and test for genetic variation. We detected genotype-dependent parental environmental effects (transgenerational plasticity) on the expression levels of stored seed transcripts, seed size, and germination behavior of four M. truncatula genotypes. More than 50% of the transcripts detected in the mature, ungerminated seed transcriptome were annotated as regulating seed germination, some of which are involved in abiotic stress response and post-embryonic development. Some genotypes showed increased seed size in response to parental exposure to salinity stress, but no parental environmental influence on germination timing. In contrast, other genotypes showed no seed size differences across contrasting parental conditions but displayed transgenerational plasticity for germimation timing, with significantly delayed germination in saline conditions when parental plants were exposed to salinity. In genotypes that show significant transgenerational plastic germination response, we found significant coexpression networks derived from salt responsive transcripts involved in post-transcriptional regulation of the germination pathway. Consistent with the delayed germination response to saline conditions in these genotypes, we found genes associated with dormancy and up-regulation of abscisic acid (ABA). Our results demonstrate genetic variation in transgenerational plasticity within M. truncatula and show that parental exposure to salinity stress influences the expression of stored seed transcripts, seed weight, and germination behavior. Furthermore, we show that the parental environment influences gene expression to modulate biological pathways that are likely responsible for offspring germination responses to salinity stress.
Analysis of transient hypermorphic activity of E(spl)D during R8 specification
Majot, Adam T.
2017-01-01
Drosophila atonal (ato) is required for the specification of founding R8 photoreceptors during retinal development. ato is regulated via dual eye-specific enhancers; ato-3’ is subject to initial induction whereas 5’-ato facilitates Notch-mediated autoregulation. Notch is further utilized to induce bHLH repressors of the E(spl) locus to restrict Ato from its initial broad expression to individual cells. Although Notch operates in two, distinct phases, it has remained unclear how the two phases maintain independence from one another. The difference in these two phases has attributed to the hypothesized delayed expression of E(spl). However, immunofluorescence data indicate that E(spl) are expressed during early Ato patterning, suggesting a more sophisticated underlying mechanism. To probe this mechanism, we provide evidence that although E(spl) exert no influence on ato-3’, E(spl) repress 5’-ato and deletion of the E(spl) locus elicits precocious 5’-ato activity. Thus, E(spl) imposes a delay to the timing in which Ato initiates autoregulation. We next sought to understand this finding in the context of E(spl)D, which encodes a dysregulated variant of E(spl)M8 that perturbs R8 patterning, though, as previously reported, only in conjunction with the mutant receptor Nspl. We established a genetic interaction between E(spl)D and roughened eye (roe), a known modulator of Notch signaling in retinogenesis. This link further suggests a dosage-dependence between E(spl) and the proneural activators Ato and Sens, as indicated via interaction assays in which E(spl)D renders aberrant R8 patterning in conjunction with reduced proneural dosage. In total, the biphasicity of Notch signaling relies, to some degree, on the post-translational regulation of individual E(spl) members and, importantly, that post-translational regulation is likely necessary to modulate the level of E(spl) activity throughout the progression of Ato expression. PMID:29036187
Chen, Jing; Stahl, Andreas; Krah, Nathan M; Seaward, Molly R; Joyal, Jean-Sebastian; Juan, Aimee M; Hatton, Colman J; Aderman, Christopher M; Dennison, Roberta J; Willett, Keirnan L; Sapieha, Przemyslaw; Smith, Lois E H
2012-01-01
Mutations in low-density lipoprotein receptor-related protein 5 (Lrp5) impair retinal angiogenesis in patients with familial exudative vitreoretinopathy (FEVR), a rare type of blinding vascular eye disease. The defective retinal vasculature phenotype in human FEVR patients is recapitulated in Lrp5 knockout (Lrp5(-/-)) mouse with delayed and incomplete development of retinal vessels. In this study we examined gene expression changes in the developing Lrp5(-/-) mouse retina to gain insight into the molecular mechanisms that underlie the pathology of FEVR in humans. Gene expression levels were assessed with an Illumina microarray on total RNA from Lrp5(-/-) and WT retinas isolated on postnatal day (P) 8. Regulated genes were confirmed using RT-qPCR analysis. Consistent with a role in vascular development, we identified expression changes in genes involved in cell-cell adhesion, blood vessel morphogenesis and membrane transport in Lrp5(-/-) retina compared to WT retina. In particular, tight junction protein claudin5 and amino acid transporter slc38a5 are both highly down-regulated in Lrp5(-/-) retina. Similarly, several Wnt ligands including Wnt7b show decreased expression levels. Plasmalemma vesicle associated protein (plvap), an endothelial permeability marker, in contrast, is up-regulated consistent with increased permeability in Lrp5(-/-) retinas. Together these data suggest that Lrp5 regulates multiple groups of genes that influence retinal angiogenesis and may contribute to the pathogenesis of FEVR.
Ortiz-Espín, Ana; Iglesias-Fernández, Raquel; Calderón, Aingeru; Carbonero, Pilar; Sevilla, Francisca
2017-01-01
Abstract Mitochondrial thioredoxin-o (AtTrxo1) was characterized and its expression examined in different organs of Arabidopsis thaliana. AtTrxo1 transcript levels were particularly high in dry seeds and cotyledons where they reached a maximum 36 h after imbibition with water, coinciding with 50% germination. Expression was lower in seeds germinating in 100 mM NaCl. To gain insight into the transcriptional regulation of the AtTrxo1 gene, a phylogenomic analysis was coupled with the screening of an arrayed library of Arabidopsis transcription factors in yeast. The basic leucine zipper AtbZIP9 and the zinc finger protein AZF2 were identified as putative transcriptional regulators. Transcript regulation of AtbZIP9 and AtAFZ2 during germination was compatible with the proposed role in transcriptional regulation of AtTrxo1. Transient over-expression of AtbZIP9 and AtAZF2 in Nicotiana benthamiana leaves demonstrated an activation effect of AtbZIP9 and a repressor effect of AtAZF2 on AtTrxo1 promoter-driven reporter expression. Although moderate concentrations of salt delayed germination in Arabidopsis wild-type seeds, those of two different AtTrxo1 knock-out mutants germinated faster and accumulated higher H2O2 levels than the wild-type. All these data indicate that AtTrxo1 has a role in redox homeostasis during seed germination under salt conditions. PMID:28184497
Kamenšek, Simona; Browning, Douglas F; Podlesek, Zdravko; Busby, Stephen J W; Žgur-Bertok, Darja; Butala, Matej
2015-06-01
Colicins are plasmid-encoded narrow spectrum antibiotics that are synthesized by strains of Escherichia coli and govern intraspecies competition. In a previous report, we demonstrated that the global transcriptional factor IscR, co dependently with the master regulator of the DNA damage response, LexA, delays induction of the pore forming colicin genes after SOS induction. Here we show that IscR is not involved in the regulation of nuclease colicins, but that the AsnC protein is. We report that AsnC, in concert with LexA, is the key controller of the temporal induction of the DNA degrading colicin E8 gene (cea8), after DNA damage. We demonstrate that a large AsnC nucleosome-like structure, in conjunction with two LexA molecules, prevent cea8 transcription initiation and that AsnC binding activity is directly modulated by L asparagine. We show that L-asparagine is an environmental factor that has a marked impact on cea8 promoter regulation. Our results show that AsnC also modulates the expression of several other DNase and RNase colicin genes but does not substantially affect pore-forming colicin K gene expression. We propose that selection pressure has "chosen" highly conserved regulators to control colicin expression in E. coli strains, enabling similar colicin gene silencing among bacteria upon exchange of colicinogenic plasmids.
Effects of copper on growth, metamorphosis and endocrine disruption of Bufo gargarizans larvae.
Wang, Chao; Liang, Gang; Chai, Lihong; Wang, Hongyuan
2016-01-01
Chinese toad (Bufo gargarizans) tadpoles were exposed to copper (1, 6.4, 32 and 64μgL(-1) copper) from the beginning of larval period through completion of metamorphosis. We examined the effects of chronic copper exposure on mortality, growth, time to metamorphosis, tail resorption time, body size at the metamorphic climax (Gs 42) and completion of metamorphosis (Gs 46) and thyroid gland histology. In addition, type 2 and 3 iodothyronine deiodinase (Dio2 and Dio3), thyroid hormone receptors (TRα and TRβ) mRNA levels were also measured to assess disruption of TH synthesis. Our result showed that 6.4-64μgL(-1) copper concentration increased the mortality and inhibited the growth of B. gargarizans tadpoles. In addition, significant reduction in size at Gs 42 and a time delay to Gs 42 were observed at 6.4-64μgL(-1) copper treatments. Moreover, histological examinations have clearly revealed that 64μgL(-1) copper caused follicular cell hyperplasia in thyroid gland. According to real-time PCR results, exposure to 32 and 64μgL(-1) copper significantly up-regulated mRNA expression of Dio3, but down-regulated mRNA expression of TRα and TRβ mRNA level. We concluded that copper delayed amphibian metamorphosis through changing mRNA expression of Dio3, TRα and TRβ, which suggests that copper might have the endocrine-disrupting effect. Copyright © 2015 Elsevier B.V. All rights reserved.
Sun, Wei; Roland, Kenneth L; Kuang, Xiaoying; Branger, Christine G; Curtiss, Roy
2010-03-01
Two mutant strains of Yersinia pestis KIM5+, a Deltacrp mutant and a mutant with arabinose-dependent regulated delayed-shutoff crp expression (araC P(BAD) crp), were constructed, characterized in vitro, and evaluated for virulence, immunogenicity, and protective efficacy in mice. Both strains were highly attenuated by the subcutaneous (s.c.) route. The 50% lethal doses (LD(50)s) of the Deltacrp and araC P(BAD) crp mutants were approximately 1,000,000-fold and 10,000-fold higher than those of Y. pestis KIM5+, respectively, indicating that both strains were highly attenuated. Mice vaccinated s.c. with 3.8 x 10(7) CFU of the Deltacrp mutant developed high anti-Y. pestis and anti-LcrV serum IgG titers, both with a strong Th2 bias, and induced protective immunity against subcutaneous challenge with virulent Y. pestis (80% survival) but no protection against pulmonary challenge. Mice vaccinated with 3.0 x 10(4) CFU of the araC P(BAD) crp mutant also developed high anti-Y. pestis and anti-LcrV serum IgG titers but with a more balanced Th1/Th2 response. This strain induced complete protection against s.c. challenge and partial protection (70% survival) against pulmonary challenge. Our results demonstrate that arabinose-dependent regulated crp expression is an effective strategy to attenuate Y. pestis while retaining strong immunogenicity, leading to protection against the pneumonic and bubonic forms of plague.
Tatematsu, Kiyoshi; Nakabayashi, Kazumi; Kamiya, Yuji; Nambara, Eiji
2008-01-01
To understand the molecular mechanisms underlying regulation of seed germination, we searched enriched cis elements in the upstream regions of Arabidopsis genes whose transcript levels increased during seed germination. Using available published microarray data, we found that two cis elements, Up1 or Up2, which regulate outgrowth of Arabidopsis axillary shoots, were significantly over-represented. Classification of Up1- and Up2-containing genes by gene ontology revealed that protein synthesis-related genes, especially ribosomal protein genes, were highly over-represented. Expression analysis using a reporter gene driven by a synthetic promoter regulated by these elements showed that the Up1 is necessary and sufficient for germination-associated gene induction, whereas Up2 acts as an enhancer of Up1. Up1-mediated gene expression was suppressed by treatments that blocked germination. Up1 is almost identical to the site II motif, which is the predicted target of TCP transcription factors. Of 24 AtTCP genes, AtTCP14, which showed the highest transcript level just prior to germination, was functionally characterized to test its involvement in the regulation of seed germination. Transposon-tagged lines for AtTCP14 showed delayed germination. In addition, germination of attcp14 mutants exhibited hypersensitivity to exogenously applied abscisic acid and paclobutrazol, an inhibitor of gibberellin biosynthesis. AtTCP14 was predominantly expressed in the vascular tissues of the embryo, and affected gene expression in radicles in a non-cell-autonomous manner. Taken together, these results indicate that AtTCP14 regulates the activation of embryonic growth potential in Arabidopsis seeds.
Schwarz, Alexander P; Trofimov, Alexander N; Zubareva, Olga E; Lioudyno, Victoria I; Kosheverova, Vera V; Ischenko, Alexander M; Klimenko, Victor M
2017-08-30
Long (D2L) and short (D2S) isoform of the D2 dopamine receptor are believed to play different roles in behavioral regulation. However, little is known about differential regulation of these isoforms mRNA expression during the process of learning in physiological and pathological states. In this study, we have investigated the combined effect of training in active avoidance (AA) paradigm and chronic early life treatment with pro-inflammatory cytokine interleukin (IL)-1β (1μg/kg i.p., P15-21) on D2S and D2L dopamine receptor mRNA expression in the medial prefrontal cortex (mPFC) of adult rats. We have shown differential regulation of D2 short and long mRNA isoform expression in the mPFC. There was no effect of AA-training on D2S mRNA expression, while D2L mRNA was downregulated in AA-trained control (intact and saline-treated) animals, and this effect was not observed in rats treated with IL-1β. D2S mRNA expression level negatively correlated with learning ability within control (saline-treated and intact) groups but not in IL-1β-treated animals. Thus, prefrontal expression of distinct D2 dopamine receptor splice variants is supposed to be implicated in cognitive decline caused by early life immune challenge. Copyright © 2017 Elsevier B.V. All rights reserved.
MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Haigang; Hou, Liyue; Liu, Jingjing
MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 bymore » luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.« less
Kasper, Brigitte; Winoto-Morbach, Supandi; Mittelstädt, Jessica; Brandt, Ernst; Schütze, Stefan; Petersen, Frank
2010-04-01
Human monocytes respond to a variety of stimuli with a complex spectrum of activities ranging from acute defense mechanisms to cell differentiation or cytokine release. However, the individual intracellular signaling pathways related to these functions are not well understood. CXC chemokine ligand 4 (CXCL4) represents a broad activator of monocytes, which induces acute as well as delayed activities in these cells including cell differentiation, survival, or the release of ROS, and cytokines. Here, we report for the first time that CXCL4-treated monocytes significantly upregulate sphingosine kinase 1 (SphK1) mRNA and that CXCL4 induces SphK1 enzyme activity as well as its translocation to the cell membrane. Furthermore, we could show that pharmacological inhibition of SphK results in reversal of CXCL4-induced monocyte survival, cytokine expression, and release of oxygen radicals, which was confirmed by the use of SphK1-specific siRNA. CXCL4-mediated rescue from apoptosis, which is accompanied by inhibition of caspases, is controlled by SphK1 and its downstream element Erk. Taken together, these data assign SphK1 as a central regulator of acute and delayed monocyte activation and suggest SphK1 as a potential therapeutic target to suppress pro-inflammatory responses induced by CXCL4.
Graeber, Kai; Linkies, Ada; Steinbrecher, Tina; Mummenhoff, Klaus; Tarkowská, Danuše; Turečková, Veronika; Ignatz, Michael; Sperber, Katja; Voegele, Antje; de Jong, Hans; Urbanová, Terezie; Strnad, Miroslav; Leubner-Metzger, Gerhard
2014-08-26
Seed germination is an important life-cycle transition because it determines subsequent plant survival and reproductive success. To detect optimal spatiotemporal conditions for germination, seeds act as sophisticated environmental sensors integrating information such as ambient temperature. Here we show that the delay of germination 1 (DOG1) gene, known for providing dormancy adaptation to distinct environments, determines the optimal temperature for seed germination. By reciprocal gene-swapping experiments between Brassicaceae species we show that the DOG1-mediated dormancy mechanism is conserved. Biomechanical analyses show that this mechanism regulates the material properties of the endosperm, a seed tissue layer acting as germination barrier to control coat dormancy. We found that DOG1 inhibits the expression of gibberellin (GA)-regulated genes encoding cell-wall remodeling proteins in a temperature-dependent manner. Furthermore we demonstrate that DOG1 causes temperature-dependent alterations in the seed GA metabolism. These alterations in hormone metabolism are brought about by the temperature-dependent differential expression of genes encoding key enzymes of the GA biosynthetic pathway. These effects of DOG1 lead to a temperature-dependent control of endosperm weakening and determine the optimal temperature for germination. The conserved DOG1-mediated coat-dormancy mechanism provides a highly adaptable temperature-sensing mechanism to control the timing of germination.
Young, Steven L; Savaris, Ricardo F; Lessey, Bruce A; Sharkey, Andrew M; Balthazar, Ursula; Zaino, Richard J; Sherwin, Robert A; Fritz, Marc A
2017-09-01
What doses of secretory phase progesterone (P) in women are associated with altered endometrial structure and/or function? Consistently delayed histological maturation was seen at the lowest tested daily P dose (2.5 mg), whereas consistently altered functional response, as reflected by microarray analysis of gene expression was seen at both the 5 and 2.5 mg doses. Progesterone is absolutely required for normal embryo implantation and pregnancy survival. Progesterone supplementation is beneficial in ART cycles. In this case-control experimental trial, 46 healthy young female volunteers (age 19-34) underwent a single modeled endometrial cycle after GnRH down-regulation or monitored in natural cycles. In a university hospital, modeled cycles were obtained by GnRH agonist down-regulation, transdermal estradiol (E2) (0.2 mg/d), and daily injections of P in oil for 10 days: 2.5 mg (n = 6), 5 mg (n = 6), 10 mg (n = 12) or 40 mg (n = 12), after the 10th day of E2. Ten healthy, ovulatory women were used as controls. Endometrial biopsies were obtained on the 10th day of P exposure, or urinary LH surge (in controls). Analysis included histological dating, serum progesterone levels, microarray analysis of the whole genome, RT-PCR, western blot and comparison with the GEO database. In endometrial biopsies, a morphological delay appears in the 2.5 mg/day of P group. Higher sub-physiological levels of P (≥5 mg/day) resulted in normal histology, but aberrant gene expression. P levels required for consistent histological delay were lower than those in all ovulatory women. Gene expression abnormalities occurred at higher sub-physiological P concentrations, without a change in histology, a functional-morphological disassociation. The expression of some endometrial receptivity-associated genes appeared multiphasic, with peak or nadir of mean or median expression levels between the lowest and highest doses, suggesting sustained supraphysiological doses seen in ART treatment cycles may not be optimal. GEO DataSets ID: 200056980; GSE 56980. These results were obtained in fertile women, who may respond differently from infertile subjects. The dose of P required for normal endometrial structure (5 mg/day) corresponds to a P concentration well below that seen in ovulatory women, suggesting that persistently delayed mid-secretory histology cannot be solely due to inadequate P concentrations in an ovulatory cycle. Endometrial gene expression is differentially regulated by different doses of progesterone. The apparent multiphasic response of some genes to P dose suggests the possibility that P concentration kinetics may play a role in normal endometrial preparation for receptivity. These findings strongly confirm that histologic development is not a reliable measure of endometrial P action. Supported by The Eunice Kennedy Shriver National Institute for Child Health and Disease, National Institute of Health, USA (NICHD/NIH) (R01HD067721 and U54HD30476; SLY and BAL) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) 240239/2012-1 (RFS). All authors have no competing interests. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Sebastian, Soji; Sreenivas, Prethish; Sambasivan, Ramkumar; Cheedipudi, Sirisha; Kandalla, Prashanth; Pavlath, Grace K.; Dhawan, Jyotsna
2009-01-01
Most cells in adult tissues are nondividing. In skeletal muscle, differentiated myofibers have exited the cell cycle permanently, whereas satellite stem cells withdraw transiently, returning to active proliferation to repair damaged myofibers. We have examined the epigenetic mechanisms operating in conditional quiescence by analyzing the function of a predicted chromatin regulator mixed lineage leukemia 5 (MLL5) in a culture model of reversible arrest. MLL5 is induced in quiescent myoblasts and regulates both the cell cycle and differentiation via a hierarchy of chromatin and transcriptional regulators. Knocking down MLL5 delays entry of quiescent myoblasts into S phase, but hastens S-phase completion. Cyclin A2 (CycA) mRNA is no longer restricted to S phase, but is induced throughout G0/G1, with activation of the cell cycle regulated element (CCRE) in the CycA promoter. Overexpressed MLL5 physically associates with the CCRE and impairs its activity. MLL5 also regulates CycA indirectly: Cux, an activator of CycA promoter and S phase is induced in RNAi cells, and Brm/Brg1, CCRE-binding repressors that promote differentiation are repressed. In knockdown cells, H3K4 methylation at the CCRE is reduced, reflecting quantitative global changes in methylation. MLL5 appears to lack intrinsic histone methyl transferase activity, but regulates expression of histone-modifying enzymes LSD1 and SET7/9, suggesting an indirect mechanism. Finally, expression of muscle regulators Pax7, Myf5, and myogenin is impaired in MLL5 knockdown cells, which are profoundly differentiation defective. Collectively, our results suggest that MLL5 plays an integral role in novel chromatin regulatory mechanisms that suppress inappropriate expression of S-phase-promoting genes and maintain expression of determination genes in quiescent cells. PMID:19264965
The Effects of Injury Magnitude on the Kinetics of the Acute Phase Response
Bauzá, Graciela; Miller, Glenn; Kaseje, Neema; Wigner, Nathan A.; Wang, Zhongyan; Gerstenfeld, Louis C.; Burke, Peter A.
2013-01-01
Background The acute-phase response (APR) is critical to the body's ability to successfully respond to injury. A murine model of closed unilateral femur fractures and bilateral femur fracture were used to study the effect of injury magnitude on this response. Methods Standardized unilateral femur fracture and bilateral femur fracture in mice were performed. The femur fracture sites, livers, and serum were harvested over time after injury. Changes in mRNA expression of cytokines, hepatic acute-phase proteins, and serum cytokines overtime were measured. Results There was a rapid and short-lived hepatic APR to fracture injuries. The overall pattern in both models was similar. Both acute-phase proteins' mRNA (fibrinogen-γ and serum amyloid A-3) showed increased mRNA expression over baseline within the first 48 hours and their levels positively correlated with the extent of injury. However, increased severity of injury resulted in a delayed induction of the APR. A similar effect on the gene expression of cytokines (interleukin [IL]-1β, IL-6, and tumor necrosis factor-α) at the fracture site was seen. Serum IL-6 levels increased with increased injury and showed no delay between injury models. Conclusions Greater severity of injury resulted in a delayed induction of the liver's APR and a diminished expression of cytokines at the fracture site. Serum IL-6 levels were calibrated to the extent of the injury, and changes may represent mechanisms by which the local organ responses to injury are regulated by the injury magnitude. PMID:20693926
Bajaj, Gaurav; Guha, Gunjan; Wang, Zhixing; Jang, Hyo-Sang; Leid, Mark; Indra, Arup Kumar; Ganguli-Indra, Gitali
2012-01-01
Background COUP-TF interacting protein 2 [(Ctip2), also known as Bcl11b] is an important regulator of skin homeostasis, and is overexpressed in head and neck cancer. Ctip2ep−/− mice, selectively ablated for Ctip2 in epidermal keratinocytes, exhibited impaired terminal differentiation and delayed epidermal permeability barrier (EPB) establishment during development, similar to what was observed in Ctip2 null (Ctip2−/−) mice. Considering that as an important role of Ctip2, and the fact that molecular networks which underlie cancer progression partially overlap with those responsible for tissue remodeling, we sought to determine the role of Ctip2 during cutaneous wound healing. Methodology/Principal Findings Full thickness excisional wound healing experiments were performed on Ctip2L2/L2 and Ctip2ep−/− animals per time point and used for harvesting samples for histology, immunohistochemistry (IHC) and immunoblotting. Results demonstrated inherent defects in proliferation and migration of Ctip2 lacking keratinocytes during re-epithelialization. Mutant mice exhibited reduced epidermal proliferation, delayed keratinocyte activation, altered cell-cell adhesion and impaired ECM development. Post wounding, Ctip2ep−/− mice wounds displayed lack of E-Cadherin suppression in the migratory tongue, insufficient expression of alpha smooth muscle actin (alpha SMA) in the dermis, and robust induction of K8. Importantly, dysregulated expression of several hair follicle (HF) stem cell markers such as K15, NFATc1, CD133, CD34 and Lrig1 was observed in mutant skin during wound repair. Conclusions/Significance Results confirm a cell autonomous role of keratinocytic Ctip2 to modulate cell migration, proliferation and/or differentiation, and to maintain HF stem cells during cutaneous wounding. Furthermore, Ctip2 in a non-cell autonomous manner regulated granulation tissue formation and tissue contraction during wound closure. PMID:22383956
Gutiérrez, Rodrigo A; Stokes, Trevor L; Thum, Karen; Xu, Xiaodong; Obertello, Mariana; Katari, Manpreet S; Tanurdzic, Milos; Dean, Alexis; Nero, Damion C; McClung, C Robertson; Coruzzi, Gloria M
2008-03-25
Understanding how nutrients affect gene expression will help us to understand the mechanisms controlling plant growth and development as a function of nutrient availability. Nitrate has been shown to serve as a signal for the control of gene expression in Arabidopsis. There is also evidence, on a gene-by-gene basis, that downstream products of nitrogen (N) assimilation such as glutamate (Glu) or glutamine (Gln) might serve as signals of organic N status that in turn regulate gene expression. To identify genome-wide responses to such organic N signals, Arabidopsis seedlings were transiently treated with ammonium nitrate in the presence or absence of MSX, an inhibitor of glutamine synthetase, resulting in a block of Glu/Gln synthesis. Genes that responded to organic N were identified as those whose response to ammonium nitrate treatment was blocked in the presence of MSX. We showed that some genes previously identified to be regulated by nitrate are under the control of an organic N-metabolite. Using an integrated network model of molecular interactions, we uncovered a subnetwork regulated by organic N that included CCA1 and target genes involved in N-assimilation. We validated some of the predicted interactions and showed that regulation of the master clock control gene CCA1 by Glu or a Glu-derived metabolite in turn regulates the expression of key N-assimilatory genes. Phase response curve analysis shows that distinct N-metabolites can advance or delay the CCA1 phase. Regulation of CCA1 by organic N signals may represent a novel input mechanism for N-nutrients to affect plant circadian clock function.
Expression and regulation of the neutral amino acid transporter B0AT1 in rat small intestine
Jando, Julia; Camargo, Simone M. R.; Herzog, Brigitte
2017-01-01
Absorption of neutral amino acids across the luminal membrane of intestinal enterocytes is mediated by the broad neutral amino acid transporter B0AT1 (SLC6A19). Its intestinal expression depends on co-expression of the membrane-anchored peptidase angiotensin converting enzyme 2 (ACE2) and is additionally enhanced by aminopeptidase N (CD13). We investigated in this study the expression of B0AT1 and its auxiliary peptidases as well as its transport function along the rat small intestine. Additionally, we tested its possible short- and long-term regulation by dietary proteins and amino acids. We showed by immunofluorescence that B0AT1, ACE2 and CD13 co-localize on the luminal membrane of small intestinal villi and by Western blotting that their protein expression increases in distal direction. Furthermore, we observed an elevated transport activity of the neutral amino acid L-isoleucine during the nocturnal active phase compared to the inactive one. Gastric emptying was delayed by intragastric application of an amino acid cocktail but we observed no acute dietary regulation of B0AT1 protein expression and L-isoleucine transport. Investigation of the chronic dietary regulation of B0AT1, ACE2 and CD13 by different diets revealed an increased B0AT1 protein expression under amino acid-supplemented diet in the proximal section but not in the distal one and for ACE2 protein expression a reverse localization of the effect. Dietary regulation for CD13 protein expression was not as distinct as for the two other proteins. Ring uptake experiments showed a tendency for increased L-isoleucine uptake under amino acid-supplemented diet and in vivo L-isoleucine absorption was more efficient under high protein and amino acid-supplemented diet. Additionally, plasma levels of branched-chain amino acids were elevated under high protein and amino acid diet. Taken together, our experiments did not reveal an acute amino acid-induced regulation of B0AT1 but revealed a chronic dietary adaptation mainly restricted to the proximal segment of the small intestine. PMID:28915252
Luo, Li-Jun; Liu, Feng; Lin, Zhi-Kai; Xie, Yu-Feng; Xu, Jia-Li; Tong, Qing-Chun; Shu, Rong
2012-06-01
Periodontal ligament (PDL) cells are fibroblasts that play key roles in tissue integrity, periodontal inflammation and tissue regeneration in the periodontium. The periodontal tissue destruction in periodontitis is mediated by host tissue-produced inflammatory cytokines, including interleukin-1β (IL-1β). Here, we report the expression of G protein-coupled receptor 30 (GPR30, also known as G protein-coupled estrogen receptor 1 GPER) in human PDL cells and its regulation by IL-1β. IL-1β-induced GPR30 expression in human PDL cells leads to the activation of multiple signaling pathways, including MAPK, NF-κB and PI3K. In contrast, genistein, an estrogen receptor ligand, postpones the activation of MAPKs induced by IL-1β. Moreover, the inhibition of GPR30 by G15, a GPR30-specific antagonist, eliminates this delay. Thus, genistein plays a role in the regulation of MAPK activation via GPR30, and GPR30 represents a novel target regulated by steroid hormones in PDL cells. Copyright © 2012 Elsevier Inc. All rights reserved.
Loiselle, Alayna E.; Lloyd, Shane A. J.; Paul, Emmanuel M.; Lewis, Gregory S.; Donahue, Henry J.
2013-01-01
Connexin 43 (Cx43) is the most abundant gap junction protein in bone and is required for osteoblastic differentiation and bone homeostasis. During fracture healing, Cx43 is abundantly expressed in osteoblasts and osteocytes, while Cx43 deficiency impairs bone formation and healing. In the present study we selectively deleted Cx43 in the osteoblastic lineage from immature osteoblasts through osteocytes and tested the hypothesis that Cx43 deficiency results in delayed osteoblastic differentiation and impaired restoration of biomechanical properties due to attenuated β-catenin expression relative to wild type littermates. Here we show that Cx43 deficiency results in alterations in the mineralization and remodeling phases of healing. In Cx43 deficient fractures the mineralization phase is marked by delayed expression of osteogenic genes. Additionally, the decrease in the RankL/ Opg ratio, osteoclast number and osteoclast size suggest decreased osteoclast bone resorption and remodeling. These changes in healing result in functional deficits as shown by a decrease in ultimate torque at failure. Consistent with these impairments in healing, β-catenin expression is attenuated in Cx43 deficient fractures at 14 and 21 days, while Sclerostin (Sost) expression, a negative regulator of bone formation is increased in Cx43cKO fractures at 21 days, as is GSK-3β, a key component of the β-catenin proteasomal degradation complex. Furthermore, we show that alterations in healing in Cx43 deficient fractures can be rescued by inhibiting GSK-3β activity using Lithium Chloride (LiCl). Treatment of Cx43 deficient mice with LiCl restores both normal bone formation and mechanical properties relative to LiCl treated WT fractures. This study suggests that Cx43 is a potential therapeutic target to enhance fracture healing and identifies a previously unknown role for Cx43 in regulating β-catenin expression and thus bone formation during fracture repair. PMID:24260576
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adams, Stephanie; Munz, Barbara, E-mail: barbara.munz@charite.de
2010-01-01
Receptor interacting protein 4 (RIP4) is an important regulator of epidermal morphogenesis during embryonic development. We could previously show that expression of the rip4 gene is strongly downregulated in cutaneous wound repair, which might be initiated by a broad variety of growth factors and cytokines. Here, we demonstrate that in keratinocytes, rip4 expression is controlled by a multitude of different signal transduction pathways, such as the p38 mitogen-activated protein kinase (MAPK) and the nuclear factor kappa B (NF-{kappa}B) cascade, in a unique and specific manner. Furthermore, we show that the steroid dexamethasone abolishes the physiological rip4 downregulation after injury andmore » might thus contribute to the phenotype of reduced and delayed wound reepithelialization seen in glucocorticoid-treated patients. As a whole, our data indicate that rip4 expression is regulated in a complex manner, which might have therapeutic implications.« less
Zhu, Xiang-Yu; Liu, Ning; Liu, Wei; Song, Shao-Wei; Guo, Ke-Jian
2012-04-01
Integrin-linked kinase (ILK) is an ankyrin repeat-containing serine-threonine protein kinase that is involved in the regulation of integrin-mediated processes such as cancer cell proliferation, migration and invasion. In this study, we examined the effect of a lentivirus-mediated knockdown of ILK on the proliferation, migration and invasion of pancreatic cancer (Panc-1) cells. Immunohistochemical staining showed that ILK expression was enhanced in pancreatic cancer tissue. The silencing of ILK in human Panc-1 cells led to cell cycle arrest in the G0/G1 phase and delayed cell proliferation, in addition to down-regulating cell migration and invasion. The latter effects were mediated by up-regulating the expression of E-cadherin, a key protein in cell adhesion. These findings indicate that ILK may be a new diagnostic marker for pancreatic cancer and that silencing ILK could be a potentially useful therapeutic approach for treating pancreatic cancer.
Cyclin D regulation of a sexually dimorphic asymmetric cell division
Tilmann, Christopher; Kimble, Judith
2006-01-01
SUMMARY The C. elegans somatic gonadal precursor cell (SGP) divides asymmetrically to establish gonad-specific coordinates in both sexes. In addition, the SGP division is sexually dimorphic and initiates sex-specific programs of gonadogenesis. Wnt/MAPK signaling determines the gonadal axes, and the FKH-6 transcription factor specifies the male mode of SGP division. In this paper, we demonstrate that C. elegans cyclin D controls POP-1/TCF asymmetry in the SGP daughters as well as fkh-6 and rnr expression in the SGPs. Although cyclin D mutants have delayed SGP divisions, the cyclin D defects are not mimicked by other methods of retarding the SGP division. We find that EFL-1/E2F has an antagonistic effect on fkh-6 expression and gonadogenesis, which is relieved by cyclin D activity. We propose that cyclin D and other canonical regulators of the G1/S transition coordinate key regulators of axis formation and sex determination with cell cycle progression to achieve the sexually dimorphic SGP asymmetric division. PMID:16198291
Ohya, Susumu; Nakamura, Erina; Horiba, Sayuri; Kito, Hiroaki; Matsui, Miki; Yamamura, Hisao; Imaizumi, Yuji
2013-07-01
The intermediate-conductance Ca(2+)-activated K(+) channel (K(Ca)3.1) modulates the Ca(2+) response through the control of the membrane potential in the immune system. We investigated the role of K(Ca)3.1 on the pathogenesis of delayed-type hypersensitivity (DTH) in auricular lymph node (ALN) CD4(+) T-lymphocytes of oxazolone (Ox)-induced DTH model mice. The expression patterns of K(Ca)3.1 and its possible transcriptional regulators were compared among ALN T-lymphocytes of three groups [non-sensitized (Ox-/-), Ox-sensitized, but non-challenged (Ox+/-) and Ox-sensitized and -challenged (Ox+/+)] using real-time polymerase chain reaction, Western blotting and flow cytometry. KCa 3.1 activity was measured by whole-cell patch clamp and the voltage-sensitive dye imaging. The effects of K(Ca)3.1 blockade were examined by the administration of selective K(Ca)3.1 blockers. Significant up-regulation of K(Ca)3.1a was observed in CD4(+) T-lymphocytes of Ox+/- and Ox+/+, without any evident changes in the expression of the dominant-negative form, K(Ca)3.1b. Negatively correlated with this, the repressor element-1 silencing transcription factor (REST) was significantly down-regulated. Pharmacological blockade of K(Ca)3.1 resulted in an accumulation of the CD4(+) T-lymphocytes of Ox+/+ at the G0/G1 phase of the cell cycle, and also significantly recovered not only the pathogenesis of DTH, but also the changes in the K(Ca)3.1 expression and activity in the CD4(+) T-lymphocytes of Ox+/- and Ox+/+. The up-regulation of K(Ca)3.1a in conjunction with the down-regulation of REST may be involved in CD4(+) T-lymphocyte proliferation in the ALNs of DTH model mice; and K(Ca)3.1 may be an important target for therapeutic intervention in allergy diseases such as DTH. © 2013 The British Pharmacological Society.
Arabidopsis thaliana responses to mechanical stimulation do not require ETR1 or EIN2
NASA Technical Reports Server (NTRS)
Johnson, K. A.; Sistrunk, M. L.; Polisensky, D. H.; Braam, J.; McIntire, L. V. (Principal Investigator)
1998-01-01
Plants exposed to repetitive touch or wind are generally shorter and stockier than sheltered plants. These mechanostimulus-induced developmental changes are termed thigmomorphogenesis and may confer resistance to subsequent stresses. An early response of Arabidopsis thaliana to touch or wind is the up-regulation of TCH (touch) gene expression. The signal transduction pathway that leads to mechanostimulus responses is not well defined. A role for ethylene has been proposed based on the observation that mechanostimulation of plants leads to ethylene evolution and exogenous ethylene leads to thigmomorphogenetic-like changes. To determine whether ethylene has a role in plant responses to mechanostimulation, we assessed the ability of two ethylene-insensitive mutants, etr1-3 and ein2-1, to undergo thigmomorphogenesis and TCH gene up-regulation of expression. The ethylene-insensitive mutants responded to wind similarly to the wild type, with a delay in flowering, decrease in inflorescence elongation rate, shorter mature primary inflorescences, more rosette paraclades, and appropriate TCH gene expression changes. Also, wild-type and mutant Arabidopsis responded to vibrational stimulation, with an increase in hypocotyl elongation and up-regulation of TCH gene expression. We conclude that the ETR1 and EIN2 protein functions are not required for the developmental and molecular responses to mechanical stimulation.
Regulation of broad by the Notch pathway affects timing of follicle cell development
Jia, Dongyu; Tamori, Yoichiro; Pyrowolakis, George; Deng, Wu-Min
2014-01-01
During Drosophila oogenesis, activation of Notch signaling in the follicular epithelium (FE) around stage 6 of oogenesis is essential for entry into the endocycle and a series of other changes such as cell differentiation and migration of subsets of the follicle cells. Notch induces the expression of zinc finger protein Hindsight and suppresses homeodomain protein Cut to regulate the mitotic/endocycle (ME) switch. Here we report that broad (br), encoding a small group of zinc-finger transcription factors resulting from alternative splicing, is a transcriptional target of Notch nuclear effector Suppressor of Hairless (Su(H)). The early pattern of Br in the FE, uniformly expressed except in the polar cells, is established by Notch signaling around stage 6, through the binding of Su(H) to the br early enhancer (brE) region. Mutation of the Su(H) binding site leads to a significant reduction of brE reporter expression in follicle cells undergoing the endocycle. Chromatin immunoprecipitation results further confirm Su(H) binding to the br early enhancer. Consistent with its expression in follicle cells during midoogenesis, loss of br function results in a delayed entry into the endocycle. Our findings suggest an important role of br in the timing of follicle cell development, and its transcriptional regulation by the Notch pathway. PMID:24815210
ATM-dependent DNA damage checkpoint functions regulate gene expression in human fibroblasts
Zhou, Tong; Chou, Jeff; Zhou, Yingchun; Simpson, Dennis A.; Cao, Feng; Bushel, Pierre R.; Paules, Richard S.; Kaufmann, William K.
2013-01-01
The relationships between profiles of global gene expression and DNA damage checkpoint functions were studied in cells from patients with ataxia telangiectasia (AT). Three telomerase-expressing AT fibroblast lines displayed the expected hypersensitivity to ionizing radiation (IR) and defects in DNA damage checkpoints. Profiles of global gene expression in AT cells were determined at 2, 6 and 24 h after treatment with 1.5 Gy IR or sham-treatment, and were compared to those previously recognized in normal human fibroblasts. Under basal conditions 160 genes or ESTs were differentially expressed in AT and normal fibroblasts, and these were associated by gene ontology with insulin-like growth factor binding and regulation of cell growth. Upon DNA damage, 1091 gene mRNAs were changed in at least two of the three AT cell lines. When compared with the 1811 genes changed in normal human fibroblasts after the same treatment, 715 were found in both AT and normal fibroblasts, including most genes categorized by gene ontology into cell cycle, cell growth and DNA damage response pathways. However, the IR-induced changes in these 715 genes in AT cells usually were delayed or attenuated in comparison to normal cells. The reduced change in DNA-damage-response genes and the attenuated repression of cell-cycle-regulated genes may account for the defects in cell cycle checkpoint function in AT cells. PMID:17699107
48 CFR 49.108-6 - Delay in settling subcontractor settlement proposals.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Delay in settling subcontractor settlement proposals. 49.108-6 Section 49.108-6 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACT MANAGEMENT TERMINATION OF CONTRACTS General Principles 49.108-6 Delay in...
Juárez-Rodríguez, María Dolores; Yang, Jiseon; Kader, Rebin; Alamuri, Praveen; Curtiss, Roy
2012-01-01
Live recombinant attenuated Salmonella vaccine (RASV) strains have great potential to induce protective immunity against Mycobacterium tuberculosis by delivering M. tuberculosis antigens. Recently, we reported that, in orally immunized mice, RASV strains delivering the M. tuberculosis early secreted antigenic target 6-kDa (ESAT-6) protein and culture filtrate protein 10 (CFP-10) antigens via the Salmonella type III secretion system (SopE amino-terminal region residues 1 to 80 with two copies of ESAT-6 and one copy of CFP-10 [SopENt80-E2C]) afforded protection against aerosol challenge with M. tuberculosis. Here, we constructed and evaluated an improved Salmonella vaccine against M. tuberculosis. We constructed translational fusions for the synthesis of two copies of ESAT-6 plus CFP-10 fused to the OmpC signal sequence (OmpCSS-E2C) and amino acids 44 to 338 of antigen 85A (Ag85A294) flanked by the signal sequence (SS) and C-terminal peptide (CT) of β-lactamase (BlaSS-Ag85A294-BlaCT) to enable delivery via the Salmonella type II secretion system. The genes expressing these proteins were cloned as an operon transcribed from Ptrc into isogenic Asd+/MurA+ pYA3681 lysis vector derivatives with different replication origins (pBR, p15A, pSC101), resulting in pYA4890, pYA4891, and pYA4892 for SopENt80-E2C/Ag85A294 synthesis and pYA4893 and pYA4894 for OmpCSS-E2C/Ag85A294 synthesis. Mice orally immunized with the RASV χ11021 strain engineered to display regulated delayed lysis and regulated delayed antigen synthesis in vivo and harboring pYA4891, pYA4893, or pYA4894 elicited significantly greater humoral and cellular immune responses, and the RASV χ11021 strain afforded a greater degree of protection against M. tuberculosis aerosol challenge in mice than RASVs harboring any other Asd+/MurA+ lysis plasmid and immunization with M. bovis BCG, demonstrating that RASV strains displaying regulated delayed lysis with delayed antigen synthesis resulted in highly immunogenic delivery vectors for oral vaccination against M. tuberculosis infection. PMID:22144485
Mei, Yu; Jia, Wen-Jing; Chu, Yu-Jia; Xue, Hong-Wei
2012-03-01
Phosphatidylinositol monophosphate 5-kinase (PIP5K) catalyzes the synthesis of PI-4,5-bisphosphate (PtdIns(4,5)P(2)) by phosphorylation of PI-4-phosphate at the 5 position of the inositol ring, and is involved in regulating multiple developmental processes and stress responses. We here report on the functional characterization of Arabidopsis PIP5K2, which is expressed during lateral root initiation and elongation, and whose expression is enhanced by exogenous auxin. The knockout mutant pip5k2 shows reduced lateral root formation, which could be recovered with exogenous auxin, and interestingly, delayed root gravity response that could not be recovered with exogenous auxin. Crossing with the DR5-GUS marker line and measurement of free IAA content confirmed the reduced auxin accumulation in pip5k2. In addition, analysis using the membrane-selective dye FM4-64 revealed the decelerated vesicle trafficking caused by PtdIns(4,5)P(2) reduction, which hence results in suppressed cycling of PIN proteins (PIN2 and 3), and delayed redistribution of PIN2 and auxin under gravistimulation in pip5k2 roots. On the contrary, PtdIns(4,5)P(2) significantly enhanced the vesicle trafficking and cycling of PIN proteins. These results demonstrate that PIP5K2 is involved in regulating lateral root formation and root gravity response, and reveal a critical role of PIP5K2/PtdIns(4,5)P(2) in root development through regulation of PIN proteins, providing direct evidence of crosstalk between the phosphatidylinositol signaling pathway and auxin response, and new insights into the control of polar auxin transport.
Gordon, Nancy; Koshkina, Nadezhda V.; Jia, Shu-Fang; Khanna, Chand; Mendoza, Arnulfo; Worth, Laura L.; Kleinerman, Eugenie S.
2015-01-01
Purpose Pulmonary metastases continue to be a significant problem in osteosarcoma. Apoptosis dysfunction is known to influence tumor development. Fas (CD95, APO-1)/FasL is one of the most extensively studied apoptotic pathways. Because FasL is constitutively expressed in the lung, cells that express Fas should be eliminated by lung endothelium. Cells with low or no cell surface Fas expression may be able to evade this innate defense mechanism. The purpose of these studies was to evaluate Fas expression in osteosarcoma lung metastases and the effect of gemcitabine on Fas expression and tumor growth. Experimental Design and Results Using the K7M2 murine osteosarcoma model, Fas expression was quantified using immunohistochemistry. High levels of Fas were present in primary tumors, but no Fas expression was present in actively growing lung metastases. Blocking the Fas pathway using Fas-associated death domain dominant-negative delayed tumor cell clearance from the lung and increased metastatic potential. Treatment of mice with aerosol gemcitabine resulted in increased Fas expression and subsequent tum or regression. Conclusions We conclude that corruption of the Fas pathway is critical to the ability of osteosarcoma cells to grow in the lung. Agents such as gemcitabine that up-regulate cell surface Fas expression may therefore be effective in treating osteosarcoma lung metastases. These data also suggest that an additional mechanism by which gemcitabine induces regression of osteosarcoma lung metastases is mediated by enhancing the sensitivity of the tumor cells to the constitutive FasL in the lung. PMID:17671136
Xie, Qiaoli; Hu, Zongli; Zhu, Zhiguo; Dong, Tingting; Zhao, Zhiping; Cui, Baolu; Chen, Guoping
2014-01-01
MADS-domain proteins are important transcription factors involved in many biological processes of plants. In our study, a tomato MADS-box gene, SlFYFL, was isolated. SlFYFL is expressed in all tissues of tomato and significantly higher in mature leave, fruit of different stages, AZ (abscission zone) and sepal. Delayed leaf senescence and fruit ripening, increased storability and longer sepals were observed in 35S:FYFL tomato. The accumulation of carotenoid was reduced, and ethylene content, ethylene biosynthetic and responsive genes were down-regulated in 35S:FYFL fruits. Abscission zone (AZ) did not form normally and abscission zone development related genes were declined in AZs of 35S:FYFL plants. Yeast two-hybrid assay revealed that SlFYFL protein could interact with SlMADS-RIN, SlMADS1 and SlJOINTLESS, respectively. These results suggest that overexpression of SlFYFL regulate fruit ripening and development of AZ via interactions with the ripening and abscission zone-related MADS box proteins. PMID:24621662
Hong, Fang; Doan, Stacey N; Lopez, Angelica; Evans, Gary W
2017-01-01
Self-regulation is associated with many positive outcomes, but there is limited information about individual difference regarding children's spontaneous use of strategies to self-regulate and the relative success of those strategies. In the current study, we examined whether temperament and gender are associated with self-regulation and explored the types of spontaneous strategies children use during Mischel's delay of gratification protocol. In addition, we investigated whether spontaneous strategy use during the task could moderate the effects of temperament on self-regulation and whether temperament would mediate the effect of gender on self-regulation. Participants were 349 9-year-olds (182 boys, M age = 9.18, SD = 1.17). Mothers reported on children's temperament and the Delay of Gratification task was used to assess self-regulation. Both temperament and child's gender were significantly associated with children's delay time. Girls were able to delay longer than boys, and children scoring high on activity level were less able to delay. Activity level also mediated the relationship between gender and delay time. Finally, we found an interaction effect between activity level and certain strategies in relation to self-regulatory behavior.
Hong, Fang; Doan, Stacey N.; Lopez, Angelica; Evans, Gary W.
2017-01-01
Self-regulation is associated with many positive outcomes, but there is limited information about individual difference regarding children’s spontaneous use of strategies to self-regulate and the relative success of those strategies. In the current study, we examined whether temperament and gender are associated with self-regulation and explored the types of spontaneous strategies children use during Mischel’s delay of gratification protocol. In addition, we investigated whether spontaneous strategy use during the task could moderate the effects of temperament on self-regulation and whether temperament would mediate the effect of gender on self-regulation. Participants were 349 9-year-olds (182 boys, Mage = 9.18, SD = 1.17). Mothers reported on children’s temperament and the Delay of Gratification task was used to assess self-regulation. Both temperament and child’s gender were significantly associated with children’s delay time. Girls were able to delay longer than boys, and children scoring high on activity level were less able to delay. Activity level also mediated the relationship between gender and delay time. Finally, we found an interaction effect between activity level and certain strategies in relation to self-regulatory behavior. PMID:29163300
Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng
2017-07-01
Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.
N-CADHERIN PRODOMAIN CLEAVAGE REGULATES SYNAPSE FORMATION IN VIVO
Latefi, Nazlie S.; Pedraza, Liliana; Schohl, Anne; Li, Ziwei; Ruthazer, Edward S.
2009-01-01
Cadherins are initially synthesized bearing a prodomain that is thought to limit adhesion during early stages of biosynthesis. Functional cadherins lack this prodomain, raising the intriguing possibility that cells may utilize prodomain cleavage as a means to temporally or spatially regulate adhesion after delivery of cadherin to the cell surface. In support of this idea, immunostaining for the prodomain of zebrafish N-cadherin revealed enriched labeling at neuronal surfaces at the soma and along axonal processes. To determine whether post-translational cleavage of the prodomain affects synapse formation, we imaged Rohon-Beard cells in zebrafish embryos expressing GFP-tagged wild-type N-cadherin (NCAD-GFP) or a GFP-tagged N-cadherin mutant expressing an uncleavable prodomain (PRON-GFP) rendering it non-adhesive. NCAD-GFP accumulated at synaptic microdomains in a developmentally regulated manner, and its overexpression transiently accelerated synapse formation. PRON-GFP was much more diffusely distributed along the axon and its overexpression delayed synapse formation. Our results support the notion that N-cadherin serves to stabilize pre- to postsynaptic contacts early in synapse development and suggests that regulated cleavage of the N-cadherin prodomain may be a mechanism by which the kinetics of synaptogenesis are regulated. PMID:19365814
Enhanced endothelial cell senescence by lithium-induced matrix metalloproteinase-1 expression.
Struewing, Ian T; Durham, Samuel N; Barnett, Corey D; Mao, Catherine D
2009-06-26
Endothelial cell (EC) senescence and dysfunction occurring after chronic injury and inflammation are highly associated with the development and progression of cardiovascular diseases. However, the factors involved in the establishment of EC senescence remain poorly understood. We have previously shown that lithium, an inhibitor of glycogen synthase kinase (GSK)-3beta and activator of the Wnt/beta-catenin signaling pathway, induces an EC senescent-like phenotype. Herein, we show that lithium induces a rapid and pronounced up-regulation of the matrix metalloproteinase (MMP)-1, an inflammation and senescent cell marker, at the mRNA and protein levels, whereas the induction of two other senescent cell markers is either weak (interleukin-8) or delayed (plasminogen activator inhibitor-1). Lithium effect on MMP-1 expression is also specific among other MMPs and not mediated by GSK3beta inhibition. Lithium affects MMP-1 expression mainly at the transcriptional level but neither the AP1/Ets regulatory sites nor the redox sensitive (-1607/2G) site in MMP-1 promoter are involved in lithium-dependent MMP-1 regulation. However, down-regulation of p53, a target of lithium in EC, dampens both basal and lithium-induced MMP-1 expression, which further links MMP-1 up-regulation with the establishment of cell senescence. Although increased MMP-1 levels are usually associated with angiogenesis in enabled proliferative EC, the exogenous addition of activated MMP-1 on lithium- arrested EC increases the number of EC positive for the senescent-associated-beta-galactosidase marker. Conversely, down-regulation of MMP-1 expression by small interfering RNAs blunts the lithium-dependent increase in senescent-associated-beta-galactosidase positive cells. Altogether our data indicate that lithium-induced MMP-1 may participate in the reinforcement of EC senescence and reveal a novel mechanism for lithium-induced tissue remodeling.
Zhang, W N; Xiao, H J; Liang, G M; Guo, Y Y; Wu, K M
2014-08-01
Evolution of resistance to insecticides usually has fitness tradeoffs associated with adaptation to the stress. The basic regulation mechanism of tradeoff between reproduction and resistance evolution to Bacillus thuringiensis (Bt) toxin in the cotton bollworm, Helicoverpa armigera (Ha), based on the vitellogenin (Vg) gene expression was analyzed here. The full-length cDNA of the Vg gene HaVg (JX504706) was cloned and identified. HaVg has 5704 base pairs (bp) with an open reading frame (ORF) of 5265 bp, which encoded 1756 amino acid protein with a predicted molecular mass of 197.28 kDa and a proposed isoelectric point of 8.74. Sequence alignment analysis indicated that the amino acid sequence of HaVg contained all of the conserved domains detected in the Vgs of the other insects and had a high similarity with the Vgs of the Lepidoptera insects, especially Noctuidae. The resistance level to Cry1Ac Bt toxin and relative HaVg mRNA expression levels among the following four groups: Cry1Ac-susceptible strain (96S), Cry1Ac-resistant strain fed on artificial diet with Bt toxin for 135 generations (BtR stands for the Cry1Ac Bt resistance), progeny of the Cry1Ac-resistant strain with a non-Bt-toxin artificial diet for 38 generations (CK1) and the direct descendants of the 135th-generation resistant larvae which were fed on an artificial diet without the Cry1Ac protein (CK2) were analyzed. Compared with the 96S strain, the resistance ratios of the BtR strain, the CK1 strain and the CK2 strain were 2917.15-, 2.15- and 2037.67-fold, respectively. The maximum relative HaVg mRNA expression levels of the BtR strain were approximately 50% less than that of the 96S strain, and the coming of maximum expression was delayed for approximately 4 days. The overall trend of the HaVg mRNA expression levels in the CK1 strain was similar to that in the 96S strain, and the overall trend of the HaVg mRNA expression levels in the CK2 strain was similar to that in the BtR strain. Our results suggest that the changes in reproduction due to the Bt-toxin resistance evolution in the BtR strain may be regulated by the Vg gene expression. The down-regulation of HaVg at the early stages resulted in a period of delayed reproduction and decreased fecundity in the BtR strain. This performance disappeared when the Bt-toxin selection pressure was lost.
Effects of growth hormone over-expression on reproduction in the common carp Cyprinus carpio L.
Cao, Mengxi; Chen, Ji; Peng, Wei; Wang, Yaping; Liao, Lanjie; Li, Yongming; Trudeau, Vance L; Zhu, Zuoyan; Hu, Wei
2014-01-01
To study the complex interaction between growth and reproduction we have established lines of transgenic common carp (Cyprinus carpio) carrying a grass carp (Ctenopharyngodon idellus) growth hormone (GH) transgene. The GH-transgenic fish showed delayed gonadal development compared with non-transgenic common carp. To gain a better understanding of the phenomenon, we studied body growth, gonad development, changes of reproduction related genes and hormones of GH-transgenic common carp for 2years. Over-expression of GH elevated peripheral gh transcription, serum GH levels, and inhibited endogenous GH expression in the pituitary. Hormone analyses indicated that GH-transgenic common carp had reduced pituitary and serum level of luteinizing hormone (LH). Among the tested genes, pituitary lhβ was inhibited in GH-transgenic fish. Further analyses in vitro showed that GH inhibited lhβ expression. Localization of ghr with LH indicates the possibility of direct regulation of GH on gonadotrophs. We also found that GH-transgenic common carp had reduced pituitary sensitivity to stimulation by co-treatments with a salmon gonadotropin-releasing hormone (GnRH) agonist and a dopamine antagonist. Together these results suggest that the main cause of delayed reproductive development in GH transgenic common carp is reduced LH production and release. Copyright © 2013 Elsevier Inc. All rights reserved.
Shox2-deficiency leads to dysplasia and ankylosis of the temporomandibular joint in Mice
Gu, Shuping; Wei, Na; Yu, Ling; Fei, Jian; Chen, YiPing
2010-01-01
The temporomandibular joint (TMJ) is a unique synovial joint whose development differs from the formation of other synovial joints. Mutations have been associated with the developmental defects of the TMJ only in a few genes. In this study, we report the expression of the homeobox gene Shox2 in the cranial neural crest derived mesenchymal cells of the maxilla-mandibular junction and later in the progenitor cells and undifferentiated chondrocytes of the condyle as well as the glenoid fossa of the developing TMJ. A conditional inactivation of Shox2 in the cranial neural crest-derived cells causes developmental abnormalities in the TMJ, including dysplasia of the condyle and glenoid fossa. The articulating disc forms but fuses with the fibrous layers of the condyle and glenoid fossa, clinically known as TMJ ankylosis. Histological examination indicates a delay in development in the mutant TMJ, accompanied by a significantly reduced rate of cell proliferation. In situ hybridization further demonstrates an altered expression of several key osteogenic genes and a delayed expression of the osteogenic differentiation markers. Shox2 appears to regulate the expression of osteogenic genes and is essential for the development and function of the TMJ. The Shox2 conditional mutant thus provides a unique animal model of TMJ ankylosis. PMID:18514492
Kiełbowicz-Matuk, Agnieszka; Czarnecka, Jagoda; Banachowicz, Ewa; Rey, Pascal; Rorat, Tadeusz
2017-03-01
ZPR1 proteins belong to the C4-type of zinc finger coordinators known in animal cells to interact with other proteins and participate in cell growth and proliferation. In contrast, the current knowledge regarding plant ZPR1 proteins is very scarce. Here, we identify a novel potato nuclear factor belonging to this family and named StZPR1. StZPR1 is specifically expressed in photosynthetic organs during the light period, and the ZPR1 protein is located in the nuclear chromatin fraction. From modelling and experimental analyses, we reveal the StZPR1 ability to bind the circadian DNA cis motif 'CAACAGCATC', named CIRC and present in the promoter of the clock-controlled double B-box StBBX24 gene, the expression of which peaks in the middle of the day. We found that transgenic lines silenced for StZPR1 expression still display a 24 h period for the oscillation of StBBX24 expression but delayed by 4 h towards the night. Importantly, other BBX genes exhibit altered circadian regulation in these lines. Our data demonstrate that StZPR1 allows fitting of the StBBX24 circadian rhythm to the light period and provide evidence that ZPR1 is a novel clock-associated protein in plants necessary for the accurate rhythmic expression of specific circadian-regulated genes. © 2016 John Wiley & Sons Ltd.
Jin, Yong-Ri; Turcotte, Taryn J.; Crocker, Alison L.; Han, Xiang Hua; Yoon, Jeong Kyo
2011-01-01
R-spondins are a recently characterized family of secreted proteins that activate Wnt/β-catenin signaling. Herein, we determine R-spondin2 (Rspo2) function in craniofacial development in mice. Mice lacking a functional Rspo2 gene exhibit craniofacial abnormalities such as mandibular hypoplasia, maxillary and mandibular skeletal deformation, and cleft palate. We found that loss of the mouse Rspo2 gene significantly disrupted Wnt/β-catenin signaling and gene expression within the first branchial arch (BA1). Rspo2, which is normally expressed in BA1 mesenchymal cells, regulates gene expression through a unique ectoderm-mesenchyme interaction loop. The Rspo2 protein, potentially in combination with ectoderm-derived Wnt ligands, up-regulates Msx1 and Msx2 expression within mesenchymal cells. In contrast, Rspo2 regulates expression of the Dlx5, Dlx6, and Hand2 genes in mesenchymal cells via inducing expression of their upstream activator, Endothelin1 (Edn1), within ectodermal cells. Loss of Rspo2 also causes increased cell apoptosis, especially within the aboral (or caudal) domain of the BA1, resulting in hypoplasia of the BA1. Severely reduced expression of Fgf8, a survival factor for mesenchymal cells, in the ectoderm of Rspo2−/− embryos is likely responsible for increased cell apoptosis. Additionally, we found that cleft palate in Rspo2−/− mice is not associated with defects intrinsic to the palatal shelves. A possible cause of cleft palate is a delay of proper palatal shelf elevation that may result from the small mandible and a failure of lowering the tongue. Thus, our study identifies Rspo2 as a mesenchyme-derived factor that plays critical roles in regulating BA1 patterning and morphogenesis through ectodermal-mesenchymal interaction and a novel genetic factor for cleft palate. PMID:21237142
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ma, Liwei; Zhao, Wenting; Zheng, Quanhui
2016-01-15
The expression change of cellular senescence-associated genes is underlying the genetic foundation of cellular senescence. Using a suppressive subtractive hybridization system, we identified CSIG (cellular senescence-inhibited gene protein; RSL1D1) as a novel senescence-associated gene. CSIG is implicated in various process including cell cycle regulation, apoptosis, and tumor metastasis. We previously showed that CSIG plays an important role in regulating cell proliferation and cellular senescence progression through inhibiting PTEN, however, which domain or region of CSIG contributes to this function? To clarify this question, we investigated the functional importance of ribosomal L1 domain and lysine (Lys) -rich region of CSIG. Themore » data showed that expression of CSIG potently reduced PTEN expression, increased cell proliferation rates, and reduced the senescent phenotype (lower SA-β-gal activity). By contrast, neither the expression of CSIG N- terminal (NT) fragment containing the ribosomal L1 domain nor C-terminal (CT) fragment containing Lys-rich region could significantly altered the levels of PTEN; instead of promoting cell proliferation and delaying cellular senescence, expression of CSIG-NT or CSIG-CT inhibited cell proliferation and accelerated cell senescence (increased SA-β-gal activity) compared to either CSIG over-expressing or control (empty vector transfected) cells. The further immunofluorescence analysis showed that CSIG-CT and CSIG-NT truncated proteins exhibited different subcellular distribution with that of wild-type CSIG. Conclusively, both ribosomal L1 domain and Lys-rich region of CSIG are critical for CSIG to act as a regulator of cell proliferation and cellular senescence. - Highlights: • The ribosomal L1 domain and lysine-rich region of CSIG were expressed. • They are critical for CSIG to regulate proliferation and senescence. • CSIG and its domains exhibit different subcellular distribution.« less
NASA Astrophysics Data System (ADS)
Prayuni, Kinasih; Dwivany, Fenny M.
2015-09-01
Banana is classified as a climateric fruit, whose ripening is regulated by ethylene. Ethylene is synthesized from ACC (1-aminocyclopropane-1-carboxylic acid) by ACC oxidase enzyme which is encoded by ACO gene. Controling an important gene expression in ethylene biosynthesis pathway has became a target to delay the ripening process. Therefore in the previous study we have designed a MaACO-RNAi construct to control MaACO gene expression. In this research, we study the effectiveness of different transient transformation methods to deliver the construct. Direct injection, with or no vaccum infiltration methods were used to deliver MaACO-RNAi construct. All of the methods succesfully deliver the construct into banana fruits based on RT-PCR result.
Chand, Subodh K; Nanda, Satyabrata; Joshi, Raj K
2016-01-01
MicroRNAs (miRNAs) are a class of post-transcriptional regulators that negatively regulate gene expression through target mRNA cleavage or translational inhibition and play important roles in plant development and stress response. In the present study, six conserved miRNAs from garlic (Allium sativum L.) were analyzed to identify differentially expressed miRNAs in response to Fusarium oxysporum f. sp. cepae (FOC) infection. Stem-loop RT-PCR revealed that miR394 is significantly induced in garlic seedlings post-treatment with FOC for 72 h. The induction of miR394 expression during FOC infection was restricted to the basal stem plate tissue, the primary site of infection. Garlic miR394 was also upregulated by exogenous application of jasmonic acid. Two putative targets of miR394 encoding F-box domain and cytochrome P450 (CYP450) family proteins were predicted and verified using 5' RLM-RACE (RNA ligase mediated rapid amplification of cDNA ends) assay. Quantitative RT-PCR showed that the transcript levels of the predicted targets were significantly reduced in garlic plants exposed to FOC. When garlic cultivars with variable sensitivity to FOC were exposed to the pathogen, an upregulation of miR394 and down regulation of the targets were observed in both varieties. However, the expression pattern was delayed in the resistant genotypes. These results suggest that miR394 functions in negative modulation of FOC resistance and the difference in timing and levels of expression in variable genotypes could be examined as markers for selection of FOC resistant garlic cultivars.
Pan, Yung-Wei; Zou, Junhui; Wang, Wenbin; Sakagami, Hiroyuki; Garelick, Michael G.; Abel, Glen; Kuo, Chay T.; Storm, Daniel R.; Xia, Zhengui
2012-01-01
Recent studies have led to the exciting idea that adult-born neurons in the dentate gyrus of the hippocampus may play a role in hippocampus-dependent memory formation. However, signaling mechanisms that regulate adult hippocampal neurogenesis are not well defined. Here we report that extracellular signal-regulated kinase 5 (ERK5), a member of the mitogen-activated protein kinase family, is selectively expressed in the neurogenic regions of the adult mouse brain. We present evidence that shRNA suppression of ERK5 in adult hippocampal neural stem/progenitor cells (aNPCs) reduces the number of neurons while increasing the number of cells expressing markers for stem/progenitor cells or proliferation. Furthermore, shERK5 attenuates both transcription and neuronal differentiation mediated by Neurogenin 2, a transcription factor expressed in adult hippocampal neural progenitor cells. By contrast, ectopic activation of endogenous ERK5 signaling via expression of constitutive active MEK5, an upstream activating kinase for ERK5, promotes neurogenesis in cultured aNPCs and in the dentate gyrus of the mouse brain. Moreover, neurotrophins including NT3 activate ERK5 and stimulate neuronal differentiation in aNPCs in an ERK5-dependent manner. Finally, inducible and conditional deletion of ERK5 specifically in the neurogenic regions of the adult mouse brain delays the normal progression of neuronal differentiation and attenuates adult neurogenesis in vivo. These data suggest ERK5 signaling as a critical regulator of adult hippocampal neurogenesis. PMID:22645146
Safian, Diego; van der Kant, Henk J. G.; Crespo, Diego; Bogerd, Jan; Schulz, Rüdiger W.
2017-01-01
Previous work showed that pharmacological inactivation of Igf-binding proteins (Igfbps), modulators of Igf activity, resulted in an excessive differentiation of type A undifferentiated (Aund) spermatogonia in zebrafish testis in tissue culture when Fsh was present in the incubation medium. Using this testis tissue culture system, we studied here the regulation of igfbp transcript levels by Fsh and two of its downstream effectors, Igf3 and 11-ketotestosterone (11-KT). We also explored how Fsh-modulated igfbp expression affected spermatogonial proliferation by adding or removing the Igfbp inhibitor NBI-31772 at different times. Fsh (100 ng/mL) decreased the transcript levels of igfbp1a, -3, and -6a after 1 or 3 days, while increasing igfbp2a and -5b expression, but only after 5 days of incubation. Igf3 down-regulated the same igfbp transcripts as Fsh but with a delay of at least 4 days. 11-KT increased the transcripts (igfbp2a and 5b) that were elevated by Fsh and decreased those of igfbp6a, as did Fsh, while 11-KT did not change igfbp1a or -3 transcript levels. To evaluate Igfbps effects on spermatogenesis, we quantified under different conditions the mitotic indices and relative section areas occupied by the different spermatogonial generations (type Aund, type A differentiating (Adiff), or type B (B) spermatogonia). Igf3 (100 ng/mL) increased the area occupied by Adiff and B while decreasing the one for Aund. Interestingly, a concentration of Igf3 that was inactive by itself (25 ng/mL) became active in the presence of the Igfbp inhibitor NBI-31772 and mimicked the effect of 100 ng/mL Igf3 on spermatogonia. Studies exploiting the different dynamics of igfbp expression in response to Fsh and adding or removing NBI-31772 at different times showed that the quick downregulation of three igfbp as well as the delayed upregulated of two igfbps all support Igf3 bioactivity, namely the stimulation of spermatogonial differentiation. We conclude that Fsh modulates, directly or via androgens and Igf3, igfbp gene expression, supporting Igf3 bioactivity either by decreasing igfbp1a, -3, -6a or by increasing igfbp2a and -5b gene expression. PMID:29209278
BCL-2 family protein, BAD is down-regulated in breast cancer and inhibits cell invasion.
Cekanova, Maria; Fernando, Romaine I; Siriwardhana, Nalin; Sukhthankar, Mugdha; De la Parra, Columba; Woraratphoka, Jirayus; Malone, Christine; Ström, Anders; Baek, Seung J; Wade, Paul A; Saxton, Arnold M; Donnell, Robert M; Pestell, Richard G; Dharmawardhane, Suranganie; Wimalasena, Jay
2015-02-01
We have previously demonstrated that the anti-apoptotic protein BAD is expressed in normal human breast tissue and shown that BAD inhibits expression of cyclin D1 to delay cell-cycle progression in breast cancer cells. Herein, expression of proteins in breast tissues was studied by immunohistochemistry and results were analyzed statistically to obtain semi-quantitative data. Biochemical and functional changes in BAD-overexpressing MCF7 breast cancer cells were evaluated using PCR, reporter assays, western blotting, ELISA and extracellular matrix invasion assays. Compared to normal tissues, Grade II breast cancers expressed low total/phosphorylated forms of BAD in both cytoplasmic and nuclear compartments. BAD overexpression decreased the expression of β-catenin, Sp1, and phosphorylation of STATs. BAD inhibited Ras/MEK/ERK and JNK signaling pathways, without affecting the p38 signaling pathway. Expression of the metastasis-related proteins, MMP10, VEGF, SNAIL, CXCR4, E-cadherin and TlMP2 was regulated by BAD with concomitant inhibition of extracellular matrix invasion. Inhibition of BAD by siRNA increased invasion and Akt/p-Akt levels. Clinical data and the results herein suggest that in addition to the effect on apoptosis, BAD conveys anti-metastatic effects and is a valuable prognostic marker in breast cancer. Copyright © 2014 Elsevier Inc. All rights reserved.
BCL-2 family protein, BAD is down-regulated in breast cancer and inhibits cancer cell invasion
Cekanova, Maria; Fernando, Romaine I.; Siriwardhana, Nalin; Sukhthankar, Mugdha; de la Parra, Columba; Woraratphoka, Jirayus; Malone, Christine; Ström, Anders; Baek, Seung J.; Wade, Paul A.; Saxton, Arnold M.; Donnell, Robert M.; Pestell, Richard G.; Dharmawardhane, Suranganie; Wimalasena, Jay
2015-01-01
We have previously demonstrated that the anti-apoptotic protein BAD is expressed in normal human breast tissue and shown that BAD inhibits expression of cyclin D1 to delay cell-cycle progression in breast cancer cells. Herein, expression of proteins in breast tissues was studied by immunohistochemistry and results were analyzed statistically to obtain semi-quantitative data. Biochemical and functional changes in BAD-overexpressing MCF7 breast cancer cells were evaluated using PCR, reporter assays, western blotting, ELISA and extracellular matrix invasion assays. Compared to normal tissues, Grade II breast cancers expressed low total/phosphorylated forms of BAD in both cytoplasmic and nuclear compartments. BAD overexpression decreased the expression of β-catenin, Sp1, and phosphorylation of STATs. BAD inhibited Ras/MEK/ERK and JNK signaling pathways, without affecting the p38 signaling pathway. Expression of the metastasis-related proteins, MMP10, VEGF, SNAIL, CXCR4, E-cadherin and TlMP2 were regulated by BAD with concomitant inhibition of extracellular matrix invasion. siRNA knockdown of BAD increased invasion and Akt/p-Akt levels. Clinical data and the results herein suggest that in addition to the effect on apoptosis, BAD conveys anti-metastatic effects and is a valuable prognostic marker in breast cancer. PMID:25499972
Characterization of ACE and ACE2 Expression within Different Organs of the NOD Mouse
Roca-Ho, Heleia; Riera, Marta; Palau, Vanesa; Pascual, Julio; Soler, Maria Jose
2017-01-01
Renin angiotensin system (RAS) is known to play a key role in several diseases such as diabetes, and renal and cardiovascular pathologies. Its blockade has been demonstrated to delay chronic kidney disease progression and cardiovascular damage in diabetic patients. In this sense, since local RAS has been described, the aim of this study is to characterize angiotensin converting enzyme (ACE) and ACE2 activities, as well as protein expression, in several tissues of the non-obese diabetic (NOD) mice model. After 21 or 40 days of diabetes onset, mouse serums and tissues were analyzed for ACE and ACE2 enzyme activities and protein expression. ACE and ACE2 enzyme activities were detected in different tissues. Their expressions vary depending on the studied tissue. Thus, whereas ACE activity was highly expressed in lungs, ACE2 activity was highly expressed in pancreas among the studied tissues. Interestingly, we also observed that diabetes up-regulates ACE mainly in serum, lung, heart, and liver, and ACE2 mainly in serum, liver, and pancreas. In conclusion, we found a marked serum and pulmonary alteration in ACE activity of diabetic mice, suggesting a common regulation. The increase of ACE2 activity within the circulation in diabetic mice may be ascribed to a compensatory mechanism of RAS. PMID:28273875
Characterization of ACE and ACE2 Expression within Different Organs of the NOD Mouse.
Roca-Ho, Heleia; Riera, Marta; Palau, Vanesa; Pascual, Julio; Soler, Maria Jose
2017-03-05
Renin angiotensin system (RAS) is known to play a key role in several diseases such as diabetes, and renal and cardiovascular pathologies. Its blockade has been demonstrated to delay chronic kidney disease progression and cardiovascular damage in diabetic patients. In this sense, since local RAS has been described, the aim of this study is to characterize angiotensin converting enzyme (ACE) and ACE2 activities, as well as protein expression, in several tissues of the non-obese diabetic (NOD) mice model. After 21 or 40 days of diabetes onset, mouse serums and tissues were analyzed for ACE and ACE2 enzyme activities and protein expression. ACE and ACE2 enzyme activities were detected in different tissues. Their expressions vary depending on the studied tissue. Thus, whereas ACE activity was highly expressed in lungs, ACE2 activity was highly expressed in pancreas among the studied tissues. Interestingly, we also observed that diabetes up-regulates ACE mainly in serum, lung, heart, and liver, and ACE2 mainly in serum, liver, and pancreas. In conclusion, we found a marked serum and pulmonary alteration in ACE activity of diabetic mice, suggesting a common regulation. The increase of ACE2 activity within the circulation in diabetic mice may be ascribed to a compensatory mechanism of RAS.
Wang, Nan; Gu, Yuanting; Li, Lin; Wang, Fang; Lv, Pengwei; Xiong, Youyi; Qiu, Xinguang
2018-04-24
Recently, circular RNAs (circRNAs) have been demonstrated as essential regulators in human cancers. However, the function and mechanism of circRNAs in breast cancer (BC) remain largely unknown and require to be investigated. In the present study, we found that circMYO9B was highly expressed in BC tissues by bioinformatics analysis. And we showed that circMYO9B expression was positively correlated with patients' prognosis. Moreover, we found that circMYO9B knockdown significantly suppressed the proliferation, migration and invasion of BC cells in vitro. In vivo assays also indicated that circMYO9B silence delayed tumor growth. In mechanism, we found that circMYO9B promoted the expression of FOXP4 by sponging miR-4316 in BC cells. We showed that the expression of miR-4316 was inversely associated with that of circMYO9B or FOXP4 in BC tissues. Finally, we found that restoration of FOXP4 expression significantly reversed the effects of circMYO9B knockdown on BC cell proliferation, migration and invasion. In conclusion, our findings demonstrated a key role of circMYO9B/miR-4316/FOXP4 axis in regulating BC progression. Copyright © 2018. Published by Elsevier Inc.
UVB Radiation Delays Tribolium castaneum Metamorphosis by Influencing Ecdysteroid Metabolism.
Sang, Wen; Yu, Lin; He, Li; Ma, Wei-Hua; Zhu, Zhi-Hui; Zhu, Fen; Wang, Xiao-Ping; Lei, Chao-Liang
2016-01-01
Ultraviolet B (UVB) radiation is an important environmental factor. It is generally known that UVB exhibits high genotoxicity due to causing DNA damage, potentially leading to skin carcinogenesis and aging in mammals. However, little is known about the effects of UVB on the development and metamorphosis of insects, which are the most abundant terrestrial animals. In the present study, we performed dose-response analyses of the effects UVB irradiation on Tribolium castaneum metamorphosis, assessed the function of the T. castaneum prothoracicotropic hormone gene (Trcptth), and analyzed ecdysteroid pathway gene expression profile and ecdysterone titers post-UVB irradiation. The results showed that UVB not only caused death of T. castaneum larvae, but also delayed larval-pupal metamorphosis and reduced the size and emergence rate of pupae. In addition, we verified the function of Trcptth, which is responsible for regulating metamorphosis. It was also found that the expression profiles of Trcptth as well as ecdysteroidogenesis and response genes were influenced by UVB radiation. Therefore, a disturbance pulse of ecdysteroid may be involved in delaying development under exposure to irradiation. To our knowledge, this is the first report indicating that UVB can influence the metamorphosis of insects. This study will contribute to a better understanding of the impact of UVB on signaling mechanisms in insect metamorphosis.
Li, Meng Amy; Amaral, Paulo P; Cheung, Priscilla; Bergmann, Jan H; Kinoshita, Masaki; Kalkan, Tüzer; Ralser, Meryem; Robson, Sam; von Meyenn, Ferdinand; Paramor, Maike; Yang, Fengtang; Chen, Caifu; Nichols, Jennifer; Spector, David L; Kouzarides, Tony; He, Lin; Smith, Austin
2017-01-01
Execution of pluripotency requires progression from the naïve status represented by mouse embryonic stem cells (ESCs) to a state capacitated for lineage specification. This transition is coordinated at multiple levels. Non-coding RNAs may contribute to this regulatory orchestra. We identified a rodent-specific long non-coding RNA (lncRNA) linc1281, hereafter Ephemeron (Eprn), that modulates the dynamics of exit from naïve pluripotency. Eprn deletion delays the extinction of ESC identity, an effect associated with perduring Nanog expression. In the absence of Eprn, Lin28a expression is reduced which results in persistence of let-7 microRNAs, and the up-regulation of de novo methyltransferases Dnmt3a/b is delayed. Dnmt3a/b deletion retards ES cell transition, correlating with delayed Nanog promoter methylation and phenocopying loss of Eprn or Lin28a. The connection from lncRNA to miRNA and DNA methylation facilitates the acute extinction of naïve pluripotency, a pre-requisite for rapid progression from preimplantation epiblast to gastrulation in rodents. Eprn illustrates how lncRNAs may introduce species-specific network modulations. DOI: http://dx.doi.org/10.7554/eLife.23468.001 PMID:28820723
A genomic lifespan program that reorganises the young adult brain is targeted in schizophrenia.
Skene, Nathan G; Roy, Marcia; Grant, Seth Gn
2017-09-12
The genetic mechanisms regulating the brain and behaviour across the lifespan are poorly understood. We found that lifespan transcriptome trajectories describe a calendar of gene regulatory events in the brain of humans and mice. Transcriptome trajectories defined a sequence of gene expression changes in neuronal, glial and endothelial cell-types, which enabled prediction of age from tissue samples. A major lifespan landmark was the peak change in trajectories occurring in humans at 26 years and in mice at 5 months of age. This species-conserved peak was delayed in females and marked a reorganization of expression of synaptic and schizophrenia-susceptibility genes. The lifespan calendar predicted the characteristic age of onset in young adults and sex differences in schizophrenia. We propose a genomic program generates a lifespan calendar of gene regulation that times age-dependent molecular organization of the brain and mutations that interrupt the program in young adults cause schizophrenia.
Bove, Jérôme; Lucas, Philippe; Godin, Béatrice; Ogé, Laurent; Jullien, Marc; Grappin, Philippe
2005-03-01
Seed dormancy in Nicotiana plumbaginifolia is characterized by an abscisic acid accumulation linked to a pronounced germination delay. Dormancy can be released by 1 year after-ripening treatment. Using a cDNA-amplified fragment length polymorphism (cDNA-AFLP) approach we compared the gene expression patterns of dormant and after-ripened seeds, air-dry or during one day imbibition and analyzed 15,000 cDNA fragments. Among them 1020 were found to be differentially regulated by dormancy. Of 412 sequenced cDNA fragments, 83 were assigned to a known function by search similarities to public databases. The functional categories of the identified dormancy maintenance and breaking responsive genes, give evidence that after-ripening turns in the air-dry seed to a new developmental program that modulates, at the RNA level, components of translational control, signaling networks, transcriptional control and regulated proteolysis.
Song, Zhi-Jing; Miao, Shuai; Zhao, Ye; Wang, Xiu-Li; Liu, Yue-Peng
2018-01-01
Purpose Preventing opioid-induced hyperalgesia and tolerance continues to be a major clinical challenge, and the underlying mechanisms of hyperalgesia and tolerance remain elusive. Here, we investigated the role of sonic hedgehog (Shh) signaling in opioid-induced hyperalgesia and tolerance. Methods Shh signaling expression, behavioral changes, and neurochemical alterations induced by morphine were analyzed in male adult CD-1 mice with repeated administration of morphine. To investigate the contribution of Shh to morphine-induced hyperalgesia (MIH) and tolerance, Shh signaling inhibitor cyclopamine and Shh small interfering RNA (siRNA) were used. To explore the mechanisms of Shh signaling in MIH and tolerance, brain-derived neurotrophic factor (BDNF) inhibitor K252 and anti-BDNF antibody were used. Results Repeated administration of morphine produced obvious hyperalgesia and tolerance. The behavioral changes were correlated with the upregulation and activation of morphine treatment-induced Shh signaling. Pharmacologic and genetic inhibition of Shh signaling significantly delayed the generation of MIH and tolerance and associated neurochemical changes. Chronic morphine administration also induced upregulation of BDNF. Inhibiting BDNF effectively delayed the generation of MIH and tolerance. The upregulation of BDNF induced by morphine was significantly suppressed by inhibiting Shh signaling. In naïve mice, exogenous activation of Shh signaling caused a rapid increase of BDNF expression, as well as thermal hyperalgesia. Inhibiting BDNF significantly suppressed smoothened agonist-induced hyperalgesia. Conclusion These findings suggest that Shh signaling may be a critical mediator for MIH and tolerance by regulating BDNF expression. Inhibiting Shh signaling, especially during the early phase, may effectively delay or suppress MIH and tolerance. PMID:29662325
The mechanism involved in the loss of PTEN expression in NSCLC tumor cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Gang; Zhao, Jingfeng; Peng, Xianjing
2012-02-17
Highlights: Black-Right-Pointing-Pointer Radiation stimulates PTEN reexpression in NSCLC independent of p53 activation. Black-Right-Pointing-Pointer PTEN reexpression is mediated by miR-29b overexpression. Black-Right-Pointing-Pointer miR-29b regulates Dnmts expression in NSCLC tumor cells. Black-Right-Pointing-Pointer Target therapy could be established by overexpressing miR-29b expression. -- Abstract: Loss of PTEN expression is observed in most non-small cell lung cancers (NSCLC). However, the mechanism by which PTEN expression is regulated in NSCLC has not been fully elucidated. In this study, we investigated the role of DNA methyltransferases (Dnmts), microRNA-29b (miR-29b), and anti-miR-29b inhibitor in PTEN promoter methylation and PTEN gene expression in H358 NSCLC cells in vitromore » and in vivo. PTEN mRNA was measured by RT-PCR. PTEN and Dnmts protein levels were measured by Western blot. miR-29b expression was detected by Northern blot. A xenograft H358 tumor mouse model was established by subcutaneously inoculating H358 cells into the right hind limbs of nude mice. We found that radiation induced cell apoptosis and hypomethylation in PTEN promoter, PTEN and miR-29b expression, and downregulation of Dnmt1, 3a and 3b expression in H358 tumor cells. The effect of radiation on gene expression and apoptosis was blocked by anti-miR-29b inhibitor. In the xenograft H358 tumor model, anti-miR-29b inhibitor reversed radiation-induced tumor growth delay, PTEN reexpression and downregulation of Dnmts expression. Our study suggested that miR-29b is an upstream molecule of PTEN. miR-29b regulates PTEN gene expression through downregulating Dnmts expression and subsequently induces hypomethylation in PTEN promoter. Targeting therapy could be established in NSCLC by upregulating miR-29b expression.« less
MicroRNA filters Hox temporal transcription noise to confer boundary formation in the spinal cord
NASA Astrophysics Data System (ADS)
Li, Chung-Jung; Hong, Tian; Tung, Ying-Tsen; Yen, Ya-Ping; Hsu, Ho-Chiang; Lu, Ya-Lin; Chang, Mien; Nie, Qing; Chen, Jun-An
2017-03-01
The initial rostrocaudal patterning of the neural tube leads to differential expression of Hox genes that contribute to the specification of motor neuron (MN) subtype identity. Although several 3' Hox mRNAs are expressed in progenitors in a noisy manner, these Hox proteins are not expressed in the progenitors and only become detectable in postmitotic MNs. MicroRNA biogenesis impairment leads to precocious expression and propagates the noise of Hoxa5 at the protein level, resulting in an imprecise Hoxa5-Hoxc8 boundary. Here we uncover, using in silico simulation, two feed-forward Hox-miRNA loops accounting for the precocious and noisy Hoxa5 expression, as well as an ill-defined boundary phenotype in Dicer mutants. Finally, we identify mir-27 as a major regulator coordinating the temporal delay and spatial boundary of Hox protein expression. Our results provide a novel trans Hox-miRNA circuit filtering transcription noise and controlling the timing of protein expression to confer robust individual MN identity.
Graeber, Kai; Linkies, Ada; Steinbrecher, Tina; Mummenhoff, Klaus; Tarkowská, Danuše; Turečková, Veronika; Ignatz, Michael; Sperber, Katja; Voegele, Antje; de Jong, Hans; Urbanová, Terezie; Strnad, Miroslav; Leubner-Metzger, Gerhard
2014-01-01
Seed germination is an important life-cycle transition because it determines subsequent plant survival and reproductive success. To detect optimal spatiotemporal conditions for germination, seeds act as sophisticated environmental sensors integrating information such as ambient temperature. Here we show that the DELAY OF GERMINATION 1 (DOG1) gene, known for providing dormancy adaptation to distinct environments, determines the optimal temperature for seed germination. By reciprocal gene-swapping experiments between Brassicaceae species we show that the DOG1-mediated dormancy mechanism is conserved. Biomechanical analyses show that this mechanism regulates the material properties of the endosperm, a seed tissue layer acting as germination barrier to control coat dormancy. We found that DOG1 inhibits the expression of gibberellin (GA)-regulated genes encoding cell-wall remodeling proteins in a temperature-dependent manner. Furthermore we demonstrate that DOG1 causes temperature-dependent alterations in the seed GA metabolism. These alterations in hormone metabolism are brought about by the temperature-dependent differential expression of genes encoding key enzymes of the GA biosynthetic pathway. These effects of DOG1 lead to a temperature-dependent control of endosperm weakening and determine the optimal temperature for germination. The conserved DOG1-mediated coat-dormancy mechanism provides a highly adaptable temperature-sensing mechanism to control the timing of germination. PMID:25114251
Cai, Hongxia; Ma, Yuanyuan; Jiang, Lu; Mu, Zhihao; Jiang, Zhen; Chen, Xiaoyan; Wang, Yongting; Yang, Guo-Yuan; Zhang, Zhijun
2017-06-07
Matrix metalloproteinase 9 (MMP-9) plays a beneficial role in the delayed phase of middle cerebral artery occlusion (MCAO). However, the mechanism is obscure. Here, we constructed hypoxia response element (HRE)-regulated MMP-9 to explore its effect on glial scars and neurogenesis in delayed ischemic stroke. Adult male Institute of Cancer Research (ICR) mice underwent MCAO and received a stereotactic injection of lentivirus carrying HRE-MMP-9 or normal saline (NS)/lentivirus-GFP 7 days after ischemia. We found that HRE-MMP-9 improved neurological outcomes, reduced ischemia-induced brain atrophy, and degraded glial scars (p < 0.05). Furthermore, HRE-MMP-9 increased the number of microvessels in the peri-infarct area (p < 0.001), which may have been due to the accumulation of endogenous endothelial progenitor cells (EPCs) in the peri-infarct area after glial scar degradation. Finally, HRE-MMP-9 increased the number of bromodeoxyuridine-positive (BrdU + )/NeuN + cells and the expression of PSD-95 in the peri-infarct area (p < 0.01). These changes could be blocked by vascular endothelial growth factor receptor 2 (VEGFR2) inhibitor SU5416 and MMP-9 inhibitor 2-[[(4-phenoxyphenyl)sulfonyl]methyl]-thiirane (SB-3CT). Our results provided a novel mechanism by which glial scar degradation and vascular endothelial growth factor (VEGF)/VEGFR2-dependent angiogenesis may be key procedures for neurological recovery in delayed ischemic stroke after HRE-MMP-9 treatment. Therefore, HRE-MMP-9 overexpression in the delayed ischemic brain is a promising approach for neurological recovery. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Conditional Expression of Wnt4 during Chondrogenesis Leads to Dwarfism in Mice
Lee, Hu-Hui; Behringer, Richard R.
2007-01-01
Wnts are expressed in the forming long bones, suggesting roles in skeletogenesis. To examine the action of Wnts in skeleton formation, we developed a genetic system to conditionally express Wnt4 in chondrogenic tissues of the mouse. A mouse Wnt4 cDNA was introduced into the ubiquitously expressed Rosa26 (R26) locus by gene targeting in embryonic stem (ES) cells. The expression of Wnt4 from the R26 locus was blocked by a neomycin selection cassette flanked by loxP sites (floxneo) that was positioned between the Rosa26 promoter and the Wnt4 cDNA, creating the allele designated R26floxneoWnt4. Wnt4 expression was activated during chondrogenesis using Col2a1-Cre transgenic mice that express Cre recombinase in differentiating chondrocytes. R26floxneoWnt4; Col2a1-Cre double heterozygous mice exhibited a growth deficiency, beginning approximately 7 to 10 days after birth, that resulted in dwarfism. In addition, they also had craniofacial abnormalities, and delayed ossification of the lumbar vertebrae and pelvic bones. Histological analysis revealed a disruption in the organization of the growth plates and a delay in the onset of the primary and secondary ossification centers. Molecular studies showed that Wnt4 overexpression caused decreased proliferation and altered maturation of chondrocytes. In addition, R26floxneoWnt4; Col2a1-Cre mice had decreased expression of vascular endothelial growth factor (VEGF). These studies demonstrate that Wnt4 overexpression leads to dwarfism in mice. The data indicate that Wnt4 levels must be regulated in chondrocytes for normal growth plate development and skeletogenesis. Decreased VEGF expression suggests that defects in vascularization may contribute to the dwarf phenotype. PMID:17505543
Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.
Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang
2018-05-07
Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.
Viguerie, Nathalie; Montastier, Emilie; Maoret, Jean-José; Roussel, Balbine; Combes, Marion; Valle, Carine; Villa-Vialaneix, Nathalie; Iacovoni, Jason S.; Martinez, J. Alfredo; Holst, Claus; Astrup, Arne; Vidal, Hubert; Clément, Karine; Hager, Jorg; Saris, Wim H. M.; Langin, Dominique
2012-01-01
Weight control diets favorably affect parameters of the metabolic syndrome and delay the onset of diabetic complications. The adaptations occurring in adipose tissue (AT) are likely to have a profound impact on the whole body response as AT is a key target of dietary intervention. Identification of environmental and individual factors controlling AT adaptation is therefore essential. Here, expression of 271 transcripts, selected for regulation according to obesity and weight changes, was determined in 515 individuals before, after 8-week low-calorie diet-induced weight loss, and after 26-week ad libitum weight maintenance diets. For 175 genes, opposite regulation was observed during calorie restriction and weight maintenance phases, independently of variations in body weight. Metabolism and immunity genes showed inverse profiles. During the dietary intervention, network-based analyses revealed strong interconnection between expression of genes involved in de novo lipogenesis and components of the metabolic syndrome. Sex had a marked influence on AT expression of 88 transcripts, which persisted during the entire dietary intervention and after control for fat mass. In women, the influence of body mass index on expression of a subset of genes persisted during the dietary intervention. Twenty-two genes revealed a metabolic syndrome signature common to men and women. Genetic control of AT gene expression by cis signals was observed for 46 genes. Dietary intervention, sex, and cis genetic variants independently controlled AT gene expression. These analyses help understanding the relative importance of environmental and individual factors that control the expression of human AT genes and therefore may foster strategies aimed at improving AT function in metabolic diseases. PMID:23028366
The transcription factor Lc-Maf participates in Col27a1 regulation during chondrocyte maturation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mayo, Jaime L.; Holden, Devin N.; Barrow, Jeffery R.
2009-08-01
The transcription factor Lc-Maf, which is a splice variant of c-Maf, is expressed in cartilage undergoing endochondral ossification and participates in the regulation of type II collagen through a cartilage-specific Col2a1 enhancer element. Type XXVII and type XI collagens are also expressed in cartilage during endochondral ossification, and so enhancer/reporter assays were used to determine whether Lc-Maf could regulate cartilage-specific enhancers from the Col27a1 and Col11a2 genes. The Col27a1 enhancer was upregulated over 4-fold by Lc-Maf, while the Col11a2 enhancer was downregulated slightly. To confirm the results of these reporter assays, rat chondrosarcoma (RCS) cells were transiently transfected with anmore » Lc-Maf expression plasmid, and quantitative RT-PCR was performed to measure the expression of endogenous Col27a1 and Col11a2 genes. Endogenous Col27a1 was upregulated 6-fold by Lc-Maf overexpression, while endogenous Col11a2 was unchanged. Finally, in situ hybridization and immunohistochemistry were performed in the radius and ulna of embryonic day 17 mouse forelimbs undergoing endochondral ossification. Results demonstrated that Lc-Maf and Col27a1 mRNAs are coexpressed in proliferating and prehypertrophic regions, as would be predicted if Lc-Maf regulates Col27a1 expression. Type XXVII collagen protein was also most abundant in prehypertrophic and proliferating chondrocytes. Others have shown that mice that are null for Lc-Maf and c-Maf have expanded hypertrophic regions with reduced ossification and delayed vascularization. Separate studies have indicated that Col27a1 may serve as a scaffold for ossification and vascularization. The work presented here suggests that Lc-Maf may affect the process of endochondral ossification by participating in the regulation of Col27a1 expression.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miao, Zongyu; Xu, Delin; Cui, Miao
2016-06-10
HSP70 acts mostly as a molecular chaperone and plays important roles in facilitating the folding of nascent peptides as well as the refolding or degradation of the denatured proteins. Under stressed conditions, the expression level of HSP70 is upregulated significantly and rapidly, as is known to be achieved by various regulatory factors controlling the transcriptional level. In this study, a high mobility group protein DSP1 was identified by DNA-affinity purification from the nuclear extracts of Crassostrea hongkongensis using the ChHSP70 promoter as a bait. The specific interaction between the prokaryotically expressed ChDSP1 and the FITC-labeled ChHSP70 promoter was confirmed bymore » EMSA analysis. ChDSP1 was shown to negatively regulate ChHSP70 promoter expression by Luciferase Reporter Assay in the heterologous HEK293T cells. Both ChHSP70 and ChDSP1 transcriptions were induced by either thermal or CdCl{sub 2} stress, while the accumulated expression peaks of ChDSP1 were always slightly delayed when compared with that of ChHSP70. This indicates that ChDSP1 is involved, very likely to exert its suppressive role, in the recovery of the ChHSP70 expression from the induced level to its original state. This study is the first to report negative regulator of HSP70 gene transcription, and provides novel insights into the mechanisms controlling heat shock protein expression. -- Highlights: •HMG protein ChDSP1 shows affinity to ChHSP70 promoter in Crassostrea hongkongensis. •ChDSP1 negatively regulates ChHSP70 transcription. •ChHSP70 and ChDSP1 transcriptions were coordinately induced by thermal/Cd stress. •ChDSP1 may contribute to the recovery of the induced ChHSP70 to its original state. •This is the first report regarding negative regulator of HSP70 transcription.« less
Zheng, Desen; Hao, Guixia; Cursino, Luciana; Zhang, Hongsheng; Burr, Thomas J
2012-09-01
The characterization of Tn5 transposon insertional mutants of Agrobacterium vitis strain F2/5 revealed a gene encoding a predicted LysR-type transcriptional regulator, lhnR (for 'LysR-type regulator associated with HR and necrosis'), and an immediate upstream operon consisting of three open reading frames (lhnABC) required for swarming motility, surfactant production and the induction of a hypersensitive response (HR) on tobacco and necrosis on grape. The operon lhnABC is unique to A. vitis among the sequenced members in Rhizobiaceae. Mutagenesis of lhnR and lhnABC by gene disruption and complementation of ΔlhnR and ΔlhnABC confirmed their roles in the expression of these phenotypes. Mutation of lhnR resulted in complete loss of HR, swarming motility, surfactant production and reduced necrosis, whereas mutation of lhnABC resulted in loss of swarming motility, delayed and reduced HR development and reduced surfactant production and necrosis. The data from promoter-green fluorescent protein (gfp) fusions showed that lhnR suppresses the expression of lhnABC and negatively autoregulates its own expression. It was also shown that lhnABC negatively affects its own expression and positively affects the transcription of lhnR. lhnR and lhnABC constitute a regulatory circuit that coordinates the transcription level of lhnR, resulting in the expression of swarming, surfactant, HR and necrosis phenotypes. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.
Sakaguchi, Kouhei; Ohno, Ryoko; Yoshida, Kentaro
2017-01-01
Triploid wheat hybrids between tetraploid wheat and Aegilops tauschii sometimes show abnormal growth phenotypes, and the growth abnormalities inhibit generation of wheat synthetic hexaploids. In type II necrosis, one of the growth abnormalities, necrotic cell death accompanied by marked growth repression occurs only under low temperature conditions. At normal temperature, the type II necrosis lines show grass-clump dwarfism with no necrotic symptoms, excess tillers, severe dwarfism and delayed flowering. Here, we report comparative expression analyses to elucidate the molecular mechanisms of the temperature-dependent phenotypic plasticity in the triploid wheat hybrids. We compared gene and small RNA expression profiles in crown tissues to characterize the temperature-dependent phenotypic plasticity. No up-regulation of defense-related genes was observed under the normal temperature, and down-regulation of wheat APETALA1-like MADS-box genes, considered to act as flowering promoters, was found in the grass-clump dwarf lines. Some microRNAs, including miR156, were up-regulated, whereas the levels of transcripts of the miR156 target genes SPLs, known to inhibit tiller and branch number, were reduced in crown tissues of the grass-clump dwarf lines at the normal temperature. Unusual expression of the miR156/SPLs module could explain the grass-clump dwarf phenotype. Dramatic alteration of gene expression profiles, including miRNA levels, in crown tissues is associated with the temperature-dependent phenotypic plasticity in type II necrosis/grass-clump dwarf wheat hybrids. PMID:28463975
Warnes, G; Biggerstaff, J P; Francis, J L
1998-07-01
Recent studies have investigated the use of anti-inflammatory cytokine, interleukin 10 (IL-10) to control the development of disseminated intravascular coagulation (DIC) in sepsis by down-regulation of monocyte tissue factor (MTF) induced by lipopolysaccharide (LPS) in the initial phase of the disease. In vitro and in vivo human studies have shown that a minimal (<1 h) delay in IL-10 treatment significantly reduces the cytokines ability to inhibit LPS-induced MTF expression and the end products of coagulation. In this whole blood in vitro study we investigated the role of lymphocyte and platelet interactions with monocytes to up-regulate MTF expression in the presence of IL-10 in the initial phase of exposure to LPS. Individual blockade of monocyte B7 or platelet P-selectin significantly (35%) reduced MTF expression (P<0.05). IL-10 showed a dose-dependent inhibition of LPS (0.1 microg/ml) induced MTF expression, with 56% inhibition at 1 ng/ml, maximizing at 5 ng/ml IL-10 (75%; P<0.05). Simultaneous exposure to LPS and IL-10 (1 ng/ml) or addition of IL-10 1 h after LPS, with individual B7 and P-selectin blockade significantly enhanced the inhibition of MTF expression by IL-10 (P<0.05). We conclude that the efficacy of IL-10 to control DIC could be enhanced by a simultaneous B7 and P-selectin blockade.
Kumamoto, Yusuke; Tomschegg, Antje; Bennai-Sanfourche, Fatima; Boerner, Anke; Kaser, Arthur; Schmidt-Knosalla, Isabella; Heinemann, Thomas; Schlawinsky, Mirko; Blumberg, Richard S; Volk, Hans-Dieter; Utku, Nalan
2004-04-01
T cell immune response c-DNA (TIRC7) is up-regulated during the early stages of T-cell activation in response to alloantigens. In this study, we analyzed the effects of newly developed monoclonal antibodies (mAb) against TIRC7 in acute cardiac allograft rejection. Fully vascularized heterotopic allogeneic heart transplantation was performed in mice across a full-mismatch barrier (C57Bl/10 into CBA). Recipients received seven injections (day 0-7) of a novel anti-TIRC7 mAb or remained untreated. Graft survival, histology and ex vivo lymphocyte functions were tested. Targeting of TIRC7 with an anti-TIRC7 mAb diminishes lymphocyte infiltration into grafts resulting in delay of morphological graft damage and prolongation of allograft survival. The lymphocytes from anti-TIRC7 mAb-treated animals exhibit hypo-responsiveness without evidence of lymphocyte depletion against the donor allo-antigens. Proliferation and expression of interferon-gamma (IFN-gamma) and tumor necrosis factor-alpha (TNF-alpha) were down-regulated while interleukin-4 (IL-4) and IL-10 expression were spared. Moreover, anti-TIRC7 mAb enhanced up-regulation of CTLA-4 expression but suppressed up-regulation of CD25 on stimulated lymphocytes in vitro and in vivo. Ligation of TIRC7 has important effects on the regulation of co-stimulatory signaling pathways associated with suppressing of T-cell activation. Targeting of TIRC7 may therefore provide a novel therapeutic approach for modulating T cell immune responses during organ transplantation.
Lv, Lin; Huo, Ximei; Wen, Luhua; Gao, Zhihong; Khalil-ur-Rehman, Muhammad
2018-01-01
Bud dormancy release is regulated by gibberellins (GAs). DELLA proteins are highly conserved and act as negative regulators in GA signaling pathway. The present study established a relationship between PmRGL2 in Japanese apricot and GA4 levels during dormancy release of floral buds. Overexpression of PmRGL2 in poplar delayed the onset of bud dormancy and resulted in dwarf plants, relative to wild-type trees. PmRGL2 exhibited higher expression during ecodormancy and relatively lower expression during endodormancy. The relative level of GA4 exhibited an increasing trend at the transition from endodormancy to ecodormancy and displayed a similar expression pattern of genes related to GA metabolism, PmGA20ox2, PmGA3ox1, PmGID1b, in both Japanese apricot and transgenic poplar. These results suggests that PmRGL2 acts as an integrator and negative regulator of dormancy via a GA-signaling pathway. Moreover, an interaction between RGL2 and SLY1 in a yeast two hybrid (Y2H) system further suggests that SCF E3 ubiquitin ligases, such as SLY1, may be a critical factor in the regulation of RGL2 through an SCFSLY1-proteasome pathway. Our study demonstrated that PmRGL2 plays a negative role in bud dormancy release by regulating the GA biosynthetic enzymes, GA20ox and GA3ox1 and the GA receptor, GID1b. PMID:29434610
Hippo Cascade Controls Lineage Commitment of Liver Tumors in Mice and Humans.
Zhang, Shanshan; Wang, Jingxiao; Wang, Haichuan; Fan, Lingling; Fan, Biao; Zeng, Billy; Tao, Junyan; Li, Xiaolei; Che, Li; Cigliano, Antonio; Ribback, Silvia; Dombrowski, Frank; Chen, Bin; Cong, Wenming; Wei, Lixin; Calvisi, Diego F; Chen, Xin
2018-04-01
Primary liver cancer consists mainly of hepatocellular carcinoma (HCC) and intrahepatic cholangiocarcinoma (ICC). A subset of human HCCs expresses a ICC-like gene signature and is classified as ICC-like HCC. The Hippo pathway is a critical regulator of normal and malignant liver development. However, the precise function(s) of the Hippo cascade along liver carcinogenesis remain to be fully delineated. The role of the Hippo pathway in a murine mixed HCC/ICC model induced by activated forms of AKT and Ras oncogenes (AKT/Ras) was investigated. The authors demonstrated the inactivation of Hippo in AKT/Ras liver tumors leading to nuclear localization of Yap and TAZ. Coexpression of AKT/Ras with Lats2, which activates Hippo, or the dominant negative form of TEAD2 (dnTEAD2), which blocks Yap/TAZ activity, resulted in delayed hepatocarcinogenesis and elimination of ICC-like lesions in the liver. Mechanistically, Notch2 expression was found to be down-regulated by the Hippo pathway in liver tumors. Overexpression of Lats2 or dnTEAD2 in human HCC cell lines inhibited their growth and led to the decreased expression of ICC-like markers, as well as Notch2 expression. Altogether, this study supports the key role of the Hippo cascade in regulating the differentiation status of liver tumors. Copyright © 2018 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Izawa, Takashi; Arakaki, Rieko; Mori, Hiroki; Tsunematsu, Takaaki; Kudo, Yasusei; Tanaka, Eiji
2016-01-01
The aryl hydrocarbon receptor (AhR) pathway plays a key role in receptor activator of NF-κB ligand (RANKL)–mediated osteoclastogenesis. However, the mechanism underlying the regulation of AhR expression in osteoclasts and the signaling pathway through which AhR controls osteoclastogenesis remain unclear. We found that the expression of AhR in bone marrow–derived osteoclasts was upregulated by RANKL at an earlier stage than was the expression of signature osteoclast genes such as those encoding cathepsin K and NFAT, cytoplasmic, calcineurin-dependent 1. In response to RANKL, bone marrow macrophages isolated from AhR−/− mice exhibited impaired phosphorylation of Akt and MAPK as well as NF-κB, whereas their response to M-CSF remained unchanged. Osteoclast differentiation mediated by the AhR signaling pathway was also regulated in an RANKL/c-Fos–dependent manner. Furthermore, ligand activation of AhR by the smoke toxin benzo[a]pyrene accelerated osteoclast differentiation in a receptor-dependent manner, and AhR-dependent regulation of mitochondrial biogenesis in osteoclasts was observed. Moreover, AhR−/− mice exhibited impaired bone healing with delayed endochondral ossification. Taken together, the present results suggest that the RANKL/AhR/c-Fos signaling axis plays a critical role in osteoclastogenesis, thereby identifying the potential of AhR in treating pathological, inflammatory, or metabolic disorders of the bone. PMID:27849171
Santhanam, Abirami; Peng, Wen-Hsin; Yu, Ya-Ting; Sang, Tzu-Kang
2014-01-01
The rapid removal of larval midgut is a critical developmental process directed by molting hormone ecdysone during Drosophila metamorphosis. To date, it remains unclear how the stepwise events can link the onset of ecdysone signaling to the destruction of larval midgut. This study investigated whether ecdysone-induced expression of receptor protein tyrosine phosphatase PTP52F regulates this process. The mutation of the Ptp52F gene caused significant delay in larval midgut degradation. Transitional endoplasmic reticulum ATPase (TER94), a regulator of ubiquitin proteasome system, was identified as a substrate and downstream effector of PTP52F in the ecdysone signaling. The inducible expression of PTP52F at the puparium formation stage resulted in dephosphorylation of TER94 on its Y800 residue, ensuring the rapid degradation of ubiquitylated proteins. One of the proteins targeted by dephosphorylated TER94 was found to be Drosophila inhibitor of apoptosis 1 (DIAP1), which was rapidly proteolyzed in cells with significant expression of PTP52F. Importantly, the reduced level of DIAP1 in response to inducible PTP52F was essential not only for the onset of apoptosis but also for the initiation of autophagy. This study demonstrates a novel function of PTP52F in regulating ecdysone-directed metamorphosis via enhancement of autophagic and apoptotic cell death in doomed Drosophila midguts. PMID:24550005
Pietilä, Mika; Vijay, Geraldine V.; Soundararajan, Rama; Yu, Xian; Symmans, William F.; Sphyris, Nathalie; Mani, Sendurai A.
2016-01-01
Cancer cells with stem cell properties (CSCs) underpin the chemotherapy resistance and high therapeutic failure of triple-negative breast cancers (TNBCs). Even though CSCs are known to proliferate more slowly, they are sensitive to inhibitors of G2/M kinases such as polo-like kinase 1 (PLK1). Understanding the cell cycle regulatory mechanisms of CSCs will help target these cells more efficiently. Herein, we identify a novel role for the transcription factor FOXC2, which is mostly expressed in CSCs, in the regulation of cell cycle of CSC-enriched breast cancer cells. We demonstrate that FOXC2 expression is regulated in a cell cycle-dependent manner, with FOXC2 protein levels accumulating in G2, and rapidly decreasing during mitosis. Knockdown of FOXC2 in CSC-enriched TNBC cells delays mitotic entry without significantly affecting the overall proliferation rate of these cells. Moreover, PLK1 activity is important for FOXC2 protein stability, since PLK1 inhibition reduces FOXC2 protein levels. Indeed, FOXC2 expressing CSC-enriched TNBC cells are sensitive to PLK1 inhibition. Collectively, our findings demonstrate a novel role for FOXC2 as a regulator of the G2/M transition and elucidate the reason for the observed sensitivity of CSC-enriched breast cancer cells to PLK1 inhibitor. PMID:27064522
Sun, Xiao-Cai; Xian, Xiao-Hui; Li, Wen-Bin; Li, Li; Yan, Cai-Zhen; Li, Qing-Jun; Zhang, Min
2010-08-01
This study investigates whether activation of p38 MAPK by the up-regulation of HSP 70 participates in the induction of brain ischemic tolerance by limb ischemic preconditioning (LIP). Western blot and immunohistochemical assays indicated that p38 MAPK activation occurred earlier than HSP 70 induction in the CA1 region of the hippocampus after LIP. P-p38 MAPK expression was up-regulated at 6h and reached its peak 12h after LIP, while HSP 70 expression was not significantly increased until 1 day and peaked 2 days after LIP. Neuropathological evaluation by thionin staining showed that quercetin (4 ml/kg, 50mg/kg, intraperitoneal injection), an inhibitor of HSP 70, blocked the protective effect of LIP against delayed neuronal death that is normally induced by lethal brain ischemic insult, indicating that HSP 70 participates in the induction of brain ischemic tolerance by LIP. Furthermore, SB 203580, an inhibitor of HSP 70, inhibited HSP 70 activation in the CA1 region of the hippocampus induced by LIP either with or without the presence of subsequent brain ischemic insult. Based on the above results, it can be concluded that activation of p38 MAPK participates in the brain ischemic tolerance induced by LIP at least partly by the up-regulation of HSP 70 expression. (c) 2010 Elsevier Inc. All rights reserved.
Cell-type-specific expression of NFIX in the developing and adult cerebellum.
Fraser, James; Essebier, Alexandra; Gronostajski, Richard M; Boden, Mikael; Wainwright, Brandon J; Harvey, Tracey J; Piper, Michael
2017-07-01
Transcription factors from the nuclear factor one (NFI) family have been shown to play a central role in regulating neural progenitor cell differentiation within the embryonic and post-natal brain. NFIA and NFIB, for instance, promote the differentiation and functional maturation of granule neurons within the cerebellum. Mice lacking Nfix exhibit delays in the development of neuronal and glial lineages within the cerebellum, but the cell-type-specific expression of this transcription factor remains undefined. Here, we examined the expression of NFIX, together with various cell-type-specific markers, within the developing and adult cerebellum using both chromogenic immunohistochemistry and co-immunofluorescence labelling and confocal microscopy. In embryos, NFIX was expressed by progenitor cells within the rhombic lip and ventricular zone. After birth, progenitor cells within the external granule layer, as well as migrating and mature granule neurons, expressed NFIX. Within the adult cerebellum, NFIX displayed a broad expression profile, and was evident within granule cells, Bergmann glia, and interneurons, but not within Purkinje neurons. Furthermore, transcriptomic profiling of cerebellar granule neuron progenitor cells showed that multiple splice variants of Nfix are expressed within this germinal zone of the post-natal brain. Collectively, these data suggest that NFIX plays a role in regulating progenitor cell biology within the embryonic and post-natal cerebellum, as well as an ongoing role within multiple neuronal and glial populations within the adult cerebellum.
Wierstra, Inken; Kloppstech, Klaus
2000-01-01
The effects of methyl jasmonate (JA-Me) on early light-inducible protein (ELIP) expression in barley (Hordeum vulgare L. cv Apex) have been studied. Treatment of leaf segments with JA-Me induces the same symptoms as those exhibited by norflurazon bleaching, including a loss of pigments and enhanced light stress that results in increased ELIP expression under both high- and low-light conditions. The expression of both low- and high-molecular-mass ELIP families is considerably down-regulated by JA-Me at the transcript and protein levels. This repression occurs despite increased photoinhibition measurable as a massive degradation of D1 protein and a delayed recovery of photosystem II activity. In JA-Me-treated leaf segments, the decrease of the photochemical efficiency of photosystem II under high light is substantially more pronounced as compared to controls in water. The repression of ELIP expression by JA-Me is superimposed on the effect of the increased light stress that leads to enhanced ELIP expression. The fact that the reduction of ELIP transcript levels is less pronounced than those of light-harvesting complex II and small subunit of Rubisco transcripts indicates that light stress is still affecting gene expression in the presence of JA-Me. The jasmonate-induced protein transcript levels that are induced by JA-Me decline under light stress conditions. PMID:11027731
Marcorelles, Pascale; Friocourt, Gaëlle; Uguen, Arnaud; Ledé, Françoise; Férec, Claude; Laquerrière, Annie
2014-11-01
Cystic Fibrosis Transmembrane conductance Regulator (CFTR) protein has recently been shown to be expressed in the human adult central nervous system (CNS). As CFTR expression has also been documented during embryonic development in several organs, such as the respiratory tract, the intestine and the male reproductive system, suggesting a possible role during development we decided to investigate the expression of CFTR in the human developing CNS. In addition, as some, although rare, neurological symptoms have been reported in patients with CF, we compared the expression of normal and mutated CFTR at several fetal stages. Immunohistochemistry was performed on brain and spinal cord samples of foetuses between 13 and 40 weeks of gestation and compared with five patients with cystic fibrosis (CF) of similar ages. We showed in this study that CFTR is only expressed in neurons and has an early and widespread distribution during development. Although we did not observe any cerebral abnormality in patients with CF, we observed a slight delay in the maturation of several brain structures. We also observed different expression and localization of CFTR depending on the brain structure or the cell maturation stage. Our findings, along with a literature review on the neurological phenotypes of patients with CF, suggest that this gene may play previously unsuspected roles in neuronal maturation or function. © The Author(s) 2014.
MC1R and cAMP signaling inhibit cdc25B activity and delay cell cycle progression in melanoma cells
Lyons, Jesse; Bastian, Boris C.; McCormick, Frank
2013-01-01
The melanocortin 1 receptor (MC1R) mediates the tanning response through induction of cAMP and downstream pigmentary enzymes. Diminished function alleles of MC1R are associated with decreased tanning and increased melanoma risk, which has been attributed to increased rates of mutation. We have found that MC1R or cAMP signaling also directly decreases proliferation in melanoma cell lines. MC1R overexpression, treatment with the MC1R ligand, or treatment with small-molecule activators of cAMP signaling causes delayed progression from G2 into mitosis. This delay is caused by phosphorylation and inhibition of cdc25B, a cyclin dependent kinase 1-activating phosphatase, and is rescued by expression of a cdc25B mutant that cannot be phosphorylated at the serine 323 residue. These results show that MC1R and cAMP signaling can directly inhibit melanoma growth through regulation of the G2/M checkpoint. PMID:23908401
Phenotypic Checkpoints Regulate Neuronal Development
Ben-Ari, Yehezkel; Spitzer, Nicholas C.
2010-01-01
Nervous system development proceeds by sequential gene expression mediated by cascades of transcription factors in parallel with sequences of patterned network activity driven by receptors and ion channels. These sequences are cell type- and developmental stage-dependent and modulated by paracrine actions of substances released by neurons and glia. How and to what extent these sequences interact to enable neuronal network development is not understood. Recent evidence demonstrates that CNS development requires intermediate stages of differentiation providing functional feedback that influences gene expression. We suggest that embryonic neuronal functions constitute a series of phenotypic checkpoint signatures; neurons failing to express these functions are delayed or developmentally arrested. Such checkpoints are likely to be a general feature of neuronal development and may constitute presymptomatic signatures of neurological disorders when they go awry. PMID:20864191
Roben, Caroline K.P.; Cole, Pamela M.; Armstrong, Laura Marie
2012-01-01
Researchers have suggested that as children’s language skill develops in early childhood, it comes to help children regulate their emotions (Cole, Armstrong, & Pemberton, 2010; Kopp, 1989), but the pathways by which this occurs have not been studied empirically. In a longitudinal study of 120 children from 18 to 48 months of age, associations among child language skill, observed anger expression, and regulatory strategies during a delay task were examined. Toddlers with better language skill, and whose language skill increased more over time, appeared less angry at 48 months and their anger declined more over time. Two regulatory strategies, support-seeking and distraction, explained a portion of the variance in the association between language skill and anger expression by 36 months. PMID:23278601
Sharma, Satyendra Nath; Maheshwari, Ankita; Sharma, Chitra; Shukla, Nidhi
2018-03-01
We are proposing mechanisms to account for the loss of viability (seed deterioration/ageing) and enhancement in seed quality (post-storage priming treatment). In order to understand the regulatory mechanism of these traits, we conducted controlled deterioration (CD) test for up to 8 d using primed mung bean seeds and examined how CD effects the expression of many genes, regulating the seed metabolism in relation to CD and priming. Germination declined progressively with increased duration of CD, and the priming treatment completely/partially reversed the inhibition depending on the duration of CD. The loss of germination capacity by CD was accompanied by a reduction in total RNA content and RNA integrity, indicating that RNA quantity and quality impacts seed longevity. Expression analysis revealed that biosynthesis genes of GA, ethylene, ABA and ROS-scavenging enzymes were differentially affected in response to duration of CD and priming, suggesting coordinately regulated mechanisms for controlling the germination capacity of seeds by modifying the permeability characteristics of biological membranes and activities of different enzymes. ABA genes were highly expressed when germination was delayed and inhibited by CD. Whereas, GA and ethylene genes were more highly expressed when germination was enhanced and permitted by priming under similar conditions. GSTI, a well characterized enzyme family involved in stress tolerance, was expressed in primed seeds over the period of CD, suggesting an additional protection against deterioration. The results are discussed in light of understanding the mechanisms underlying longevity/priming which are important issues economically and ecologically. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Yang, Liu; Ye, Chaofei; Zhao, Yuting; Cheng, Xiaolin; Wang, Yiqiao; Jiang, Yuan-Qing; Yang, Bo
2018-06-01
Overexpression of BnaWGR1 causes ROS accumulation and promotes leaf senescence. BnaWGR1 binds to promoters of RbohD and RbohF and regulates their expression. Manipulation of leaf senescence process affects agricultural traits of crop plants, including biomass, seed yield and stress resistance. Since delayed leaf senescence usually enhances tolerance to multiple stresses, we analyzed the function of specific MAPK-WRKY cascades in abiotic and biotic stress tolerance as well as leaf senescence in oilseed rape (Brassica napus L.), one of the important oil crops. In the present study, we showed that expression of one WRKY gene from oilseed rape, BnaWGR1, induced an accumulation of reactive oxygen species (ROS), cell death and precocious leaf senescence both in Nicotiana benthamiana and transgenic Arabidopsis (Arabidopsis thaliana). BnaWGR1 regulates the transcription of two genes encoding key enzymes implicated in production of ROS, that is, respiratory burst oxidase homolog (Rboh) D and RbohF. A dual-luciferase reporter assay confirmed the transcriptional regulation of RbohD and RbohF by BnaWGR1. In vitro electrophoresis mobility shift assay (EMSA) showed that BnaWGR1 could bind to W-box cis-elements within promoters of RbohD and RbohF. Moreover, RbohD and RbohF were significantly upregulated in transgenic Arabidopsis overexpressing BnaWGR1. In summary, these results suggest that BnaWGR1 could positively regulate leaf senescence through regulating the expression of RbohD and RbohF genes.
Reduced COX-2 expression in aged mice is associated with impaired fracture healing.
Naik, Amish A; Xie, Chao; Zuscik, Michael J; Kingsley, Paul; Schwarz, Edward M; Awad, Hani; Guldberg, Robert; Drissi, Hicham; Puzas, J Edward; Boyce, Brendan; Zhang, Xinping; O'Keefe, Regis J
2009-02-01
The cellular and molecular events responsible for reduced fracture healing with aging are unknown. Cyclooxygenase 2 (COX-2), the inducible regulator of prostaglandin E(2) (PGE(2)) synthesis, is critical for normal bone repair. A femoral fracture repair model was used in mice at either 7-9 or 52-56 wk of age, and healing was evaluated by imaging, histology, and gene expression studies. Aging was associated with a decreased rate of chondrogenesis, decreased bone formation, reduced callus vascularization, delayed remodeling, and altered expression of genes involved in repair and remodeling. COX-2 expression in young mice peaked at 5 days, coinciding with the transition of mesenchymal progenitors to cartilage and the onset of expression of early cartilage markers. In situ hybridization and immunohistochemistry showed that COX-2 is expressed primarily in early cartilage precursors that co-express col-2. COX-2 expression was reduced by 75% and 65% in fractures from aged mice compared with young mice on days 5 and 7, respectively. Local administration of an EP4 agonist to the fracture repair site in aged mice enhanced the rate of chondrogenesis and bone formation to levels observed in young mice, suggesting that the expression of COX-2 during the early inflammatory phase of repair regulates critical subsequent events including chondrogenesis, bone formation, and remodeling. The findings suggest that COX-2/EP4 agonists may compensate for deficient molecular signals that result in the reduced fracture healing associated with aging.
Knoch, Bianca; Barnett, Matthew P. G.; Cooney, Janine; McNabb, Warren C.; Barraclough, Diane; Laing, William; Zhu, Shuotun; Park, Zaneta A.; MacLean, Paul; Knowles, Scott O.; Roy, Nicole C.
2010-01-01
The interleukin-10 gene-deficient (Il10 −/−) mouse is a model of human inflammatory bowel disease and Ppara has been identified as one of the key genes involved in regulation of colitis in the bacterially inoculated Il10 −/− model. The aims were to (1) characterize colitis onset and progression using a histopathological, transcriptomic, and proteomic approach and (2) investigate links between PPARα and IL10 using gene network analysis. Bacterial inoculation resulted in severe colitis in Il10 −/− mice from 10 to 12 weeks of age. Innate and adaptive immune responses showed differences in gene expression relating to colitis severity. Actin cytoskeleton dynamics, innate immunity, and apoptosis-linked gene and protein expression data suggested a delayed remodeling process in 12-week-old Il10 −/− mice. Gene expression changes in 12-week-old Il10 −/− mice were related to PPARα signaling likely to control colitis, but how PPARα activation might regulate intestinal IL10 production remains to be determined. PMID:20671959
Drug targeting of NR4A nuclear receptors for treatment of acute myeloid leukemia.
Boudreaux, Seth P; Duren, Ryan P; Call, Steven G; Nguyen, Loc; Freire, Pablo R; Narayanan, Padmini; Redell, Michele S; Conneely, Orla M
2018-06-08
NR4As are AML tumor suppressors that are frequently silenced in human acute myeloid leukemia (AML). Despite their potential as novel targets for therapeutic intervention, mechanisms of NR4A silencing and strategies for their reactivation remain poorly defined. Here we show that NR4A silencing in AML occurs through blockade of transcriptional elongation rather than epigenetic promoter silencing. By intersection of NR4A-regulated gene signatures captured upon acute, exogenous expression of NR4As in human AML cells with in silico chemical genomics screening, we identify several FDA-approved drugs including dihydroergotamine (DHE) that reactivate NR4A expression and regulate NR4A-dependent gene signatures. We show that DHE induces NR4A expression via recruitment of the super elongation complex to enable elongation of NR4A promoter paused RNA polymerase II. Finally, DHE exhibits AML selective NR4A-dependent anti-leukemic activity in cytogenetically distinct human AML cells in vitro and delays AML progression in mice revealing its potential as a novel therapeutic agent in AML.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuang Wei; Department of Stomatology, Guangzhou General Hospital, Guangzhou Military Command, Guangzhou 510010; Tan Jiali
2009-01-09
Proliferation and differentiation of muscle stem cells must be tightly regulated by intrinsic and extrinsic signals for effective regeneration and adaptive response. MicroRNAs have been implicated as potent regulators in diverse biological processes at the level of posttranscriptional repression. In this study, we found that miR-146a was significantly upregulated upon a 48-h cyclic stretch of 5% elongation/10cycles/min. Importantly, miR-146 was predicted to base-pair with sequences in the 3' UTR of Numb, which promotes satellite cell differentiation towards muscle cells by inhibiting Notch signaling. Through reporter assay and exogenous expression experiment, we confirmed Numb was inhibited by miR-146a. Inhibition of miR-146amore » by antago-miR-146a rescued the expression of Numb and facilitated the differentiation of C2C12 at a cost of compromised proliferation. Thus, for the first time, we propose a role of miR-146a in skewing the balance of muscle differentiation and proliferation through inhibiting the expression of Numb.« less
Self-regulation strategies may enhance the acute effect of exercise on smoking delay.
Hatzigeorgiadis, Antonis; Pappa, Vassiliki; Tsiami, Anastasia; Tzatzaki, Theodora; Georgakouli, Kalliopi; Zourbanos, Nikos; Goudas, Marios; Chatzisarantis, Nikos; Theodorakis, Yannis
2016-06-01
The present study examined the acute effect of a moderate intensity aerobic exercise session combined with self-regulation on smoking delay in physically inactive smokers. Participants were 11 adults (5 males and 6 females) that completed three experimental conditions: control, exercise, and exercise using self-regulation strategies (SR). Following the experimental treatment smoking for the two exercise conditions delayed significantly more than for the control condition; in addition exercise SR delayed smoking marginally more that the plain exercise condition. Findings supported previous research that acute exercise reduces cravings to smoke, and suggests that the use of self-regulation strategies may strengthen exercise for smoking cessation interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chen, Zhong; Ye, Meixia; Su, Xiaoxing; Liao, Weihua; Ma, Huandi; Gao, Kai; Lei, Bingqi; An, Xinmin
2015-08-01
APETALA1 plays a crucial role in the transition from vegetative to reproductive phase and in floral development. In this study, to determine the effect of AP1 expression on flowering time and floral organ development, transgenic Arabidopsis and poplar overexpressing of AtAP1M3 (Arabidopsis AP1 mutant by dominant negative mutation) were generated. Transgenic Arabidopsis with e35Spro::AtAP1M3 displayed phenotypes with delayed-flowering compared to wild-type and flowers with abnormal sepals, petals and stamens. In addition, transgenic Arabidopsis plants exhibited reduced growth vigor compared to the wild-type plants. Ectopic expression of AtAP1M3 in poplar resulted in up- or down-regulation of some endogenous key flowering-related genes, including floral meristems identity gene LFY, B-class floral organ identity genes AP3 and PI, flowering pathway integrator FT1 and flower repressors TFL1 and SVP. These results suggest that AtAP1M3 regulates flowering time and floral development in plants.
Ngo, Quy A.; Baroux, Celia; Guthörl, Daniela; Mozerov, Peter; Collinge, Margaret A.; Sundaresan, Venkatesan; Grossniklaus, Ueli
2012-01-01
The proper balance of parental genomic contributions to the fertilized embryo and endosperm is essential for their normal growth and development. The characterization of many gametophytic maternal effect (GME) mutants affecting seed development indicates that there are certain classes of genes with a predominant maternal contribution. We present a detailed analysis of the GME mutant zak ixik (zix), which displays delayed and arrested growth at the earliest stages of embryo and endosperm development. ZIX encodes an Armadillo repeat (Arm) protein highly conserved across eukaryotes. Expression studies revealed that ZIX manifests a GME through preferential maternal expression in the early embryo and endosperm. This parent-of-origin–dependent expression is regulated by neither the histone and DNA methylation nor the DNA demethylation pathways known to regulate some other GME mutants. The ZIX protein is localized in the cytoplasm and nucleus of cells in reproductive tissues and actively dividing root zones. The maternal ZIX allele is required for the maternal expression of MINISEED3. Collectively, our results reveal a reproductive function of plant Arm proteins in promoting early seed growth, which is achieved through a distinct GME of ZIX that involves mechanisms for maternal allele-specific expression that are independent of the well-established pathways. PMID:23064319
Singh, R; Upadhyay, G; Kumar, S; Kapoor, A; Kumar, A; Tiwari, M; Godbole, M M
2003-01-01
Thyroid hormone (TH) deficiency results in delayed proliferation and migration of cerebellar granule cells. Although extensive cell loss during the development of the cerebellum under hypothyroid conditions is known, its nature and its mechanism are poorly understood. Bcl-2 family gene expression is known to determine the fate of cells to undergo apoptosis. We evaluated the effect of hypothyroidism on Bcl-2 family gene expression in the developing rat cerebellum. Electrophoresis and Western blotting were used to analyze DNA fragmentation and expression of DNA fragmentation factor (DFF-45), Bcl-2, Bcl-xL and Bax genes respectively. In the hypothyroid condition, extensive DNA fragmentation and enhanced cleavage of DFF-45 were seen throughout development (postnatal day 0 to day 24) and adulthood whereas they were absent in the euthyroid state. The anti-apoptotic genes Bcl-2 and Bcl-xL were down-regulated and the pro-apoptotic gene Bax was expressed at higher levels compared with the euthyroid state. These results suggest that normal levels of TH prevent cerebellar apoptosis to a large extent, whereas hypothyroidism not only increases the extent but also the duration of apoptosis by down-regulating the anti-apoptotic genes and maintaining a high level of the pro-apoptotic gene Bax.
Kcnh1 Voltage-gated Potassium Channels Are Essential for Early Zebrafish Development*
Stengel, Rayk; Rivera-Milla, Eric; Sahoo, Nirakar; Ebert, Christina; Bollig, Frank; Heinemann, Stefan H.; Schönherr, Roland; Englert, Christoph
2012-01-01
The Kcnh1 gene encodes a voltage-gated potassium channel highly expressed in neurons and involved in tumor cell proliferation, yet its physiological roles remain unclear. We have used the zebrafish as a model to analyze Kcnh1 function in vitro and in vivo. We found that the kcnh1 gene is duplicated in teleost fish (i.e. kcnh1a and kcnh1b) and that both genes are maternally expressed during early development. In adult zebrafish, kcnh1a and kcnh1b have distinct expression patterns but share expression in brain and testis. Heterologous expression of both genes in Xenopus oocytes revealed a strong conservation of characteristic functional properties between human and fish channels, including a unique sensitivity to intracellular Ca2+/calmodulin and modulation of voltage-dependent gating by extracellular Mg2+. Using a morpholino antisense approach, we demonstrate a strong kcnh1 loss-of-function phenotype in developing zebrafish, characterized by growth retardation, delayed hindbrain formation, and embryonic lethality. This late phenotype was preceded by transcriptional up-regulation of known cell-cycle inhibitors (p21, p27, cdh2) and down-regulation of pro-proliferative factors, including cyclin D1, at 70% epiboly. These results reveal an unanticipated basic activity of kcnh1 that is crucial for early embryonic development and patterning. PMID:22927438
Jiang, Xu-pin; Zhang, Dong-xia; Teng, Miao; Zhang, Qiong; Zhang, Jia-ping; Huang, Yue-sheng
2013-01-01
Tetraspanin CD9 has been implicated in various cellular and physiological processes, including cell migration. In our previous study, we found that wound repair is delayed in CD9-null mice, suggesting that CD9 is critical for cutaneous wound healing. However, many cell types, including immune cells, endothelial cells, keratinocytes and fibroblasts undergo marked changes in gene expression and phenotype, leading to cell proliferation, migration and differentiation during wound repair, whether CD9 regulates kerationcytes migration directly remains unclear. In this study, we showed that the expression of CD9 was downregulated in migrating keratinocytes during wound repair in vivo and in vitro. Recombinant adenovirus vector for CD9 silencing or overexpressing was constructed and used to infect HaCaT cells. Using cell scratch wound assay and cell migration assay, we have also demonstrated that downregulation of CD9 promoted keratinocyte migration in vitro, whereas CD9 overexpression inhibited cell migration. Moreover, CD9 inversely regulated the activity and expression of MMP-9 in keratinocytes, which was involved in CD9-regulated keratinocyte migration. Importantly, CD9 silencing-activated JNK signaling was accompanied by the upregulation of MMP-9 activity and expression. Coincidentally, we found that SP600125, a JNK pathway inhibitor, decreased the activity and expression of MMP-9 of CD9-silenced HaCaT cells. Thus, our results suggest that CD9 is downregulated in migrating keratinocytes in vivo and in vitro, and a low level of CD9 promotes keratinocyte migration in vitro, in which the regulation of MMP-9 through the JNK pathway plays an important role. PMID:24147081
Chand, Subodh K.; Nanda, Satyabrata; Joshi, Raj K.
2016-01-01
MicroRNAs (miRNAs) are a class of post-transcriptional regulators that negatively regulate gene expression through target mRNA cleavage or translational inhibition and play important roles in plant development and stress response. In the present study, six conserved miRNAs from garlic (Allium sativum L.) were analyzed to identify differentially expressed miRNAs in response to Fusarium oxysporum f. sp. cepae (FOC) infection. Stem-loop RT-PCR revealed that miR394 is significantly induced in garlic seedlings post-treatment with FOC for 72 h. The induction of miR394 expression during FOC infection was restricted to the basal stem plate tissue, the primary site of infection. Garlic miR394 was also upregulated by exogenous application of jasmonic acid. Two putative targets of miR394 encoding F-box domain and cytochrome P450 (CYP450) family proteins were predicted and verified using 5′ RLM-RACE (RNA ligase mediated rapid amplification of cDNA ends) assay. Quantitative RT-PCR showed that the transcript levels of the predicted targets were significantly reduced in garlic plants exposed to FOC. When garlic cultivars with variable sensitivity to FOC were exposed to the pathogen, an upregulation of miR394 and down regulation of the targets were observed in both varieties. However, the expression pattern was delayed in the resistant genotypes. These results suggest that miR394 functions in negative modulation of FOC resistance and the difference in timing and levels of expression in variable genotypes could be examined as markers for selection of FOC resistant garlic cultivars. PMID:26973694
A Transcriptome Approach Toward Understanding Fruit Softening in Persimmon
Jung, Jihye; Choi, Sang Chul; Jung, Sunghee; Cho, Byung-Kwan; Ahn, Gwang-Hwan; Ryu, Stephen B.
2017-01-01
Persimmon (Diospyros kaki Thunb.), which is a climacteric fruit, softens in 3–5 weeks after harvest. However, little is known regarding the transcriptional changes that underlie persimmon ripening. In this study, high-throughput de novo RNA sequencing was performed to examine differential expression between freshly harvested (FH) and softened (ST) persimmon fruit peels. Using the Illumina HiSeq platform, we obtained 259,483,704 high quality reads and 94,856 transcripts. After the removal of redundant sequences, a total of 31,258 unigenes were predicted, 1,790 of which were differentially expressed between FH and ST persimmon (1,284 up-regulated and 506 down-regulated in ST compared with FH). The differentially expressed genes (DEGs) were further subjected to KEGG pathway analysis. Several pathways were found to be up-regulated in ST persimmon, including “amino sugar and nucleotide sugar metabolism.” Pathways down-regulated in ST persimmon included “photosynthesis” and “carbon fixation in photosynthetic organisms.” Expression patterns of genes in these pathways were further confirmed using quantitative real-time RT-PCR. Ethylene gas production during persimmon softening was monitored with gas chromatography and found to be correlated with the fruit softening. Transcription involved in ethylene biosynthesis, perception and signaling was up-regulated. On the whole, this study investigated the key genes involved in metabolic pathways of persimmon fruit softening, especially implicated in increased sugar metabolism, decreased photosynthetic capability, and increased ethylene production and other ethylene-related functions. This transcriptome analysis provides baseline information on the identity and modulation of genes involved in softening of persimmon fruits and can underpin the future development of technologies to delay softening in persimmon. PMID:28955353
2012-01-01
Background Midkine is a small heparin binding growth factor expressed in numerous tissues during development. The unique midkine gene in mammals has two paralogs in zebrafish: midkine-a (mdka) and midkine-b (mdkb). In the zebrafish retina, during both larval development and adult photoreceptor regeneration, mdka is expressed in retinal stem and progenitor cells and functions as a molecular component of the retina’s stem cell niche. In this study, loss-of-function and conditional overexpression were used to investigate the function of Mdka in the retina of the embryonic zebrafish. Results The results show that during early retinal development Mdka functions to regulate cell cycle kinetics. Following targeted knockdown of Mdka synthesis, retinal progenitors cycle more slowly, and this results in microphthalmia, a diminished rate of cell cycle exit and a temporal delay of cell cycle exit and neuronal differentiation. In contrast, Mdka overexpression results in acceleration of the cell cycle and retinal overgrowth. Mdka gain-of-function, however, does not temporally advance cell cycle exit. Experiments to identify a potential Mdka signaling pathway show that Mdka functions upstream of the HLH regulatory protein, Id2a. Gene expression analysis shows Mdka regulates id2a expression, and co-injection of Mdka morpholinos and id2a mRNA rescues the Mdka loss-of-function phenotype. Conclusions These data show that in zebrafish, Mdka resides in a shared Id2a pathway to regulate cell cycle kinetics in retinal progenitors. This is the first study to demonstrate the function of Midkine during retinal development and adds Midkine to the list of growth factors that transcriptionally regulate Id proteins. PMID:23111152
Luo, Jing; Uribe, Rosa A; Hayton, Sarah; Calinescu, Anda-Alexandra; Gross, Jeffrey M; Hitchcock, Peter F
2012-10-30
Midkine is a small heparin binding growth factor expressed in numerous tissues during development. The unique midkine gene in mammals has two paralogs in zebrafish: midkine-a (mdka) and midkine-b (mdkb). In the zebrafish retina, during both larval development and adult photoreceptor regeneration, mdka is expressed in retinal stem and progenitor cells and functions as a molecular component of the retina's stem cell niche. In this study, loss-of-function and conditional overexpression were used to investigate the function of Mdka in the retina of the embryonic zebrafish. The results show that during early retinal development Mdka functions to regulate cell cycle kinetics. Following targeted knockdown of Mdka synthesis, retinal progenitors cycle more slowly, and this results in microphthalmia, a diminished rate of cell cycle exit and a temporal delay of cell cycle exit and neuronal differentiation. In contrast, Mdka overexpression results in acceleration of the cell cycle and retinal overgrowth. Mdka gain-of-function, however, does not temporally advance cell cycle exit. Experiments to identify a potential Mdka signaling pathway show that Mdka functions upstream of the HLH regulatory protein, Id2a. Gene expression analysis shows Mdka regulates id2a expression, and co-injection of Mdka morpholinos and id2a mRNA rescues the Mdka loss-of-function phenotype. These data show that in zebrafish, Mdka resides in a shared Id2a pathway to regulate cell cycle kinetics in retinal progenitors. This is the first study to demonstrate the function of Midkine during retinal development and adds Midkine to the list of growth factors that transcriptionally regulate Id proteins.
Communication-dependent mineralization of osteoblasts via gap junctions.
Hashida, Yukihiko; Nakahama, Ken-ichi; Shimizu, Kaori; Akiyama, Masako; Harada, Kiyoshi; Morita, Ikuo
2014-04-01
Connexin43 (Cx43) is a major gap junction (GJ) protein in bone and plays a critical role in osteoblast differentiation. Several studies show that osteoblast differentiation is delayed by Cx43 ablation. However, the precise mechanism underlying the role of Cx43 in osteoblast differentiation is not fully understood. Firstly, we analyzed the phenotype of a conditional knockout mouse, which was generated by mating of an osterix promoter-driven Cre expressing mouse with a Cx43-floxed mouse. As expected, delayed ossification was observed. Secondly, we demonstrated that the cell communication via gap junctions played an important role in osteoblast differentiation using a tamoxifen-inducible knockout system in vitro. Genetic ablation of Cx43 resulted in both the disruption of cell-communications and the attenuation of osteoblast mineralization induced by BMP-2, but not by ascorbic acid. Moreover, restoring full-length Cx43 (382aa) expression rescued the impairment of osteoblast cell-communication and osteoblast mineralization; however, the expression of the Cx43 N-terminal mutant (382aaG2V) did not rescue either of them. Comparing the gene expression profiles, the genes directly regulated by BMP-2 were attenuated by Cx43 gene ablation. These results suggested that the cell-communication mediated by gap junctions was indispensable for normal differentiation of osteoblast induced by BMP-2. Copyright © 2013 Elsevier Inc. All rights reserved.
Ku, Hsiao-Yun; Huang, Yu-Fei; Chao, Pei-Hsuan; Huang, Chiung-Chun; Hsu, Kuei-Sen
2008-11-01
Activity-dependent alterations of synaptic efficacy or connectivity are essential for the development, signal processing, and learning and memory functions of the nervous system. It was observed that, in particular in the CA1 region of the hippocampus, low-frequency stimulation (LFS) became progressively less effective at inducing long-term depression (LTD) with advancing developmental age. The physiological factors regulating this developmental plasticity change, however, have not yet been elucidated. Here we examined the hypothesis that neonatal isolation (once per day for 1 h from postnatal days 1-7) is able to alter processes underlying the developmental decline of LTD. We confirm that the magnitude of LTD induced by LFS (900 stimuli at 1 Hz) protocol correlates negatively with developmental age and illustrates that neonatal isolation delays this developmental decline via the activation of corticotrophin-releasing factor (CRF) system. Furthermore, this modulation appears to be mediated by an increased transcription of N-methyl-D-aspartate receptor NR2B subunits. We also demonstrate that intracerebroventricular injection of CRF postnatally mimicked the effect of neonatal isolation to increase the expression of NR2B subunits and delayed the developmental decline of LTD, which was specifically blocked by CRF receptor 1 antagonist NBI27914 pretreatment. These results suggest a novel role for CRF in regulating developmental events in the hippocampus and indicate that although maternal deprivation is stressful for neonate, appropriate neonatal isolation can serve to promote an endocrine state that may regulate the gradual developmental change in the induction rules for synaptic plasticity in the hippocampal CA1 region.
Chiu, Rex S; Nahal, Hardeep; Provart, Nicholas J; Gazzarrini, Sonia
2012-01-27
Imbibed seeds integrate environmental and endogenous signals to break dormancy and initiate growth under optimal conditions. Seed maturation plays an important role in determining the survival of germinating seeds, for example one of the roles of dormancy is to stagger germination to prevent mass growth under suboptimal conditions. The B3-domain transcription factor FUSCA3 (FUS3) is a master regulator of seed development and an important node in hormonal interaction networks in Arabidopsis thaliana. Its function has been mainly characterized during embryonic development, where FUS3 is highly expressed to promote seed maturation and dormancy by regulating ABA/GA levels. In this study, we present evidence for a role of FUS3 in delaying seed germination at supraoptimal temperatures that would be lethal for the developing seedlings. During seed imbibition at supraoptimal temperature, the FUS3 promoter is reactivated and induces de novo synthesis of FUS3 mRNA, followed by FUS3 protein accumulation. Genetic analysis shows that FUS3 contributes to the delay of seed germination at high temperature. Unlike WT, seeds overexpressing FUS3 (ML1:FUS3-GFP) during imbibition are hypersensitive to high temperature and do not germinate, however, they can fully germinate after recovery at control temperature reaching 90% seedling survival. ML1:FUS3-GFP hypersensitivity to high temperature can be partly recovered in the presence of fluridone, an inhibitor of ABA biosynthesis, suggesting this hypersensitivity is due in part to higher ABA level in this mutant. Transcriptomic analysis shows that WT seeds imbibed at supraoptimal temperature activate seed-specific genes and ABA biosynthetic and signaling genes, while inhibiting genes that promote germination and growth, such as GA biosynthetic and signaling genes. In this study, we have uncovered a novel function for the master regulator of seed maturation, FUS3, in delaying germination at supraoptimal temperature. Physiologically, this is important since delaying germination has a protective role at high temperature. Transcriptomic analysis of seeds imbibed at supraoptimal temperature reveal that a complex program is in place, which involves not only the regulation of heat and dehydration response genes to adjust cellular functions, but also the activation of seed-specific programs and the inhibition of germination-promoting programs to delay germination. © 2011 Chiu et al; licensee BioMed Central Ltd.
2012-01-01
Background Imbibed seeds integrate environmental and endogenous signals to break dormancy and initiate growth under optimal conditions. Seed maturation plays an important role in determining the survival of germinating seeds, for example one of the roles of dormancy is to stagger germination to prevent mass growth under suboptimal conditions. The B3-domain transcription factor FUSCA3 (FUS3) is a master regulator of seed development and an important node in hormonal interaction networks in Arabidopsis thaliana. Its function has been mainly characterized during embryonic development, where FUS3 is highly expressed to promote seed maturation and dormancy by regulating ABA/GA levels. Results In this study, we present evidence for a role of FUS3 in delaying seed germination at supraoptimal temperatures that would be lethal for the developing seedlings. During seed imbibition at supraoptimal temperature, the FUS3 promoter is reactivated and induces de novo synthesis of FUS3 mRNA, followed by FUS3 protein accumulation. Genetic analysis shows that FUS3 contributes to the delay of seed germination at high temperature. Unlike WT, seeds overexpressing FUS3 (ML1:FUS3-GFP) during imbibition are hypersensitive to high temperature and do not germinate, however, they can fully germinate after recovery at control temperature reaching 90% seedling survival. ML1:FUS3-GFP hypersensitivity to high temperature can be partly recovered in the presence of fluridone, an inhibitor of ABA biosynthesis, suggesting this hypersensitivity is due in part to higher ABA level in this mutant. Transcriptomic analysis shows that WT seeds imbibed at supraoptimal temperature activate seed-specific genes and ABA biosynthetic and signaling genes, while inhibiting genes that promote germination and growth, such as GA biosynthetic and signaling genes. Conclusion In this study, we have uncovered a novel function for the master regulator of seed maturation, FUS3, in delaying germination at supraoptimal temperature. Physiologically, this is important since delaying germination has a protective role at high temperature. Transcriptomic analysis of seeds imbibed at supraoptimal temperature reveal that a complex program is in place, which involves not only the regulation of heat and dehydration response genes to adjust cellular functions, but also the activation of seed-specific programs and the inhibition of germination-promoting programs to delay germination. PMID:22279962
Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira
2014-12-01
Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.
Li, Jianhua; Bai, Caiyan; Guo, Junxia; Liang, Wanqian; Long, Jingning
2017-07-01
Myocardial ischaemia/reperfusion (I/R) injury may cause the apoptosis of cardiomyocytes as well as mitochondrial dysfunction. The aims of the present study were to investigate whether NADH dehydrogenase 1 alpha subcomplex subunit 4-like 2 (NDUFA4L2) on myocardial ischaemia-reperfusion (I/R) injury and the underlying molecular mechanism. The hypoxia-reperfusion (H/R) model was established in vitro using H9c2 cells to simulate I/R injury. NDUFA4L2 and complex I expression levels were detected using RT-PCR and western blot. The apoptosis of H9c2 cells was evaluated by flow cytometry and the expression of Bax and Bcl-2 was detected by western blot. The mitochondrial function was assessed by ATP concentration, mPTP opening and cytochrome c (cyto C) expression. Our data indicated that NDUFA4L2 expression was significantly down-regulated in myocardial H/R injury. Overexpression of NDUFA4L2 led to a dramatic prevention of H/R-induced apoptosis accompanied by a decrease in the expression of Bax and an increase in the expression of Bcl-2. Meanwhile, augmentation of NDUFA4L2 dramatically prevented mitochondrial dysfunction caused by H/R as reflecting in the increased ATP concentration, delayed mPTP opening, as well as down-regulated cyto C expression. Moreover, complex I activation was heightened and negatively regulated by NDUFA4L2. Silencing complex I conspicuously attenuated cell apoptosis and mitochondrial dysfunction. Taken together, our findings demonstrated that NDUFA4L2 protects against H/R injury by preventing myocardium apoptosis and mitochondrial dysfunction via the complex I, and may be a potential therapeutic approach for attenuating myocardial I/R injury. © 2017 John Wiley & Sons Australia, Ltd.
Klähn, Stephan; Orf, Isabel; Schwarz, Doreen; Matthiessen, Jasper K.F.; Kopka, Joachim; Hess, Wolfgang R.; Hagemann, Martin
2015-01-01
The acquisition and assimilation of inorganic carbon (Ci) represents the largest flux of inorganic matter in photosynthetic organisms; hence, this process is tightly regulated. We examined the Ci-dependent transcriptional and metabolic regulation in wild-type Synechocystis sp. PCC 6803 compared with a mutant defective in the main transcriptional repressor for Ci acquisition genes, the NAD(P)H dehydrogenase transcriptional regulator NdhR. The analysis revealed that many protein-coding transcripts that are normally repressed in the presence of high CO2 (HC) concentrations were strongly expressed in ∆ndhR, whereas other messenger RNAs were strongly down-regulated in mutant cells, suggesting a potential activating role for NdhR. A conserved NdhR-binding motif was identified in the promoters of derepressed genes. Interestingly, the expression of some NdhR-regulated genes remained further inducible under low-CO2 conditions, indicating the involvement of additional NdhR-independent Ci-regulatory mechanisms. Intriguingly, we also observed that the abundance of 52 antisense RNAs and 34 potential noncoding RNAs was affected by Ci supply, although most of these molecules were not regulated through NdhR. Thus, antisense and noncoding RNAs could contribute to NdhR-independent carbon regulation. In contrast to the transcriptome, the metabolome in ∆ndhR cells was similar to that of wild-type cells under HC conditions. This observation and the delayed metabolic responses to the low-CO2 shift in ∆ndhR, specifically the lack of transient increases in the photorespiratory pathway intermediates 2-phosphoglycolate, glycolate, and glycine, suggest that the deregulation of gene expression in the ΔndhR mutant successfully preacclimates cyanobacterial cells to lowered Ci supply under HC conditions. PMID:25630438
Regulation of Bt crops in Canada.
Macdonald, Phil; Yarrow, Stephen
2003-06-01
The Canadian Food Inspection Agency (CFIA) regulates environmental releases of plants with novel traits, which include transgenic plants such as Bt crops. Bt crops are regulated in Canada because they express insect resistance novel to their species. Commercialization of crops with novel traits such as the production of insecticidal Bt proteins requires an approval for environmental release, as well as approvals for use as feed and food. Environmental factors such as potential impacts on non-target species are considered. Insect resistance management (IRM) may be imposed as a condition for environmental release of Bt crops to delay the development of resistance in the target insect. Bt potato and European corn borer-resistant Bt corn have been released with mandatory IRM. The CFIA imposes an IRM plan consisting of appropriate refugia, education of farmers and seed dealers, and monitoring and mitigation. Industry, regulators, government extension staff and public researchers provide expert advice on IRM.
Role of sugars under abiotic stress.
Sami, Fareen; Yusuf, Mohammad; Faizan, Mohammad; Faraz, Ahmad; Hayat, Shamsul
2016-12-01
Sugars are the most important regulators that facilitate many physiological processes, such as photosynthesis, seed germination, flowering, senescence, and many more under various abiotic stresses. Exogenous application of sugars in low concentration promote seed germination, up regulates photosynthesis, promotes flowering, delayed senescence under various unfavorable environmental conditions. However, high concentration of sugars reverses all these physiological process in a concentration dependent manner. Thus, this review focuses the correlation between sugars and their protective functions in several physiological processes against various abiotic stresses. Keeping in mind the multifaceted role of sugars, an attempt has been made to cover the role of sugar-regulated genes associated with photosynthesis, seed germination and senescence. The concentration of sugars determines the expression of these sugar-regulated genes. This review also enlightens the interaction of sugars with several phytohormones, such as abscisic acid, ethylene, cytokinins and gibberellins and its effect on their biosynthesis under abiotic stress conditions. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Zhang, Ting; Qu, Yixin; Wang, Haibin; Wang, Jingjing; Song, Aiping; Hu, Yueheng; Chen, Sumei; Jiang, Jiafu; Chen, Fadi
2017-06-01
TCP transcription factors are important for plant growth and development, but their activity in chrysanthemum (Chrysanthemum morifolium) has not been thoroughly explored. Here, a chrysanthemum TCP-P sequence, which encodes a protein harboring the conserved basic helix-loop-helix (bHLH) motif, was shown to be related phylogenetically to the Arabidopsis thaliana gene AtTCP14. A yeast-one hybrid assay showed that the encoding protein had no transcriptional activation ability, and a localization experiment indicated that it was localized in the nucleus. Transcription profiling established that the gene was most active in the stem and leaf. Its heterologous expression in A. thaliana down-regulated certain cell cycle-related genes, reduced the size of various organs and increased the chlorophyll and carotenoid contents of the leaf which led to delayed senescence and a prolonged flowering period. Moreover, by screening the cDNA library of chrysanthemum, we found that the CmTCP14 can interact with CmFTL2 and some CmDELLAs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Sun, Fenglong; Cao, Jie; Huo, Na; Wuda, Bala; Du, Jinkun; Peng, Huiru; Ni, Zhongfu; Sun, Qixin
2018-01-01
Seed germination is important for grain yield and quality and rapid, near-simultaneous germination helps in cultivation; however, cultivars that germinate too readily can undergo preharvest sprouting (PHS), which causes substantial losses in areas that tend to get rain around harvest time. Moreover, our knowledge of mechanisms regulating seed germination in wheat (Triticum aestivum) remains limited. In this study, we analyzed function of a wheat-specific microRNA 9678 (miR9678), which is specifically expressed in the scutellum of developing and germinating seeds. Overexpression of miR9678 delayed germination and improved resistance to PHS in wheat through reducing bioactive gibberellin (GA) levels; miR9678 silencing enhanced germination rates. We provide evidence that miR9678 targets a long noncoding RNA (WSGAR) and triggers the generation of phased small interfering RNAs that play a role in the delay of seed germination. Finally, we found that abscisic acid (ABA) signaling proteins bind the promoter of miR9678 precursor and activate its expression, indicating that miR9678 affects germination by modulating the GA/ABA signaling. PMID:29567662
Krüger, Angela V; Jelier, Rob; Dzyubachyk, Oleh; Zimmerman, Timo; Meijering, Erik; Lehner, Ben
2015-02-15
Chromatin regulators are widely expressed proteins with diverse roles in gene expression, nuclear organization, cell cycle regulation, pluripotency, physiology and development, and are frequently mutated in human diseases such as cancer. Their inhibition often results in pleiotropic effects that are difficult to study using conventional approaches. We have developed a semi-automated nuclear tracking algorithm to quantify the divisions, movements and positions of all nuclei during the early development of Caenorhabditis elegans and have used it to systematically study the effects of inhibiting chromatin regulators. The resulting high dimensional datasets revealed that inhibition of multiple regulators, including F55A3.3 (encoding FACT subunit SUPT16H), lin-53 (RBBP4/7), rba-1 (RBBP4/7), set-16 (MLL2/3), hda-1 (HDAC1/2), swsn-7 (ARID2), and let-526 (ARID1A/1B) affected cell cycle progression and caused chromosome segregation defects. In contrast, inhibition of cir-1 (CIR1) accelerated cell division timing in specific cells of the AB lineage. The inhibition of RNA polymerase II also accelerated these division timings, suggesting that normal gene expression is required to delay cell cycle progression in multiple lineages in the early embryo. Quantitative analyses of the dataset suggested the existence of at least two functionally distinct SWI/SNF chromatin remodeling complex activities in the early embryo, and identified a redundant requirement for the egl-27 and lin-40 MTA orthologs in the development of endoderm and mesoderm lineages. Moreover, our dataset also revealed a characteristic rearrangement of chromatin to the nuclear periphery upon the inhibition of multiple general regulators of gene expression. Our systematic, comprehensive and quantitative datasets illustrate the power of single cell-resolution quantitative tracking and high dimensional phenotyping to investigate gene function. Furthermore, the results provide an overview of the functions of essential chromatin regulators during the early development of an animal. Copyright © 2014 Elsevier Inc. All rights reserved.
Chen, Yan; Whetstone, Heather C; Lin, Alvin C; Nadesan, Puviindran; Wei, Qingxia; Poon, Raymond; Alman, Benjamin A
2007-01-01
Background Delayed fracture healing causes substantial disability and usually requires additional surgical treatments. Pharmacologic management to improve fracture repair would substantially improve patient outcome. The signaling pathways regulating bone healing are beginning to be unraveled, and they provide clues into pharmacologic management. The β-catenin signaling pathway, which activates T cell factor (TCF)-dependent transcription, has emerged as a key regulator in embryonic skeletogenesis, positively regulating osteoblasts. However, its role in bone repair is unknown. The goal of this study was to explore the role of β-catenin signaling in bone repair. Methods and Findings Western blot analysis showed significant up-regulation of β-catenin during the bone healing process. Using a β-Gal activity assay to observe activation during healing of tibia fractures in a transgenic mouse model expressing a TCF reporter, we found that β-catenin-mediated, TCF-dependent transcription was activated in both bone and cartilage formation during fracture repair. Using reverse transcription-PCR, we observed that several WNT ligands were expressed during fracture repair. Treatment with DKK1 (an antagonist of WNT/β-catenin pathway) inhibited β-catenin signaling and the healing process, suggesting that WNT ligands regulate β-catenin. Healing was significantly repressed in mice conditionally expressing either null or stabilized β-catenin alleles induced by an adenovirus expressing Cre recombinase. Fracture repair was also inhibited in mice expressing osteoblast-specific β-catenin null alleles. In stark contrast, there was dramatically enhanced bone healing in mice expressing an activated form of β-catenin, whose expression was restricted to osteoblasts. Treating mice with lithium activated β-catenin in the healing fracture, but healing was enhanced only when treatment was started subsequent to the fracture. Conclusions These results demonstrate that β-catenin functions differently at different stages of fracture repair. In early stages, precise regulation of β-catenin is required for pluripotent mesenchymal cells to differentiate to either osteoblasts or chondrocytes. Once these undifferentiated cells have become committed to the osteoblast lineage, β-catenin positively regulates osteoblasts. This is a different function for β-catenin than has previously been reported during development. Activation of β-catenin by lithium treatment has potential to improve fracture healing, but only when utilized in later phases of repair, after mesenchymal cells have become committed to the osteoblast lineage. PMID:17676991
Chen, Yan; Whetstone, Heather C; Lin, Alvin C; Nadesan, Puviindran; Wei, Qingxia; Poon, Raymond; Alman, Benjamin A
2007-07-31
Delayed fracture healing causes substantial disability and usually requires additional surgical treatments. Pharmacologic management to improve fracture repair would substantially improve patient outcome. The signaling pathways regulating bone healing are beginning to be unraveled, and they provide clues into pharmacologic management. The beta-catenin signaling pathway, which activates T cell factor (TCF)-dependent transcription, has emerged as a key regulator in embryonic skeletogenesis, positively regulating osteoblasts. However, its role in bone repair is unknown. The goal of this study was to explore the role of beta-catenin signaling in bone repair. Western blot analysis showed significant up-regulation of beta-catenin during the bone healing process. Using a beta-Gal activity assay to observe activation during healing of tibia fractures in a transgenic mouse model expressing a TCF reporter, we found that beta-catenin-mediated, TCF-dependent transcription was activated in both bone and cartilage formation during fracture repair. Using reverse transcription-PCR, we observed that several WNT ligands were expressed during fracture repair. Treatment with DKK1 (an antagonist of WNT/beta-catenin pathway) inhibited beta-catenin signaling and the healing process, suggesting that WNT ligands regulate beta-catenin. Healing was significantly repressed in mice conditionally expressing either null or stabilized beta-catenin alleles induced by an adenovirus expressing Cre recombinase. Fracture repair was also inhibited in mice expressing osteoblast-specific beta-catenin null alleles. In stark contrast, there was dramatically enhanced bone healing in mice expressing an activated form of beta-catenin, whose expression was restricted to osteoblasts. Treating mice with lithium activated beta-catenin in the healing fracture, but healing was enhanced only when treatment was started subsequent to the fracture. These results demonstrate that beta-catenin functions differently at different stages of fracture repair. In early stages, precise regulation of beta-catenin is required for pluripotent mesenchymal cells to differentiate to either osteoblasts or chondrocytes. Once these undifferentiated cells have become committed to the osteoblast lineage, beta-catenin positively regulates osteoblasts. This is a different function for beta-catenin than has previously been reported during development. Activation of beta-catenin by lithium treatment has potential to improve fracture healing, but only when utilized in later phases of repair, after mesenchymal cells have become committed to the osteoblast lineage.
Guo, Jun; Wang, Tingzhong; Li, Xian; Shallow, Heidi; Yang, Tonghua; Li, Wentao; Xu, Jianmin; Fridman, Michael D.; Yang, Xiaolong; Zhang, Shetuan
2012-01-01
The human ether-a-go-go-related gene (hERG) encodes the rapidly activating delayed rectifier potassium channel (IKr) which plays an important role in cardiac repolarization. A reduction or increase in hERG current can cause long or short QT syndrome, respectively, leading to fatal cardiac arrhythmias. The channel density in the plasma membrane is a key determinant of the whole cell current amplitude. To gain insight into the molecular mechanisms for the regulation of hERG density at the plasma membrane, we used whole cell voltage clamp, Western blotting, and immunocytochemical methods to investigate the effects of an integral membrane protein, caveolin-3 (Cav3) on hERG expression levels. Our data demonstrate that Cav3, hERG, and ubiquitin-ligase Nedd4-2 interact with each other and form a complex. Expression of Cav3 thus enhances the hERG-Nedd4-2 interaction, leading to an increased ubiquitination and degradation of mature, plasma-membrane localized hERG channels. Disrupting Nedd4-2 interaction with hERG by mutations eliminates the effects of Cav3 on hERG channels. Knockdown of endogenous Cav3 or Nedd4-2 in cultured neonatal rat ventricular myocytes using siRNA led to an increase in native IKr. Our data demonstrate that hERG expression in the plasma membrane is regulated by Cav3 via Nedd4-2. These findings extend our understanding of the regulation of hERG channels and cardiac electrophysiology. PMID:22879586
Tan, Janice G L; Lee, Yih Yean; Wang, Tianhua; Yap, Miranda G S; Tan, Tin Wee; Ng, Say Kong
2015-05-01
CHO cells are major production hosts for recombinant biologics including the rapidly expanding recombinant monoclonal antibodies (mAbs). Heat shock protein 27 (HSP27) expression was observed to be down-regulated towards the late-exponential and stationary phase of CHO fed-batch bioreactor cultures, whereas HSP27 was found to be highly expressed in human pathological cells and reported to have anti-apoptotic functions. These phenotypes suggest that overexpression of HSP27 is a potential cell line engineering strategy for improving robustness of CHO cells. In this work, HSP27 was stably overexpressed in CHO cells producing recombinant mAb and the effects of HSP27 on cell growth, volumetric production titer and product quality were assessed. Concomitantly, HSP27 anti-apoptosis functions in CHO cells were investigated. Stably transfected clones cultured in fed-batch bioreactors displayed 2.2-fold higher peak viable cell density, delayed loss of culture viability by two days and 2.3-fold increase in mAb titer without affecting the N-glycosylation profile, as compared to clones stably transfected with the vector backbone. Co-immunoprecipitation studies revealed HSP27 interactions with Akt, pro-caspase 3 and Daxx and caspase activity profiling showed delayed increase in caspase 2, 3, 8 and 9 activities. These results suggest that HSP27 modulates apoptosis signaling pathways and delays caspase activities to improve performance of CHO fed-batch bioreactor cultures. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Is research ethics regulation really killing people?
Hunter, David
2015-04-06
It has been argued that research ethics regulation is leading to loss of life by delaying life-saving research. For example, Whitney and Schneider argue that the delays to the ISIS-2 trial cost 6538 lives. This suggests that there are grounds for rejecting research ethics regulation. However, the methods adopted by critics are flawed because: they conflate regulatory delays with those due to genuine normative requirements that would be present even if the regulatory framework was not; and looking at the impact of regulation on a per-project basis is the wrong metric, because it neglects all the unsuccessful research and because delaying specific projects does not reduce the overall research done by researchers. Research ethics regulation does not lead to substantial losses of life, but we have strong obligations to make it as efficient as possible.
Delay in polling systems in heavy traffic
NASA Astrophysics Data System (ADS)
van der Mei, Robert D.
1998-10-01
We study the delay in asymmetric cyclic polling systems with general mixtures of gated and exhaustive service, with generally distributed service times and switch-over times, in heavy traffic. We obtain closed-form expressions for all moments of the delay incurred at each of the queues. The expressions are strikingly simple and can even be expressed as finite products of known factors. The results provide new insights into the heavy-traffic behavior of polling systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Medendorp, Klaas; Groningen, Jan J.M. van; Vreede, Lilian
2009-08-15
Previously, we found that in t(X;1)(p11;q21)-positive renal cell carcinomas the bHLH-LZ transcription factor TFE3 is fused to a novel protein designated PRCC. In addition, we found that the PRCCTFE3 fusion protein, which has retained all known functional domains of TFE3, acts as a more potent transcriptional activator than wild type TFE3. We also found that PRCCTFE3 expression confers in vitro and in vivo transformation onto various cell types, including those of the kidney. Here we show that de novo expression of the PRCCTFE3 fusion protein provokes cell cycle delay. This delay, which is mediated by induction of the cyclin-dependent kinasemore » inhibitor p21{sup W{sup A{sup F{sup 1{sup /{sup C{sup I{sup P{sup 1}}}}}}}}}, affects both the G1/S and the G2/M phases of the cell cycle and prevents the cells from undergoing polyploidization. We also show that the PRCCTFE3 fusion protein binds directly to the p21{sup W{sup A{sup F{sup 1{sup /{sup C{sup I{sup P{sup 1}}}}}}}}} promoter and that the PRCCTFE3-induced up-regulation of p21{sup W{sup A{sup F{sup 1{sup /{sup C{sup I{sup P{sup 1}}}}}}}}} leads to activation of the pRB pathway. Finally, we show that in t(X;1)(p11;q21)-positive renal tumor cells several processes that link PRCCTFE3 expression to p21{sup W{sup A{sup F{sup 1{sup /{sup C{sup I{sup P{sup 1}}}}}}}}}-mediated cell cycle delay are abrogated. Our data suggest a scenario in which, during the course of renal cell carcinoma development, an initial PRCCTFE3-induced cell cycle delay must be numbed, thus permitting continued proliferation and progression towards full-blown malignancy.« less
Ono, Daisuke; Honma, Sato; Nakajima, Yoshihiro; Kuroda, Shigeru; Enoki, Ryosuke; Honma, Ken-ichi
2017-01-01
The temporal order of physiology and behavior in mammals is primarily regulated by the circadian pacemaker located in the hypothalamic suprachiasmatic nucleus (SCN). Taking advantage of bioluminescence reporters, we monitored the circadian rhythms of the expression of clock genes Per1 and Bmal1 in the SCN of freely moving mice and found that the rate of phase shifts induced by a single light pulse was different in the two rhythms. The Per1-luc rhythm was phase-delayed instantaneously by the light presented at the subjective evening in parallel with the activity onset of behavioral rhythm, whereas the Bmal1-ELuc rhythm was phase-delayed gradually, similar to the activity offset. The dissociation was confirmed in cultured SCN slices of mice carrying both Per1-luc and Bmal1-ELuc reporters. The two rhythms in a single SCN slice showed significantly different periods in a long-term (3 wk) culture and were internally desynchronized. Regional specificity in the SCN was not detected for the period of Per1-luc and Bmal1-ELuc rhythms. Furthermore, neither is synchronized with circadian intracellular Ca2+ rhythms monitored by a calcium indicator, GCaMP6s, or with firing rhythms monitored on a multielectrode array dish, although the coupling between the circadian firing and Ca2+ rhythms persisted during culture. These findings indicate that the expressions of two key clock genes, Per1 and Bmal1, in the SCN are regulated in such a way that they may adopt different phases and free-running periods relative to each other and are respectively associated with the expression of activity onset and offset. PMID:28416676
Inactivation of Tgfbr2 in Osterix-Cre expressing Dental Mesenchyme Disrupts Molar Root Formation
Coricor, George; MacDougall, Mary; Serra, Rosa
2013-01-01
It has been difficult to examine the role of TGF-ß in post-natal tooth development due to perinatal lethality in many of the signaling deficient mouse models. To address the role of Tgfbr2 in postnatal tooth development, we generated a mouse in which Tgfbr2 was deleted in odontoblast-and bone-producing mesenchyme. Osx-Cre;Tgfbr2fl/fl mice were generated (Tgfbr2cko) and postnatal tooth development was compared in Tgfbr2cko and control littermates. X-ray and μCT analysis showed that in Tgfbr2cko mice radicular dentin matrix density was reduced in the molars. Molar shape was abnormal and molar eruption was delayed in the mutant mice. Most significantly, defects in root formation, including failure of the root to elongate, were observed by postnatal day 10. Immunostaining for Keratin-14 (K14) was used to delineate Hertwig's epithelial root sheath (HERS). The results showed a delay in elongation and disorganization of the HERS in Tgfbr2cko mice. In addition, the HERS was maintained and the break up into epithelial rests was attenuated suggesting that Tgfbr2 acts on dental mesenchyme to indirectly regulate the formation and maintenance of the HERS. Altered odontoblast organization and reduced Dspp expression indicated that odontoblast differentiation was disrupted in the mutant mice likely contributing to the defect in root formation. Nevertheless, expression of Nfic, a key mesenchymal regulator of root development, was similar in Tgfbr2cko mice and controls. The number of osteoclasts in the bone surrounding the tooth was reduced and osteoblast differentiation was disrupted likely contributing to both root and eruption defects. We conclude that Tgfbr2 in dental mesenchyme and bone is required for tooth development particularly root formation. PMID:23933490
Ye, Zhi; Wang, Na; Xia, Pingping; Wang, E; Liao, Juan; Guo, Qulian
2013-04-01
Parecoxib, a novel COX-2 inhibitor, functions as a neuroprotective agent and rescues neurons from cerebral ischemic reperfusion injury-induced apoptosis. However, the molecular mechanisms underlying parecoxib neuroprotection remain to be elucidated. There is growing evidence that endoplasmic reticulum (ER) stress plays an important role in neuronal death caused by brain ischemia. However, very little is known about the role of parecoxib in mediating pathophysiological reactions to ER stress induced by ischemic reperfusion injury. Therefore, in the present study, we investigated whether delayed administration of parecoxib attenuates brain damage via suppressing ER stress-induced cell death. Adult male Sprague-Dawley rats were administered parecoxib (10 or 30 mg kg(-1), IP) or isotonic saline twice a day starting 24 h after middle cerebral artery occlusion (MCAO) for three consecutive days. The expressions of glucose-regulated protein 78 (GRP78) and oxygen-regulated protein 150 (ORP150) and C/EBP-homologous protein (CHOP) and forkhead box protein O 1 (Foxo1) in cytoplasmic and nuclear fraction were determined by Western blotting. The levels of caspase-12 expression were checked by immunohistochemistry analysis, served as a marker for ER stress-induced apoptosis. Parecoxib significantly suppressed cerebral ischemic injury-induced nuclear translocation of CHOP and Foxo1 and attenuated the immunoreactivity of caspase-12 in ischemic penumbra. Furthermore, the protective effect of delayed administration of parecoxib was accompanied by an increased GRP78 and ORP150 expression. Therefore, our study suggested that elevation of GRP78 and ORP150, and suppression of CHOP and Foxo1 nuclear translocation may contribute to parecoxib-mediated neuroprotection during ER stress responses.
Wu, Tao; Sun, Lu; ZhuGe, Fen; Guo, Xichao; Zhao, Zhining; Tang, Ruiqi; Chen, Qinping; Chen, Lin; Kato, Hisanori; Fu, Zhengwei
2011-12-01
The timing of meals has been suggested to play an important role in circadian regulation and metabolic health. Three meals a day is a well-established human feeding habit, which in today's lifestyle may or may not be followed. The aim of this study was to test whether the absence of breakfast or supper significantly affects the circadian system and physiological function. The authors developed a rat model for their daily three meals study, whereby animals were divided into three groups (three meals, TM; no first meal, NF; no last meal, NL) all fed with the same amount of food every day. Rats in the NF group displayed significantly decreased levels of plasma triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and glucose in the activity phase, accompanied by delayed circadian phases of hepatic peripheral clock and downstream metabolic genes. Rats in the NL group showed lower concentration of plasma TC, HDL-C, and glucose in the rest phase, plus reduced adipose tissue accumulation and body weight gain. Real-time polymerase chain reaction (PCR) analysis indicated an attenuated rhythm in the food-entraining pathway, including down-regulated expression of the clock genes Per2, Bmal1, and Rev-erbα, which may further contribute to the delayed and decreased expression of FAS in lipogenesis in this group. Our findings are consistent with the conclusion that the daily first meal determines the circadian phasing of peripheral clocks, such as in the liver, whereas the daily last meal tightly couples to lipid metabolism and adipose tissue accumulation, which suggests differential physiological effects and function of the respective meal timings.
Effect of cytokinins on delaying petunia flower senescence: a transcriptome study approach.
Trivellini, Alice; Cocetta, Giacomo; Vernieri, Paolo; Mensuali-Sodi, Anna; Ferrante, Antonio
2015-01-01
Flower senescence is a fascinating natural process that represents the final developmental stage in the life of a flower. Plant hormones play an important role in regulating the timing of flower senescence. Ethylene is a trigger and usually accelerates the senescence rate, while cytokinins are known to delay it. The aim of this work was to study the effect of 6-benzylaminopurine (BA) on petal senescence by transcript profile comparison after 3 or 6 h using a cross-species method by hybridizing petunia samples to a 4 × 44 K Agilent tomato array. The relative content of ethylene, abscisic acid, anthocyanins, total carotenoids and total phenols that determine the physiological behaviours of the petal tissue were measured. BA treatment prolonged the flower life and increased the concentrations of phenols and anthocyanins, while total carotenoids did not increase and were lower than the control. The ethylene biosynthetic and perception gene expressions were studied immediately after treatment until 24 h and all genes were repressed, while ethylene production was strongly induced after 4 days. The microarray analyses highlighted that BA strongly affected gene regulation after 3 h, but only 14% of genes remained differentially expressed after 6 h. The most affected pathways and genes were those related to stress, such as heat shock proteins, abscisic acid (ABA) catabolism and its signalling pathway, lipid metabolism and antioxidant defence systems. A gene annotation enrichment analysis using DAVID showed that the most important gene clusters were involved in energy generation and conservation processes. In addition to the ethylene pathway, cytokinins seem to be strongly involved the regulation of the ABA response in flower tissues.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Otani, Satoshi; Kakinuma, Sei, E-mail: skakinuma.gast@tmd.ac.jp; Department for Liver Disease Control, Tokyo Medical and Dental University, Tokyo
Fetal hepatic stem/progenitor cells, called hepatoblasts, play central roles in liver development; however, the molecular mechanisms regulating the phenotype of these cells have not been completely elucidated. Matrix metalloproteinase (MMP)-14 is a type I transmembrane proteinase regulating pericellular proteolysis of the extracellular matrix and is essential for the activation of several MMPs and cytokines. However, the physiological functions of MMP-14 in liver development are unknown. Here we describe a functional role for MMP-14 in hepatic and biliary differentiation of mouse hepatoblasts. MMP-14 was upregulated in cells around the portal vein in perinatal stage liver. Formation of bile duct-like structures inmore » MMP-14–deficient livers was significantly delayed compared with wild-type livers in vivo. In vitro biliary differentiation assays showed that formation of cholangiocytic cysts derived from MMP-14–deficient hepatoblasts was completely impaired, and that overexpression of MMP-14 in hepatoblasts promoted the formation of bile duct-like cysts. In contrast, the expression of molecules associated with metabolic functions in hepatocytes, including hepatic nuclear factor 4α and tryptophan 2,3-dioxygenase, were significantly increased in MMP-14–deficient livers. Expression of the epidermal growth factor receptor and phosphorylation of mitogen-activated protein kinases were significantly upregulated in MMP-14–deficient livers. We demonstrate that MMP-14–mediated signaling in fetal hepatic progenitor cells promotes biliary luminal formation around the portal vein and negatively controls the maturation of hepatocytes. - Highlights: • Loss of MMP-14 delayed formation of bile duct-like structures in perinatal liver. • Overexpression of MMP-14 in hepatobalsts promoted the biliary formation in vitro. • Loss of MMP-14 promoted hepatocyte maturation of hepatoblasts in vivo. • MMP-14–mediated signaling regulates terminal differentiation of hepatoblasts.« less
Jiang, Jianping; Wang, Dongmei; Zhou, Xiaolong; Huo, Yuping; Chen, Tingjun; Hu, Fenjuan; Quirion, Rémi; Hong, Yanguo
2013-11-01
Mas oncogene-related gene (Mrg) receptors are exclusively distributed in small-sized neurons in trigeminal and dorsal root ganglia (DRG). We investigated the effects of MrgC receptor activation on inflammatory hyperalgesia and its mechanisms. A selective MrgC receptor agonist, bovine adrenal medulla peptide 8-22 (BAM8-22) or melanocyte-stimulating hormone (MSH) or the μ-opioid receptor (MOR) antagonist CTAP was administered intrathecally (i.t.) in rats injected with complete Freund's adjuvant (CFA) in one hindpaw. Thermal and mechanical nociceptive responses were assessed. Neurochemicals were measured by immunocytochemistry, Western blot, ELISA and RT-PCR. CFA injection increased mRNA for MrgC receptors in lumbar DRG. BAM8-22 or MSH, given i.t., generated instant short and delayed long-lasting attenuations of CFA-induced thermal hyperalgesia, but not mechanical allodynia. These effects were associated with decreased up-regulation of neuronal NOS (nNOS), CGRP and c-Fos expression in the spinal dorsal horn and/or DRG. However, i.t. administration of CTAP blocked the induction by BAM8-22 of delayed anti-hyperalgesia and inhibition of nNOS and CGRP expression in DRG. BAM8-22 also increased mRNA for MORs and pro-opiomelanocortin, along with β-endorphin content in the lumbar spinal cord and/or DRG. MrgC receptors and nNOS were co-localized in DRG neurons. Activation of MrgC receptors suppressed up-regulation of pronociceptive mediators and consequently inhibited inflammatory pain, because of the activation of up-regulated MrgC receptors and subsequent endogenous activity at MORs. The uniquely distributed MrgC receptors could be a novel target for relieving inflammatory pain. © 2013 The British Pharmacological Society.
Protein PSMD8 may mediate microgravity-induced cell cycle arrest
NASA Astrophysics Data System (ADS)
Hang, Xiaoming; Sun, Yeqing; Xu, Dan; Wu, Di; Chen, Xiaoning
Microgravity environment of space can induce a serial of changes in cells, such as morphology alterations, cytoskeleton disorder and cell cycle disturbance. Our previous study of simulated-microgravity on zebrafish (Danio rerio) embryos demonstrated 26s proteasome non-ATPase regulatory subunit 8 (PSMD8) might be a microgravity sensitive gene. However, functional study on PSMD8 is very limited and it has not been cloned in zebrafish till now. In this study, we tried to clone PSMD8 gene in zebrafish, quantify its protein expression level in zebrafish embryos after simulated microgravity and identify its possible function in cell cycle regulation. A rotary cell culture system (RCCS) designed by national aeronautics and apace administration (NASA) of America was used to simulate microgravity. The full-length of psmd8 gene in zebrafish was cloned. Preliminary analysis on its sequence and phylogenetic tree construction were carried out subsequently. Quantitative analysis by western blot showed that PSMD8 protein expression levels were significantly increased 1.18 and 1.22 times after 24-48hpf and 24-72hpf simulated microgravity, respectively. Moreover, a significant delay on zebrafish embryo development was found in simulated-microgravity exposed group. Inhibition of PSMD8 protein in zebrafish embryonic cell lines ZF4 could block cell cycle in G1 phase, which indicated that PSMD8 may play a role in cell cycle regulation. Interestingly, simulated-microgravity could also block ZF4 cell in G1 phase. Whether it is PSMD8 mediated cell cycle regulation result in the zebrafish embryo development delay after simulated microgravity exposure still needs further study. Key Words: PSMD8; Simulated-microgravity; Cell cycle; ZF4 cell line
Shuai, Haiwei; Meng, Yongjie; Luo, Xiaofeng; Chen, Feng; Zhou, Wenguan; Dai, Yujia; Qi, Ying; Du, Junbo; Yang, Feng; Liu, Jiang; Yang, Wenyu; Shu, Kai
2017-10-03
Auxin is an important phytohormone which mediates diverse development processes in plants. Published research has demonstrated that auxin induces seed dormancy. However, the precise mechanisms underlying the effect of auxin on seed germination need further investigation, especially the relationship between auxins and both abscisic acid (ABA) and gibberellins (GAs), the latter two phytohormones being the key regulators of seed germination. Here we report that exogenous auxin treatment represses soybean seed germination by enhancing ABA biosynthesis, while impairing GA biogenesis, and finally decreasing GA 1 /ABA and GA 4 /ABA ratios. Microscope observation showed that auxin treatment delayed rupture of the soybean seed coat and radicle protrusion. qPCR assay revealed that transcription of the genes involved in ABA biosynthetic pathway was up-regulated by application of auxin, while expression of genes involved in GA biosynthetic pathway was down-regulated. Accordingly, further phytohormone quantification shows that auxin significantly increased ABA content, whereas the active GA 1 and GA 4 levels were decreased, resulting insignificant decreases in the ratiosGA 1 /ABA and GA 4 /ABA.Consistent with this, ABA biosynthesis inhibitor fluridone reversed the delayed-germination phenotype associated with auxin treatment, while paclobutrazol, a GA biosynthesis inhibitor, inhibited soybean seed germination. Altogether, exogenous auxin represses soybean seed germination by mediating ABA and GA biosynthesis.
Prospects for Creation of Cardioprotective Drugs Based on Cannabinoid Receptor Agonists.
Maslov, Leonid N; Khaliulin, Igor; Zhang, Yi; Krylatov, Andrey V; Naryzhnaya, Natalia V; Mechoulam, Raphael; De Petrocellis, Luciano; Downey, James M
2016-05-01
Cannabinoids can mimic the infarct-reducing effect of early ischemic preconditioning, delayed ischemic preconditioning, and ischemic postconditioning against myocardial ischemia/reperfusion. They do this primarily through both CB1 and CB2 receptors. Cannabinoids are also involved in remote preconditioning of the heart. The cannabinoid receptor ligands also exhibit an antiapoptotic effect during ischemia/reperfusion of the heart. The acute cardioprotective effect of cannabinoids is mediated by activation of protein kinase C, extracellular signal-regulated kinase, and p38 kinase. The delayed cardioprotective effect of cannabinoid anandamide is mediated via stimulation of phosphatidylinositol-3-kinase-Akt signaling pathway and enhancement of heat shock protein 72 expression. The delayed cardioprotective effect of another cannabinoid, Δ9-tetrahydrocannabinol, is associated with augmentation of nitric oxide (NO) synthase expression, but data on the involvement of NO synthase in the acute cardioprotective effect of cannabinoids are contradictory. The adenosine triphosphate-sensitive K(+)channel is involved in the synthetic cannabinoid HU-210-induced cardiac resistance to ischemia/reperfusion injury. Cannabinoids inhibit Na(+)/Ca(2+)exchange via peripheral cannabinoid receptor (CB2) activation that may also be related to the antiapoptotic and cardioprotective effects of cannabinoids. The cannabinoid receptor agonists should be considered as prospective group of compounds for creation of drugs that are able to protect the heart against ischemia-reperfusion injury in the clinical setting. © The Author(s) 2015.
Pareja-Santos, Alessandra; Oliveira Souza, Valdênia Maria; Bruni, Fernanda M; Sosa-Rosales, Josefina Ines; Lopes-Ferreira, Mônica; Lima, Carla
2008-07-01
Thalassophryne maculosa fish envenomation is characterized by severe pain, dizziness, fever, edema and necrosis. Here, the dynamic of cellular influx, activation status of phagocytic cells, and inflammatory modulator production in the acute inflammatory response to T. maculosa venom was studied using an experimental model. Leukocyte counting was performed (2 h to 21 days) after venom injection in BALB/c mice footpads. Our results showed an uncommon leukocyte migration kinetic after venom injection, with early mononuclear cell recruitment followed by elevated and delayed neutrophil influx. The pattern of chemokine expression is consistent with the delay in neutrophil recruitment to the footpad: T. maculosa venom stimulated an early production of IL-1beta, IL-6, and MCP-1, but was unable to induce an effective early TNF-alpha and KC release. Complementary to these observations, we detected a marked increase in soluble KC and TNF-alpha in footpad at 7 days post-venom injection when a prominent influx of neutrophils was also detected. In addition, we demonstrated that bone marrow-derived macrophages and dendritic cells were strongly stimulated by the venom, showing up-regulated ability to capture FITC-dextran. Thus, the reduced levels of KC and TNF-alpha in footpad of mice concomitant with a defective accumulation of neutrophils at earlier times provide an important clue to uncovering the mechanism by which T. maculosa venom regulates neutrophil movement.
Wu, Yuantai; Janetopoulos, Chris
2013-01-01
While GABA has been suggested to regulate spore encapsulation in the social amoeba Dictyostelium discoideum, the metabolic profile and other potential functions of GABA during development remain unclear. In this study, we investigated the homeostasis of GABA metabolism by disrupting genes related to GABA metabolism and signaling. Extracellular levels of GABA are tightly regulated during early development, and GABA is generated by the glutamate decarboxylase, GadB, during growth and in early development. However, overexpression of the prespore-specific homologue, GadA, in the presence of GadB reduces production of extracellular GABA. Perturbation of extracellular GABA levels delays the process of aggregation. Cytosolic GABA is degraded by the GABA transaminase, GabT, in the mitochondria. Disruption of a putative vesicular GABA transporter (vGAT) homologue DdvGAT reduces secreted GABA. We identified the GABAB receptor-like family member GrlB as the major GABA receptor during early development, and either disruption or overexpression of GrlB delays aggregation. This delay is likely the result of an abolished pre-starvation response and late expression of several “early” developmental genes. Distinct genes are employed for GABA generation during sporulation. During sporulation, GadA alone is required for generating GABA and DdvGAT is likely responsible for GABA secretion. GrlE but not GrlB is the GABA receptor during late development. PMID:23548898
Salleh, Faezah Mohd; Mariotti, Lorenzo; Spadafora, Natasha D; Price, Anna M; Picciarelli, Piero; Wagstaff, Carol; Lombardi, Lara; Rogers, Hilary
2016-04-02
In many species floral senescence is coordinated by ethylene. Endogenous levels rise, and exogenous application accelerates senescence. Furthermore, floral senescence is often associated with increased reactive oxygen species, and is delayed by exogenously applied cytokinin. However, how these processes are linked remains largely unresolved. Erysimum linifolium (wallflower) provides an excellent model for understanding these interactions due to its easily staged flowers and close taxonomic relationship to Arabidopsis. This has facilitated microarray analysis of gene expression during petal senescence and provided gene markers for following the effects of treatments on different regulatory pathways. In detached Erysimum linifolium (wallflower) flowers ethylene production peaks in open flowers. Furthermore senescence is delayed by treatments with the ethylene signalling inhibitor silver thiosulphate, and accelerated with ethylene released by 2-chloroethylphosphonic acid. Both treatments with exogenous cytokinin, or 6-methyl purine (which is an inhibitor of cytokinin oxidase), delay petal senescence. However, treatment with cytokinin also increases ethylene biosynthesis. Despite the similar effects on senescence, transcript abundance of gene markers is affected differentially by the treatments. A significant rise in transcript abundance of WLS73 (a putative aminocyclopropanecarboxylate oxidase) was abolished by cytokinin or 6-methyl purine treatments. In contrast, WFSAG12 transcript (a senescence marker) continued to accumulate significantly, albeit at a reduced rate. Silver thiosulphate suppressed the increase in transcript abundance both of WFSAG12 and WLS73. Activity of reactive oxygen species scavenging enzymes changed during senescence. Treatments that increased cytokinin levels, or inhibited ethylene action, reduced accumulation of hydrogen peroxide. Furthermore, although auxin levels rose with senescence, treatments that delayed early senescence did not affect transcript abundance of WPS46, an auxin-induced gene. A model for the interaction between cytokinins, ethylene, reactive oxygen species and auxin in the regulation of floral senescence in wallflowers is proposed. The combined increase in ethylene and reduction in cytokinin triggers the initiation of senescence and these two plant growth regulators directly or indirectly result in increased reactive oxygen species levels. A fall in conjugated auxin and/or the total auxin pool eventually triggers abscission.
Composite transcriptome assembly of RNA-seq data in a sheep model for delayed bone healing.
Jäger, Marten; Ott, Claus-Eric; Grünhagen, Johannes; Hecht, Jochen; Schell, Hanna; Mundlos, Stefan; Duda, Georg N; Robinson, Peter N; Lienau, Jasmin
2011-03-24
The sheep is an important model organism for many types of medically relevant research, but molecular genetic experiments in the sheep have been limited by the lack of knowledge about ovine gene sequences. Prior to our study, mRNA sequences for only 1,556 partial or complete ovine genes were publicly available. Therefore, we developed a composite de novo transcriptome assembly method for next-generation sequence data to combine known ovine mRNA and EST sequences, mRNA sequences from mouse and cow, and sequences assembled de novo from short read RNA-Seq data into a composite reference transcriptome, and identified transcripts from over 12 thousand previously undescribed ovine genes. Gene expression analysis based on these data revealed substantially different expression profiles in standard versus delayed bone healing in an ovine tibial osteotomy model. Hundreds of transcripts were differentially expressed between standard and delayed healing and between the time points of the standard and delayed healing groups. We used the sheep sequences to design quantitative RT-PCR assays with which we validated the differential expression of 26 genes that had been identified by RNA-seq analysis. A number of clusters of characteristic expression profiles could be identified, some of which showed striking differences between the standard and delayed healing groups. Gene Ontology (GO) analysis showed that the differentially expressed genes were enriched in terms including extracellular matrix, cartilage development, contractile fiber, and chemokine activity. Our results provide a first atlas of gene expression profiles and differentially expressed genes in standard and delayed bone healing in a large-animal model and provide a number of clues as to the shifts in gene expression that underlie delayed bone healing. In the course of our study, we identified transcripts of 13,987 ovine genes, including 12,431 genes for which no sequence information was previously available. This information will provide a basis for future molecular research involving the sheep as a model organism.
Composite transcriptome assembly of RNA-seq data in a sheep model for delayed bone healing
2011-01-01
Background The sheep is an important model organism for many types of medically relevant research, but molecular genetic experiments in the sheep have been limited by the lack of knowledge about ovine gene sequences. Results Prior to our study, mRNA sequences for only 1,556 partial or complete ovine genes were publicly available. Therefore, we developed a composite de novo transcriptome assembly method for next-generation sequence data to combine known ovine mRNA and EST sequences, mRNA sequences from mouse and cow, and sequences assembled de novo from short read RNA-Seq data into a composite reference transcriptome, and identified transcripts from over 12 thousand previously undescribed ovine genes. Gene expression analysis based on these data revealed substantially different expression profiles in standard versus delayed bone healing in an ovine tibial osteotomy model. Hundreds of transcripts were differentially expressed between standard and delayed healing and between the time points of the standard and delayed healing groups. We used the sheep sequences to design quantitative RT-PCR assays with which we validated the differential expression of 26 genes that had been identified by RNA-seq analysis. A number of clusters of characteristic expression profiles could be identified, some of which showed striking differences between the standard and delayed healing groups. Gene Ontology (GO) analysis showed that the differentially expressed genes were enriched in terms including extracellular matrix, cartilage development, contractile fiber, and chemokine activity. Conclusions Our results provide a first atlas of gene expression profiles and differentially expressed genes in standard and delayed bone healing in a large-animal model and provide a number of clues as to the shifts in gene expression that underlie delayed bone healing. In the course of our study, we identified transcripts of 13,987 ovine genes, including 12,431 genes for which no sequence information was previously available. This information will provide a basis for future molecular research involving the sheep as a model organism. PMID:21435219
Wu, Chongming; Feng, Juanjuan; Wang, Ran; Liu, Hong; Yang, Huixia; Rodriguez, Pedro L; Qin, Huanju; Liu, Xin; Wang, Daowen
2012-01-01
In this work, we conducted functional analysis of Arabidopsis HRS1 gene in order to provide new insights into the mechanisms governing seed germination. Compared with wild type (WT) control, HRS1 knockout mutant (hrs1-1) exhibited significant germination delays on either normal medium or those supplemented with abscisic acid (ABA) or sodium chloride (NaCl), with the magnitude of the delay being substantially larger on the latter media. The hypersensitivity of hrs1-1 germination to ABA and NaCl required ABI3, ABI4 and ABI5, and was aggravated in the double mutant hrs1-1abi1-2 and triple mutant hrs1-1hab1-1abi1-2, indicating that HRS1 acts as a negative regulator of ABA signaling during seed germination. Consistent with this notion, HRS1 expression was found in the embryo axis, and was regulated both temporally and spatially, during seed germination. Further analysis showed that the delay of hrs1-1 germination under normal conditions was associated with reduction in the elongation of the cells located in the lower hypocotyl (LH) and transition zone (TZ) of embryo axis. Interestingly, the germination rate of hrs1-1 was more severely reduced by the inhibitor of cell elongation, and more significantly decreased by the suppressors of plasmalemma H(+)-ATPase activity, than that of WT control. The plasmalemma H(+)-ATPase activity in the germinating seeds of hrs1-1 was substantially lower than that exhibited by WT control, and fusicoccin, an activator of this pump, corrected the transient germination delay of hrs1-1. Together, our data suggest that HRS1 may be needed for suppressing ABA signaling in germinating embryo axis, which promotes the timely germination of Arabidopsis seeds probably by facilitating the proper function of plasmalemma H(+)-ATPase and the efficient elongation of LH and TZ cells.
Wang, Ran; Liu, Hong; Yang, Huixia; Rodriguez, Pedro L.; Qin, Huanju; Liu, Xin; Wang, Daowen
2012-01-01
In this work, we conducted functional analysis of Arabidopsis HRS1 gene in order to provide new insights into the mechanisms governing seed germination. Compared with wild type (WT) control, HRS1 knockout mutant (hrs1-1) exhibited significant germination delays on either normal medium or those supplemented with abscisic acid (ABA) or sodium chloride (NaCl), with the magnitude of the delay being substantially larger on the latter media. The hypersensitivity of hrs1-1 germination to ABA and NaCl required ABI3, ABI4 and ABI5, and was aggravated in the double mutant hrs1-1abi1-2 and triple mutant hrs1-1hab1-1abi1-2, indicating that HRS1 acts as a negative regulator of ABA signaling during seed germination. Consistent with this notion, HRS1 expression was found in the embryo axis, and was regulated both temporally and spatially, during seed germination. Further analysis showed that the delay of hrs1-1 germination under normal conditions was associated with reduction in the elongation of the cells located in the lower hypocotyl (LH) and transition zone (TZ) of embryo axis. Interestingly, the germination rate of hrs1-1 was more severely reduced by the inhibitor of cell elongation, and more significantly decreased by the suppressors of plasmalemma H+-ATPase activity, than that of WT control. The plasmalemma H+-ATPase activity in the germinating seeds of hrs1-1 was substantially lower than that exhibited by WT control, and fusicoccin, an activator of this pump, corrected the transient germination delay of hrs1-1. Together, our data suggest that HRS1 may be needed for suppressing ABA signaling in germinating embryo axis, which promotes the timely germination of Arabidopsis seeds probably by facilitating the proper function of plasmalemma H+-ATPase and the efficient elongation of LH and TZ cells. PMID:22545134
Attari, Seyedeh Maryam; Ozgoli, Giti; Solhi, Mahnaz; Alavi Majd, Hamid
2016-01-01
One of the major causes of morbidity and mortality in breast cancer patients is delay in seeking help. Leventhal's self-regulation model provides an appropriate framework to assess delay in seeking help. The aim of this study was to investigate the relationship between "illness perception" and "help seeking delay" in breast cancer patients based on Leventhal's self-regulation model. In this correlational descriptive study with convenience sampling conducted in 2013, participants were 120 women with breast cancer who were diagnosed in the last year and referred to chemotherapy and radiotherapy centers in Rasht, Iran. Data collection scales included demographic data, Revised Illness Perception Questionnaire (IPQ-R)and a researcher made questionnaire to measure the delay in seeking help. Pre-hospital delay (help seeking delay) was evaluated in 3 phases (assessment, disease, behavior). The data were analyzed using SPSS-19. The mean (SD) age calculated for the patients was 47.3±10.2. Some 43% of the patients had a high school or higher education level and 82% were married. The "pre-hospital delay" was reported ≥3 months. Logistic regression analysis showed that none of the illness perception components were correlated with appraisal and behavioral delay phases. In the illness delay phase, "time line" (p-value =0.04) and "risk factors"(p-value=0.03) had significant effects on reducing and "psychological attributions" had significant effects on increasing the delay (p-value =0.01). "Illness coherence" was correlated with decreased pre-hospital patient delay (p-value<0.01). Women's perceptions of breast cancer influences delay in seeking help. In addition to verifying the validity of Leventhal's self-regulation model in explaining delay in seeking help, the results signify the importance of the "illness delay phase" (decision to seek help) and educational interventions-counseling for women in the community.
Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shi Xiongjie; Graduate School of the Chinese Academy of Sciences, Beijing 100039; Du Yongbing
2008-07-01
Perfluorooctanesulfonate (PFOS) is a persistent organic pollutant, the potential toxicity of which is causing great concern. In the present study, we employed zebrafish embryos to investigate the developmental toxicity of this compound. Four-hour post-fertilization (hpf) zebrafish embryos were exposed to 0.1, 0.5, 1, 3 and 5 mg/L PFOS. Hatching was delayed and hatching rates as well as larval survivorship were significantly reduced after the embryos were exposed to 1, 3 and 5 mg/L PFOS until 132 hpf. The fry displayed gross developmental malformations, including epiboly deformities, hypopigmentation, yolk sac edema, tail and heart malformations and spinal curvature upon exposure tomore » PFOS concentrations of 1 mg/L or greater. Growth (body length) was significantly reduced in the 3 and 5 mg/L PFOS-treated groups. To test whether developmental malformation was mediated via apoptosis, flow cytometry analysis of DNA content, acridine orange staining and TUNEL assay was used. These techniques indicated that more apoptotic cells were present in the PFOS-treated embryos than in the control embryos. Certain genes related to cell apoptosis, p53 and Bax, were both significantly up-regulated upon exposure to all the concentrations tested. In addition, we investigated the effects of PFOS on marker genes related to early thyroid development (hhex and pax8) and genes regulating the balance of androgens and estrogens (cyp19a and cyp19b). For thyroid development, the expression of hhex was significantly up-regulated at all concentrations tested, whereas pax8 expression was significantly up-regulated only upon exposure to lower concentrations of PFOS (0.1, 0.5, 1 mg/L). The expression of cyp19a and of cyp19b was significantly down-regulated at all exposure concentrations. The overall results indicated that zebrafish embryos constitute a reliable model for testing the developmental toxicity of PFOS, and the gene expression patterns in the embryos were able to reveal some potential mechanisms of developmental toxicity.« less
Isoe, Jun; Scaraffia, Patricia Y.
2013-01-01
Aedes aegypti mosquitoes do not have a typical functional urea cycle for ammonia disposal such as the one present in most terrestrial vertebrates. However, they can synthesize urea by two different pathways, argininolysis and uricolysis. We investigated how formation of urea by these two pathways is regulated in females of A. aegypti. The expression of arginase (AR) and urate oxidase (UO), either separately or simultaneously (ARUO) was silenced by RNAi. The amounts of several nitrogen compounds were quantified in excreta using mass spectrometry. Injection of mosquitoes with either dsRNA-AR or dsRNA-UO significantly decreased the expressions of AR or UO in the fat body (FB) and Malpighian tubules (MT). Surprisingly, the expression level of AR was increased when UO was silenced and vice versa, suggesting a cross-talk regulation between pathways. In agreement with these data, the amount of urea measured 48 h after blood feeding remained unchanged in those mosquitoes injected with dsRNA-AR or dsRNA-UO. However, allantoin significantly increased in the excreta of dsRNA-AR-injected females. The knockdown of ARUO mainly led to a decrease in urea and allantoin excretion, and an increase in arginine excretion. In addition, dsRNA-AR-injected mosquitoes treated with a specific nitric oxide synthase inhibitor showed an increase of UO expression in FB and MT and a significant increase in the excretion of nitrogen compounds. Interestingly, both a temporary delay in the digestion of a blood meal and a significant reduction in the expression of several genes involved in ammonia metabolism were observed in dsRNA-AR, UO or ARUO-injected females. These results reveal that urea synthesis and excretion in A. aegypti are tightly regulated by a unique cross-talk signaling mechanism. This process allows blood-fed mosquitoes to regulate the synthesis and/or excretion of nitrogen waste products, and avoid toxic effects that could result from a lethal concentration of ammonia in their tissues. PMID:23755226
Barbosa, Cindy; Xiao, Yucheng; Johnson, Andrew J.; Xie, Wenrui; Strong, Judith A.; Zhang, Jun-Ming; Cummins, Theodore R.
2017-01-01
Nav1.6 and Nav1.6 mediated resurgent currents have been implicated in several pain pathologies. However, our knowledge of how fast resurgent currents are modulated in neurons is limited. Our study explored the potential regulation of Nav1.6 mediated resurgent currents by isoforms of Fibroblast growth Factor Homologous factor 2 (FHF2) in an effort to address the gap in our knowledge. FHF2 isoforms colocalize with Nav1.6 in peripheral sensory neurons. Cell line studies suggest that these proteins differentially regulate inactivation. In particular, FHF2A mediates long-term inactivation, a mechanism proposed to compete with the open-channel blocker mechanism that mediates resurgent currents. On the other hand, FHF2B lacks the ability to mediate long-term inactivation and may delay inactivation favoring open-channel block. Based on these observations, we hypothesized that FHF2A limits resurgent currents, whereas, FHF2B enhances resurgent currents. Overall our results suggest that FHF2A negatively regulates fast resurgent current by enhancing long-term inactivation and delaying recovery. In contrast FHF2B positively regulated resurgent current and did not alter long-term inactivation. Chimeric constructs of FHF2A and Navβ4 (likely the endogenous open channel blocker in sensory neurons) exhibited differential effects on resurgent currents suggesting that specific regions within FHF2A and Navβ4 have important regulatory functions. Our data also indicate FHFAs and FHF2B isoform expression are differentially regulated in a radicular pain model and that associated neuronal hyperexcitability is substantially attenuated by a FHFA peptide. As such, these findings suggest that FHF2A and FHF2B regulate resurgent current in sensory neurons and may contribute to hyperexcitability associated with some pain pathologies. PMID:27999940
Comparing Active Delay and Procrastination from a Self-Regulated Learning Perspective
ERIC Educational Resources Information Center
Corkin, Danya M.; Yu, Shirley L.; Lindt, Suzanne F.
2011-01-01
Researchers have proposed that the act of postponing academic work may be divided into a traditional definition of procrastination, viewed as maladaptive, and adaptive forms of delay. Adaptive forms of delay may be more consistent with certain facets of self-regulated learning. The current study investigated this issue by examining whether the…
Ruan, Banpu; Kang, Shujing; He, Lei; Zhang, Sen; Dong, Guojun; Hu, Jiang; Zeng, Dali; Zhang, Guangheng; Gao, Zhenyu; Ren, Deyong; Hu, Xingming; Chen, Guang; Guo, Longbiao; Qian, Qian; Zhu, Li
2015-01-01
Ferredoxin (Fd) protein as unique electron acceptor, involved in a variety of fundamental metabolic and signaling processes, which is indispensable for plant growth. The molecular mechanisms of Fd such as regulation of electron partitioning, impact of photosynthetic rate and involvement in the carbon fixing remain elusive in rice. Here we reported a heading date delay and yellowish leaf 1 (hdy1) mutant derived from Japonica rice cultivar “Nipponbare” subjected to EMS treatment. In the paddy field, the hdy1 mutant appeared at a significantly late heading date and had yellow-green leaves during the whole growth stage. Further investigation indicated that the abnormal phenotype of hdy1 was connected with depressed pigment content and photosynthetic rate. Genetic analysis results showed that the hdy1 mutant phenotype was caused by a single recessive nuclear gene mutation. Map-based cloning revealed that OsHDY1 is located on chromosome 3 and encodes an ortholog of the AtFdC2 gene. Complementation and overexpression, transgenic plants exhibited the mutant phenotype including head date, leaf color and the transcription levels of the FdC2 were completely rescued by transformation with OsHDY1. Real-time PCR revealed that the expression product of OsHDY1 was detected in almost all of the organs except root, whereas highest expression levels were observed in seeding new leaves. The lower expression levels of HDY1 and content of iron were detected in hdy1 than WT’s. The FdC2::GFP was detected in the chloroplasts of rice. Real-time PCR results showed that the expression of many photosynthetic electron transfer related genes in hdy1 were higher than WT. Our results suggest that OsFdC2 plays an important role in photosynthetic rate and development of heading date by regulating electron transfer and chlorophyll content in rice. PMID:26598971
Chen, Yi-Hao; Chen, Ching-Long; Lu, Da-Wen; Liang, Chang-Min; Tai, Ming-Cheng; Chen, Jiann-Torng
2016-01-01
The objective of this study was to evaluate the effects of silibinin on cell proliferation in platelet-derived growth factor (PDGF)-treated human Tenon's fibroblasts (HTFs). The effect of silibinin on cell proliferation in PDGF-treated HTFs was determined by examining the expression of proliferating cell nuclear antigen (PCNA) and performing WST-1 assays. Cell cycle progression was evaluated using flow cytometry. The related cyclins and cyclin-dependent kinases (CDKs) were also analyzed using western blot. A modified rat trabeculectomy model was established to evaluate the effect of silibinin on cell proliferation in vivo. Western blot analysis was carried out to determine the effect of silibinin on the expression of PDGF receptor and on the downstream signaling pathways regulated by PDGF receptor. PDGF elevated the expression of PCNA in HTFs, and this elevation was inhibited by silibinin. The inhibitory effect of silibinin on cell proliferation was also confirmed via WST-1 assay. PDGF-stimulated cell cycle in HTFs was delayed by silibinin, and the related cyclin D1 and CDK4 were also suppressed by silibinin. In the rat model of trabeculectomy, silibinin reduced the expression of PCNA at the site of blebs in vivo. The effects of silibinin on PDGF-stimulated HTFs were mediated via the downregulation of PDGF receptor-regulated signaling pathways, such as ERKs and STATs, which may be partially caused by the downregulation of N-glycosylation of PDGF receptor beta (PDGFRβ). The effect of silibinin on modulation of N-glycosylation of PDGFRβ was mediated in a proteasome-dependent manner. Silibinin inhibited cell proliferation and delayed cell cycle progression in PDGF-treated HTFs in vitro. PDGF also modulated the process of N-glycosylation of the PDGFRβ in a proteasome-dependent manner. Our findings suggest that silibinin has potential therapeutic applications in glaucoma filtering surgery.
Chen, Yi-Hao; Chen, Ching-Long; Lu, Da-Wen; Liang, Chang-Min; Tai, Ming-Cheng; Chen, Jiann-Torng
2016-01-01
The objective of this study was to evaluate the effects of silibinin on cell proliferation in platelet-derived growth factor (PDGF)-treated human Tenon's fibroblasts (HTFs). The effect of silibinin on cell proliferation in PDGF-treated HTFs was determined by examining the expression of proliferating cell nuclear antigen (PCNA) and performing WST-1 assays. Cell cycle progression was evaluated using flow cytometry. The related cyclins and cyclin-dependent kinases (CDKs) were also analyzed using western blot. A modified rat trabeculectomy model was established to evaluate the effect of silibinin on cell proliferation in vivo. Western blot analysis was carried out to determine the effect of silibinin on the expression of PDGF receptor and on the downstream signaling pathways regulated by PDGF receptor. PDGF elevated the expression of PCNA in HTFs, and this elevation was inhibited by silibinin. The inhibitory effect of silibinin on cell proliferation was also confirmed via WST-1 assay. PDGF-stimulated cell cycle in HTFs was delayed by silibinin, and the related cyclin D1 and CDK4 were also suppressed by silibinin. In the rat model of trabeculectomy, silibinin reduced the expression of PCNA at the site of blebs in vivo. The effects of silibinin on PDGF-stimulated HTFs were mediated via the downregulation of PDGF receptor-regulated signaling pathways, such as ERKs and STATs, which may be partially caused by the downregulation of N-glycosylation of PDGF receptor beta (PDGFRβ). The effect of silibinin on modulation of N-glycosylation of PDGFRβ was mediated in a proteasome-dependent manner. Silibinin inhibited cell proliferation and delayed cell cycle progression in PDGF-treated HTFs in vitro. PDGF also modulated the process of N-glycosylation of the PDGFRβ in a proteasome-dependent manner. Our findings suggest that silibinin has potential therapeutic applications in glaucoma filtering surgery. PMID:28030611
Li, Shou; Gao, Jiong; Yao, Lingya; Ren, Guodong; Zhu, Xiaoyu; Gao, Shan; Qiu, Kai; Zhou, Xin; Kuai, Benke
2016-08-01
ANAC072 positively regulates both age- and dark-induced leaf senescence through activating the transcription of NYE1. Leaf senescence is integral to plant development, which is age-dependent and strictly regulated by internal and environmental signals. Although a number of senescence-related mutants and senescence-associated genes (SAGs) have been identified and characterized in the past decades, the general regulatory network of leaf senescence is still far from being elucidated. Here, we report the role of ANAC072, an SAG identified through bioinformatics analysis, in the regulation of chlorophyll degradation during natural and dark-induced leaf senescence. The expression of ANAC072 was increased with advancing leaf senescence in Arabidopsis. Leaf degreening was significantly delayed under normal or dark-induced conditions in anac072-1, a knockout mutant of ANAC072, with a higher chlorophyll level detected. In contrast, an overexpression mutant, anac072-2, with ANAC072 transcription markedly upregulated, showed an early leaf-yellowing phenotype. Consistently, senescent leaves of the loss-of-function mutant anac072-1 exhibited delays in the decrease of photosynthesis efficiency of photosystem II (F v/F m ratio) and the increase of plasma membrane ion leakage rate as compared with corresponding leaves of wild-type Col-0 plants, whereas the overexpression mutant anac072-2 showed opposite changes. Our data suggest that ANAC072 plays a positive role during natural and dark-induced leaf senescence. In addition, the transcript level of NYE1, a key regulatory gene in chlorophyll degradation, relied on the function of ANAC072. Combining these analyses with electrophoretic mobility shift assay and chromatin immunoprecipitation, we demonstrated that ANAC072 directly bound to the NYE1 promoter in vitro and in vivo, so ANAC072 may promote chlorophyll degradation by directly upregulating the expression of NYE1.
Constructing Hopf bifurcation lines for the stability of nonlinear systems with two time delays
NASA Astrophysics Data System (ADS)
Nguimdo, Romain Modeste
2018-03-01
Although the plethora real-life systems modeled by nonlinear systems with two independent time delays, the algebraic expressions for determining the stability of their fixed points remain the Achilles' heel. Typically, the approach for studying the stability of delay systems consists in finding the bifurcation lines separating the stable and unstable parameter regions. This work deals with the parametric construction of algebraic expressions and their use for the determination of the stability boundaries of fixed points in nonlinear systems with two independent time delays. In particular, we concentrate on the cases for which the stability of the fixed points can be ascertained from a characteristic equation corresponding to that of scalar two-delay differential equations, one-component dual-delay feedback, or nonscalar differential equations with two delays for which the characteristic equation for the stability analysis can be reduced to that of a scalar case. Then, we apply our obtained algebraic expressions to identify either the parameter regions of stable microwaves generated by dual-delay optoelectronic oscillators or the regions of amplitude death in identical coupled oscillators.
HIF-1α coordinates lymphangiogenesis during wound healing and in response to inflammation
Zampell, Jamie C.; Yan, Alan; Avraham, Tomer; Daluvoy, Sanjay; Weitman, Evan S.; Mehrara, Babak J.
2012-01-01
This study aimed to investigate the mechanisms that coordinate lymphangiogenesis. Using mouse models of lymphatic regeneration and inflammatory lymphangiogenesis, we explored the hypothesis that hypoxia inducible factor-α (HIF-1α) is a central regulator of lymphangiogenesis. We show that HIF-1α inhibition by small molecule inhibitors (YC-1 and 2-methyoxyestradiol) results in delayed lymphatic repair, decreased local vascular endothelial growth factor-C (VEGF-C) expression, reduced numbers of VEGF-C+ cells, and reductions in inflammatory lymphangiogenesis. Using transgenic HIF-1α/luciferase mice to image HIF-1α expression in real time in addition to Western blot analysis and pimonidazole staining for cellular hypoxia, we demonstrate that hypoxia stabilizes HIF-1α during initial stages of wound repair (1–2 wk); whereas inflammation secondary to gradients of lymphatic fluid stasis stabilizes HIF-1α thereafter (3–6 wk). In addition, we show that CD4+ cell-mediated inflammation is necessary for this response and regulates HIF-1α expression by macrophages, as CD4-deficient or CD4-depleted mice demonstrate 2-fold reductions in HIF-1α expression as compared to wild-types. In summary, we show that HIF-1α is a critical coordinator of lymphangiogenesis by regulating the expression of lymphangiogenic cytokines as part of an early response mechanism to hypoxia, inflammation, and lymphatic fluid stasis.—Zampell, J. C., Yan, A., Avraham, T., Daluvoy, S., Weitman, E. S., Mehrara, B. J. HIF-1α coordinates lymphangiogenesis during wound healing and in response to inflammation. PMID:22067482
Bancroft, Tara; Bouaouina, Mohamed; Roberts, Sophia; Lee, Monica; Calderwood, David A.; Schwartz, Martin; Simons, Michael; Sessa, William C.; Kyriakides, Themis R.
2015-01-01
Vascular remodeling is essential for tissue repair and is regulated by multiple factors, including thrombospondin-2 (TSP2) and hypoxia/VEGF-induced activation of Akt. In contrast to TSP2 knock-out (KO) mice, Akt1 KO mice have elevated TSP2 expression and delayed tissue repair. To investigate the contribution of increased TSP2 to Akt1 KO mice phenotypes, we generated Akt1/TSP2 double KO (DKO) mice. Full-thickness excisional wounds in DKO mice healed at an accelerated rate when compared with Akt1 KO mice. Isolated dermal Akt1 KO fibroblasts expressed increased TSP2 and displayed altered morphology and defects in migration and adhesion. These defects were rescued in DKO fibroblasts or after TSP2 knockdown. Conversely, the addition of exogenous TSP2 to WT cells induced cell morphology and migration rates that were similar to those of Akt1 KO cells. Akt1 KO fibroblasts displayed reduced adhesion to fibronectin with manganese stimulation when compared with WT and DKO cells, revealing an Akt1-dependent role for TSP2 in regulating integrin-mediated adhesions; however, this effect was not due to changes in β1 integrin surface expression or activation. Consistent with these results, Akt1 KO fibroblasts displayed reduced Rac1 activation that was dependent upon expression of TSP2 and could be rescued by a constitutively active Rac mutant. Our observations show that repression of TSP2 expression is a critical aspect of Akt1 function in tissue repair. PMID:25389299
TSH Receptor Function Is Required for Normal Thyroid Differentiation in Zebrafish
Opitz, Robert; Maquet, Emilie; Zoenen, Maxime; Dadhich, Rajesh
2011-01-01
TSH is the primary physiological regulator of thyroid gland function. The effects of TSH on thyroid cells are mediated via activation of its membrane receptor [TSH receptor (TSHR)]. In this study, we examined functional thyroid differentiation in zebrafish and characterized the role of TSHR signaling during thyroid organogenesis. Cloning of a cDNA encoding zebrafish Tshr showed conservation of primary structure and functional properties between zebrafish and mammalian TSHR. In situ hybridization confirmed that the thyroid is the major site of tshr expression during zebrafish development. In addition, we identified tpo, iyd, duox, and duoxa as novel thyroid differentiation markers in zebrafish. Temporal analyses of differentiation marker expression demonstrated the induction of an early thyroid differentiation program along with thyroid budding, followed by a delayed onset of duox and duoxa expression coincident with thyroid hormone synthesis. Furthermore, comparative analyses in mouse and zebrafish revealed for the first time a thyroid-enriched expression of cell death regulators of the B-cell lymphoma 2 family during early thyroid morphogenesis. Knockdown of tshr function by morpholino microinjection into embryos did not affect early thyroid morphogenesis but caused defects in later functional differentiation. The thyroid phenotype observed in tshr morphants at later stages comprised a reduction in number and size of functional follicles, down-regulation of differentiation markers, as well as reduced thyroid transcription factor expression. A comparison of our results with phenotypes observed in mouse models of defective TSHR and cAMP signaling highlights the value of zebrafish as a model to enhance the understanding of functional differentiation in the vertebrate thyroid. PMID:21737742
The Influence of Anger Expression on Wound Healing
Gouin, Jean-Philippe; Kiecolt-Glaser, Janice K.; Malarkey, William B.; Glaser, Ronald
2008-01-01
Certain patterns of anger expression have been associated with maladaptive alterations in cortisol secretion, immune functioning, and surgical recovery. We hypothesized that outward and inward anger expression and lack of anger control would be associated with delayed wound healing. A sample of 98 community-dwelling participants received standardized blister wounds on their non-dominant forearm. After blistering, the wounds were monitored daily for eight days to assess speed of repair. Logistic regression was used to distinguish fast and slow healers based on their anger expression pattern. Individuals exhibiting lower levels of anger control were more likely to be categorized as slow healers. The anger control variable predicted wound repair over and above differences in hostility, negative affectivity, social support, and health behaviors. Furthermore, participants with lower levels of anger control exhibited higher cortisol reactivity during the blistering procedure. This enhanced cortisol secretion was in turn related to longer time to heal. These findings suggest that the ability to regulate the expression of one’s anger has a clinically relevant impact on wound healing. PMID:18078737
Zaytseva, Olga; Tenis, Nora; Mitchell, Naomi; Kanno, Shin-ichiro; Yasui, Akira; Heierhorst, Jörg; Quinn, Leonie M
2014-01-01
The essential zinc finger protein ASCIZ (also known as ATMIN, ZNF822) plays critical roles during lung organogenesis and B cell development in mice, where it regulates the expression of dynein light chain (DYNLL1/LC8), but its functions in other species including invertebrates are largely unknown. Here we report the identification of the Drosophila ortholog of ASCIZ (dASCIZ) and show that loss of dASCIZ function leads to pronounced mitotic delays with centrosome and spindle positioning defects during development, reminiscent of impaired dynein motor functions. Interestingly, similar mitotic and developmental defects were observed upon knockdown of the DYNLL/LC8-type dynein light chain Cutup (Ctp), and dASCIZ loss-of-function phenotypes could be suppressed by ectopic Ctp expression. Consistent with a genetic function of dASCIZ upstream of Ctp, we show that loss of dASCIZ led to reduced endogenous Ctp mRNA and protein levels and dramatically reduced Ctp–LacZ reporter gene activity in vivo, indicating that dASCIZ regulates development and mitosis as a Ctp transcription factor. We speculate that the more severe mitotic defects in the absence of ASCIZ in flies compared to mice may be due to redundancy with a second, ASCIZ-independent, Dynll2 gene in mammals in contrast to a single Ctp gene in Drosophila. Altogether, our data demonstrate that ASCIZ is an evolutionary highly conserved transcriptional regulator of dynein light-chain levels and a novel regulator of mitosis in flies. PMID:24336747
Wang, Xu De; Sun, Yuan Yuan; Zhao, Chen; Qu, Fan Zhi; Zhao, Yu Qing
2017-03-05
(20R)-Dammarane-3β, 12β, 20, 25-tetrol (25-OH-PPD) is a ginsenoside isolated from Panax ginseng (C. A. Meyer). This compound exhibits anti-cancer activities on many human cancer cell lines. In this study, we investigated anti-cancer mechanisms of 12β-O-( L -Chloracetyl)-dammar-20(22)-ene-3β,25-diol(12-Chloracetyl-PPD), a modified 25-OH-PPD. We found that compound 12-Chloracetyl-PPD resulted in a concentration-dependent inhibition of viability in prostate, breast, and gastric cancer cells, without affecting the viability of normal cell (human gastric epithelial cell line-GES-1, hair follicle dermal papilla cell line-HHDPC and rat myocardial cell line-H9C2). In MDA-MB-435 and C4-2B cancer cells, 12-Chloracetyl-PPD induced G2/M cell cycle arrest, down-regulated mouse double minute 2 (MDM2) expression, up-regulated p53 expression, triggered apoptosis, and stimulated reactive oxygen species production. Apoptosis can be attenuated by the reactive oxygen species scavenger N-acetylcysteine. Our results suggested that compound 12-Chloracetyl-PPD showed obvious anti-cancer activity based on delaying cell cycle arrest and inducing cell apoptosis by reactive oxygen species production, which supported development of 12-Chloracetyl-PPD as a potential agent for cancer chemotherapy. Copyright © 2017 Elsevier B.V. All rights reserved.
Jang, Sung-Soo; Royston, Sara E.; Lee, Gunhee; Wang, Shuwei; Chung, Hee Jung
2016-01-01
Alzheimer's disease (AD) is a neurodegenerative disorder characterized by progressive cognitive decline. Pathologic accumulation of soluble amyloid-β (Aβ) oligomers impairs synaptic plasticity and causes epileptic seizures, both of which contribute to cognitive dysfunction in AD. However, whether seizures could regulate Aβ-induced synaptic weakening remains unclear. Here we show that a single episode of electroconvulsive seizures (ECS) increased protein expression of membrane-associated STriatal-Enriched protein tyrosine Phosphatase (STEP61) and decreased tyrosine-phosphorylation of its substrates N-methyl D-aspartate receptor (NMDAR) subunit GluN2B and extracellular signal regulated kinase 1/2 (ERK1/2) in the rat hippocampus at 2 days following a single ECS. Interestingly, a significant decrease in ERK1/2 expression and an increase in APP and Aβ levels were observed at 3-4 days following a single ECS when STEP61 level returned to the baseline. Given that pathologic levels of Aβ increase STEP61 activity and STEP61-mediated dephosphorylation of GluN2B and ERK1/2 leads to NMDAR internalization and ERK1/2 inactivation, we propose that upregulation of STEP61 and downregulation of GluN2B and ERK1/2 phosphorylation mediate compensatory weakening of synaptic strength in response to acute enhancement of hippocampal network activity, whereas delayed decrease in ERK1/2 expression and increase in APP and Aβ expression may contribute to the maintenance of this synaptic weakening. PMID:27127657
BCL-W has a fundamental role in B cell survival and lymphomagenesis.
Adams, Clare M; Kim, Annette S; Mitra, Ramkrishna; Choi, John K; Gong, Jerald Z; Eischen, Christine M
2017-02-01
Compromised apoptotic signaling is a prerequisite for tumorigenesis. The design of effective therapies for cancer treatment depends on a comprehensive understanding of the mechanisms that govern cell survival. The antiapoptotic proteins of the BCL-2 family are key regulators of cell survival and are frequently overexpressed in malignancies, leading to increased cancer cell survival. Unlike BCL-2 and BCL-XL, the closest antiapoptotic relative BCL-W is required for spermatogenesis, but was considered dispensable for all other cell types. Here, however, we have exposed a critical role for BCL-W in B cell survival and lymphomagenesis. Loss of Bcl-w conferred sensitivity to growth factor deprivation-induced B cell apoptosis. Moreover, Bcl-w loss profoundly delayed MYC-mediated B cell lymphoma development due to increased MYC-induced B cell apoptosis. We also determined that MYC regulates BCL-W expression through its transcriptional regulation of specific miR. BCL-W expression was highly selected for in patient samples of Burkitt lymphoma (BL), with 88.5% expressing BCL-W. BCL-W knockdown in BL cell lines induced apoptosis, and its overexpression conferred resistance to BCL-2 family-targeting BH3 mimetics. Additionally, BCL-W was overexpressed in diffuse large B cell lymphoma and correlated with decreased patient survival. Collectively, our results reveal that BCL-W profoundly contributes to B cell lymphoma, and its expression could serve as a biomarker for diagnosis and aid in the development of better targeted therapies.
BCL-W has a fundamental role in B cell survival and lymphomagenesis
Adams, Clare M.; Kim, Annette S.; Mitra, Ramkrishna; Choi, John K.; Gong, Jerald Z.; Eischen, Christine M.
2017-01-01
Compromised apoptotic signaling is a prerequisite for tumorigenesis. The design of effective therapies for cancer treatment depends on a comprehensive understanding of the mechanisms that govern cell survival. The antiapoptotic proteins of the BCL-2 family are key regulators of cell survival and are frequently overexpressed in malignancies, leading to increased cancer cell survival. Unlike BCL-2 and BCL-XL, the closest antiapoptotic relative BCL-W is required for spermatogenesis, but was considered dispensable for all other cell types. Here, however, we have exposed a critical role for BCL-W in B cell survival and lymphomagenesis. Loss of Bcl-w conferred sensitivity to growth factor deprivation–induced B cell apoptosis. Moreover, Bcl-w loss profoundly delayed MYC-mediated B cell lymphoma development due to increased MYC-induced B cell apoptosis. We also determined that MYC regulates BCL-W expression through its transcriptional regulation of specific miR. BCL-W expression was highly selected for in patient samples of Burkitt lymphoma (BL), with 88.5% expressing BCL-W. BCL-W knockdown in BL cell lines induced apoptosis, and its overexpression conferred resistance to BCL-2 family–targeting BH3 mimetics. Additionally, BCL-W was overexpressed in diffuse large B cell lymphoma and correlated with decreased patient survival. Collectively, our results reveal that BCL-W profoundly contributes to B cell lymphoma, and its expression could serve as a biomarker for diagnosis and aid in the development of better targeted therapies. PMID:28094768
Stanko, Vera; Giuliani, Concetta; Retzer, Katarzyna; Djamei, Armin; Wahl, Vanessa; Wurzinger, Bernhard; Wilson, Cathal; Heberle-Bors, Erwin; Teige, Markus; Kragler, Friedrich
2014-01-01
Mitogen-activated protein kinase (MAPK) cascades are universal signal transduction modules present in all eukaryotes. In plants, MAPK cascades were shown to regulate cell division, developmental processes, stress responses, and hormone pathways. The subgroup A of Arabidopsis MAPKs consists of AtMPK3, AtMPK6, and AtMPK10. AtMPK3 and AtMPK6 are activated by their upstream MAP kinase kinases (MKKs) AtMKK4 and AtMKK5 in response to biotic and abiotic stress. In addition, they were identified as key regulators of stomatal development and patterning. AtMPK10 has long been considered as a pseudo-gene, derived from a gene duplication of AtMPK6. Here we show that AtMPK10 is expressed highly but very transiently in seedlings and at sites of local auxin maxima leaves. MPK10 encodes a functional kinase and interacts with the upstream MAP kinase kinase (MAPKK) AtMKK2. mpk10 mutants are delayed in flowering in long-day conditions and in continuous light. Moreover, cotyledons of mpk10 and mkk2 mutants have reduced vein complexity, which can be reversed by inhibiting polar auxin transport (PAT). Auxin does not affect AtMPK10 expression while treatment with the PAT inhibitor HFCA extends the expression in leaves and reverses the mpk10 mutant phenotype. These results suggest that the AtMKK2–AtMPK10 MAPK module regulates venation complexity by altering PAT efficiency. PMID:25064848
Deletion of Otx2 in GnRH neurons results in a mouse model of hypogonadotropic hypogonadism.
Diaczok, Daniel; DiVall, Sara; Matsuo, Isao; Wondisford, Fredric E; Wolfe, Andrew M; Radovick, Sally
2011-05-01
GnRH is the central regulator of reproductive function responding to central nervous system cues to control gonadotropin synthesis and secretion. GnRH neurons originate in the olfactory placode and migrate to the forebrain, in which they are found in a scattered distribution. Congenital idiopathic hypogonadotropic hypogonadism (CIHH) has been associated with mutations or deletions in a number of genes that participate in the development of GnRH neurons and expression of GnRH. Despite the critical role of GnRH in mammalian reproduction, a comprehensive understanding of the developmental factors that are responsible for regulating the establishment of mature GnRH neurons and the expression of GnRH is lacking. orthodenticle homeobox 2 (OTX2), a homeodomain protein required for the formation of the forebrain, has been shown to be expressed in GnRH neurons, up-regulated during GnRH neuronal development, and responsible for increased GnRH promoter activity in GnRH neuronal cell lines. Interestingly, mutations in Otx2 have been associated with human hypogonadotropic hypogonadism, but the mechanism by which Otx2 mutations cause CIHH is unknown. Here we show that deletion of Otx2 in GnRH neurons results in a significant decrease in GnRH neurons in the hypothalamus, a delay in pubertal onset, abnormal estrous cyclicity, and infertility. Taken together, these data provide in vivo evidence that Otx2 is critical for GnRH expression and reproductive competence.
Yu, Yue; Liu, Liangliang; Xie, Ning; Xue, Hui; Fazli, Ladan; Buttyan, Ralph; Wang, Yuzhuo; Gleave, Martin
2013-01-01
Context: Like other tissues, the prostate is an admixture of many different cell types that can be segregated into components of the epithelium or stroma. Reciprocal interactions between these 2 types of cells are critical for maintaining prostate homeostasis, whereas aberrant stromal cell proliferation can disrupt this balance and result in diseases such as benign prostatic hyperplasia. Although the androgen and estrogen receptors are relatively well studied for their functions in controlling stromal cell proliferation and differentiation, the role of the progesterone receptor (PR) remains unclear. Objective: The aim of the study was to investigate the expression and function of the PR in the prostate. Design and Setting: Human prostate biopsies, renal capsule xenografts, and prostate stromal cells were used. Immunohistochemistry, Western blotting, real-time quantitative PCR, cell proliferation, flow cytometry, and gene microarray analyses were performed. Results: Two PR isoforms, PRA and PRB, are expressed in prostate stromal fibroblasts and smooth muscle cells, but not in epithelial cells. Both PR isoforms suppress prostate stromal cell proliferation through inhibition of the expression of cyclinA, cyclinB, and cdc25c, thus delaying cell cycling through S and M phases. Gene microarray analyses further demonstrated that PRA and PRB regulated different transcriptomes. However, one of the major gene groups commonly regulated by both PR isoforms was the one associated with regulation of cell proliferation. Conclusion: PR plays an inhibitory role in prostate stromal cell proliferation. PMID:23666965
Izawa, Takashi; Arakaki, Rieko; Mori, Hiroki; Tsunematsu, Takaaki; Kudo, Yasusei; Tanaka, Eiji; Ishimaru, Naozumi
2016-12-15
The aryl hydrocarbon receptor (AhR) pathway plays a key role in receptor activator of NF-κB ligand (RANKL)-mediated osteoclastogenesis. However, the mechanism underlying the regulation of AhR expression in osteoclasts and the signaling pathway through which AhR controls osteoclastogenesis remain unclear. We found that the expression of AhR in bone marrow-derived osteoclasts was upregulated by RANKL at an earlier stage than was the expression of signature osteoclast genes such as those encoding cathepsin K and NFAT, cytoplasmic, calcineurin-dependent 1. In response to RANKL, bone marrow macrophages isolated from AhR -/- mice exhibited impaired phosphorylation of Akt and MAPK as well as NF-κB, whereas their response to M-CSF remained unchanged. Osteoclast differentiation mediated by the AhR signaling pathway was also regulated in an RANKL/c-Fos-dependent manner. Furthermore, ligand activation of AhR by the smoke toxin benzo[a]pyrene accelerated osteoclast differentiation in a receptor-dependent manner, and AhR-dependent regulation of mitochondrial biogenesis in osteoclasts was observed. Moreover, AhR -/- mice exhibited impaired bone healing with delayed endochondral ossification. Taken together, the present results suggest that the RANKL/AhR/c-Fos signaling axis plays a critical role in osteoclastogenesis, thereby identifying the potential of AhR in treating pathological, inflammatory, or metabolic disorders of the bone. Copyright © 2016 by The American Association of Immunologists, Inc.
SOCS2 Binds to and Regulates EphA2 through Multiple Mechanisms.
Pilling, Carissa; Cooper, Jonathan A
2017-09-07
Suppressors of cytokine signaling (SOCS) proteins inhibit signaling by serving as substrate receptors for the Cullin5-RING E3 ubiquitin ligase (CRL5) and through a variety of CRL5-independent mechanisms. CRL5, SOCS2 and SOCS6 are implicated in suppressing transformation of epithelial cells. We identified cell proteins that interact with SOCS2 and SOCS6 using two parallel proteomics techniques: BioID and Flag affinity purification mass spectrometry. The receptor tyrosine kinase ephrin type-A receptor 2 (EphA2) was identified as a SOCS2-interacting protein. SOCS2-EphA2 binding requires the SOCS2 SH2 domain and EphA2 activation loop autophosphorylation, which is stimulated by Ephrin A1 (EfnA1) or by phosphotyrosine phosphatase inhibition. Surprisingly, EfnA1-stimulated EphA2-SOCS2 binding is delayed until EphA2 has been internalized into endosomes. This suggests that SOCS2 binds to EphA2 in the context of endosomal membranes. We also found that SOCS2 overexpression decreases steady state levels of EphA2, consistent with increased EphA2 degradation. This effect is indirect: SOCS2 induces EfnA1 expression, and EfnA1 induces EphA2 down-regulation. Other RTKs have been reported to bind, and be regulated by, over-expressed SOCS proteins. Our data suggest that SOCS protein over-expression may regulate receptor tyrosine kinases through indirect and direct mechanisms.
Src promotes cutaneous wound healing by regulating MMP-2 through the ERK pathway.
Wu, Xue; Yang, Longlong; Zheng, Zhao; Li, Zhenzhen; Shi, Jihong; Li, Yan; Han, Shichao; Gao, Jianxin; Tang, Chaowu; Su, Linlin; Hu, Dahai
2016-03-01
Wound healing is a highly orchestrated, multistep process, and delayed wound healing is a significant symptomatic clinical problem. Keratinocyte migration and re-epithelialization play the most important roles in wound healing, as they determine the rate of wound healing. In our previous study, we found that Src, one of the oldest proto‑oncogenes encoding a membrane-associated, non-receptor protein tyrosine kinase, promotes keratinocyte migration. We therefore hypothesized that Src promotes wound healing through enhanced keratinocyte migration. In order to test this hypothesis, vectors for overexpressing Src and small interfering RNAs (siRNAs) for silencing of Src were used in the present study. We found that the overexpression of Src accelerated keratinocyte migration in vitro and promoted wound healing in vivo without exerting a marked effect on cell proliferation. The extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) signaling pathways play important roles in Src-accelerated keratinocyte migration. Further experiments demonstrated that Src induced the protein expression of matrix metalloproteinase-2 (MMP-2) and decreased the protein expression of E-cadherin. We suggest that ERK signaling is involved in the Src-mediated regulation of MMP-2 expression. The present study provided evidence that Src promotes keratinocyte migration and cutaneous wound healing, in which the regulation of MMP-2 through the ERK pathway plays an important role, and thus we also demonstrated a potential therapeutic role for Src in cutaneous wound healing.
Lee, Kyounghee; Lee, Hong Gil; Kim, Hyun Uk; Seo, Pil Joon
2015-01-01
Seed germination is a key developmental transition that initiates the plant life cycle. The timing of germination is determined by the coordinated action of two phytohormones, gibberellin and abscisic acid (ABA). In particular, ABA plays a key role in integrating environmental information and inhibiting the germination process. The utilization of embryonic lipid reserves contributes to seed germination by acting as an energy source, and ABA suppresses lipid degradation to modulate the germination process. Here, we report that the ABA-responsive R2R3-type MYB transcription factor MYB96, which is highly expressed in embryo, regulates seed germination by controlling the expression of ABSCISIC ACID-INSENSITIVE4 (ABI4) in Arabidopsis (Arabidopsis thaliana). In the presence of ABA, germination was accelerated in MYB96-deficient myb96-1 seeds, whereas the process was significantly delayed in MYB96-overexpressing activation-tagging myb96-ox seeds. Consistently, myb96-1 seeds degraded a larger extent of lipid reserves even in the presence of ABA, while reduced lipid mobilization was observed in myb96-ox seeds. MYB96 directly regulates ABI4, which acts as a repressor of lipid breakdown, to define its spatial and temporal expression. Genetic analysis further demonstrated that ABI4 is epistatic to MYB96 in the control of seed germination. Taken together, the MYB96-ABI4 module regulates lipid mobilization specifically in the embryo to ensure proper seed germination under suboptimal conditions. PMID:25869652
Zatyka, Malgorzata; Da Silva Xavier, Gabriela; Bellomo, Elisa A.; Leadbeater, Wendy; Astuti, Dewi; Smith, Joel; Michelangeli, Frank; Rutter, Guy A.; Barrett, Timothy G.
2015-01-01
Wolfram syndrome is an autosomal recessive disorder characterized by neurodegeneration and diabetes mellitus. The gene responsible for the syndrome (WFS1) encodes an endoplasmic reticulum (ER)-resident transmembrane protein that is involved in the regulation of the unfolded protein response (UPR), intracellular ion homeostasis, cyclic adenosine monophosphate production and regulation of insulin biosynthesis and secretion. In this study, single cell Ca2+ imaging with fura-2 and direct measurements of free cytosolic ATP concentration ([ATP]CYT) with adenovirally expressed luciferase confirmed a reduced and delayed rise in cytosolic free Ca2+ concentration ([Ca2+]CYT), and additionally, diminished [ATP]CYT rises in response to elevated glucose concentrations in WFS1-depleted MIN6 cells. We also observed that sarco(endo)plasmic reticulum ATPase (SERCA) expression was elevated in several WFS1-depleted cell models and primary islets. We demonstrated a novel interaction between WFS1 and SERCA by co-immunoprecipitation in Cos7 cells and with endogenous proteins in human neuroblastoma cells. This interaction was reduced when cells were treated with the ER stress inducer dithiothreitol. Treatment of WFS1-depleted neuroblastoma cells with the proteasome inhibitor MG132 resulted in reduced accumulation of SERCA levels compared with wild-type cells. Together these results reveal a role for WFS1 in the negative regulation of SERCA and provide further insights into the function of WFS1 in calcium homeostasis. PMID:25274773
Balazadeh, Salma; Siddiqui, Hamad; Allu, Annapurna D; Matallana-Ramirez, Lilian P; Caldana, Camila; Mehrnia, Mohammad; Zanor, Maria-Inés; Köhler, Barbara; Mueller-Roeber, Bernd
2010-04-01
The onset and progression of senescence are under genetic and environmental control. The Arabidopsis thaliana NAC transcription factor ANAC092 (also called AtNAC2 and ORE1) has recently been shown to control age-dependent senescence, but its mode of action has not been analysed yet. To explore the regulatory network administered by ANAC092 we performed microarray-based expression profiling using estradiol-inducible ANAC092 overexpression lines. Approximately 46% of the 170 genes up-regulated upon ANAC092 induction are known senescence-associated genes, suggesting that the NAC factor exerts its role in senescence through a regulatory network that includes many of the genes previously reported to be senescence regulated. We selected 39 candidate genes and confirmed their time-dependent response to enhanced ANAC092 expression by quantitative RT-PCR. We also found that the majority of them (24 genes) are up-regulated by salt stress, a major promoter of plant senescence, in a manner similar to that of ANAC092, which itself is salt responsive. Furthermore, 24 genes like ANAC092 turned out to be stage-dependently expressed during seed growth with low expression at early and elevated expression at late stages of seed development. Disruption of ANAC092 increased the rate of seed germination under saline conditions, whereas the opposite occurred in respective overexpression plants. We also detected a delay of salinity-induced chlorophyll loss in detached anac092-1 mutant leaves. Promoter-reporter (GUS) studies revealed transcriptional control of ANAC092 expression during leaf and flower ageing and in response to salt stress. We conclude that ANAC092 exerts its functions during senescence and seed germination through partly overlapping target gene sets.
2012-01-01
Background Fruit ripening is a complicated development process affected by a variety of external and internal cues. It is well established that calcium treatment delays fruit ripening and senescence. However, the underlying molecular mechanisms remain unclear. Results Previous studies have shown that calcium/calmodulin-regulated SR/CAMTAs are important for modulation of disease resistance, cold sensitivity and wounding response in vegetative tissues. To study the possible roles of this gene family in fruit development and ripening, we cloned seven SR/CAMTAs, designated as SlSRs, from tomato, a model fruit-bearing crop. All seven genes encode polypeptides with a conserved DNA-binding domain and a calmodulin-binding site. Calmodulin specifically binds to the putative targeting site in a calcium-dependent manner. All SlSRs were highly yet differentially expressed during fruit development and ripening. Most notably, the expression of SlSR2 was scarcely detected at the mature green and breaker stages, two critical stages of fruit development and ripening; and SlSR3L and SlSR4 were expressed exclusively in fruit tissues. During the developmental span from 10 to 50 days post anthesis, the expression profiles of all seven SlSRs were dramatically altered in ripening mutant rin compared with wildtype fruit. By contrast, only minor alterations were noted for ripening mutant nor and Nr fruit. In addition, ethylene treatment of mature green wildtype fruit transiently stimulated expression of all SlSRs within one to two hours. Conclusions This study indicates that SlSR expression is influenced by both the Rin-mediated developmental network and ethylene signaling. The results suggest that calcium signaling is involved in the regulation of fruit development and ripening through calcium/calmodulin/SlSR interactions. PMID:22330838
Mullen, Rachel D; Park, Soyoung; Rhodes, Simon J
2012-02-01
Lin-11, Isl-1, and Mec-3 (LIM)-homeodomain (HD)-class transcription factors are critical for many aspects of mammalian organogenesis. Of these, LHX3 is essential for pituitary gland and nervous system development. Pediatric patients with mutations in coding regions of the LHX3 gene have complex syndromes, including combined pituitary hormone deficiency and nervous system defects resulting in symptoms such as dwarfism, thyroid insufficiency, infertility, and developmental delay. The pathways underlying early pituitary development are poorly understood, and the mechanisms by which the LHX3 gene is regulated in vivo are not known. Using bioinformatic and transgenic mouse approaches, we show that multiple conserved enhancers downstream of the human LHX3 gene direct expression to the developing pituitary and spinal cord in a pattern consistent with endogenous LHX3 expression. Several transferable cis elements can individually guide nervous system expression. However, a single 180-bp minimal enhancer is sufficient to confer specific expression in the developing pituitary. Within this sequence, tandem binding sites recognized by the islet-1 (ISL1) LIM-HD protein are essential for enhancer activity in the pituitary and spine, and a pituitary homeobox 1 (PITX1) bicoid class HD element is required for spatial patterning in the developing pituitary. This study establishes ISL1 as a novel transcriptional regulator of LHX3 and describes a potential mechanism for regulation by PITX1. Moreover, these studies suggest models for analyses of the transcriptional pathways coordinating the expression of other LIM-HD genes and provide tools for the molecular analysis and genetic counseling of pediatric patients with combined pituitary hormone deficiency.
Mullen, Rachel D.; Park, Soyoung
2012-01-01
Lin-11, Isl-1, and Mec-3 (LIM)-homeodomain (HD)-class transcription factors are critical for many aspects of mammalian organogenesis. Of these, LHX3 is essential for pituitary gland and nervous system development. Pediatric patients with mutations in coding regions of the LHX3 gene have complex syndromes, including combined pituitary hormone deficiency and nervous system defects resulting in symptoms such as dwarfism, thyroid insufficiency, infertility, and developmental delay. The pathways underlying early pituitary development are poorly understood, and the mechanisms by which the LHX3 gene is regulated in vivo are not known. Using bioinformatic and transgenic mouse approaches, we show that multiple conserved enhancers downstream of the human LHX3 gene direct expression to the developing pituitary and spinal cord in a pattern consistent with endogenous LHX3 expression. Several transferable cis elements can individually guide nervous system expression. However, a single 180-bp minimal enhancer is sufficient to confer specific expression in the developing pituitary. Within this sequence, tandem binding sites recognized by the islet-1 (ISL1) LIM-HD protein are essential for enhancer activity in the pituitary and spine, and a pituitary homeobox 1 (PITX1) bicoid class HD element is required for spatial patterning in the developing pituitary. This study establishes ISL1 as a novel transcriptional regulator of LHX3 and describes a potential mechanism for regulation by PITX1. Moreover, these studies suggest models for analyses of the transcriptional pathways coordinating the expression of other LIM-HD genes and provide tools for the molecular analysis and genetic counseling of pediatric patients with combined pituitary hormone deficiency. PMID:22194342
Beirowski, Bogdan; Gustin, Jason; Armour, Sean M; Yamamoto, Hiroyasu; Viader, Andreu; North, Brian J; Michán, Shaday; Baloh, Robert H; Golden, Judy P; Schmidt, Robert E; Sinclair, David A; Auwerx, Johan; Milbrandt, Jeffrey
2011-10-25
The formation of myelin by Schwann cells (SCs) occurs via a series of orchestrated molecular events. We previously used global expression profiling to examine peripheral nerve myelination and identified the NAD(+)-dependent deacetylase Sir-two-homolog 2 (Sirt2) as a protein likely to be involved in myelination. Here, we show that Sirt2 expression in SCs is correlated with that of structural myelin components during both developmental myelination and remyelination after nerve injury. Transgenic mice lacking or overexpressing Sirt2 specifically in SCs show delays in myelin formation. In SCs, we found that Sirt2 deacetylates Par-3, a master regulator of cell polarity. The deacetylation of Par-3 by Sirt2 decreases the activity of the polarity complex signaling component aPKC, thereby regulating myelin formation. These results demonstrate that Sirt2 controls an essential polarity pathway in SCs during myelin assembly and provide insights into the association between intracellular metabolism and SC plasticity.
Galindo, Mario; Pratap, Jitesh; Young, Daniel W.; Hovhannisyan, Hayk; Im, Hee-Jeong; Choi, Je-Yong; Lian, Jane B.; Stein, Janet L.; Stein, Gary S.; van Wijnen, Andre J.
2010-01-01
The Runx2 (CBFA1/AML3/PEBP2αA) transcription factor promotes skeletal cell differentiation, but it also has a novel cell growth regulatory activity in osteoblasts. We addressed here whether Runx2 activity is functionally linked to cell cycle-related mechanisms that control normal osteoblast proliferation and differentiation. We found that the levels of Runx2 gene transcription, mRNA and protein, are each up-regulated with cessation of cell growth (i.e. G0/G1 transition) in preconfluent MC3T3 osteoblastic cells that do not yet express mature bone phenotypic gene expression. Cell growth regulation of Runx2 is also observed in primary calvarial osteoblasts and other osteoblastic cells with relatively normal cell growth characteristics, but not in osteosarcoma cells (e.g. SAOS-2 and ROS17/2.8). Runx2 levels are cell cycle-regulated in MC3T3 cells with respect to the G1/S and M/G1 transitions: expression oscillates from maximal levels during early G1 to minimal levels during early S phase and mitosis. However, in normal or immortalized (e.g. ATDC5) chondrocytic cells, Runx2 expression is suppressed during quiescence, and Runx2 levels are not regulated during G1 and S phase in ATDC5 cells. Antisense or small interfering RNA-mediated reduction of the low physiological levels of Runx2 in proliferating MC3T3 cells does not accelerate cell cycle progression. However, forced expression of Runx2 suppresses proliferation of MC3T3 preosteoblasts or C2C12 mesenchymal cells which have osteogenic potential. Forced elevation of Runx2 in synchronized MC3T3 cells causes a delay in G1. We propose that Runx2 levels and function are biologically linked to a cell growth-related G1 transition in osteoblastic cells. PMID:15781466
Kim, Jae Joon; Lee, Jeong Hwan; Kim, Wanhui; Jung, Hye Seung; Huijser, Peter; Ahn, Ji Hoon
2012-01-01
The flowering time of plants is affected by modest changes in ambient temperature. However, little is known about the regulation of ambient temperature-responsive flowering by small RNAs. In this study, we show that the microRNA156 (miR156)-SQUAMOSA PROMOTER BINDING PROTEIN-LIKE3 (SPL3) module directly regulates FLOWERING LOCUS T (FT) expression in the leaf to control ambient temperature-responsive flowering. Overexpression of miR156 led to more delayed flowering at a lower ambient temperature (16°C), which was associated with down-regulation of FT and FRUITFULL expression. Among miR156 target genes, SPL3 mRNA levels were mainly reduced, probably because miR156-mediated cleavage of SPL3 mRNA was higher at 16°C. Overexpression of miR156-resistant SPL3 [SPL3(−)] caused early flowering, regardless of the ambient temperature, which was associated with up-regulation of FT and FRUITFULL expression. Reduction of miR156 activity by target mimicry led to a phenotype similar to that of SUC2::rSPL3 plants. FT up-regulation was observed after dexamethasone treatment in GVG-rSPL3 plants. Misexpression and artificial microRNA-mediated suppression of FT in the leaf dramatically altered the ambient temperature-responsive flowering of plants overexpressing miR156 and SPL3(−). Chromatin immunoprecipitation assay showed that the SPL3 protein directly binds to GTAC motifs within the FT promoter. Lesions in TERMINAL FLOWER1, SHORT VEGETATIVE PHASE, and EARLY FLOWERING3 did not alter the expression of miR156 and SPL3. Taken together, our data suggest that the interaction between the miR156-SPL3 module and FT is part of the regulatory mechanism controlling flowering time in response to ambient temperature. PMID:22427344
Gross, Claus M; Flubacher, Armin; Tinnes, Stefanie; Heyer, Andrea; Scheller, Marie; Herpfer, Inga; Berger, Mathias; Frotscher, Michael; Lieb, Klaus; Haas, Carola A
2012-03-01
Early life stress predisposes to the development of psychiatric disorders. In this context the hippocampal formation is of particular interest, because it is affected by stress on the structural and cognitive level. Since little is known how early life stress is translated on the molecular level, we mimicked early life stress in mouse models and analyzed the expression of the glycoprotein Reelin, a master molecule for development and differentiation of the hippocampus. From postnatal day 1 (P1) to P14, mouse pups were subjected to one of the following treatments: nonhandling (NH), handling (H), maternal separation (MS), and early deprivation (ED) followed by immediate (P15) or delayed (P70) real time RT-PCR analysis of reelin mRNA expression. We show that at P15, reelin mRNA levels were significantly increased in male H and ED groups when compared with the NH group. In contrast, no stress-induced alterations of reelin mRNA expression were found in female animals. This sex difference in stress-mediated stimulation of reelin expression was maintained into adulthood, since at P70 intergroup differences were still found in male, but not in female mice. On the cellular level, however, we did not find any significant differences in cell densities of Reelin-immunolabeled neurons between treatment groups or sexes, but an overall reduction of Reelin-expressing neurons in the adult hippocampus when compared to P15. To address the question whether corticosterone mediates the stress-induced up-regulation of reelin gene expression, we used age-matched hippocampal slice cultures derived from male and female mouse pups. Quantitative determination of mRNA levels revealed that corticosterone treatment significantly up-regulated reelin mRNA expression in male, but not in female hippocampi. Taken together, these results show a sex-specific regulation of reelin gene expression by early life experience, most likely mediated by corticosterone. Copyright © 2010 Wiley Periodicals, Inc.
ERIC Educational Resources Information Center
Bembenutty, Hefer; Karabenick, Stuart A.
2004-01-01
We review the association between delay of gratification and future time perspective (FTP), which can be incorporated within the theoretical perspective of self-regulation of learning. We propose that delay of gratification in academic contexts, along with facilitative beliefs about the future, increase the likelihood of completing academic tasks.…
48 CFR 22.1014 - Delay over 60 days in bid opening or commencement of work.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Delay over 60 days in bid... ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Service Contract Act of 1965, as Amended 22.1014 Delay over 60 days in bid opening or commencement of work. If a...
Zhao, Liping; Kim, Ki Woo; Ikeda, Yayoi; Anderson, Kimberly K; Beck, Laurel; Chase, Stephanie; Tobet, Stuart A; Parker, Keith L
2008-06-01
Steroidogenic factor 1 (SF-1) plays key roles in adrenal and gonadal development, expression of pituitary gonadotropins, and development of the ventromedial hypothalamic nucleus (VMH). If kept alive by adrenal transplants, global knockout (KO) mice lacking SF-1 exhibit delayed-onset obesity and decreased locomotor activity. To define specific roles of SF-1 in the VMH, we used the Cre-loxP system to inactivate SF-1 in a central nervous system (CNS)-specific manner. These mice largely recapitulated the VMH structural defect seen in mice lacking SF-1 in all tissues. In multiple behavioral tests, mice with CNS-specific KO of SF-1 had significantly more anxiety-like behavior than wild-type littermates. The CNS-specific SF-1 KO mice had diminished expression or altered distribution in the mediobasal hypothalamus of several genes whose expression has been linked to stress and anxiety-like behavior, including brain-derived neurotrophic factor, the type 2 receptor for CRH (Crhr2), and Ucn 3. Moreover, transfection and EMSAs support a direct role of SF-1 in Crhr2 regulation. These findings reveal important roles of SF-1 in the hypothalamic expression of key regulators of anxiety-like behavior, providing a plausible molecular basis for the behavioral effect of CNS-specific KO of this nuclear receptor.
Julio-Pieper, Marcela; Lara, Hernán E; Bravo, Javier A; Romero, Carmen
2006-01-01
Background Angiogenesis is a crucial process in follicular development and luteogenesis. The nerve growth factor (NGF) promotes angiogenesis in various tissues. An impaired production of this neurotrophin has been associated with delayed wound healing. A variety of ovarian functions are regulated by NGF, but its effects on ovarian angiogenesis remain unknown. The aim of this study was to elucidate if NGF modulates 1) the amount of follicular blood vessels and 2) ovarian expression of two angiogenic factors: vascular endothelial growth factor (VEGF) and transforming growth factor beta 1 (TGFbeta1), in the rat ovary. Results In cultured neonatal rat ovaries, NGF increased VEGF mRNA and protein levels, whereas TGFbeta1 expression did not change. Sectioning of the superior ovarian nerve, which increases ovarian NGF protein content, augmented VEGF immunoreactivity and the area of capillary vessels in ovaries of prepubertal rats compared to control ovaries. Conclusion Results indicate that NGF may be important in the maintenance of the follicular and luteal vasculature in adult rodents, either indirectly, by increasing the expression of VEGF in the ovary, or directly via promoting the proliferation of vascular cells. This data suggests that a disruption on NGF regulation could be a component in ovarian disorders related with impaired angiogenesis. PMID:17096853
Schrader, Alexandra; Meyer, Katharina; Walther, Neele; Stolz, Ailine; Feist, Maren; Hand, Elisabeth; von Bonin, Frederike; Evers, Maurits; Kohler, Christian; Shirneshan, Katayoon; Vockerodt, Martina; Klapper, Wolfram; Szczepanowski, Monika; Murray, Paul G.; Bastians, Holger; Trümper, Lorenz; Spang, Rainer; Kube, Dieter
2016-01-01
To discover new regulatory pathways in B lymphoma cells, we performed a combined analysis of experimental, clinical and global gene expression data. We identified a specific cluster of genes that was coherently expressed in primary lymphoma samples and suppressed by activation of the B cell receptor (BCR) through αIgM treatment of lymphoma cells in vitro. This gene cluster, which we called BCR.1, includes numerous cell cycle regulators. A reduced expression of BCR.1 genes after BCR activation was observed in different cell lines and also in CD10+ germinal center B cells. We found that BCR activation led to a delayed entry to and progression of mitosis and defects in metaphase. Cytogenetic changes were detected upon long-term αIgM treatment. Furthermore, an inverse correlation of BCR.1 genes with c-Myc co-regulated genes in distinct groups of lymphoma patients was observed. Finally, we showed that the BCR.1 index discriminates activated B cell-like and germinal centre B cell-like diffuse large B cell lymphoma supporting the functional relevance of this new regulatory circuit and the power of guided clustering for biomarker discovery. PMID:27166259
Solar UV light regulates flavonoid metabolism in apple (Malus x domestica).
Henry-Kirk, Rebecca A; Plunkett, Blue; Hall, Miriam; McGhie, Tony; Allan, Andrew C; Wargent, Jason J; Espley, Richard V
2018-03-01
Ultraviolet-B light (UV-B) is one environmental signal perceived by plants that affects the flavonoid pathway and influences the levels of anthocyanins, flavonols, and proanthocyanidins. To understand the mechanisms underlying UV exposure, apple trees were grown under spectral filters that altered transmission of solar UV light. Fruit analysis showed that UV induced changes in physiology, metabolism, and gene expression levels during development over a season. These changes were sustained after storage. Under low UV, ripening was delayed, fruit size decreased, and anthocyanin and flavonols were reduced. Expression analysis showed changes in response to UV light levels for genes in the regulation and biosynthesis of anthocyanin and flavonols. Transcription of flavonol synthase (FLS), ELONGATED HYPOCOTYL 5 (HY5), MYB10, and MYB22 were down-regulated throughout fruit development under reduced UV. Functional testing showed that the FLS promoter was activated by HY5, and this response was enhanced by the presence of MYB22. The MYB22 promoter can also be activated by the anthocyanin regulator, MYB10. As ambient levels of UV light vary around the globe, this study has implications for future crop production, the quality of which can be determined by the response to UV. © 2018 John Wiley & Sons Ltd.
Forsbach-Birk, Vera; McNealy, Tamara; Shi, Chunwei; Lynch, Damien; Marre, Reinhard
2004-07-01
Legionella bacteria have a developmental cycle in which they go from existing in the aquatic environment to replicating inside eukaryotic host cells. The adaptation to the new environment requires an efficient regulatory system. Overexpression of CsrA, a global regulatory protein found in a variety of gram-negative bacteria has been shown to suppress virulence-associated traits in Legionella pneumophila. Since evidence resulting only from overproduction may not be sufficient to validate the role of a regulatory protein, a csrA mutant strain, CsrA(-), with a drastically reduced production of CsrA, was created. Using RNA slot blots and Western blotting it was shown that fliA and flaA, genes which contribute to flagellation, were expressed early in the mutant. Additionally, in CsrA(-) the levels of the stationary-phase sigma factor, RpoS, and a recently described regulator of virulence traits, LetE, were increased. Growth curves of CsrA(-) bacteria were delayed with pigment production occurring at the same OD578 but at reduced levels in the mutant. Replication ability of the CsrA(-) mutant in amoebae was also affected. Based on these results, we could show that CsrA is involved in the regulation of the bacterial switch from the replicative to the transmissible form.
Kalinichenko, S G; Matveeva, N Yu; Kostiv, R E; Puz', A V
2017-03-01
The study established enhanced expression of vascular endothelial growth factor (VEGF) in the subpopulation of osteoblasts located in the regeneration region of femoral bone fracture near the titanium implants with bioactive calcium phosphate and hydroxyapatite coatings and suppressed activity of transforming growth factor-β2 (TGF-β2) in chondroblasts during the two weeks after surgery. In the delayed posttraumatic period, the distribution of TGF-β2 inversely related to its maximal activity. The data revealed the up-regulating effect of bioresorbable coatings on expression of VEGF and TGF-β2 and their implication in the control over various stages of reparative osteogenesis.
Spray, S; Johansson, S E; Radziwon-Balicka, A; Haanes, K A; Warfvinge, K; Povlsen, G K; Kelly, P A T; Edvinsson, L
2017-08-01
Delayed cerebral hypoperfusion is a secondary complication found in the days after transient global cerebral ischaemia that worsens the ischaemic damage inflicted by the initial transient episode of global cerebral ischaemia. A recent study demonstrated increased cerebral vasoconstriction in the large arteries on the brain surface (pial arteries) after global cerebral ischaemia. However, smaller arterioles inside the brain (parenchymal arterioles) are equally important in the regulation of cerebral blood flow and yet their pathophysiology after global cerebral ischaemia is largely unknown. Therefore, we investigated whether increased contractility occurs in the intraparenchymal arterioles. Global cerebral ischaemia was induced in male Wistar rats by bilateral common carotid occlusion for 15 min combined with hypovolaemia. Regional cerebral blood flow was determined by quantitative autoradiography. Intraparenchymal arterioles were isolated and pressurized, and concentration-response curves to endothelin-1 with and without the endothelin B receptor-selective antagonist BQ788 was generated. Endothelin B receptor expression was investigated by quantitative flow cytometry and immunohistochemistry. We observed increased endothelin-1-mediated contractility of parenchymal arterioles correlating with reduced cerebral blood flow of the cortex, hippocampus and caudate nucleus 48 h after global cerebral ischaemia. The increased endothelin-1-mediated contractility was abolished by BQ788, and the vascular smooth muscle cell-specific expression of endothelin B receptors was significantly increased after global cerebral ischaemia. Increased endothelin-1-mediated contractility and expression of endothelin B receptors in the intraparenchymal vasculature contributes to the development of delayed cerebral hypoperfusion after global cerebral ischaemia in combination with vascular changes of the pial vasculature. © 2016 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.
Kurdián, Melania; Herrero-Fresneda, Inmaculada; Lloberas, Nuria; Gimenez-Bonafe, Pepita; Coria, Virginia; Grande, María T; Boggia, José; Malacrida, Leonel; Torras, Joan; Arévalo, Miguel A; González-Martínez, Francisco; López-Novoa, José M; Grinyó, Josep; Noboa, Oscar
2012-01-01
The immunosuppressive mammalian target of rapamycin (mTOR) inhibitors are widely used in solid organ transplantation, but their effect on kidney disease progression is controversial. mTOR has emerged as one of the main pathways regulating cell growth, proliferation, differentiation, migration, and survival. The aim of this study was to analyze the effects of delayed inhibition of mTOR pathway with low dose of everolimus on progression of renal disease and TGFβ expression in the 5/6 nephrectomy model in Wistar rats. This study evaluated the effects of everolimus (0.3 mg/k/day) introduced 15 days after surgical procedure on renal function, proteinuria, renal histology and mechanisms of fibrosis and proliferation. Everolimus treated group (EveG) showed significantly less proteinuria and albuminuria, less glomerular and tubulointerstitial damage and fibrosis, fibroblast activation cell proliferation, when compared with control group (CG), even though the EveG remained with high blood pressure. Treatment with everolimus also diminished glomerular hypertrophy. Everolimus effectively inhibited the increase of mTOR developed in 5/6 nephrectomy animals, without changes in AKT mRNA or protein abundance, but with an increase in the pAKT/AKT ratio. Associated with this inhibition, everolimus blunted the increased expression of TGFβ observed in the remnant kidney model. Delayed mTOR inhibition with low dose of everolimus significantly prevented progressive renal damage and protected the remnant kidney. mTOR and TGFβ mRNA reduction can partially explain this anti fibrotic effect. mTOR can be a new target to attenuate the progression of chronic kidney disease even in those nephropathies of non-immunologic origin.
Kurdián, Melania; Herrero-Fresneda, Inmaculada; Lloberas, Nuria; Gimenez-Bonafe, Pepita; Coria, Virginia; Grande, María T.; Boggia, José; Malacrida, Leonel; Torras, Joan; Arévalo, Miguel A.; González-Martínez, Francisco; López-Novoa, José M.; Grinyó, Josep; Noboa, Oscar
2012-01-01
Background The immunosuppressive mammalian target of rapamycin (mTOR) inhibitors are widely used in solid organ transplantation, but their effect on kidney disease progression is controversial. mTOR has emerged as one of the main pathways regulating cell growth, proliferation, differentiation, migration, and survival. The aim of this study was to analyze the effects of delayed inhibition of mTOR pathway with low dose of everolimus on progression of renal disease and TGFβ expression in the 5/6 nephrectomy model in Wistar rats. Methods This study evaluated the effects of everolimus (0.3 mg/k/day) introduced 15 days after surgical procedure on renal function, proteinuria, renal histology and mechanisms of fibrosis and proliferation. Results Everolimus treated group (EveG) showed significantly less proteinuria and albuminuria, less glomerular and tubulointerstitial damage and fibrosis, fibroblast activation cell proliferation, when compared with control group (CG), even though the EveG remained with high blood pressure. Treatment with everolimus also diminished glomerular hypertrophy. Everolimus effectively inhibited the increase of mTOR developed in 5/6 nephrectomy animals, without changes in AKT mRNA or protein abundance, but with an increase in the pAKT/AKT ratio. Associated with this inhibition, everolimus blunted the increased expression of TGFβ observed in the remnant kidney model. Conclusion Delayed mTOR inhibition with low dose of everolimus significantly prevented progressive renal damage and protected the remnant kidney. mTOR and TGFβ mRNA reduction can partially explain this anti fibrotic effect. mTOR can be a new target to attenuate the progression of chronic kidney disease even in those nephropathies of non-immunologic origin. PMID:22427849
Zhu, Xiaolong; Sun, Yue; Mu, Xin; Guo, Pan; Gao, Fei; Zhang, Jing; Zhu, Yunjuan; Zhang, Xianzhi; Chen, Lingling; Ning, Zhiwei; Bai, Yunfeng; Ren, Jiling; Man, Maoqiang; Liu, Peimei; Hu, Lizhi
2017-02-26
This study aimed to investigate the role of phospholipase Cε (PLCε) in the skin wound healing process. PLCε, an effect factor of Ras/Rap small G protein, plays a crucial role in skin inflammation by regulating inflammatory cytokines. Inflammatory responses are closely associated with wound healing. Full-thickness skin wounds were made in the PLCε knockout (KO) and wild-type (WT) mice, and the healing process was analyzed. The macroscopic wound closure rate declined in the PLCε KO mice on days 3, 4, and 5 after wounding, following the decreased expression of interleukin (IL)-6, chemokine (C-X-C motif) ligand (Cxcl)-1, Cxcl-2, and chemokine (C-C motif) ligand (Ccl) 20. The proliferation rate of epidermal keratinocytes was not affected by PLCε, but silencing of PLCε resulted in the delayed migration of keratinocytes. Moreover, the scars were found to be much smaller in the PLCε KO mice than in the WT mice. The mRNA expression of Ccl20, collagen (Col) 6a1, and Col17a1 decreased in the PLCε KO mice. These results were in agreement with a previous hypothesis that PLCε might delay the early stage of cutaneous wound healing by inhibiting the migration of keratinocytes, and decrease the expression of Col6a1, Col17a1, and Ccl20 by inhibiting the inflammatory response to reduce scar formation. This study shed light on a novel role of PLCε in wound healing and provided new therapeutic approaches to target PLCε for diminishing scar formation after injury. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan, Yaoqian; Center for Cancer Research, University of Tennessee Health Science Center, Memphis, TN 38163; Balazs, Louisa
2011-05-13
Highlights: {yields} Deletion of Dicer in vascular smooth muscle cells(VSMCs) leads to embryonic mortality. {yields} Loss of Dicer in VSMCs leads to developmental delay. {yields} Loss of Dicer in VSMCs leads to hemorrhage in various organs including brain, skin and liver. {yields} Loss of Dicer in VSMCs leads to vascular wall remodeling. {yields} Loss of Dicer in VSMCs dysregulates the expression of miRNA and VSMC marker genes. -- Abstract: Dicer is a RNAase III enzyme that cleaves double stranded RNA and generates small interfering RNA (siRNA) and microRNA (miRNA). The goal of this study is to examine the role ofmore » Dicer and miRNAs in vascular smooth muscle cells (VSMCs). We deleted Dicer in VSMCs of mice, which caused a developmental delay that manifested as early as embryonic day E12.5, leading to embryonic death between E14.5 and E15.5 due to extensive hemorrhage in the liver, brain, and skin. Dicer KO embryos showed dilated blood vessels and a disarray of vascular architecture between E14.5 and E15.5. VSMC proliferation was significantly inhibited in Dicer KOs. The expression of VSMC marker genes were significantly downregulated in Dicer cKO embryos. The vascular structure of the yolk sac and embryo in Dicer KOs was lost to an extent that no blood vessels could be identified after E15.5. Expression of most miRNAs examined was compromised in VSMCs of Dicer KO. Our results indicate that Dicer is required for vascular development and regulates vascular remodeling by modulating VSMC proliferation and differentiation.« less
Artiles, Karen; Anastasia, Stephanie; McCusker, Derek; Kellogg, Douglas R.
2009-01-01
The key molecular event that marks entry into the cell cycle is transcription of G1 cyclins, which bind and activate cyclin-dependent kinases. In yeast cells, initiation of G1 cyclin transcription is linked to achievement of a critical cell size, which contributes to cell-size homeostasis. The critical cell size is modulated by nutrients, such that cells growing in poor nutrients are smaller than cells growing in rich nutrients. Nutrient modulation of cell size does not work through known critical regulators of G1 cyclin transcription and is therefore thought to work through a distinct pathway. Here, we report that Rts1, a highly conserved regulatory subunit of protein phosphatase 2A (PP2A), is required for normal control of G1 cyclin transcription. Loss of Rts1 caused delayed initiation of bud growth and delayed and reduced accumulation of G1 cyclins. Expression of the G1 cyclin CLN2 from an inducible promoter rescued the delayed bud growth in rts1Δ cells, indicating that Rts1 acts at the level of transcription. Moreover, loss of Rts1 caused altered regulation of Swi6, a key component of the SBF transcription factor that controls G1 cyclin transcription. Epistasis analysis revealed that Rts1 does not work solely through several known critical upstream regulators of G1 cyclin transcription. Cells lacking Rts1 failed to undergo nutrient modulation of cell size. Together, these observations demonstrate that Rts1 is a key player in pathways that link nutrient availability, cell size, and G1 cyclin transcription. Since Rts1 is highly conserved, it may function in similar pathways in vertebrates. PMID:19911052
Effects of perfluorooctanoic acid (PFOA) on expression of ...
PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1-17 with water or 5 mg PFO/kg to examine PPARa, PPARß, and PPARy expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARa and PPARy expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of neonates This paper represents the continuing efforts at ORD, in response to the call for assistance from OPPTS, to investigate the potential developmental toxicities of perfluoroalkyl acids (PFAA). Perfluorooctanoic acid (PFOA) is a compound which persists and is found ubiquitously in the environment, wildlife and humans. Studies in our laboratory using an in vitro transfected cell model showed that PFO
Zhang, Lili; Maruno, Shun'ichi
2010-10-01
Academic delay of gratification refers to the postponement of immediate rewards by students and the pursuit of more important, temporally remote academic goals. A path model was designed to identify the causal relationships among academic delay of gratification and motivation, self-regulated learning strategies (as specified in the Motivated Strategies for Learning Questionnaire), and grades among 386 Chinese elementary school children. Academic delay of gratification was found to be positively related to motivation and metacognition. Cognitive strategy, resource management, and grades mediated these two factors and were indirectly related to academic delay of gratification.
Gan, Yinbo; Kumimoto, Rod; Liu, Chang; Ratcliffe, Oliver; Yu, Hao; Broun, Pierre
2006-06-01
As a plant shoot matures, it transitions through a series of growth phases in which successive aerial organs undergo distinct developmental changes. This process of phase change is known to be influenced by gibberellins (GAs). We report the identification of a putative transcription factor, GLABROUS INFLORESCENCE STEMS (GIS), which regulates aspects of shoot maturation in Arabidopsis thaliana. GIS loss-of-function mutations affect the epidermal differentiation of inflorescence organs, causing a premature decrease in trichome production on successive leaves, stem internodes, and branches. Overexpression has the opposite effect on trichome initiation and causes other heterochronic phenotypes, affecting flowering and juvenile-adult leaf transition and inducing the formation of rosette leaves on inflorescence stems. Genetic and gene expression analyses suggest that GIS acts in a GA-responsive pathway upstream of the trichome initiation regulator GLABROUS1 (GL1) and downstream of the GA signaling repressor SPINDLY (SPY). GIS mediates the induction of GL1 expression by GA in inflorescence organs and is antagonized in its action by the DELLA repressor GAI. The implication of GIS in the broader regulation of phase change is further suggested by the delay in flowering caused by GIS loss of function in the spy background. The discovery of GIS reveals a novel mechanism in the control of shoot maturation, through which GAs regulate cellular differentiation in plants.
Drosophila COP9 signalosome subunit 7 interacts with multiple genomic loci to regulate development
Singer, Ruth; Atar, Shimshi; Atias, Osnat; Oron, Efrat; Segal, Daniel; Hirsch, Joel A.; Tuller, Tamir; Orian, Amir; Chamovitz, Daniel A.
2014-01-01
The COP9 signalosome protein complex has a central role in the regulation of development of multicellular organisms. While the function of this complex in ubiquitin-mediated protein degradation is well established, results over the past few years have hinted that the COP9 signalosome may function more broadly in the regulation of gene expression. Here, using DamID technology, we show that COP9 signalosome subunit 7 functionally associates with a large number of genomic loci in the Drosophila genome, and show that the expression of many genes within these loci is COP9 signalosome-dependent. This association is likely direct as we show CSN7 binds DNA in vitro. The genes targeted by CSN7 are preferentially enriched for transcriptionally active regions of the genome, and are involved in the regulation of distinct gene ontology groupings including imaginal disc development and cell-cycle control. In accord, loss of CSN7 function leads to cell-cycle delay and altered wing development. These results indicate that CSN7, and by extension the entire COP9 signalosome, functions directly in transcriptional control. While the COP9 signalosome protein complex has long been known to regulate protein degradation, here we expand the role of this complex by showing that subunit 7 binds DNA in vitro and functions directly in vivo in transcriptional control of developmentally important pathways that are relevant for human health. PMID:25106867
Müller, Margit S; Pedersen, Sofie E; Walls, Anne B; Waagepetersen, Helle S; Bak, Lasse K
2015-01-01
Glycogen phosphorylase (GP) is activated to degrade glycogen in response to different stimuli, to support both the astrocyte's own metabolic demand and the metabolic needs of neurons. The regulatory mechanism allowing such a glycogenolytic response to distinct triggers remains incompletely understood. In the present study, we used siRNA-mediated differential knockdown of the two isoforms of GP expressed in astrocytes, muscle isoform (GPMM), and brain isoform (GPBB), to analyze isoform-specific regulatory characteristics in a cellular setting. Subsequently, we tested the response of each isoform to phosphorylation, triggered by incubation with norepinephrine (NE), and to AMP, increased by glucose deprivation in cells in which expression of one GP isoform had been silenced. Successful knockdown was demonstrated on the protein level by Western blot, and on a functional level by determination of glycogen content showing an increase in glycogen levels following knockdown of either GPMM or GPBB. NE triggered glycogenolysis within 15 min in control cells and after GPBB knockdown. However, astrocytes in which expression of GPMM had been silenced showed a delay in response to NE, with glycogen levels significantly reduced only after 60 min. In contrast, allosteric activation of GP by AMP, induced by glucose deprivation, seemed to mainly affect GPBB, as only knockdown of GPBB, but not of GPMM, delayed the glycogenolytic response to glucose deprivation. Our results indicate that the two GP isoforms expressed in astrocytes respond to different physiological triggers, therefore conferring distinct metabolic functions of brain glycogen. © 2014 Wiley Periodicals, Inc.
Greenup, Aaron G.; Sasani, Shahryar; Oliver, Sandra N.; Talbot, Mark J.; Dennis, Elizabeth S.; Hemming, Megan N.; Trevaskis, Ben
2010-01-01
In temperate cereals, such as wheat (Triticum aestivum) and barley (Hordeum vulgare), the transition to reproductive development can be accelerated by prolonged exposure to cold (vernalization). We examined the role of the grass-specific MADS box gene ODDSOC2 (OS2) in the vernalization response in cereals. The barley OS2 gene (HvOS2) is expressed in leaves and shoot apices but is repressed by vernalization. Vernalization represses OS2 independently of VERNALIZATION1 (VRN1) in a VRN1 deletion mutant of einkorn wheat (Triticum monococcum), but VRN1 is required to maintain down-regulation of OS2 in vernalized plants. Furthermore, barleys that carry active alleles of the VRN1 gene (HvVRN1) have reduced expression of HvOS2, suggesting that HvVRN1 down-regulates HvOS2 during development. Overexpression of HvOS2 delayed flowering and reduced spike, stem, and leaf length in transgenic barley plants. Plants overexpressing HvOS2 showed reduced expression of barley homologs of the Arabidopsis (Arabidopsis thaliana) gene FLOWERING PROMOTING FACTOR1 (FPF1) and increased expression of RNase-S-like genes. FPF1 promotes floral development and enhances cell elongation, so down-regulation of FPF1-like genes might explain the phenotypes of HvOS2 overexpression lines. We present an extended model of the genetic pathways controlling vernalization-induced flowering in cereals, which describes the regulatory relationships between VRN1, OS2, and FPF1-like genes. Overall, these findings highlight differences and similarities between the vernalization responses of temperate cereals and the model plant Arabidopsis. PMID:20431086
JUN regulates early transcriptional responses to axonal injury in retinal ganglion cells.
Fernandes, Kimberly A; Harder, Jeffrey M; Kim, Jessica; Libby, Richard T
2013-07-01
The AP1 family transcription factor JUN is an important molecule in the neuronal response to injury. In retinal ganglion cells (RGCs), JUN is upregulated soon after axonal injury and disrupting JUN activity delays RGC death. JUN is known to participate in the control of many different injury response pathways in neurons, including pathways controlling cell death and axonal regeneration. The role of JUN in regulating genes involved in cell death, ER stress, and regeneration was tested to determine the overall importance of JUN in regulating RGC response to axonal injury. Genes from each of these pathways were transcriptionally controlled following axonal injury and Jun deficiency altered the expression of many of these genes. The differentially expressed genes included, Atf3, Ddit3, Ecel1, Gadd45α, Gal, Hrk, Pten, Socs3, and Sprr1a. Two of these genes, Hrk and Atf3, were tested for importance in RGC death using null alleles of each gene. Disruption of the prodeath Bcl2 family member Hrk did not affect the rate or amount of RGC death after axonal trauma. Deficiency in the ATF/CREB family transcription factor Atf3 did lessen the amount of RGC death after injury, though it did not provide long term protection to RGCs. Since JUN's dimerization partner determines its transcriptional targets, the expression of several candidate AP1 family members were examined. Multiple AP1 family members were induced by axonal injury and had a different expression profile in Jun deficient retinas compared to wildtype retinas (Fosl1, Fosl2 and Jund). Overall, JUN appears to play a multifaceted role in regulating RGC response to axonal injury. Copyright © 2013 Elsevier Ltd. All rights reserved.
Li, Qiang; Byrns, Brook; Badawi, Mohamed A.; Diallo, Abdoulaye Banire; Danyluk, Jean; Sarhan, Fathey; Zou, Jitao
2018-01-01
Cold acclimation and winter survival in cereal species is determined by complicated environmentally regulated gene expression. However, studies investigating these complex cold responses are mostly conducted in controlled environments that only consider the responses to single environmental variables. In this study, we have comprehensively profiled global transcriptional responses in crowns of field-grown spring and winter wheat (Triticum aestivum) genotypes and their near-isogenic lines with the VRN-A1 alleles swapped. This in-depth analysis revealed multiple signaling, interactive pathways that influence cold tolerance and phenological development to optimize plant growth and development in preparation for a wide range of over-winter stresses. Investigation of genetic differences at the VRN-A1 locus revealed that a vernalization requirement maintained a higher level of cold response pathways while VRN-A1 genetically promoted floral development. Our results also demonstrated the influence of genetic background on the expression of cold and flowering pathways. The link between delayed shoot apex development and the induction of cold tolerance was reflected by the gradual up-regulation of abscisic acid-dependent and C-REPEAT-BINDING FACTOR pathways. This was accompanied by the down-regulation of key genes involved in meristem development as the autumn progressed. The chromosome location of differentially expressed genes between the winter and spring wheat genetic backgrounds showed a striking pattern of biased gene expression on chromosomes 6A and 6D, indicating a transcriptional regulation at the genome level. This finding adds to the complexity of the genetic cascades and gene interactions that determine the evolutionary patterns of both phenological development and cold tolerance traits in wheat. PMID:29259104
SPL13 regulates shoot branching and flowering time in Medicago sativa.
Gao, Ruimin; Gruber, Margaret Y; Amyot, Lisa; Hannoufa, Abdelali
2018-01-01
Our results show SPL13 plays a crucial role in regulating vegetative and reproductive development in Medicago sativa L. (alfalfa), and that MYB112 is targeted and downregulated by SPL13 in alfalfa. We previously showed that transgenic Medicago sativa (alfalfa) plants overexpressing microRNA156 (miR156) show a bushy phenotype, reduced internodal length, delayed flowering time, and enhanced biomass yield. In alfalfa, transcripts of seven SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factors, including SPL13, are targeted for cleavage by miR156. Thus, association of each target SPL gene to a trait or set of traits is essential for developing molecular markers for alfalfa breeding. In this study, we investigated SPL13 function using SPL13 overexpression and silenced alfalfa plants. Severe growth retardation, distorted branches and up-curled leaves were observed in miR156-impervious 35S::SPL13m over-expression plants. In contrast, more lateral branches and delayed flowering time were observed in SPL13 silenced plants. SPL13 transcripts were predominantly present in the plant meristems, indicating that SPL13 is involved in regulating shoot branch development. Accordingly, the shoot branching-related CAROTENOID CLEAVAGE DIOXYGENASE 8 gene was found to be significantly downregulated in SPL13 RNAi silencing plants. A R2R3-MYB gene MYB112 was also identified as being directly silenced by SPL13 based on Next Generation Sequencing-mediated transcriptome analysis and chromatin immunoprecipitation assays, suggesting that MYB112 may be involved in regulating alfalfa vegetative growth.
Tyler, Christina R.; Labrecque, Matthew T.; Solomon, Elizabeth R.; Guo, Xun; Allan, Andrea M.
2016-01-01
Exposure to arsenic, a common environmental toxin found in drinking water, leads to a host of neurological pathologies. We have previously demonstrated that developmental exposure to a low level of arsenic (50 ppb) alters epigenetic processes that underlie deficits in adult hippocampal neurogenesis leading to aberrant behavior. It is unclear if arsenic impacts the programming and regulation of embryonic neurogenesis during development when exposure occurs. The master negative regulator of neural-lineage, REST/NRSF, controls the precise timing of fate specification and differentiation of neural stem cells (NSCs). Early in development (embryonic day 14), we observed increased expression of Rest, its co-repressor, CoREST, and the inhibitory RNA binding/splicing protein, Ptbp1, and altered expression of mRNA spliced isoforms of Pbx1 that are directly regulated by these factors in the male brain in response to prenatal 50 ppb arsenic exposure. These increases were concurrent with decreased expression of microRNA-9 (miR-9), miR-9*, and miR-124, all of which are REST/NRSF targets and inversely regulate Rest expression to allow for maturation of NSCs. Exposure to arsenic decreased the formation of neuroblasts in vitro from NSCs derived from male pup brains. The female response to arsenic was limited to increased expression of CoREST and Ptbp2, an RNA binding protein that allows for appropriate splicing of genes involved in the progression of neurogenesis. These changes were accompanied by increased neuroblast formation in vitro from NSCs derived from female pups. Unexposed male mice express transcriptomic factors to induce differentiation earlier in development compared to unexposed females. Thus, arsenic exposure likely delays differentiation of NSCs in males while potentially inducing precocious differentiation in females early in development. These effects are mitigated by embryonic day 18 of development. Arsenic-induced dysregulation of the regulatory loop formed by REST/NRSF, its target microRNAs, miR-9 and miR-124, and RNA splicing proteins, PTBP1 and 2, leads to aberrant programming of NSC function that is perhaps perpetuated into adulthood inducing deficits in differentiation we have previously observed. PMID:27751817
Naldi, Aurélien; Baruchet, Michaël; Canella, Donatella; Le Martelot, Gwendal; Guex, Nicolas; Desvergne, Béatrice; Delorenzi, Mauro; Deplancke, Bart; Desvergne, Béatrice; Guex, Nicolas; Herr, Winship; Naef, Felix; Rougemont, Jacques; Schibler, Ueli; Deplancke, Bart; Guex, Nicolas; Herr, Winship; Guex, Nicolas; Andersin, Teemu; Cousin, Pascal; Gilardi, Federica; Gos, Pascal; Martelot, Gwendal Le; Lammers, Fabienne; Canella, Donatella; Gilardi, Federica; Raghav, Sunil; Fabbretti, Roberto; Fortier, Arnaud; Long, Li; Vlegel, Volker; Xenarios, Ioannis; Migliavacca, Eugenia; Praz, Viviane; Guex, Nicolas; Naef, Felix; Rougemont, Jacques; David, Fabrice; Jarosz, Yohan; Kuznetsov, Dmitry; Liechti, Robin; Martin, Olivier; Delafontaine, Julien; Sinclair, Lucas; Cajan, Julia; Krier, Irina; Leleu, Marion; Migliavacca, Eugenia; Molina, Nacho; Naldi, Aurélien; Rey, Guillaume; Symul, Laura; Guex, Nicolas; Naef, Felix; Rougemont, Jacques; Bernasconi, David; Delorenzi, Mauro; Andersin, Teemu; Canella, Donatella; Gilardi, Federica; Martelot, Gwendal Le; Lammers, Fabienne; Baruchet, Michaël; Raghav, Sunil
2014-01-01
In mammals, the circadian clock allows them to anticipate and adapt physiology around the 24 hours. Conversely, metabolism and food consumption regulate the internal clock, pointing the existence of an intricate relationship between nutrient state and circadian homeostasis that is far from being understood. The Sterol Regulatory Element Binding Protein 1 (SREBP1) is a key regulator of lipid homeostasis. Hepatic SREBP1 function is influenced by the nutrient-response cycle, but also by the circadian machinery. To systematically understand how the interplay of circadian clock and nutrient-driven rhythm regulates SREBP1 activity, we evaluated the genome-wide binding of SREBP1 to its targets throughout the day in C57BL/6 mice. The recruitment of SREBP1 to the DNA showed a highly circadian behaviour, with a maximum during the fed status. However, the temporal expression of SREBP1 targets was not always synchronized with its binding pattern. In particular, different expression phases were observed for SREBP1 target genes depending on their function, suggesting the involvement of other transcription factors in their regulation. Binding sites for Hepatocyte Nuclear Factor 4 (HNF4) were specifically enriched in the close proximity of SREBP1 peaks of genes, whose expression was shifted by about 8 hours with respect to SREBP1 binding. Thus, the cross-talk between hepatic HNF4 and SREBP1 may underlie the expression timing of this subgroup of SREBP1 targets. Interestingly, the proper temporal expression profile of these genes was dramatically changed in Bmal1 −/− mice upon time-restricted feeding, for which a rhythmic, but slightly delayed, binding of SREBP1 was maintained. Collectively, our results show that besides the nutrient-driven regulation of SREBP1 nuclear translocation, a second layer of modulation of SREBP1 transcriptional activity, strongly dependent from the circadian clock, exists. This system allows us to fine tune the expression timing of SREBP1 target genes, thus helping to temporally separate the different physiological processes in which these genes are involved. PMID:24603613
ERIC Educational Resources Information Center
Desmarais, Chantal; Sylvestre, Audette; Meyer, Francois; Bairati, Isabelle; Rouleau, Nancie
2010-01-01
Purpose: The presence of an expressive vocabulary delay (EVD) in the context of otherwise harmonious development has been the main criterion used to define language delay in 2-year-olds. To better understand the communicative functioning of these children, other variables must be considered. In this study, the aim was to delineate and characterize…
Gómez-Suaga, Patricia; Rivero-Ríos, Pilar; Fdez, Elena; Blanca Ramírez, Marian; Ferrer, Isidro; Aiastui, Ana; López De Munain, Adolfo; Hilfiker, Sabine
2014-12-20
Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene cause late-onset autosomal dominant Parkinson's disease (PD), and sequence variations at the LRRK2 locus are associated with increased risk for sporadic PD. LRRK2 contains both GTPase and kinase domains flanked by protein interaction motifs, and mutations associated with familial PD have been described for both catalytic domains. LRRK2 has been implicated in diverse cellular processes, and recent evidence pinpoints to an important role for LRRK2 in modulating a variety of intracellular membrane trafficking pathways. However, the underlying mechanisms are poorly understood. Here, by studying the classical, well-understood, degradative trafficking pathway of the epidermal growth factor receptor (EGFR), we show that LRRK2 regulates endocytic membrane trafficking in an Rab7-dependent manner. Mutant LRRK2 expression causes a slight delay in early-to-late endosomal trafficking, and a pronounced delay in trafficking out of late endosomes, which become aberrantly elongated into tubules. This is accompanied by a delay in EGFR degradation. The LRRK2-mediated deficits in EGFR trafficking and degradation can be reverted upon coexpression of active Rab7 and of a series of proteins involved in bridging the EGFR to Rab7 on late endosomes. Effector pulldown assays indicate that pathogenic LRRK2 decreases Rab7 activity both in cells overexpressing LRRK2, as well as in fibroblasts from pathogenic mutant LRRK2 PD patients when compared with healthy controls. Together, these findings provide novel insights into a previously unknown regulation of Rab7 activity by mutant LRRK2 which impairs membrane trafficking at very late stages of the endocytic pathway. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
ERIC Educational Resources Information Center
Avci, Suleyman
2013-01-01
The present study was conducted on 508 (331 female, 144 male) first grade university students in order to investigate the relations between self regulation, the future time perspectives, and the delay of gratification in the academic field. A future time perspective scale, an academic delay of gratification scale and a motivational strategies for…
Progranulin regulates neurogenesis in the developing vertebrate retina.
Walsh, Caroline E; Hitchcock, Peter F
2017-09-01
We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.
Matthies, Swantje; Philipsen, Alexandra; Lackner, Helmut Karl; Sadohara, Chiharu; Svaldi, Jennifer
2014-12-15
Emotion dysregulation is a recognized symptom of adult Attention Deficit Hyperactivity Disorder (ADHD). The aim of this study is to induce sadness in adults suffering from ADHD and to investigate the impact of emotion regulation strategies on sadness intensity, and psychophysiological measures. Thirty-six adults diagnosed with ADHD were randomly assigned to either expressive suppression (SUPP) or acceptance (ACC) of emotion. Sadness was induced using a film clip. Participants estimated the intensity of sadness and the perception of being overwhelmed with emotion before (T1), immediately after (T2) and 2 min after the film (T3). Physiological measures were obtained. Sadness induction was effective in both conditions. The perception of being overwhelmed with emotion increased between T1 and T2 in both conditions, but persisted until T3 only in the expressive suppression condition whereas a decrease was observed in the acceptance condition. In ADHD expressive suppression of sadness seems to be associated to a prolonged recovery from the perception of being overwhelmed with emotion. Emotion-regulation via acceptance in contrast appears to allow faster recovery from the perception of being overwhelmed with emotion. To our knowledge, this is the first study to identify suppression as a critical mediator between an induced emotion and delayed recovery from emotional reactions in adult ADHD. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Song, Guo-Qing; Gao, Xuan
2017-06-19
Constitutive expression of the CBF/DREB1 for increasing freezing tolerance in woody plants is often associated with other phenotypic changes including dwarf plant and delayed flowering. These phenotypic changes have been observed when Arabidopsis DWARF AND DELAYED FLOWERING 1 (DDF1) was overexpressed in A. thaliana plants. To date, the DDF1 orthologues have not been studied in woody plants. The aim of this study is to investigate transcriptomic responses to the overexpression of blueberry (Vaccinium corymbosum) DDF1 (herein, VcDDF1-OX). The VcDDF1-OX resulted in enhanced freezing tolerance in tetraploid blueberry plants and did not result in significant changes in plant size, chilling requirement, and flowering time. Comparative transcriptome analysis of transgenic 'Legacy-VcDDF1-OX' plants containing an overexpressed VcDDF1 with non-transgenic highbush blueberry 'Legacy' plants revealed the VcDDF1-OX derived differentially expressed (DE) genes and transcripts in the pathways of cold-response, plant flowering, DELLA proteins, and plant phytohormones. The increase in freezing tolerance was associated to the expression of cold-regulated genes (CORs) and the ethylene pathway genes. The unchanged plant size, dormancy and flowering were due to the minimal effect of the VcDDF1-OX on the expression of DELLA proteins, flowering pathway genes, and the other phytohormone genes related to plant growth and development. The DE genes in auxin and cytokinin pathways suggest that the VcDDF1-OX has also altered plant tolerance to drought and high salinity. A DDF1 orthologue in blueberry functioned differently from the DDF1 reported in Arabidopsis. The overexpression of VcDDF1 or its orthologues is a new approach to increase freezing tolerance of deciduous woody plant species with no obvious effect on plant size and plant flowering time.
Jiménez, Juan M.; Prasad, Varesh; Yu, Michael D.; Kampmeyer, Christopher P.; Kaakour, Abdul-Hadi; Wang, Pei-Jiang; Maloney, Sean F.; Wright, Nathan; Johnston, Ian; Jiang, Yi-Zhou; Davies, Peter F.
2014-01-01
Drug eluting stents are associated with late stent thrombosis (LST), delayed healing and prolonged exposure of stent struts to blood flow. Using macroscale disturbed and undisturbed fluid flow waveforms, we numerically and experimentally determined the effects of microscale model strut geometries upon the generation of prothrombotic conditions that are mediated by flow perturbations. Rectangular cross-sectional stent strut geometries of varying heights and corresponding streamlined versions were studied in the presence of disturbed and undisturbed bulk fluid flow. Numerical simulations and particle flow visualization experiments demonstrated that the interaction of bulk fluid flow and stent struts regulated the generation, size and dynamics of the peristrut flow recirculation zones. In the absence of endothelial cells, deposition of thrombin-generated fibrin occurred primarily in the recirculation zones. When endothelium was present, peristrut expression of anticoagulant thrombomodulin (TM) was dependent on strut height and geometry. Thinner and streamlined strut geometries reduced peristrut flow recirculation zones decreasing prothrombotic fibrin deposition and increasing endothelial anticoagulant TM expression. The studies define physical and functional consequences of macro- and microscale variables that relate to thrombogenicity associated with the most current stent designs, and particularly to LST. PMID:24554575
ABA, porphyrins and plant TSPO-related protein.
Guillaumot, Damien; Guillon, Stéphanie; Morsomme, Pierre; Batoko, Henri
2009-11-01
We have shown that, unexpectedly, AtTSPO (Arabidopsis thaliana TSPO-related protein) is an endoplasmic reticulum and Golgi-localized membrane protein in plant cells.(1) This localization contrasts with that of mammalian 18-kDa translocator protein (at least for the mostly studied isoform, 18-kDa TSPO), a mitochondrial outer membrane protein (reviewed in ref. 2). Whereas the potential functions of 18-kDa TSPO are well documented, involved mainly in mitochondrial physiology,(2) and its interest as drugs target is been explored,(3) the roles of TSPO-related proteins in plant growth and development are yet to be specified. AtTSPO is expressed in dry seeds and can be induced in vegetative tissues by osmotic and salt stress or abscisic acid (ABA) treatment. Moreover, it was shown that the ABA-dependent induction is transient, and that boosting tetrapyrroles biosynthesis through 5-aminolevulinic acid (ALA) feeding enhanced downregulation of AtTSPO, suggesting an inherent post-translational regulation mechanism also involving ABA and likely porphyrins. We present additional evidence that ABA can help stabilize constitutively expressed AtTSPO and that ALA feeding to knockout mutant seeds, induces substantial germination delay. Here we discuss the possible link between ABA and tetrapyrroles in AtTSPO expression and post-translational regulation.
Monks, D. Ashley; Zovkic, Iva B.; Holmes, Melissa M.
2018-01-01
The social environment can alter pubertal timing through neuroendocrine mechanisms that are not fully understood; it is thought that stress hormones (e.g., glucocorticoids or corticotropin-releasing hormone) influence the hypothalamic-pituitary-gonadal axis to inhibit puberty. Here, we use the eusocial naked mole-rat, a unique species in which social interactions in a colony (i.e. dominance of a breeding female) suppress puberty in subordinate animals. Removing subordinate naked mole-rats from this social context initiates puberty, allowing for experimental control of pubertal timing. The present study quantified gene expression for reproduction- and stress-relevant genes acting upstream of gonadotropin-releasing hormone in brain regions with reproductive and social functions in pre-pubertal, post-pubertal, and opposite sex-paired animals (which are in various stages of pubertal transition). Results indicate sex differences in patterns of neural gene expression. Known functions of genes in brain suggest stress as a key contributing factor in regulating male pubertal delay. Network analysis implicates neurokinin B (Tac3) in the arcuate nucleus of the hypothalamus as a key node in this pathway. Results also suggest an unappreciated role for the nucleus accumbens in regulating puberty. PMID:29474488
Differential Role of Poly(ADP-ribose) polymerase in D. discoideum growth and development
2011-01-01
Background Poly(ADP-ribose) polymerase is evolutionarily conserved as a responder to various forms of stress. Though PARP's role in cell death is well addressed, its role in development and multicellularity is still an enigma. We have previously reported the role of PARP in oxidative stress induced delayed development of D. discoideum. Results In the current study we highlight the involvement of PARP during D. discoideum development. Oxidative stress affects expression of aca and cAR1 thus affecting aggregation. Although parp expression is not affected during oxidative stress but it is involved during normal development as confirmed by our PARP down-regulation studies. Constitutive PARP down-regulation resulted in blocked development while no effect was observed on D. discoideum growth. Interestingly, stage specific PARP down-regulation arrested development at the slug stage. Conclusion These results emphasize that PARP is essential for complex differentiation and its function may be linked to multicellularity. This is the first report where the involvement of PARP during normal multicellular development in D. discoideum, an ancient eukaryote, is established which could be of evolutionary significance. Thus our study adds one more role to the multitasking function of PARP. PMID:21385463
Immunological consequences of kidney cell death.
Sarhan, Maysa; von Mässenhausen, Anne; Hugo, Christian; Oberbauer, Rainer; Linkermann, Andreas
2018-01-25
Death of renal cells is central to the pathophysiology of acute tubular necrosis, autoimmunity, necrotizing glomerulonephritis, cystic kidney disease, urosepsis, delayed graft function and transplant rejection. By means of regulated necrosis, immunogenic damage-associated molecular patterns (DAMPs) and highly reactive organelles such as lysosomes, peroxisomes and mitochondria are released from the dying cells, thereby causing an overwhelming immunologic response. The rupture of the plasma membrane exhibits the "point of no return" for the immunogenicity of regulated cell death, explaining why apoptosis, a highly organized cell death subroutine with long-lasting plasma membrane integrity, elicits hardly any immune response. Ferroptosis, an iron-dependent necrotic type cell death, results in the release of DAMPs and large amounts of lipid peroxides. In contrast, anti-inflammatory cytokines are actively released from cells that die by necroptosis, limiting the DAMP-induced immune response to a surrounding microenvironment, whereas at the same time, inflammasome-associated caspases drive maturation of intracellularly expressed interleukin-1β (IL-1β). In a distinct setting, additionally interleukin-18 (IL-18) is expressed during pyroptosis, initiated by gasdermin-mediated plasma membrane rupture. As all of these pathways are druggable, we provide an overview of regulated necrosis in kidney diseases with a focus on immunogenicity and potential therapeutic interventions.
Mahmoud, Salma; Ibrahim, Mohammed; Hago, Ahmed; Huang, Yuhong; Wei, Yuanyi; Zhang, Jun; Zhang, Qingqing; Xiao, Yu; Wang, Jingwen; Adam, Munkaila; Guo, Yu; Wang, Li; Zhou, Shuting; Xin, Boyi; Xuan, Wei; Tang, Jianwu
2016-11-15
Lymphatic vessels function as transport channels for tumor cells to metastasize from the primary site into the lymph nodes. In this experiment we evaluated the effect of Sulfatase-1 (Sulf-1) on metastasis by upregulating it in murine hepatocarcinoma cell line Hca-F with high lymph node metastatic rate of >75%. The study in vitro showed that up regulation of Sulf-1 in Hca-F cells significantly reduced cell proliferation, migration and invasion (p<0.05). Also, the forced expression of Sulf-1 down regulated Mesothelin (Msln) at both the protein and mRNA levels. The experiment in vivo further showed that up-regulation of Sulf-1 with the attendant downregulation of mesothelin delayed tumor growth and decreased lymph node metastasis. In conclusion, our findings show that Sulf-1 is an important tumor suppressor gene in hepatocellular carcinoma (HCC), and its over expression downregulates Msln and results in a decrease in HCC cell proliferation, migration, invasion, and lymphatic metastasis. This functional relationship between Sulf-1 and Msln could be exploited for the development of a novel liver cancer therapy.
Arnab, Banerjee; Amitabh, Krishna
2011-02-10
The aim of this study was to compare the changes in concentration of glucose and glucose transporters (GLUTs) in the utero-embryonic unit, consisting of decidua, trophoblast and embryo, during delayed and non-delayed periods to understand the possible cause of delayed embryonic development in Cynopterus sphinx. The results showed a significantly decreased concentration of glucose in the utero-embryonic unit due to decline in the expression of insulin receptor (IR) and GLUT 3, 4 and 8 proteins in the utero-embryonic unit during delayed period. The in vitro study showed suppressive effect of insulin on expression of GLUTs 4 and 8 in the utero-embryonic unit and a significant positive correlation between the decreased amount of glucose consumed by the utero-embryonic unit and decreased expression of GLUTs 4 (r=0.99; p<0.05) and 8 (r=0.98; p<0.05). The in vivo study showed expression of IR and GLUT 4 proteins in adipose tissue during November suggesting increased transport of glucose to adipose tissue for adipogenesis. This study showed increased expression of HSL and OCTN2 and increased availability of l-carnitine to utero-embryonic unit suggesting increased transport of fatty acid to utero-embryonic unit during the period of delayed embryonic development. Hence it appears that due to increased transport of glucose for adipogenesis prior to winter, glucose utilization by utero-embryonic unit declines and this may be responsible for delayed embryonic development in C. sphinx. Increased supply of fatty acid to the delayed embryo may be responsible for its survival under low glucose condition but unable to promote embryonic development in C. sphinx. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Ye, Xia; Fu, Mengmeng; Liu, Yu; An, Dongliang; Zheng, Xianbo; Tan, Bin; Li, Jidong; Cheng, Jun; Wang, Wei; Feng, Jiancan
2018-05-04
Ethylene plays an important role in the grape rachis, where its production can be 10 times higher than in the berry. VvACS1 is the only rachis-specific ACC synthase (ACS) gene, and its expression is coincident with ethylene production in the rachis of Vitis vinifera 'Thompson seedless'. VvACS1 was cloned and ectopically expressed in tomato (Solanum lycopersicum 'Moneymaker'). Lateral buds were increased in two- or four-week-old 35s∷VvACS1 transgenic tomato plants after transplanting. Compared with wild-type (WT) plants, the transgenic tomato plants showed higher expression of the VvACS1 gene in the flowers, leaves, rachis, and fruits. There was no obvious difference of ACS activity in the fruit of tomato, and only increased ACS activity in the rachis of tomato. Ethylene production was decreased in flowers, leaves, and fruits (seven weeks after full bloom), while the relative expression of endogenous tomato ACS1 and ACS6 genes was not down-regulated by the ectopic expression of VvACS1. These results imply that post-transcriptional or post-translational regulation of ACS may occur, resulting in lower ethylene production in the transgenic tomato plants. Moreover, expression of VvACS1 in tomato resulted in decreased auxin and increased zeatin contents in the lateral buds, as well as reduced or delayed formation of adventitious roots in lateral bud cuttings. RNA-Seq and qRT-PCR analyses of rooted lateral bud cuttings indicated that the relative expression levels of the genes for zeatin O-glucosyltransferase-like, auxin repressed/dormancy-associated protein, and ERF transcription factors were higher in transgenic tomatoes than in WT, suggesting that ethylene may regulate auxin transport and distribution in shoots and that adventitious root formation employs coordination between auxin and ethylene. Copyright © 2018 Elsevier GmbH. All rights reserved.
Kim, Sung Tae; Moley, Kelle H.
2009-01-01
Adequate uterine glucose metabolism is an essential part of embryo implantation and the development of an adequate utero-fetal environment. However, expression of facilitative glucose transporters (GLUTs [solute transporter family SLC2A]) and AKT/MAPK/PRKAA (PRKAA) signaling has not been described in the mouse uterine cells, to our knowledge. The objective of this study was to determine the hormonal regulation of SLC2A protein expression and AKT/MAPK/PRKAA signaling in the mouse uterine epithelial cells during estrous cycles and peri-implantation periods. SLC2As 1, 4, 8, and 9B were highly expressed in the luminal and glandular epithelia of estrous stage. In metestrous and diestrous stages, expression of SLC2As 1, 4, 8, and 9B was lower than that in proestrous stage. Levels of activated phospho-AKT (p-AKT), p-MAPK3, and p-MAPK1 also varied during the estrous cycle. Estrogen and progesterone injection in an ovariectomized mouse (delayed implantation model) resulted in a decrease and an increase, respectively, in expression of GLUTs in the luminal epithelial cells of the uterus. The expression of SLC2A1, SLC2A8, SLC2A9B, p-AKT, p-MAPK3/1, and p-PRKAA was increased in the decidual region of the implantation sites and was significantly increased in the uterus of activated implantation. Using an artificial decidualization mouse model, it was also demonstrated that expression of the same GLUTs, p-MAPK3/1, and p-PRKAA was dramatically higher in the decidualized uteri than that in the control uteri. These results suggest that steroid hormones regulate expression of uterine epithelial GLUTs possibly through AKT/MAPK/PRKAA signaling pathways and that glucose utilization may have an important role in decidualization and possibly in the maintenance of pregnancy. PMID:19208550
Cho, Sun Wook; Kim, Young A; Sun, Hyun Jin; Ahn, Hwa Young; Lee, Eun Kyung; Yi, Ka Hee; Oh, Byung-Chul; Park, Do Joon; Cho, Bo Youn; Park, Young Joo
2014-09-01
Aberrant activation of the Wnt/β-catenin pathway is a common pathogenesis of various human cancers. We investigated the role of the Wnt inhibitor, Dkk-1, in papillary thyroid cancer (PTC). Immunohistochemical β-catenin staining was performed in tissue microarray containing 148 PTCs and five normal thyroid tissues. In vivo effects of Dkk-1 were explored using ectopic tumors with BHP10-3SC cells. In 27 PTC patients, 60% of patients showed β-catenin up-regulation and Dkk-1 down-regulation in tumor vs normal tissues. Tissue microarray analysis showed that 14 of 148 PTC samples exhibited cytoplasmic-dominant β-catenin expression compared to membranous-dominant expression in normal tissues. Aberrant β-catenin expression was significantly correlated with higher rates of the loss of membranous E-cadherin expression and poor disease-free survival than that in the normal membranous expression group over a median follow-up period of 14 years. Implantation of Dkk-1-overexpressing BHP10-3SC cells revealed delayed tumor growth, resulting from the rescue of membranous β-catenin and E-cadherin expressions. Furthermore, tissue microarray analysis demonstrated that BRAF(WT) patients had higher rates of aberrant expressions of β-catenin and E-cadherin than BRAF(V600E) patients. Indeed, the inhibitory effects of Dkk-1 on cell survival were more sensitive in BRAF(WT) (BHP10-3SC and TPC-1) than in BRAF(V600E) (SNU-790 and BCPAP) cells. Overexpression of BRAF(V600E) in normal thyroid epithelial (H tori) cells also reduced the effects of Dkk-1 on cell survival. A subset of PTC patients showed aberrant expression of β-catenin/E-cadherin signaling and poor disease-free survival. Dkk-1 might have a therapeutic role, particularly in BRAF(WT) patients.
Daughter-Specific Transcription Factors Regulate Cell Size Control in Budding Yeast
Di Talia, Stefano; Wang, Hongyin; Skotheim, Jan M.; Rosebrock, Adam P.; Futcher, Bruce; Cross, Frederick R.
2009-01-01
In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle. PMID:19841732
Shimoni, Einav; Asbe, Marwa; Eyal, Tal; Berger, Andrea
2016-01-01
We examined the effect of the distinct positive emotions pride and joy on children's self-regulation, focusing on their ability to delay gratification (i.e., resist a temptation in favor of a long-term goal). We hypothesized that because pride corresponds to the attainment of long-term goals and joy corresponds to the attainment of immediate desires, the experience of pride may signal sufficient progress toward a long-term goal, resulting in less delay of gratification than the experience of joy. To test this hypothesis, we induced an experience of pride or joy in 8-year-old children. At this age, the ability to self-regulate--and to experience pride and joy distinctively--is relatively mature. We then measured performance in a delay discounting task. We found that, compared with the joy condition and a control condition, children who experienced pride performed worse on the delay discounting task (p=.045), indicating poorer self-regulation. This result suggests that emotions may function as cues for sufficient goal pursuit, thereby influencing self-regulation from a very young age. Copyright © 2015 Elsevier Inc. All rights reserved.
Fukui, Mitsue
2003-11-01
Two-year old saplings grown from cuttings of Cryptomeria japonica D. Don initiate strobilus development following treatment with gibberellic acid under long-day photoperiods. At 25 degrees C with a 14-h photoperiod in a phytotron, male strobili initiated normally; however, they remained green and fell from the saplings prematurely. To examine the change in male strobilus development at the molecular level, three genes expressed specifically in male strobili were analyzed. Two were MADS box genes homologous to the B-function genes in angiosperms, CjMADS1 and CjMADS2, and the third was Cry j I, which encodes an allergen protein, and this gene is expressed mainly in microspores. Under phytotron growing conditions, the homeotic genes were expressed constantly, which reflected the extended early developmental stage of male strobili. On the other hand, Cry j I expression was detected after a long delay just before strobilus development ceased. These results indicate that the expression of the genes related to male reproductive development in C. japonica is regulated by a factor(s) that is sensitive to environmental signals.
Alkaline phosphatase in osteoblasts is down-regulated by pulsatile fluid flow
NASA Technical Reports Server (NTRS)
Hillsley, M. V.; Frangos, J. A.
1997-01-01
It is our hypothesis that interstitial fluid flow plays a role in the bone remodeling response to mechanical loading. The fluid flow-induced expression of three proteins (collagen, osteopontin, and alkaline phosphatase) involved in bone remodeling was investigated. Rat calvarial osteoblasts subjected to pulsatile fluid flow at an average shear stress of 5 dyne/cm2 showed decreased alkaline phosphatase (AP) mRNA expression after only 1 hour of flow. After 3 hours of flow, AP mRNA levels had decreased to 30% of stationary control levels and remained at this level for an additional 5 hours of flow. Steady flow (4 dyne/cm2 fluid shear stress), in contrast, resulted in a delayed and less dramatic decrease in AP mRNA expression to 63% of control levels after 8 hours of flow. The reduced AP mRNA expression under pulsatile flow conditions was followed by reduced AP enzyme activity after 24 hours. No changes in collagen or osteopontin mRNA expression were detected over 8 hours of pulsatile flow. This is the first time fluid flow has been shown to affect gene expression in osteoblasts.
Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua
2014-01-01
Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257
MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
Liberman, Louisa M.; Sparks, Erin E.; Moreno-Risueno, Miguel A.; Petricka, Jalean J.; Benfey, Philip N.
2015-01-01
Stem cells are defined by their ability to self-renew and produce daughter cells that proliferate and mature. These maturing cells transition from a proliferative state to a terminal state through the process of differentiation. In the Arabidopsis thaliana root the transcription factors SCARECROW and SHORTROOT regulate specification of the bipotent stem cell that gives rise to cortical and endodermal progenitors. Subsequent progenitor proliferation and differentiation generate mature endodermis, marked by the Casparian strip, a cell-wall modification that prevents ion diffusion into and out of the vasculature. We identified a transcription factor, MYB DOMAIN PROTEIN 36 (MYB36), that regulates the transition from proliferation to differentiation in the endodermis. We show that SCARECROW directly activates MYB36 expression, and that MYB36 likely acts in a feed-forward loop to regulate essential Casparian strip formation genes. We show that myb36 mutants have delayed and defective barrier formation as well as extra divisions in the meristem. Our results demonstrate that MYB36 is a critical positive regulator of differentiation and negative regulator of cell proliferation. PMID:26371322
Density, Frequency and the Expressive Phonology of Children with Phonological Delay
ERIC Educational Resources Information Center
Gierut, Judith A.; Morrisette, Michele L.
2012-01-01
The effect of word-level variables on expressive phonology has not been widely studied, although the properties of words likely bear on the emergence of sound structure (Stoel-Gammon, 2011). Eight preschoolers, diagnosed with phonological delay, were assigned to treatment to experimentally induce gains in expressive phonology. Erred sounds were…
Xie, Meilan; Yan, Jie; He, Chao; Yang, Li; Tan, Gang; Li, Chao; Hu, Zhian; Wang, Jiali
2015-06-01
Hippocampus-dependent learning memory is sensitive to sleep deprivation (SD). Although the ionotropic glutamate receptors play a vital role in synaptic plasticity and learning and memory, however, whether the expression of these receptor subunits is modulated by sleep loss remains unclear. In the present study, western blotting was performed by probing with specific antibodies against the ionotropic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunits GluA1, GluA2, GluA3, and against the N-methyl-d-aspartate (NMDA) glutamate receptor subunits GluN1, GluN2A, GluN2B. In hippocampus, down regulation of surface GluA1 and GluN2A surface expression were observed in both SD groups. However, surface expression level of GluA2, GluA3, GluN1 and GluN2B was significantly up-regulated in 8h-SD rats when compared to the 4h-SD rats. In parallel with the complex changes in AMPA and NMDA receptor subunit expressions, we found the 8h-SD impaired rat spatial working memory in 30-s-delay T-maze task, whereas no impairment of spatial learning was observed in 4h-SD rats. These results indicate that sleep loss alters the relative expression levels of the AMPA and NMDA receptors, thus affects the synaptic strength and capacity for plasticity and partially contributes to spatial memory impairment. Copyright © 2015. Published by Elsevier B.V.
Chronic Social Isolation Enhances Reproduction in the Monogamous Prairie Vole (Microtus ochrogaster)
Perry, Adam N.; Carter, C. Sue; Cushing, Bruce S.
2016-01-01
Chronic stressors are generally considered to disrupt reproduction and inhibit mating. Here we test the hypothesis that a chronic stressor, specifically social isolation, can facilitate adaptive changes that enhance/accelerate reproductive effort. In general, monogamous species display high levels of prosociality, delayed sexual maturation, and greater parental investment in fewer, higher quality offspring compared with closely related polygynous species. We predicted that chronic social isolation would promote behavioral and neurochemical patterns in prairie voles associated with polygyny. Male and female prairie voles were isolated for four weeks and changes in mating behavior, alloparental care, estrogen receptor (ER) α expression and tyrosine hydroxylase (TH) expression in brain regions regulating sociosexual behavior were examined. In males, isolation accelerated copulation, increased ERα in the medial amygdala (MEApd) and bed nucleus of the stria terminalis (BSTpm), and reduced TH expression in the MEApd and BSTpm, but had no effect on alloparental behavior. In females, isolation resulted in more rapid estrus induction and reduced TH expression in the MEApd and BSTpm, but had no effect on estradiol sensitivity or ERα expression. The results support the hypothesis that ERα expression in the MEApd and BSTpm is a critical determinant of male copulatory behavior and/or mating system. The lack of change in alloparental behavior suggests that changes in prosocial behavior are selective and regulated by different mechanisms. The results also suggest that TH in the MEApd and BSTpm may play a critical role in determining mating behavior in both sexes. PMID:26939085
Wilson, Anna C.; Lengua, Liliana J.; Tininenko, Jennifer; Taylor, Adam; Trancik, Anika
2009-01-01
This longitudinal study utilized a community sample of children (N=91, 45% female, 8–11 years at time 1) to investigate physiological responses (heart rate reactivity [HRR] and electrodermal responding [EDR]) during delay of gratification in relation to emotionality, self-regulation, and adjustment problems. Cluster analyses identified three profiles among children who successfully delayed: children who waited easily with low EDR and moderate HRR, children who had difficulty waiting with high EDR and moderate HRR, and children who had difficulty waiting with low EDR and low HRR. The 3 clusters and children who did not wait were compared. Children with low EDR-low HRR had the lowest self-regulation, and like the no-wait group, demonstrated the greatest baseline adjustment problems. The high EDR-moderate HRR group demonstrated highest self-regulation and increases in depression across one year. Distinct profiles among children in delay contexts point to children who are over- and under-regulated with implications for adjustment problems. PMID:20046898
Rosianskey, Yogev; Dahan, Yardena; Yadav, Sharawan; Freiman, Zohar E; Milo-Cochavi, Shira; Kerem, Zohar; Eyal, Yoram; Flaishman, Moshe A
2016-08-01
Expression of 13 genes encoding chlorophyll biosynthesis and degradation was evaluated. Chlorophyll degradation was differentially regulated in pollinated and parthenocarpic fig fruits, leading to earlier chlorophyll degradation in parthenocarpic fruits. Varieties of the common fig typically yield a commercial summer crop that requires no pollination, although it can be pollinated. Fig fruit pollination results in larger fruit size, greener skin and darker interior inflorescence color, and slows the ripening process compared to non-pollinated fruits. We evaluated the effect of pollination on chlorophyll content and levels of transcripts encoding enzymes of the chlorophyll metabolism in fruits of the common fig 'Brown Turkey'. We cloned and evaluated the expression of 13 different genes. All 13 genes showed high expression in the fruit skin, inflorescences and leaves, but extremely low expression in roots. Pollination delayed chlorophyll breakdown in the ripening fruit skin and inflorescences. This was correlated with the expression of genes encoding enzymes in the chlorophyll biosynthesis and degradation pathways. Expression of pheophorbide a oxygenase (PAO) was strongly negatively correlated with chlorophyll levels during ripening in pollinated fruits; along with its high expression levels in yellow leaves, this supports a pivotal role for PAO in chlorophyll degradation in figs. Normalizing expression levels of all chlorophyll metabolism genes in the pollinated and parthenocarpic fruit skin and inflorescences showed three synthesis (FcGluTR1, FcGluTR2 and FcCLS1) and three degradation (FcCLH1, FcCLH2 and FcRCCR1) genes with different temporal expression in the pollinated vs. parthenocarpic fruit skin and inflorescences. FcCAO also showed different expressions in the parthenocarpic fruit skin. Thus, chlorophyll degradation is differentially regulated in the pollinated and parthenocarpic fruit skin and inflorescences, leading to earlier and more sustained chlorophyll degradation in the parthenocarpic fruit.
Takabatake, Akiko; Kawazoe, Nozomi; Izawa, Shingo
2015-03-01
Yro2 and its paralogous protein Mrh1 of Saccharomyces cerevisiae have seven predicted transmembrane domains and predominantly localize to the plasma membrane. Their physiological functions and regulation of gene expression have not yet been elucidated in detail. We herein demonstrated that MRH1 was constitutively expressed, whereas the expression of YRO2 was induced by acetic acid stress and entering the stationary phase. Fluorescence microscopic analysis revealed that Mrh1 and Yro2 were distributed as small foci in the plasma membrane under acetic acid stress conditions. The null mutants of these genes (mrh1∆, yro2∆, and mrh1∆yro2∆) showed delayed growth and a decrease in the productivity of ethanol in the presence of acetic acid, indicating that Yro2 and Mrh1 are involved in tolerance to acetic acid stress.
Tight Junction Protein 1a regulates pigment cell organisation during zebrafish colour patterning.
Fadeev, Andrey; Krauss, Jana; Frohnhöfer, Hans Georg; Irion, Uwe; Nüsslein-Volhard, Christiane
2015-04-27
Zebrafish display a prominent pattern of alternating dark and light stripes generated by the precise positioning of pigment cells in the skin. This arrangement is the result of coordinated cell movements, cell shape changes, and the organisation of pigment cells during metamorphosis. Iridophores play a crucial part in this process by switching between the dense form of the light stripes and the loose form of the dark stripes. Adult schachbrett (sbr) mutants exhibit delayed changes in iridophore shape and organisation caused by truncations in Tight Junction Protein 1a (ZO-1a). In sbr mutants, the dark stripes are interrupted by dense iridophores invading as coherent sheets. Immuno-labelling and chimeric analyses indicate that Tjp1a is expressed in dense iridophores but down-regulated in the loose form. Tjp1a is a novel regulator of cell shape changes during colour pattern formation and the first cytoplasmic protein implicated in this process.
Fine motor skill predicts expressive language in infant siblings of children with autism.
LeBarton, Eve Sauer; Iverson, Jana M
2013-11-01
We investigated whether fine motor and expressive language skills are related in the later-born siblings of children with autism (heightened-risk, HR infants) who are at increased risk for language delays. We observed 34 HR infants longitudinally from 12 to 36 months. We used parent report and standardized observation measures to assess fine motor skill from 12 to 24 months in HR infants (Study 1) and its relation to later expressive vocabulary at 36 months in HR infants (Study 2). In Study 1, we also included 25 infants without a family history of autism to serve as a normative comparison group for a parent-report fine motor measure. We found that HR infants exhibited fine motor delays between 12 and 24 months and expressive vocabulary delays at 36 months. Further, fine motor skill significantly predicted expressive language at 36 months. Fine motor and expressive language skills are related early in development in HR infants, who, as a group, exhibit risk for delays in both. Our findings highlight the importance of considering fine motor skill in children at risk for language impairments and may have implications for early identification of expressive language difficulties. © 2013 John Wiley & Sons Ltd.
Pan, Yaoqian; Balazs, Louisa; Tigyi, Gabor; Yue, Junming
2013-01-01
Dicer is a RNAase III enzyme that cleaves double stranded RNA and generates small interfering RNA (siRNA) and microRNA (miRNA). The goal of this study is to examine the role of Dicer and miRNAs in vascular smooth muscle cells (VSMCs). We deleted Dicer in VSMCs of mice, which caused a developmental delay that manifested as early as embryonic day E12.5, leading to embryonic death between E14.5 and E15.5 due to extensive hemorrhage in the liver, brain, and skin. Dicer KO embryos showed dilated blood vessels and a disarray of vascular architecture between E14.5 and E15.5. VSMC proliferation was significantly inhibited in Dicer KOs. The expression of VSMC marker genes were significantly downregulated in Dicer cKO embryos. The vascular structure of the yolk sac and embryo in Dicer KOs was lost to an extent that no blood vessels could be identified after E15.5. Expression of most miRNAs examined was compromised in VSMCs of Dicer KO. Our results indicate that Dicer is required for vascular development and regulates vascular remodeling by modulating VSMC proliferation and differentiation. PMID:21371421
Proliferation, differentiation and apoptosis in connexin43-null osteoblasts
NASA Technical Reports Server (NTRS)
Furlan, F.; Lecanda, F.; Screen, J.; Civitelli, R.
2001-01-01
Osteoblasts are highly coupled by gap junctions formed primarily by connexin43 (Cx43). We have shown that interference with Cx43 expression or function disrupts transcriptional regulation of osteoblast genes, and that deletion of Cx43 in the mouse causes skeletal malformations, delayed mineralization, and osteoblast dysfunction. Here, we studied the mechanisms by which genetic deficiency of Cx43 alters osteoblast development. While cell proliferation rates were similar in osteoblastic cells derived from calvaria of Cx43-null and wild type mice, camptothecin-induced apoptosis was 3-fold higher in mutant compared to wild type osteoblasts. When grown in mineralizing medium, Cx43-null cells were able to produce mineralized matrix but it took one week longer to reach the same mineralization levels as in normal cells. Likewise, expression of alkaline phosphatase activity per cell--a marker of osteoblast differentiation--was maximal only 2 weeks later in Cx43-null relative to wild-type cells. These observations suggest that Cx43 is important for a normal and timely development of the osteoblastic phenotype. Delayed differentiation and increase programmed cell death may explain the skeletal phenotype of Cx43-null mice.
Komohara, Yoshihiro; Takemura, Kenichi; Lei, Xiao Feng; Sakashita, Naomi; Harada, Mamoru; Suzuki, Hiroshi; Kodama, Tatsuhiko; Takeya, Motohiro
2009-11-01
Class A scavenger receptors (SR-A, CD204) are highly expressed in tumor-associated macrophages (TAM). To investigate the function of SR-A in TAM, wild-type and SR-A-deficient (SR-A(-/-)) mice were injected with EL4 cells. Although these groups of mice did not differ in the numbers of infiltrating macrophages and lymphocytes and in neovascularization, SR-A(-/-) mice had delayed growth of EL4 tumors. Expression of inducible nitric oxide (NO) synthase and interferon (IFN)-gamma mRNA increased significantly in tumor tissues from SR-A(-/-) mice. Engulfment of necrotic EL4 cells induced upregulation of NO and IFN-gamma production by cultured macrophages, and production of NO and IFN-gamma increased in SR-A(-/-) macrophages in vitro. IFN-beta production by cultured macrophages was also elevated in SR-A(-/-) macrophages in vitro. These results suggested that the antitumor activity of macrophages increased in SR-A(-/-) mice because of upregulation of NO and IFN-gamma production. These data indicate an important role of SR-A in regulating TAM function by inhibiting toll-like receptor (TLR)4-IFN-beta signaling.
Taurine activates delayed rectifier KV channels via a metabotropic pathway in retinal neurons
Bulley, Simon; Liu, Yufei; Ripps, Harris; Shen, Wen
2013-01-01
Taurine is one of the most abundant amino acids in the retina, throughout the CNS, and in heart and muscle cells. In keeping with its broad tissue distribution, taurine serves as a modulator of numerous basic processes, such as enzyme activity, cell development, myocardial function and cytoprotection. Despite this multitude of functional roles, the precise mechanism underlying taurine's actions has not yet been identified. In this study we report findings that indicate a novel role for taurine in the regulation of voltage-gated delayed rectifier potassium (KV) channels in retinal neurons by means of a metabotropic receptor pathway. The metabotropic taurine response was insensitive to the Cl− channel blockers, picrotoxin and strychnine, but it was inhibited by a specific serotonin 5-HT2A receptor antagonist, MDL11939. Moreover, we found that taurine enhanced KV channels via intracellular protein kinase C-mediated pathways. When 5-HT2A receptors were expressed in human embryonic kidney cells, taurine and AL34662, a non-specific 5-HT2 receptor activator, produced a similar regulation of KIR channels. In sum, this study provides new evidence that taurine activates a serotonin system, apparently via 5-HT2A receptors and related intracellular pathways. PMID:23045337
Graeber, Kai; Linkies, Ada; Müller, Kerstin; Wunchova, Andrea; Rott, Anita; Leubner-Metzger, Gerhard
2010-05-01
Seed dormancy is genetically determined with substantial environmental influence mediated, at least in part, by the plant hormone abscisic acid (ABA). The ABA-related transcription factor ABI3/VP1 (ABA INSENSITIVE3/VIVIPAROUS1) is widespread among green plants. Alternative splicing of its transcripts appears to be involved in regulating seed dormancy, but the role of ABI3/VP1 goes beyond seeds and dormancy. In contrast, DOG1 (DELAY OF GERMINATION 1), a major quantitative trait gene more specifically involved in seed dormancy, was so far only known from Arabidopsis thaliana (AtDOG1) and whether it also has roles during the germination of non-dormant seeds was not known. Seed germination of Lepidium sativum ('garden cress') is controlled by ABA and its antagonists gibberellins and ethylene and involves the production of apoplastic hydroxyl radicals. We found orthologs of AtDOG1 in the Brassicaceae relatives L. sativum (LesaDOG1) and Brassica rapa (BrDOG1) and compared their gene structure and the sequences of their transcripts expressed in seeds. Tissue-specific analysis of LesaDOG1 transcript levels in L. sativum seeds showed that they are degraded upon imbibition in the radicle and the micropylar endosperm. ABA inhibits germination in that it delays radicle protrusion and endosperm weakening and it increased LesaDOG1 transcript levels during early germination due to enhanced transcription and/or inhibited degradation. A reduced decrease in LesaDOG1 transcript levels upon ABA treatment is evident in the late germination phase in both tissues. This temporal and ABA-related transcript expression pattern suggests a role for LesaDOG1 in the control of germination timing of non-dormant L. sativum seeds. The possible involvement of the ABA-related transcription factors ABI3 and ABI5 in the regulation of DOG1 transcript expression is discussed. Other species of the monophyletic genus Lepidium showed coat or embryo dormancy and are therefore highly suited for comparative seed biology.
Williams, Helen; Campbell, Laura; Crompton, Rachel A; Singh, Gurdeep; McHugh, Brian J; Davidson, Donald J; McBain, Andrew J; Cruickshank, Sheena M; Hardman, Matthew J
2018-04-30
Chronic wounds cause significant patient morbidity and mortality. A key factor in their etiology is microbial infection, yet skin host-microbiota interactions during wound repair remain poorly understood. Microbiome profiles of non-infected human chronic wounds are associated with subsequent healing outcome. Furthermore, poor clinical healing outcome was associated with increased local expression of the pattern recognition receptor NOD2. To investigate NOD2 function in the context of cutaneous healing, we treated mice with the NOD2 ligand muramyl dipeptide (MDP) and analyzed wound repair parameters and expression of anti-microbial peptides. MDP treatment of littermate controls significantly delayed wound repair associated with reduced re-epithelialization, heightened inflammation and upregulation of murine β-Defensins (mBD) 1, 3 and particularly 14. We postulated that although BD14 might impact on local skin microbial communities it may further impact other healing parameters. Indeed, exogenously administered mBD14 directly delayed mouse primary keratinocyte scratch wound closure in vitro. To further explore the role of mBD14 in wound repair, we employed Defb14 -/- mice, and showed they had a global delay in healing in vivo, associated with alterations in wound microbiota. Taken together these studies suggest a key role for NOD2-mediated regulation of local skin microbiota which in turn impacts on chronic wound etiology. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Two R7 RGS proteins shape retinal bipolar cell signaling
Mojumder, Deb Kumar; Qian, Yan; Wensel, Theodore G.
2009-01-01
RGS7, RGS11, and their binding partner Gβ5 are localized to the dendritic tips of retinal ON bipolar cells (ON-BPC), where mGluR6 responds to glutamate released from photoreceptor terminals by activation of the RGS7/RGS11 substrate, Gαo. To determine their functions in retinal signaling, we investigated cell-specific expression patterns of RGS7 and RGS11 by immunostaining, and measured light responses by electroretinography (ERG) in mice with targeted disruptions of the genes encoding them. RGS7 staining is present in dendritic tips of all rod ON-BPC, but missing in those for subsets of cone ON-BPC, whereas the converse was true for RGS11 staining. Genetic disruption of either RGS7 or RGS11 produced delays in the ON-BPC-derived electroretinogram b-wave, but no changes in the photoreceptor-derived a-wave. Homozygous RGS7 mutant mice had delays in rod-driven b-waves, whereas, RGS11 mutant mice had delays in rod-driven, and especially in cone-driven b-waves. The b-wave delays were further enhanced in mice homozygous for both RGS7 and RGS11 gene disruptions. Thus, RGS7 and RGS11 act in parallel to regulate the kinetics of ON bipolar cell responses, with differential impacts on the rod and cone pathways. PMID:19535587
Response of jujube fruits to exogenous oxalic acid treatment based on proteomic analysis.
Wang, Qing; Lai, Tongfei; Qin, Guozheng; Tian, Shiping
2009-02-01
In this study, we found that oxalic acid (OA) at the concentration of 5 mM could delay jujube fruit sene-scence by reducing ethylene production, repressing fruit reddening and reducing alcohol content, which consequently increased fruit resistance against blue mold caused by Penicillium expansum. In order to gain a further understanding of the mechanism by which OA delays senescence and increases disease resistance of jujube fruit, we used a proteomics approach to compare soluble proteome of jujube fruits treated with water or 5 mM OA for 10 min. A total of 25 differentially expressed proteins were identified by using electrospray ionization quadrupole time-of-flight tandem mass spectrometry (ESI-Q-TOF-MS/MS). Among these proteins, alcohol dehydrogenase 1, which plays a direct role in ethanol metabolism, was repressed, and the abundances of three photosynthesis-related proteins was enhanced in jujube fruit after OA treatment. The protein identified as a cystathionine beta-synthase domain-containing protein, which can regulate ethylene precursors, was also induced by OA treatment. The activity of 1-aminocyclopropane-1-carboxylic acid synthase was significantly suppressed in OA-treated jujube fruit. In addition, three proteins related to the defense/stress response were up-regulated by OA, and contributed to the establishment of systemic resistance induced by OA in jujube fruits. These results indicated that OA treatment might affect ethanol and ethylene metabolism, resulting in delaying senescence, and increase resistance of jujube fruits against fungal pathogens.
Speech and language delay in two children: an unusual presentation of hyperthyroidism.
Sohal, Aman P S; Dasarathi, Madhuri; Lodh, Rajib; Cheetham, Tim; Devlin, Anita M
2013-01-01
Hyperthyroidism is rare in pre-school children. Untreated, it can have a profound effect on normal growth and development, particularly in the first 2 years of life. Although neurological manifestations of dysthyroid states are well known, specific expressive speech and language disorder as a presentation of hyperthyroidism is rarely documented. Case reports of two children with hyperthyroidism presenting with speech and language delay. We report two pre-school children with hyperthyroidism, who presented with expressive speech and language delay, and demonstrated a significant improvement in their language skills following treatment with anti-thyroid medication. Hyperthyroidism must be considered in all children presenting with speech and language difficulties, particularly expressive speech delay. Prompt recognition and early treatment are likely to improve outcome.
Harcourt, Brooke E; Bullen, Denise V R; Kao, Kung-Ting; Tassoni, Daniella; Alexander, Erin J; Burgess, Trent; White, Susan M; Sabin, Matthew A
2018-01-01
Childhood obesity is a significant world health problem. Understanding the genetic and environmental factors contributing to the development of obesity in childhood is important for the rational design of strategies for obesity prevention and treatment. Brain-derived neurotrophic factor (BDNF) plays an important role in the growth and development of the central nervous system, there is also an evidence that BDNF plays a role in regulation of appetite. Disruption of the expression of this gene in a child has been previously reported to result in a phenotype of severe obesity, hyperphagia, impaired cognitive function, and hyperactivity. We report a mother and child, both with micro-deletions encompassing the BDNF gene locus, who both have obesity and developmental delay, although without hyperactivity. This report highlights the maternal inheritance of a rare genetic cause of childhood obesity. © 2017 Wiley Periodicals, Inc.
Changes in the expression of potassium channels during mouse T cell development
1986-01-01
In this report we have combined the whole-cell electrophysiological recording technique with flow microfluorometry to isolate phenotypically defined thymocytes and T lymphocytes. Results obtained showed that J11d-/Lyt-2-/L3T4- cells express none or very few delayed rectifier K+ channels, whereas most other Lyt-2-/L3T4- cells, as well as typical cortical thymocytes (Lyt-2+/L3T4+), do express K+ channels. Mature (Lyt-2+/L3T4- or Lyt-2-/L3T4+) thymocytes, which are heterogeneous for J11d expression, were also found to be heterogeneous for K+ channel expression. Consistent with this finding was the observation that the cortisone-resistant subpopulation of thymocytes, which express low levels of J11d, were enriched for cells expressing low levels of K+ channels. Mature phenotype peripheral T lymphocytes expressed very low levels of K+ channels, but upon activation with Con A were found to express high levels of K+ channels. The results suggest that K+ channel expression in T cells is developmentally regulated. Increased expression of the channel is induced in response to mitogenic signals throughout the T cell lineage. Expression of the channel, therefore, serves as a useful marker in defining steps in the T cell differentiation pathway. PMID:2431091
Hughes, Sheryl O.; Power, Thomas G.; O’Connor, Teresia M.; Fisher, Jennifer Orlet
2016-01-01
The purpose of the present study was to examine relationships between child eating self-regulation, child non-eating self-regulation, and child BMIz in a low-income sample of Hispanic families with preschoolers. The eating in the absence of hunger task as well as parent-report of child satiety responsiveness and food responsiveness were used to assess child eating self-regulation. Two laboratory tasks assessing executive functioning, a parent questionnaire assessing child effortful control (a temperament dimension related to executive functioning), and the delay of gratification and gift delay tasks assessing child emotion regulation were used to assess child non-eating self-regulation. Bivariate correlations were run among all variables in the study. Hierarchical linear regression analyses assessed: 1) child eating self-regulation associations with the demographic, executive functioning, effortful control, and emotion regulation measures; and 2) child BMI z-scores associations with executive functioning, effortful control, emotion regulation measures, and eating self-regulation measures. Within child eating self-regulation, only the two parent-report measures were related. Low to moderate positive correlations were found between measures of executive functioning, effortful control, and emotion regulation. Only three relationships were found between child eating self-regulation and other forms of child self-regulation: eating in the absence of hunger was positively associated with delay of gratification, and poor regulation on the gift delay task was associated positively with maternal reports of food responsiveness and negatively with parent-reports of satiety responsiveness. Regression analyses showed that child eating self-regulation was associated with child BMIz but other forms of child self-regulation were not. Implications for understanding the role of self-regulation in the development of child obesity are discussed. PMID:25596501
Hughes, Sheryl O; Power, Thomas G; O'Connor, Teresia M; Orlet Fisher, Jennifer
2015-06-01
The purpose of the present study was to examine relationships between child eating self-regulation, child non-eating self-regulation, and child BMIz in a low-income sample of Hispanic families with preschoolers. The eating in the absence of hunger task as well as parent-report of child satiety responsiveness and food responsiveness were used to assess child eating self-regulation. Two laboratory tasks assessing executive functioning, a parent questionnaire assessing child effortful control (a temperament dimension related to executive functioning), and the delay of gratification and gift delay tasks assessing child emotion regulation were used to assess child non-eating self-regulation. Bivariate correlations were run among all variables in the study. Hierarchical linear regression analyses assessed: (1) child eating self-regulation associations with the demographic, executive functioning, effortful control, and emotion regulation measures; and (2) child BMI z-score associations with executive functioning, effortful control, emotion regulation measures, and eating self-regulation measures. Within child eating self-regulation, only the two parent-report measures were related. Low to moderate positive correlations were found between measures of executive functioning, effortful control, and emotion regulation. Only three relationships were found between child eating self-regulation and other forms of child self-regulation: eating in the absence of hunger was positively associated with delay of gratification, and poor regulation on the gift delay task was associated positively with maternal reports of food responsiveness and negatively with parent-reports of satiety responsiveness. Regression analyses showed that child eating self-regulation was associated with child BMIz but other forms of child self-regulation were not. Implications for understanding the role of self-regulation in the development of child obesity are discussed. Copyright © 2015 Elsevier Ltd. All rights reserved.
Inflorescence Development and the Role of LsFT in Regulating Bolting in Lettuce (Lactuca sativa L.).
Chen, Zijing; Han, Yingyan; Ning, Kang; Ding, Yunyu; Zhao, Wensheng; Yan, Shuangshuang; Luo, Chen; Jiang, Xiaotang; Ge, Danfeng; Liu, Renyi; Wang, Qian; Zhang, Xiaolan
2017-01-01
Lettuce ( Lactuca sativa L.) is one of the most important leafy vegetable that is consumed during its vegetative growth. The transition from vegetative to reproductive growth is induced by high temperature, which has significant economic effect on lettuce production. However, the progression of floral transition and the molecular regulation of bolting are largely unknown. Here we morphologically characterized the inflorescence development and functionally analyzed the FLOWERING LOCUS T (LsFT) gene during bolting regulation in lettuce. We described the eight developmental stages during floral transition process. The expression of LsFT was negatively correlated with bolting in different lettuce varieties, and was promoted by heat treatment. Overexpression of LsFT could recover the late-flowering phenotype of ft-2 mutant. Knockdown of LsFT by RNA interference dramatically delayed bolting in lettuce, and failed to respond to high temperature. Therefore, this study dissects the process of inflorescence development and characterizes the role of LsFT in bolting regulation in lettuce.
Inflorescence Development and the Role of LsFT in Regulating Bolting in Lettuce (Lactuca sativa L.)
Chen, Zijing; Han, Yingyan; Ning, Kang; Ding, Yunyu; Zhao, Wensheng; Yan, Shuangshuang; Luo, Chen; Jiang, Xiaotang; Ge, Danfeng; Liu, Renyi; Wang, Qian; Zhang, Xiaolan
2018-01-01
Lettuce (Lactuca sativa L.) is one of the most important leafy vegetable that is consumed during its vegetative growth. The transition from vegetative to reproductive growth is induced by high temperature, which has significant economic effect on lettuce production. However, the progression of floral transition and the molecular regulation of bolting are largely unknown. Here we morphologically characterized the inflorescence development and functionally analyzed the FLOWERING LOCUS T (LsFT) gene during bolting regulation in lettuce. We described the eight developmental stages during floral transition process. The expression of LsFT was negatively correlated with bolting in different lettuce varieties, and was promoted by heat treatment. Overexpression of LsFT could recover the late-flowering phenotype of ft-2 mutant. Knockdown of LsFT by RNA interference dramatically delayed bolting in lettuce, and failed to respond to high temperature. Therefore, this study dissects the process of inflorescence development and characterizes the role of LsFT in bolting regulation in lettuce. PMID:29403510
Cholesterol regulates HERG K+ channel activation by increasing phospholipase C β1 expression.
Chun, Yoon Sun; Oh, Hyun Geun; Park, Myoung Kyu; Cho, Hana; Chung, Sungkwon
2013-01-01
Human ether-a-go-go-related gene (HERG) K(+) channel underlies the rapidly activating delayed rectifier K(+) conductance (IKr) during normal cardiac repolarization. Also, it may regulate excitability in many neuronal cells. Recently, we showed that enrichment of cell membrane with cholesterol inhibits HERG channels by reducing the levels of phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] due to the activation of phospholipase C (PLC). In this study, we further explored the effect of cholesterol enrichment on HERG channel kinetics. When membrane cholesterol level was mildly increased in human embryonic kidney (HEK) 293 cells expressing HERG channel, the inactivation and deactivation kinetics of HERG current were not affected, but the activation rate was significantly decelerated at all voltages tested. The application of PtdIns(4,5)P2 or inhibitor for PLC prevented the effect of cholesterol enrichment, while the presence of antibody against PtdIns(4,5)P2 in pipette solution mimicked the effect of cholesterol enrichment. These results indicate that the effect of cholesterol enrichment on HERG channel is due to the depletion of PtdIns(4,5)P2. We also found that cholesterol enrichment significantly increases the expression of β1 and β3 isoforms of PLC (PLCβ1, PLCβ3) in the membrane. Since the effects of cholesterol enrichment on HERG channel were prevented by inhibiting transcription or by inhibiting PLCβ1 expression, we conclude that increased PLCβ1 expression leads to the deceleration of HERG channel activation rate via downregulation of PtdIns(4,5)P2. These results confirm a crosstalk between two plasma membrane-enriched lipids, cholesterol and PtdIns(4,5)P2, in the regulation of HERG channels.
Chaieb, Leila; Koyama, Takashi; Sarwar, Prioty; Mirth, Christen K.; Smith, Wendy A.; Suzuki, Yuichiro
2014-01-01
Although endocrine changes are known to modulate the timing of major developmental transitions, the genetic mechanisms underlying these changes remain poorly understood. In insects, two developmental hormones, juvenile hormone (JH) and ecdysteroids, are coordinated with each other to induce developmental changes associated with metamorphosis. However, the regulation underlying the coordination of JH and ecdysteroid synthesis remains elusive. Here, we examined the function of a homolog of the vertebrate POU domain protein, Ventral veins lacking (Vvl)/Drifter, in regulating both of these hormonal pathways in the red flour beetle, Tribolium castaneum (Tenebrionidae). RNA interference-mediated silencing of vvl expression led to both precocious metamorphosis and inhibition of molting in the larva. Ectopic application of a JH analog on vvl knockdown larvae delayed the onset of metamorphosis and led to a prolonged larval stage, indicating that Vvl acts upstream of JH signaling. Accordingly, vvl knockdown also reduced the expression of a JH biosynthesis gene, JH acid methyltransferase 3 (jhamt3). In addition, ecdysone titer and the expression of the ecdysone response gene, hormone receptor 3 (HR3), were reduced in vvl knockdown larvae. The expression of the ecdysone biosynthesis gene phantom (phm) and spook (spo) were reduced in vvl knockdown larvae in the anterior and posterior halves, respectively, indicating that Vvl might influence ecdysone biosynthesis in both the prothoracic gland and additional endocrine sources. Injection of 20-hydroxyecdysone (20E) into vvl knockdown larvae could restore the expression of HR3 although molting was never restored. These findings suggest that Vvl coordinates both JH and ecdysteroid biosynthesis as well as molting behavior to influence molting and the timing of metamorphosis. Thus, in both vertebrates and insects, POU factors modulate the production of major neuroendocrine regulators during sexual maturation. PMID:24945490
Yu, Albert Cheung Hoi; Yung, Hon Wa; Hui, Michael Hung Kit; Lau, Lok Ting; Chen, Xiao Qian; Collins, Richard A
2003-10-15
An in vitro ischemia model was established and the effect of the metabolic inhibitors cycloheximide (CHX) and actinomycin D (ActD) on apoptosis in astrocytes under ischemia studied. CHX decreased by 75% the number of cells dying after 6 hr of ischemia compared with control cultures. TdT-mediated dUTP nick end labelling (TUNEL) staining of comparable cultures was reduced by 40%. ActD decreased cell death by 60% compared with controls. The number of TUNEL-positive cells was reduced by 38%. The nuclear shrinkage in TUNEL-positive astrocytes in control cultures did not occur in ActD-treated astrocytes, indicating that nuclear shrinkage and DNA fragmentation during apoptosis are two unrelated processes. Expression of bcl-2 (alpha and beta), bax, and Ice in astrocytes under similar ischemic conditions, as measured by quantitative reverse transcription-polymerase chain reaction, indicated that ischemia down-regulated bcl-2 (alpha and beta) and bax. Ice was initially down-regulated from 0 to 4 hr, before returning to control levels after 8 hr of ischemia. ActD decreased the expression of these genes. CHX reduced the expression of bcl-2 (alpha and beta) but increased bax and Ice expression. It is hypothesized that the balance of proapoptotic (Bad, Bax) and antiapoptotic (Bcl-2, Bcl-Xl) proteins determines apoptosis. The data suggest that the ratio of Bcl-2/Bad in astrocytes following ActD and CHX treatment does not decrease as much in untreated cells during ischemia. Our data indicate that it is the ratio of Bcl-2 family members that plays a critical role in determining ischemia-induced apoptosis. It is also important to note that ischemia-induced apoptosis involves the regulation of RNA and protein synthesis. Copyright 2003 Wiley-Liss, Inc.
Noir, Sandra; Bömer, Moritz; Takahashi, Naoki; Ishida, Takashi; Tsui, Tjir-Li; Balbi, Virginia; Shanahan, Hugh; Sugimoto, Keiko; Devoto, Alessandra
2013-01-01
Phytohormones regulate plant growth from cell division to organ development. Jasmonates (JAs) are signaling molecules that have been implicated in stress-induced responses. However, they have also been shown to inhibit plant growth, but the mechanisms are not well understood. The effects of methyl jasmonate (MeJA) on leaf growth regulation were investigated in Arabidopsis (Arabidopsis thaliana) mutants altered in JA synthesis and perception, allene oxide synthase and coi1-16B (for coronatine insensitive1), respectively. We show that MeJA inhibits leaf growth through the JA receptor COI1 by reducing both cell number and size. Further investigations using flow cytometry analyses allowed us to evaluate ploidy levels and to monitor cell cycle progression in leaves and cotyledons of Arabidopsis and/or Nicotiana benthamiana at different stages of development. Additionally, a novel global transcription profiling analysis involving continuous treatment with MeJA was carried out to identify the molecular players whose expression is regulated during leaf development by this hormone and COI1. The results of these studies revealed that MeJA delays the switch from the mitotic cell cycle to the endoreduplication cycle, which accompanies cell expansion, in a COI1-dependent manner and inhibits the mitotic cycle itself, arresting cells in G1 phase prior to the S-phase transition. Significantly, we show that MeJA activates critical regulators of endoreduplication and affects the expression of key determinants of DNA replication. Our discoveries also suggest that MeJA may contribute to the maintenance of a cellular “stand-by mode” by keeping the expression of ribosomal genes at an elevated level. Finally, we propose a novel model for MeJA-regulated COI1-dependent leaf growth inhibition. PMID:23439917
Matta, Benjamin M.; Raimondi, Giorgio; Rosborough, Brian R.; Sumpter, Tina L.; Thomson, Angus W.
2012-01-01
Plasmacytoid (p) dendritic cells (DC) are highly-specialized APC that, in addition to their well-recognized role in anti-viral immunity, also regulate immune responses. Liver-resident pDC are considerably less immunostimulatory than those from secondary lymphoid tissues and are equipped to promote immune tolerance/regulation through various mechanisms. IL-27 is an IL-12-family cytokine that regulates the function of both APC and T cells, although little is known about its role in pDC immunobiology. In this study, we show that mouse liver pDC express higher levels of IL-27p28 and EBV-induced protein (Ebi)3 compared to splenic pDC. Both populations of pDC express the IL-27Rα/WSX-1; however, only liver pDC significantly upregulate expression of the co-regulatory molecule B7 homolog-1 (B7-H1) in response to IL-27. Inhibition of STAT3 activation completely abrogates IL-27-induced upregulation of B7-H1 expression on liver pDC. Liver pDC treated with IL-27 increase the percentage of CD4+Foxp3+ T cells in MLR, which is dependent upon expression of B7-H1. pDC from Ebi3-deficient mice lacking functional IL-27, show increased capacity to stimulate allogeneic T cell proliferation and IFN-γ production in MLR. Liver but not spleen pDC suppress delayed-type hypersensitivity responses to OVA, an effect that is lost with Ebi3−/− and B7-H1−/− liver pDC compared to wild-type (WT) liver pDC. These data suggest that IL-27 signaling in pDC promotes their immunoregulatory function and that IL-27 produced by pDC contributes to their capacity to regulate immuneresponses in vitro and in vivo. PMID:22508931
Self-Regulation of Learning and Academic Delay of Gratification among Korean College Students
ERIC Educational Resources Information Center
Bembenutty, Hefer
2007-01-01
The goal of the present study was to examine the relationship between Korean students' motivation for learning, use of self-regulation of learning strategies, and delay of gratification Self-regulation of learning is a process that required students to get involved in their personal, behavioral, motivational, and cognitive learning tasks in order…
BCL-2 family protein, BAD is down-regulated in breast cancer and inhibits cell invasion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cekanova, Maria, E-mail: mcekanov@utk.edu; Fernando, Romaine I.; Siriwardhana, Nalin
We have previously demonstrated that the anti-apoptotic protein BAD is expressed in normal human breast tissue and shown that BAD inhibits expression of cyclin D1 to delay cell-cycle progression in breast cancer cells. Herein, expression of proteins in breast tissues was studied by immunohistochemistry and results were analyzed statistically to obtain semi-quantitative data. Biochemical and functional changes in BAD-overexpressing MCF7 breast cancer cells were evaluated using PCR, reporter assays, western blotting, ELISA and extracellular matrix invasion assays. Compared to normal tissues, Grade II breast cancers expressed low total/phosphorylated forms of BAD in both cytoplasmic and nuclear compartments. BAD overexpression decreasedmore » the expression of β-catenin, Sp1, and phosphorylation of STATs. BAD inhibited Ras/MEK/ERK and JNK signaling pathways, without affecting the p38 signaling pathway. Expression of the metastasis-related proteins, MMP10, VEGF, SNAIL, CXCR4, E-cadherin and TlMP2 was regulated by BAD with concomitant inhibition of extracellular matrix invasion. Inhibition of BAD by siRNA increased invasion and Akt/p-Akt levels. Clinical data and the results herein suggest that in addition to the effect on apoptosis, BAD conveys anti-metastatic effects and is a valuable prognostic marker in breast cancer. - Highlights: • BAD and p-BAD expressions are decreased in breast cancer compared with normal breast tissue. • BAD impedes breast cancer invasion and migration. • BAD inhibits the EMT and transcription factors that promote cancer cell migration. • Invasion and migration functions of BAD are distinct from the BAD's role in apoptosis.« less
Das, Sayan; Ehlers, Jeffrey D; Close, Timothy J; Roberts, Philip A
2010-08-19
The locus Rk confers resistance against several species of root-knot nematodes (Meloidogyne spp., RKN) in cowpea (Vigna unguiculata). Based on histological and reactive oxygen species (ROS) profiles, Rk confers a delayed but strong resistance mechanism without a hypersensitive reaction-mediated cell death process, which allows nematode development but blocks reproduction. Responses to M. incognita infection in roots of resistant genotype CB46 and a susceptible near-isogenic line (null-Rk) were investigated using a soybean Affymetrix GeneChip expression array at 3 and 9 days post-inoculation (dpi). At 9 dpi 552 genes were differentially expressed in incompatible interactions (infected resistant tissue compared with non-infected resistant tissue) and 1,060 genes were differentially expressed in compatible interactions (infected susceptible tissue compared with non-infected susceptible tissue). At 3 dpi the differentially expressed genes were 746 for the incompatible and 623 for the compatible interactions. When expression between infected resistant and susceptible genotypes was compared, 638 and 197 genes were differentially expressed at 9 and 3 dpi, respectively. In comparing the differentially expressed genes in response to nematode infection, a greater number and proportion of genes were down-regulated in the resistant than in the susceptible genotype, whereas more genes were up-regulated in the susceptible than in the resistant genotype. Gene ontology based functional categorization revealed that the typical defense response was partially suppressed in resistant roots, even at 9 dpi, allowing nematode juvenile development. Differences in ROS concentrations, induction of toxins and other defense related genes seem to play a role in this unique resistance mechanism.
Regulation and function of the atypical cadherin FAT1 in hepatocellular carcinoma.
Valletta, Daniela; Czech, Barbara; Spruss, Thilo; Ikenberg, Kristian; Wild, Peter; Hartmann, Arndt; Weiss, Thomas S; Oefner, Peter J; Müller, Martina; Bosserhoff, Anja-Katrin; Hellerbrand, Claus
2014-06-01
In human cancers, giant cadherin FAT1 may function both, as an oncogene and a tumor suppressor. Here, we investigated the expression and function of FAT1 in hepatocellular carcinoma (HCC). FAT1 expression was increased in human HCC cell lines and tissues compared with primary human hepatocytes and non-tumorous liver tissue as assessed by quantitative PCR and western blot analysis. Combined immunohistochemical and tissue microarray analysis showed a significant correlation of FAT1 expression with tumor stage and proliferation. Suppression of FAT1 expression by short hairpin RNA impaired proliferation and migration as well as apoptosis resistance of HCC cells in vitro. In nude mice, tumors formed by FAT1-suppressed HCC cells showed a delayed onset and more apoptosis compared with tumors of control cells. Both hepatocyte growth factor and hypoxia-mediated hypoxia-inducible factor 1 alpha activation were identified as strong inducers of FAT1 in HCC. Moreover, demethylating agents induced FAT1 expression in HCC cells. Hypoxia lead to reduced levels of the methyl group donor S-adenosyl-L-methionine (SAM) and hypoxia-induced FAT1 expression was inhibited by SAM supplementation in HCC cells. Together, these findings indicate that FAT1 expression in HCC is regulated via promotor methylation. FAT1 appears as relevant mediator of hypoxia and growth receptor signaling to critical tumorigenic pathways in HCC. This knowledge may facilitate the rational design of novel therapeutics against this highly aggressive malignancy. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Weng, Lin; Zhao, Fangfang; Li, Rong; Xu, Changjie; Chen, Kunsong
2015-01-01
Abscisic acid (ABA) regulates plant development and adaptation to environmental conditions. Although the ABA biosynthesis pathway in plants has been thoroughly elucidated, how ABA biosynthetic genes are regulated at the molecular level during plant development is less well understood. Here, we show that the tomato (Solanum lycopersicum) zinc finger transcription factor SlZFP2 is involved in the regulation of ABA biosynthesis during fruit development. Overexpression of SlZFP2 resulted in multiple phenotypic changes, including more branches, early flowering, delayed fruit ripening, lighter seeds, and faster seed germination, whereas down-regulation of its expression caused problematic fruit set, accelerated ripening, and inhibited seed germination. SlZFP2 represses ABA biosynthesis during fruit development through direct suppression of the ABA biosynthetic genes NOTABILIS, SITIENS, and FLACCA and the aldehyde oxidase SlAO1. We also show that SlZFP2 regulates fruit ripening through transcriptional suppression of the ripening regulator COLORLESS NON-RIPENING. Using bacterial one-hybrid screening and a selected amplification and binding assay, we identified the (A/T)(G/C)TT motif as the core binding sequence of SlZFP2. Furthermore, by RNA sequencing profiling, we found that 193 genes containing the SlZFP2-binding motifs in their promoters were differentially expressed in 2 d post anthesis fruits between the SlZFP2 RNA interference line and its nontransgenic sibling. We propose that SlZFP2 functions as a repressor to fine-tune ABA biosynthesis during fruit development and provides a potentially valuable tool for dissecting the role of ABA in fruit ripening. PMID:25637453
48 CFR 42.1304 - Government delay of work.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 48 Federal Acquisition Regulations System 1 2011-10-01 2011-10-01 false Government delay of work... CONTRACT MANAGEMENT CONTRACT ADMINISTRATION AND AUDIT SERVICES Suspension of Work, Stop-Work Orders, and Government Delay of Work 42.1304 Government delay of work. (a) The clause at 52.242-17, Government Delay of...
Berdún, S; Rychter, J; Vergara, P
2016-06-01
Surgical handling of the bowel evokes degranulation of peritoneal mast cells (PMC). Nonetheless, role of PMCs in postoperative ileus (POI) is somewhat controversial. We aimed to investigate if intestinal manipulation elicits changes in afferent mediators related to MC activation and alteration of gastrointestinal (GI) motility. Postoperative ileus was induced by intestinal manipulation in Sprague-Dawley rats. Additionally, compound 48/80 (C48/80) and ketotifen were used to modulate MC activity. Rat mast cell protease 6 (RMCP-6, ELISA) release was determined in peritoneal lavage 20 min after intestinal manipulation. At 24 h, GI transit was determined. Gene expression of calcitonin gene-related peptide (CGRP), protease-activated receptor-2 (PAR-2), nerve growth factor (NGF), and TrkA receptor was determined (PCR) in dorsal root ganglia (DRG). Ileal wall inflammation was assessed by myeloperoxidase (MPO) activity, interleukin-6 expression (IL-6). Intestinal manipulation and exposure to C48/80-induced degranulation of PMCs delayed GI transit and up-regulated IL-6 and MPO activity. Intestinal manipulation, but not C48/80, up-regulated CGRP, PAR-2, and NGF/TrkA in DRGs. Ketotifen only improved gastric emptying and fecal output. Up-regulation of CGRP and TrkA expression in DRG was not prevented by ketotifen. Postoperative ileus is accompanied by activation of CGRP, NGF-TrkA, and PAR-2 in DRGs. Our results suggest that these mediators could be a target in further POI studies in order to find new therapeutic targets for this medical condition. © 2016 John Wiley & Sons Ltd.
The miR172 target TOE3 represses AGAMOUS expression during Arabidopsis floral patterning.
Jung, Jae-Hoon; Lee, Sangmin; Yun, Ju; Lee, Minyoung; Park, Chung-Mo
2014-02-01
microRNA172 (miR172) regulates phase transition and floral patterning in Arabidopsis by repressing targets that encode the APETALA2 (AP2) and AP2-like transcription factors. The miR172-mediated repression of the AP2 gene restricts AGAMOUS (AG) expression. In addition, most miR172 targets, including AP2, redundantly act as floral repressors, and the overexpression of the target genes causes delayed flowering. However, how miR172 targets other than AP2 regulate both of the developmental processes remains unclear. Here, we demonstrate that miR172-mediated repression of the TARGET OF EAT 3 (TOE3) gene is critical for floral patterning in Arabidopsis. Transgenic plants that overexpress a miR172-resistant TOE3 gene (rTOE3-ox) exhibit indeterminate flowers with numerous stamens and carpelloid organs, which is consistent with previous observations in transgenic plants that overexpress a miR172-resistant AP2 gene. TOE3 binds to the second intron of the AG gene. Accordingly, AG expression is significantly reduced in rTOE3-ox plants. TOE3 also interacts with AP2 in the nucleus. Given the major role of AP2 in floral patterning, miR172 likely regulates TOE3 in floral patterning, at least in part via AP2. In addition, a miR156 target SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 3 directly activates TOE3 expression, revealing a novel signaling interaction between miR156 and miR172 in floral patterning. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Barx2 is Expressed in Satellite Cells and is Required for Normal Muscle Growth and Regeneration
Meech, Robyn; Gonzalez, Katie N.; Barro, Marietta; Gromova, Anastasia; Zhuang, Lizhe; Hulin, Julie-Ann; Makarenkova, Helen P.
2015-01-01
Muscle growth and regeneration are regulated through a series of spatiotemporally dependent signaling and transcriptional cascades. Although the transcriptional program controlling myogenesis has been extensively investigated, the full repertoire of transcriptional regulators involved in this process is far from defined. Various homeodomain transcription factors have been shown to play important roles in both muscle development and muscle satellite cell-dependent repair. Here, we show that the homeodomain factor Barx2 is a new marker for embryonic and adult myoblasts and is required for normal postnatal muscle growth and repair. Barx2 is coexpressed with Pax7, which is the canonical marker of satellite cells, and is upregulated in satellite cells after muscle injury. Mice lacking the Barx2 gene show reduced postnatal muscle growth, muscle atrophy, and defective muscle repair. Moreover, loss of Barx2 delays the expression of genes that control proliferation and differentiation in regenerating muscle. Consistent with the in vivo observations, satellite cell-derived myoblasts cultured from Barx2−/− mice show decreased proliferation and ability to differentiate relative to those from wild-type or Barx2+/− mice. Barx2−/− myoblasts show reduced expression of the differentiation-associated factor myogenin as well as cell adhesion and matrix molecules. Finally, we find that mice lacking both Barx2 and dystrophin gene expression have severe early onset myopathy. Together, these data indicate that Barx2 is an important regulator of muscle growth and repair that acts via the control of satellite cell proliferation and differentiation. PMID:22076929
Prerostova, Sylva; Dobrev, Petre I.; Gaudinova, Alena; Knirsch, Vojtech; Körber, Niklas; Pieruschka, Roland; Fiorani, Fabio; Brzobohatý, Břetislav; černý, Martin; Spichal, Lukas; Humplik, Jan; Vanek, Tomas; Schurr, Ulrich; Vankova, Radomira
2018-01-01
Our phenotyping and hormonal study has characterized the role of cytokinins (CK) in the drought and recovery responses of Arabidopsis thaliana. CK down-regulation was achieved by overexpression of the gene for CK deactivating enzyme cytokinin oxidase/dehydrogenase (CKX): constitutive (35S:CKX) or at the stress onset using a dexamethasone-inducible pOp/LhGR promoter (DEX:CKX). The 35S:CKX plants exhibited slow ontogenesis and higher expression levels of stress-associated genes, e.g., AtP5CS1, already at well-watered conditions. CK down-regulation resulted during drought in higher stress tolerance (indicated by relatively low up-regulation of the expression of drought stress marker gene AtRD29B) accompanied with lower leaf water loss. Nevertheless, these plants exhibited slow and delayed recovery after re-watering. CK levels were increased at the stress onset by stimulation of the expression of CK biosynthetic gene isopentenyl transferase (ipt) (DEX:IPT) or by application of exogenous CK meta-topolin. After water withdrawal, long-term CK elevation resulted in higher water loss in comparison with CKX transformants as well as with plants overexpressing ipt driven by senescence-inducible SAG12 promoter (SAG:IPT), which gradually enhanced CKs during the stress progression. In all cases, CK up-regulation resulted in fast and more vigorous recovery. All drought-stressed plants exhibited growth suppression associated with elevation of abscisic acid and decrease of auxins and active CKs (with the exception of SAG:IPT plants). Apart from the ipt overexpressers, also increase of jasmonic and salicylic acid was found. PMID:29872444
Dang, Ruihong; Li, Jinxi; Jiang, Jinzhu; Zhang, Ning; Jia, Meiru; Wei, Lingzhi; Li, Ziqiang; Li, Bingbing; Jia, Wensuo
2015-01-01
Whereas the regulatory mechanisms that direct fruit ripening have been studied extensively, little is known about the signaling mechanisms underlying this process, especially for nonclimacteric fruits. In this study, we demonstrated that a SUCROSE NONFERMENTING1-RELATED PROTEIN KINASE2, designated as FaSnRK2.6, is a negative regulator of fruit development and ripening in the nonclimacteric fruit strawberry (Fragaria × ananassa) and can also mediate temperature-modulated strawberry fruit ripening. FaSnRK2.6 was identified as an ortholog of OPEN STOMATA1. Levels of FaSnRK2.6 transcript rapidly decreased during strawberry fruit development and ripening. FaSnRK2.6 was found to be capable of physically interacting with strawberry ABSCISIC ACID INSENSITIVE1, a negative regulator in strawberry fruit ripening. RNA interference-induced silencing of FaSnRK2.6 significantly promoted fruit ripening. By contrast, overexpression of FaSnRK2.6 arrested fruit ripening. Strawberry fruit ripening is highly sensitive to temperature, with high temperatures promoting ripening and low temperatures delaying it. As the temperature increased, the level of FaSnRK2.6 expression declined. Furthermore, manipulating the level of FaSnRK2.6 expression altered the expression of a variety of temperature-responsive genes. Taken together, this study demonstrates that FaSnRK2.6 is a negative regulator of strawberry fruit development and ripening and, furthermore, that FaSnRK2.6 mediates temperature-modulated strawberry fruit ripening. PMID:25609556
Kumari, Rasiah Pratheepa; Ramkumar, Srinivasagan; Thankappan, Bency; Natarajaseenivasan, Kalimuthusamy; Balaji, Sadhasivam
2015-01-01
Purpose This study was designed to examine the constrictive potential of C-Phycocyanin (C-PC) in regulating changes imposed on gene expression in the selenite-induced cataract model. Methods Wistar rat pups were divided into three groups of eight each. On P10, Group I received an intraperitoneal injection of normal saline. Groups II and III received a subcutaneous injection of sodium selenite (19 μmol/kg bodyweight); Group III also received an intraperitoneal injection of C-PC (200 mg/kg bodyweight) on P9–14. Total RNA was isolated on P16, and the relative abundance of mRNA of the crystallin structural genes, redox components, and apoptotic cascade were ascertained with real-time PCR with reference to the internal control β-actin. Results Real-time PCR analysis showed the crystallin genes (αA-, βB1-, γD-) and redox cycle components (Cat, SOD-1, Gpx) were downregulated, the apoptotic components were upregulated, and antiapoptotic Bcl-2 was downregulated in Group II. Treatment with 200 mg/kg bodyweight C-PC (Group III) transcriptionally regulated the instability of the expression of these genes, thus ensuring C-PC is a prospective anticataractogenic agent that probably delays the onset and progression of cataractogenesis induced by sodium selenite. Conclusions C-PC treatment possibly prevented cataractogenesis triggered by sodium selenite, by regulating the lens crystallin, redox genes, and apoptotic cascade mRNA expression and thus maintains lens transparency. C-PC may be developed as a potential antioxidant compound applied in the future to prevent and treat age-related cataract. PMID:25593511
Dynamic change of SGK expression and its role in neuron apoptosis after traumatic brain injury.
Wu, Xinmin; Mao, Hui; Liu, Jiao; Xu, Jian; Cao, Jianhua; Gu, Xingxing; Cui, Gang
2013-01-01
Activation of specific signaling pathways in response to mechanical trauma causes delayed neuronal apoptosis; GSK-3β/β-catenin signaling plays a critical role in the apoptosis of neurons in CNS diseases, SGK was discovered as a regulator of GSK-3β/β-catenin pathway, The goal of this study was to determine if the mechanism of cell death or survival mediated by the SGK/GSK-3β/β-catenin pathway is involved in a rat model of TBI. Here, an acute traumatic brain injury model was applied to investigate the expression change and possible roles of SGK, Expression of SGK, and total-GSK-3β, phospho-GSK3β on ser-9, beta-catenin, and caspase-3 were examined by immunohistochemistry and Western blot analysis. Double immunofluorescent staining was used to observe the SGK localizations. Si-RNA was performed to identify whether SGK regulates neuron apoptosis via GSK-3β/β-catenin pathway, ultimately inhibit caspase-3 activation. Temporally, SGK expression showed an increase pattern after TBI and reached a peak at day 3. Spatially, SGK was widely expressed in the neuron, rarely in astrocytes and oligodendrocytes; in addition, the expression patterns of active caspase-3 and phospho-GSK3β were parallel with that of SGK, at the same time, the expression of β-catenin shows similarity with SGK. In vitro, to further investigate the function of SGK, a neuronal cell line PC12 was employed to establish an apoptosis model. We analyzed the association of SGK with apoptosis on PC12 cells by western blot, immunofluorescent labeling and siRNA. the results implied that SGK plays an important role in neuron apoptosis via the regulation of GSK3β/β-catenin signaling pathway; ultimately inhibit caspase-3 activation. Taken together, we inferred traumatic brain injury induced an upregulation of SGK in the central nervous system, which show a protective role in neuron apoptosis.
2012-01-01
Background Fuzzless-lintless cotton mutants are considered to be the ideal material to understand the molecular mechanisms involved in fibre cell development. Although there are few reports on transcriptome and proteome analyses in cotton at fibre initiation and elongation stages, there is no comprehensive comparative transcriptome analysis of fibre-bearing and fuzzless-lintless cotton ovules covering fibre initiation to secondary cell wall (SCW) synthesis stages. In the present study, a comparative transcriptome analysis was carried out using G. hirsutum L. cv. MCU5 wild-type (WT) and it’s near isogenic fuzzless-lintless (fl) mutant at fibre initiation (0 dpa/days post anthesis), elongation (5, 10 and 15 dpa) and SCW synthesis (20 dpa) stages. Results Scanning electron microscopy study revealed the delay in the initiation of fibre cells and lack of any further development after 2 dpa in the fl mutant. Transcriptome analysis showed major down regulation of transcripts (90%) at fibre initiation and early elongation (5 dpa) stages in the fl mutant. Majority of the down regulated transcripts at fibre initiation stage in the fl mutant represent calcium and phytohormone mediated signal transduction pathways, biosynthesis of auxin and ethylene and stress responsive transcription factors (TFs). Further, transcripts involved in carbohydrate and lipid metabolisms, mitochondrial electron transport system (mETS) and cell wall loosening and elongation were highly down-regulated at fibre elongation stage (5–15 dpa) in the fl mutant. In addition, cellulose synthases and sucrose synthase C were down-regulated at SCW biosynthesis stage (15–20 dpa). Interestingly, some of the transcripts (~50%) involved in phytohormone signalling and stress responsive transcription factors that were up-regulated at fibre initiation stage in the WT were found to be up-regulated at much later stage (15 dpa) in fl mutant. Conclusions Comparative transcriptome analysis of WT and its near isogenic fl mutant revealed key genes and pathways involved at various stages of fibre development. Our data implicated the significant role of mitochondria mediated energy metabolism during fibre elongation process. The delayed expression of genes involved in phytohormone signalling and stress responsive TFs in the fl mutant suggests the need for a coordinated expression of regulatory mechanisms in fibre cell initiation and differentiation. PMID:23151214
Maruyama, Tessho; Nishihara, Kazuhide; Umikawa, Masato; Arasaki, Akira; Nakasone, Toshiyuki; Nimura, Fumikazu; Matayoshi, Akira; Takei, Kimiko; Nakachi, Saori; Kariya, Ken-Ichi; Yoshimi, Naoki
2018-01-01
MicroRNAs (miRs) are expected to serve as prognostic tools for cancer. However, many miRs have been reported as prognostic markers of recurrence or metastasis in oral squamous cell carcinoma patients. We aimed to determine the prognostic markers in early-stage tongue squamous cell carcinoma (TSCC). Based on previous studies, we hypothesized that miR-10a, 10b, 196a-5p, 196a-3p, and 196b were prognostic markers and we retrospectively performed miR expression analyses using formalin-fixed paraffin-embedded sections of surgical specimens. Total RNA was isolated from cancer tissues and adjacent normal tissue as control, and samples were collected by laser-capture microdissection. After cDNA synthesis, reverse transcription-quantitative polymerase chain reaction was performed. Statistical analyses for patient clinicopathological characteristics, recurrence/metastasis, and survival rates were performed to discern their relationships with miR expression levels, and the 2−ΔΔCq method was used. miR-196a-5p levels were significantly upregulated in early-stage TSCC, particularly in the lymph node metastasis (LNM) group. The LNM-free survival rate in the low miR-196a-5p ΔΔCq value regulation group was found to be lower than that in the high ΔΔCq value regulation group (P=0.0079). Receiver operating characteristic analysis of ΔΔCq values revealed that miR-196a-5p had a P-value=0.0025, area under the curve=0.740, and a cut-off value=−0.875 for distinguishing LNM. To our knowledge, this is the first study to examine LNM-related miRs in early-stage TSCC as well as miRs and ‘delayed LNM’ in head and neck cancer. miR-196a-5p upregulation may predict delayed LNM. Our data serve as a foundation for future studies to evaluate miR levels and facilitate the prediction of delayed LNM during early-stage TSCC, which prevent metastasis when combined with close follow-up and aggressive adjuvant therapy or elective neck dissection. Moreover, our data will serve as a foundation for future studies to evaluate whether miR-196a-5p can serve as a therapeutic marker for preventing metastasis. PMID:29434944
ERIC Educational Resources Information Center
Sylvestre, Audette; Desmarais, Chantal; Meyer, Francois; Bairati, Isabelle; Rouleau, Nancie; Merette, Chantal
2012-01-01
The purpose of this exploratory study was to examine child and environmental factors known to be associated to language development and how they relate to results in expressive vocabulary, expressive language, and receptive language in language-delayed toddlers. The cross-sectional data on 96 French-speaking children aged 18-36 months were…
Moriya, Shunpei; Tahara, Yu; Sasaki, Hiroyuki; Ishigooka, Jun; Shibata, Shigenobu
2015-11-01
A number of animal studies have implicated circadian clock genes in the regulation of mood, anxiety, and reward. However, the effect of misalignment of the environmental light-dark and internal circadian clock on the monoamine system is not fully understood. In the present study, we examined whether an abnormal light-dark schedule would affect behavior-, circadian clock-, and monoamine-related gene expressions, along with monoamine contents in the amygdala and hippocampus of mice. Mice were subjected to an 8-hour phase delay in the light-dark cycle (Shift) every two days for four weeks, and locomotor activity was continuously measured. We examined the circadian expression of clock genes (Per1, Per2, and Bmal1) and genes of the NE/5HT uptake transporters (Net and Sert). In addition, the levels of NE/5HT and their metabolites MHPG/5HIAA were analyzed in the amygdala and hippocampus. Locomotor activity showed a free-running phenotype with a longer period (>24 hours) and showed misalignment between the light-dark and inactive-active cycles. The amplitude of the day-night fluctuation of Bmal1 expression was reduced in the amygdala and hippocampus of light-dark-shifted mice. Net gene expression in the Shift group showed different profiles compared with the Control group. In addition, NE and 5HT levels in the amygdala of the Shift group increased during the active period. The present results suggest that misalignment of the internal and external clocks by continuous shifting of the light-dark cycle affects the circadian clocks and monoamine metabolism in the amygdala and hippocampus of mice. Copyright © 2015 Elsevier B.V. All rights reserved.
Saulnier, N; Viguier, E; Perrier-Groult, E; Chenu, C; Pillet, E; Roger, T; Maddens, S; Boulocher, C
2015-01-01
The anti-inflammatory and anti-catabolic effects of neonatal Mesenchymal Stromal Cell (MSC) were investigated in a xenogeneic model of mild osteoarthritis (OA). The paracrine properties of MSC on synoviocytes were further investigated in vitro. OA was induced by medial meniscal release (MMR) in 30 rabbit knees. A single early (day 3) or delayed (day 15) intra-articular (IA) injection of MSC isolated from equine Umbilical Cord Wharton's jelly (UC-MSC) was performed. Rabbits were euthanized on days 15 or 56. OA grading was performed and gene expression of inflammatory cytokines and metalloproteinases was measured in synovial tissue. Paracrine effects of UC-MSC were investigated using UC-conditioned vs control medium on rabbit primary synoviocytes stimulated with interleukin 1 beta in vitro. No adverse local or systemic responses were observed clinically after xenogeneic UC-MSC injection. At study end point, cartilage fibrillation was lower in early treatment than in delayed treatment group. Cellular infiltrate was observed in the synovium of both UC-MSC groups. OA synovium exhibited a reduced expression of metalloproteinases-1, -3, -13 in the early cell-treated group at d56. In vitro, UC-conditioned medium exerted anti-inflammatory and anti-catabolic effects on synoviocytes exposed to pro-inflammatory stimulus. Early IA injection of equine UC-MSC was effective in preventing OA signs in rabbit knees following MMR. UC-MSC target the synovium and modulate the gene expression pattern of synoviocytes to promote an anti-catabolic environment. This confirms the synovium is a major target and mediator of MSC therapy, modulating the expression of matrix-degrading enzymes. Copyright © 2014 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
Gaye, Amadou; Doumatey, Ayo P; Davis, Sharon K; Rotimi, Charles N; Gibbons, Gary H
2018-01-01
Several clinical guidelines have been proposed to distinguish metabolically healthy obesity (MHO) from other subgroups of obesity but the molecular mechanisms by which MHO individuals remain metabolically healthy despite having a high fat mass are yet to be elucidated. We conducted the first whole blood transcriptomic study designed to identify specific sets of genes that might shed novel insights into the molecular mechanisms that protect or delay the occurrence of obesity-related co-morbidities in MHO. The study included 29 African-American obese individuals, 8 MHO and 21 metabolically abnormal obese (MAO). Unbiased transcriptome-wide network analysis was carried out to identify molecular modules of co-expressed genes that are collectively associated with MHO. Network analysis identified a group of 23 co-expressed genes, including ribosomal protein genes (RPs), which were significantly downregulated in MHO subjects. The three pathways enriched in the group of co-expressed genes are EIF2 signaling, regulation of eIF4 and p70S6K signaling, and mTOR signaling. The expression of ten of the RPs collectively predicted MHO status with an area under the curve of 0.81. Triglycerides/HDL (TG/HDL) ratio, an index of insulin resistance, was the best predictor of the expression of genes in the MHO group. The higher TG/HDL values observed in the MAO subjects may underlie the activation of endoplasmic reticulum (ER) and related-stress pathways that lead to a chronic inflammatory state. In summary, these findings suggest that controlling ER stress and/or ribosomal stress by downregulating RPs or controlling TG/HDL ratio may represent effective strategies to prevent or delay the occurrence of metabolic disorders in obese individuals.
Beecken, Wolf-Dietrich C; Ringel, Eva Maria; Babica, Jan; Oppermann, Elsie; Jonas, Dietger; Blaheta, Roman A
2010-10-28
beta(2)-Glycoprotein-I (beta(2)gpI), an abundant plasma glycoprotein, functions as a regulator of thrombosis. Previously, we demonstrated that plasmin-clipped beta(2)gpI (cbeta(2)gpI) exerts an anti-angiogenic effect on human umbilical vein endothelial cells (HUVEC). The present study was focused on the molecular background responsible for this phenomenon. cbeta(2)gpI strongly reduced HUVEC growth and proliferation as evidenced by the MTT and BrdU assay and delayed cell cycle progression arresting HUVEC in the S-and G2/M-phase. Western blot analysis indicated that cbeta(2)gpI inhibited cyclin A, B and D1, and enhanced p21 and p27 expression. Activity of p38 was down-regulated independently from the cbeta(2)gpI incubation time. Phosphorylation of ERK1/2 was not changed early (30 and 60 min) but became enhanced later (90 min, 4h). JNK activity was reduced rapidly after cbeta(2)gpI treatment but compared to controls, increased thereafter. Annexin II blockade prevented growth inhibition and cell cycle delay evoked by cbeta(2)gpI. We assume that cbeta(2)gpI's effects on HUVEC growth is mediated via cyclin A, B and D1 suppression, up-regulation of p21 and p27 and coupled to modifications of the mitogen-activated protein (MAP) kinase signalling pathway. cbeta(2)gpI may represent a potential endogenous angiogenesis-targeted compound, opening the possibility of a novel tool to treat cancer. 2010 Elsevier Ireland Ltd. All rights reserved.
Wang, Xiaodan; Gao, Lihui; Lin, Hua; Song, Jingling; Wang, Jinwen; Yin, Yumin; Zhao, Jianghu; Xu, Xiangwei; Li, Zhenkun; Li, Ling
2018-04-05
Diabetic nephropathy (DN) is one of the most severe microangiopathies of diabetes mellitus and is a leading cause of end stage renal disease. Numerous studies suggest that podocyte injury contributes to progressive proteinuria. Podocytes are highly specialized, terminally differentiated cells that are unable to proliferate, autophagy plays a key role in maintaining the structure and function of podocytes. Autophagy impairment is involved in the pathogenesis of podocyte loss, which leads to massive proteinuria in DN. In the present study, we investigated the effects of mangiferin on nephropathy in streptozotocin (STZ)-induced diabetic rats; we focused on pathological factors related to autophagy in podocytes and the AMPK-mTOR-ULK1 pathway. The results showed that chronic treatment with mangiferin significantly decreased albuminuria, inhibited glomerular extracellular matrix expansion and restored the expression of nephrin, a podocyte marker, in diabetic rats; these results suggest that mangiferin delayed the process of DN and protected the podocytes. In addition, mangiferin induced autophagy, as shown by the up-regulation of LC3 II and the down-regulation of p62 in both DN rats and podocytes. Transmission electron microscope analyses showed that mangiferin increased the number of autophagosomes in the podocytes of DN rats. This underlying mechanism was associated with the up-regulation of AMPK phosphorylation, the down-regulation of mTOR phosphorylation and the up-regulation of p-ULK1. Taken together, mangiferin delayed the progression of DN and protected the podocytes by enhancing autophagy under diabetic conditions via the AMPK-mTOR-ULK1 pathway. These findings provide new insights into the molecular mechanisms underlying the renoprotective effects of mangiferin in DN. Copyright © 2018 Elsevier B.V. All rights reserved.
Neuenschwander, Regula; Blair, Clancy
2017-02-01
When delaying gratification, both motivational and regulatory processes are likely to be at play; however, the relative contributions of motivational and regulatory influences on delay behavior are unclear. By examining behavioral responses during a delay task, this study sought to examine the motivational (anticipatory behavior) and regulatory mechanisms (executive function and self-control strategies) underlying children's self-regulation. The participants, 65 5- to 9-year-old children (M age =7.19years, SD=0.89), were video-recorded during a delay procedure and later coded for anticipatory behaviors (e.g., gazing intensely at the tablet) and self-control strategies. Children also completed two executive function (EF) tasks. We found that anticipatory behavior was curvilinearly related to delay time. Children showing either very low or very high levels of anticipatory behavior were not able to wait the entire time. Furthermore, our results indicated that anticipatory behavior interacted with EF to predict delay time. Specifically, anticipatory behavior was negatively related to delay time only if EF abilities were low. Finally, self-control strategies also interacted with EF to predict children's ability to delay. Spontaneous engagement in self-control strategies such as fidgeting and engagement in alternative activities were beneficial for children with low EF but were unrelated to delay time for children with high EF. Results indicate the value of examining motivational and regulatory influences on delay behavior. Lapses in self-regulation may be due to the combination of powerful impulsigenic (i.e., anticipatory behavior) and weak volitional processes (i.e., EF, self-control strategies). Copyright © 2016. Published by Elsevier Inc.
77 FR 41110 - Exemptive Order Regarding Compliance With Certain Swap Regulations
Federal Register 2010, 2011, 2012, 2013, 2014
2012-07-12
... delay compliance with certain entity-level requirements of the CEA (and Commission regulations promulgated thereunder), subject to specified conditions. Additionally, with respect to transaction-level.... major swap participants may delay compliance with certain entity-level requirements of the CEA (and...
Carrasco, Emilce; Blum, Mariann; Weickert, Cynthia Shannon; Casper, Diana
2003-01-10
It has been established that thyroid hormone and neurotrophic factors both orchestrate developmental events in the brain. However, it is not clear how these two influences are related. In this study, we investigated the effects of thyroid hormone on cerebellar development and the coincident expression of transforming growth factor-alpha (TGF-alpha), a ligand in the epidermal growth factor (EGF) family, and the epidermal growth factor receptor (EGFR). Profiles of thyroid hormone expression were measured in postnatal animals and were found to peak at postnatal day 15 (P15). These levels dropped below detectable levels when mice were made hypothyroid with propylthiouracil (PTU). TGF-alpha and EGFR expression, as determined by RNAse protection assay, was maximal at P6 in normal animals, but remained low in hypothyroid animals, suggesting that thyroid hormone was responsible for their induction. In situ hybridization and immunohistochemical analysis of EGFR expression revealed that this receptor was present on granule cells within the inner zone of the external granule cell layer (EGL), suggesting that EGFR-ligands were not inducing granule cell proliferation. The persistence of EGFR expression on migrating granule cells and subsequent down-regulation of expression in the internal granule cell layer (IGL) implicates a role for EGFR-ligands in differentiation and/or migration. In hypothyroid animals, we observed a delayed progression of granule cell migration, consistent with the persistence of EGFR labeling in the EGL, and in the 'pile-up' of labeled cells at the interface between the molecular layer and the Purkinje cell layer. Taken together, these results implicate thyroid hormone in the coordinated expression of TGF-alpha and EGFR, which are positioned to play a role in post-mitotic developmental events in the cerebellum.
Shynlova, Oksana; Mitchell, Jennifer A; Tsampalieros, Anne; Langille, B Lowell; Lye, Stephen J
2004-04-01
Myometrial growth and remodeling during pregnancy depends on increased synthesis of interstitial matrix proteins. We hypothesize that the presence of mechanical tension in a specific hormonal environment regulates the expression of extracellular matrix (ECM) components in the uterus. Myometrial tissue was collected from pregnant rats on Gestational Days 0, 12, 15, 17, 19, 21, 22, 23 (labor), and 1 day postpartum and ECM expression was analyzed by Northern blotting. Expression of fibronectin, laminin beta2, and collagen IV mRNA was low during early gestation but increased dramatically on Day 23 during labor. Expression of fibrillar collagens (type I and III) peaked Day 19 and decreased near term. In contrast, elastin mRNA remained elevated from midgestation onward. Injection of progesterone (P4) on Days 20-23 (to maintain elevated plasma P4 levels) delayed the onset of labor, caused dramatic reductions in the levels of fibronectin and laminin mRNA, and prevented the fall of collagen III mRNA levels on Day 23. Treatment of pregnant rats with the progesterone receptor antagonist RU486 on Day 19 induced preterm labor on Day 20 and a premature increase in mRNA levels of collagen IV, fibronectin, and laminin. Analysis of the uterine tissue from unilaterally pregnant rats revealed that most of the changes in ECM gene expression occurred specifically in the gravid horn. Our results show a decrease in expression of fibrillar collagens and a coordinated temporal increase in expression of components of the basement membrane near term associated with decreased P4 and increased mechanical tension. These ECM changes contribute to myometrial growth and remodeling during late pregnancy and the preparation for the synchronized contractions of labor.
Regulation of cAMP and GSK3 signaling pathways contributes to the neuronal conversion of glioma
Kim, Yongbo; Che, Lihua; Kim, Jeong Beom; Chang, Gyeong Eon; Cheong, Eunji; Kang, Seok-Gu; Ha, Yoon
2017-01-01
Glioma is the most malignant type of primary central nervous system tumors, and has an extremely poor prognosis. One potential therapeutic approach is to induce the terminal differentiation of glioma through the forced expression of pro-neural factors. Our goal is to show the proof of concept of the neuronal conversion of C6 glioma through the combined action of small molecules. We investigated the various changes in gene expression, cell-specific marker expression, signaling pathways, physiological characteristics, and morphology in glioma after combination treatment with two small molecules (CHIR99021, a glycogen synthase kinase 3 [GSK3] inhibitor and forskolin, a cyclic adenosine monophosphate [cAMP] activator). Here, we show that the combined action of CHIR99021 and forskolin converted malignant glioma into fully differentiated neurons with no malignant characteristics; inhibited the proliferation of malignant glioma; and significantly down-regulated gene ontology and gene expression profiles related to cell division, gliogenesis, and angiogenesis in small molecule–induced neurons. In vivo, the combined action of CHIR99021 and forskolin markedly delayed neurological deficits and significantly reduced the tumor volume. We suggest that reprogramming technology may be a potential treatment strategy replacing the therapeutic paradigm of traditional treatment of malignant glioma, and a combination molecule comprising a GSK3 inhibitor and a cAMP inducer could be the next generation of anticancer drugs. PMID:29161257
Xie, Xiaohua; Liu, Chao; Zhang, Hua; Jani, Priyam H; Lu, Yongbo; Wang, Xiaofang; Zhang, Bin; Qin, Chunlin
2016-05-05
Amelogenesis Imperfecta (AI) can be caused by the deficiencies of enamel matrix proteins, molecules responsible for the transportation and secretion of enamel matrix components, and proteases processing enamel matrix proteins. In the present study, we discovered the double deletion of bone morphogenetic protein 2 (Bmp2) and bone morphogenetic protein 4 (Bmp4) in the dental epithelium by K14-cre resulted in hypoplastic enamel and reduced density in X-ray radiography as well as shortened enamel rods under scanning electron microscopy. Such enamel phenotype was consistent with the diagnosis of hypoplastic amelogenesis imperfecta. Histological and molecular analyses revealed that the removal of matrix proteins in the mutant enamel was drastically delayed, which was coincided with the greatly reduced expression of matrix metalloproteinase 20 (MMP20) and kallikrein 4 (KLK4). Although the expression of multiple enamel matrix proteins was down-regulated in the mutant ameloblasts, the cleavage of ameloblastin was drastically impaired. Therefore, we attributed the AI primarily to the reduction of MMP20 and KLK4. Further investigation found that BMP/Smad4 signaling pathway was down-regulated in the K14-cre;Bmp2(f/f);Bmp4(f/f)ameloblasts, suggesting that the reduced MMP20 and KLK4 expression may be due to the attenuated epithelial BMP/Smad4 signaling.
Xie, Xiaohua; Liu, Chao; Zhang, Hua; Jani, Priyam H.; Lu, Yongbo; Wang, Xiaofang; Zhang, Bin; Qin, Chunlin
2016-01-01
Amelogenesis Imperfecta (AI) can be caused by the deficiencies of enamel matrix proteins, molecules responsible for the transportation and secretion of enamel matrix components, and proteases processing enamel matrix proteins. In the present study, we discovered the double deletion of bone morphogenetic protein 2 (Bmp2) and bone morphogenetic protein 4 (Bmp4) in the dental epithelium by K14-cre resulted in hypoplastic enamel and reduced density in X-ray radiography as well as shortened enamel rods under scanning electron microscopy. Such enamel phenotype was consistent with the diagnosis of hypoplastic amelogenesis imperfecta. Histological and molecular analyses revealed that the removal of matrix proteins in the mutant enamel was drastically delayed, which was coincided with the greatly reduced expression of matrix metalloproteinase 20 (MMP20) and kallikrein 4 (KLK4). Although the expression of multiple enamel matrix proteins was down-regulated in the mutant ameloblasts, the cleavage of ameloblastin was drastically impaired. Therefore, we attributed the AI primarily to the reduction of MMP20 and KLK4. Further investigation found that BMP/Smad4 signaling pathway was down-regulated in the K14-cre;Bmp2f/f;Bmp4f/fameloblasts, suggesting that the reduced MMP20 and KLK4 expression may be due to the attenuated epithelial BMP/Smad4 signaling. PMID:27146352
Properties and function of KCNQ1 K+ channels isolated from the rectal gland of Squalus acanthias.
Kerst, G; Beschorner, U; Unsöld, B; von Hahn, T; Schreiber, R; Greger, R; Gerlach, U; Lang, H J; Kunzelmann, K; Bleich, M
2001-10-01
KCNQ1 (KVLQT1) K+ channels play an important role during electrolyte secretion in airways and colon. KCNQ1 was cloned recently from NaCl-secreting shark rectal glands. Here we study the properties and regulation of the cloned sKVLQT1 expressed in Xenopus oocytes and Chinese hamster ovary (CHO) cells and compare the results with those obtained from in vitro perfused rectal gland tubules (RGT). The expression of sKCNQ1 induced voltage-dependent, delayed activated K+ currents, which were augmented by an increase in intracellular cAMP and Ca2+. The chromanol derivatives 293B and 526B potently inhibited sKCNQ1 expressed in oocytes and CHO cells, but had little effect on RGT electrolyte transport. Short-circuit currents in RGT were activated by alkalinization and were decreased by acidification. In CHO cells an alkaline pH activated and an acidic pH inhibited 293B-sensitive KCNQ1 currents. Noise analysis of the cell-attached basolateral membrane of RGT indicated the presence of low-conductance (<3 pS) K+ channels, in parallel with other K+ channels. sKCNQ1 generated similar small-conductance K+ channels upon expression in CHO cells and Xenopus oocytes. The results suggest the presence of low-conductance KCNQ1 K+ channels in RGT, which are probably regulated by changes in intracellular cAMP, Ca2+ and pH.
Eklund, D Magnus; Thelander, Mattias; Landberg, Katarina; Ståldal, Veronika; Nilsson, Anders; Johansson, Monika; Valsecchi, Isabel; Pederson, Eric R A; Kowalczyk, Mariusz; Ljung, Karin; Ronne, Hans; Sundberg, Eva
2010-04-01
The plant hormone auxin plays fundamental roles in vascular plants. Although exogenous auxin also stimulates developmental transitions and growth in non-vascular plants, the effects of manipulating endogenous auxin levels have thus far not been reported. Here, we have altered the levels and sites of auxin production and accumulation in the moss Physcomitrella patens by changing the expression level of homologues of the Arabidopsis SHI/STY family proteins, which are positive regulators of auxin biosynthesis genes. Constitutive expression of PpSHI1 resulted in elevated auxin levels, increased and ectopic expression of the auxin response reporter GmGH3pro:GUS, and in an increased caulonema/chloronema ratio, an effect also induced by exogenous auxin application. In addition, we observed premature ageing and necrosis in cells ectopically expressing PpSHI1. Knockout of either of the two PpSHI genes resulted in reduced auxin levels and auxin biosynthesis rates in leafy shoots, reduced internode elongation, delayed ageing, a decreased caulonema/chloronema ratio and an increased number of axillary hairs, which constitute potential auxin biosynthesis sites. Some of the identified auxin functions appear to be analogous in vascular and non-vascular plants. Furthermore, the spatiotemporal expression of the PpSHI genes and GmGH3pro:GUS strongly overlap, suggesting that local auxin biosynthesis is important for the regulation of auxin peak formation in non-vascular plants.
NASA Astrophysics Data System (ADS)
Hofmann, A.; Ritz, U.; Rompe, J.-D.; Tresch, A.; Rommens, P. M.
2015-01-01
Shock wave therapy has been increasingly evaluated as a non-invasive alternative for the treatment of delayed fracture healing and non-unions. Although several clinical studies showed a beneficial effect especially for the hypertrophic type of non-union, little is known about the biological mechanism of its osteogenic effect. To identify the molecular background for the positive effect of shock waves on healing of fracture non-unions, we have analyzed the changes of the global gene expression in human osteoblasts after exposure to shock waves of different energy flux densities. Human osteoblasts were isolated from five patients at non-union sites, treated with 500 impulses of energy flux densities of 0.06 and , and cultured for 96 h. HG-U133A microarrays were used for the analysis of the shock wave-regulated mRNA-transcripts. Differential gene expression was verified by reverse transcriptase polymerase chain reactions. We identified 47 transcripts that showed differential expression after and 45 transcripts after energy treatment. Most intriguing was the up-regulation of neprilysin, calmegin, osteoglycin, asporin, and interleukin-13 receptor-. Eighteen identified genes were previously described to fulfill an important function in bone growth and metabolism. Our study provides the first molecular profile of shock wave-induced gene expression changes in human osteoblasts from patients with hypertrophic fracture non-unions, and it offers a possible molecular explanation for the positive effects of shock waves in patients ridden with this disease.
Gwee, Serene S L; Radford, Rowan A W; Chow, Sharron; Syal, Monisha D; Morsch, Marco; Formella, Isabel; Lee, Albert; Don, Emily K; Badrock, Andrew P; Cole, Nicholas J; West, Adrian K; Cheung, Steve N S; Chung, Roger S
2018-02-21
Aurora kinase B (AurkB) is a serine/threonine protein kinase with a well-characterised role in orchestrating cell division and cytokinesis, and is prominently expressed in healthy proliferating and cancerous cells. However, the role of AurkB in differentiated and non-dividing cells has not been extensively explored. Previously, we have described a significant upregulation of AurkB expression in cultured cortical neurons following an experimental axonal transection. This is somewhat surprising, as AurkB expression is generally associated only with dividing cells Frangini et al. (Mol Cell 51:647-661, 2013); Hegarat et al. (J Cell Biol 195:1103-1113, 2011); Lu et al. (J Biol Chem 283:31785-31790, 2008); Trakala et al. (Cell Cycle 12:1030-1041, 2014). Herein, we present the first description of a role for AurkB in terminally differentiated neurons. AurkB was prominently expressed within post-mitotic neurons of the zebrafish brain and spinal cord. The expression of AurkB varied during the development of the zebrafish spinal motor neurons. Utilising pharmacological and genetic manipulation to impair AurkB activity resulted in truncation and aberrant motor axon morphology, while overexpression of AurkB resulted in extended axonal outgrowth. Further pharmacological inhibition of AurkB activity in regenerating axons delayed their recovery following UV laser-mediated injury. Collectively, these results suggest a hitherto unreported role of AurkB in regulating neuronal development and axonal outgrowth.
Khor, S C; Mohd Yusof, Y A; Wan Ngah, W Z; Makpol, S
Vitamin E has been suggested as nutritional intervention for the prevention of degenerative and age-related diseases. In this study, we aimed to elucidate the underlying mechanism of tocotrienol-rich fraction (TRF) in delaying cellular aging by targeting the proliferation signaling pathways in human diploid fibroblasts (HDFs). Tocotrienol-rich fraction was used to treat different stages of cellular aging of primary human diploid fibroblasts viz. young (passage 6), pre-senescent (passage 15) and senescent (passage 30). Several selected targets involved in the downstream of PI3K/AKT and RAF/MEK/ERK pathways were compared in total RNA and protein. Different transcriptional profiles were observed in young, pre-senescent and senescent HDFs, in which cellular aging increased AKT, FOXO3, CDKN1A and RSK1 mRNA expression level, but decreased ELK1, FOS and SIRT1 mRNA expression level. With tocotrienol-rich fraction treatment, gene expression of AKT, FOXO3, ERK and RSK1 mRNA was decreased in senescent cells, but not in young cells. The three down-regulated mRNA in cellular aging, ELK1, FOS and SIRT1, were increased with tocotrienol-rich fraction treatment. Expression of FOXO3 and P21Cip1 proteins showed up-regulation in senescent cells but tocotrienol-rich fraction only decreased P21Cip1 protein expression in senescent cells. Tocotrienol-rich fraction exerts gene modulating properties that might be responsible in promoting cell cycle progression during cellular aging.
Jin, Liang; Zhang, Kai; Sternglanz, Rolf; Neiman, Aaron M
2017-05-01
In response to starvation, diploid cells of Saccharomyces cerevisiae undergo meiosis and form haploid spores, a process collectively referred to as sporulation. The differentiation into spores requires extensive changes in gene expression. The transcriptional activator Ndt80 is a central regulator of this process, which controls many genes essential for sporulation. Ndt80 induces ∼300 genes coordinately during meiotic prophase, but different mRNAs within the NDT80 regulon are translated at different times during sporulation. The protein kinase Ime2 and RNA binding protein Rim4 are general regulators of meiotic translational delay, but how differential timing of individual transcripts is achieved was not known. This report describes the characterization of two related NDT80 -induced genes, PES4 and MIP6 , encoding predicted RNA binding proteins. These genes are necessary to regulate the steady-state expression, translational timing, and localization of a set of mRNAs that are transcribed by NDT80 but not translated until the end of meiosis II. Mutations in the predicted RNA binding domains within PES4 alter the stability of target mRNAs. PES4 and MIP6 affect only a small portion of the NDT80 regulon, indicating that they act as modulators of the general Ime2/Rim4 pathway for specific transcripts. Copyright © 2017 American Society for Microbiology.
Liu, Nan; Wang, Lin-Hui; Guo, Ling-Ling; Wang, Guo-Qing; Zhou, Xi-Ping; Jiang, Yan; Shang, Jing; Murao, Koji; Chen, Jing-Wei; Fu, Wen-Qing; Zhang, Guo-Xing
2013-01-01
Solid evidence has demonstrated that psychoemotional stress induced alteration of hair cycle through neuropeptide substance P (SP) mediated immune response, the role of reactive oxygen species (ROS) in brain-skin-axis regulation system remains unknown. The present study aims to investigate possible mechanisms of ROS in regulation of SP-mast cell signal pathway in chronic restraint stress (CRS, a model of chronic psychoemotional stress) which induced abnormal of hair cycle. Our results have demonstrated that CRS actually altered hair cycle by inhibiting hair follicle growth in vivo, prolonging the telogen stage and delaying subsequent anagen and catagen stage. Up-regulation of SP protein expression in cutaneous peripheral nerve fibers and activation of mast cell were observed accompanied with increase of lipid peroxidation levels and reduction of the activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) in CRS mice skin. In addition, SP receptor antagonist (RP67580) reduced mast cell activations and lipid peroxidation levels as well as increased GSH-Px activity and normalized hair cycle. Furthermore, antioxidant Tempol (a free radical scavenger) also restored hair cycle, reduced SP protein expression and mast cell activation. Our study provides the first solid evidence for how ROS play a role in regulation of psychoemotional stress induced SP-Mast cell pathway which may provide a convincing rationale for antioxidant application in clinical treatment with psychological stress induced hair loss.
[Immune regulation activity and mechanism of Tibetan Kefir exopolysaccharide fractions].
Meng, Li; Zhang, Lanwei
2009-12-01
To investigate the effects and mechanism on immune regulation activity in mice of two Tibetan Kefir exoploysaccharides (EPS) with different molecular weight of 0.1 x 10(5) - 3 x 10(5) (fraction 1) and 1.8 x 10(3) (fraction 2). The immune regulation activity experiment was carried out in vitro based on the Functional Assessment Procedure and Test Methods of Health Food, which was issued by Ministry of Health of China. First, we treated mice subjects with EPS at doses of 40 mg/kg, 80 mg/kg, 120 mg/kg through ig. Then we detected the index of immune organs, the ability of antibody production (tested by HC50), activity of NK cell, delayed type hypersensitivity (DTH) and phagocytosis of macrophage in mice. Finally, we examined the expression of Erk protein in Macrophages by Western Blot assay. Fraction 1 could promote HC50, activity of NK cell and DTH in mice which low dose showed better. Fraction 2 could promote DTH, phagocytosis of macrophage which high dose showed better. The expression of Erk and COX-2 had the same trend with Phagocytic index. We verified the two fractions of Tibetan Kefir EPS could enhance immune functions in mice. Fraction 1 regulated immune function through NK cell and B cell while fraction 2 through macrophage cell and T cell. The effects to macrophage of Tibetan Kefir EPS in mice may realize through extra cellular signal-regulated kinase Erk pathway.
Drosophila COP9 signalosome subunit 7 interacts with multiple genomic loci to regulate development.
Singer, Ruth; Atar, Shimshi; Atias, Osnat; Oron, Efrat; Segal, Daniel; Hirsch, Joel A; Tuller, Tamir; Orian, Amir; Chamovitz, Daniel A
2014-09-01
The COP9 signalosome protein complex has a central role in the regulation of development of multicellular organisms. While the function of this complex in ubiquitin-mediated protein degradation is well established, results over the past few years have hinted that the COP9 signalosome may function more broadly in the regulation of gene expression. Here, using DamID technology, we show that COP9 signalosome subunit 7 functionally associates with a large number of genomic loci in the Drosophila genome, and show that the expression of many genes within these loci is COP9 signalosome-dependent. This association is likely direct as we show CSN7 binds DNA in vitro. The genes targeted by CSN7 are preferentially enriched for transcriptionally active regions of the genome, and are involved in the regulation of distinct gene ontology groupings including imaginal disc development and cell-cycle control. In accord, loss of CSN7 function leads to cell-cycle delay and altered wing development. These results indicate that CSN7, and by extension the entire COP9 signalosome, functions directly in transcriptional control. While the COP9 signalosome protein complex has long been known to regulate protein degradation, here we expand the role of this complex by showing that subunit 7 binds DNA in vitro and functions directly in vivo in transcriptional control of developmentally important pathways that are relevant for human health. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Andrews, Jonathan C.; Fernández, María Paz; Yu, Qin; Leary, Greg P.; Leung, Adelaine K. W.; Kavanaugh, Michael P.; Kravitz, Edward A.; Certel, Sarah J.
2014-01-01
Chemosensory pheromonal information regulates aggression and reproduction in many species, but how pheromonal signals are transduced to reliably produce behavior is not well understood. Here we demonstrate that the pheromonal signals detected by Gr32a-expressing chemosensory neurons to enhance male aggression are filtered through octopamine (OA, invertebrate equivalent of norepinephrine) neurons. Using behavioral assays, we find males lacking both octopamine and Gr32a gustatory receptors exhibit parallel delays in the onset of aggression and reductions in aggression. Physiological and anatomical experiments identify Gr32a to octopamine neuron synaptic and functional connections in the suboesophageal ganglion. Refining the Gr32a-expressing population indicates that mouth Gr32a neurons promote male aggression and form synaptic contacts with OA neurons. By restricting the monoamine neuron target population, we show that three previously identified OA-FruM neurons involved in behavioral choice are among the Gr32a-OA connections. Our findings demonstrate that octopaminergic neuromodulatory neurons function as early as a second-order step in this chemosensory-driven male social behavior pathway. PMID:24852170
Perturbed desmosomal cadherin expression in grainy head-like 1-null mice.
Wilanowski, Tomasz; Caddy, Jacinta; Ting, Stephen B; Hislop, Nikki R; Cerruti, Loretta; Auden, Alana; Zhao, Lin-Lin; Asquith, Stephen; Ellis, Sarah; Sinclair, Rodney; Cunningham, John M; Jane, Stephen M
2008-03-19
In Drosophila, the grainy head (grh) gene plays a range of key developmental roles through the regulation of members of the cadherin gene family. We now report that mice lacking the grh homologue grainy head-like 1 (Grhl1) exhibit hair and skin phenotypes consistent with a reduction in expression of the genes encoding the desmosomal cadherin, desmoglein 1 (Dsg1). Grhl1-null mice show an initial delay in coat growth, and older mice exhibit hair loss as a result of poor anchoring of the hair shaft in the follicle. The mice also develop palmoplantar keratoderma, analogous to humans with DSG1 mutations. Sequence analysis, DNA binding, and chromatin immunoprecipitation experiments demonstrate that the human and mouse Dsg1 promoters are direct targets of GRHL1. Ultrastructural analysis reveals reduced numbers of abnormal desmosomes in the interfollicular epidermis. These findings establish GRHL1 as an important regulator of the Dsg1 genes in the context of hair anchorage and epidermal differentiation, and suggest that cadherin family genes are key targets of the grainy head-like genes across 700 million years of evolution.
Perturbed desmosomal cadherin expression in grainy head-like 1-null mice
Wilanowski, Tomasz; Caddy, Jacinta; Ting, Stephen B; Hislop, Nikki R; Cerruti, Loretta; Auden, Alana; Zhao, Lin-Lin; Asquith, Stephen; Ellis, Sarah; Sinclair, Rodney; Cunningham, John M; Jane, Stephen M
2008-01-01
In Drosophila, the grainy head (grh) gene plays a range of key developmental roles through the regulation of members of the cadherin gene family. We now report that mice lacking the grh homologue grainy head-like 1 (Grhl1) exhibit hair and skin phenotypes consistent with a reduction in expression of the genes encoding the desmosomal cadherin, desmoglein 1 (Dsg1). Grhl1-null mice show an initial delay in coat growth, and older mice exhibit hair loss as a result of poor anchoring of the hair shaft in the follicle. The mice also develop palmoplantar keratoderma, analogous to humans with DSG1 mutations. Sequence analysis, DNA binding, and chromatin immunoprecipitation experiments demonstrate that the human and mouse Dsg1 promoters are direct targets of GRHL1. Ultrastructural analysis reveals reduced numbers of abnormal desmosomes in the interfollicular epidermis. These findings establish GRHL1 as an important regulator of the Dsg1 genes in the context of hair anchorage and epidermal differentiation, and suggest that cadherin family genes are key targets of the grainy head-like genes across 700 million years of evolution. PMID:18288204
Mannini, Linda; Deri, Paolo; Gremigni, Vittorio; Rossi, Leonardo; Salvetti, Alessandra; Batistoni, Renata
2008-01-01
Regeneration in planarians is an intriguing phenomenon, based on the presence of pluripotent stem cells, known as neoblasts. Following amputation, these cells activate mitotic divisions, migrate distally and undergo differentiation, giving rise to the regeneration blastema. We have identified two msh/msx-related genes, Djmsh1 and Djmsh2, which are expressed in distinct cell populations of the planarian Dugesia japonica and activated, with different patterns, during head regeneration. We demonstrate that RNA interference of Djmsh1 or Djmsh2 generates a delay in the growth of cephalic blastema, interfering with the dynamics of mitoses during its initial formation. Our data also reveal that the activity of the two planarian msh genes is required to regulate Djbmp expression during head regeneration. This study identifies, for the first time, a functional association between muscle segment homeobox (MSH) homeoproteins and BMP signaling during stem cell-based regeneration of the planarian head and provides a functional analysis of how msh genes may regulate in vivo the regenerative response of planarian stem cells.
Sarraf-Zadeh, Ladan; Christen, Stefan; Sauer, Uwe; Cognigni, Paola; Miguel-Aliaga, Irene; Stocker, Hugo; Köhler, Katja; Hafen, Ernst
2013-09-01
In Drosophila, growth takes place during the larval stages until the formation of the pupa. Starvation delays pupariation to allow prolonged feeding, ensuring that the animal reaches an appropriate size to form a fertile adult. Pupariation is induced by a peak of the steroid hormone ecdysone produced by the prothoracic gland (PG) after larvae have reached a certain body mass. Local downregulation of the insulin/insulin-like growth factor signaling (IIS) activity in the PG interferes with ecdysone production, indicating that IIS activity in the PG couples the nutritional state to development. However, the underlying mechanism is not well understood. In this study we show that the secreted Imaginal morphogenesis protein-Late 2 (Imp-L2), a growth inhibitor in Drosophila, is involved in this process. Imp-L2 inhibits the activity of the Drosophila insulin-like peptides by direct binding and is expressed by specific cells in the brain, the ring gland, the gut and the fat body. We demonstrate that Imp-L2 is required to regulate and adapt developmental timing to nutritional conditions by regulating IIS activity in the PG. Increasing Imp-L2 expression at its endogenous sites using an Imp-L2-Gal4 driver delays pupariation, while Imp-L2 mutants exhibit a slight acceleration of development. These effects are strongly enhanced by starvation and are accompanied by massive alterations of ecdysone production resulting most likely from increased Imp-L2 production by neurons directly contacting the PG and not from elevated Imp-L2 levels in the hemolymph. Taken together our results suggest that Imp-L2-expressing neurons sense the nutritional state of Drosophila larvae and coordinate dietary information and ecdysone production to adjust developmental timing under starvation conditions. Copyright © 2013 Elsevier Inc. All rights reserved.
Scioli, Maria Giovanna; Lo Giudice, Pietro; Bielli, Alessandra; Tarallo, Valeria; De Rosa, Alfonso; De Falco, Sandro; Orlandi, Augusto
2015-01-01
Background Impaired wound healing represents a high cost for health care systems. Endothelial dysfunction characterizes dermal microangiopathy and contributes to delayed wound healing and chronic ulcers. Endothelial dysfunction impairs cutaneous microvascular blood flow by inducing an imbalance between vasorelaxation and vasoconstriction as a consequence of reduced nitric oxide (NO) production and the increase of oxidative stress and inflammation. Propionyl-L-carnitine (PLC) is a natural derivative of carnitine that has been reported to ameliorate post-ischemic blood flow recovery. Methods and Results We investigated the effects of PLC in rat skin flap and cutaneous wound healing. A daily oral PLC treatment improved skin flap viability and associated with reactive oxygen species (ROS) reduction, inducible nitric oxide synthase (iNOS) and NO up-regulation, accelerated wound healing and increased capillary density, likely favoring dermal angiogenesis by up-regulation for iNOS, vascular endothelial growth factor (VEGF), placental growth factor (PlGF) and reduction of NADPH-oxidase 4 (Nox4) expression. In serum-deprived human dermal microvascular endothelial cell cultures, PLC ameliorated endothelial dysfunction by increasing iNOS, PlGF, VEGF receptors 1 and 2 expression and NO level. In addition, PLC counteracted serum deprivation-induced impairment of mitochondrial β-oxidation, Nox4 and cellular adhesion molecule (CAM) expression, ROS generation and leukocyte adhesion. Moreover, dermal microvascular endothelial cell dysfunction was prevented by Nox4 inhibition. Interestingly, inhibition of β-oxidation counteracted the beneficial effects of PLC on oxidative stress and endothelial dysfunction. Conclusion PLC treatment improved rat skin flap viability, accelerated wound healing and dermal angiogenesis. The beneficial effects of PLC likely derived from improvement of mitochondrial β-oxidation and reduction of Nox4-mediated oxidative stress and endothelial dysfunction. Antioxidant therapy and pharmacological targeting of endothelial dysfunction may represent a promising tool for the treatment of delayed wound healing or chronic ulcers. PMID:26473356
Neuronal Sodium Channels in Neurodegeneration and Neuroprotection
2002-06-01
following 2 h MCAo/ reperfusion injury Group’ Baselineb 2 h 4 h 6 h $ 24 1h Vehicle 37.0±0.7 38.3±0.7 37.1 ±0.8 37.5 ±0.7 36.6±0.8 RS (0.01 mg/kg) 36.4-±0.3...brain injury caused by middle cerebral neuronal cell death caused by ischemia results from artery occlusion (MCAo) for 2h followed by reperfusion a...expression following cerebral ischemia study, was delayed post- injury (i.e. > 2 -6h post- involves the up-regulation of several gene families injury ). This
Chung, Yih-Lin; Pui, Newman N M
2015-01-01
We hypothesized the histone deacetylase inhibitor phenylbutyrate (PB) has beneficial effects on radiation-induced injury by modulating the expression of DNA repair and wound healing genes. Hamsters received a radiosurgical dose of radiation (40 Gy) to the cheek and were treated with varying PB dosing regimens. Gross alteration of the irradiated cheeks, eating function, histological changes, and gene expression during the course of wound healing were compared between treatment groups. Pathological analysis showed decreased radiation-induced mucositis, facilitated epithelial cell growth, and preventing ulcerative wound formation, after short-term PB treatment, but not after vehicle or sustained PB. The radiation-induced wound healing gene expression profile exhibited a sequential transition from the inflammatory and DNA repair phases to the tissue remodeling phase in the vehicle group. Sustained PB treatment resulted in a prolonged wound healing gene expression profile and delayed the wound healing process. Short-term PB shortened the duration of inflammatory cytokine expression, triggered repeated pulsed expression of cell cycle and DNA repair-regulating genes, and promoted earlier oscillatory expression of tissue remodeling genes. Distinct gene expression patterns between sustained and short-term treatment suggest dynamic profiling of wound healing gene expression can be an important part of a biological therapeutic strategy to mitigate radiation-related tissue injury. © 2015 by the Wound Healing Society.
Frank, S; Zacharowski, K; Wray, G M; Thiemermann, C; Pfeilschifter, J
1999-05-01
To define the mechanism of nitric oxide (NO) action in the glomerulus, we attempted to identify genes that are regulated by NO in rat glomerular mesangial cells. We identified a Cu/Zn superoxide dismutase (SOD) that was strongly induced in these cells by treatment with S-nitroso-glutathione as a NO-donating agent. Bacterial lipopolysaccharide (LPS) acutely decreased Cu/Zn SOD mRNA levels. The LPS-mediated decrease in Cu/Zn SOD is reversed by endogenously produced NO, as LPS also induced a delayed strong iNOS expression in these cells in vitro, which is accompanied by increased Cu/Zn SOD expression. NO dependency of Cu/Zn SOD mRNA recovery could be demonstrated by inhibition of this process by L-NG-monomethylarginine, an inhibitor of NOS enzymatic activity. To demonstrate the in vivo relevance of our observations, we have chosen LPS-treated rats as a model for induction of a systemic inflammatory response. In these animals, we demonstrate a direct coupling of Cu/Zn SOD expression levels to the presence of NO, as Cu/Zn SOD mRNA levels declined during acute inflammation in the presence of a selective inhibitor of iNOS. We propose that the up-regulation of Cu/Zn SOD by endogenous NO may serve as an adaptive, protective mechanism to prevent the formation of toxic quantities of peroxynitrite in conditions associated with iNOS induction during endotoxic shock.
Świątek, Magdalena A.; Gubbens, Jacob; Bucca, Giselda; Song, Eunjung; Yang, Yung-Hun; Laing, Emma; Kim, Byung-Gee; Smith, Colin P.
2013-01-01
Members of the ROK family of proteins are mostly transcriptional regulators and kinases that generally relate to the control of primary metabolism, whereby its member glucose kinase acts as the central control protein in carbon control in Streptomyces. Here, we show that deletion of SCO6008 (rok7B7) strongly affects carbon catabolite repression (CCR), growth, and antibiotic production in Streptomyces coelicolor. Deletion of SCO7543 also affected antibiotic production, while no major changes were observed after deletion of the rok family genes SCO0794, SCO1060, SCO2846, SCO6566, or SCO6600. Global expression profiling of the rok7B7 mutant by proteomics and microarray analysis revealed strong upregulation of the xylose transporter operon xylFGH, which lies immediately downstream of rok7B7, consistent with the improved growth and delayed development of the mutant on xylose. The enhanced CCR, which was especially obvious on rich or xylose-containing media, correlated with elevated expression of glucose kinase and of the glucose transporter GlcP. In liquid-grown cultures, expression of the biosynthetic enzymes for production of prodigionines, siderophores, and calcium-dependent antibiotic (CDA) was enhanced in the mutant, and overproduction of prodigionines was corroborated by matrix-assisted laser desorption ionization–time-of-flight analysis. These data present Rok7B7 as a pleiotropic regulator of growth, CCR, and antibiotic production in Streptomyces. PMID:23292782
Chen, Ying-Jiun J.; Johnson, Madeleine A.; Lieberman, Michael D.; Goodchild, Rose E.; Schobel, Scott; Lewandowski, Nicole; Rosoklija, Gorazd; Liu, Ruei-Che; Gingrich, Jay A.; Small, Scott; Moore, Holly; Dwork, Andrew J.; Talmage, David A.; Role, Lorna W.
2008-01-01
Neuregulin-1 (Nrg1)/erbB signaling regulates neuronal development, migration, myelination, and synaptic maintenance. The Nrg1 gene is a schizophrenia susceptibility gene. To understand the contribution of Nrg1 signaling to adult brain structure and behaviors, we have studied the regulation of Type III Nrg1 expression and evaluated the effect of decreased expression of the Type III Nrg1 isoforms. Type III Nrg1 is transcribed by a promoter distinct from those for other Nrg1 isoforms and, in the adult brain, is expressed in the medial prefrontal cortex, ventral hippocampus and ventral subiculum, regions involved in the regulation of sensorimotor gating and short term memory. Adult heterozygous mutant mice with a targeted disruption for Type III Nrg1 (Nrg1tm1.1Lwr+/-) have enlarged lateral ventricles and decreased dendritic spine density on subicular pyramidal neurons. MRI imaging of Type III Nrg1 heterozygous mice revealed hypo-function in the medial prefrontal cortex and the hippocampal CA1 and subiculum regions. Type III Nrg1 heterozygous mice also have impaired performance on delayed alternation memory tasks, and deficits in prepulse inhibition (PPI). Chronic nicotine treatment eliminated differences in PPI between Type III Nrg1 heterozygous mice and their wild type littermates. Our findings demonstrate a role of Type III Nrg1-signaling in the maintenance of cortico-striatal components, and in the neural circuits involved in sensorimotor gating and short term memory. PMID:18596162
An Ethylene-Induced Regulatory Module Delays Flower Senescence by Regulating Cytokinin Content.
Wu, Lin; Ma, Nan; Jia, Yangchao; Zhang, Yi; Feng, Ming; Jiang, Cai-Zhong; Ma, Chao; Gao, Junping
2017-01-01
In many plant species, including rose (Rosa hybrida), flower senescence is promoted by the gaseous hormone ethylene and inhibited by the cytokinin (CTK) class of hormones. However, the molecular mechanisms underlying these antagonistic effects are not well understood. In this study, we characterized the association between a pathogenesis-related PR-10 family gene from rose (RhPR10.1) and the hormonal regulation of flower senescence. Quantitative reverse transcription PCR analysis showed that RhPR10.1 was expressed at high levels during senescence in different floral organs, including petal, sepal, receptacle, stamen, and pistil, and that expression was induced by ethylene treatment. Silencing of RhPR10.1 expression in rose plants by virus-induced gene silencing accelerated flower senescence, which was accompanied by a higher ion leakage rate in the petals, as well as increased expression of the senescence marker gene RhSAG12 CTK content and the expression of three CTK signaling pathway genes were reduced in RhPR10.1-silenced plants, and the accelerated rate of petal senescence that was apparent in the RhPR10.1-silenced plants was restored to normal levels by CTK treatment. Finally, RhHB6, a homeodomain-Leu zipper I transcription factor, was observed to bind to the RhPR10.1 promoter, and silencing of its expression also promoted flower senescence. Our results reveal an ethylene-induced RhHB6-RhPR10.1 regulatory module that functions as a brake of ethylene-promoted senescence through increasing the CTK content. © 2017 American Society of Plant Biologists. All Rights Reserved.
Perry, Adam N; Carter, C Sue; Cushing, Bruce S
2016-06-01
Chronic stressors are generally considered to disrupt reproduction and inhibit mating. Here we test the hypothesis that a chronic stressor, specifically social isolation, can facilitate adaptive changes that enhance/accelerate reproductive effort. In general, monogamous species display high levels of prosociality, delayed sexual maturation, and greater parental investment in fewer, higher quality offspring compared with closely related polygynous species. We predicted that chronic social isolation would promote behavioral and neurochemical patterns in prairie voles associated with polygyny. Male and female prairie voles were isolated for four weeks and changes in mating behavior, alloparental care, estrogen receptor (ER) α expression and tyrosine hydroxylase (TH) expression in brain regions regulating sociosexual behavior were examined. In males, isolation accelerated copulation, increased ERα in the medial amygdala (MEApd) and bed nucleus of the stria terminalis (BSTpm), and reduced TH expression in the MEApd and BSTpm, but had no effect on alloparental behavior. In females, isolation resulted in more rapid estrus induction and reduced TH expression in the MEApd and BSTpm, but had no effect on estradiol sensitivity or ERα expression. The results support the hypothesis that ERα expression in the MEApd and BSTpm is a critical determinant of male copulatory behavior and/or mating system. The lack of change in alloparental behavior suggests that changes in prosocial behavior are selective and regulated by different mechanisms. The results also suggest that TH in the MEApd and BSTpm may play a critical role in determining mating behavior in both sexes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Extracting rate changes in transcriptional regulation from MEDLINE abstracts.
Liu, Wenting; Miao, Kui; Li, Guangxia; Chang, Kuiyu; Zheng, Jie; Rajapakse, Jagath C
2014-01-01
Time delays are important factors that are often neglected in gene regulatory network (GRN) inference models. Validating time delays from knowledge bases is a challenge since the vast majority of biological databases do not record temporal information of gene regulations. Biological knowledge and facts on gene regulations are typically extracted from bio-literature with specialized methods that depend on the regulation task. In this paper, we mine evidences for time delays related to the transcriptional regulation of yeast from the PubMed abstracts. Since the vast majority of abstracts lack quantitative time information, we can only collect qualitative evidences of time delays. Specifically, the speed-up or delay in transcriptional regulation rate can provide evidences for time delays (shorter or longer) in GRN. Thus, we focus on deriving events related to rate changes in transcriptional regulation. A corpus of yeast regulation related abstracts was manually labeled with such events. In order to capture these events automatically, we create an ontology of sub-processes that are likely to result in transcription rate changes by combining textual patterns and biological knowledge. We also propose effective feature extraction methods based on the created ontology to identify the direct evidences with specific details of these events. Our ontologies outperform existing state-of-the-art gene regulation ontologies in the automatic rule learning method applied to our corpus. The proposed deterministic ontology rule-based method can achieve comparable performance to the automatic rule learning method based on decision trees. This demonstrates the effectiveness of our ontology in identifying rate-changing events. We also tested the effectiveness of the proposed feature mining methods on detecting direct evidence of events. Experimental results show that the machine learning method on these features achieves an F1-score of 71.43%. The manually labeled corpus of events relating to rate changes in transcriptional regulation for yeast is available in https://sites.google.com/site/wentingntu/data. The created ontologies summarized both biological causes of rate changes in transcriptional regulation and corresponding positive and negative textual patterns from the corpus. They are demonstrated to be effective in identifying rate-changing events, which shows the benefits of combining textual patterns and biological knowledge on extracting complex biological events.
Absence of bone sialoprotein (BSP) impairs cortical defect repair in mouse long bone.
Malaval, Luc; Monfoulet, Laurent; Fabre, Thierry; Pothuaud, Laurent; Bareille, Reine; Miraux, Sylvain; Thiaudiere, Eric; Raffard, Gerard; Franconi, Jean-Michel; Lafage-Proust, Marie-Hélène; Aubin, Jane E; Vico, Laurence; Amédée, Joëlle
2009-11-01
Matrix proteins of the SIBLING family interact with bone cells and with bone mineral and are thus in a key position to regulate bone development, remodeling and repair. Within this family, bone sialoprotein (BSP) is highly expressed by osteoblasts, hypertrophic chondrocytes and osteoclasts. We recently reported that mice lacking BSP (BSP-/-) have very low trabecular bone turnover. In the present study, we set up an experimental model of bone repair by drilling a 1 mm diameter hole in the cortical bone of femurs in both BSP-/- and +/+ mice. A non-invasive MRI imaging and bone quantification procedure was designed to follow bone regeneration, and these data were extended by microCT imaging and histomorphometry on undecalcified sections for analysis at cellular level. These combined approaches revealed that the repair process as reflected in defect-refilling in the cortical area was significantly delayed in BSP-/- mice compared to +/+ mice. Concomitantly, histomorphometry showed that formation, mineralization and remodeling of repair (primary) bone in the medulla were delayed in BSP-/- mice, with lower osteoid and osteoclast surfaces at day 15. In conclusion, the absence of BSP delays bone repair at least in part by impairing both new bone formation and osteoclast activity.
An ortholog of LEAFY in Jatropha curcas regulates flowering time and floral organ development.
Tang, Mingyong; Tao, Yan-Bin; Fu, Qiantang; Song, Yaling; Niu, Longjian; Xu, Zeng-Fu
2016-11-21
Jatropha curcas seeds are an excellent biofuel feedstock, but seed yields of Jatropha are limited by its poor flowering and fruiting ability. Thus, identifying genes controlling flowering is critical for genetic improvement of seed yield. We isolated the JcLFY, a Jatropha ortholog of Arabidopsis thaliana LEAFY (LFY), and identified JcLFY function by overexpressing it in Arabidopsis and Jatropha. JcLFY is expressed in Jatropha inflorescence buds, flower buds, and carpels, with highest expression in the early developmental stage of flower buds. JcLFY overexpression induced early flowering, solitary flowers, and terminal flowers in Arabidopsis, and also rescued the delayed flowering phenotype of lfy-15, a LFY loss-of-function Arabidopsis mutant. Microarray and qPCR analysis revealed several flower identity and flower organ development genes were upregulated in JcLFY-overexpressing Arabidopsis. JcLFY overexpression in Jatropha also induced early flowering. Significant changes in inflorescence structure, floral organs, and fruit shape occurred in JcLFY co-suppressed plants in which expression of several flower identity and floral organ development genes were changed. This suggests JcLFY is involved in regulating flower identity, floral organ patterns, and fruit shape, although JcLFY function in Jatropha floral meristem determination is not as strong as that of Arabidopsis.
Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista
2012-01-01
Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495
BAP1 induces cell death via interaction with 14-3-3 in neuroblastoma.
Sime, Wondossen; Niu, Qiankun; Abassi, Yasmin; Masoumi, Katarzyna Chmielarska; Zarrizi, Reihaneh; Køhler, Julie Bonne; Kjellström, Sven; Lasorsa, Vito Alessandro; Capasso, Mario; Fu, Haian; Massoumi, Ramin
2018-04-24
BRCA1-associated protein 1 (BAP1) is a nuclear deubiquitinating enzyme that is associated with multiprotein complexes that regulate key cellular pathways, including cell cycle, cellular differentiation, cell death, and the DNA damage response. In this study, we found that the reduced expression of BAP1 pro6motes the survival of neuroblastoma cells, and restoring the levels of BAP1 in these cells facilitated a delay in S and G2/M phase of the cell cycle, as well as cell apoptosis. The mechanism that BAP1 induces cell death is mediated via an interaction with 14-3-3 protein. The association between BAP1 and 14-3-3 protein releases the apoptotic inducer protein Bax from 14-3-3 and promotes cell death through the intrinsic apoptosis pathway. Xenograft studies confirmed that the expression of BAP1 reduces tumor growth and progression in vivo by lowering the levels of pro-survival factors such as Bcl-2, which in turn diminish the survival potential of the tumor cells. Patient data analyses confirmed the finding that the high-BAP1 mRNA expression correlates with a better clinical outcome. In summary, our study uncovers a new mechanism for BAP1 in the regulation of cell apoptosis in neuroblastoma cells.
A Drought-Inducible Transcription Factor Delays Reproductive Timing in Rice.
Zhang, Chunyu; Liu, Jun; Zhao, Tao; Gomez, Adam; Li, Cong; Yu, Chunsheng; Li, Hongyu; Lin, Jianzhong; Yang, Yuanzhu; Liu, Bin; Lin, Chentao
2016-05-01
The molecular mechanisms underlying photoperiod or temperature control of flowering time have been recently elucidated, but how plants regulate flowering time in response to other external factors, such as water availability, remains poorly understood. Using a large-scale Hybrid Transcription Factor approach, we identified a bZIP transcriptional factor, O. sativa ABA responsive element binding factor 1 (OsABF1), which acts as a suppressor of floral transition in a photoperiod-independent manner. Simultaneous knockdown of both OsABF1 and its closest homologous gene, OsbZIP40, in rice (Oryza sativa) by RNA interference results in a significantly earlier flowering phenotype. Molecular and genetic analyses demonstrate that a drought regime enhances expression of the OsABF1 gene, which indirectly suppresses expression of the Early heading date 1 (Ehd1) gene that encodes a key activator of rice flowering. Furthermore, we identified a drought-inducible gene named OsWRKY104 that is under the direct regulation of OsABF1 Overexpression of OsWRKY104 can suppress Ehd1 expression and confers a later flowering phenotype in rice. Together, these findings reveal a novel pathway by which rice modulates heading date in response to the change of ambient water availability. © 2016 American Society of Plant Biologists. All Rights Reserved.
An ortholog of LEAFY in Jatropha curcas regulates flowering time and floral organ development
Tang, Mingyong; Tao, Yan-Bin; Fu, Qiantang; Song, Yaling; Niu, Longjian; Xu, Zeng-Fu
2016-01-01
Jatropha curcas seeds are an excellent biofuel feedstock, but seed yields of Jatropha are limited by its poor flowering and fruiting ability. Thus, identifying genes controlling flowering is critical for genetic improvement of seed yield. We isolated the JcLFY, a Jatropha ortholog of Arabidopsis thaliana LEAFY (LFY), and identified JcLFY function by overexpressing it in Arabidopsis and Jatropha. JcLFY is expressed in Jatropha inflorescence buds, flower buds, and carpels, with highest expression in the early developmental stage of flower buds. JcLFY overexpression induced early flowering, solitary flowers, and terminal flowers in Arabidopsis, and also rescued the delayed flowering phenotype of lfy-15, a LFY loss-of-function Arabidopsis mutant. Microarray and qPCR analysis revealed several flower identity and flower organ development genes were upregulated in JcLFY-overexpressing Arabidopsis. JcLFY overexpression in Jatropha also induced early flowering. Significant changes in inflorescence structure, floral organs, and fruit shape occurred in JcLFY co-suppressed plants in which expression of several flower identity and floral organ development genes were changed. This suggests JcLFY is involved in regulating flower identity, floral organ patterns, and fruit shape, although JcLFY function in Jatropha floral meristem determination is not as strong as that of Arabidopsis. PMID:27869146
Fei, Guanghe; Guo, Conghui; Sun, Hong-Shuo; Feng, Zhong-Ping
2007-01-01
Chronic hypoxia exposure can cause neurobehavioral dysfunction, but the underlying cellular and molecular mechanisms remain unclear. Here, we found that adult Lymnaea stagnalis snails maintained in low O(2) (approximately 5%) for 4 days developed slowed reactions to light stimuli, and reduced righting movement. Semiquantitative immunoblotting analyses showed that hypoxia exposure induced increased expression of heat-shock protein (HSP)70 in ganglion preparations, and suppressed expression of the presynaptic proteins syntaxin I, synaptic vesicle protein 2 (SV2) and synaptotagmin I. Detailed time course analyses showed that an early moderate increase developed within 6 h, preceding a substantial up-regulation of HSP70 after 4 days; an early reduction of syntaxin I in the first 24 h; a delayed reduction of synaptotagmin I after 4 days; and a biphasic change in SV2. Using a double-stranded RNA interference approach, we demonstrated that preventing the hypoxia inducible HSP70 enhanced down-regulation of syntaxin and synaptotagmin, and aggravated motor and sensory suppression. Co-immunoprecipitation analysis revealed an interaction between HSP70 and syntaxin. We have thus provided the first evidence that early induction of HSP70 by chronic hypoxia is critical for maintaining expression levels of presynaptic proteins. These findings implicate a new molecular mechanism underlying chronic hypoxia-induced neurobehavioral adaptation and impairment.
Reduction of EEG Theta Power and Changes in Motor Activity in Rats Treated with Ceftriaxone
Bellesi, Michele; Vyazovskiy, Vladyslav V.; Tononi, Giulio; Cirelli, Chiara; Conti, Fiorenzo
2012-01-01
The glutamate transporter GLT-1 is responsible for the largest proportion of total glutamate transport. Recently, it has been demonstrated that ceftriaxone (CEF) robustly increases GLT-1 expression. In addition, physiological studies have shown that GLT-1 up-regulation strongly affects synaptic plasticity, and leads to an impairment of the prepulse inhibition, a simple form of information processing, thus suggesting that GLT-1 over-expression may lead to dysfunctions of large populations of neurons. To test this possibility, we assessed whether CEF affects cortical electrical activity by using chronic electroencephalographic (EEG) recordings in male WKY rats. Spectral analysis showed that 8 days of CEF treatment resulted in a delayed reduction in EEG theta power (7–9 Hz) in both frontal and parietal derivations. This decrease peaked at day 10, i.e., 2 days after the end of treatment, and disappeared by day 16. In addition, we found that the same CEF treatment increased motor activity, especially when EEG changes are more prominent. Taken together, these data indicate that GLT-1 up-regulation, by modulating glutamatergic transmission, impairs the activity of widespread neural circuits. In addition, the increased motor activity and prepulse inhibition alterations previously described suggest that neural circuits involved in sensorimotor control are particularly sensitive to GLT-1 up-regulation. PMID:22479544
Reduction of EEG theta power and changes in motor activity in rats treated with ceftriaxone.
Bellesi, Michele; Vyazovskiy, Vladyslav V; Tononi, Giulio; Cirelli, Chiara; Conti, Fiorenzo
2012-01-01
The glutamate transporter GLT-1 is responsible for the largest proportion of total glutamate transport. Recently, it has been demonstrated that ceftriaxone (CEF) robustly increases GLT-1 expression. In addition, physiological studies have shown that GLT-1 up-regulation strongly affects synaptic plasticity, and leads to an impairment of the prepulse inhibition, a simple form of information processing, thus suggesting that GLT-1 over-expression may lead to dysfunctions of large populations of neurons. To test this possibility, we assessed whether CEF affects cortical electrical activity by using chronic electroencephalographic (EEG) recordings in male WKY rats. Spectral analysis showed that 8 days of CEF treatment resulted in a delayed reduction in EEG theta power (7-9 Hz) in both frontal and parietal derivations. This decrease peaked at day 10, i.e., 2 days after the end of treatment, and disappeared by day 16. In addition, we found that the same CEF treatment increased motor activity, especially when EEG changes are more prominent. Taken together, these data indicate that GLT-1 up-regulation, by modulating glutamatergic transmission, impairs the activity of widespread neural circuits. In addition, the increased motor activity and prepulse inhibition alterations previously described suggest that neural circuits involved in sensorimotor control are particularly sensitive to GLT-1 up-regulation.
Tumor suppressor Lzap regulates cell cycle progression, doming and zebrafish epiboly
Liu, Dan; Wang, Wen-Der; Melville, David B.; Cha, Yong I.; Yin, Zhirong; Issaeva, Natalia; Knapik, Ela W.; Yarbrough, Wendell G.
2012-01-01
Initial stages of embryonic development rely on rapid, synchronized cell divisions of the fertilized egg followed by a set of morphogenetic movements collectively called epiboly and gastrulation. Lzap is a putative tumor suppressor whose expression is lost in 30% of head and neck squamous cell carcinomas. Lzap activities include regulation of cell cycle progression and response to therapeutic agents. Here we explore developmental roles of the lzap gene during zebrafish morphogenesis. Lzap is highly conserved among vertebrates and is maternally deposited. Expression is initially ubiquitous during gastrulation, and later becomes more prominent in the pharyngeal arches, digestive tract and brain. Antisense morpholino-mediated depletion of Lzap resulted in delayed cell divisions and apoptosis during blastomere formation, resulting in fewer, larger cells. Cell cycle analysis suggested that Lzap loss in early embryonic cells resulted in a G2/M arrest. Furthermore, the Lzap-deficient embryos failed to initiate epiboly – the earliest morphogenetic movement in animal development – which has been shown to be dependent on cell adhesion and migration of epithelial sheets. Our results strongly implicate Lzap in regulation of cell cycle progression, adhesion and migratory activity of epithelial cell sheets during early development. These functions provide further insight into Lzap activity that may contribute not only to development, but also to tumor formation. PMID:21523853
Qian, J; Ramroop, K; McLeod, A; Bandari, P; Livingston, D H; Harrison, J S; Rameshwar, P
2001-10-15
The bone marrow (BM), which is the major site of immune cell development in the adult, responds to different stimuli such as inflammation and hemorrhagic shock. Substance P (SP) is the major peptide encoded by the immune/hemopoietic modulator gene, preprotachykinin-1 (PPT-I). Differential gene expression using a microarray showed that SP reduced hypoxia-inducible factor-1alpha (HIF-1alpha) mRNA levels in BM stroma. Because long-term hypoxia induced the expression of PPT-I in BM mononuclear cells, we used timeline studies to determine whether PPT-I is central to the biologic responses of BM stroma subjected to 30-min hypoxia (pO(2) = 35 mm Hg) followed by reoxygenation. HIF-1alpha mRNA and protein levels were increased up to 12 h. At this time, beta-PPT-I mRNA was detected with the release of SP at 16 h. SP release correlated with down-regulation of HIF-1alpha to baseline. A direct role for SP in HIF-1alpha expression was demonstrated as follows: 1) transient knockout of beta-PPT-I showed an increase in HIF-1alpha expression up to 48 h of reoxygenation; and 2) HIF-1alpha expression remained baseline during reoxygenation when stroma was subjected to hypoxia in the presence of SP. Reoxygenation activated the PPT-I promoter with concomitant nuclear translocation of HIF-1alpha that can bind to the respective consensus sequences within the PPT-I promoter. SP reversed active caspase-3, an indicator of apoptosis and erythropoiesis, to homeostasis level after reoxygenation of hypoxic stroma. The results show that during reoxgenation the PPT-I gene acts as a negative regulator on the expression of HIF-1alpha and active caspase-3 in BM stroma subjected to reoxygenation.
Protective role for miR-9-5p in the fibrogenic transformation of human dermal fibroblasts.
Miguel, Verónica; Busnadiego, Oscar; Fierro-Fernández, Marta; Lamas, Santiago
2016-01-01
Excessive accumulation of extracellular matrix (ECM) proteins is the hallmark of fibrotic diseases, including skin fibrosis. This response relies on the activation of dermal fibroblasts that evolve into a pro-fibrogenic phenotype. One of the major players in this process is the cytokine transforming growth factor-β (TGF-β). MicroRNAs (miRNAs) are small non-coding RNAs that post-transcriptionally regulate gene expression affecting a wide range of pathophysiological events including fibrogenesis. MicroRNA-9-5p (miR-9-5p) has been shown to exert a protective role in lung and peritoneal fibrosis. This study aimed to evaluate the role of miR-9-5p in skin fibrosis. miR-9-5p is up-regulated in TGF-β1-treated human dermal fibroblasts (HDFs). In silico identification of miR-9-5p targets spotted the type II TGF-β receptor (TGFBR2) as a potential TGF-β signaling-related effector for this miRNA. Consistently, over-expression of miR-9-5p in HDFs down-regulated TGFBR2 at both the mRNA and protein levels and reduced the phosphorylation of Smad2 and the translocation of Smad2/3 to the nucleus. In keeping, over-expression of miR-9-5p significantly delayed TGF-β1-dependent transformation of dermal fibroblasts, decreasing the expression of ECM protein collagen, type I, alpha 1 (Col1α1), and fibronectin (FN), the amount of secreted collagen proteins, and the expression of the archetypal myofibroblast marker alpha-smooth muscle actin (α-SMA). By contrast, specific inhibition of miR-9-5p resulted in enhanced presence of fibrosis markers. The expression of miR-9-5p was also detected in the skin and plasma in the mouse model of bleomycin-induced dermal fibrosis. Using lentiviral constructs, we demonstrated that miR-9-5p over-expression was also capable of deterring fibrogenesis in this same model. miR-9-5p significantly prevents fibrogenesis in skin fibrosis. This is mediated by an abrogation of TGF-β-mediated signaling through the down-regulation of TGFBR2 expression in HDFs. These results may pave the way for future diagnostic or therapeutic developments for skin fibrosis based on miR-9-5p.
Truong, Van-Long; Bak, Min Ji; Lee, Changook; Jun, Mira; Jeong, Woo-Sik
2017-09-08
Hair loss (alopecia) is a universal problem for numerous people in the world. The present study was conducted to investigate the effects of red ginseng oil (RGO) and its major components on hair re-growth using testosterone (TES)-induced delay of anagen entry in C57BL/6 mice and their mechanisms of action. Seven-week-old C57BL/6 mice were daily treated with TES for 1 h prior to topical application of 10% RGO, 1% linoleic acid (LA), 1% β-sitosterol (SITOS), or 1% bicyclo(10.1.0)tridec-1-ene (BICYCLO) once a day for 28 days. Hair regenerative capacity was significantly restored by treatment of RGO and its major compounds in the TES-treated mice. Histological analysis showed that RGO along with LA and SITOS but not BICYCLO promoted hair growth through early inducing anagen phase that was delayed by TES in mice. Treatment of mice with RGO, LA, or SITOS up-regulated Wnt/β-catenin and Shh/Gli pathways-mediated expression of genes such as β-catenin, Lef-1, Sonic hedgehog, Smoothened, Gli-1, Cyclin D1, and Cyclin E in the TES-treated mice. In addition, RGO and its major components reduced the protein level of TGF-β but enhanced the expression of anti-apoptotic protein Bcl-2. These results suggest that RGO is a potent novel therapeutic natural product for treatment of androgenic alopecia possibly through hair re-growth activity of its major components such as LA and SITOS.
Heinzelmann, Morgan; Reddy, Swarnalatha Y.; French, Louis M.; Wang, Dan; Lee, Hyunhwa; Barr, Taura; Baxter, Tristin; Mysliwiec, Vincent; Gill, Jessica
2014-01-01
Objective: Approximately one-quarter of military personnel who deployed to combat stations sustained one or more blast-related, closed-head injuries. Blast injuries result from the detonation of an explosive device. The mechanisms associated with blast exposure that give rise to traumatic brain injury (TBI), and place military personnel at high risk for chronic symptoms of post-concussive disorder (PCD), post-traumatic stress disorder (PTSD), and depression are not elucidated. Methods: To investigate the mechanisms of persistent blast-related symptoms, we examined expression profiles of transcripts across the genome to determine the role of gene activity in chronic symptoms following blast-TBI. Active duty military personnel with (1) a medical record of a blast-TBI that occurred during deployment (n = 19) were compared to control participants without TBI (n = 17). Controls were matched to cases on demographic factors including age, gender, and race, and also in diagnoses of sleep disturbance, and symptoms of PTSD and depression. Due to the high number of PCD symptoms in the TBI+ group, we did not match on this variable. Using expression profiles of transcripts in microarray platform in peripheral samples of whole blood, significantly differentially expressed gene lists were generated. Statistical threshold is based on criteria of 1.5 magnitude fold-change (up or down) and p-values with multiple test correction (false discovery rate <0.05). Results: There were 34 transcripts in 29 genes that were differentially regulated in blast-TBI participants compared to controls. Up-regulated genes included epithelial cell transforming sequence and zinc finger proteins, which are necessary for astrocyte differentiation following injury. Tensin-1, which has been implicated in neuronal recovery in pre-clinical TBI models, was down-regulated in blast-TBI participants. Protein ubiquitination genes, such as epidermal growth factor receptor, were also down-regulated and identified as the central regulators in the gene network determined by interaction pathway analysis. Conclusion: In this study, we identified a gene-expression pathway of delayed neuronal recovery in military personnel a blast-TBI and chronic symptoms. Future work is needed to determine if therapeutic agents that regulate these pathways may provide novel treatments for chronic blast-TBI-related symptoms. PMID:25346719
48 CFR 52.242-17 - Government Delay of Work.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 48 Federal Acquisition Regulations System 2 2011-10-01 2011-10-01 false Government Delay of Work....242-17 Government Delay of Work. As prescribed in 42.1305(c), insert the following clause in... services, or for supplies that are commercial or modified-commercial items. Government Delay of Work (APR...
48 CFR 52.242-17 - Government Delay of Work.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Government Delay of Work....242-17 Government Delay of Work. As prescribed in 42.1305(c), insert the following clause in... services, or for supplies that are commercial or modified-commercial items. Government Delay of Work (APR...
48 CFR 52.242-17 - Government Delay of Work.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 48 Federal Acquisition Regulations System 2 2013-10-01 2013-10-01 false Government Delay of Work....242-17 Government Delay of Work. As prescribed in 42.1305(c), insert the following clause in... services, or for supplies that are commercial or modified-commercial items. Government Delay of Work (APR...
48 CFR 52.242-17 - Government Delay of Work.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 48 Federal Acquisition Regulations System 2 2014-10-01 2014-10-01 false Government Delay of Work....242-17 Government Delay of Work. As prescribed in 42.1305(c), insert the following clause in... services, or for supplies that are commercial or modified-commercial items. Government Delay of Work (APR...
Boyanapalli, Sarandeep S S; Huang, Ying; Su, Zhengyuan; Cheng, David; Zhang, Chengyue; Guo, Yue; Rao, Rohit; Androulakis, Ioannis P; Kong, Ah-Ng
2018-06-05
Chronic inflammation is a key driver of cancer development. Nitrite levels, which are regulated by inducible nitric oxide synthase (iNOS), play a critical role in inflammation. While the anti-oxidant and anti-inflammatory effects of curcumin, a natural product present in the roots of Curcuma longa have been widely studied, the acute pharmacokinetics (PK) and pharmacodynamics (PD) of curcumin in suppressing pro-inflammatory markers and epigenetic modulators remain unclear. In this study, we evaluated the PK and PD of curcumin-induced suppression of lipopolysaccharide (LPS)-mediated inflammation in rat lymphocytes. LPS was administered intravenously either alone or with curcumin to female Sprague-Dawley rats. Plasma samples were analyzed for curcumin concentration and mRNA expression was quantified in lymphocytes. Relative gene expression of several inflammatory and epigenetic modulators was analyzed. To investigate the relationship between curcumin concentration and iNOS, TNF-α, and IL-6 gene expression, PK/PD modeling using Jusko's indirect response model (IDR) integrating transit compartments (TC) describing the delayed response was conducted. The concentration-time profile of curcumin exhibited a bi-exponential decline, which was well described by a two-compartmental pharmacokinetic model. Importantly our results demonstrate that LPS induced gene expression of pro-inflammatory markers in lymphocytes, with peak expression at approximately 3 h and curcumin suppressed the gene expression in animals administered with LPS. These effects were well captured using the IDR model and an IDR model with the transit compartments. In summary, the PK/PD modeling approach could potentially provide a robust quantitative framework for evaluating the acute anti-inflammatory and epigenetic effects of curcumin in future clinical trials. This article is protected by copyright. All rights reserved.
Autoinducer-2 Quorum Sensing Contributes to Regulation of Microcin PDI in Escherichia coli
Lu, Shao-Yeh; Zhao, Zhe; Avillan, Johannetsy J.; Liu, Jinxin; Call, Douglas R.
2017-01-01
The Escherichia coli quorum sensing (QS) signal molecule, autoinducer-2 (AI-2), reaches its maximum concentration during mid-to-late growth phase after which it quickly degrades during stationary phase. This pattern of AI-2 concentration coincides with the up- then down-regulation of a recently described microcin PDI (mccPDI) effector protein (McpM). To determine if there is a functional relationship between these systems, a prototypical mccPDI-expressing strain of E. coli 25 was used to generate ΔluxS, ΔlsrACDBFG (Δlsr), and ΔlsrR mutant strains that are deficient in AI-2 production, transportation, and AI-2 transport regulation, respectively. Trans-complementation, RT-qPCR, and western blot assays were used to detect changes of microcin expression and synthesis under co-culture and monoculture conditions. Compared to the wild-type strain, the AI-2-deficient strain (ΔluxS) and -uptake negative strain (Δlsr) were >1,000-fold less inhibitory to susceptible bacteria (P < 0.05). With in trans complementation of luxS, the AI-2 deficient mutant reduced the susceptible E. coli population by 4-log, which was within 1-log of the wild-type phenotype. RT-qPCR and western blot results for the AI-2 deficient E. coli 25 showed a 5-fold reduction in mcpM transcription with an average 2-h delay in McpM synthesis. Furthermore, overexpression of sRNA micC and micF (both involved in porin protein regulation) was correlated with mcpM regulation, consistent with a possible link between QS and mcpM regulation. This is the direct first evidence that microcin regulation can be linked to quorum sensing in a Gram-negative bacterium. PMID:29312248
CPT-11-Induced Delayed Diarrhea Develops via Reduced Aquaporin-3 Expression in the Colon
Kon, Risako; Tsubota, Yuika; Minami, Moe; Kato, Saki; Matsunaga, Yukari; Kimura, Hiroshi; Murakami, Yuta; Fujikawa, Tetsuya; Sakurai, Ryoya; Tomimoto, Rei; Machida, Yoshiaki; Ikarashi, Nobutomo; Sugiyama, Kiyoshi
2018-01-01
While irinotecan (CPT-11) has a potent anti-cancer effect, it also causes serious diarrhea as an adverse reaction. In this study, we analyzed the pathogenic mechanism of CPT-11-induced delayed diarrhea by focusing on water channel aquaporin-3 (AQP3) in the colon. When rats received CPT-11, the expression level of AQP3 was reduced during severe diarrhea. It was found that the expression levels of inflammatory cytokines and the loss of crypt cells were increased in the colon when CPT-11 was administered. When celecoxib, an anti-inflammatory drug, was concomitantly administered, both the diarrhea and the reduced expression of AQP3 induced by CPT-11 were suppressed. The inflammation in the rat colon during diarrhea was caused via activated macrophage by CPT-11. These results showed that when CPT-11 is administered, the expression level of AQP3 in the colon is reduced, resulting in delayed diarrhea by preventing water transport from the intestinal tract. It was also suggested that the reduced expression of AQP3 might be due to the inflammation that occurs following the loss of colonic crypt cells and to the damage caused by the direct activation of macrophages by CPT-11. Therefore, it was considered that anti-inflammatory drugs that suppress the reduction of AQP3 expression could prevent CPT-11-induced delayed diarrhea. PMID:29316651
CPT-11-Induced Delayed Diarrhea Develops via Reduced Aquaporin-3 Expression in the Colon.
Kon, Risako; Tsubota, Yuika; Minami, Moe; Kato, Saki; Matsunaga, Yukari; Kimura, Hiroshi; Murakami, Yuta; Fujikawa, Tetsuya; Sakurai, Ryoya; Tomimoto, Rei; Machida, Yoshiaki; Ikarashi, Nobutomo; Sugiyama, Kiyoshi
2018-01-06
While irinotecan (CPT-11) has a potent anti-cancer effect, it also causes serious diarrhea as an adverse reaction. In this study, we analyzed the pathogenic mechanism of CPT-11-induced delayed diarrhea by focusing on water channel aquaporin-3 (AQP3) in the colon. When rats received CPT-11, the expression level of AQP3 was reduced during severe diarrhea. It was found that the expression levels of inflammatory cytokines and the loss of crypt cells were increased in the colon when CPT-11 was administered. When celecoxib, an anti-inflammatory drug, was concomitantly administered, both the diarrhea and the reduced expression of AQP3 induced by CPT-11 were suppressed. The inflammation in the rat colon during diarrhea was caused via activated macrophage by CPT-11. These results showed that when CPT-11 is administered, the expression level of AQP3 in the colon is reduced, resulting in delayed diarrhea by preventing water transport from the intestinal tract. It was also suggested that the reduced expression of AQP3 might be due to the inflammation that occurs following the loss of colonic crypt cells and to the damage caused by the direct activation of macrophages by CPT-11. Therefore, it was considered that anti-inflammatory drugs that suppress the reduction of AQP3 expression could prevent CPT-11-induced delayed diarrhea.
LcMCII-1 is involved in the ROS-dependent senescence of the rudimentary leaves of Litchi chinensis.
Wang, Congcong; Lü, Peitao; Zhong, Silin; Chen, Houbin; Zhou, Biyan
2017-01-01
LcMCII - 1 is a type II metacaspase. Over-expression of LcMCII- 1 in Arabidopsis promoted ROS-dependent and natural senescence. Virus-induced LcMCII- 1 silencing delayed the ROS-dependent senescence of the rudimentary leaves of Litchi chinensis . Litchi is an evergreen woody fruit tree that is widely cultivated in subtropical and tropical regions. Its floral buds are mixed with axillary or apical panicle primordia, leaf primordia and rudimentary leaves. A low spring temperature is vital for litchi production as it promotes the abscission of the rudimentary leaves, which could otherwise prevent panicle development. Hence, climate change could present additional challenges for litchi production. We previously reported that reactive oxygen species (ROS) can substitute low-temperature treatment to induce the senescence of rudimentary leaves. We have now identified from RNA-Seq data a litchi type II metacaspase gene, LcMCII-1, that is responsive to ROS. Silencing LcMCII-1 by virus-induced gene silencing delayed ROS-dependent senescence. The ectopic over-expression of LcMCII-1 in transgenic Arabidopsis promoted ROS-dependent and natural senescence. Consistently, the transient expression of LcMCII-1 in tobacco leaf by agroinfiltration resulted in leaf yellowing. Our findings demonstrate that LcMCII-1 is positively involved in the regulation of rudimentary leaf senescence in litchi and provide a new target for the future molecular breeding of new cultivars that can set fruit in warmer climates.
Emotion suppression affects cardiovascular responses to initial and subsequent laboratory stressors.
Quartana, Phillip J; Burns, John W
2010-09-01
The study of anger suppression and risk for cardiovascular disease has relied predominately on inspection of correlations between trait anger-in and cardiovascular risk factors and disease. This approach tells us little about whether inhibitory processes have anything to do with outcomes, and cannot speak to whether suppression of anger per se affects cardiovascular parameters. Drawing on the broader emotion regulation literature, we examined the effects of experimentally induced anger and general negative emotion in the context of expressive and experiential suppression on cardiovascular responses to initial and subsequent laboratory stressors. Of all participants, 201 healthy participants were randomly assigned to one of six conditions formed by crossing emotion (anxiety, anger) and suppression (experiential, expressive, control) conditions. Participants completed a mental arithmetic task with anxiety or anger induction under their respective suppression manipulation instructions, and subsequently were exposed to a cold pressor task. Systolic blood pressure (SBP), diastolic blood pressure, and heart rate values were obtained for each experimental epoch. More robust SBP responses to the initial stressor were evidenced for those in the expressive versus the control condition. In response to the subsequent stressor, those in the experiential suppression condition showed the most pronounced SBP responses, suggesting pronounced delayed effects of this type of suppression. Effects of suppression on SBP reactivity were indistinguishable across anxiety and anger conditions. Effortful suppression of negative emotion has immediate and delayed consequences for stress-induced cardiovascular reactivity. Theoretical and clinical significance of these findings are discussed.
2017-05-19
This final rule finalizes May 20, 2017 as the effective date of the final rule titled "Advancing Care Coordination Through Episode Payment Models (EPMs); Cardiac Rehabilitation Incentive Payment Model; and Changes to the Comprehensive Care for Joint Replacement Model (CJR)" originally published in the January 3, 2017 Federal Register. This final rule also finalizes a delay of the applicability date of the regulations at 42 CFR part 512 from July 1, 2017 to January 1, 2018 and delays the effective date of the specific CJR regulations listed in the DATES section from July 1, 2017 to January 1, 2018.
NASA Astrophysics Data System (ADS)
Fang, Shengle; Jiang, Minghui
2009-12-01
In this paper, we investigate the stability and Hopf bifurcation of a new regulated logistic growth with discrete and distributed delays. By choosing the discrete delay τ as a bifurcation parameter, we prove that the system is locally asymptotically stable in a range of the delay and Hopf bifurcation occurs as τ crosses a critical value. Furthermore, explicit algorithm for determining the direction of the Hopf bifurcation and the stability of the bifurcating periodic solutions is derived by normal form theorem and center manifold argument. Finally, an illustrative example is also given to support the theoretical results.
Genzer, Yoni; Dadon, Maayan; Burg, Chen; Chapnik, Nava; Froy, Oren
2015-12-05
Ketogenic diet (KD) is used for weight loss or to treat epilepsy. KD leads to liver AMP-activated protein kinase (AMPK) activation, which would be expected to inhibit gluconeogenesis. However, KD leads to increased hepatic glucose output. As AMPK and its active phosphorylated form (pAMPK) show circadian oscillation, this discrepancy could stem from wrong-time-of-day sampling. The effect of KD was tested on mouse clock gene expression, AMPK, mTOR, SIRT1 and locomotor activity for 2 months and compared to low-fat diet (LFD). KD led to 1.5-fold increased levels of blood glucose and insulin. Brain pAMPK/AMPK ratio was 40% higher under KD, whereas that in liver was not affected. KD led to 40% and 20% down-regulation of the ratio of pP70S6K/P70S6K, the downstream target of mTOR, in the brain and liver, respectively. SIRT1 levels were 40% higher in the brain, but 40% lower in the liver of KD-fed mice. Clock genes showed delayed rhythms under KD. In the brain of KD-fed mice, amplitudes of clock genes were down-regulated, whereas 6-fold up-regulation was found in the liver. The metabolic state under KD indicates reduced satiety in the brain and reduced anabolism alongside increased gluconeogenesis in the liver. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Sagredo, Onintza; Pazos, M Ruth; Satta, Valentina; Ramos, José A; Pertwee, Roger G; Fernández-Ruiz, Javier
2011-09-01
We studied whether combinations of botanical extracts enriched in either Δ(9)-tetrahydrocannabinol (Δ(9)-THC) or cannabidiol (CBD), which are the main constituents of the cannabis-based medicine Sativex, provide neuroprotection in rat models of Huntington's disease (HD). We used rats intoxicated with 3-nitropropionate (3NP) that were given combinations of Δ(9)-THC- and CBD-enriched botanical extracts. The issue was also studied in malonate-lesioned rats. The administration of Δ(9)-THC- and CBD-enriched botanical extracts combined in a ratio of 1:1 as in Sativex attenuated 3NP-induced GABA deficiency, loss of Nissl-stained neurons, down-regulation of CB(1) receptor and IGF-1 expression, and up-regulation of calpain expression, whereas it completely reversed the reduction in superoxide dismutase-1 expression. Similar responses were generally found with other combinations of Δ(9)-THC- and CBD-enriched botanical extracts, suggesting that these effects are probably related to the antioxidant and CB(1) and CB(2) receptor-independent properties of both phytocannabinoids. In fact, selective antagonists for both receptor types, i.e., SR141716 and AM630, respectively, were unable to prevent the positive effects on calpain expression caused in 3NP-intoxicated rats by the 1:1 combination of Δ(9)-THC and CBD. Finally, this combination also reversed the up-regulation of proinflammatory markers such as inducible nitric oxide synthase observed in malonate-lesioned rats. In conclusion, this study provides preclinical evidence in support of a beneficial effect of the cannabis-based medicine Sativex as a neuroprotective agent capable of delaying disease progression in HD, a disorder that is currently poorly managed in the clinic, prompting an urgent need for clinical trials with agents showing positive results in preclinical studies. Copyright © 2011 Wiley-Liss, Inc.
Energy status of ripening and postharvest senescent fruit of litchi (Litchi chinensis Sonn.)
2013-01-01
Background Recent studies have demonstrated that cellular energy is a key factor switching on ripening and senescence of fruit. However, the factors that influence fruit energy status remain largely unknown. Results HPLC profiling showed that ATP abundance increased significantly in developing preharvest litchi fruit and was strongly correlated with fruit fresh weight. In contrast, ATP levels declined significantly during postharvest fruit senescence and were correlated with the decrease in the proportion of edible fruit. The five gene transcripts isolated from the litchi fruit pericarp were highly expressed in vegetative tissues and peaked at 70 days after flowering (DAF) consistent with fruit ADP concentrations, except for uncoupling mitochondrial protein 1 (UCP1), which was predominantly expressed in the root, and ATP synthase beta subunit (AtpB), which was up-regulated significantly before harvest and peaked 2 days after storage. These results indicated that the color-breaker stage at 70 DAF and 2 days after storage may be key turning points in fruit energy metabolism. Transcript abundance of alternative oxidase 1 (AOX1) increased after 2 days of storage to significantly higher levels than those of LcAtpB, and was down-regulated significantly by exogenous ATP. ATP supplementation had no significant effect on transcript abundance of ADP/ATP carrier 1 (AAC1) and slowed the changes in sucrose non-fermenting-1-related kinase 2 (SnRK2) expression, but maintained ATP and energy charge levels, which were correlated with delayed senescence. Conclusions Our results suggest that senescence of litchi fruit is closely related with energy. A surge of LcAtpB expression marked the beginning of fruit senescence. The findings may provide a new strategy to extend fruit shelf life by regulating its energy level. PMID:23547657
Li, Yu-rong; Cui, Yi-ping; Ji, Zhi-yuan; Cai, Lu-lu; Zou, Hua-song; Hutchins, William C.; Yang, Ching-hong; Chen, Gong-you
2012-01-01
Fructose-bisphophate aldolase (FbaB), is an enzyme in glycolysis and gluconeogenesis in living organisms. The mutagenesis in a unique fbaB gene of Xanthomonas oryzae pv. oryzicola, the causal agent of rice bacterial leaf streak, led the pathogen not only unable to use pyruvate and malate for growth and delayed its growth when fructose was used as the sole carbon source, but also reduced extracellular polysaccharide (EPS) production and impaired bacterial virulence and growth in rice. Intriguingly, the fbaB promoter contains an imperfect PIP-box (plant-inducible promoter) (TTCGT-N9-TTCGT). The expression of fbaB was negatively regulated by a key hrp regulatory HrpG and HrpX cascade. Base substitution in the PIP-box altered the regulation of fbaB with the cascade. Furthermore, the expression of fbaB in X. oryzae pv. oryzicola RS105 strain was inducible in planta rather than in a nutrient-rich medium. Except other hrp-hrc-hpa genes, the expression of hrpG and hrpX was repressed and the transcripts of hrcC, hrpE and hpa3 were enhanced when fbaB was deleted. The mutation in hrcC, hrpE or hpa3 reduced the ability of the pathogen to acquire pyruvate and malate. In addition, bacterial virulence and growth in planta and EPS production in RΔfbaB mutant were completely restored to the wild-type level by the presence of fbaB in trans. This is the first report to demonstrate that carbohydrates, assimilated by X. oryzae pv. oryzicola, play critical roles in coordinating hrp gene expression through a yet unknown regulator. PMID:22384086
Interleukin-6 is an essential determinant of on-time parturition in the mouse.
Robertson, Sarah A; Christiaens, Inge; Dorian, Camilla L; Zaragoza, Dean B; Care, Alison S; Banks, Anke M; Olson, David M
2010-08-01
IL-6 abundance in amniotic fluid and uterine tissues increases in late gestation or with infection-associated preterm labor. A role in regulation of labor onset is suggested by observations that IL-6 increases expression of genes controlling prostaglandin synthesis and signaling in isolated uterine cells, but whether IL-6 is essential for normal parturition is unknown. To evaluate the physiological role of IL-6 in parturition in mice, we investigated the effect of Il6 null mutation on the timing of parturition and expression of genes associated with uterine activation. Il6 null mutant mice delivered 24 h later than wild-type mice, although circulating progesterone fell similarly in both genotypes during the prepartal period. Il6 null mutant mice were also refractory to low doses of lipopolysaccharide sufficient to induce preterm delivery in wild-type mice. The characteristic late-gestation elevation in uterine expression of Oxtr mRNA encoding oxytocin receptor, and peripartal increases in Ptgfr and Ptgs2 mRNAs regulating prostaglandin synthesis and signaling were delayed by 24 h in Il6 null mutant mice. Conversely, Ptger4 mRNA encoding the prostaglandin E receptor-4 was abnormally elevated in late-gestation in Il6 null mutant mice. Administration of recombinant IL-6 from d 11.5 postcoitum until term restored the normal timing of delivery and normalized Ptger4 mRNA expression in late gestation. We conclude that IL-6 has a key role in controlling the progression of events culminating in parturition and that it acts downstream of luteolysis in the uterus to regulate genes involved in the prostaglandin-mediated uterine activation cascade.
Lammerding, Leoni; Slowik, Alexander; Johann, Sonja; Beyer, Cordian; Zendedel, Adib
2016-01-01
CNS ischemia results in locally confined and rapid tissue damage accompanied by a loss of neurons and their circuits. Early and time-delayed inflammatory responses are critical variables determining the extent of neural disintegration and regeneration. Inflammasomes are vital effectors in innate immunity. Their activation in brain-intrinsic immune cells contributes to ischemia-related brain damage. The steroids 17β-estradiol (E2) and progesterone (P) are neuroprotective and anti-inflammatory. Using a transient focal rat ischemic model, we evaluated the time response of different inflammasomes in the peri-infarct zone from the early to late phases after poststroke ischemia. We show that the different inflammasome complexes reveal a specific time-oriented sequential expression pattern with a maximum at approximately 24 h after the infarct. Within the limits of antibody availability, immunofluorescence labeling demonstrated that microglia and neurons are major sources of the locally activated inflammasomes NOD-like receptor protein-3 (NLRP3) and associated speck-like protein (ASC), respectively. E2 and P given for 24 h immediately after ischemia onset reduced hypoxia-induced mRNA expression of the inflammasomes NLRC4, AIM2 and ASC, and decreased the protein levels of ASC and NLRP3. In addition, mRNA protein levels of the cytokines interleukin-1β (IL1β), IL18 and TNFα were reduced by the steroids. The findings provide for the first time a detailed flow chart of hypoxia-driven inflammasome regulation in the peri-infarct cerebral cortex. Further, we demonstrate that E2 and P alleviate the expression of certain inflammasome components, sometimes in a hormone-specific way. Besides directly regulating other cellular neuroprotective pathways, the control of inflammasomes by these steroids might contribute to its neuroprotective potency. © 2015 S. Karger AG, Basel.
2017-01-01
Endothelial nitric-oxide synthase (eNOS) and its bioactive product, nitric oxide (NO), mediate many endothelial cell functions, including angiogenesis and vascular permeability. For example, vascular endothelial growth factor (VEGF)-mediated angiogenesis is inhibited upon reduction of NO bioactivity both in vitro and in vivo. Moreover, genetic disruption or pharmacological inhibition of eNOS attenuates angiogenesis during tissue repair, resulting in delayed wound closure. These observations emphasize that eNOS-derived NO can promote angiogenesis. Intriguingly, eNOS activity is regulated by nitric-oxide synthase trafficking inducer (NOSTRIN), which sequesters eNOS, thereby attenuating NO production. This has prompted significant interest in NOSTRIN's function in endothelial cells. We show here that NOSTRIN affects the functional transcriptome of endothelial cells by down-regulating several genes important for invasion and angiogenesis. Interestingly, the effects of NOSTRIN on endothelial gene expression were independent of eNOS activity. NOSTRIN also affected the expression of secreted cytokines involved in inflammatory responses, and ectopic NOSTRIN overexpression functionally restricted endothelial cell proliferation, invasion, adhesion, and VEGF-induced capillary tube formation. Furthermore, NOSTRIN interacted directly with TNF receptor-associated factor 6 (TRAF6), leading to the suppression of NFκB activity and inhibition of AKT activation via phosphorylation. Interestingly, TNF-α-induced NFκB pathway activation was reversed by NOSTRIN. We found that the SH3 domain of NOSTRIN is involved in the NOSTRIN-TRAF6 interaction and is required for NOSTRIN-induced down-regulation of endothelial cell proteins. These results have broad biological implications, as aberrant NOSTRIN expression leading to deactivation of the NFκB pathway, in turn triggering an anti-angiogenic cascade, might inhibit tumorigenesis and cancer progression. PMID:28235804
Carles, Cristel C; Choffnes-Inada, Dan; Reville, Keira; Lertpiriyapong, Kvin; Fletcher, Jennifer C
2005-03-01
The higher-plant shoot apical meristem is a dynamic structure continuously producing cells that become incorporated into new leaves, stems and flowers. The maintenance of a constant flow of cells through the meristem depends on coordination of two antagonistic processes: self-renewal of the stem cell population and initiation of the lateral organs. This coordination is stringently controlled by gene networks that contain both positive and negative components. We have previously defined the ULTRAPETALA1 (ULT1) gene as a key negative regulator of cell accumulation in Arabidopsis shoot and floral meristems, because mutations in ULT1 cause the enlargement of inflorescence and floral meristems, the production of supernumerary flowers and floral organs, and a delay in floral meristem termination. Here, we show that ULT1 negatively regulates the size of the WUSCHEL (WUS)-expressing organizing center in inflorescence meristems. We have cloned the ULT1 gene and find that it encodes a small protein containing a B-box-like motif and a SAND domain, a DNA-binding motif previously reported only in animal transcription factors. ULT1 and its Arabidopsis paralog ULT2 define a novel small gene family in plants. ULT1 and ULT2 are expressed coordinately in embryonic shoot apical meristems, in inflorescence and floral meristems, and in developing stamens, carpels and ovules. Additionally, ULT1 is expressed in vegetative meristems and leaf primordia. ULT2 protein can compensate for mutant ULT1 protein when overexpressed in an ult1 background, indicating that the two genes may regulate a common set of targets during plant development. Downregulation of both ULT genes can lead to shoot apical meristem arrest shortly after germination, revealing a requirement for ULT activity in early development.
Hoque, T S; Uraji, M; Tuya, A; Nakamura, Y; Murata, Y
2012-09-01
Methylglyoxal (MG) is a highly reactive metabolite derived from glycolysis. In this study, we examined the effect of MG on seed germination, root elongation, chlorosis and stress-responsive gene expression in Arabidopsis using an abscisic acid (ABA)-deficient mutant, aba2-2. In the wild type, 0.1 mm MG did not affect germination but delayed root elongation, whereas 1.0 mm MG inhibited germination and root elongation and induced chlorosis. MG increased transcription levels of RD29B and RAB18 in a dose-dependent manner but did not affect RD29A transcription level. In contrast, in the aba2-2 mutant, MG inhibition of seed germination at 1.0 mm and 10.0 mm and a delay of root elongation at 0.1 mm MG were mitigated, although there was no significant difference in chlorosis between the wild type and mutant. Moreover, the aba2-2 mutation impaired MG-induced RD29B and RAB18 gene expression. These observations suggest that MG not only directly inhibits germination and root elongation but also indirectly modulates these processes via endogenous ABA in Arabidopsis. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.
The Plasmodium protein P113 supports efficient sporozoite to liver stage conversion in vivo.
Offeddu, Vittoria; Rauch, Manuel; Silvie, Olivier; Matuschewski, Kai
2014-02-01
Invasive stages of Plasmodium parasites possess distinct integral and peripheral membrane proteins that mediate host cell attachment and invasion. P113 is an abundant protein in detergent-resistant high molecular weight complexes in Plasmodium schizonts, but is unusual since expression extends to gametocytes and sporozoites. In this study, we tested whether P113 performs important functions for parasite propagation in Plasmodium berghei. We show that pre-erythrocytic expression of P113 displays key signatures of upregulated in infectious sporozoites (UIS) genes, including control by the liver stage master regulator SLARP. Targeted gene deletion resulted in viable blood stage parasites that displayed no signs of blood stage growth defects. p113(-) parasites propagated normally through the life cycle until mature sporozoites, but displayed defects during natural sporozoite transmission, leading to a delay to patency in infected animals. By comparative in vitro and in vivo analysis of pre-erythrocytic development and using a xeno-diagnostic test we show that ablation of P113 results in lower sporozoite to liver stage conversion and, as a consequence, reduced merozoite output in vivo, without delaying liver stage development. We conclude that p113 is dispensable for Plasmodium life cycle progression and plays auxiliary roles during pre-erythrocytic development. Copyright © 2014 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garige, Mamatha; Walters, Eric, E-mail: ewalters@howard.edu
The molecular basis for nutraceutical properties of the polyphenol curcumin (Curcuma longa, Turmeric) is complex, affecting multiple factors that regulate cell signaling and homeostasis. Here, we report the effect of curcumin on cellular and developmental mechanisms in the eukaryotic model, Dictyostelium discoideum. Dictyostelium proliferation was inhibited in the presence of curcumin, which also suppressed the prestarvation marker, discoidin I, members of the yakA-mediated developmental signaling pathway, and expression of the extracellular matrix/cell adhesion proteins (DdCAD and csA). This resulted in delayed chemotaxis, adhesion, and development of the organism. In contrast to the inhibitory effects on developmental genes, curcumin induced gstAmore » gene expression, overall GST activity, and generated production of reactive oxygen species. These studies expand our knowledge of developmental and biochemical signaling influenced by curcumin, and lends greater consideration of GST enzyme function in eukaryotic cell signaling, development, and differentiation.« less
Hunger-promoting hypothalamic neurons modulate effector and regulatory T-cell responses
Matarese, Giuseppe; Procaccini, Claudio; Menale, Ciro; Kim, Jae Geun; Kim, Jung Dae; Diano, Sabrina; Diano, Nadia; De Rosa, Veronica; Dietrich, Marcelo O.; Horvath, Tamas L.
2013-01-01
Whole-body energy metabolism is regulated by the hypothalamus and has an impact on diverse tissue functions. Here we show that selective knockdown of Sirtuin 1 Sirt1 in hypothalamic Agouti-related peptide-expressing neurons, which renders these cells less responsive to cues of low energy availability, significantly promotes CD4+ T-cell activation by increasing production of T helper 1 and 17 proinflammatory cytokines via mediation of the sympathetic nervous system. These phenomena were associated with an impaired thymic generation of forkhead box P3 (FoxP3+) naturally occurring regulatory T cells and their reduced suppressive capacity in the periphery, which resulted in increased delayed-type hypersensitivity responses and autoimmune disease susceptibility in mice. These observations unmask a previously unsuspected role of hypothalamic feeding circuits in the regulation of adaptive immune response. PMID:23530205
Li, Pei-Fang; Lee, Yung-I; Yang, Chang-Hsien
2015-01-01
In this study of Arabidopsis (Arabidopsis thaliana), we investigated the relationship between FOREVER YOUNG FLOWER (FYF) and Ethylene Response DNA-binding Factors (EDFs) and functionally analyzed a key FYF target, an Ethylene-Responsive Factor (ERF), that controls flower senescence/abscission. Ectopic expression of EDF1/2/3/4 caused promotion of flower senescence/abscission and the activation of the senescence-associated genes. The presence of a repressor domain in EDFs and the enhancement of the promotion of senescence/abscission in EDF1/2/3/4+SRDX (converting EDFs to strong repressors by fusion with the ERF-associated amphiphilic repression motif repression domain SRDX) transgenic plants suggested that EDFs act as repressors. The significant reduction of β-glucuronidase (GUS) expression by 35S:FYF in EDF1/2/3/4:GUS plants indicates that EDF1/2/3/4 functions downstream of FYF in regulating flower senescence/abscission. In this study, we also characterized an ERF gene, FOREVER YOUNG FLOWER UP-REGULATING FACTOR1 (FUF1), which is up-regulated by FYF during flower development. Ectopic expression of FUF1 caused similar delayed flower senescence/abscission as seen in 35S:FYF plants. This phenotype was correlated with deficient abscission zone formation, ethylene insensitivity, and down-regulation of EDF1/2/3/4 and abscission-associated genes in 35S:FUF1 flowers. In contrast, significant promotion of flower senescence/abscission and up-regulation of EDF1/2/3/4 were observed in 35S:FUF1+SRDX transgenic dominant-negative plants, in which FUF1 is converted to a potent repressor by fusion to an SRDX-suppressing motif. Thus, FUF1 acts as an activator in suppressing EDF1/2/3/4 function and senescence/abscission of the flowers. Our results reveal that FYF regulates flower senescence/abscission by negatively regulating EDF1/2/3/4, which is the downstream gene in the ethylene response, by activating FUF1 in Arabidopsis. PMID:26063506
Chen, Wei-Han; Li, Pei-Fang; Chen, Ming-Kun; Lee, Yung-I; Yang, Chang-Hsien
2015-08-01
In this study of Arabidopsis (Arabidopsis thaliana), we investigated the relationship between FOREVER YOUNG FLOWER (FYF) and Ethylene Response DNA-binding Factors (EDFs) and functionally analyzed a key FYF target, an Ethylene-Responsive Factor (ERF), that controls flower senescence/abscission. Ectopic expression of EDF1/2/3/4 caused promotion of flower senescence/abscission and the activation of the senescence-associated genes. The presence of a repressor domain in EDFs and the enhancement of the promotion of senescence/abscission in EDF1/2/3/4+SRDX (converting EDFs to strong repressors by fusion with the ERF-associated amphiphilic repression motif repression domain SRDX) transgenic plants suggested that EDFs act as repressors. The significant reduction of β-glucuronidase (GUS) expression by 35S:FYF in EDF1/2/3/4:GUS plants indicates that EDF1/2/3/4 functions downstream of FYF in regulating flower senescence/abscission. In this study, we also characterized an ERF gene, FOREVER YOUNG FLOWER UP-REGULATING FACTOR1 (FUF1), which is up-regulated by FYF during flower development. Ectopic expression of FUF1 caused similar delayed flower senescence/abscission as seen in 35S:FYF plants. This phenotype was correlated with deficient abscission zone formation, ethylene insensitivity, and down-regulation of EDF1/2/3/4 and abscission-associated genes in 35S:FUF1 flowers. In contrast, significant promotion of flower senescence/abscission and up-regulation of EDF1/2/3/4 were observed in 35S:FUF1+SRDX transgenic dominant-negative plants, in which FUF1 is converted to a potent repressor by fusion to an SRDX-suppressing motif. Thus, FUF1 acts as an activator in suppressing EDF1/2/3/4 function and senescence/abscission of the flowers. Our results reveal that FYF regulates flower senescence/abscission by negatively regulating EDF1/2/3/4, which is the downstream gene in the ethylene response, by activating FUF1 in Arabidopsis. © 2015 American Society of Plant Biologists. All Rights Reserved.
Chaudhry, Rajeev; Madden-Fuentes, Ramiro J; Ortiz, Tara K; Balsara, Zarine; Tang, Yuping; Nseyo, Unwanaobong; Wiener, John S; Ross, Sherry S; Seed, Patrick C
2014-05-01
Urinary tract infections cause significant morbidity in patients with spinal cord injury. An in vivo spinal cord injured rat model of experimental Escherichia coli urinary tract infection mimics human disease with enhanced susceptibility to urinary tract infection compared to controls. We hypothesized that a dysregulated inflammatory response contributes to enhanced susceptibility to urinary tract infection. Spinal cord injured and sham injured rats were inoculated transurethrally with E. coli. Transcript levels of 84 inflammatory pathway genes were measured in bladder tissue of each group before infection, 24 hours after infection and after 5 days of antibiotic therapy. Before infection quantitative polymerase chain reaction array revealed greater than twofold up-regulation in the proinflammatory factor transcripts slc11a1, ccl4 and il1β, and down-regulation of the antimicrobial peptides lcn2 and mpo in spinal cord injured vs control bladders. At 24 hours after infection spinal cord injured bladders showed an attenuated innate immune response with decreased expression of il6, slc11a1, il1β and lcn2, and decreased il10 and slpi expression compared to controls. Despite clearance of bacteriuria with antibiotics spinal cord injured rats had delayed induction of il6 transcription and a delayed anti-inflammatory response with decreased il10 and slpi transcript levels relative to controls. Spinal cord injured bladders fail to mount a characteristic inflammatory response to E. coli infection and cannot suppress inflammation after infection is eliminated. This may lead to increased susceptibility to urinary tract infection and persistent chronic inflammation through neural mediated pathways, which to our knowledge remain to be defined. Copyright © 2014 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Hsu, Y-C; Chen, M-J; Huang, T-Y
2014-02-27
Cucurbitacin E (CuE) is a natural compound previously shown to have anti-feedant, antioxidant and antitumor activities as well as a potent chemo-preventive action against cancer. The present study investigates its anti-proliferative property using MTT assay; CuE demonstrated cytotoxic activity against malignant glioma GBM 8401 cells and induced cell cycle G2/M arrest in these cells. CuE-treated cells accumulated in metaphase (CuE 2.5-10 μM) as determined using MPM-2 by flow cytometry. We attempted to characterize the molecular pathways responsible for cytotoxic effects of CuE in GBM 8401 cells. We studied the genome-wide gene expression profile on microarrays and molecular networks by using pathway analysis tools of bioinformatics. The CuE reduced the expression of 558 genes and elevated the levels of 1354 genes, suggesting an existence of the common pathways involved in induction of G2/M arrest. We identified the RB (GADD45β and GADD45γ) and the p53 (GADD45α) signaling pathways as the common pathways, serving as key molecules that regulate cell cycle. Results indicate that CuE produced G2/M arrest as well as the upregulation of GADD45 γ and binding with CDC2. Both effects increased proportionally with the dose of CuE, suggesting that the CuE-induced mitosis delay is regulated by GADD45γ overexpression. Our findings suggest that, in addition to the known effects on cancer prevention, CuE may have antitumor activity in glioma therapy.
Puthumana, Jayesh; Lee, Min-Chul; Park, Jun Chul; Kim, Hui-Su; Hwang, Dae-Sik; Han, Jeonghoon; Lee, Jae-Seong
2017-03-01
To evaluate the effects of ultraviolet B (UV-B) radiation at the developmental, reproductive, and molecular levels in aquatic invertebrates, we measured UV-B-induced acute toxicity, impairments in developmental and reproductive traits, and UV-B interaction with the entire family of cytochrome P450 (CYP) genes in the intertidal benthic copepod Tigriopus japonicus. We found a significant, dose-dependent reduction (P<0.05) in the survival of T. japonicus that began as a developmental delay and decreased fecundity. The 48h LD10 and LD50 were 1.35 and 1.84kJ/m 2 , and the CYP inhibitor (PBO) elevated mortality, confirming the involvement of CYP genes in UV-B induced toxicity. Low-dose UV-B (1.5kJ/m 2 ) induced developmental delays, and higher doses (6-18kJ/m 2 ) caused reproductive impairments in ovigerous females. The significant up-regulation of CYP genes belonging to clans 2/3/MT/4/20 in T. japonicus exposed to UV-B (12kJ/m 2 ) confirmed molecular interaction between UV-B and CYP genes. Moreover, orphan CYPs, such as CYP20A1, provide good insight on the deorphanization of invertebrate CYPs. Overall, these results demonstrate the involvement of UV-B radiation in the expression of all the CYP genes in T. japonicus and their susceptibility to UV-B radiation. This will provide a better understanding of the mechanistic effects of UV-B in copepods through the predicted AhR-mediated up-regulation of CYP genes. Copyright © 2017 Elsevier B.V. All rights reserved.
Effects of Different PER Translational Kinetics on the Dynamics of a Core Circadian Clock Model
Nieto, Paula S.; Revelli, Jorge A.; Garbarino-Pico, Eduardo; Condat, Carlos A.; Guido, Mario E.; Tamarit, Francisco A.
2015-01-01
Living beings display self-sustained daily rhythms in multiple biological processes, which persist in the absence of external cues since they are generated by endogenous circadian clocks. The period (per) gene is a central player within the core molecular mechanism for keeping circadian time in most animals. Recently, the modulation PER translation has been reported, both in mammals and flies, suggesting that translational regulation of clock components is important for the proper clock gene expression and molecular clock performance. Because translational regulation ultimately implies changes in the kinetics of translation and, therefore, in the circadian clock dynamics, we sought to study how and to what extent the molecular clock dynamics is affected by the kinetics of PER translation. With this objective, we used a minimal mathematical model of the molecular circadian clock to qualitatively characterize the dynamical changes derived from kinetically different PER translational mechanisms. We found that the emergence of self-sustained oscillations with characteristic period, amplitude, and phase lag (time delays) between per mRNA and protein expression depends on the kinetic parameters related to PER translation. Interestingly, under certain conditions, a PER translation mechanism with saturable kinetics introduces longer time delays than a mechanism ruled by a first-order kinetics. In addition, the kinetic laws of PER translation significantly changed the sensitivity of our model to parameters related to the synthesis and degradation of per mRNA and PER degradation. Lastly, we found a set of parameters, with realistic values, for which our model reproduces some experimental results reported recently for Drosophila melanogaster and we present some predictions derived from our analysis. PMID:25607544
Effects of different per translational kinetics on the dynamics of a core circadian clock model.
Nieto, Paula S; Revelli, Jorge A; Garbarino-Pico, Eduardo; Condat, Carlos A; Guido, Mario E; Tamarit, Francisco A
2015-01-01
Living beings display self-sustained daily rhythms in multiple biological processes, which persist in the absence of external cues since they are generated by endogenous circadian clocks. The period (per) gene is a central player within the core molecular mechanism for keeping circadian time in most animals. Recently, the modulation PER translation has been reported, both in mammals and flies, suggesting that translational regulation of clock components is important for the proper clock gene expression and molecular clock performance. Because translational regulation ultimately implies changes in the kinetics of translation and, therefore, in the circadian clock dynamics, we sought to study how and to what extent the molecular clock dynamics is affected by the kinetics of PER translation. With this objective, we used a minimal mathematical model of the molecular circadian clock to qualitatively characterize the dynamical changes derived from kinetically different PER translational mechanisms. We found that the emergence of self-sustained oscillations with characteristic period, amplitude, and phase lag (time delays) between per mRNA and protein expression depends on the kinetic parameters related to PER translation. Interestingly, under certain conditions, a PER translation mechanism with saturable kinetics introduces longer time delays than a mechanism ruled by a first-order kinetics. In addition, the kinetic laws of PER translation significantly changed the sensitivity of our model to parameters related to the synthesis and degradation of per mRNA and PER degradation. Lastly, we found a set of parameters, with realistic values, for which our model reproduces some experimental results reported recently for Drosophila melanogaster and we present some predictions derived from our analysis.
An Essential Postdevelopmental Role for Lis1 in Mice
Hines, Timothy J.; Gao, Xu; Sahu, Subhshri; Lange, Meghann M.; Turner, Jill R.
2018-01-01
LIS1 mutations cause lissencephaly (LIS), a severe developmental brain malformation. Much less is known about its role in the mature nervous system. LIS1 regulates the microtubule motor cytoplasmic dynein 1 (dynein), and as LIS1 and dynein are both expressed in the adult nervous system, Lis1 could potentially regulate dynein-dependent processes such as axonal transport. We therefore knocked out Lis1 in adult mice using tamoxifen-induced, Cre-ER-mediated recombination. When an actin promoter was used to drive Cre-ER expression (Act-Cre-ER), heterozygous Lis1 knockout (KO) caused no obvious change in viability or behavior, despite evidence of widespread recombination by a Cre reporter three weeks after tamoxifen exposure. In contrast, homozygous Lis1 KO caused the rapid onset of neurological symptoms in both male and female mice. One tamoxifen-dosing regimen caused prominent recombination in the midbrain/hindbrain, PNS, and cardiac/skeletal muscle within a week; these mice developed severe symptoms in that time frame and were killed. A different tamoxifen regimen resulted in delayed recombination in midbrain/hindbrain, but not in other tissues, and also delayed the onset of symptoms. This indicates that Lis1 loss in the midbrain/hindbrain causes the severe phenotype. In support of this, brainstem regions known to house cardiorespiratory centers showed signs of axonal dysfunction in KO animals. Transport defects, neurofilament (NF) alterations, and varicosities were observed in axons in cultured DRG neurons from KO animals. Because no symptoms were observed when a cardiac specific Cre-ER promoter was used, we propose a vital role for Lis1 in autonomic neurons and implicate defective axonal transport in the KO phenotype. PMID:29404402
Molecular basis and function of voltage-gated K+ channels in pulmonary arterial smooth muscle cells.
Yuan, X J; Wang, J; Juhaszova, M; Golovina, V A; Rubin, L J
1998-04-01
K(+)-channel activity-mediated alteration of the membrane potential and cytoplasmic free Ca2+ concentration ([Ca2+]cyt) is a pivotal mechanism in controlling pulmonary vasomotor tone. By using combined approaches of patch clamp, imaging fluorescent microscopy, and molecular biology, we examined the electrophysiological properties of K+ channels and the role of different K+ currents in regulating [Ca2+]cyt and explored the molecular identification of voltage-gated K+ (KV)- and Ca(2+)-activated K+ (KCa)-channel genes expressed in pulmonary arterial smooth muscle cells (PASMC). Two kinetically distinct KV currents [IK(V)], a rapidly inactivating (A-type) and a noninactivating delayed rectifier, as well as a slowly activated KCa current [IK(Ca)] were identified. IK(V) was reversibly inhibited by 4-aminopyridine (5 mM), whereas IK(Ca) was significantly inhibited by charybdotoxin (10-20 nM). K+ channels are composed of pore-forming alpha-subunits and auxiliary beta-subunits. Five KV-channel alpha-subunit genes from the Shaker subfamily (KV1.1, KV1.2, KV1.4, KV1.5, and KV1.6), a KV-channel alpha-subunit gene from the Shab subfamily (KV2.1), a KV-channel modulatory alpha-subunit (KV9.3), and a KCa-channel alpha-subunit gene (rSlo), as well as three KV-channel beta-subunit genes (KV beta 1.1, KV beta 2, and KV beta 3) are expressed in PASMC. The data suggest that 1) native K+ channels in PASMC are encoded by multiple genes; 2) the delayed rectifier IK(V) may be generated by the KV1.1, KV1.2, KV1.5, KV1.6, KV2.1, and/or KV2.1/KV9.3 channels; 3) the A-type IK(V) may be generated by the KV1.4 channel and/or the delayed rectifier KV channels (KV1 subfamily) associated with beta-subunits; and 4) the IK(Ca) may be generated by the rSlo gene product. The function of the KV channels plays an important role in the regulation of membrane potential and [Ca2+]cyt in PASMC.
Chen, Hangang; Sun, Xianding; Yin, Liangjun; Chen, Shuai; Zhu, Ying; Huang, Junlan; Jiang, Wanling; Chen, Bo; Zhang, Ruobin; Chen, Lin; Nie, Mao; Xie, Yangli; Deng, Zhongliang
2017-01-01
Bone fracture healing is processed through multiple stages including the cartilaginous callus formation and its transition to bony callus. FGFR3 negatively regulates chondrogenesis and enhances osteogenesis during skeleton development. We previously found in mice carrying gain-of-function mutation of FGFR3 that FGFR3 delays the healing of un-stabilized fracture that heals mainly through endochondral ossification. Since fracture is regularly treated in clinics with rigid fixation, and stabilized fracture is healed largely through intramembranous ossification, we asked whether FGFR3, a key regulator of osteogenesis, also affect the regeneration of stabilized fracture. We found that gain-of-function mutation of FGFR3 inhibits the initiation of chondrogenesis and the subsequent bone formation. We further studied whether PTH1-34 can improve the osteopenia and delayed healing of the stabilized tibia fracture in mice with achondroplasia. Fracture healing was evaluated by radiography, micro-CT, biomechanical tests, histology, and real-time polymerase chain reaction (RT-PCR) analysis. We found that PTH 1-34 can alleviate the decreased bone mass and compromised architecture in ACH mice. Histological analysis revealed that administration of PTH1-34 increased the size of both the total callus and cartilaginous callus at 14 days after the surgery in ACH mice. RT-PCR data suggested that systemic PTH1-34 accelerated the initiation of chondrogenesis and chondrocyte maturation (earlier and higher levels of expression of chondrogenesis related markers) and enhanced the osteogenic differentiation in the fracture callus in ACH mice. These results indicate that the PTH1-34 administration resulted in an enhanced callus formation during bone fracture healing in ACH mice, which is at least in part mediated by an increase of cartilaginous callus at early stage and the promotion of bone formation in bony callus. In summary, in this study we revealed that FGFR3 delays the regeneration of stabilized fracture by inhibiting both the chondrogenesis and osteogenesis, and PTH1-34 treatment can improve the dysregulated bone metabolism and delayed bone injury healing resulting from gain-of-function mutation of FGFR3. PMID:29104492