Sample records for regulated expression pattern

  1. Transcriptome analysis of the painted lady butterfly, Vanessa cardui during wing color pattern development.

    PubMed

    Connahs, Heidi; Rhen, Turk; Simmons, Rebecca B

    2016-03-31

    Butterfly wing color patterns are an important model system for understanding the evolution and development of morphological diversity and animal pigmentation. Wing color patterns develop from a complex network composed of highly conserved patterning genes and pigmentation pathways. Patterning genes are involved in regulating pigment synthesis however the temporal expression dynamics of these interacting networks is poorly understood. Here, we employ next generation sequencing to examine expression patterns of the gene network underlying wing development in the nymphalid butterfly, Vanessa cardui. We identified 9, 376 differentially expressed transcripts during wing color pattern development, including genes involved in patterning, pigmentation and gene regulation. Differential expression of these genes was highest at the pre-ommochrome stage compared to early pupal and late melanin stages. Overall, an increasing number of genes were down-regulated during the progression of wing development. We observed dynamic expression patterns of a large number of pigment genes from the ommochrome, melanin and also pteridine pathways, including contrasting patterns of expression for paralogs of the yellow gene family. Surprisingly, many patterning genes previously associated with butterfly pattern elements were not significantly up-regulated at any time during pupation, although many other transcription factors were differentially expressed. Several genes involved in Notch signaling were significantly up-regulated during the pre-ommochrome stage including slow border cells, bunched and pebbles; the function of these genes in the development of butterfly wings is currently unknown. Many genes involved in ecdysone signaling were also significantly up-regulated during early pupal and late melanin stages and exhibited opposing patterns of expression relative to the ecdysone receptor. Finally, a comparison across four butterfly transcriptomes revealed 28 transcripts common to all four species that have no known homologs in other metazoans. This study provides a comprehensive list of differentially expressed transcripts during wing development, revealing potential candidate genes that may be involved in regulating butterfly wing patterns. Some differentially expressed genes have no known homologs possibly representing genes unique to butterflies. Results from this study also indicate that development of nymphalid wing patterns may arise not only from melanin and ommochrome pigments but also the pteridine pigment pathway.

  2. Epigenetic regulation of serotype expression antagonizes transcriptome dynamics in Paramecium tetraurelia

    PubMed Central

    Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J. V.; Schulz, Marcel H.; Simon, Martin

    2015-01-01

    Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. PMID:26231545

  3. Sho-saiko-to, a traditional herbal medicine, regulates gene expression and biological function by way of microRNAs in primary mouse hepatocytes

    PubMed Central

    2014-01-01

    Background Sho-saiko-to (SST) (also known as so-shi-ho-tang or xiao-chai-hu-tang) has been widely prescribed for chronic liver diseases in traditional Oriental medicine. Despite the substantial amount of clinical evidence for SST, its molecular mechanism has not been clearly identified at a genome-wide level. Methods By using a microarray, we analyzed the temporal changes of messenger RNA (mRNA) and microRNA expression in primary mouse hepatocytes after SST treatment. The pattern of genes regulated by SST was identified by using time-series microarray analysis. The biological function of genes was measured by pathway analysis. For the identification of the exact targets of the microRNAs, a permutation-based correlation method was implemented in which the temporal expression of mRNAs and microRNAs were integrated. The similarity of the promoter structure between temporally regulated genes was measured by analyzing the transcription factor binding sites in the promoter region. Results The SST-regulated gene expression had two major patterns: (1) a temporally up-regulated pattern (463 genes) and (2) a temporally down-regulated pattern (177 genes). The integration of the genes and microRNA demonstrated that 155 genes could be the targets of microRNAs from the temporally up-regulated pattern and 19 genes could be the targets of microRNAs from the temporally down-regulated pattern. The temporally up-regulated pattern by SST was associated with signaling pathways such as the cell cycle pathway, whereas the temporally down-regulated pattern included drug metabolism-related pathways and immune-related pathways. All these pathways could be possibly associated with liver regenerative activity of SST. Genes targeted by microRNA were moreover associated with different biological pathways from the genes not targeted by microRNA. An analysis of promoter similarity indicated that co-expressed genes after SST treatment were clustered into subgroups, depending on the temporal expression patterns. Conclusions We are the first to identify that SST regulates temporal gene expression by way of microRNA. MicroRNA targets and non-microRNA targets moreover have different biological roles. This functional segregation by microRNA would be critical for the elucidation of the molecular activities of SST. PMID:24410935

  4. Sho-saiko-to, a traditional herbal medicine, regulates gene expression and biological function by way of microRNAs in primary mouse hepatocytes.

    PubMed

    Song, Kwang Hoon; Kim, Yun Hee; Kim, Bu-Yeo

    2014-01-11

    Sho-saiko-to (SST) (also known as so-shi-ho-tang or xiao-chai-hu-tang) has been widely prescribed for chronic liver diseases in traditional Oriental medicine. Despite the substantial amount of clinical evidence for SST, its molecular mechanism has not been clearly identified at a genome-wide level. By using a microarray, we analyzed the temporal changes of messenger RNA (mRNA) and microRNA expression in primary mouse hepatocytes after SST treatment. The pattern of genes regulated by SST was identified by using time-series microarray analysis. The biological function of genes was measured by pathway analysis. For the identification of the exact targets of the microRNAs, a permutation-based correlation method was implemented in which the temporal expression of mRNAs and microRNAs were integrated. The similarity of the promoter structure between temporally regulated genes was measured by analyzing the transcription factor binding sites in the promoter region. The SST-regulated gene expression had two major patterns: (1) a temporally up-regulated pattern (463 genes) and (2) a temporally down-regulated pattern (177 genes). The integration of the genes and microRNA demonstrated that 155 genes could be the targets of microRNAs from the temporally up-regulated pattern and 19 genes could be the targets of microRNAs from the temporally down-regulated pattern. The temporally up-regulated pattern by SST was associated with signaling pathways such as the cell cycle pathway, whereas the temporally down-regulated pattern included drug metabolism-related pathways and immune-related pathways. All these pathways could be possibly associated with liver regenerative activity of SST. Genes targeted by microRNA were moreover associated with different biological pathways from the genes not targeted by microRNA. An analysis of promoter similarity indicated that co-expressed genes after SST treatment were clustered into subgroups, depending on the temporal expression patterns. We are the first to identify that SST regulates temporal gene expression by way of microRNA. MicroRNA targets and non-microRNA targets moreover have different biological roles. This functional segregation by microRNA would be critical for the elucidation of the molecular activities of SST.

  5. Epigenetic regulation of serotype expression antagonizes transcriptome dynamics in Paramecium tetraurelia.

    PubMed

    Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J V; Schulz, Marcel H; Simon, Martin

    2015-08-01

    Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  6. Gene expression underlying adaptive variation in Heliconius wing patterns: non-modular regulation of overlapping cinnabar and vermilion prepatterns.

    PubMed

    Reed, Robert D; McMillan, W Owen; Nagy, Lisa M

    2008-01-07

    Geographical variation in the mimetic wing patterns of the butterfly Heliconius erato is a textbook example of adaptive polymorphism; however, little is known about how this variation is controlled developmentally. Using microarrays and qPCR, we identified and compared expression of candidate genes potentially involved with a red/yellow forewing band polymorphism in H. erato. We found that transcripts encoding the pigment synthesis enzymes cinnabar and vermilion showed pattern- and polymorphism-related expression patterns, respectively. cinnabar expression was associated with the forewing band regardless of pigment colour, providing the first gene expression pattern known to be correlated with a major Heliconius colour pattern. In contrast, vermilion expression changed spatially over time in red-banded butterflies, but was not expressed at detectable levels in yellow-banded butterflies, suggesting that regulation of this gene may be involved with the red/yellow polymorphism. Furthermore, we found that the yellow pigment, 3-hydroxykynurenine, is incorporated into wing scales from the haemolymph rather than being synthesized in situ. We propose that some aspects of Heliconius colour patterns are determined by spatio-temporal overlap of pigment gene transcription prepatterns and speculate that evolutionary changes in vermilion regulation may in part underlie an adaptive colour pattern polymorphism.

  7. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    PubMed Central

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  8. The spatial expression and regulation of transcription factors IDEF1 and IDEF2

    PubMed Central

    Kobayashi, Takanori; Ogo, Yuko; Aung, May Sann; Nozoye, Tomoko; Itai, Reiko Nakanishi; Nakanishi, Hiromi; Yamakawa, Takashi; Nishizawa, Naoko K.

    2010-01-01

    Background and Aims Under conditions of low iron availability, rice plants induce genes involved in iron uptake and utilization. The iron deficiency-responsive cis-acting element binding factors 1 and 2 (IDEF1 and IDEF2) regulate transcriptional response to iron deficiency in rice roots. Clarification of the functions of IDEF1 and IDEF2 could uncover the gene regulation mechanism. Methods Spatial patterns of IDEF1 and IDEF2 expression were analysed by histochemical staining of IDEF1 and IDEF2 promoter-GUS transgenic rice lines. Expression patterns of the target genes of IDEF1 and IDEF2 were analysed using transformants with induced or repressed expression of IDEF1 or IDEF2 grown in iron-rich or in iron-deficient solutions for 1 d. Key Results IDEF1 and IDEF2 were highly expressed in the basal parts of the lateral roots and vascular bundles. IDEF1 and IDEF2 expression was dominant in leaf mesophyll and vascular cells, respectively. These expression patterns were similar under both iron-deficient and iron-sufficient conditions. IDEF1 was strongly expressed in pollen, ovaries, the aleurone layer and embryo. IDEF2 was expressed in pollen, ovaries and the dorsal vascular region of the endosperm. During seed germination, IDEF1 and IDEF2 were expressed in the endosperm and embryo. Expression of IDEF1 target genes was regulated in iron-rich roots similar to early iron-deficiency stages. In addition, the expression patterns of IDEF2 target genes were similar between iron-rich conditions and early or subsequent iron deficiency. Conclusions IDEF1 and IDEF2 are constitutively expressed during both vegetative and reproductive stages. The spatial expression patterns of IDEF1 and IDEF2 overlap with their target genes in restricted cell types, but not in all cells. The spatial expression patterns and gene regulation of IDEF1 and IDEF2 in roots are generally conserved under conditions of iron sufficiency and deficiency, suggesting complicated interactions with unknown factors for sensing and transmitting iron-deficiency signals. PMID:20197292

  9. The tailless Ortholog nhr-67 Regulates Patterning of Gene Expression and Morphogenesis in the C. elegans Vulva

    PubMed Central

    Fernandes, Jolene S; Sternberg, Paul W

    2007-01-01

    Regulation of spatio-temporal gene expression in diverse cell and tissue types is a critical aspect of development. Progression through Caenorhabditis elegans vulval development leads to the generation of seven distinct vulval cell types (vulA, vulB1, vulB2, vulC, vulD, vulE, and vulF), each with its own unique gene expression profile. The mechanisms that establish the precise spatial patterning of these mature cell types are largely unknown. Dissection of the gene regulatory networks involved in vulval patterning and differentiation would help us understand how cells generate a spatially defined pattern of cell fates during organogenesis. We disrupted the activity of 508 transcription factors via RNAi and assayed the expression of ceh-2, a marker for vulB fate during the L4 stage. From this screen, we identified the tailless ortholog nhr-67 as a novel regulator of gene expression in multiple vulval cell types. We find that one way in which nhr-67 maintains cell identity is by restricting inappropriate cell fusion events in specific vulval cells, namely vulE and vulF. nhr-67 exhibits a dynamic expression pattern in the vulval cells and interacts with three other transcriptional regulators cog-1 (Nkx6.1/6.2), lin-11 (LIM), and egl-38 (Pax2/5/8) to generate the composite expression patterns of their downstream targets. We provide evidence that egl-38 regulates gene expression in vulB1, vulC, vulD, vulE, as well as vulF cells. We demonstrate that the pairwise interactions between these regulatory genes are complex and vary among the seven cell types. We also discovered a striking regulatory circuit that affects a subset of the vulval lineages: cog-1 and nhr-67 inhibit both one another and themselves. We postulate that the differential levels and combinatorial patterns of lin-11, cog-1, and nhr-67 expression are a part of a regulatory code for the mature vulval cell types. PMID:17465684

  10. Fungal and host transcriptome analysis of pH-regulated genes during colonization of apple fruits by Penicillium expansum.

    PubMed

    Barad, Shiri; Sela, Noa; Kumar, Dilip; Kumar-Dubey, Amit; Glam-Matana, Nofar; Sherman, Amir; Prusky, Dov

    2016-05-04

    Penicillium expansum is a destructive phytopathogen that causes decay in deciduous fruits during postharvest handling and storage. During colonization the fungus secretes D-gluconic acid (GLA), which modulates environmental pH and regulates mycotoxin accumulation in colonized tissue. Till now no transcriptomic analysis has addressed the specific contribution of the pathogen's pH regulation to the P. expansum colonization process. For this purpose total RNA from the leading edge of P. expansum-colonized apple tissue of cv. 'Golden Delicious' and from fungal cultures grown under pH 4 or 7 were sequenced and their gene expression patterns were compared. We present a large-scale analysis of the transcriptome data of P. expansum and apple response to fungal colonization. The fungal analysis revealed nine different clusters of gene expression patterns that were divided among three major groups in which the colonized tissue showed, respectively: (i) differing transcript expression patterns between mycelial growth at pH 4 and pH 7; (ii) similar transcript expression patterns of mycelial growth at pH 4; and (iii) similar transcript expression patterns of mycelial growth at pH 7. Each group was functionally characterized in order to decipher genes that are important for pH regulation and also for colonization of apple fruits by Penicillium. Furthermore, comparison of gene expression of healthy apple tissue with that of colonized tissue showed that differentially expressed genes revealed up-regulation of the jasmonic acid and mevalonate pathways, and also down-regulation of the glycogen and starch biosynthesis pathways. Overall, we identified important genes and functionalities of P. expansum that were controlled by the environmental pH. Differential expression patterns of genes belonging to the same gene family suggest that genes were selectively activated according to their optimal environmental conditions (pH, in vitro or in vivo) to enable the fungus to cope with varying conditions and to make optimal use of available enzymes. Comparison between the activation of the colonized host's gene responses by alkalizing Colletotrichum gloeosporioides and acidifying P. expansum pathogens indicated similar gene response patterns, but stronger responses to P. expansum, suggesting the importance of acidification by P. expansum as a factor in its increased aggressiveness.

  11. A Modified Consumer Inkjet for Spatiotemporal Control of Gene Expression

    PubMed Central

    Cohen, Daniel J.; Morfino, Roberto C.; Maharbiz, Michel M.

    2009-01-01

    This paper presents a low-cost inkjet dosing system capable of continuous, two-dimensional spatiotemporal regulation of gene expression via delivery of diffusible regulators to a custom-mounted gel culture of E. coli. A consumer-grade, inkjet printer was adapted for chemical printing; E. coli cultures were grown on 750 µm thick agar embedded in micro-wells machined into commercial compact discs. Spatio-temporal regulation of the lac operon was demonstrated via the printing of patterns of lactose and glucose directly into the cultures; X-Gal blue patterns were used for visual feedback. We demonstrate how the bistable nature of the lac operon's feedback, when perturbed by patterning lactose (inducer) and glucose (inhibitor), can lead to coordination of cell expression patterns across a field in ways that mimic motifs seen in developmental biology. Examples of this include sharp boundaries and the generation of traveling waves of mRNA expression. To our knowledge, this is the first demonstration of reaction-diffusion effects in the well-studied lac operon. A finite element reaction-diffusion model of the lac operon is also presented which predicts pattern formation with good fidelity. PMID:19763256

  12. Identification of Cell Cycle-Regulated Genes by Convolutional Neural Network.

    PubMed

    Liu, Chenglin; Cui, Peng; Huang, Tao

    2017-01-01

    The cell cycle-regulated genes express periodically with the cell cycle stages, and the identification and study of these genes can provide a deep understanding of the cell cycle process. Large false positives and low overlaps are big problems in cell cycle-regulated gene detection. Here, a computational framework called DLGene was proposed for cell cycle-regulated gene detection. It is based on the convolutional neural network, a deep learning algorithm representing raw form of data pattern without assumption of their distribution. First, the expression data was transformed to categorical state data to denote the changing state of gene expression, and four different expression patterns were revealed for the reported cell cycle-regulated genes. Then, DLGene was applied to discriminate the non-cell cycle gene and the four subtypes of cell cycle genes. Its performances were compared with six traditional machine learning methods. At last, the biological functions of representative cell cycle genes for each subtype are analyzed. Our method showed better and more balanced performance of sensitivity and specificity comparing to other machine learning algorithms. The cell cycle genes had very different expression pattern with non-cell cycle genes and among the cell-cycle genes, there were four subtypes. Our method not only detects the cell cycle genes, but also describes its expression pattern, such as when its highest expression level is reached and how it changes with time. For each type, we analyzed the biological functions of the representative genes and such results provided novel insight to the cell cycle mechanisms. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  13. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori)

    PubMed Central

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-01-01

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family. PMID:27706106

  14. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    PubMed

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  15. The spatial patterning of mouse cone opsin expression is regulated by BMP signaling through downstream effector COUP-TF nuclear receptors

    PubMed Central

    Satoh, Shinya; Tang, Ke; Iida, Atsumi; Inoue, Mariko; Kodama, Tatsuhiko; Tsai, Sophia Y.; Tsai, Ming-Jer; Furuta, Yasuhide; Watanabe, Sumiko

    2009-01-01

    Cone photopigments, known as opsins, are pivotal elements and the first detection module employed in color vision. In mice, cone photoreceptors are distributed throughout the retina, and S- and M-opsins have unique expression patterns in the retina with a gradient along the dorsoventral axis; however, the mechanisms regulating the spatial patterning of cone opsin expression have not been well documented. The purpose of this study was to define the mechanisms regulating the spatial patterning of cone opsin expression. By analyzing knockouts for bone morphogenetic protein (BMP) signaling, we found an essential role for BMP in forming cone opsin expression patterns in the retina; however, BMP signaling is activated only transiently in the dorsal half of the retina during early retinal development. Thus, BMP is not likely to play a direct role in opsin gene expression, which starts at a later stage of retinal development. We identified the chicken ovalbumin upstream promoter-transcription factor (COUP-TF) nuclear receptor as a link between BMP and opsin expression. BMP signaling is essential for the correct dorsoventral spatial expression of COUP-TFI and -TFII. Through gain- and loss-of-function analyses, we found that both COUP-TFI and -TFII are required to suppress S-opsin expression in the dorsal retina but that only COUP-TFI plays an essential role in suppressing M-opsin expression in the ventral retina. Based on these findings, we propose a new molecular cascade involving BMP and COUP-TFs that conveys dorsoventral information to direct the expression of cone opsins during retinal development. PMID:19812316

  16. MicroRNA networks in mouse lung organogenesis.

    PubMed

    Dong, Jie; Jiang, Guoqian; Asmann, Yan W; Tomaszek, Sandra; Jen, Jin; Kislinger, Thomas; Wigle, Dennis A

    2010-05-26

    MicroRNAs (miRNAs) are known to be important regulators of both organ development and tumorigenesis. MiRNA networks and their regulation of messenger RNA (mRNA) translation and protein expression in specific biological processes are poorly understood. We explored the dynamic regulation of miRNAs in mouse lung organogenesis. Comprehensive miRNA and mRNA profiling was performed encompassing all recognized stages of lung development beginning at embryonic day 12 and continuing to adulthood. We analyzed the expression patterns of dynamically regulated miRNAs and mRNAs using a number of statistical and computational approaches, and in an integrated manner with protein levels from an existing mass-spectrometry derived protein database for lung development. In total, 117 statistically significant miRNAs were dynamically regulated during mouse lung organogenesis and clustered into distinct temporal expression patterns. 11,220 mRNA probes were also shown to be dynamically regulated and clustered into distinct temporal expression patterns, with 3 major patterns accounting for 75% of all probes. 3,067 direct miRNA-mRNA correlation pairs were identified involving 37 miRNAs. Two defined correlation patterns were observed upon integration with protein data: 1) increased levels of specific miRNAs directly correlating with downregulation of predicted mRNA targets; and 2) increased levels of specific miRNAs directly correlating with downregulation of translated target proteins without detectable changes in mRNA levels. Of 1345 proteins analyzed, 55% appeared to be regulated in this manner with a direct correlation between miRNA and protein level, but without detectable change in mRNA levels. Systematic analysis of microRNA, mRNA, and protein levels over the time course of lung organogenesis demonstrates dynamic regulation and reveals 2 distinct patterns of miRNA-mRNA interaction. The translation of target proteins affected by miRNAs independent of changes in mRNA level appears to be a prominent mechanism of developmental regulation in lung organogenesis.

  17. A novel role of BELL1-like homeobox genes, PENNYWISE and POUND-FOOLISH, in floral patterning.

    PubMed

    Yu, Lifeng; Patibanda, Varun; Smith, Harley M S

    2009-02-01

    Flowers are determinate shoots comprised of perianth and reproductive organs displayed in a whorled phyllotactic pattern. Floral organ identity genes display region-specific expression patterns in the developing flower. In Arabidopsis, floral organ identity genes are activated by LEAFY (LFY), which functions with region-specific co-regulators, UNUSUAL FLORAL ORGANS (UFO) and WUSCHEL (WUS), to up-regulate homeotic genes in specific whorls of the flower. PENNYWISE (PNY) and POUND-FOOLISH (PNF) are redundant functioning BELL1-like homeodomain proteins that are expressed in shoot and floral meristems. During flower development, PNY functions with a co-repressor complex to down-regulate the homeotic gene, AGAMOUS (AG), in the outer whorls of the flower. However, the function of PNY as well as PNF in regulating floral organ identity in the central whorls of the flower is not known. In this report, we show that combining mutations in PNY and PNF enhance the floral patterning phenotypes of weak and strong alleles of lfy, indicating that these BELL1-like homeodomain proteins play a role in the specification of petals, stamens and carpels during flower development. Expression studies show that PNY and PNF positively regulate the homeotic genes, APETALA3 and AG, in the inner whorls of the flower. Moreover, PNY and PNF function in parallel with LFY, UFO and WUS to regulate homeotic gene expression. Since PNY and PNF interact with the KNOTTED1-like homeodomain proteins, SHOOTMERISTEMLESS (STM) and KNOTTED-LIKE from ARABIDOPSIS THALIANA2 (KNAT2) that regulate floral development, we propose that PNY/PNF-STM and PNY/PNF-KNAT2 complexes function in the inner whorls to regulate flower patterning events.

  18. A Common Position-Dependent Mechanism Controls Cell-Type Patterning and GLABRA2 Regulation in the Root and Hypocotyl Epidermis of Arabidopsis1

    PubMed Central

    Hung, Chen-Yi; Lin, Yan; Zhang, Meng; Pollock, Susan; David Marks, M.; Schiefelbein, John

    1998-01-01

    A position-dependent pattern of epidermal cell types is produced during root development in Arabidopsis thaliana. This pattern is reflected in the expression pattern of GLABRA2 (GL2), a homeobox gene that regulates cell differentiation in the root epidermis. GL2 promoter::GUS fusions were used to show that the TTG gene, a regulator of root epidermis development, is necessary for maximal GL2 activity but is not required for the pattern of GL2 expression. Furthermore, GL2-promoter activity is influenced by expression of the myc-like maize R gene (35S::R) in Arabidopsis but is not affected by gl2 mutations. A position-dependent pattern of cell differentiation and GL2-promoter activity was also discovered in the hypocotyl epidermis that was analogous to the pattern in the root. Non-GL2-expressing cell files in the hypocotyl epidermis located outside anticlinal cortical cell walls exhibit reduced cell length and form stomata. Like the root, the hypocotyl GL2 activity was shown to be influenced by ttg and 35S::R but not by gl2. The parallel pattern of cell differentiation in the root and hypocotyl indicates that TTG and GL2 participate in a common position-dependent mechanism to control cell-type patterning throughout the apical-basal axis of the Arabidopsis seedling. PMID:9576776

  19. Computational synchronization of microarray data with application to Plasmodium falciparum.

    PubMed

    Zhao, Wei; Dauwels, Justin; Niles, Jacquin C; Cao, Jianshu

    2012-06-21

    Microarrays are widely used to investigate the blood stage of Plasmodium falciparum infection. Starting with synchronized cells, gene expression levels are continually measured over the 48-hour intra-erythrocytic cycle (IDC). However, the cell population gradually loses synchrony during the experiment. As a result, the microarray measurements are blurred. In this paper, we propose a generalized deconvolution approach to reconstruct the intrinsic expression pattern, and apply it to P. falciparum IDC microarray data. We develop a statistical model for the decay of synchrony among cells, and reconstruct the expression pattern through statistical inference. The proposed method can handle microarray measurements with noise and missing data. The original gene expression patterns become more apparent in the reconstructed profiles, making it easier to analyze and interpret the data. We hypothesize that reconstructed gene expression patterns represent better temporally resolved expression profiles that can be probabilistically modeled to match changes in expression level to IDC transitions. In particular, we identify transcriptionally regulated protein kinases putatively involved in regulating the P. falciparum IDC. By analyzing publicly available microarray data sets for the P. falciparum IDC, protein kinases are ranked in terms of their likelihood to be involved in regulating transitions between the ring, trophozoite and schizont developmental stages of the P. falciparum IDC. In our theoretical framework, a few protein kinases have high probability rankings, and could potentially be involved in regulating these developmental transitions. This study proposes a new methodology for extracting intrinsic expression patterns from microarray data. By applying this method to P. falciparum microarray data, several protein kinases are predicted to play a significant role in the P. falciparum IDC. Earlier experiments have indeed confirmed that several of these kinases are involved in this process. Overall, these results indicate that further functional analysis of these additional putative protein kinases may reveal new insights into how the P. falciparum IDC is regulated.

  20. Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

    PubMed Central

    Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

    2012-01-01

    Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

  1. Regulation of mouse hepatic CYP2D9 mRNA expression by growth and adrenal hormones.

    PubMed

    Jarukamjorn, Kanokwan; Sakuma, Tsutomu; Jaruchotikamol, Atika; Oguro, Miki; Nemoto, Nobuo

    2006-02-01

    The constitutive expression of CYP2D9 is sexually dimorphic, namely, strong in males, but diminutive in females. Repetition of mimic growth hormone (GH) secretion pattern impressively returned the mRNA expression level to that in intact mice: the GH secretion pattern's regulation of CYP2D9 mRNA expression has been predominantly disrupted by exogenous GH-administration. The extensive decline of CYP2D9 mRNA expression becoming a sexually non-specific P450 in 9-week-old male mice exposed as neonates to monosodium L-glutamate (MSG) suggested that the male GH secretion pattern is a key to the regulation of male-specific CYP2D9 mRNA expression in adult mice. Dexamethasone (Dex) showed possibility to induce CYP2D9 mRNA expression in adult MSG-neonatally treated mice of either sex. However, the antagonism was observed by co-administration of Dex and GH in the males. Dex-administration in adrenalectomized mice significantly elevated CYP2D9 mRNA expression levels. These findings suggest that an adrenal hormone participates in the regulatory mechanism of CYP2D9 mRNA expression in association with GH.

  2. Regulation of Chlamydia Gene Expression by Tandem Promoters with Different Temporal Patterns.

    PubMed

    Rosario, Christopher J; Tan, Ming

    2016-01-15

    Chlamydia is a genus of pathogenic bacteria with an unusual intracellular developmental cycle marked by temporal waves of gene expression. The three main temporal groups of chlamydial genes are proposed to be controlled by separate mechanisms of transcriptional regulation. However, we have noted genes with discrepancies, such as the early gene dnaK and the midcycle genes bioY and pgk, which have promoters controlled by the late transcriptional regulators EUO and σ(28). To resolve this issue, we analyzed the promoters of these three genes in vitro and in Chlamydia trachomatis bacteria grown in cell culture. Transcripts from the σ(28)-dependent promoter of each gene were detected only at late times in the intracellular infection, bolstering the role of σ(28) RNA polymerase in late gene expression. In each case, however, expression prior to late times was due to a second promoter that was transcribed by σ(66) RNA polymerase, which is the major form of chlamydial polymerase. These results demonstrate that chlamydial genes can be transcribed from tandem promoters with different temporal profiles, leading to a composite expression pattern that differs from the expression profile of a single promoter. In addition, tandem promoters allow a gene to be regulated by multiple mechanisms of transcriptional regulation, such as DNA supercoiling or late regulation by EUO and σ(28). We discuss how tandem promoters broaden the repertoire of temporal gene expression patterns in the chlamydial developmental cycle and can be used to fine-tune the expression of specific genes. Chlamydia is a pathogenic bacterium that is responsible for the majority of infectious disease cases reported to the CDC each year. It causes an intracellular infection that is characterized by coordinated expression of chlamydial genes in temporal waves. Chlamydial transcription has been shown to be regulated by DNA supercoiling, alternative forms of RNA polymerase, and transcription factors, but the number of transcription factors found in Chlamydia is far fewer than the number found in most bacteria. This report describes the use of tandem promoters that allow the temporal expression of a gene or operon to be controlled by more than one regulatory mechanism. This combinatorial strategy expands the range of expression patterns that are available to regulate chlamydial genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  3. Integrating Genetic and Gene Co-expression Analysis Identifies Gene Networks Involved in Alcohol and Stress Responses

    PubMed Central

    Luo, Jie; Xu, Pei; Cao, Peijian; Wan, Hongjian; Lv, Xiaonan; Xu, Shengchun; Wang, Gangjun; Cook, Melloni N.; Jones, Byron C.; Lu, Lu; Wang, Xusheng

    2018-01-01

    Although the link between stress and alcohol is well recognized, the underlying mechanisms of how they interplay at the molecular level remain unclear. The purpose of this study is to identify molecular networks underlying the effects of alcohol and stress responses, as well as their interaction on anxiety behaviors in the hippocampus of mice using a systems genetics approach. Here, we applied a gene co-expression network approach to transcriptomes of 41 BXD mouse strains under four conditions: stress, alcohol, stress-induced alcohol and control. The co-expression analysis identified 14 modules and characterized four expression patterns across the four conditions. The four expression patterns include up-regulation in no restraint stress and given an ethanol injection (NOE) but restoration in restraint stress followed by an ethanol injection (RSE; pattern 1), down-regulation in NOE but rescue in RSE (pattern 2), up-regulation in both restraint stress followed by a saline injection (RSS) and NOE, and further amplification in RSE (pattern 3), and up-regulation in RSS but reduction in both NOE and RSE (pattern 4). We further identified four functional subnetworks by superimposing protein-protein interactions (PPIs) to the 14 co-expression modules, including γ-aminobutyric acid receptor (GABA) signaling, glutamate signaling, neuropeptide signaling, cAMP-dependent signaling. We further performed module specificity analysis to identify modules that are specific to stress, alcohol, or stress-induced alcohol responses. Finally, we conducted causality analysis to link genetic variation to these identified modules, and anxiety behaviors after stress and alcohol treatments. This study underscores the importance of integrative analysis and offers new insights into the molecular networks underlying stress and alcohol responses. PMID:29674951

  4. Epidermal patterning genes are active during embryogenesis in Arabidopsis.

    PubMed

    Costa, Silvia; Dolan, Liam

    2003-07-01

    Epidermal cells in the root of Arabidopsis seedling differentiate either as hair or non-hair cells, while in the hypocotyl they become either stomatal or elongated cells. WEREWOLF (WER) and GLABRA2 (GL2) are positive regulators of non-hair and elongated cell development. CAPRICE (CPC) is a positive regulator of hair cell development in the root. We show that WER, GL2 and CPC are expressed and active during the stages of embryogenesis when the pattern of cells in the epidermis of the root-hypocotyl axis forms. GL2 is first expressed in the future epidermis in the heart stage embryo and its expression is progressively restricted to those cells that will acquire a non-hair identity in the transition between torpedo and mature stage. The expression of GL2 at the heart stage requires WER function. WER and CPC are transiently expressed throughout the root epidermal layer in the torpedo stage embryo when the cell-specific pattern of GL2 expression is being established in the epidermis. We also show that WER positively regulates CPC transcription and GL2 negatively regulates WER transcription in the mature embryo. We propose that the restriction of GL2 to the future non-hair cells in the root epidermis can be correlated with the activities of WER and CPC during torpedo stage. In the embryonic hypocotyl we show that WER controls GL2 expression. We also provide evidence indicating that CPC may also regulate GL2 expression in the hypocotyl.

  5. Parallels between Global Transcriptional Programs of Polarizing Caco-2 Intestinal Epithelial Cells In Vitro and Gene Expression Programs in Normal Colon and Colon Cancer

    PubMed Central

    Sääf, Annika M.; Halbleib, Jennifer M.; Chen, Xin; Yuen, Siu Tsan; Leung, Suet Yi

    2007-01-01

    Posttranslational mechanisms are implicated in the development of epithelial cell polarity, but little is known about the patterns of gene expression and transcriptional regulation during this process. We characterized temporal patterns of gene expression during cell–cell adhesion-initiated polarization of cultured human Caco-2 cells, which develop structural and functional polarity resembling enterocytes in vivo. A distinctive switch in gene expression patterns occurred upon formation of cell–cell contacts. Comparison to gene expression patterns in normal human colon and colon tumors revealed that the pattern in proliferating, nonpolarized Caco-2 cells paralleled patterns seen in human colon cancer in vivo, including expression of genes involved in cell proliferation. The pattern switched in polarized Caco-2 cells to one more closely resembling that in normal colon tissue, indicating that regulation of transcription underlying Caco-2 cell polarization is similar to that during enterocyte differentiation in vivo. Surprisingly, the temporal program of gene expression in polarizing Caco-2 cells involved changes in signaling pathways (e.g., Wnt, Hh, BMP, FGF) in patterns similar to those during migration and differentiation of intestinal epithelial cells in vivo, despite the absence of morphogen gradients and interactions with stromal cells characteristic of enterocyte differentiation in situ. The full data set is available at http://microarray-pubs.stanford.edu/CACO2. PMID:17699589

  6. Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

    PubMed

    Kohsokabe, Takahiro; Kaneko, Kunihiko

    2016-01-01

    Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

  7. Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

    PubMed Central

    Kohsokabe, Takahiro

    2016-01-01

    ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

  8. ULTRAPETALA trxG genes interact with KANADI transcription factor genes to regulate Aradopsis Gynoecium patterning

    USDA-ARS?s Scientific Manuscript database

    Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin remodeling factors cont...

  9. Integrating genome-wide genetic variations and monocyte expression data reveals trans-regulated gene modules in humans.

    PubMed

    Rotival, Maxime; Zeller, Tanja; Wild, Philipp S; Maouche, Seraya; Szymczak, Silke; Schillert, Arne; Castagné, Raphaele; Deiseroth, Arne; Proust, Carole; Brocheton, Jessy; Godefroy, Tiphaine; Perret, Claire; Germain, Marine; Eleftheriadis, Medea; Sinning, Christoph R; Schnabel, Renate B; Lubos, Edith; Lackner, Karl J; Rossmann, Heidi; Münzel, Thomas; Rendon, Augusto; Erdmann, Jeanette; Deloukas, Panos; Hengstenberg, Christian; Diemert, Patrick; Montalescot, Gilles; Ouwehand, Willem H; Samani, Nilesh J; Schunkert, Heribert; Tregouet, David-Alexandre; Ziegler, Andreas; Goodall, Alison H; Cambien, François; Tiret, Laurence; Blankenberg, Stefan

    2011-12-01

    One major expectation from the transcriptome in humans is to characterize the biological basis of associations identified by genome-wide association studies. So far, few cis expression quantitative trait loci (eQTLs) have been reliably related to disease susceptibility. Trans-regulating mechanisms may play a more prominent role in disease susceptibility. We analyzed 12,808 genes detected in at least 5% of circulating monocyte samples from a population-based sample of 1,490 European unrelated subjects. We applied a method of extraction of expression patterns-independent component analysis-to identify sets of co-regulated genes. These patterns were then related to 675,350 SNPs to identify major trans-acting regulators. We detected three genomic regions significantly associated with co-regulated gene modules. Association of these loci with multiple expression traits was replicated in Cardiogenics, an independent study in which expression profiles of monocytes were available in 758 subjects. The locus 12q13 (lead SNP rs11171739), previously identified as a type 1 diabetes locus, was associated with a pattern including two cis eQTLs, RPS26 and SUOX, and 5 trans eQTLs, one of which (MADCAM1) is a potential candidate for mediating T1D susceptibility. The locus 12q24 (lead SNP rs653178), which has demonstrated extensive disease pleiotropy, including type 1 diabetes, hypertension, and celiac disease, was associated to a pattern strongly correlating to blood pressure level. The strongest trans eQTL in this pattern was CRIP1, a known marker of cellular proliferation in cancer. The locus 12q15 (lead SNP rs11177644) was associated with a pattern driven by two cis eQTLs, LYZ and YEATS4, and including 34 trans eQTLs, several of them tumor-related genes. This study shows that a method exploiting the structure of co-expressions among genes can help identify genomic regions involved in trans regulation of sets of genes and can provide clues for understanding the mechanisms linking genome-wide association loci to disease.

  10. Comprehensive Expression Map of Transcription Regulators in the Adult Zebrafish Telencephalon Reveals Distinct Neurogenic Niches

    PubMed Central

    Diotel, Nicolas; Rodriguez Viales, Rebecca; Armant, Olivier; März, Martin; Ferg, Marco; Rastegar, Sepand; Strähle, Uwe

    2015-01-01

    The zebrafish has become a model to study adult vertebrate neurogenesis. In particular, the adult telencephalon has been an intensely studied structure in the zebrafish brain. Differential expression of transcriptional regulators (TRs) is a key feature of development and tissue homeostasis. Here we report an expression map of 1,202 TR genes in the telencephalon of adult zebrafish. Our results are summarized in a database with search and clustering functions to identify genes expressed in particular regions of the telencephalon. We classified 562 genes into 13 distinct patterns, including genes expressed in the proliferative zone. The remaining 640 genes displayed unique and complex patterns of expression and could thus not be grouped into distinct classes. The neurogenic ventricular regions express overlapping but distinct sets of TR genes, suggesting regional differences in the neurogenic niches in the telencephalon. In summary, the small telencephalon of the zebrafish shows a remarkable complexity in TR gene expression. The adult zebrafish telencephalon has become a model to study neurogenesis. We established the expression pattern of more than 1200 transcription regulators (TR) in the adult telencephalon. The neurogenic regions express overlapping but distinct sets of TR genes suggesting regional differences in the neurogenic potential. J. Comp. Neurol. 523:1202–1221, 2015. © 2015 Wiley Periodicals, Inc. PMID:25556858

  11. Comprehensive expression map of transcription regulators in the adult zebrafish telencephalon reveals distinct neurogenic niches.

    PubMed

    Diotel, Nicolas; Rodriguez Viales, Rebecca; Armant, Olivier; März, Martin; Ferg, Marco; Rastegar, Sepand; Strähle, Uwe

    2015-06-01

    The zebrafish has become a model to study adult vertebrate neurogenesis. In particular, the adult telencephalon has been an intensely studied structure in the zebrafish brain. Differential expression of transcriptional regulators (TRs) is a key feature of development and tissue homeostasis. Here we report an expression map of 1,202 TR genes in the telencephalon of adult zebrafish. Our results are summarized in a database with search and clustering functions to identify genes expressed in particular regions of the telencephalon. We classified 562 genes into 13 distinct patterns, including genes expressed in the proliferative zone. The remaining 640 genes displayed unique and complex patterns of expression and could thus not be grouped into distinct classes. The neurogenic ventricular regions express overlapping but distinct sets of TR genes, suggesting regional differences in the neurogenic niches in the telencephalon. In summary, the small telencephalon of the zebrafish shows a remarkable complexity in TR gene expression. The adult zebrafish telencephalon has become a model to study neurogenesis. We established the expression pattern of more than 1200 transcription regulators (TR) in the adult telencephalon. The neurogenic regions express overlapping but distinct sets of TR genes suggesting regional differences in the neurogenic potential. © 2015 Wiley Periodicals, Inc.

  12. DNA-Demethylase Regulated Genes Show Methylation-Independent Spatiotemporal Expression Patterns

    PubMed Central

    Schumann, Ulrike; Lee, Joanne; Kazan, Kemal; Ayliffe, Michael; Wang, Ming-Bo

    2017-01-01

    Recent research has indicated that a subset of defense-related genes is downregulated in the Arabidopsis DNA demethylase triple mutant rdd (ros1 dml2 dml3) resulting in increased susceptibility to the fungal pathogen Fusarium oxysporum. In rdd plants these downregulated genes contain hypermethylated transposable element sequences (TE) in their promoters, suggesting that this methylation represses gene expression in the mutant and that these sequences are actively demethylated in wild-type plants to maintain gene expression. In this study, the tissue-specific and pathogen-inducible expression patterns of rdd-downregulated genes were investigated and the individual role of ROS1, DML2, and DML3 demethylases in these spatiotemporal regulation patterns was determined. Large differences in defense gene expression were observed between pathogen-infected and uninfected tissues and between root and shoot tissues in both WT and rdd plants, however, only subtle changes in promoter TE methylation patterns occurred. Therefore, while TE hypermethylation caused decreased gene expression in rdd plants it did not dramatically effect spatiotemporal gene regulation, suggesting that this latter regulation is largely methylation independent. Analysis of ros1-3, dml2-1, and dml3-1 single gene mutant lines showed that promoter TE hypermethylation and defense-related gene repression was predominantly, but not exclusively, due to loss of ROS1 activity. These data demonstrate that DNA demethylation of TE sequences, largely by ROS1, promotes defense-related gene expression but does not control spatiotemporal expression in Arabidopsis. Summary: Ros1-mediated DNA demethylation of promoter transposable elements is essential for activation of defense-related gene expression in response to fungal infection in Arabidopsis thaliana. PMID:28894455

  13. Hypoxia regulates microRNA expression in the human carotid body

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mkrtchian, Souren, E-mail: souren.mkrtchian@ki.se; Lee, Kian Leong, E-mail: csilkl@nus.edu.sg; Kåhlin, Jessica

    The carotid body (CB) is the key sensing organ for physiological oxygen levels in the body. Under conditions of low oxygen (hypoxia), the CB plays crucial roles in signaling to the cardiorespiratory center in the medulla oblongata for the restoration of oxygen homeostasis. How hypoxia regulates gene expression in the human CB remains poorly understood. While limited information on transcriptional regulation in animal CBs is available, the identity and impact of important post-transcriptional regulators such as non-coding RNAs, and in particular miRNAs are not known. Here we show using ex vivo experiments that indeed a number of miRNAs are differentiallymore » regulated in surgically removed human CB slices when acute hypoxic conditions were applied. Analysis of the hypoxia-regulated miRNAs shows that they target biological pathways with upregulation of functions related to cell proliferation and immune response and downregulation of cell differentiation and cell death functions. Comparative analysis of the human CB miRNAome with the global miRNA expression patterns of a large number of different human tissues showed that the CB miRNAome had a unique profile which reflects its highly specialized functional status. Nevertheless, the human CB miRNAome is most closely related to the miRNA expression pattern of brain tissues indicating that they may have the most similar developmental origins. - Highlights: • Hypoxia triggers differential expression of many miRNAs in the human carotid body. • This can lead to the upregulation of proliferation and immune response functions. • CB expression profile in the carotid body resembles the miRNA expression pattern in the brain. • miRNAs are involved in the regulation of carotid body functions including oxygen sensing.« less

  14. The Maize (Zea mays L.) AUXIN/INDOLE-3-ACETIC ACID Gene Family: Phylogeny, Synteny, and Unique Root-Type and Tissue-Specific Expression Patterns during Development

    PubMed Central

    Ludwig, Yvonne; Zhang, Yanxiang; Hochholdinger, Frank

    2013-01-01

    The plant hormone auxin plays a key role in the coordination of many aspects of growth and development. AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) genes encode instable primary auxin responsive regulators of plant development that display a protein structure with four characteristic domains. In the present study, a comprehensive analysis of the 34 members of the maize Aux/IAA gene family was performed. Phylogenetic reconstructions revealed two classes of Aux/IAA proteins that can be distinguished by alterations in their domain III. Seven pairs of paralogous maize Aux/IAA proteins were discovered. Comprehensive root-type and tissue-specific expression profiling revealed unique expression patterns of the diverse members of the gene family. Remarkably, five of seven pairs of paralogous genes displayed highly correlated expression patterns in roots. All but one (ZmIAA23) tested maize Aux/IAA genes were auxin inducible, displaying two types of auxin induction within three hours of treatment. Moreover, 51 of 55 (93%) differential Aux/IAA expression patterns between different root-types followed the expression tendency: crown roots > seminal roots > primary roots > lateral roots. This pattern might imply root-type-specific regulation of Aux/IAA transcript abundance. In summary, the detailed analysis of the maize Aux/IAA gene family provides novel insights in the evolution and developmental regulation and thus the function of these genes in different root-types and tissues. PMID:24223858

  15. The maize (Zea mays L.) AUXIN/INDOLE-3-ACETIC ACID gene family: phylogeny, synteny, and unique root-type and tissue-specific expression patterns during development.

    PubMed

    Ludwig, Yvonne; Zhang, Yanxiang; Hochholdinger, Frank

    2013-01-01

    The plant hormone auxin plays a key role in the coordination of many aspects of growth and development. AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) genes encode instable primary auxin responsive regulators of plant development that display a protein structure with four characteristic domains. In the present study, a comprehensive analysis of the 34 members of the maize Aux/IAA gene family was performed. Phylogenetic reconstructions revealed two classes of Aux/IAA proteins that can be distinguished by alterations in their domain III. Seven pairs of paralogous maize Aux/IAA proteins were discovered. Comprehensive root-type and tissue-specific expression profiling revealed unique expression patterns of the diverse members of the gene family. Remarkably, five of seven pairs of paralogous genes displayed highly correlated expression patterns in roots. All but one (ZmIAA23) tested maize Aux/IAA genes were auxin inducible, displaying two types of auxin induction within three hours of treatment. Moreover, 51 of 55 (93%) differential Aux/IAA expression patterns between different root-types followed the expression tendency: crown roots > seminal roots > primary roots > lateral roots. This pattern might imply root-type-specific regulation of Aux/IAA transcript abundance. In summary, the detailed analysis of the maize Aux/IAA gene family provides novel insights in the evolution and developmental regulation and thus the function of these genes in different root-types and tissues.

  16. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    PubMed Central

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  17. Bacterial competition reveals differential regulation of the pks genes by Bacillus subtilis.

    PubMed

    Vargas-Bautista, Carol; Rahlwes, Kathryn; Straight, Paul

    2014-02-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305-310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis.

  18. Mechanisms of macroevolution: polyphagous plasticity in butterfly larvae revealed by RNA-Seq.

    PubMed

    de la Paz Celorio-Mancera, Maria; Wheat, Christopher W; Vogel, Heiko; Söderlind, Lina; Janz, Niklas; Nylin, Sören

    2013-10-01

    Transcriptome studies of insect herbivory are still rare, yet studies in model systems have uncovered patterns of transcript regulation that appear to provide insights into how insect herbivores attain polyphagy, such as a general increase in expression breadth and regulation of ribosomal, digestion- and detoxification-related genes. We investigated the potential generality of these emerging patterns, in the Swedish comma, Polygonia c-album, which is a polyphagous, widely-distributed butterfly. Urtica dioica and Ribes uva-crispa are hosts of P. c-album, but Ribes represents a recent evolutionary shift onto a very divergent host. Utilizing the assembled transcriptome for read mapping, we assessed gene expression finding that caterpillar life-history (i.e. 2nd vs. 4th-instar regulation) had a limited influence on gene expression plasticity. In contrast, differential expression in response to host-plant identified genes encoding serine-type endopeptidases, membrane-associated proteins and transporters. Differential regulation of genes involved in nucleic acid binding was also observed suggesting that polyphagy involves large scale transcriptional changes. Additionally, transcripts coding for structural constituents of the cuticle were differentially expressed in caterpillars in response to their diet indicating that the insect cuticle may be a target for plant defence. Our results state that emerging patterns of transcript regulation from model species appear relevant in species when placed in an evolutionary context. © 2013 John Wiley & Sons Ltd.

  19. Low-rank regularization for learning gene expression programs.

    PubMed

    Ye, Guibo; Tang, Mengfan; Cai, Jian-Feng; Nie, Qing; Xie, Xiaohui

    2013-01-01

    Learning gene expression programs directly from a set of observations is challenging due to the complexity of gene regulation, high noise of experimental measurements, and insufficient number of experimental measurements. Imposing additional constraints with strong and biologically motivated regularizations is critical in developing reliable and effective algorithms for inferring gene expression programs. Here we propose a new form of regulation that constrains the number of independent connectivity patterns between regulators and targets, motivated by the modular design of gene regulatory programs and the belief that the total number of independent regulatory modules should be small. We formulate a multi-target linear regression framework to incorporate this type of regulation, in which the number of independent connectivity patterns is expressed as the rank of the connectivity matrix between regulators and targets. We then generalize the linear framework to nonlinear cases, and prove that the generalized low-rank regularization model is still convex. Efficient algorithms are derived to solve both the linear and nonlinear low-rank regularized problems. Finally, we test the algorithms on three gene expression datasets, and show that the low-rank regularization improves the accuracy of gene expression prediction in these three datasets.

  20. Transcriptional analysis of the conidiation pattern shift of the entomopathogenic fungus Metarhizium acridum in response to different nutrients.

    PubMed

    Wang, Zhenglong; Jin, Kai; Xia, Yuxian

    2016-08-09

    Most fungi, including entomopathogenic fungi, have two different conidiation patterns, normal and microcycle conidiation, under different culture conditions, eg, in media containing different nutrients. However, the mechanisms underlying the conidiation pattern shift are poorly understood. In this study, Metarhizium acridum undergoing microcycle conidiation on sucrose yeast extract agar (SYA) medium shifted to normal conidiation when the medium was supplemented with sucrose, nitrate, or phosphate. By linking changes in nutrients with the conidiation pattern shift and transcriptional changes, we obtained conidiation pattern shift libraries by Solexa/Illumina deep-sequencing technology. A comparative analysis demonstrated that the expression of 137 genes was up-regulated during the shift to normal conidiation, while the expression of 436 genes was up-regulated at the microcycle conidiation stage. A comparison of subtractive libraries revealed that 83, 216, and 168 genes were related to sucrose-induced, nitrate-induced, and phosphate-induced conidiation pattern shifts, respectively. The expression of 217 genes whose expression was specific to microcycle conidiation was further analyzed by the gene expression profiling via multigene concatemers method using mRNA isolated from M. acridum grown on SYA and the four normal conidiation media. The expression of 142 genes was confirmed to be up-regulated on standard SYA medium. Of these 142 genes, 101 encode hypothetical proteins or proteins of unknown function, and only 41 genes encode proteins with putative functions. Of these 41 genes, 18 are related to cell growth, 10 are related to cell proliferation, three are related to the cell cycle, three are related to cell differentiation, two are related to cell wall synthesis, two are related to cell division, and seven have other functions. These results indicate that the conidiation pattern shift in M. acridum mainly results from changes in cell growth and proliferation. The results indicate that M. acridum shifts conidiation pattern from microcycle conidiation to normal conidiation when there is increased sucrose, nitrate, or phosphate in the medium during microcycle conidiation. The regulation of conidiation patterning is a complex process involving the cell cycle and metabolism of M. acridum. This study provides essential information about the molecular mechanism of the induction of the conidiation pattern shift by single nutrients.

  1. Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae

    PubMed Central

    Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.

    2014-01-01

    Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905

  2. JAK/Stat signaling regulates heart precursor diversification in Drosophila

    PubMed Central

    Johnson, Aaron N.; Mokalled, Mayssa H.; Haden, Tom N.; Olson, Eric N.

    2011-01-01

    Intercellular signal transduction pathways regulate the NK-2 family of transcription factors in a conserved gene regulatory network that directs cardiogenesis in both flies and mammals. The Drosophila NK-2 protein Tinman (Tin) was recently shown to regulate Stat92E, the Janus kinase (JAK) and Signal transducer and activator of transcription (Stat) pathway effector, in the developing mesoderm. To understand whether the JAK/Stat pathway also regulates cardiogenesis, we performed a systematic characterization of JAK/Stat signaling during mesoderm development. Drosophila embryos with mutations in the JAK/Stat ligand upd or in Stat92E have non-functional hearts with luminal defects and inappropriate cell aggregations. Using strong Stat92E loss-of-function alleles, we show that the JAK/Stat pathway regulates tin expression prior to heart precursor cell diversification. tin expression can be subdivided into four phases and, in Stat92E mutant embryos, the broad phase 2 expression pattern in the dorsal mesoderm does not restrict to the constrained phase 3 pattern. These embryos also have an expanded pericardial cell domain. We show the E(spl)-C gene HLHm5 is expressed in a pattern complementary to tin during phase 3 and that this expression is JAK/Stat dependent. In addition, E(spl)-C mutant embryos phenocopy the cardiac defects of Stat92E embryos. Mechanistically, JAK/Stat signals activate E(spl)-C genes to restrict Tin expression and the subsequent expression of the T-box transcription factor H15 to direct heart precursor diversification. This study is the first to characterize a role for the JAK/Stat pathway during cardiogenesis and identifies an autoregulatory circuit in which tin limits its own expression domain. PMID:21965617

  3. Dlx homeobox gene family expression in osteoclasts.

    PubMed

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  4. Characterization, expression profiles, intracellular distribution and association analysis of porcine PNAS-4 gene with production traits.

    PubMed

    Mo, Delin; Zhu, Zhengmao; te Pas, Marinus F W; Li, Xinyun; Yang, Shulin; Wang, Heng; Wang, Huanling; Li, Kui

    2008-06-30

    In a previous screen to identify differentially expressed genes associated with embryonic development, the porcine PNAS-4 gene had been found. Considering differentially expressed genes in early stages of muscle development are potential candidate genes to improve meat quality and production efficiency, we determined how porcine PNAS-4 gene regulates meat production. Therefore, this gene has been sequenced, expression analyzed and associated with meat production traits. We cloned the full-length cDNA of porcine PNAS-4 gene encoding a protein of 194 amino acids which was expressed in the Golgi complex. This gene was mapped to chromosome 10, q11-16, in a region of conserved synteny with human chromosome 1 where the human homologous gene was localized. Real-time PCR revealed that PNAS-4 mRNA was widely expressed with highest expression levels in skeletal muscle followed by lymph, liver and other tissues, and showed a down-regulated expression pattern during prenatal development while a up-regulated expression pattern after weaning. Association analysis revealed that allele C of SNP A1813C was prevalent in Chinese indigenous breeds whereas A was dominant allele in Landrace and Large White, and the pigs with homozygous CC had a higher fat content than those of the pigs with other genotypes (P < 0.05). Porcine PNAS-4 protein tagged with green fluorescent protein accumulated in the Golgi complex, and its mRNA showed a widespread expression across many tissues and organs in pigs. It may be an important factor affecting the meat production efficiency, because its down-regulated expression pattern during early embryogenesis suggests involvement in increase of muscle fiber number. In addition, the SNP A1813C associated with fat traits might be a genetic marker for molecular-assisted selection in animal breeding.

  5. Embryonic expression of the transforming growth factor beta ligand and receptor genes in chicken.

    PubMed

    Cooley, James R; Yatskievych, Tatiana A; Antin, Parker B

    2014-03-01

    Transforming growth factor-beta (TGFβ) signaling regulates a myriad of biological processes during embryogenesis, in the adult, and during the manifestation of disease. TGFβ signaling is propagated through one of three TGFβ ligands interacting with Type I and Type II receptors, and Type III co-receptors. Although TGFβ signaling is regulated partly by the combinatorial expression patterns of TGFβ receptors and ligands, a comprehensive gene expression analysis has not been published. Here we report the embryonic mRNA expression patterns in chicken embryos of the canonical TGFβ ligands (TGFB1, TGFB2, and TGFB3) and receptors (TGFBR1, TGFBR2, TGFBR3), plus the Activin A receptor, type 1 (ACVR1) and co receptor Endoglin (ENG) that also transduce TGFβ signaling. TGFB ligands and receptors show dynamic and frequently overlapping expression patterns in numerous embryonic cell layers and structures. Integrating expression information identifies combinations of ligands and receptors that are involved in specific developmental processes including somitogenesis, cardiogenesis and vasculogenesis. Copyright © 2013 Wiley Periodicals, Inc.

  6. BMPs regulate msx gene expression in the dorsal neuroectoderm of Drosophila and vertebrates by distinct mechanisms.

    PubMed

    Esteves, Francisco F; Springhorn, Alexander; Kague, Erika; Taylor, Erika; Pyrowolakis, George; Fisher, Shannon; Bier, Ethan

    2014-09-01

    In a broad variety of bilaterian species the trunk central nervous system (CNS) derives from three primary rows of neuroblasts. The fates of these neural progenitor cells are determined in part by three conserved transcription factors: vnd/nkx2.2, ind/gsh and msh/msx in Drosophila melanogaster/vertebrates, which are expressed in corresponding non-overlapping patterns along the dorsal-ventral axis. While this conserved suite of "neural identity" gene expression strongly suggests a common ancestral origin for the patterning systems, it is unclear whether the original regulatory mechanisms establishing these patterns have been similarly conserved during evolution. In Drosophila, genetic evidence suggests that Bone Morphogenetic Proteins (BMPs) act in a dosage-dependent fashion to repress expression of neural identity genes. BMPs also play a dose-dependent role in patterning the dorsal and lateral regions of the vertebrate CNS, however, the mechanism by which they achieve such patterning has not yet been clearly established. In this report, we examine the mechanisms by which BMPs act on cis-regulatory modules (CRMs) that control localized expression of the Drosophila msh and zebrafish (Danio rerio) msxB in the dorsal central nervous system (CNS). Our analysis suggests that BMPs act differently in these organisms to regulate similar patterns of gene expression in the neuroectoderm: repressing msh expression in Drosophila, while activating msxB expression in the zebrafish. These findings suggest that the mechanisms by which the BMP gradient patterns the dorsal neuroectoderm have reversed since the divergence of these two ancient lineages.

  7. BMPs Regulate msx Gene Expression in the Dorsal Neuroectoderm of Drosophila and Vertebrates by Distinct Mechanisms

    PubMed Central

    Esteves, Francisco F.; Taylor, Erika; Pyrowolakis, George; Fisher, Shannon; Bier, Ethan

    2014-01-01

    In a broad variety of bilaterian species the trunk central nervous system (CNS) derives from three primary rows of neuroblasts. The fates of these neural progenitor cells are determined in part by three conserved transcription factors: vnd/nkx2.2, ind/gsh and msh/msx in Drosophila melanogaster/vertebrates, which are expressed in corresponding non-overlapping patterns along the dorsal-ventral axis. While this conserved suite of “neural identity” gene expression strongly suggests a common ancestral origin for the patterning systems, it is unclear whether the original regulatory mechanisms establishing these patterns have been similarly conserved during evolution. In Drosophila, genetic evidence suggests that Bone Morphogenetic Proteins (BMPs) act in a dosage-dependent fashion to repress expression of neural identity genes. BMPs also play a dose-dependent role in patterning the dorsal and lateral regions of the vertebrate CNS, however, the mechanism by which they achieve such patterning has not yet been clearly established. In this report, we examine the mechanisms by which BMPs act on cis-regulatory modules (CRMs) that control localized expression of the Drosophila msh and zebrafish (Danio rerio) msxB in the dorsal central nervous system (CNS). Our analysis suggests that BMPs act differently in these organisms to regulate similar patterns of gene expression in the neuroectoderm: repressing msh expression in Drosophila, while activating msxB expression in the zebrafish. These findings suggest that the mechanisms by which the BMP gradient patterns the dorsal neuroectoderm have reversed since the divergence of these two ancient lineages. PMID:25210771

  8. Regulation of MET by FOXP2, genes implicated in higher cognitive dysfunction and autism risk.

    PubMed

    Mukamel, Zohar; Konopka, Genevieve; Wexler, Eric; Osborn, Gregory E; Dong, Hongmei; Bergman, Mica Y; Levitt, Pat; Geschwind, Daniel H

    2011-08-10

    Autism spectrum disorder (ASD) is a highly heritable, behaviorally defined, heterogeneous disorder of unknown pathogenesis. Several genetic risk genes have been identified, including the gene encoding the receptor tyrosine kinase MET, which regulates neuronal differentiation and growth. An ASD-associated polymorphism disrupts MET gene transcription, and there are reduced levels of MET protein expression in the mature temporal cortex of subjects with ASD. To address the possible neurodevelopmental contribution of MET to ASD pathogenesis, we examined the expression and transcriptional regulation of MET by a transcription factor, FOXP2, which is implicated in regulation of cognition and language, two functions altered in ASD. MET mRNA expression in the midgestation human fetal cerebral cortex is strikingly restricted, localized to portions of the temporal and occipital lobes. Within the cortical plate of the temporal lobe, the pattern of MET expression is highly complementary to the expression pattern of FOXP2, suggesting the latter may play a role in repression of gene expression. Consistent with this, MET and FOXP2 also are reciprocally expressed by differentiating normal human neuronal progenitor cells (NHNPs) in vitro, leading us to assess whether FOXP2 transcriptionally regulates MET. Indeed, FOXP2 binds directly to the 5' regulatory region of MET, and overexpression of FOXP2 results in transcriptional repression of MET. The expression of MET in restricted human neocortical regions, and its regulation in part by FOXP2, is consistent with genetic evidence for MET contributing to ASD risk.

  9. Dynamic patterns of expression for genes regulating cytokinin metabolism and signaling during rice inflorescence development.

    PubMed

    Yamburenko, Maria V; Kieber, Joseph J; Schaller, G Eric

    2017-01-01

    Inflorescence development in cereals, including such important crops as rice, maize, and wheat, directly affects grain number and size and is a key determinant of yield. Cytokinin regulates meristem size and activity and, as a result, has profound effects on inflorescence development and architecture. To clarify the role of cytokinin action in inflorescence development, we used the NanoString nCounter system to analyze gene expression in the early stages of rice panicle development, focusing on 67 genes involved in cytokinin biosynthesis, degradation, and signaling. Results point toward key members of these gene families involved in panicle development and indicate that the expression of many genes involved in cytokinin action differs between the panicle and vegetative tissues. Dynamic patterns of gene expression suggest that subnetworks mediate cytokinin action during different stages of panicle development. The variation of expression during panicle development is greater among genes encoding proteins involved in cytokinin metabolism and negative regulators of the pathway than for the genes in the primary response pathway. These results provide insight into the expression patterns of genes involved in cytokinin action during inflorescence development in a crop of agricultural importance, with relevance to similar processes in other monocots. The identification of subnetworks of genes expressed at different stages of early panicle development suggests that manipulation of their expression could have substantial effects on inflorescence architecture.

  10. Transcriptomic variation of eyestalk reveals the genes and biological processes associated with molting in Portunus trituberculatus

    PubMed Central

    Zhang, Longtao; Liu, Ping; Li, Jian

    2017-01-01

    Background Molting is an essential biological process throughout the life history of crustaceans, which is regulated by many neuropeptide hormones expressed in the eyestalk. To better understand the molting mechanism in Portunus trituberculatus, we used digital gene expression (DGE) to analyze single eyestalk samples during the molting cycle by high-throughput sequencing. Results We obtained 14,387,942, 12,631,508 and 13,060,062 clean sequence reads from inter-molt (InM), pre-molt (PrM) and post-molt (PoM) cDNA libraries, respectively. A total of 1,394 molt-related differentially expressed genes (DEGs) were identified. GO and KEGG enrichment analysis identified some important processes and pathways with key roles in molting regulation, such as chitin metabolism, peptidase inhibitor activity, and the ribosome. We first observed a pattern associated with the neuromodulator-related pathways during the molting cycle, which were up-regulated in PrM and down-regulated in PoM. Four categories of important molting-related transcripts were clustered and most of them had similar expression patterns, which suggests that there is a connection between these genes throughout the molt cycle. Conclusion Our work is the first molt-related investigation of P. trituberculatus focusing on the eyestalk at the whole transcriptome level. Together, our results, including DEGs, identification of molting-related biological processes and pathways, and observed expression patterns of important genes, provide a novel insight into the function of the eyestalk in molting regulation. PMID:28394948

  11. Transitional gene expression profiling in ovarian follicle during ovulation in normal-cycle rats.

    PubMed

    Tsubota, Kenjiro; Kanki, Masayuki; Noto, Takahisa; Shiraki, Katsuhisa; Takeuchi, Ayano; Nakatsuji, Shunji; Seki, Jiro; Oishi, Yuji; Matsumoto, Masahiro; Nakayama, Hiroyuki

    2011-06-01

    Evaluation of ovarian toxicity requires an understanding of the physiological changes related to the estrous cycle in the ovary. The authors investigated the transitional gene expression profile of ovulatory follicles in rats that show normal estrous cyclicity. Ovaries were collected at 10:00 and 22:00 on the proestrus day and at 10:00 on the estrus day. Ovarian follicles or early corpora lutea were isolated using laser microdissection, and extracted total RNA was analyzed using microarray technology. Clustering analysis revealed four different expression patterns: transient up- or down-regulation only at 22:00 on the proestrus day (pattern 1), up- or down-regulation only at 10:00 on the estrus day (pattern 2), continuous increase at 22:00 on the proestrus day and at 10:00 on the estrus day (pattern 3), and up- or down-regulation at 22:00 on the proestrus day and level maintenance at 10:00 on the estrus day (pattern 4). In addition, these probe sets were functionally categorized in each pattern using the Ingenuity Pathways Analysis database. These data will aid in understanding the physiology of ovulation and may be useful in assessing ovarian toxicity and its mechanism, such as in investigations of chemical-induced ovulatory impairment.

  12. Signaling by Bone Morphogenetic Proteins directs formation of an ectodermal signaling center that regulates craniofacial development

    PubMed Central

    Foppiano, Silvia; Hu, Diane; Marcucio, Ralph S.

    2008-01-01

    We previously described a signaling center, the Frontonasal Ectodermal Zone (FEZ) that regulates growth and patterning of the frontonasal process (FNP). The FEZ is comprised of FNP ectoderm flanking a boundary between Sonic hedgehog (Shh) and Fibroblast growth factor 8 (Fgf8) expression domains. Our objective was to examine BMP signaling during formation of the FEZ. We blocked BMP signaling throughout the FNP prior to FEZ formation by infecting chick embryos at stage 10 (HH10) with a replication competent avian retrovirus encoding the BMP antagonist Noggin. We assessed gene expression patterns in the FNP 72 hours after infection (~HH22) and observed that Shh expression was reduced or absent. In the mesenchyme we observed that Bmp2 transcripts were absent while the Bmp4 expression domain was expanded proximally. In addition to the molecular changes, infected embryos also exhibited facial malformations at 72 and 96 hours after infection suggesting that the FEZ did not form. Our data indicate that reduced cell proliferation, but not apoptosis, in the mesenchyme contributed to the phenotype that we observed. Additionally, adding exogenous SHH into the mesenchyme of RCAS-Noggin infected embryos did not restore Bmp2 and Bmp4 to a normal pattern of expression. These data indicate that BMP signaling mediates interactions between tissues in the FNP that regulate FEZ formation; and that the correct pattern of Bmp2 and Bmp4, but not Bmp7, expression in the FNP mesenchyme requires signaling by the BMP pathway. PMID:18028903

  13. Identifying arsenic trioxide (ATO) functions in leukemia cells by using time series gene expression profiles.

    PubMed

    Yang, Hong; Lin, Shan; Cui, Jingru

    2014-02-10

    Arsenic trioxide (ATO) is presently the most active single agent in the treatment of acute promyelocytic leukemia (APL). In order to explore the molecular mechanism of ATO in leukemia cells with time series, we adopted bioinformatics strategy to analyze expression changing patterns and changes in transcription regulation modules of time series genes filtered from Gene Expression Omnibus database (GSE24946). We totally screened out 1847 time series genes for subsequent analysis. The KEGG (Kyoto encyclopedia of genes and genomes) pathways enrichment analysis of these genes showed that oxidative phosphorylation and ribosome were the top 2 significantly enriched pathways. STEM software was employed to compare changing patterns of gene expression with assigned 50 expression patterns. We screened out 7 significantly enriched patterns and 4 tendency charts of time series genes. The result of Gene Ontology showed that functions of times series genes mainly distributed in profiles 41, 40, 39 and 38. Seven genes with positive regulation of cell adhesion function were enriched in profile 40, and presented the same first increased model then decreased model as profile 40. The transcription module analysis showed that they mainly involved in oxidative phosphorylation pathway and ribosome pathway. Overall, our data summarized the gene expression changes in ATO treated K562-r cell lines with time and suggested that time series genes mainly regulated cell adhesive. Furthermore, our result may provide theoretical basis of molecular biology in treating acute promyelocytic leukemia. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Dampened regulates the activating potency of Bicoid and the embryonic patterning outcome in Drosophila

    PubMed Central

    Liu, Junbo; Ma, Jun

    2014-01-01

    The Drosophila morphogen gradient of Bicoid (Bcd) initiates anterior-posterior (AP) patterning, but it is poorly understood how its ability to activate a target gene may impact this process. Here we report an F-box protein, Dampened (Dmpd) as a nuclear co-factor of Bcd that can enhance its activating potency. We establish a quantitative platform to specifically investigate two parameters of a Bcd target gene response, expression amplitude and boundary position. We show that embryos lacking Dmpd have a reduced amplitude of Bcd-activated hunchback (hb) expression at a critical time of development. This is due to a reduced Bcd-dependent transcribing probability. This defect is faithfully propagated further downstream of the AP patterning network to alter the spatial characteristics of even-skipped (eve) stripes. Thus, unlike another Bcd-interacting F-box protein Fates-shifted (Fsd), which controls AP patterning through regulating the Bcd gradient profile, Dmpd achieves its patterning role through regulating the activating potency of Bcd. PMID:24336107

  15. The costs of parental pressure to express emotions: conditional regard and autonomy support as predictors of emotion regulation and intimacy.

    PubMed

    Roth, Guy; Assor, Avi

    2012-08-01

    This research focuses on offspring's perceptions of their parents' usage of conditional regard and autonomy-supportive practices in response to the offspring's experiences of negative emotion. Participants were 174 college students (60% were females). As predicted from self-determination theory (Ryan & Deci, 2000), students' perceptions of parents as hinging their regard on students' expression or suppression of negative emotions predicted a maladaptive pattern of emotion regulation and intimacy capacity. In contrast, autonomy-supportive parenting predicted more adaptive emotion regulation and intimacy patterns. Also as predicted, emotion-regulation mode mediated the relations between parental practices and intimacy capacity. The innovative aspect of the study is the finding that parents who use conditional regard to encourage children's expression (sharing) of negative emotions may actually undermine their children's socioemotional capacities. Copyright © 2011 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  16. Expression pattern of L-FABP gene in different tissues and its regulation of fat metabolism-related genes in duck.

    PubMed

    He, Jun; Tian, Yong; Li, Jinjun; Shen, Junda; Tao, Zhengrong; Fu, Yan; Niu, Dong; Lu, Lizhi

    2013-01-01

    Liver fatty acid binding protein (L-FABP) is a member of intracellular lipid-binding proteins responsible for the transportation of fatty acids. The expression pattern of duck L-FABP mRNA was examined in this study by quantitative RT-PCR. The results showed that duck L-FABP gene was expressed in many tissues, including heart, lung, kidney, muscle, ovary, brain, intestine, stomach and adipocyte tissues, and highly expressed in liver. Several lipid metabolism-related genes were selected to detect the regulation of L-FABP in duck. The expression of L-FABP and lipoprotein lipase was promoted by oleic acid. The L-FABP knockdown decreased the expression levels of peroxisome proliferator-activated receptor α (PPARα), fatty acid synthase and lipoprotein lipase by 61.1, 42.3 and 53.7 %, respectively (P < 0.05), but had no influences on the mRNA levels of PPARγ and leptin receptor. L-FABP might function through the PPARα to regulate the fat metabolism-related gene expression and play important roles in lipid metabolism in duck hepatocytes.

  17. WEREWOLF, a Regulator of Root Hair Pattern Formation, Controls Flowering Time through the Regulation of FT mRNA Stability1[C][W][OA

    PubMed Central

    Seo, Eunjoo; Yu, Jihyeon; Ryu, Kook Hui; Lee, Myeong Min; Lee, Ilha

    2011-01-01

    A key floral activator, FT, integrates stimuli from long-day, vernalization, and autonomous pathways and triggers flowering by directly regulating floral meristem identity genes in Arabidopsis (Arabidopsis thaliana). Since a small amount of FT transcript is sufficient for flowering, the FT level is strictly regulated by diverse genes. In this study, we show that WEREWOLF (WER), a MYB transcription factor regulating root hair pattern, is another regulator of FT. The mutant wer flowers late in long days but normal in short days and shows a weak sensitivity to vernalization, which indicates that WER controls flowering time through the photoperiod pathway. The expression and double mutant analyses showed that WER modulates FT transcript level independent of CONSTANS and FLOWERING LOCUS C. The histological analysis of WER shows that it is expressed in the epidermis of leaves, where FT is not expressed. Consistently, WER regulates not the transcription but the stability of FT mRNA. Our results reveal a novel regulatory mechanism of FT that is non cell autonomous. PMID:21653190

  18. WEREWOLF, a regulator of root hair pattern formation, controls flowering time through the regulation of FT mRNA stability.

    PubMed

    Seo, Eunjoo; Yu, Jihyeon; Ryu, Kook Hui; Lee, Myeong Min; Lee, Ilha

    2011-08-01

    A key floral activator, FT, integrates stimuli from long-day, vernalization, and autonomous pathways and triggers flowering by directly regulating floral meristem identity genes in Arabidopsis (Arabidopsis thaliana). Since a small amount of FT transcript is sufficient for flowering, the FT level is strictly regulated by diverse genes. In this study, we show that WEREWOLF (WER), a MYB transcription factor regulating root hair pattern, is another regulator of FT. The mutant wer flowers late in long days but normal in short days and shows a weak sensitivity to vernalization, which indicates that WER controls flowering time through the photoperiod pathway. The expression and double mutant analyses showed that WER modulates FT transcript level independent of CONSTANS and FLOWERING LOCUS C. The histological analysis of WER shows that it is expressed in the epidermis of leaves, where FT is not expressed. Consistently, WER regulates not the transcription but the stability of FT mRNA. Our results reveal a novel regulatory mechanism of FT that is non cell autonomous.

  19. R-spondin 3 regulates dorsoventral and anteroposterior patterning by antagonizing Wnt/β-catenin signaling in zebrafish embryos.

    PubMed

    Rong, Xiaozhi; Chen, Chen; Zhou, Pin; Zhou, Yumei; Li, Yun; Lu, Ling; Liu, Yunzhang; Zhou, Jianfeng; Duan, Cunming

    2014-01-01

    The Wnt/β-catenin or canonical Wnt signaling pathway plays fundamental roles in early development and in maintaining adult tissue homeostasis. R-spondin 3 (Rspo3) is a secreted protein that has been implicated in activating the Wnt/β-catenin signaling in amphibians and mammals. Here we report that zebrafish Rspo3 plays a negative role in regulating the zygotic Wnt/β-catenin signaling. Zebrafish Rspo3 has a unique domain structure. It contains a third furin-like (FU3) domain. This FU3 is present in other four ray-finned fish species studied but not in elephant shark. In zebrafish, rspo3 mRNA is maternally deposited and has a ubiquitous expression in early embryonic stages. After 12 hpf, its expression becomes tissue-specific. Forced expression of rspo3 promotes dorsoanterior patterning and increases the expression of dorsal and anterior marker genes. Knockdown of rspo3 increases ventral-posterior development and stimulates ventral and posterior marker genes expression. Forced expression of rspo3 abolishes exogenous Wnt3a action and reduces the endogenous Wnt signaling activity. Knockdown of rspo3 results in increased Wnt/β-catenin signaling activity. Further analyses indicate that Rspo3 does not promote maternal Wnt signaling. Human RSPO3 has similar action when tested in zebrafish embryos. These results suggest that Rspo3 regulates dorsoventral and anteroposterior patterning by negatively regulating the zygotic Wnt/β-catenin signaling in zebrafish embryos.

  20. R-Spondin 3 Regulates Dorsoventral and Anteroposterior Patterning by Antagonizing Wnt/β-Catenin Signaling in Zebrafish Embryos

    PubMed Central

    Zhou, Pin; Zhou, Yumei; Li, Yun; Lu, Ling; Liu, Yunzhang; Zhou, Jianfeng; Duan, Cunming

    2014-01-01

    The Wnt/β-catenin or canonical Wnt signaling pathway plays fundamental roles in early development and in maintaining adult tissue homeostasis. R-spondin 3 (Rspo3) is a secreted protein that has been implicated in activating the Wnt/β-catenin signaling in amphibians and mammals. Here we report that zebrafish Rspo3 plays a negative role in regulating the zygotic Wnt/β-catenin signaling. Zebrafish Rspo3 has a unique domain structure. It contains a third furin-like (FU3) domain. This FU3 is present in other four ray-finned fish species studied but not in elephant shark. In zebrafish, rspo3 mRNA is maternally deposited and has a ubiquitous expression in early embryonic stages. After 12 hpf, its expression becomes tissue-specific. Forced expression of rspo3 promotes dorsoanterior patterning and increases the expression of dorsal and anterior marker genes. Knockdown of rspo3 increases ventral-posterior development and stimulates ventral and posterior marker genes expression. Forced expression of rspo3 abolishes exogenous Wnt3a action and reduces the endogenous Wnt signaling activity. Knockdown of rspo3 results in increased Wnt/β-catenin signaling activity. Further analyses indicate that Rspo3 does not promote maternal Wnt signaling. Human RSPO3 has similar action when tested in zebrafish embryos. These results suggest that Rspo3 regulates dorsoventral and anteroposterior patterning by negatively regulating the zygotic Wnt/β-catenin signaling in zebrafish embryos. PMID:24918770

  1. A comprehensive data mining study shows that most nuclear receptors act as newly proposed homeostasis-associated molecular pattern receptors.

    PubMed

    Wang, Luqiao; Nanayakkara, Gayani; Yang, Qian; Tan, Hongmei; Drummer, Charles; Sun, Yu; Shao, Ying; Fu, Hangfei; Cueto, Ramon; Shan, Huimin; Bottiglieri, Teodoro; Li, Ya-Feng; Johnson, Candice; Yang, William Y; Yang, Fan; Xu, Yanjie; Xi, Hang; Liu, Weiqing; Yu, Jun; Choi, Eric T; Cheng, Xiaoshu; Wang, Hong; Yang, Xiaofeng

    2017-10-24

    Nuclear receptors (NRs) can regulate gene expression; therefore, they are classified as transcription factors. Despite the extensive research carried out on NRs, still several issues including (1) the expression profile of NRs in human tissues, (2) how the NR expression is modulated during atherosclerosis and metabolic diseases, and (3) the overview of the role of NRs in inflammatory conditions are not fully understood. To determine whether and how the expression of NRs are regulated in physiological/pathological conditions, we took an experimental database analysis to determine expression of all 48 known NRs in 21 human and 17 murine tissues as well as in pathological conditions. We made the following significant findings: (1) NRs are differentially expressed in tissues, which may be under regulation by oxygen sensors, angiogenesis pathway, stem cell master regulators, inflammasomes, and tissue hypo-/hypermethylation indexes; (2) NR sequence mutations are associated with increased risks for development of cancers and metabolic, cardiovascular, and autoimmune diseases; (3) NRs have less tendency to be upregulated than downregulated in cancers, and autoimmune and metabolic diseases, which may be regulated by inflammation pathways and mitochondrial energy enzymes; and (4) the innate immune sensor inflammasome/caspase-1 pathway regulates the expression of most NRs. Based on our findings, we propose a new paradigm that most nuclear receptors are anti-inflammatory homeostasis-associated molecular pattern receptors (HAMPRs). Our results have provided a novel insight on NRs as therapeutic targets in metabolic diseases, inflammations, and malignancies.

  2. Differentiating Human Multipotent Mesenchymal Stromal Cells Regulate microRNAs: Prediction of microRNA Regulation by PDGF During Osteogenesis

    PubMed Central

    Goff, Loyal A.; Boucher, Shayne; Ricupero, Christopher L.; Fenstermacher, Sara; Swerdel, Mavis; Chase, Lucas; Adams, Christopher; Chesnut, Jonathan; Lakshmipathy, Uma; Hart, Ronald P.

    2009-01-01

    Objective Human multipotent mesenchymal stromal cells (MSC) have the potential to differentiate into multiple cell types, although little is known about factors that control their fate. Differentiation-specific microRNAs may play a key role in stem cell self renewal and differentiation. We propose that specific intracellular signalling pathways modulate gene expression during differentiation by regulating microRNA expression. Methods Illumina mRNA and NCode microRNA expression analyses were performed on MSC and their differentiated progeny. A combination of bioinformatic prediction and pathway inhibition was used to identify microRNAs associated with PDGF signalling. Results The pattern of microRNA expression in MSC is distinct from that in pluripotent stem cells such as human embryonic stem cells. Specific populations of microRNAs are regulated in MSC during differentiation targeted towards specific cell types. Complementary mRNA expression analysis increases the pool of markers characteristic of MSC or differentiated progeny. To identify microRNA expression patterns affected by signalling pathways, we examined the PDGF pathway found to be regulated during osteogenesis by microarray studies. A set of microRNAs bioinformatically predicted to respond to PDGF signalling was experimentally confirmed by direct PDGF inhibition. Conclusion Our results demonstrate that a subset of microRNAs regulated during osteogenic differentiation of MSCs is responsive to perturbation of the PDGF pathway. This approach not only identifies characteristic classes of differentiation-specific mRNAs and microRNAs, but begins to link regulated molecules with specific cellular pathways. PMID:18657893

  3. Distal-less regulates eyespot patterns and melanization in Bicyclus butterflies.

    PubMed

    Monteiro, Antónia; Chen, Bin; Ramos, Diane M; Oliver, Jeffrey C; Tong, Xiaoling; Guo, Min; Wang, Wen-Kai; Fazzino, Lisa; Kamal, Firdous

    2013-07-01

    Butterfly eyespots represent novel complex traits that display substantial diversity in number and size within and across species. Correlative gene expression studies have implicated a large suite of transcription factors, including Distal-less (Dll), Engrailed (En), and Spalt (Sal), in eyespot development in butterflies, but direct evidence testing the function of any of these proteins is still missing. Here we show that the characteristic two-eyespot pattern of wildtype Bicyclus anynana forewings is correlated with dynamic progression of Dll, En, and Sal expression in larval wings from four spots to two spots, whereas no such decline in gene expression ensues in a four-eyespot mutant. We then conduct transgenic experiments testing whether over-expression of any of these genes in a wild-type genetic background is sufficient to induce eyespot differentiation in these pre-patterned wing compartments. We also produce a Dll-RNAi transgenic line to test how Dll down-regulation affects eyespot development. Finally we test how ectopic expression of these genes during the pupal stages of development alters adults color patters. We show that over-expressing Dll in larvae is sufficient to induce the differentiation of additional eyespots and increase the size of eyespots, whereas down-regulating Dll leads to a decrease in eyespot size. Furthermore, ectopic expression of Dll in the early pupal wing led to the appearance of ectopic patches of black scales. We conclude that Dll is a positive regulator of focal differentiation and eyespot signaling and that this gene is also a possible selector gene for scale melanization in butterflies. Copyright © 2013 Wiley Periodicals, Inc.

  4. Honey Bee Aggression Supports a Link Between Gene Regulation and Behavioral Evolution

    USDA-ARS?s Scientific Manuscript database

    A prominent theory holds that animal phenotypes arise by evolutionary changes in the regulation of gene expression. Emerging from studies of animal development, evidence for this theory consists largely of differences in temporal or spatial patterns of gene expression that are related to morphologi...

  5. Mapping of Human FOXP2 Enhancers Reveals Complex Regulation.

    PubMed

    Becker, Martin; Devanna, Paolo; Fisher, Simon E; Vernes, Sonja C

    2018-01-01

    Mutations of the FOXP2 gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with FOXP2 mutations have structural and functional alterations affecting brain circuits that overlap with sites of FOXP2 expression, including regions of the cortex, striatum, and cerebellum. FOXP2 displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of FOXP2 or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human FOXP2 locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the FOXP2 promoter and enhancer regions by candidate regulators - FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human FOXP2 . Understanding the upstream regulatory pathways controlling FOXP2 expression will bring new insight into the molecular networks contributing to human language and related disorders.

  6. Mapping of Human FOXP2 Enhancers Reveals Complex Regulation

    PubMed Central

    Becker, Martin; Devanna, Paolo; Fisher, Simon E.; Vernes, Sonja C.

    2018-01-01

    Mutations of the FOXP2 gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with FOXP2 mutations have structural and functional alterations affecting brain circuits that overlap with sites of FOXP2 expression, including regions of the cortex, striatum, and cerebellum. FOXP2 displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of FOXP2 or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human FOXP2 locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the FOXP2 promoter and enhancer regions by candidate regulators – FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human FOXP2. Understanding the upstream regulatory pathways controlling FOXP2 expression will bring new insight into the molecular networks contributing to human language and related disorders. PMID:29515369

  7. The MADS transcription factor XAL2/AGL14 modulates auxin transport during Arabidopsis root development by regulating PIN expression

    PubMed Central

    Garay-Arroyo, Adriana; Ortiz-Moreno, Enrique; de la Paz Sánchez, María; Murphy, Angus S; García-Ponce, Berenice; Marsch-Martínez, Nayelli; de Folter, Stefan; Corvera-Poiré, Adriana; Jaimes-Miranda, Fabiola; Pacheco-Escobedo, Mario A; Dubrovsky, Joseph G; Pelaz, Soraya; Álvarez-Buylla, Elena R

    2013-01-01

    Elucidating molecular links between cell-fate regulatory networks and dynamic patterning modules is a key for understanding development. Auxin is important for plant patterning, particularly in roots, where it establishes positional information for cell-fate decisions. PIN genes encode plasma membrane proteins that serve as auxin efflux transporters; mutations in members of this gene family exhibit smaller roots with altered root meristems and stem-cell patterning. Direct regulators of PIN transcription have remained elusive. Here, we establish that a MADS-box gene (XAANTAL2, XAL2/AGL14) controls auxin transport via PIN transcriptional regulation during Arabidopsis root development; mutations in this gene exhibit altered stem-cell patterning, root meristem size, and root growth. XAL2 is necessary for normal shootward and rootward auxin transport, as well as for maintaining normal auxin distribution within the root. Furthermore, this MADS-domain transcription factor upregulates PIN1 and PIN4 by direct binding to regulatory regions and it is required for PIN4-dependent auxin response. In turn, XAL2 expression is regulated by auxin levels thus establishing a positive feedback loop between auxin levels and PIN regulation that is likely to be important for robust root patterning. PMID:24121311

  8. Plant twitter: ligands under 140 amino acids enforcing stomatal patterning.

    PubMed

    Rychel, Amanda L; Peterson, Kylee M; Torii, Keiko U

    2010-05-01

    Stomata are an essential land plant innovation whose patterning and density are under genetic and environmental control. Recently, several putative ligands have been discovered that influence stomatal density, and they all belong to the epidermal patterning factor-like family of secreted cysteine-rich peptides. Two of these putative ligands, EPF1 and EPF2, are expressed exclusively in the stomatal lineage cells and negatively regulate stomatal density. A third, EPFL6 or CHALLAH, is also a negative regulator of density, but is expressed subepidermally in the hypocotyl. A fourth, EPFL9 or STOMAGEN, is expressed in the mesophyll tissues and is a positive regulator of density. Genetic evidence suggests that these ligands may compete for the same receptor complex. Proper stomatal patterning is likely to be an intricate process involving ligand competition, regional specificity, and communication between tissue layers. EPFL-family genes exist in the moss Physcomitrella patens, the lycophyte Selaginella moellendorffii, and rice, Oryza sativa, and their sequence analysis yields several genes some of which are related to EPF1, EPF2, EPFL6, and EPFL9. Presence of these EPFL family members in the basal land plants suggests an exciting hypothesis that the genetic components for stomatal patterning originated early in land plant evolution.

  9. Systematic analysis of gene expression pattern in has-miR-197 over-expressed human uterine leiomyoma cells.

    PubMed

    Ling, Jing; Wu, Xiaoli; Fu, Ziyi; Tan, Jie; Xu, Qing

    2015-10-01

    Our previous study showed that the expression of miR-197 in leiomyoma was down-regulated compared with myometrium. Further, miR-197 has been identified to affect uterine leiomyoma cell proliferation, apoptosis, and metastasis ability, though the responsible molecular mechanism has not been well elucidated. In this study, we sought to determine the expression patterns of miR-197 targeted genes and to explore their potential functions, participating Pathways and the networks that are involved in the biological behavior of human uterine leiomyoma. After transfection of human uterine leiomyoma cells with miR-197, we confirmed the expression level of miR-197 using quantitative real-time PCR (qRT-PCR), and we detected the gene expression profiles after miR-197 over-expression through DNA microarray analysis. Further, we performed GO and Pathway analysis. The dominantly dys-regulated genes, which were up- or down-regulated by more than 10-fold, compared with parental cells, were confirmed using qRT-PCR technology. Compared with the control group, miR-197 was up-regulated by 30-fold after miR-197 lentiviral transfection. The microarray data showed that 872 genes were dys-regulated by more than 2-fold in human uterine leiomyoma cells after miR-197 overexpression, including 537 up-regulated and 335 down-regulated genes. The GO analysis indicated that the dys-regulated genes were primarily involved in response to stimuli, multicellular organ processes, and the signaling of biological progression. Further, Pathway analysis data showed that these genes participated in regulating several signaling Pathways, including the JAK/STAT signaling Pathway, the Toll-like receptor signaling Pathway, and cytokine-cytokine receptor interaction. The qRT-PCR results confirmed that 17 of the 66 selected genes, which were up- or down-regulated more than 10-fold by miR-197, were consistent with the microarray results, including tumorigenesis-related genes, such as DRT7, SLC549, SFMBT2, FLJ37956, FBLN2, C10orf35, HOXD12, CACNG7, and LOC100134279. Our study explored gene expression patterns after miR-197 overexpression and confirmed 17 dominantly dys-regulated genes, which could expand the insights into the function of miR-197 and the molecular mechanisms during the development and progression of uterine leiomyomas. This study might afford new clues for understanding the pathogenesis of uterine leiomyomas, and it could likely provide a unique method for diagnosing or predicting prognosis in the clinical treatment of leiomyoma. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  10. A gene expression profile indicative of early stage HER2 targeted therapy response.

    PubMed

    O'Neill, Fiona; Madden, Stephen F; Clynes, Martin; Crown, John; Doolan, Padraig; Aherne, Sinéad T; O'Connor, Robert

    2013-07-01

    Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor.Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents.

  11. A gene expression profile indicative of early stage HER2 targeted therapy response

    PubMed Central

    2013-01-01

    Background Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Results Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. Conclusions In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor. Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents. PMID:23816254

  12. Expression pattern analysis of IRF4 and its related genes revealed the functional differentiation of IRF4 paralogues in teleost.

    PubMed

    Ai, Kete; Luo, Kai; Li, Youshen; Hu, Wei; Gao, Weihua; Fang, Liu; Tian, Guangming; Ruan, Guoliang; Xu, Qiaoqing

    2017-01-01

    In mammals, interferon regulatory factor 4 (IRF4) plays an important role in the process of development and differentiation of B cells, T cells and dendritic cells. It can regulate immune pathway through IRF5, MyD88, IL21, PGC1α, and NOD2. In the present study, we investigated the expression pattern of IRF4 paralogues and these related genes for the first time in teleosts. The results showed that these genes were all expressed predominantly in known immune tissues while IRF5 was also relatively highly expressed in muscle. IRF4b, IL21, MyD88, IRF5 and NOD2 showed maternal expression in the oocyte and the higher expression of IRF4a, Mx and PGC1α before hatching might be involved in the embryonic innate defense system. Zebrafish embryonic fibroblast (ZF4) cells were infected with GCRV and SVCV. During GCRV infection, the expression of Mx was significantly up-regulated from 3 h to 24 h, reaching the highest level at 12 h (101.5-fold over the controls, P < 0.001). And the expression of IRF4a was significantly up-regulated from 3 h to 48 h, reaching the highest level at 12 h (13.75-fold over the controls, P < 0.001). While the expression of IRF4b was only slightly up-regulated at 12 h and 24 h (3.39-fold, 1.93-fold) above control levels, respectively. Whereas the expression of Mx was significantly up-regulated during SVCV infection from 1 h to 48 h, reaching the highest level at 24 h (11.49-fold over the controls, P < 0.001). IRF4a transcripts were significantly up-regulated from 6 h to 24 h, reaching the highest level at 24 h (41-fold over the controls, P < 0.01). IRF4b only showed a slightly up-regulation by SVCV at 24 h (3.2-fold over the controls, P < 0.01). IRF4a and IRF4b displayed a distinct tissue expression pattern, embryonic stages expression and inducible expression in vivo and in vitro, suggesting that IRF4 paralogues might play different roles in immune system. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. The miR172 target TOE3 represses AGAMOUS expression during Arabidopsis floral patterning.

    PubMed

    Jung, Jae-Hoon; Lee, Sangmin; Yun, Ju; Lee, Minyoung; Park, Chung-Mo

    2014-02-01

    microRNA172 (miR172) regulates phase transition and floral patterning in Arabidopsis by repressing targets that encode the APETALA2 (AP2) and AP2-like transcription factors. The miR172-mediated repression of the AP2 gene restricts AGAMOUS (AG) expression. In addition, most miR172 targets, including AP2, redundantly act as floral repressors, and the overexpression of the target genes causes delayed flowering. However, how miR172 targets other than AP2 regulate both of the developmental processes remains unclear. Here, we demonstrate that miR172-mediated repression of the TARGET OF EAT 3 (TOE3) gene is critical for floral patterning in Arabidopsis. Transgenic plants that overexpress a miR172-resistant TOE3 gene (rTOE3-ox) exhibit indeterminate flowers with numerous stamens and carpelloid organs, which is consistent with previous observations in transgenic plants that overexpress a miR172-resistant AP2 gene. TOE3 binds to the second intron of the AG gene. Accordingly, AG expression is significantly reduced in rTOE3-ox plants. TOE3 also interacts with AP2 in the nucleus. Given the major role of AP2 in floral patterning, miR172 likely regulates TOE3 in floral patterning, at least in part via AP2. In addition, a miR156 target SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 3 directly activates TOE3 expression, revealing a novel signaling interaction between miR156 and miR172 in floral patterning. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  14. Circadian Rhythms Regulate Amelogenesis

    PubMed Central

    Zheng, Li; Seon, Yoon Ji; Mourão, Marcio A.; Schnell, Santiago; Kim, Doohak; Harada, Hidemitsu; Papagerakis, Silvana; Papagerakis, Petros

    2013-01-01

    Ameloblasts, the cells responsible for making enamel, modify their morphological features in response to specialized functions necessary for synchronized ameloblast differentiation and enamel formation. Secretory and maturation ameloblasts are characterized by the expression of stage-specific genes which follows strictly controlled repetitive patterns. Circadian rhythms are recognized as key regulators of development and diseases of many tissues including bone. Our aim was to gain novel insights on the role of clock genes in enamel formation and to explore the potential links between circadian rhythms and amelogenesis. Our data shows definitive evidence that the main clock genes (Bmal1, Clock, Per1 and Per2) oscillate in ameloblasts at regular circadian (24h) intervals both at RNA and protein levels. This study also reveals that two markers of ameloblast differentiation i.e. amelogenin (Amelx; a marker of secretory ameloblasts) and kallikrein-related peptidase 4 (Klk4, a marker of maturation ameloblasts) are downstream targets of clock genes. Both, Amelx and Klk4 show 24h oscillatory expression patterns and their expression levels are up-regulated after Bmal1 over-expression in HAT-7 ameloblast cells. Taken together, these data suggest that both the secretory and the maturation stage of amelogenesis might be under circadian control. Changes in clock genes expression patterns might result in significant alterations of enamel apposition and mineralization. PMID:23486183

  15. Interactions between Bmp-4 and Msx-1 act to restrict gene expression to odontogenic mesenchyme.

    PubMed

    Tucker, A S; Al Khamis, A; Sharpe, P T

    1998-08-01

    Tooth development is regulated by a reciprocal series of epithelial-mesenchymal interactions. Bmp4 has been identified as a candidate signalling molecule in these interactions, initially as an epithelial signal and then later at the bud stage as a mesenchymal signal (Vainio et al. [1993] Cell 75:45-58). A target gene for Bmp4 signalling is the homeobox gene Msx-1, identified by the ability of recombinant Bmp4 protein to induce expression in mesenchyme. There is, however, no evidence that Bmp4 is the endogenous inducer of Msx-1 expression. Msx-1 and Bmp-4 show dynamic, interactive patterns of expression in oral epithelium and ectomesenchyme during the early stages of tooth development. In this study, we compare the temporal and spatial expression of these two genes to determine whether the changing expression patterns of these genes are consistent with interactions between the two molecules. We show that changes in Bmp-4 expression precede changes in Msx-1 expression. At embryonic day (E)10.5-E11.0, expression patterns are consistent with BMP4 from the epithelium, inducing or maintaining Msx-1 in underlying mesenchyme. At E11.5, Bmp-4 expression shifts from epithelium to mesenchyme and is rapidly followed by localised up-regulation of Msx-1 expression at the sites of Bmp-4 expression. Using cultured explants of developing mandibles, we confirm that exogenous BMP4 is capable of replacing the endogenous source in epithelium and inducing Msx-1 gene expression in mesenchyme. By using noggin, a BMP inhibitor, we show that endogenous Msx-1 expression can be inhibited at E10.5 and E11.5, providing the first evidence that endogenous Bmp-4 from the epithelium is responsible for regulating the early spatial expression of Msx-1. We also show that the mesenchymal shift in Bmp-4 is responsible for up-regulating Msx-1 specifically at the sites of future tooth formation. Thus, we establish that a reciprocal series of interactions act to restrict expression of both genes to future sites of tooth formation, creating a positive feedback loop that maintains expression of both genes in tooth mesenchymal cells.

  16. Differential Expression of MicroRNA and Predicted Targets in Pulmonary Sarcoidosis

    PubMed Central

    Crouser, Elliott D.; Julian, Mark W.; Crawford, Melissa; Shao, Guohong; Yu, Lianbo; Planck, Stephen R.; Rosenbaum, James T.; Nana-Sinkam, S. Patrick

    2014-01-01

    Background Recent studies show that various inflammatory diseases are regulated at the level of RNA translation by small non-coding RNAs, termed microRNAs (miRNAs). We sought to determine whether sarcoidosis tissues harbor a distinct pattern of miRNA expression and then considered their potential molecular targets. Methods and Results Genome-wide microarray analysis of miRNA expression in lung tissue and peripheral blood mononuclear cells (PBMCs) was performed and differentially expressed (DE)-miRNAs were then validated by real-time PCR. A distinct pattern of DE-miRNA expression was identified in both lung tissue and PBMCs of sarcoidosis patients. A subgroup of DE-miRNAs common to lung and lymph node tissues were predicted to target transforming growth factor (TGFβ)-regulated pathways. Likewise, the DE-miRNAs identified in PBMCs of sarcoidosis patients were predicted to target the TGFβ-regulated “wingless and integrase-1” (WNT) pathway. Conclusions This study is the first to profile miRNAs in sarcoidosis tissues and to consider their possible roles in disease pathogenesis. Our results suggest that miRNA regulate TGFβ and related WNT pathways in sarcoidosis tissues, pathways previously incriminated in the pathogenesis of sarcoidosis. PMID:22209793

  17. WEREWOLF, a MYB-related protein in Arabidopsis, is a position-dependent regulator of epidermal cell patterning.

    PubMed

    Lee, M M; Schiefelbein, J

    1999-11-24

    The formation of the root epidermis of Arabidopsis provides a simple and elegant model for the analysis of cell patterning. A novel gene, WEREWOLF (WER), is described here that is required for position-dependent patterning of the epidermal cell types. The WER gene encodes a MYB-type protein and is preferentially expressed within cells destined to adopt the non-hair fate. Furthermore, WER is shown to regulate the position-dependent expression of the GLABRA2 homeobox gene, to interact with a bHLH protein, and to act in opposition to the CAPRICE MYB. These results suggest a simple model to explain the specification of the two root epidermal cell types, and they provide insight into the molecular mechanisms used to control cell patterning.

  18. Regulatory analysis of the mouse Hoxb3 gene: multiple elements work in concert to direct temporal and spatial patterns of expression.

    PubMed

    Kwan, C T; Tsang, S L; Krumlauf, R; Sham, M H

    2001-04-01

    The expression pattern of the mouse Hoxb3 gene is exceptionally complex and dynamic compared with that of other members of the Hoxb cluster. There are multiple types of transcripts for Hoxb3 gene, and the anterior boundaries of its expression vary at different stages of development. Two enhancers flanking Hoxb3 on the 3' and 5' sides regulate Hoxb2 and Hoxb4, respectively, and these control regions define the two ends of a 28-kb interval in and around the Hoxb3 locus. To assay the regulatory potential of DNA fragments in this interval we have used transgenic analysis with a lacZ reporter gene to locate cis-elements for directing the dynamic patterns of Hoxb3 expression. Our detailed analysis has identified four new and widely spaced cis-acting regulatory regions that can together account for major aspects of the Hoxb3 expression pattern. Elements Ib, IIIa, and IVb control gene expression in neural and mesodermal tissues; element Va controls mesoderm-specific gene expression. The most anterior neural expression domain of Hoxb3 is controlled by an r5 enhancer (element IVa); element IIIa directs reporter expression in the anterior spinal cord and hindbrain up to r6, and the region A enhancer (in element I) mediates posterior neural expression. Hence, the regulation of segmental expression of Hoxb3 in the hindbrain is different from that of Hoxa3, as two separate enhancer elements contribute to expression in r5 and r6. The mesoderm-specific element (Va) directs reporter expression to prevertebra C1 at 12.5 dpc, which is the anterior limit of paraxial mesoderm expression for Hoxb3. When tested in combinations, these cis-elements appear to work as modules in an additive manner to recapitulate the major endogenous expression patterns of Hoxb3 during embryogenesis. Together our study shows that multiple control elements direct reporter gene expression in diverse tissue-, temporal-, and spatially restricted subset of the endogenous Hoxb3 expression domains and work in concert to control the neural and mesodermal patterns of expression. Copyright 2001 Academic Press.

  19. RNA splicing and splicing regulator changes in prostate cancer pathology.

    PubMed

    Munkley, Jennifer; Livermore, Karen; Rajan, Prabhakar; Elliott, David J

    2017-09-01

    Changes in mRNA splice patterns have been associated with key pathological mechanisms in prostate cancer progression. The androgen receptor (abbreviated AR) transcription factor is a major driver of prostate cancer pathology and activated by androgen steroid hormones. Selection of alternative promoters by the activated AR can critically alter gene function by switching mRNA isoform production, including creating a pro-oncogenic isoform of the normally tumour suppressor gene TSC2. A number of androgen-regulated genes generate alternatively spliced mRNA isoforms, including a prostate-specific splice isoform of ST6GALNAC1 mRNA. ST6GALNAC1 encodes a sialyltransferase that catalyses the synthesis of the cancer-associated sTn antigen important for cell mobility. Genetic rearrangements occurring early in prostate cancer development place ERG oncogene expression under the control of the androgen-regulated TMPRSS2 promoter to hijack cell behaviour. This TMPRSS2-ERG fusion gene shows different patterns of alternative splicing in invasive versus localised prostate cancer. Alternative AR mRNA isoforms play a key role in the generation of prostate cancer drug resistance, by providing a mechanism through which prostate cancer cells can grow in limited serum androgen concentrations. A number of splicing regulator proteins change expression patterns in prostate cancer and may help drive key stages of disease progression. Up-regulation of SRRM4 establishes neuronal splicing patterns in neuroendocrine prostate cancer. The splicing regulators Sam68 and Tra2β increase expression in prostate cancer. The SR protein kinase SRPK1 that modulates the activity of SR proteins is up-regulated in prostate cancer and has already given encouraging results as a potential therapeutic target in mouse models.

  20. A quantitative validated model reveals two phases of transcriptional regulation for the gap gene giant in Drosophila.

    PubMed

    Hoermann, Astrid; Cicin-Sain, Damjan; Jaeger, Johannes

    2016-03-15

    Understanding eukaryotic transcriptional regulation and its role in development and pattern formation is one of the big challenges in biology today. Most attempts at tackling this problem either focus on the molecular details of transcription factor binding, or aim at genome-wide prediction of expression patterns from sequence through bioinformatics and mathematical modelling. Here we bridge the gap between these two complementary approaches by providing an integrative model of cis-regulatory elements governing the expression of the gap gene giant (gt) in the blastoderm embryo of Drosophila melanogaster. We use a reverse-engineering method, where mathematical models are fit to quantitative spatio-temporal reporter gene expression data to infer the regulatory mechanisms underlying gt expression in its anterior and posterior domains. These models are validated through prediction of gene expression in mutant backgrounds. A detailed analysis of our data and models reveals that gt is regulated by domain-specific CREs at early stages, while a late element drives expression in both the anterior and the posterior domains. Initial gt expression depends exclusively on inputs from maternal factors. Later, gap gene cross-repression and gt auto-activation become increasingly important. We show that auto-regulation creates a positive feedback, which mediates the transition from early to late stages of regulation. We confirm the existence and role of gt auto-activation through targeted mutagenesis of Gt transcription factor binding sites. In summary, our analysis provides a comprehensive picture of spatio-temporal gene regulation by different interacting enhancer elements for an important developmental regulator. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Focal exposure of limited lung volumes to high-dose irradiation down-regulated organ development-related functions and up-regulated the immune response in mouse pulmonary tissues.

    PubMed

    Kim, Bu-Yeo; Jin, Hee; Lee, Yoon-Jin; Kang, Ga-Young; Cho, Jaeho; Lee, Yun-Sil

    2016-01-27

    Despite the emergence of stereotactic body radiotherapy (SBRT) for treatment of medically inoperable early-stage non-small-cell lung cancer patients, the molecular effects of focal exposure of limited lung volumes to high-dose radiation have not been fully characterized. This study was designed to identify molecular changes induced by focal high-dose irradiation using a mouse model of SBRT. Central areas of the mouse left lung were focally-irradiated (3 mm in diameter) with a single high-dose of radiation (90 Gy). Temporal changes in gene expression in the irradiated and non-irradiated neighboring lung regions were analyzed by microarray. For comparison, the long-term effect (12 months) of 20 Gy radiation on a diffuse region of lung was also measured. The majority of genes were down-regulated in the focally-irradiated lung areas at 2 to 3 weeks after irradiation. This pattern of gene expression was clearly different than gene expression in the diffuse region of lungs exposed to low-dose radiation. Ontological and pathway analyses indicated these down-regulated genes were mainly associated with organ development. Although the number was small, genes that were up-regulated after focal irradiation were associated with immune-related functions. The temporal patterns of gene expression and the associated biological functions were also similar in non-irradiated neighboring lung regions, although statistical significance was greatly reduced when compared with those from focally-irradiated areas of the lung. From network analysis of temporally regulated genes, we identified inter-related modules associated with diverse functions, including organ development and the immune response, in both the focally-irradiated regions and non-irradiated neighboring lung regions. Focal exposure of lung tissue to high-dose radiation induced expression of genes associated with organ development and the immune response. This pattern of gene expression was also observed in non-irradiated neighboring areas of lung tissue, indicating a global lung response to focal high-dose irradiation.

  2. Pattern-Recognition Receptor Signaling Regulator mRNA Expression in Humans and Mice, and in Transient Inflammation or Progressive Fibrosis

    PubMed Central

    Günthner, Roman; Kumar, Vankayala Ramaiah Santhosh; Lorenz, Georg; Anders, Hans-Joachim; Lech, Maciej

    2013-01-01

    The cell type-, organ-, and species-specific expression of the pattern-recognition receptors (PRRs) are well described but little is known about the respective expression profiles of their negative regulators. We therefore determined the mRNA expression levels of A20, CYLD, DUBA, ST2, CD180, SIGIRR, TANK, SOCS1, SOCS3, SHIP, IRAK-M, DOK1, DOK2, SHP1, SHP2, TOLLIP, IRF4, SIKE, NLRX1, ERBIN, CENTB1, and Clec4a2 in human and mouse solid organs. Humans and mice displayed significant differences between their respective mRNA expression patterns of these factors. Additionally, we characterized their expression profiles in mononuclear blood cells upon bacterial endotoxin, which showed a consistent induction of A20, SOCS3, IRAK-M, and Clec4a2 in human and murine cells. Furthermore, we studied the expression pattern in transient kidney ischemia-reperfusion injury versus post-ischemic atrophy and fibrosis in mice. A20, CD180, ST2, SOCS1, SOCS3, SHIP, IRAK-M, DOK1, DOK2, IRF4, CENTB1, and Clec4a2 were all induced, albeit at different times of injury and repair. Progressive fibrosis was associated with a persistent induction of these factors. Thus, the organ- and species-specific expression patterns need to be considered in the design and interpretation of studies related to PRR-mediated innate immunity, which seems to be involved in tissue injury, tissue regeneration and in progressive tissue scarring. PMID:24009023

  3. Structure and transcriptional regulation of the major intrinsic protein gene family in grapevine.

    PubMed

    Wong, Darren Chern Jan; Zhang, Li; Merlin, Isabelle; Castellarin, Simone D; Gambetta, Gregory A

    2018-04-11

    The major intrinsic protein (MIP) family is a family of proteins, including aquaporins, which facilitate water and small molecule transport across plasma membranes. In plants, MIPs function in a huge variety of processes including water transport, growth, stress response, and fruit development. In this study, we characterize the structure and transcriptional regulation of the MIP family in grapevine, describing the putative genome duplication events leading to the family structure and characterizing the family's tissue and developmental specific expression patterns across numerous preexisting microarray and RNAseq datasets. Gene co-expression network (GCN) analyses were carried out across these datasets and the promoters of each family member were analyzed for cis-regulatory element structure in order to provide insight into their transcriptional regulation. A total of 29 Vitis vinifera MIP family members (excluding putative pseudogenes) were identified of which all but two were mapped onto Vitis vinifera chromosomes. In this study, segmental duplication events were identified for five plasma membrane intrinsic protein (PIP) and four tonoplast intrinsic protein (TIP) genes, contributing to the expansion of PIPs and TIPs in grapevine. Grapevine MIP family members have distinct tissue and developmental expression patterns and hierarchical clustering revealed two primary groups regardless of the datasets analyzed. Composite microarray and RNA-seq gene co-expression networks (GCNs) highlighted the relationships between MIP genes and functional categories involved in cell wall modification and transport, as well as with other MIPs revealing a strong co-regulation within the family itself. Some duplicated MIP family members have undergone sub-functionalization and exhibit distinct expression patterns and GCNs. Cis-regulatory element (CRE) analyses of the MIP promoters and their associated GCN members revealed enrichment for numerous CREs including AP2/ERFs and NACs. Combining phylogenetic analyses, gene expression profiling, gene co-expression network analyses, and cis-regulatory element enrichment, this study provides a comprehensive overview of the structure and transcriptional regulation of the grapevine MIP family. The study highlights the duplication and sub-functionalization of the family, its strong coordinated expression with genes involved in growth and transport, and the putative classes of TFs responsible for its regulation.

  4. Regulation of miRNA Processing and miRNA Mediated Gene Repression in Cancer

    PubMed Central

    Bajan, Sarah; Hutvagner, Gyorgy

    2014-01-01

    The majority of human protein-coding genes are predicted to be targets of miRNA-mediated post-transcriptional regulation. The widespread influence of miRNAs is illustrated by their essential roles in all biological processes. Regulated miRNA expression is essential for maintaining cellular differentiation; therefore alterations in miRNA expression patterns are associated with several diseases, including various cancers. High-throughput sequencing technologies revealed low level expressing miRNA isoforms, termed isomiRs. IsomiRs may differ in sequence, length, target preference and expression patterns from their parental miRNA and can arise from differences in miRNA biosynthesis, RNA editing, or SNPs inherent to the miRNA gene. The association between isomiR expression and disease progression is largely unknown. Misregulated miRNA expression is thought to contribute to the formation and/or progression of cancer. However, due to the diversity of targeted transcripts, miRNAs can function as both tumor-suppressor genes and oncogenes as defined by cellular context. Despite this, miRNA profiling studies concluded that the differential expression of particular miRNAs in diseased tissue could aid the diagnosis and treatment of some cancers. PMID:25069508

  5. Protein-DNA binding dynamics predict transcriptional response to nutrients in archaea.

    PubMed

    Todor, Horia; Sharma, Kriti; Pittman, Adrianne M C; Schmid, Amy K

    2013-10-01

    Organisms across all three domains of life use gene regulatory networks (GRNs) to integrate varied stimuli into coherent transcriptional responses to environmental pressures. However, inferring GRN topology and regulatory causality remains a central challenge in systems biology. Previous work characterized TrmB as a global metabolic transcription factor in archaeal extremophiles. However, it remains unclear how TrmB dynamically regulates its ∼100 metabolic enzyme-coding gene targets. Using a dynamic perturbation approach, we elucidate the topology of the TrmB metabolic GRN in the model archaeon Halobacterium salinarum. Clustering of dynamic gene expression patterns reveals that TrmB functions alone to regulate central metabolic enzyme-coding genes but cooperates with various regulators to control peripheral metabolic pathways. Using a dynamical model, we predict gene expression patterns for some TrmB-dependent promoters and infer secondary regulators for others. Our data suggest feed-forward gene regulatory topology for cobalamin biosynthesis. In contrast, purine biosynthesis appears to require TrmB-independent regulators. We conclude that TrmB is an important component for mediating metabolic modularity, integrating nutrient status and regulating gene expression dynamics alone and in concert with secondary regulators.

  6. EXPRESSION PATTERNS OF ESTROGEN RECEPTORS IN THE CENTRAL AUDITORY SYSTEM CHANGE IN PREPUBERTAL AND AGED MICE

    PubMed Central

    Charitidi, K.; Frisina, R. D.; Vasilyeva, O. N.; Zhu, X.; Canlon, B.

    2011-01-01

    Estrogens are important in the development, maintenance and physiology of the CNS. Several studies have shown their effects on the processing of hearing in both males and females, and these effects, in part, are thought to result from regulation of the transcription of genes via their classical estrogen receptor (ER) pathway. In order to understand the spatiotemporal changes that occur with age, we have studied the expression of ERs in the central auditory pathway in prepubertal and aged CBA mice with immunohistochemistry. In prepubertal mice a clear dichotomy was noted between the expression of ERα and ERβ. ERβ-positive neurons were found in the metencephalon whereas the majority of ERα was found in mesencephalon, diencephalon or the telencephalon. In the aged animals a different pattern of ER expression was found in terms of location and overall intensity. These age-induced changes in the expression pattern were generally not uniform, suggesting that region-specific mechanisms regulate the ERs’ age-related expression. Neither the prepubertal nor the aged animals showed sex differences in any auditory structure. Our results demonstrate different age-dependent spatial and temporal changes in the pattern of expression of ERα and ERβ, suggesting that each ER type may be involved in distinct roles across the central auditory pathway in different periods of maturation. PMID:20736049

  7. Microarray identification of novel genes downstream of Six1, a critical factor in cranial placode, somite and kidney development

    PubMed Central

    Yan, Bo; Neilson, Karen M.; Ranganathan, Ramya; Maynard, Thomas; Streit, Andrea; Moody, Sally A.

    2014-01-01

    Background Six1 plays an important role in the development of several vertebrate organs, including cranial sensory placodes, somites and kidney. Although Six1 mutations cause one form of Branchio-Otic Syndrome (BOS), the responsible gene in many patients has not been identified; genes that act downstream of Six1 are potential BOS candidates. Results We sought to identify novel genes expressed during placode, somite and kidney development by comparing gene expression between control and Six1-expressing ectodermal explants. The expression patterns of 19 of the significantly up-regulated and 11 of the significantly down-regulated genes were assayed from cleavage to larval stages. 28/30 genes are expressed in the otocyst, a structure that is functionally disrupted in BOS, and 26/30 genes are expressed in the nephric mesoderm, a structure that is functionally disrupted in the related Branchio-Otic-Renal (BOR) syndrome. We also identified the chick homologues of 5 genes and show that they have conserved expression patterns. Conclusions Of the 30 genes selected for expression analyses, all are expressed at many of the developmental times and appropriate tissues to be regulated by Six1. Many have the potential to play a role in the disruption of hearing and kidney function seen in BOS/BOR patients. PMID:25403746

  8. Characterisation and expression of microRNAs in developing wings of the neotropical butterfly Heliconius melpomene

    PubMed Central

    2011-01-01

    Background Heliconius butterflies are an excellent system for studies of adaptive convergent and divergent phenotypic traits. Wing colour patterns are used as signals to both predators and potential mates and are inherited in a Mendelian manner. The underlying genetic mechanisms of pattern formation have been studied for many years and shed light on broad issues, such as the repeatability of evolution. In Heliconius melpomene, the yellow hindwing bar is controlled by the HmYb locus. MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that have key roles in many biological processes, including development. miRNAs could act as regulators of genes involved in wing development, patterning and pigmentation. For this reason we characterised miRNAs in developing butterfly wings and examined differences in their expression between colour pattern races. Results We sequenced small RNA libraries from two colour pattern races and detected 142 Heliconius miRNAs with homology to others found in miRBase. Several highly abundant miRNAs were differentially represented in the libraries between colour pattern races. These candidates were tested further using Northern blots, showing that differences in expression were primarily due to developmental stage rather than colour pattern. Assembly of sequenced reads to the HmYb region identified hme-miR-193 and hme-miR-2788; located 2380 bp apart in an intergenic region. These two miRNAs are expressed in wings and show an upregulation between 24 and 72 hours post-pupation, indicating a potential role in butterfly wing development. A search for miRNAs in all available H. melpomene BAC sequences (~ 2.5 Mb) did not reveal any other miRNAs and no novel miRNAs were predicted. Conclusions Here we describe the first butterfly miRNAs and characterise their expression in developing wings. Some show differences in expression across developing pupal stages and may have important functions in butterfly wing development. Two miRNAs were located in the HmYb region and were expressed in developing pupal wings. Future work will examine the expression of these miRNAs in different colour pattern races and identify miRNA targets among wing patterning genes. PMID:21266089

  9. Characterisation and expression of microRNAs in developing wings of the neotropical butterfly Heliconius melpomene.

    PubMed

    Surridge, Alison K; Lopez-Gomollon, Sara; Moxon, Simon; Maroja, Luana S; Rathjen, Tina; Nadeau, Nicola J; Dalmay, Tamas; Jiggins, Chris D

    2011-01-26

    Heliconius butterflies are an excellent system for studies of adaptive convergent and divergent phenotypic traits. Wing colour patterns are used as signals to both predators and potential mates and are inherited in a Mendelian manner. The underlying genetic mechanisms of pattern formation have been studied for many years and shed light on broad issues, such as the repeatability of evolution. In Heliconius melpomene, the yellow hindwing bar is controlled by the HmYb locus. MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that have key roles in many biological processes, including development. miRNAs could act as regulators of genes involved in wing development, patterning and pigmentation. For this reason we characterised miRNAs in developing butterfly wings and examined differences in their expression between colour pattern races. We sequenced small RNA libraries from two colour pattern races and detected 142 Heliconius miRNAs with homology to others found in miRBase. Several highly abundant miRNAs were differentially represented in the libraries between colour pattern races. These candidates were tested further using Northern blots, showing that differences in expression were primarily due to developmental stage rather than colour pattern. Assembly of sequenced reads to the HmYb region identified hme-miR-193 and hme-miR-2788; located 2380 bp apart in an intergenic region. These two miRNAs are expressed in wings and show an upregulation between 24 and 72 hours post-pupation, indicating a potential role in butterfly wing development. A search for miRNAs in all available H. melpomene BAC sequences (~2.5 Mb) did not reveal any other miRNAs and no novel miRNAs were predicted. Here we describe the first butterfly miRNAs and characterise their expression in developing wings. Some show differences in expression across developing pupal stages and may have important functions in butterfly wing development. Two miRNAs were located in the HmYb region and were expressed in developing pupal wings. Future work will examine the expression of these miRNAs in different colour pattern races and identify miRNA targets among wing patterning genes.

  10. System Biology Approach: Gene Network Analysis for Muscular Dystrophy.

    PubMed

    Censi, Federica; Calcagnini, Giovanni; Mattei, Eugenio; Giuliani, Alessandro

    2018-01-01

    Phenotypic changes at different organization levels from cell to entire organism are associated to changes in the pattern of gene expression. These changes involve the entire genome expression pattern and heavily rely upon correlation patterns among genes. The classical approach used to analyze gene expression data builds upon the application of supervised statistical techniques to detect genes differentially expressed among two or more phenotypes (e.g., normal vs. disease). The use of an a posteriori, unsupervised approach based on principal component analysis (PCA) and the subsequent construction of gene correlation networks can shed a light on unexpected behaviour of gene regulation system while maintaining a more naturalistic view on the studied system.In this chapter we applied an unsupervised method to discriminate DMD patient and controls. The genes having the highest absolute scores in the discrimination between the groups were then analyzed in terms of gene expression networks, on the basis of their mutual correlation in the two groups. The correlation network structures suggest two different modes of gene regulation in the two groups, reminiscent of important aspects of DMD pathogenesis.

  11. Defining global neuroendocrine gene expression patterns associated with reproductive seasonality in fish.

    PubMed

    Zhang, Dapeng; Xiong, Huiling; Mennigen, Jan A; Popesku, Jason T; Marlatt, Vicki L; Martyniuk, Christopher J; Crump, Kate; Cossins, Andrew R; Xia, Xuhua; Trudeau, Vance L

    2009-06-05

    Many vertebrates, including the goldfish, exhibit seasonal reproductive rhythms, which are a result of interactions between external environmental stimuli and internal endocrine systems in the hypothalamo-pituitary-gonadal axis. While it is long believed that differential expression of neuroendocrine genes contributes to establishing seasonal reproductive rhythms, no systems-level investigation has yet been conducted. In the present study, by analyzing multiple female goldfish brain microarray datasets, we have characterized global gene expression patterns for a seasonal cycle. A core set of genes (873 genes) in the hypothalamus were identified to be differentially expressed between May, August and December, which correspond to physiologically distinct stages that are sexually mature (prespawning), sexual regression, and early gonadal redevelopment, respectively. Expression changes of these genes are also shared by another brain region, the telencephalon, as revealed by multivariate analysis. More importantly, by examining one dataset obtained from fish in October who were kept under long-daylength photoperiod (16 h) typical of the springtime breeding season (May), we observed that the expression of identified genes appears regulated by photoperiod, a major factor controlling vertebrate reproductive cyclicity. Gene ontology analysis revealed that hormone genes and genes functionally involved in G-protein coupled receptor signaling pathway and transmission of nerve impulses are significantly enriched in an expression pattern, whose transition is located between prespawning and sexually regressed stages. The existence of seasonal expression patterns was verified for several genes including isotocin, ependymin II, GABA(A) gamma2 receptor, calmodulin, and aromatase b by independent samplings of goldfish brains from six seasonal time points and real-time PCR assays. Using both theoretical and experimental strategies, we report for the first time global gene expression patterns throughout a breeding season which may account for dynamic neuroendocrine regulation of seasonal reproductive development.

  12. Defining Global Neuroendocrine Gene Expression Patterns Associated with Reproductive Seasonality in Fish

    PubMed Central

    Mennigen, Jan A.; Popesku, Jason T.; Marlatt, Vicki L.; Martyniuk, Christopher J.; Crump, Kate; Cossins, Andrew R.; Xia, Xuhua; Trudeau, Vance L.

    2009-01-01

    Background Many vertebrates, including the goldfish, exhibit seasonal reproductive rhythms, which are a result of interactions between external environmental stimuli and internal endocrine systems in the hypothalamo-pituitary-gonadal axis. While it is long believed that differential expression of neuroendocrine genes contributes to establishing seasonal reproductive rhythms, no systems-level investigation has yet been conducted. Methodology/Principal Findings In the present study, by analyzing multiple female goldfish brain microarray datasets, we have characterized global gene expression patterns for a seasonal cycle. A core set of genes (873 genes) in the hypothalamus were identified to be differentially expressed between May, August and December, which correspond to physiologically distinct stages that are sexually mature (prespawning), sexual regression, and early gonadal redevelopment, respectively. Expression changes of these genes are also shared by another brain region, the telencephalon, as revealed by multivariate analysis. More importantly, by examining one dataset obtained from fish in October who were kept under long-daylength photoperiod (16 h) typical of the springtime breeding season (May), we observed that the expression of identified genes appears regulated by photoperiod, a major factor controlling vertebrate reproductive cyclicity. Gene ontology analysis revealed that hormone genes and genes functionally involved in G-protein coupled receptor signaling pathway and transmission of nerve impulses are significantly enriched in an expression pattern, whose transition is located between prespawning and sexually regressed stages. The existence of seasonal expression patterns was verified for several genes including isotocin, ependymin II, GABAA gamma2 receptor, calmodulin, and aromatase b by independent samplings of goldfish brains from six seasonal time points and real-time PCR assays. Conclusions/Significance Using both theoretical and experimental strategies, we report for the first time global gene expression patterns throughout a breeding season which may account for dynamic neuroendocrine regulation of seasonal reproductive development. PMID:19503831

  13. Histone methylation at gene promoters is associated with developmental regulation and region-specific expression of ionotropic and metabotropic glutamate receptors in human brain.

    PubMed

    Stadler, Florian; Kolb, Gabriele; Rubusch, Lothar; Baker, Stephen P; Jones, Edward G; Akbarian, Schahram

    2005-07-01

    Glutamatergic signaling is regulated, in part, through differential expression of NMDA and AMPA/KA channel subunits and G protein-coupled metabotropic receptors. In human brain, region-specific expression patterns of glutamate receptor genes are maintained over the course of decades, suggesting a role for molecular mechanisms involved in long-term regulation of transcription, including methylation of lysine residues at histone N-terminal tails. Using a native chromatin immunoprecipitation assay, we studied histone methylation marks at proximal promoters of 16 ionotropic and metabotropic glutamate receptor genes (GRIN1,2A-D; GRIA1,3,4; GRIK2,4,5; GRM1,3,4,6,7 ) in cerebellar cortex collected across a wide age range from midgestation to 90 years old. Levels of di- and trimethylated histone H3-lysine 4, which are associated with open chromatin and transcription, showed significant differences between promoters and a robust correlation with corresponding mRNA levels in immature and mature cerebellar cortex. In contrast, levels of trimethylated H3-lysine 27 and H4-lysine 20, two histone modifications defining silenced or condensed chromatin, did not correlate with transcription but were up-regulated overall in adult cerebellum. Furthermore, differential gene expression patterns in prefrontal and cerebellar cortex were reflected by similar differences in H3-lysine 4 methylation at promoters. Together, these findings suggest that histone lysine methylation at gene promoters is involved in developmental regulation and maintenance of region-specific expression patterns of ionotropic and metabotropic glutamate receptors. The association of a specific epigenetic mark, H3-(methyl)-lysine 4, with the molecular architecture of glutamatergic signaling in human brain has potential implications for schizophrenia and other disorders with altered glutamate receptor function.

  14. Embryonic control of epidermal cell patterning in the root and hypocotyl of Arabidopsis.

    PubMed

    Lin, Y; Schiefelbein, J

    2001-10-01

    A position-dependent pattern of epidermal cell types is produced during the development of the Arabidopsis seedling root and hypocotyl. To understand the origin and regulation of this patterning mechanism, we have examined the embryonic expression of the GLABRA2 (GL2) gene, which encodes a cell-type-specific transcription factor. Using in situ RNA hybridization and a sensitive GL2::GFP reporter, we discovered that a position-dependent pattern of GL2 expression is established within protodermal cells at the heart stage and is maintained throughout the remainder of embryogenesis. In addition, we show that an exceptional GL2 expression character and epidermal cell pattern arises during development of the root-hypocotyl junction, which represents an anatomical transition zone. Furthermore, we find that two of the genes regulating seedling epidermal patterning, TRANSPARENT TESTA GLABRA (TTG) and WEREWOLF (WER), also control the embryonic GL2 pattern, whereas the CAPRICE (CPC) and GL2 genes are not required to establish this pattern. These results indicate that position-dependent patterning of epidermal cell types begins at an early stage of embryogenesis, before formation of the apical meristems and shortly after the cellular anatomy of the protoderm and outer ground tissue layer is established. Thus, epidermal cell specification in the Arabidopsis seedling relies on the embryonic establishment of a patterning mechanism that is perpetuated postembryonically.

  15. Gene expression profiling in Ishikawa cells: A fingerprint for estrogen active compounds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boehme, Kathleen; Simon, Stephanie; Mueller, Stefan O.

    2009-04-01

    Several anthropogenous and naturally occurring substances, referred to as estrogen active compounds (EACs), are able to interfere with hormone and in particular estrogen receptor signaling. EACs can either cause adverse health effects in humans and wildlife populations or have beneficial effects on estrogen-dependent diseases. The aim of this study was to examine global gene expression profiles in estrogen receptor (ER)-proficient Ishikawa plus and ER-deficient Ishikawa minus endometrial cancer cells treated with selected well-known EACs (Diethylstilbestrol, Genistein, Zearalenone, Resveratrol, Bisphenol A and o,p'-DDT). We also investigated the effect of the pure antiestrogen ICI 182,780 (ICI) on the expression patterns caused bymore » these compounds. Transcript levels were quantified 24 h after compound treatment using Illumina BeadChip Arrays. We identified 87 genes with similar expression changes in response to all EAC treatments in Ishikawa plus. ICI lowered the magnitude or reversed the expression of these genes, indicating ER dependent regulation. Apart from estrogenic gene regulation, Bisphenol A, o,p'-DDT, Zearalenone, Genistein and Resveratrol displayed similarities to ICI in their expression patterns, suggesting mixed estrogenic/antiestrogenic properties. In particular, the predominant antiestrogenic expression response of Resveratrol could be clearly distinguished from the other test compounds, indicating a distinct mechanism of action. Divergent gene expression patterns of the phytoestrogens, as well as weaker estrogenic gene expression regulation determined for the anthropogenous chemicals Bisphenol A and o,p'-DDT, warrants a careful assessment of potential detrimental and/or beneficial effects of EACs. The characteristic expression fingerprints and the identified subset of putative marker genes can be used for screening chemicals with an unknown mode of action and for predicting their potential to exert endocrine disrupting effects.« less

  16. Opposing Functions of the ETS Factor Family Define Shh Spatial Expression in Limb Buds and Underlie Polydactyly

    PubMed Central

    Lettice, Laura A.; Williamson, Iain; Wiltshire, John H.; Peluso, Silvia; Devenney, Paul S.; Hill, Alison E.; Essafi, Abdelkader; Hagman, James; Mort, Richard; Grimes, Graeme; DeAngelis, Carlo L.; Hill, Robert E.

    2012-01-01

    Summary Sonic hedgehog (Shh) expression during limb development is crucial for specifying the identity and number of digits. The spatial pattern of Shh expression is restricted to a region called the zone of polarizing activity (ZPA), and this expression is controlled from a long distance by the cis-regulator ZRS. Here, members of two groups of ETS transcription factors are shown to act directly at the ZRS mediating a differential effect on Shh, defining its spatial expression pattern. Occupancy at multiple GABPα/ETS1 sites regulates the position of the ZPA boundary, whereas ETV4/ETV5 binding restricts expression outside the ZPA. The ETS gene family is therefore attributed with specifying the boundaries of the classical ZPA. Two point mutations within the ZRS change the profile of ETS binding and activate Shh expression at an ectopic site in the limb bud. These molecular changes define a pathogenetic mechanism that leads to preaxial polydactyly (PPD). PMID:22340503

  17. Regulation of Development and Nitrogen Fixation in Anabaena

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    James W. Golden

    2008-10-17

    The regulation of development and cellular differentiation is important for all multicellular organisms. The nitrogen-fixing filamentous cyanobacterium Anabaena (also Nostoc) sp. PCC 7120 (hereafter Anabaena) provides a model of multicellular microbial development and pattern formation. Anabaena reduces N2 to ammonia in specialized terminally differentiated cells called heterocysts. A one-dimensional developmental pattern of single heterocysts regularly spaced along filaments of photosynthetic vegetative cells is established to form a multicellular organism composed of these two interdependent cell types. This multicellular growth pattern, the distinct phylogeny of cyanobacteria, and the suspected antiquity of heterocyst development make this an important model system. Our long-termmore » goal is to understand the regulatory network required for heterocyst development and nitrogen fixation. This project is focused on two key aspects of heterocyst regulation: one, the mechanism by which HetR controls the initiation of differentiation, and two, the cis and trans acting factors required for expression of the nitrogen-fixation (nif) genes. HetR is thought to be a central regulator of heterocyst development but the partners and mechanisms involved in this regulation are unknown. Our recent results indicate that PatS and other signals that regulate heterocyst pattern cannot interact, directly or indirectly, with a R223W mutant of HetR. We plan to use biochemical and genetic approaches to identify proteins that interact with the HetR protein, which will help reveal the mechanisms underlying its regulation of development. Our second goal is to determine how the nif genes are expressed. It is important to understand the mechanisms controlling nif genes since they represent the culmination of the differentiation process and the essence of heterocyst function. The Anabaena genome lacks the genes required for expression of nif genes present in other organisms such as rpoN (sigma 54) and nifA. We will use nifH-gfp reporter fusions to define the upstream sequences that are required for nifH expression and for genetic experiments to identify the trans-acting factors required for nifH regulation.« less

  18. Identification of new participants in the rainbow trout (Oncorhynchus mykiss) oocyte maturation and ovulation processes using cDNA microarrays

    PubMed Central

    Bobe, Julien; Montfort, Jerôme; Nguyen, Thaovi; Fostier, Alexis

    2006-01-01

    Background The hormonal control of oocyte maturation and ovulation as well as the molecular mechanisms of nuclear maturation have been thoroughly studied in fish. In contrast, the other molecular events occurring in the ovary during post-vitellogenesis have received far less attention. Methods Nylon microarrays displaying 9152 rainbow trout cDNAs were hybridized using RNA samples originating from ovarian tissue collected during late vitellogenesis, post-vitellogenesis and oocyte maturation. Differentially expressed genes were identified using a statistical analysis. A supervised clustering analysis was performed using only differentially expressed genes in order to identify gene clusters exhibiting similar expression profiles. In addition, specific genes were selected and their preovulatory ovarian expression was analyzed using real-time PCR. Results From the statistical analysis, 310 differentially expressed genes were identified. Among those genes, 90 were up-regulated at the time of oocyte maturation while 220 exhibited an opposite pattern. After clustering analysis, 90 clones belonging to 3 gene clusters exhibiting the most remarkable expression patterns were kept for further analysis. Using real-time PCR analysis, we observed a strong up-regulation of ion and water transport genes such as aquaporin 4 (aqp4) and pendrin (slc26). In addition, a dramatic up-regulation of vasotocin (avt) gene was observed. Furthermore, angiotensin-converting-enzyme 2 (ace2), coagulation factor V (cf5), adam 22, and the chemokine cxcl14 genes exhibited a sharp up-regulation at the time of oocyte maturation. Finally, ovarian aromatase (cyp19a1) exhibited a dramatic down-regulation over the post-vitellogenic period while a down-regulation of Cytidine monophosphate-N-acetylneuraminic acid hydroxylase (cmah) was observed at the time of oocyte maturation. Conclusion We showed the over or under expression of more that 300 genes, most of them being previously unstudied or unknown in the fish preovulatory ovary. Our data confirmed the down-regulation of estrogen synthesis genes during the preovulatory period. In addition, the strong up-regulation of aqp4 and slc26 genes prior to ovulation suggests their participation in the oocyte hydration process occurring at that time. Furthermore, among the most up-regulated clones, several genes such as cxcl14, ace2, adam22, cf5 have pro-inflammatory, vasodilatory, proteolytics and coagulatory functions. The identity and expression patterns of those genes support the theory comparing ovulation to an inflammatory-like reaction. PMID:16872517

  19. Extensive circadian and light regulation of the transcriptome in the malaria mosquito Anopheles gambiae

    PubMed Central

    2013-01-01

    Background Mosquitoes exhibit 24 hr rhythms in flight activity, feeding, reproduction and development. To better understand the molecular basis for these rhythms in the nocturnal malaria vector Anopheles gambiae, we have utilized microarray analysis on time-of-day specific collections of mosquitoes over 48 hr to explore the coregulation of gene expression rhythms by the circadian clock and light, and compare these with the 24 hr rhythmic gene expression in the diurnal Aedes aegypti dengue vector mosquito. Results In time courses from An. gambiae head and body collected under light:dark cycle (LD) and constant dark (DD) conditions, we applied three algorithms that detect sinusoidal patterns and an algorithm that detects spikes in expression. This revealed across four experimental conditions 393 probes newly scored as rhythmic. These genes correspond to functions such as metabolic detoxification, immunity and nutrient sensing. This includes glutathione S-transferase GSTE5, whose expression pattern and chromosomal location are shared with other genes, suggesting shared chromosomal regulation; and pulsatile expression of the gene encoding CYP6M2, a cytochrome P450 that metabolizes pyrethroid insecticides. We explored the interaction of light and the circadian clock and highlight the regulation of odorant binding proteins (OBPs), important components of the olfactory system. We reveal that OBPs have unique expression patterns as mosquitoes make the transition from LD to DD conditions. We compared rhythmic expression between An. gambiae and Ae. aegypti heads collected under LD conditions using a single cosine fitting algorithm, and report distinct similarities and differences in the temporal regulation of genes involved in tRNA priming, the vesicular-type ATPase, olfaction and vision between the two species. Conclusions These data build on our previous analyses of time-of-day specific regulation of the An. gambiae transcriptome to reveal additional rhythmic genes, an improved understanding of the co-regulation of rhythms in gene expression by the circadian clock and by light, and an understanding of the time-of-day specific regulation of some of these rhythmic processes in comparison with a different species of mosquito. Improved understanding of biological timing at the molecular level that underlies key physiological aspects of mosquito vectors may prove to be important to successful implementation of established and novel insect control methods. PMID:23552056

  20. Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures

    PubMed Central

    Liu, Juan; Franks, Robert G.; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin;  (Jenny) Xiang, Qiu-Yun

    2013-01-01

    Background and Aims LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Methods Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT–PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. Key Results cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. Conclusions The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories. PMID:24052556

  1. Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures.

    PubMed

    Liu, Juan; Franks, Robert G; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun

    2013-11-01

    LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT-PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories.

  2. Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

    NASA Astrophysics Data System (ADS)

    Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf, Yvonne N.

    2017-02-01

    Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin.

  3. Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

    PubMed Central

    Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf , Yvonne N.

    2017-01-01

    Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin. PMID:28150704

  4. SHORT-ROOT regulates vascular patterning, but not apical meristematic activity in the Arabidopsis root through cytokinin homeostasis

    PubMed Central

    Hao, Yueling; Cui, Hongchang

    2012-01-01

    SHORT-ROOT (SHR) is a key regulator of radial patterning and stem-cell renewal in the Arabidopsis root. Although SHR is expressed in the stele, its function in the vascular tissue was not recognized until recently. In shr, the protoxylem is missing due to the loss of expression of microRNA165A (miR165A) and microRNA166B (miR165B). shr is also defective in lateral root formation, but the mechanism remains unclear. To dissect the SHR developmental pathway, we recently have identified its direct targets at the genome scale by chromatin immunoprecipitation followed by microarray analysis (ChIP-chip). In further studies, we have shown that SHR regulates cytokinin homeostasis through cytokinin oxidase 3 and that this role of SHR is critical to vascular patterning in the root. In this communication we report that SHR also regulates miR165A and miR166B indirectly through its effect on cytokinin homeostasis. Although cytokinin is inhibitory to root growth, the root-apical-meristem defect in shr was not alleviated by reduction of endogenous cytokinin. These results together suggest that SHR regulates vascular patterning, but not root apical meristematic activity, through cytokinin homeostasis. PMID:22476466

  5. Circadian rhythms regulate amelogenesis.

    PubMed

    Zheng, Li; Seon, Yoon Ji; Mourão, Marcio A; Schnell, Santiago; Kim, Doohak; Harada, Hidemitsu; Papagerakis, Silvana; Papagerakis, Petros

    2013-07-01

    Ameloblasts, the cells responsible for making enamel, modify their morphological features in response to specialized functions necessary for synchronized ameloblast differentiation and enamel formation. Secretory and maturation ameloblasts are characterized by the expression of stage-specific genes which follows strictly controlled repetitive patterns. Circadian rhythms are recognized as key regulators of the development and diseases of many tissues including bone. Our aim was to gain novel insights on the role of clock genes in enamel formation and to explore the potential links between circadian rhythms and amelogenesis. Our data shows definitive evidence that the main clock genes (Bmal1, Clock, Per1 and Per2) oscillate in ameloblasts at regular circadian (24 h) intervals both at RNA and protein levels. This study also reveals that the two markers of ameloblast differentiation i.e. amelogenin (Amelx; a marker of secretory stage ameloblasts) and kallikrein-related peptidase 4 (Klk4, a marker of maturation stage ameloblasts) are downstream targets of clock genes. Both, Amelx and Klk4 show 24h oscillatory expression patterns and their expression levels are up-regulated after Bmal1 over-expression in HAT-7 ameloblast cells. Taken together, these data suggest that both the secretory and the maturation stages of amelogenesis might be under circadian control. Changes in clock gene expression patterns might result in significant alterations of enamel apposition and mineralization. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. A Systematic Survey of Expression and Function of Zebrafish frizzled Genes

    PubMed Central

    Nikaido, Masataka; Law, Edward W. P.; Kelsh, Robert N.

    2013-01-01

    Wnt signaling is crucial for the regulation of numerous processes in development. Consistent with this, the gene families for both the ligands (Wnts) and receptors (Frizzleds) are very large. Surprisingly, while we have a reasonable understanding of the Wnt ligands likely to mediate specific Wnt-dependent processes, the corresponding receptors usually remain to be elucidated. Taking advantage of the zebrafish model's excellent genomic and genetic properties, we undertook a comprehensive analysis of the expression patterns of frizzled (fzd) genes in zebrafish. To explore their functions, we focused on testing their requirement in several developmental events known to be regulated by Wnt signaling, convergent extension movements of gastrulation, neural crest induction, and melanocyte specification. We found fourteen distinct fzd genes in the zebrafish genome. Systematic analysis of their expression patterns between 1-somite and 30 hours post-fertilization revealed complex, dynamic and overlapping expression patterns. This analysis demonstrated that only fzd3a, fzd9b, and fzd10 are expressed in the dorsal neural tube at stages corresponding to the timing of melanocyte specification. Surprisingly, however, morpholino knockdown of these, alone or in combination, gave no indication of reduction of melanocytes, suggesting the important involvement of untested fzds or another type of Wnt receptor in this process. Likewise, we found only fzd7b and fzd10 expressed at the border of the neural plate at stages appropriate for neural crest induction. However, neural crest markers were not reduced by knockdown of these receptors. Instead, these morpholino knockdown studies showed that fzd7a and fzd7b work co-operatively to regulate convergent extension movement during gastrulation. Furthermore, we show that the two fzd7 genes function together with fzd10 to regulate epiboly movements and mesoderm differentiation. PMID:23349976

  7. Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

    2015-04-15

    DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

  8. Expression Analysis of Stress-Related Genes in Kernels of Different Maize (Zea mays L.) Inbred Lines with Different Resistance to Aflatoxin Contamination

    PubMed Central

    Jiang, Tingbo; Zhou, Boru; Luo, Meng; Abbas, Hamed K.; Kemerait, Robert; Lee, Robert Dewey; Scully, Brian T.; Guo, Baozhu

    2011-01-01

    This research examined the expression patterns of 94 stress-related genes in seven maize inbred lines with differential expressions of resistance to aflatoxin contamination. The objective was to develop a set of genes/probes associated with resistance to A. flavus and/or aflatoxin contamination. Ninety four genes were selected from previous gene expression studies with abiotic stress to test the differential expression in maize lines, A638, B73, Lo964, Lo1016, Mo17, Mp313E, and Tex6, using real-time RT-PCR. Based on the relative-expression levels, the seven maize inbred lines clustered into two different groups. One group included B73, Lo1016 and Mo17, which had higher levels of aflatoxin contamination and lower levels of overall gene expression. The second group which included Tex6, Mp313E, Lo964 and A638 had lower levels of aflatoxin contamination and higher overall levels of gene expressions. A total of six “cross-talking” genes were identified between the two groups, which are highly expressed in the resistant Group 2 but down-regulated in susceptible Group 1. When further subjected to drought stress, Tex6 expressed more genes up-regulated and B73 has fewer genes up-regulated. The transcript patterns and interactions measured in these experiments indicate that the resistant mechanism is an interconnected process involving many gene products and transcriptional regulators, as well as various host interactions with environmental factors, particularly, drought and high temperature. PMID:22069724

  9. Extracellular matrix metalloproteinase inducer expression in the baboon endometrium: menstrual cycle and endometriosis

    PubMed Central

    Braundmeier, A G; Fazleabas, A T; Nowak, R A

    2016-01-01

    Extracellular matrix metalloproteinase inducer (EMMPRIN; BSG) regulates tissue remodeling through matrix metalloproteinases (MMPs). In human and non-human primates, endometrial remodeling is important for menstruation and the pathogenesis of endometriosis. We hypothesized that as in humans, BSG and MMPs are expressed in the endometrium of cycling baboons, and their expression is hormonally regulated by ovarian hormones, but endometriosis disrupts this regulation. BSG expression was evaluated in the baboon endometrium by q-PCR and immunohistochemistry. In the endometrium of control cycling animals, BSG mRNA levels were highest in late secretory stage tissue. BSG protein localized to glandular epithelial cells during the proliferative phase; whereas, secretory stage tissues expressed BSG in glandular and luminal epithelia with weak stromal staining. Several MMPs were differentially expressed throughout the menstrual cycle with the highest levels found during menstruation. In ovariectomized animals, BSG endometrial mRNA levels were highest with treatment of both estrogen and progesterone than that with only estrogen. Estrogen alone resulted in BSG protein localization primarily in the endometrial glandular epithelia, while estrogen and progesterone treatment displayed BSG protein localization in both the glandular and stromal cells. Exogenous hormone treatment resulted in differential expression patterns of all MMPs compared with the control cycling animals. In the eutopic endometrium of endometriotic animals, BSG mRNA levels and protein were elevated early but decreased later in disease progression. Endometriosis elevated the expression of all MMPs except MMP7 compared with the control animals. In baboons, BSG and MMP endometrial expression is regulated by both ovarian hormones, and their expression patterns are dysregulated in endometriotic animals. PMID:20841363

  10. Coordinated transcriptional regulation patterns associated with infertility phenotypes in men

    PubMed Central

    Ellis, Peter J I; Furlong, Robert A; Conner, Sarah J; Kirkman‐Brown, Jackson; Afnan, Masoud; Barratt, Christopher; Griffin, Darren K; Affara, Nabeel A

    2007-01-01

    Introduction Microarray gene‐expression profiling is a powerful tool for global analysis of the transcriptional consequences of disease phenotypes. Understanding the genetic correlates of particular pathological states is important for more accurate diagnosis and screening of patients, and thus for suggesting appropriate avenues of treatment. As yet, there has been little research describing gene‐expression profiling of infertile and subfertile men, and thus the underlying transcriptional events involved in loss of spermatogenesis remain unclear. Here we present the results of an initial screen of 33 patients with differing spermatogenic phenotypes. Methods Oligonucleotide array expression profiling was performed on testis biopsies for 33 patients presenting for testicular sperm extraction. Significantly regulated genes were selected using a mixed model analysis of variance. Principle components analysis and hierarchical clustering were used to interpret the resulting dataset with reference to the patient history, clinical findings and histological composition of the biopsies. Results Striking patterns of coordinated gene expression were found. The most significant contains multiple germ cell‐specific genes and corresponds to the degree of successful spermatogenesis in each patient, whereas a second pattern corresponds to inflammatory activity within the testis. Smaller‐scale patterns were also observed, relating to unique features of the individual biopsies. PMID:17496197

  11. Gene expression networks underlying ovarian development in wild largemouth bass (Micropterus salmoides).

    PubMed

    Martyniuk, Christopher J; Prucha, Melinda S; Doperalski, Nicholas J; Antczak, Philipp; Kroll, Kevin J; Falciani, Francesco; Barber, David S; Denslow, Nancy D

    2013-01-01

    Oocyte maturation in fish involves numerous cell signaling cascades that are activated or inhibited during specific stages of oocyte development. The objectives of this study were to characterize molecular pathways and temporal gene expression patterns throughout a complete breeding cycle in wild female largemouth bass to improve understanding of the molecular sequence of events underlying oocyte maturation. Transcriptomic analysis was performed on eight morphologically diverse stages of the ovary, including primary and secondary stages of oocyte growth, ovulation, and atresia. Ovary histology, plasma vitellogenin, 17β-estradiol, and testosterone were also measured to correlate with gene networks. Global expression patterns revealed dramatic differences across ovarian development, with 552 and 2070 genes being differentially expressed during both ovulation and atresia respectively. Gene set enrichment analysis (GSEA) revealed that early primary stages of oocyte growth involved increases in expression of genes involved in pathways of B-cell and T-cell receptor-mediated signaling cascades and fibronectin regulation. These pathways as well as pathways that included adrenergic receptor signaling, sphingolipid metabolism and natural killer cell activation were down-regulated at ovulation. At atresia, down-regulated pathways included gap junction and actin cytoskeleton regulation, gonadotrope and mast cell activation, and vasopressin receptor signaling and up-regulated pathways included oxidative phosphorylation and reactive oxygen species metabolism. Expression targets for luteinizing hormone signaling were low during vitellogenesis but increased 150% at ovulation. Other networks found to play a significant role in oocyte maturation included those with genes regulated by members of the TGF-beta superfamily (activins, inhibins, bone morphogenic protein 7 and growth differentiation factor 9), neuregulin 1, retinoid X receptor, and nerve growth factor family. This study offers novel insight into the gene networks underlying vitellogenesis, ovulation and atresia and generates new hypotheses about the cellular pathways regulating oocyte maturation.

  12. Transcriptional Analysis of Resistance to Low Temperatures in Bermudagrass Crown Tissues

    PubMed Central

    Melmaiee, Kalpalatha; Anderson, Michael; Elavarthi, Sathya; Guenzi, Arron; Canaan, Patricia

    2015-01-01

    Bermudagrass (Cynodon dactylon L pers.) is one of the most geographically adapted and utilized of the warm-season grasses. However, bermudagrass adaptation to the Northern USA is limited by freeze damage and winterkill. Our study provides the first large-scale analyses of gene expression in bermudagrass regenerative crown tissues during cold acclimation. We compared gene expression patterns in crown tissues from highly cold tolerant “MSU” and susceptible “Zebra” genotypes exposed to near-freezing temperatures. Suppressive subtractive hybridization was used to isolate putative cold responsive genes Approximately, 3845 transcript sequences enriched for cold acclimation were deposited in the GenBank. A total of 4589 ESTs (3184 unigenes) including 744 ESTs associated with the bermudagrass disease spring dead spot were printed on microarrays and hybridized with cold acclimated complementary Deoxyribonucleic acid (cDNA). A total of 587 differentially expressed unigenes were identified in this study. Of these only 97 (17%) showed significant NCBI matches. The overall expression pattern revealed 40% more down- than up-regulated genes, which was particularly enhanced in MSU compared to Zebra. Among the up-regulated genes 68% were uniquely expressed in MSU (36%) or Zebra (32%). Among the down-regulated genes 40% were unique to MSU, while only 15% to Zebra. Overall expression intensity was significantly higher in MSU than in Zebra (p value ≤ 0.001) and the overall number of genes expressed at 28 days was 2.7 fold greater than at 2 days. These changes in expression patterns reflect the strong genotypic and temporal response to cold temperatures. Additionally, differentially expressed genes from this study can be utilized for developing molecular markers in bermudagrass and other warm season grasses for enhancing cold hardiness. PMID:26348040

  13. Transcriptional expression analysis of genes involved in regulation of calcium translocation and storage in finger millet (Eleusine coracana L. Gartn.).

    PubMed

    Mirza, Neelofar; Taj, Gohar; Arora, Sandeep; Kumar, Anil

    2014-10-25

    Finger millet (Eleusine coracana) variably accumulates calcium in different tissues, due to differential expression of genes involved in uptake, translocation and accumulation of calcium. Ca(2+)/H(+) antiporter (CAX1), two pore channel (TPC1), CaM-stimulated type IIB Ca(2+) ATPase and two CaM dependent protein kinase (CaMK1 and 2) homologs were studied in finger millet. Two genotypes GP-45 and GP-1 (high and low calcium accumulating, respectively) were used to understand the role of these genes in differential calcium accumulation. For most of the genes higher expression was found in the high calcium accumulating genotype. CAX1 was strongly expressed in the late stages of spike development and could be responsible for accumulating high concentrations of calcium in seeds. TPC1 and Ca(2+) ATPase homologs recorded strong expression in the root, stem and developing spike and signify their role in calcium uptake and translocation, respectively. Calmodulin showed strong expression and a similar expression pattern to the type IIB ATPase in the developing spike only and indicating developing spike or even seed specific isoform of CaM affecting the activity of downstream target of calcium transportation. Interestingly, CaMK1 and CaMK2 had expression patterns similar to ATPase and TPC1 in various tissues raising a possibility of their respective regulation via CaM kinase. Expression pattern of 14-3-3 gene was observed to be similar to CAX1 gene in leaf and developing spike inferring a surprising possibility of CAX1 regulation through 14-3-3 protein. Our results provide a molecular insight for explaining the mechanism of calcium accumulation in finger millet. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. SOX1 links the function of neural patterning and Notch signalling in the ventral spinal cord during the neuron-glial fate switch

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Genethliou, Nicholas; Panayiotou, Elena; Department of Biological Sciences, University of Cyprus, P.O. Box 20537, 1678 Nicosia

    2009-12-25

    During neural development the transition from neurogenesis to gliogenesis, known as the neuron-glial ({Nu}/G) fate switch, requires the coordinated function of patterning factors, pro-glial factors and Notch signalling. How this process is coordinated in the embryonic spinal cord is poorly understood. Here, we demonstrate that during the N/G fate switch in the ventral spinal cord (vSC) SOX1 links the function of neural patterning and Notch signalling. We show that, SOX1 expression in the vSC is regulated by PAX6, NKX2.2 and Notch signalling in a domain-specific manner. We further show that SOX1 regulates the expression of Hes1 and that loss ofmore » Sox1 leads to enhanced production of oligodendrocyte precursors from the pMN. Finally, we show that Notch signalling functions upstream of SOX1 during this fate switch and is independently required for the acquisition of the glial fate perse by regulating Nuclear Factor I A expression in a PAX6/SOX1/HES1/HES5-independent manner. These data integrate functional roles of neural patterning factors, Notch signalling and SOX1 during gliogenesis.« less

  15. miRNA-21 is developmentally regulated in mouse brain and is co-expressed with SOX2 in glioma

    PubMed Central

    2012-01-01

    Background MicroRNAs (miRNAs) and their role during tumor development have been studied in great detail during the last decade, albeit their expression pattern and regulation during normal development are however not so well established. Previous studies have shown that miRNAs are differentially expressed in solid human tumors. Platelet-derived growth factor (PDGF) signaling is known to be involved in normal development of the brain as well as in malignant primary brain tumors, gliomas, but the complete mechanism is still lacking. We decided to investigate the expression of the oncogenic miR-21 during normal mouse development and glioma, focusing on PDGF signaling as a potential regulator of miR-21. Methods We generated mouse glioma using the RCAS/tv-a system for driving PDGF-BB expression in a cell-specific manner. Expression of miR-21 in mouse cell cultures and mouse brain were assessed using Northern blot analysis and in situ hybridization. Immunohistochemistry and Western blot analysis were used to investigate SOX2 expression. LNA-modified siRNA was used for irreversible depletion of miR-21. For inhibition of PDGF signaling Gleevec (imatinib mesylate), Rapamycin and U0126, as well as siRNA were used. Statistical significance was calculated using double-sided unpaired Student´s t-test. Results We identified miR-21 to be highly expressed during embryonic and newborn brain development followed by a gradual decrease until undetectable at postnatal day 7 (P7), this pattern correlated with SOX2 expression. Furthermore, miR-21 and SOX2 showed up-regulation and overlapping expression pattern in RCAS/tv-a generated mouse brain tumor specimens. Upon irreversible depletion of miR-21 the expression of SOX2 was strongly diminished in both mouse primary glioma cultures and human glioma cell lines. Interestingly, in normal fibroblasts the expression of miR-21 was induced by PDGF-BB, and inhibition of PDGF signaling in mouse glioma primary cultures resulted in suppression of miR-21 suggesting that miR-21 is indeed regulated by PDGF signaling. Conclusions Our data show that miR-21 and SOX2 are tightly regulated already during embryogenesis and define a distinct population with putative tumor cell of origin characteristics. Furthermore, we believe that miR-21 is a mediator of PDGF-driven brain tumors, which suggests miR-21 as a promising target for treatment of glioma. PMID:22931209

  16. Regulation of the grapevine polygalacturonase-inhibiting protein encoding gene: expression pattern, induction profile and promoter analysis.

    PubMed

    Joubert, D Albert; de Lorenzo, Giulia; Vivier, Melané A

    2013-03-01

    Regulation of defense in plants is a complex process mediated by various signaling pathways. Promoter analysis of defense-related genes is useful to understand these signaling pathways involved in regulation. To this end, the regulation of the polygalacturonase-inhibiting protein encoding gene from Vitis vinifera L. (Vvpgip1) was analyzed with regard to expression pattern and induction profile as well as the promoter in terms of putative regulatory elements present, core promoter size and the start of transcription. Expression of Vvpgip1 is tissue-specific and developmentally regulated. Vvpgip1 expression was induced in response to auxin, salicylic acid and sugar treatment, wounding and pathogen infection. The start of transcription was mapped to 17 bp upstream of the ATG and the core promoter was mapped to the 137 bp upstream of the ATG. Fructose- and Botrytis responsiveness were identified in the region between positions -3.1 and -1.5 kb. The analyses showed induction in water when the leaves were submersed and this response and the response to wounding mapped to the region between positions -1.1 and -0.1 kb. In silico analyses revealed putative cis-acting elements in these areas that correspond well to the induction stimuli tested.

  17. Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

    PubMed Central

    Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

    2016-01-01

    Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

  18. AtPDS over-expression in tomato: exposing unique patterns of carotenoid self-regulation and an alternative strategy for the enhancement of fruit carotenoid content

    USDA-ARS?s Scientific Manuscript database

    The regulation of plant carotenogenesis is an active research area for both biological discovery and practical implementation. In tomato, we demonstrate additional bottlenecks exist in the poly-cis-transformation of phytoene to lycopene in the context of ripening-induced PSY1 expression and activity...

  19. Fox (forkhead) genes are involved in the dorso-ventral patterning of the Xenopus mesoderm.

    PubMed

    El-Hodiri, H; Bhatia-Dey, N; Kenyon, K; Ault, K; Dirksen, M; Jamrich, M

    2001-01-01

    Fox (forkhead/winged helix) genes encode a family of transcription factors that are involved in embryonic pattern formation, regulation of tissue specific gene expression and tumorigenesis. Several of them are transcribed during Xenopus embryogenesis and are important for the patterning of ectoderm, mesoderm and endoderm. We have isolated three forkhead genes that are activated during gastrulation and play an important role in the dorso-ventral patterning of the mesoderm. XFKH1 (FoxA4b), the first vertebrate forkhead gene to be implicated in embryonic pattern formation, is expressed in the Spemann-Mangold organizer region and later in the embryonic notochord. XFKH7, the Xenopus orthologue of the murine Mfh1(Foxc2), is expressed in the presomitic mesoderm, but not in the notochord or lateral plate mesoderm. Finally, XFD-13'(FoxF1b)1 is expressed in the lateral plate mesoderm, but not in the notochord or presomitic mesoderm. Expression pattern and functional experiments indicate that these three forkhead genes are involved in the dorso-ventral patterning of the mesoderm.

  20. Midline signals regulate retinal neurogenesis in zebrafish.

    PubMed

    Masai, I; Stemple, D L; Okamoto, H; Wilson, S W

    2000-08-01

    In zebrafish, neuronal differentiation progresses across the retina in a pattern that is reminiscent of the neurogenic wave that sweeps across the developing eye in Drosophila. We show that expression of a zebrafish homolog of Drosophila atonal, ath5, sweeps across the eye predicting the wave of neuronal differentiation. By analyzing the regulation of ath5 expression, we have elucidated the mechanisms that regulate initiation and spread of neurogenesis in the retina. ath5 expression is lost in Nodal pathway mutant embryos lacking axial tissues that include the prechordal plate. A likely role for axial tissue is to induce optic stalk cells that subsequently regulate ath5 expression. Our results suggest that a series of inductive events, initiated from the prechordal plate and progressing from the optic stalks, regulates the spread of neuronal differentiation across the zebrafish retina.

  1. Intra- and interregional coregulation of opioid genes: broken symmetry in spinal circuits

    PubMed Central

    Kononenko, Olga; Galatenko, Vladimir; Andersson, Malin; Bazov, Igor; Watanabe, Hiroyuki; Zhou, Xing Wu; Iatsyshyna, Anna; Mityakina, Irina; Yakovleva, Tatiana; Sarkisyan, Daniil; Ponomarev, Igor; Krishtal, Oleg; Marklund, Niklas; Tonevitsky, Alex; Adkins, DeAnna L.; Bakalkin, Georgy

    2017-01-01

    Regulation of the formation and rewiring of neural circuits by neuropeptides may require coordinated production of these signaling molecules and their receptors that may be established at the transcriptional level. Here, we address this hypothesis by comparing absolute expression levels of opioid peptides with their receptors, the largest neuropeptide family, and by characterizing coexpression (transcriptionally coordinated) patterns of these genes. We demonstrated that expression patterns of opioid genes highly correlate within and across functionally and anatomically different areas. Opioid peptide genes, compared with their receptor genes, are transcribed at much greater absolute levels, which suggests formation of a neuropeptide cloud that covers the receptor-expressed circuits. Surprisingly, we found that both expression levels and the proportion of opioid receptors are strongly lateralized in the spinal cord, interregional coexpression patterns are side specific, and intraregional coexpression profiles are affected differently by left- and right-side unilateral body injury. We propose that opioid genes are regulated as interconnected components of the same molecular system distributed between distinct anatomic regions. The striking feature of this system is its asymmetric coexpression patterns, which suggest side-specific regulation of selective neural circuits by opioid neurohormones.—Kononenko, O., Galatenko, V., Andersson, M., Bazov, I., Watanabe, H., Zhou, X. W., Iatsyshyna, A., Mityakina, I., Yakovleva, T., Sarkisyan, D., Ponomarev, I., Krishtal, O., Marklund, N., Tonevitsky, A., Adkins, D. L., Bakalkin, G. Intra- and interregional coregulation of opioid genes: broken symmetry in spinal circuits. PMID:28122917

  2. Increased methylation and decreased expression of homeobox genes TLX1, HOXA10 and DLX5 in human placenta are associated with trophoblast differentiation.

    PubMed

    Novakovic, Boris; Fournier, Thierry; Harris, Lynda K; James, Joanna; Roberts, Claire T; Yong, Hannah E J; Kalionis, Bill; Evain-Brion, Danièle; Ebeling, Peter R; Wallace, Euan M; Saffery, Richard; Murthi, Padma

    2017-07-03

    Homeobox genes regulate embryonic and placental development, and are widely expressed in the human placenta, but their regulatory control by DNA methylation is unclear. DNA methylation analysis was performed on human placentae from first, second and third trimesters to determine methylation patterns of homeobox gene promoters across gestation. Most homeobox genes were hypo-methylated throughout gestation, suggesting that DNA methylation is not the primary mechanism involved in regulating HOX genes expression in the placenta. Nevertheless, several genes showed variable methylation patterns across gestation, with a general trend towards an increase in methylation over gestation. Three genes (TLX1, HOXA10 and DLX5) showed inverse gains of methylation with decreasing mRNA expression throughout pregnancy, supporting a role for DNA methylation in their regulation. Proteins encoded by these genes were primarily localised to the syncytiotrophoblast layer, and showed decreased expression later in gestation. siRNA mediated downregulation of DLX5, TLX1 and HOXA10 in primary term villous cytotrophoblast resulted in decreased proliferation and increased expression of differentiation markers, including ERVW-1. Our data suggest that loss of DLX5, TLX1 and HOXA10 expression in late gestation is required for proper placental differentiation and function.

  3. Caste-Specific and Sex-Specific Expression of Chemoreceptor Genes in a Termite

    PubMed Central

    Mikheyev, Alexander; Tin, Mandy M. Y.; Watanabe, Yutaka; Matsuura, Kenji

    2016-01-01

    The sophisticated colony organization of eusocial insects is primarily maintained through the utilization of pheromones. The regulation of these complex social interactions requires intricate chemoreception systems. The recent publication of the genome of Zootermopsis nevadensis opened a new avenue to study molecular basis of termite caste systems. Although there has been a growing interest in the termite chemoreception system that regulates their sophisticated caste system, the relationship between division of labor and expression of chemoreceptor genes remains to be explored. Using high-throughput mRNA sequencing (RNA-seq), we found several chemoreceptors that are differentially expressed among castes and between sexes in a subterranean termite Reticulitermes speratus. In total, 53 chemoreception-related genes were annotated, including 22 odorant receptors, 7 gustatory receptors, 12 ionotropic receptors, 9 odorant-binding proteins, and 3 chemosensory proteins. Most of the chemoreception-related genes had caste-related and sex-related expression patterns; in particular, some chemoreception genes showed king-biased or queen-biased expression patterns. Moreover, more than half of the genes showed significant age-dependent differences in their expression in female and/or male reproductives. These results reveal a strong relationship between the evolution of the division of labor and the regulation of chemoreceptor gene expression, thereby demonstrating the chemical communication and underlining chemoreception mechanism in social insects. PMID:26760975

  4. Caste-Specific and Sex-Specific Expression of Chemoreceptor Genes in a Termite.

    PubMed

    Mitaka, Yuki; Kobayashi, Kazuya; Mikheyev, Alexander; Tin, Mandy M Y; Watanabe, Yutaka; Matsuura, Kenji

    2016-01-01

    The sophisticated colony organization of eusocial insects is primarily maintained through the utilization of pheromones. The regulation of these complex social interactions requires intricate chemoreception systems. The recent publication of the genome of Zootermopsis nevadensis opened a new avenue to study molecular basis of termite caste systems. Although there has been a growing interest in the termite chemoreception system that regulates their sophisticated caste system, the relationship between division of labor and expression of chemoreceptor genes remains to be explored. Using high-throughput mRNA sequencing (RNA-seq), we found several chemoreceptors that are differentially expressed among castes and between sexes in a subterranean termite Reticulitermes speratus. In total, 53 chemoreception-related genes were annotated, including 22 odorant receptors, 7 gustatory receptors, 12 ionotropic receptors, 9 odorant-binding proteins, and 3 chemosensory proteins. Most of the chemoreception-related genes had caste-related and sex-related expression patterns; in particular, some chemoreception genes showed king-biased or queen-biased expression patterns. Moreover, more than half of the genes showed significant age-dependent differences in their expression in female and/or male reproductives. These results reveal a strong relationship between the evolution of the division of labor and the regulation of chemoreceptor gene expression, thereby demonstrating the chemical communication and underlining chemoreception mechanism in social insects.

  5. Transcriptional Modulation of Genes Encoding Structural Characteristics of Differentiating Enterocytes During Development of a Polarized Epithelium In Vitro

    PubMed Central

    Halbleib, Jennifer M.; Sääf, Annika M.

    2007-01-01

    Although there is considerable evidence implicating posttranslational mechanisms in the development of epithelial cell polarity, little is known about the patterns of gene expression and transcriptional regulation during this process. We characterized the temporal program of gene expression during cell–cell adhesion–initiated polarization of human Caco-2 cells in tissue culture, which develop structural and functional polarity similar to that of enterocytes in vivo. A distinctive switch in gene expression patterns occurred upon formation of cell–cell contacts between neighboring cells. Expression of genes involved in cell proliferation was down-regulated concomitant with induction of genes necessary for functional specialization of polarized epithelial cells. Transcriptional up-regulation of these latter genes correlated with formation of important structural and functional features in enterocyte differentiation and establishment of structural and functional cell polarity; components of the apical microvilli were induced as the brush border formed during polarization; as barrier function was established, expression of tight junction transmembrane proteins peaked; transcripts encoding components of the apical, but not the basal-lateral trafficking machinery were increased during polarization. Coordinated expression of genes encoding components of functional cell structures were often observed indicating temporal control of expression and assembly of multiprotein complexes. PMID:17699590

  6. Epigenetic hierarchy governing Nestin expression.

    PubMed

    Han, Dong Wook; Do, Jeong Tae; Araúzo-Bravo, Marcos J; Lee, Sung Ho; Meissner, Alexander; Lee, Hoon Taek; Jaenisch, Rudolf; Schöler, Hans R

    2009-05-01

    Nestin is an intermediate filament protein expressed specifically in neural stem cells and progenitor cells of the central nervous system. DNA demethylation and histone modifications are two types of epigenetic modifications working in a coordinate or synergistic manner to regulate the expression of various genes. This study investigated and elucidated the epigenetic regulation of Nestin gene expression during embryonic differentiation along the neural cell lineage. Nestin exhibits differential DNA methylation and histone acetylation patterns in Nestin-expressing and nonexpressing cells. In P19 embryonic carcinoma cells, activation of Nestin expression is mediated by both trichostatin A and 5-aza-2'-deoxycytidine treatment, concomitant with histone acetylation, but not with DNA demethylation. Nestin transcription is also mediated by treatment with retinoic acid, again in the absence of DNA demethylation. Thus, histone acetylation is sufficient to mediate the activation of Nestin transcription. This study proposed that the regulation of Nestin gene expression can be used as a model to study the epigenetic regulation of gene expression mediated by histone acetylation, but not by DNA demethylation.

  7. Use of whole genome expression analysis in the toxicity screening of nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fröhlich, Eleonore, E-mail: eleonore.froehlich@medunigraz.at; Meindl, Claudia; Wagner, Karin

    2014-10-15

    The use of nanoparticles (NPs) offers exciting new options in technical and medical applications provided they do not cause adverse cellular effects. Cellular effects of NPs depend on particle parameters and exposure conditions. In this study, whole genome expression arrays were employed to identify the influence of particle size, cytotoxicity, protein coating, and surface functionalization of polystyrene particles as model particles and for short carbon nanotubes (CNTs) as particles with potential interest in medical treatment. Another aim of the study was to find out whether screening by microarray would identify other or additional targets than commonly used cell-based assays formore » NP action. Whole genome expression analysis and assays for cell viability, interleukin secretion, oxidative stress, and apoptosis were employed. Similar to conventional assays, microarray data identified inflammation, oxidative stress, and apoptosis as affected by NP treatment. Application of lower particle doses and presence of protein decreased the total number of regulated genes but did not markedly influence the top regulated genes. Cellular effects of CNTs were small; only carboxyl-functionalized single-walled CNTs caused appreciable regulation of genes. It can be concluded that regulated functions correlated well with results in cell-based assays. Presence of protein mitigated cytotoxicity but did not cause a different pattern of regulated processes. - Highlights: • Regulated functions were screened using whole genome expression assays. • Polystyrene particles regulated more genes than short carbon nanotubes. • Protein coating of polystyrene particles did not change regulation pattern. • Functions regulated by microarray were confirmed by cell-based assay.« less

  8. Ethylene and cold participate in the regulation of LeCBF1 gene expression in postharvest tomato fruits.

    PubMed

    Zhao, Danying; Shen, Lin; Fan, Bei; Yu, Mengmeng; Zheng, Yang; Lv, Shengnan; Sheng, Jiping

    2009-10-20

    C-repeat/dehydration-responsive element binding factor (CBF) is a transcription factor regulating cold response in plants, of which little is known in fruits. We showed a double-peak expression pattern of Lycopersicon esculentum putative transcriptional activator CBF1 (LeCBF1) in mature green fruit. The peaks appeared at 2 and 16 h after subjection to cold storage (2 degrees C). The second peak was coincident with, and thus caused by a peak in endogenous ethylene production. We showed that LeCBF1 expression was regulated by exogenous ethylene and 1-methylcyclopropene, and was not expressed without cold induction. LeCBF1 expression was different in the five maturation stages of fruits, but expression peaked at 2 h at all stages.

  9. Function does not follow form in gene regulatory circuits.

    PubMed

    Payne, Joshua L; Wagner, Andreas

    2015-08-20

    Gene regulatory circuits are to the cell what arithmetic logic units are to the chip: fundamental components of information processing that map an input onto an output. Gene regulatory circuits come in many different forms, distinct structural configurations that determine who regulates whom. Studies that have focused on the gene expression patterns (functions) of circuits with a given structure (form) have examined just a few structures or gene expression patterns. Here, we use a computational model to exhaustively characterize the gene expression patterns of nearly 17 million three-gene circuits in order to systematically explore the relationship between circuit form and function. Three main conclusions emerge. First, function does not follow form. A circuit of any one structure can have between twelve and nearly thirty thousand distinct gene expression patterns. Second, and conversely, form does not follow function. Most gene expression patterns can be realized by more than one circuit structure. And third, multifunctionality severely constrains circuit form. The number of circuit structures able to drive multiple gene expression patterns decreases rapidly with the number of these patterns. These results indicate that it is generally not possible to infer circuit function from circuit form, or vice versa.

  10. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pandi, Narayanan Sathiya, E-mail: sathiyapandi@gmail.com; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However,more » the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC.« less

  11. Oxygen and tissue culture affect placental gene expression.

    PubMed

    Brew, O; Sullivan, M H F

    2017-07-01

    Placental explant culture is an important model for studying placental development and functions. We investigated the differences in placental gene expression in response to tissue culture, atmospheric and physiologic oxygen concentrations. Placental explants were collected from normal term (38-39 weeks of gestation) placentae with no previous uterine contractile activity. Placental transcriptomic expressions were evaluated with GeneChip ® Human Genome U133 Plus 2.0 arrays (Affymetrix). We uncovered sub-sets of genes that regulate response to stress, induction of apoptosis programmed cell death, mis-regulation of cell growth, proliferation, cell morphogenesis, tissue viability, and protection from apoptosis in cultured placental explants. We also identified a sub-set of genes with highly unstable pattern of expression after exposure to tissue culture. Tissue culture irrespective of oxygen concentration induced dichotomous increase in significant gene expression and increased enrichment of significant pathways and transcription factor targets (TFTs) including HIF1A. The effect was exacerbated by culture at atmospheric oxygen concentration, where further up-regulation of TFTs including PPARA, CEBPD, HOXA9 and down-regulated TFTs such as JUND/FOS suggest intrinsic heightened key biological and metabolic mechanisms such as glucose use, lipid biosynthesis, protein metabolism; apoptosis, inflammatory responses; and diminished trophoblast proliferation, differentiation, invasion, regeneration, and viability. These findings demonstrate that gene expression patterns differ between pre-culture and cultured explants, and the gene expression of explants cultured at atmospheric oxygen concentration favours stressed, pro-inflammatory and increased apoptotic transcriptomic response. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Expression of the Retrotransposon Helena Reveals a Complex Pattern of TE Deregulation in Drosophila Hybrids

    PubMed Central

    Romero-Soriano, Valèria; Garcia Guerreiro, Maria Pilar

    2016-01-01

    Transposable elements (TEs), repeated mobile sequences, are ubiquitous in the eukaryotic kingdom. Their mobilizing capacity confers on them a high mutagenic potential, which must be strongly regulated to guarantee genome stability. In the Drosophila germline, a small RNA-mediated silencing system, the piRNA (Piwi-interacting RNA) pathway, is the main responsible TE regulating mechanism, but some stressful conditions can destabilize it. For instance, during interspecific hybridization, genomic stress caused by the shock of two different genomes can lead, in both animals and plants, to higher transposition rates. A recent study in D. buzatii—D. koepferae hybrids detected mobilization of 28 TEs, yet little is known about the molecular mechanisms explaining this transposition release. We have characterized one of the mobilized TEs, the retrotransposon Helena, and used quantitative expression to assess whether its high transposition rates in hybrids are preceded by increased expression. We have also localized Helena expression in the gonads to see if cellular expression patterns have changed in the hybrids. To give more insight into changes in TE regulation in hybrids, we analysed Helena-specific piRNA populations of hybrids and parental species. Helena expression is not globally altered in somatic tissues, but male and female gonads have different patterns of deregulation. In testes, Helena is repressed in F1, increasing then its expression up to parental values. This is linked with a mislocation of Helena transcripts along with an increase of their specific piRNA levels. Ovaries have additive levels of Helena expression, but the ping-pong cycle efficiency seems to be reduced in F1 hybrids. This could be at the origin of new Helena insertions in hybrids, which would be transmitted to F1 hybrid female progeny. PMID:26812285

  13. Klf8 regulates left-right asymmetric patterning through modulation of Kupffer's vesicle morphogenesis and spaw expression.

    PubMed

    Lin, Che-Yi; Tsai, Ming-Yuan; Liu, Yu-Hsiu; Lu, Yu-Fen; Chen, Yi-Chung; Lai, Yun-Ren; Liao, Hsin-Chi; Lien, Huang-Wei; Yang, Chung-Hsiang; Huang, Chang-Jen; Hwang, Sheng-Ping L

    2017-07-17

    Although vertebrates are bilaterally symmetric organisms, their internal organs are distributed asymmetrically along a left-right axis. Disruption of left-right axis asymmetric patterning often occurs in human genetic disorders. In zebrafish embryos, Kupffer's vesicle, like the mouse node, breaks symmetry by inducing asymmetric expression of the Nodal-related gene, spaw, in the left lateral plate mesoderm (LPM). Spaw then stimulates transcription of itself and downstream genes, including lft1, lft2, and pitx2, specifically in the left side of the diencephalon, heart and LPM. This developmental step is essential to establish subsequent asymmetric organ positioning. In this study, we evaluated the role of krüppel-like factor 8 (klf8) in regulating left-right asymmetric patterning in zebrafish embryos. Zebrafish klf8 expression was disrupted by both morpholino antisense oligomer-mediated knockdown and a CRISPR-Cas9 system. Whole-mount in situ hybridization was conducted to evaluate gene expression patterns of Nodal signalling components and the positions of heart and visceral organs. Dorsal forerunner cell number was evaluated in Tg(sox17:gfp) embryos and the length and number of cilia in Kupffer's vesicle were analyzed by immunocytochemistry using an acetylated tubulin antibody. Heart jogging, looping and visceral organ positioning were all defective in zebrafish klf8 morphants. At the 18-22 s stages, klf8 morphants showed reduced expression of genes encoding Nodal signalling components (spaw, lft1, lft2, and pitx2) in the left LPM, diencephalon, and heart. Co-injection of klf8 mRNA with klf8 morpholino partially rescued spaw expression. Furthermore, klf8 but not klf8△zf overexpressing embryos showed dysregulated bilateral expression of Nodal signalling components at late somite stages. At the 10s stage, klf8 morphants exhibited reductions in length and number of cilia in Kupffer's vesicle, while at 75% epiboly, fewer dorsal forerunner cells were observed. Interestingly, klf8 mutant embryos, generated by a CRISPR-Cas9 system, showed bilateral spaw expression in the LPM at late somite stages. This observation may be partly attributed to compensatory upregulation of klf12b, because klf12b knockdown reduced the percentage of klf8 mutants exhibiting bilateral spaw expression. Our results demonstrate that zebrafish Klf8 regulates left-right asymmetric patterning by modulating both Kupffer's vesicle morphogenesis and spaw expression in the left LPM.

  14. Evidence for the temporal regulation of insect segmentation by a conserved sequence of transcription factors

    PubMed Central

    2018-01-01

    ABSTRACT Long-germ insects, such as the fruit fly Drosophila melanogaster, pattern their segments simultaneously, whereas short-germ insects, such as the beetle Tribolium castaneum, pattern their segments sequentially, from anterior to posterior. Although the two modes of segmentation at first appear quite distinct, much of this difference might simply reflect developmental heterochrony. We now show here that, in both Drosophila and Tribolium, segment patterning occurs within a common framework of sequential Caudal, Dichaete and Odd-paired expression. In Drosophila, these transcription factors are expressed like simple timers within the blastoderm, whereas in Tribolium they form wavefronts that sweep from anterior to posterior across the germband. In Drosophila, all three are known to regulate pair-rule gene expression and influence the temporal progression of segmentation. We propose that these regulatory roles are conserved in short-germ embryos, and that therefore the changing expression profiles of these genes across insects provide a mechanistic explanation for observed differences in the timing of segmentation. In support of this hypothesis, we demonstrate that Odd-paired is essential for segmentation in Tribolium, contrary to previous reports. PMID:29724758

  15. Detection of changes in gene regulatory patterns, elicited by perturbations of the Hsp90 molecular chaperone complex, by visualizing multiple experiments with an animation

    PubMed Central

    2011-01-01

    Background To make sense out of gene expression profiles, such analyses must be pushed beyond the mere listing of affected genes. For example, if a group of genes persistently display similar changes in expression levels under particular experimental conditions, and the proteins encoded by these genes interact and function in the same cellular compartments, this could be taken as very strong indicators for co-regulated protein complexes. One of the key requirements is having appropriate tools to detect such regulatory patterns. Results We have analyzed the global adaptations in gene expression patterns in the budding yeast when the Hsp90 molecular chaperone complex is perturbed either pharmacologically or genetically. We integrated these results with publicly accessible expression, protein-protein interaction and intracellular localization data. But most importantly, all experimental conditions were simultaneously and dynamically visualized with an animation. This critically facilitated the detection of patterns of gene expression changes that suggested underlying regulatory networks that a standard analysis by pairwise comparison and clustering could not have revealed. Conclusions The results of the animation-assisted detection of changes in gene regulatory patterns make predictions about the potential roles of Hsp90 and its co-chaperone p23 in regulating whole sets of genes. The simultaneous dynamic visualization of microarray experiments, represented in networks built by integrating one's own experimental with publicly accessible data, represents a powerful discovery tool that allows the generation of new interpretations and hypotheses. PMID:21672238

  16. Effects of the soya isoflavone genistein in early life stages of the Senegalese sole, Solea senegalensis: Thyroid, estrogenic and metabolic biomarkers.

    PubMed

    Sarasquete, Carmen; Úbeda-Manzanaro, Maria; Ortiz-Delgado, Juan Bosco

    2017-09-01

    This study examines the effects induced by environmentally relevant concentrations of the isoflavone genistein (3mg/L and 10mg/L) during early life stages of the Senegalese sole. Throughout the hypothalamus-pituitary-thyroid (HPT) axis, several neurohormonal regulatory thyroid signalling patterns (thyroglobulin/Tg, thyroid peroxidase/TPO, transthyretin/TTR, thyroid receptors/TRβ, and iodothrynonine deiodinases, Dio2 and Dio3) were analysed. Furthermore, the expression patterns of estrogen receptor ERβ and haemoprotein Cyp1a were also evaluated. In the control larvae, progressive increases of constitutive hormonal signalling pathways have been evidenced from the pre-metamorphosis phase onwards, reaching the highest expression basal levels at the metamorphosis (Tg, TPO, Dio2) and/or during post-metamorphosis (TTR, TRβ, ERβ). When the early larvae were exposed to both genistein concentrations (3mg/L and 10mg/L), a statistically significant down-regulation of TPO, TTR and Tg mRNA levels was clearly detected at the metamorphic stages. In addition, the Dio2 and Dio3 transcript expression levels were also down and up-regulated when exposed to both genistein concentrations. In the larvae exposed to genistein, no statistically significant responses were recorded for the TRβ expression patterns. Nevertheless, the ERβ and Cyp1a transcript levels were up-regulated at the middle metamorphic stage (S2, at 16 dph) in the larvae exposed to high genistein concentrations and, only the ERβ was down-regulated (S1, at 12dph) at the lower doses. Finally, all these pointed out imbalances were only temporarily disrupted by exposure to genistein, since most of the modulated transcriptional signals (i.e. up or down-regulation) were quickly restored to the baseline levels. Additionally, the control and genistein-exposed Senegalese sole specimens showed characteristic ontogenetic patterns and completely suitable for an optimal development, metamorphosis, and growth. Copyright © 2017. Published by Elsevier Inc.

  17. Expression and regulation of Sef, a novel signaling inhibitor of receptor tyrosine kinases-mediated signaling in the nervous system.

    PubMed

    Grothe, Claudia; Claus, Peter; Haastert, Kirsten; Lutwak, Ela; Ron, Dina

    2008-01-01

    Fibroblast growth factors (FGFs) signal via four distinct high affinity cell surface tyrosine kinase receptors, termed FGFR1-FGFR4 (FGFR-FGF-receptor). Recently, a new modulator of the FGF signaling pathway, the transmembrane protein 'similar expression to FGF genes' (Sef), has been identified in zebrafish and subsequently in mammals. Sef from mouse and human inhibits FGF mitogenic activity. In the present study, we analyzed the expression of Sef in distinct rat brain areas, in the spinal cord and in peripheral nerves and spinal ganglia using semi-quantitative RT-PCR. Furthermore, we studied the cellular expression pattern of Sef in intact spinal ganglia and sciatic nerves and, in addition, after crush lesion, using in situ hybridization and immunohistochemistry. Sef transcripts were expressed in all brain areas evaluated and in the spinal cord. A neuronal expression was found in both intact and injured spinal ganglia. Intact sciatic nerves, however, showed little or no Sef expression. Seven days after injury, high Sef expression was concentrated to the crush site, and Schwann cells seemed to be the source of Sef. The labeling pattern of up-regulated Sef was complementary to the patterns of FGF-2 and FGFR1-3, which were localized proximal and distal to the crush site. These results suggest an involvement of Sef during the nerve regeneration process, possibly by fine-tuning the effects of FGF signaling.

  18. Prediction of epigenetically regulated genes in breast cancer cell lines.

    PubMed

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria E H; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-06-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profiles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profiles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fixed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically significant negative correlation between methylation profiles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identified 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.

  19. TORNADO1 regulates root epidermal patterning through the WEREWOLF pathway in Arabidopsis thaliana.

    PubMed

    Kwak, Su-Hwan; Song, Sang-Kee; Lee, Myeong Min; Schiefelbein, John

    2015-01-01

    Cell fate in the root epidermis of Arabidopsis thaliana is determined in a position-dependent manner. SCRAMBLED (SCM), an atypical leucine-rich repeat receptor-like kinase, mediates this positional regulation via its effect on WEREWOLF (WER) expression, and subsequently, its downstream transcription factor, GLABRA2 (GL2), which are required for nonhair cell development. Previously, TORNADO1 (TRN1), a plant-specific protein with a leucine-rich repeat ribonuclease inhibitor-like domain, was shown to be required for proper epidermal patterning in Arabidopsis roots. In this work, we analyzed the possible involvement of TRN1 in the known root epidermal gene network. We discovered that the trn1 mutant caused the ectopic expression of WER and the randomized expression of GL2 and EGL3. This suggests that TRN1 regulates the position-dependent cell fate determination by affecting WER expression in Arabidopsis root epidermis. Additionally, the distinct phenotypes of the aerial parts of the trn1-t and scm-2 mutant suggest that TRN1 and SCM might have different functions in the development of aerial parts.

  20. TORNADO1 regulates root epidermal patterning through the WEREWOLF pathway in Arabidopsis thaliana

    PubMed Central

    Kwak, Su-Hwan; Song, Sang-Kee; Lee, Myeong Min; Schiefelbein, John

    2015-01-01

    Cell fate in the root epidermis of Arabidopsis thaliana is determined in a position-dependent manner. SCRAMBLED (SCM), an atypical leucine-rich repeat receptor-like kinase, mediates this positional regulation via its effect on WEREWOLF (WER) expression, and subsequently, its downstream transcription factor, GLABRA2 (GL2), which are required for nonhair cell development. Previously, TORNADO1 (TRN1), a plant-specific protein with a leucine-rich repeat ribonuclease inhibitor-like domain, was shown to be required for proper epidermal patterning in Arabidopsis roots. In this work, we analyzed the possible involvement of TRN1 in the known root epidermal gene network. We discovered that the trn1 mutant caused the ectopic expression of WER and the randomized expression of GL2 and EGL3. This suggests that TRN1 regulates the position-dependent cell fate determination by affecting WER expression in Arabidopsis root epidermis. Additionally, the distinct phenotypes of the aerial parts of the trn1-t and scm-2 mutant suggest that TRN1 and SCM might have different functions in the development of aerial parts. PMID:26451798

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morishige, Naoyuki; Ko, Ji-Ae, E-mail: jiae0831@yamaguchi-u.ac.jp; Morita, Yukiko

    The neural guidance protein semaphorin 3A (Sema3A) is expressed in corneal epithelial cells of the adult rat. We have now further investigated the localization of Sema3A in the normal rat corneal epithelium as well as changes in its expression pattern during wound healing after central corneal epithelial debridement. The expression pattern of Sema3A was compared with that of the tight-junction protein zonula occludens-1 (ZO-1), the gap-junction protein connexin43 (Cx43), or the cell proliferation marker Ki67. Immunofluorescence analysis revealed that Sema3A was present predominantly in the membrane of basal and wing cells of the intact corneal epithelium. The expression of Sema3Amore » at the basal side of basal cells was increased in the peripheral epithelium compared with that in the central region. Sema3A was detected in all layers at the leading edge of the migrating corneal epithelium at 6 h after central epithelial debridement. The expression of Sema3A was markedly up-regulated in the basal and lateral membranes of columnar basal cells apparent in the thickened, newly healed epithelium at 1 day after debridement, but it had largely returned to the normal pattern at 3 days after debridement. The expression of ZO-1 was restricted to superficial epithelial cells and remained mostly unchanged during the wound healing process. The expression of Cx43 in basal cells was down-regulated at the leading edge of the migrating epithelium but was stable in the remaining portion of the epithelium. Ki67 was not detected in basal cells of the central epithelium at 1 day after epithelial debridement, when Sema3A was prominently expressed. Immunoblot analysis showed that the abundance of Sema3A in the central cornea was increased 1 day after epithelial debridement, whereas that of ZO-1 or Cx43 remained largely unchanged. This increase in Sema3A expression was accompanied by up-regulation of the Sema3A coreceptor neuropilin-1. Our observations have thus shown that the expression of Sema3A is increased markedly in basal cells of the newly healed corneal epithelium, and that this up-regulation of Sema3A is not associated with cell proliferation. They further suggest that Sema3A might play a role in the regulation of corneal epithelial wound healing.« less

  2. Frontal electroencephalographic correlates of individual differences in emotion expression in infants: a brain systems perspective on emotion.

    PubMed

    Dawson, G

    1994-01-01

    Emotion expressions can be characterized by both the type of emotion displayed and the intensity with which the emotion is expressed. Individual differences in these two aspects of emotion appear to vary independently and may perhaps account for distinct dimensions of temperament, personality, and vulnerability to psychopathology. We reviewed several sets of data gathered in our laboratory that indicate that these two dimensions of emotion expression are associated with distinct and independent patterns of frontal EEG activity in infants. Specifically, whereas the type of emotion expression was found to be associated with asymmetries in frontal EEG activity, the intensity of emotion expression was found to be associated with generalized activation of both the right and the left frontal regions. Moreover, we reviewed and provided evidence that measures of asymmetrical frontal activity are better predictors of individual differences in the tendency to express certain emotions, such as distress and sadness, whereas measures of generalized frontal activity are better predictors of individual differences in emotional reactivity and emotion intensity. The neuroanatomical bases of emotion were discussed with special reference to the role of the frontal lobe in emotion regulation. It was hypothesized that the frontal activation asymmetries that have been found to accompany emotion expressions reflect specific regulation strategies. The left frontal region is specialized for regulation strategies involving action schemes that serve to maintain continuity and stability of the organism-environment relation and of ongoing motor schemes, such as those involved in language and the expression of happiness and interest. In contrast, the right frontal region appears to be specialized for regulation strategies that involve processing novel stimuli that disrupt ongoing activity, such as might occur during the expression of fear, disgust, and distress. Furthermore, it was proposed that individual differences in patterns of frontal EEG asymmetries during emotion may be related to socialization influences rather than solely innate factors. It was speculated that the pattern of generalized frontal lobe activation that accompanies the experience of intense emotions may reflect, in part, the relatively diffuse influence of subcortical structures on the cortex and may serve to increase the infant's general readiness to receive and respond to significant external stimuli.

  3. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  4. Gene expression patterns during the larval development of European sea bass (dicentrarchus labrax) by microarray analysis.

    PubMed

    Darias, M J; Zambonino-Infante, J L; Hugot, K; Cahu, C L; Mazurais, D

    2008-01-01

    During the larval period, marine teleosts undergo very fast growth and dramatic changes in morphology, metabolism, and behavior to accomplish their metamorphosis into juvenile fish. Regulation of gene expression is widely thought to be a key mechanism underlying the management of the biological processes required for harmonious development over this phase of life. To provide an overall analysis of gene expression in the whole body during sea bass larval development, we monitored the expression of 6,626 distinct genes at 10 different points in time between 7 and 43 days post-hatching (dph) by using heterologous hybridization of a rainbow trout cDNA microarray. The differentially expressed genes (n = 485) could be grouped into two categories: genes that were generally up-expressed early, between 7 and 23 dph, and genes up-expressed between 25 and 43 dph. Interestingly, among the genes regulated during the larval period, those related to organogenesis, energy pathways, biosynthesis, and digestion were over-represented compared with total set of analyzed genes. We discuss the quantitative regulation of whole-body contents of these specific transcripts with regard to the ontogenesis and maturation of essential functions that take place over larval development. Our study is the first utilization of a transcriptomic approach in sea bass and reveals dynamic changes in gene expression patterns in relation to marine finfish larval development.

  5. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer.

    PubMed

    Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-10-04

    Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Estradiol stimulates an anti-translocation expression pattern of glucocorticoid co-regulators in a hippocampal cell model

    PubMed Central

    Malviya, Sanjana A.; Kelly, Sean D.; Greenlee, Megan M.; Eaton, Douglas C.; Duke, Billie Jeanne; Bourke, Chase H.; Neigh, Gretchen N.

    2013-01-01

    A consistent clinical finding in patients with major depressive disorder (MDD) is hyperactivity of the hypothalamic–pituitary–adrenal (HPA) axis, the system in the body that facilitates the response to stress. It has been suggested that alterations in glucocorticoid receptor (GR)-mediated feedback prolong activation of the HPA axis, leading to the dysfunction observed in MDD. Additionally, the risk for developing MDD is heightened by several risk factors, namely gender, genetics and early life stress. Previous studies have demonstrated that GR translocation is sexually dimorphic and this difference may be facilitated by differential expression of GR co-regulators. The purpose of this study was to determine the extent to which ovarian hormones alter expression of GR and its co-regulators, Fkbp5 and Ppid, in HT-22 hippocampal neurons. The impact of corticosterone (cort), estradiol (E2), and progesterone (P4) treatments on the expression of the genes Nr3c1, Ppid, and Fkbp5 was assessed in HT-22 hippocampal neurons. Treatment of cells with increasing doses of cort increased the expression of Fkbp5, an effect that was potentiated by E2. Exposure of HT-22 cells to E2 decreased the expression of Ppid and simultaneous exposure to E2 and P4 had combinatory effects on Ppid expression. The effects of E2 on Ppid extend previous work which demonstrated that serum E2 concentrations correlate with hippocampal Ppid expression in female rats. The results presented here illustrate that E2 generates an anti-translocation pattern of GR co-regulators in hippocampal cells. PMID:23541378

  7. Male sex interspecies divergence and down regulation of expression of spermatogenesis genes in Drosophila sterile hybrids.

    PubMed

    Sundararajan, Vignesh; Civetta, Alberto

    2011-01-01

    Male sex genes have shown a pattern of rapid interspecies divergence at both the coding and gene expression level. A common outcome from crosses between closely-related species is hybrid male sterility. Phenotypic and genetic studies in Drosophila sterile hybrid males have shown that spermatogenesis arrest is postmeiotic with few exceptions, and that most misregulated genes are involved in late stages of spermatogenesis. Comparative studies of gene regulation in sterile hybrids and parental species have mainly used microarrays providing a whole genome representation of regulatory problems in sterile hybrids. Real-time PCR studies can reject or reveal differences not observed in microarray assays. Moreover, differences in gene expression between samples can be dependant on the source of RNA (e.g., whole body vs. tissue). Here we survey expression in D. simulans, D. mauritiana and both intra and interspecies hybrids using a real-time PCR approach for eight genes expressed at the four main stages of sperm development. We find that all genes show a trend toward under expression in the testes of sterile hybrids relative to parental species with only the two proliferation genes (bam and bgcn) and the two meiotic class genes (can and sa) showing significant down regulation. The observed pattern of down regulation for the genes tested can not fully explain hybrid male sterility. We discuss the down regulation of spermatogenesis genes in hybrids between closely-related species within the contest of rapid divergence experienced by the male genome, hybrid sterility and possible allometric changes due to subtle testes-specific developmental abnormalities.

  8. Differential Gene Expression between Leaf and Rhizome in Atractylodes lancea: A Comparative Transcriptome Analysis

    PubMed Central

    Huang, Qianqian; Huang, Xiao; Deng, Juan; Liu, Hegang; Liu, Yanwen; Yu, Kun; Huang, Bisheng

    2016-01-01

    The rhizome of Atractylodes lancea is extensively used in the practice of Traditional Chinese Medicine because of its broad pharmacological activities. This study was designed to characterize the transcriptome profiling of the rhizome and leaf of Atractylodes lancea in an attempt to uncover the molecular mechanisms regulating rhizome formation and growth. Over 270 million clean reads were assembled into 92,366 unigenes, 58% of which are homologous with sequences in public protein databases (NR, Swiss-Prot, GO, and KEGG). Analysis of expression levels showed that genes involved in photosynthesis, stress response, and translation were the most abundant transcripts in the leaf, while transcripts involved in stress response, transcription regulation, translation, and metabolism were dominant in the rhizome. Tissue-specific gene analysis identified distinct gene families active in the leaf and rhizome. Differential gene expression analysis revealed a clear difference in gene expression pattern, identifying 1518 up-regulated genes and 3464 down-regulated genes in the rhizome compared with the leaf, including a series of genes related to signal transduction, primary and secondary metabolism. Transcription factor (TF) analysis identified 42 TF families, with 67 and 60 TFs up-regulated in the rhizome and leaf, respectively. A total of 104 unigenes were identified as candidates for regulating rhizome formation and development. These data offer an overview of the gene expression pattern of the rhizome and leaf and provide essential information for future studies on the molecular mechanisms of controlling rhizome formation and growth. The extensive transcriptome data generated in this study will be a valuable resource for further functional genomics studies of A. lancea. PMID:27066021

  9. Knockdown of connexin43-mediated regulation of the zone of polarizing activity in the developing chick limb leads to digit truncation.

    PubMed

    Law, Lee Yong; Lin, Jun Sheng; Becker, David L; Green, Colin R

    2002-12-01

    In the developing chick wing, the use of antisense oligodeoxynucleotides to transiently knock down the expression of the gap junction protein, connexin43 (Cx43), results in limb patterning defects, including deletion of the anterior digits. To understand more about how such defects arise, the effects of transient Cx43 knockdown on the expression patterns of several genes known to play pivotal roles in limb formation were examined. Sonic hedgehog (Shh), which is normally expressed in the zone of polarizing activity (ZPA) and is required to maintain both the ZPA and the apical ectodermal ridge (AER), was found to be downregulated in treated limbs within 30 h. Bone morphogenetic protein-2 (Bmp-2), a gene downstream of Shh, was similarly downregulated. Fibroblast growth factor-8 expression, however, was unaltered 30 h after treatment but was greatly reduced at 48 h post-treatment, when the AER begins to regress. Expressions of Bmp-4 and Muscle segment homeobox-like gene (Msx-1) were not affected at any of the time points examined. Cx43 expression is therefore involved in some, but not all patterning cascades, and appears to play a role in the regulation of ZPA activity.

  10. Suppression subtractive hybridization and comparative expression analysis to identify developmentally regulated genes in filamentous fungi.

    PubMed

    Gesing, Stefan; Schindler, Daniel; Nowrousian, Minou

    2013-09-01

    Ascomycetes differentiate four major morphological types of fruiting bodies (apothecia, perithecia, pseudothecia and cleistothecia) that are derived from an ancestral fruiting body. Thus, fruiting body differentiation is most likely controlled by a set of common core genes. One way to identify such genes is to search for genes with evolutionary conserved expression patterns. Using suppression subtractive hybridization (SSH), we selected differentially expressed transcripts in Pyronema confluens (Pezizales) by comparing two cDNA libraries specific for sexual and for vegetative development, respectively. The expression patterns of selected genes from both libraries were verified by quantitative real time PCR. Expression of several corresponding homologous genes was found to be conserved in two members of the Sordariales (Sordaria macrospora and Neurospora crassa), a derived group of ascomycetes that is only distantly related to the Pezizales. Knockout studies with N. crassa orthologues of differentially regulated genes revealed a functional role during fruiting body development for the gene NCU05079, encoding a putative MFS peptide transporter. These data indicate conserved gene expression patterns and a functional role of the corresponding genes during fruiting body development; such genes are candidates of choice for further functional analysis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. The roles of ERAS during cell lineage specification of mouse early embryonic development.

    PubMed

    Zhao, Zhen-Ao; Yu, Yang; Ma, Huai-Xiao; Wang, Xiao-Xiao; Lu, Xukun; Zhai, Yanhua; Zhang, Xiaoxin; Wang, Haibin; Li, Lei

    2015-08-01

    Eras encodes a Ras-like GTPase protein that was originally identified as an embryonic stem cell-specific Ras. ERAS has been known to be required for the growth of embryonic stem cells and stimulates somatic cell reprogramming, suggesting its roles on mouse early embryonic development. We now report a dynamic expression pattern of Eras during mouse peri-implantation development: its expression increases at the blastocyst stage, and specifically decreases in E7.5 mesoderm. In accordance with its expression pattern, the increased expression of Eras promotes cell proliferation through controlling AKT activation and the commitment from ground to primed state through ERK activation in mouse embryonic stem cells; and the reduced expression of Eras facilitates primitive streak and mesoderm formation through AKT inhibition during gastrulation. The expression of Eras is finely regulated to match its roles in mouse early embryonic development during which Eras expression is negatively regulated by the β-catenin pathway. Thus, beyond its well-known role on cell proliferation, ERAS may also play important roles in cell lineage specification during mouse early embryonic development. © 2015 The Authors.

  12. Identification of new regulators of embryonic patterning and morphogenesis in Xenopus gastrulae by RNA sequencing.

    PubMed

    Popov, Ivan K; Kwon, Taejoon; Crossman, David K; Crowley, Michael R; Wallingford, John B; Chang, Chenbei

    2017-06-15

    During early vertebrate embryogenesis, cell fate specification is often coupled with cell acquisition of specific adhesive, polar and/or motile behaviors. In Xenopus gastrulae, tissues fated to form different axial structures display distinct motility. The cells in the early organizer move collectively and directionally toward the animal pole and contribute to anterior mesendoderm, whereas the dorsal and the ventral-posterior trunk tissues surrounding the blastopore of mid-gastrula embryos undergo convergent extension and convergent thickening movements, respectively. While factors regulating cell lineage specification have been described in some detail, the molecular machinery that controls cell motility is not understood in depth. To gain insight into the gene battery that regulates both cell fates and motility in particular embryonic tissues, we performed RNA sequencing (RNA-seq) to investigate differentially expressed genes in the early organizer, the dorsal and the ventral marginal zone of Xenopus gastrulae. We uncovered many known signaling and transcription factors that have been reported to play roles in embryonic patterning during gastrulation. We also identified many uncharacterized genes as well as genes that encoded extracellular matrix (ECM) proteins or potential regulators of actin cytoskeleton. Co-expression of a selected subset of the differentially expressed genes with activin in animal caps revealed that they had distinct ability to block activin-induced animal cap elongation. Most of these factors did not interfere with mesodermal induction by activin, but an ECM protein, EFEMP2, inhibited activin signaling and acted downstream of the activated type I receptor. By focusing on a secreted protein kinase PKDCC1, we showed with overexpression and knockdown experiments that PKDCC1 regulated gastrulation movements as well as anterior neural patterning during early Xenopus development. Overall, our studies identify many differentially expressed signaling and cytoskeleton regulators in different embryonic regions of Xenopus gastrulae and imply their functions in regulating cell fates and/or behaviors during gastrulation. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. ERK/MAPK Regulates Hippocampal Histone Phosphorylation Following Contextual Fear Conditioning

    ERIC Educational Resources Information Center

    Levenson, Jonathan M.; Sweatt, J. David; Chwang, Wilson B.; O'Riordan, Kenneth J.

    2006-01-01

    Long-term memory formation is regulated by many distinct molecular mechanisms that control gene expression. An emerging model for effecting a stable, coordinated pattern of gene transcription involves epigenetic tagging through modifications of histones or DNA. In this study, we investigated the regulation of histone phosphorylation in the…

  14. A major gene controls mimicry and crypsis in butterflies and moths

    PubMed Central

    Nadeau, Nicola J.; Pardo-Diaz, Carolina; Whibley, Annabel; Supple, Megan; Saenko, Suzanne V.; Wallbank, Richard W. R.; Wu, Grace C.; Maroja, Luana; Ferguson, Laura; Hanly, Joseph J.; Hines, Heather; Salazar, Camilo; Merrill, Richard; Dowling, Andrea; ffrench-Constant, Richard; Llaurens, Violaine; Joron, Mathieu; McMillan, W. Owen; Jiggins, Chris D.

    2016-01-01

    The wing patterns of butterflies and moths (Lepidoptera) are diverse and striking examples of evolutionary diversification by natural selection1,2. Lepidopteran wing colour patterns are a key innovation, consisting of arrays of coloured scales. We still lack a general understanding of how these patterns are controlled and if there is any commonality across the 160,000 moth and 17,000 butterfly species. Here, we identify a gene, cortex, through fine-scale mapping using population genomics and gene expression analyses, which regulates pattern switches in multiple species across the mimetic radiation in Heliconius butterflies. cortex belongs to a fast evolving subfamily of the otherwise highly conserved fizzy family of cell cycle regulators3, suggesting that it most likely regulates pigmentation patterning through regulation of scale cell development. In parallel with findings in the peppered moth (Biston betularia)4, our results suggest that this mechanism is common within Lepidoptera and that cortex has become a major target for natural selection acting on colour and pattern variation in this group of insects. PMID:27251285

  15. The gene cortex controls mimicry and crypsis in butterflies and moths.

    PubMed

    Nadeau, Nicola J; Pardo-Diaz, Carolina; Whibley, Annabel; Supple, Megan A; Saenko, Suzanne V; Wallbank, Richard W R; Wu, Grace C; Maroja, Luana; Ferguson, Laura; Hanly, Joseph J; Hines, Heather; Salazar, Camilo; Merrill, Richard M; Dowling, Andrea J; ffrench-Constant, Richard H; Llaurens, Violaine; Joron, Mathieu; McMillan, W Owen; Jiggins, Chris D

    2016-06-02

    The wing patterns of butterflies and moths (Lepidoptera) are diverse and striking examples of evolutionary diversification by natural selection. Lepidopteran wing colour patterns are a key innovation, consisting of arrays of coloured scales. We still lack a general understanding of how these patterns are controlled and whether this control shows any commonality across the 160,000 moth and 17,000 butterfly species. Here, we use fine-scale mapping with population genomics and gene expression analyses to identify a gene, cortex, that regulates pattern switches in multiple species across the mimetic radiation in Heliconius butterflies. cortex belongs to a fast-evolving subfamily of the otherwise highly conserved fizzy family of cell-cycle regulators, suggesting that it probably regulates pigmentation patterning by regulating scale cell development. In parallel with findings in the peppered moth (Biston betularia), our results suggest that this mechanism is common within Lepidoptera and that cortex has become a major target for natural selection acting on colour and pattern variation in this group of insects.

  16. YODA MAP3K kinase regulates plant immune responses conferring broad-spectrum disease resistance.

    PubMed

    Sopeña-Torres, Sara; Jordá, Lucía; Sánchez-Rodríguez, Clara; Miedes, Eva; Escudero, Viviana; Swami, Sanjay; López, Gemma; Piślewska-Bednarek, Mariola; Lassowskat, Ines; Lee, Justin; Gu, Yangnan; Haigis, Sabine; Alexander, Danny; Pattathil, Sivakumar; Muñoz-Barrios, Antonio; Bednarek, Pawel; Somerville, Shauna; Schulze-Lefert, Paul; Hahn, Michael G; Scheel, Dierk; Molina, Antonio

    2018-04-01

    Mitogen-activated protein kinases (MAPKs) cascades play essential roles in plants by transducing developmental cues and environmental signals into cellular responses. Among the latter are microbe-associated molecular patterns perceived by pattern recognition receptors (PRRs), which trigger immunity. We found that YODA (YDA) - a MAPK kinase kinase regulating several Arabidopsis developmental processes, like stomatal patterning - also modulates immune responses. Resistance to pathogens is compromised in yda alleles, whereas plants expressing the constitutively active YDA (CA-YDA) protein show broad-spectrum resistance to fungi, bacteria, and oomycetes with different colonization modes. YDA functions in the same pathway as ERECTA (ER) Receptor-Like Kinase, regulating both immunity and stomatal patterning. ER-YDA-mediated immune responses act in parallel to canonical disease resistance pathways regulated by phytohormones and PRRs. CA-YDA plants exhibit altered cell-wall integrity and constitutively express defense-associated genes, including some encoding putative small secreted peptides and PRRs whose impairment resulted in enhanced susceptibility phenotypes. CA-YDA plants show strong reprogramming of their phosphoproteome, which contains protein targets distinct from described MAPKs substrates. Our results suggest that, in addition to stomata development, the ER-YDA pathway regulates an immune surveillance system conferring broad-spectrum disease resistance that is distinct from the canonical pathways mediated by described PRRs and defense hormones. © 2018 Universidad Politécnica de Madrid (UPM) New Phytologist © 2018 New Phytologist Trust.

  17. Regulation of Human Skin Pigmentation in situ by Repetitive UV Exposure – Molecular Characterization of Responses to UVA and/or UVB

    PubMed Central

    Choi, Wonseon; Miyamura, Yoshinori; Wolber, Rainer; Smuda, Christoph; Reinhold, William; Liu, Hongfang; Kolbe, Ludger; Hearing, Vincent J.

    2012-01-01

    Ultraviolet (UV) radiation is a major environmental factor that affects pigmentation in human skin and can eventually result in various types of UV-induced skin cancers. The effects of various wavelengths of UV on melanocytes and other types of skin cells in culture have been studied but little is known about gene expression patterns in situ following in situe exposure of human skin to different types of UV (UVA and/or UVB). Paracrine factors expressed by keratinocytes and/or fibroblasts that affect skin pigmentation might be regulated differently by UV, as might their corresponding receptors expressed on melanocytes. To test the hypothesis that different mechanisms are involved in the pigmentary responses of the skin to different types of UV, we used immunohistochemical and whole human genome microarray analyses to characterize human skin in situ to examine how melanocyte-specific proteins and paracrine melanogenic factors are regulated by repetitive exposure to different types of UV compared with unexposed skin as a control. The results show that gene expression patterns induced by UVA or UVB are distinct, UVB eliciting dramatic increases in a large number of genes involved in pigmentation as well as in other cellular functions, while UVA had little or no effect on those. The expression patterns characterize the distinct responses of the skin to UVA or UVB, and identify several potential previously unidentified factors involved in UV-induced responses of human skin. PMID:20147966

  18. New insights into roles of cell wall invertase in early seed development revealed by comprehensive spatial and temporal expression patterns of GhCWIN1 in cotton.

    PubMed

    Wang, Lu; Ruan, Yong-Ling

    2012-10-01

    Despite substantial evidence on the essential roles of cell wall invertase (CWIN) in seed filling, it remains largely unknown how CWIN exerts its regulation early in seed development, a critical stage that sets yield potential. To fill this knowledge gap, we systematically examined the spatial and temporal expression patterns of a major CWIN gene, GhCWIN1, in cotton (Gossypium hirsutum) seeds from prefertilization to prestorage phase. GhCWIN1 messenger RNA was abundant at the innermost seed coat cell layer at 5 d after anthesis but became undetectable at 10 d after anthesis, at the onset of its differentiation into transfer cells characterized by wall ingrowths, suggesting that CWIN may negatively regulate transfer cell differentiation. Within the filial tissues, GhCWIN1 transcript was detected in endosperm cells undergoing nuclear division but not in those cells at the cellularization stage, with similar results observed in Arabidopsis (Arabidopsis thaliana) endosperm for CWIN, AtCWIN4. These findings indicate a function of CWIN in nuclear division but not cell wall biosynthesis in endosperm, contrasting to the role proposed for sucrose synthase (Sus). Further analyses revealed a preferential expression pattern of GhCWIN1 and AtCWIN4 in the provascular region of the torpedo embryos in cotton and Arabidopsis seed, respectively, indicating a role of CWIN in vascular initiation. Together, these novel findings provide insights into the roles of CWIN in regulating early seed development spatially and temporally. By comparing with previous studies on Sus expression and in conjunction with the expression of other related genes, we propose models of CWIN- and Sus-mediated regulation of early seed development.

  19. Spectral analysis of two-signed microarray expression data.

    PubMed

    Higham, Desmond J; Kalna, Gabriela; Vass, J Keith

    2007-06-01

    We give a simple and informative derivation of a spectral algorithm for clustering and reordering complementary DNA microarray expression data. Here, expression levels of a set of genes are recorded simultaneously across a number of samples, with a positive weight reflecting up-regulation and a negative weight reflecting down-regulation. We give theoretical support for the algorithm based on a biologically justified hypothesis about the structure of the data, and illustrate its use on public domain data in the context of unsupervised tumour classification. The algorithm is derived by considering a discrete optimization problem and then relaxing to the continuous realm. We prove that in the case where the data have an inherent 'checkerboard' sign pattern, the algorithm will automatically reveal that pattern. Further, our derivation shows that the algorithm may be regarded as imposing a random graph model on the expression levels and then clustering from a maximum likelihood perspective. This indicates that the output will be tolerant to perturbations and will reveal 'near-checkerboard' patterns when these are present in the data. It is interesting to note that the checkerboard structure is revealed by the first (dominant) singular vectors--previous work on spectral methods has focussed on the case of nonnegative edge weights, where only the second and higher singular vectors are relevant. We illustrate the algorithm on real and synthetic data, and then use it in a tumour classification context on three different cancer data sets. Our results show that respecting the two-signed nature of the data (thereby distinguishing between up-regulation and down-regulation) reveals structures that cannot be gleaned from the absolute value data (where up- and down-regulation are both regarded as 'changes').

  20. Natural language indicators of differential gene regulation in the human immune system.

    PubMed

    Mehl, Matthias R; Raison, Charles L; Pace, Thaddeus W W; Arevalo, Jesusa M G; Cole, Steve W

    2017-11-21

    Adverse social conditions have been linked to a conserved transcriptional response to adversity (CTRA) in circulating leukocytes that may contribute to social gradients in disease. However, the CNS mechanisms involved remain obscure, in part because CTRA gene-expression profiles often track external social-environmental variables more closely than they do self-reported internal affective states such as stress, depression, or anxiety. This study examined the possibility that variations in patterns of natural language use might provide more sensitive indicators of the automatic threat-detection and -response systems that proximally regulate autonomic induction of the CTRA. In 22,627 audio samples of natural speech sampled from the daily interactions of 143 healthy adults, both total language output and patterns of function-word use covaried with CTRA gene expression. These language features predicted CTRA gene expression substantially better than did conventional self-report measures of stress, depression, and anxiety and did so independently of demographic and behavioral factors (age, sex, race, smoking, body mass index) and leukocyte subset distributions. This predictive relationship held when language and gene expression were sampled more than a week apart, suggesting that associations reflect stable individual differences or chronic life circumstances. Given the observed relationship between personal expression and gene expression, patterns of natural language use may provide a useful behavioral indicator of nonconsciously evaluated well-being (implicit safety vs. threat) that is distinct from conscious affective experience and more closely tracks the neurobiological processes involved in peripheral gene regulation. Copyright © 2017 the Author(s). Published by PNAS.

  1. Conservation of Endo16 expression in sea urchins despite evolutionary divergence in both cis and trans-acting components of transcriptional regulation

    NASA Technical Reports Server (NTRS)

    Romano, Laura A.; Wray, Gregory A.

    2003-01-01

    Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.

  2. The HMX/NKX homeodomain protein MLS-2 specifies the identity of the AWC sensory neuron type via regulation of the ceh-36 Otx gene in C. elegans

    PubMed Central

    Kim, Kyuhyung; Kim, Rinho; Sengupta, Piali

    2010-01-01

    The differentiated features of postmitotic neurons are dictated by the expression of specific transcription factors. The mechanisms by which the precise spatiotemporal expression patterns of these factors are regulated are poorly understood. In C. elegans, the ceh-36 Otx homeobox gene is expressed in the AWC sensory neurons throughout postembryonic development, and regulates terminal differentiation of this neuronal subtype. Here, we show that the HMX/NKX homeodomain protein MLS-2 regulates ceh-36 expression specifically in the AWC neurons. Consequently, the AWC neurons fail to express neuron type-specific characteristics in mls-2 mutants. mls-2 is expressed transiently in postmitotic AWC neurons, and directly initiates ceh-36 expression. CEH-36 subsequently interacts with a distinct site in its cis-regulatory sequences to maintain its own expression, and also directly regulates the expression of AWC-specific terminal differentiation genes. We also show that MLS-2 acts in additional neuron types to regulate their development and differentiation. Our analysis describes a transcription factor cascade that defines the unique postmitotic characteristics of a sensory neuron subtype, and provides insights into the spatiotemporal regulatory mechanisms that generate functional diversity in the sensory nervous system. PMID:20150279

  3. Different CHD chromatin remodelers are required for expression of distinct gene sets and specific stages during development of Dictyostelium discoideum

    PubMed Central

    Platt, James L.; Rogers, Benjamin J.; Rogers, Kelley C.; Harwood, Adrian J.; Kimmel, Alan R.

    2013-01-01

    Control of chromatin structure is crucial for multicellular development and regulation of cell differentiation. The CHD (chromodomain-helicase-DNA binding) protein family is one of the major ATP-dependent, chromatin remodeling factors that regulate nucleosome positioning and access of transcription factors and RNA polymerase to the eukaryotic genome. There are three mammalian CHD subfamilies and their impaired functions are associated with several human diseases. Here, we identify three CHD orthologs (ChdA, ChdB and ChdC) in Dictyostelium discoideum. These CHDs are expressed throughout development, but with unique patterns. Null mutants lacking each CHD have distinct phenotypes that reflect their expression patterns and suggest functional specificity. Accordingly, using genome-wide (RNA-seq) transcriptome profiling for each null strain, we show that the different CHDs regulate distinct gene sets during both growth and development. ChdC is an apparent ortholog of the mammalian Class III CHD group that is associated with the human CHARGE syndrome, and GO analyses of aberrant gene expression in chdC nulls suggest defects in both cell-autonomous and non-autonomous signaling, which have been confirmed through analyses of chdC nulls developed in pure populations or with low levels of wild-type cells. This study provides novel insight into the broad function of CHDs in the regulation development and disease, through chromatin-mediated changes in directed gene expression. PMID:24301467

  4. Wnt/Yes-Associated Protein Interactions During Neural Tissue Patterning of Human Induced Pluripotent Stem Cells.

    PubMed

    Bejoy, Julie; Song, Liqing; Zhou, Yi; Li, Yan

    2018-04-01

    Human induced pluripotent stem cells (hiPSCs) have special ability to self-assemble into neural spheroids or mini-brain-like structures. During the self-assembly process, Wnt signaling plays an important role in regional patterning and establishing positional identity of hiPSC-derived neural progenitors. Recently, the role of Wnt signaling in regulating Yes-associated protein (YAP) expression (nuclear or cytoplasmic), the pivotal regulator during organ growth and tissue generation, has attracted increasing interests. However, the interactions between Wnt and YAP expression for neural lineage commitment of hiPSCs remain poorly explored. The objective of this study is to investigate the effects of Wnt signaling and YAP expression on the cellular population in three-dimensional (3D) neural spheroids derived from hiPSCs. In this study, Wnt signaling was activated using CHIR99021 for 3D neural spheroids derived from human iPSK3 cells through embryoid body formation. Our results indicate that Wnt activation induces nuclear localization of YAP and upregulates the expression of HOXB4, the marker for hindbrain/spinal cord. By contrast, the cells exhibit more rostral forebrain neural identity (expression of TBR1) without Wnt activation. Cytochalasin D was then used to induce cytoplasmic YAP and the results showed the decreased HOXB4 expression. In addition, the incorporation of microparticles in the neural spheroids was investigated for the perturbation of neural patterning. This study may indicate the bidirectional interactions of Wnt signaling and YAP expression during neural tissue patterning, which have the significance in neurological disease modeling, drug screening, and neural tissue regeneration.

  5. Gene expression patterns during somatic embryo development and germination in maize Hi II callus cultures.

    PubMed

    Che, Ping; Love, Tanzy M; Frame, Bronwyn R; Wang, Kan; Carriquiry, Alicia L; Howell, Stephen H

    2006-09-01

    Gene expression patterns were profiled during somatic embryogenesis in a regeneration-proficient maize hybrid line, Hi II, in an effort to identify genes that might be used as developmental markers or targets to optimize regeneration steps for recovering maize plants from tissue culture. Gene expression profiles were generated from embryogenic calli induced to undergo embryo maturation and germination. Over 1,000 genes in the 12,060 element arrays showed significant time variation during somatic embryo development. A substantial number of genes were downregulated during embryo maturation, largely histone and ribosomal protein genes, which may result from a slowdown in cell proliferation and growth during embryo maturation. The expression of these genes dramatically recovered at germination. Other genes up-regulated during embryo maturation included genes encoding hydrolytic enzymes (nucleases, glucosidases and proteases) and a few storage genes (an alpha-zein and caleosin), which are good candidates for developmental marker genes. Germination is accompanied by the up-regulation of a number of stress response and membrane transporter genes, and, as expected, greening is associated with the up-regulation of many genes encoding photosynthetic and chloroplast components. Thus, some, but not all genes typically associated with zygotic embryogenesis are significantly up or down-regulated during somatic embryogenesis in Hi II maize line regeneration. Although many genes varied in expression throughout somatic embryo development in this study, no statistically significant gene expression changes were detected between total embryogenic callus and callus enriched for transition stage somatic embryos.

  6. Specialized Motor-Driven dusp1 Expression in the Song Systems of Multiple Lineages of Vocal Learning Birds

    PubMed Central

    Horita, Haruhito; Kobayashi, Masahiko; Liu, Wan-chun; Oka, Kotaro; Jarvis, Erich D.; Wada, Kazuhiro

    2012-01-01

    Mechanisms for the evolution of convergent behavioral traits are largely unknown. Vocal learning is one such trait that evolved multiple times and is necessary in humans for the acquisition of spoken language. Among birds, vocal learning is evolved in songbirds, parrots, and hummingbirds. Each time similar forebrain song nuclei specialized for vocal learning and production have evolved. This finding led to the hypothesis that the behavioral and neuroanatomical convergences for vocal learning could be associated with molecular convergence. We previously found that the neural activity-induced gene dual specificity phosphatase 1 (dusp1) was up-regulated in non-vocal circuits, specifically in sensory-input neurons of the thalamus and telencephalon; however, dusp1 was not up-regulated in higher order sensory neurons or motor circuits. Here we show that song motor nuclei are an exception to this pattern. The song nuclei of species from all known vocal learning avian lineages showed motor-driven up-regulation of dusp1 expression induced by singing. There was no detectable motor-driven dusp1 expression throughout the rest of the forebrain after non-vocal motor performance. This pattern contrasts with expression of the commonly studied activity-induced gene egr1, which shows motor-driven expression in song nuclei induced by singing, but also motor-driven expression in adjacent brain regions after non-vocal motor behaviors. In the vocal non-learning avian species, we found no detectable vocalizing-driven dusp1 expression in the forebrain. These findings suggest that independent evolutions of neural systems for vocal learning were accompanied by selection for specialized motor-driven expression of the dusp1 gene in those circuits. This specialized expression of dusp1 could potentially lead to differential regulation of dusp1-modulated molecular cascades in vocal learning circuits. PMID:22876306

  7. Expression of forkhead box transcription factor genes Foxp1 and Foxp2 during jaw development.

    PubMed

    Cesario, Jeffry M; Almaidhan, Asma A; Jeong, Juhee

    2016-03-01

    Development of the face is regulated by a large number of genes that are expressed in temporally and spatially specific patterns. While significant progress has been made on characterizing the genes that operate in the oral region of the face, those regulating development of the aboral (lateral) region remain largely unknown. Recently, we discovered that transcription factors LIM homeobox (LHX) 6 and LHX8, which are key regulators of oral development, repressed the expression of the genes encoding forkhead box transcription factors, Foxp1 and Foxp2, in the oral region. To gain insights into the potential role of the Foxp genes in region-specific development of the face, we examined their expression patterns in the first pharyngeal arch (primordium for the jaw) of mouse embryos at a high spatial and temporal resolution. Foxp1 and Foxp2 were preferentially expressed in the aboral and posterior parts of the first pharyngeal arch, including the developing temporomandibular joint. Through double immunofluorescence and double fluorescent RNA in situ hybridization, we found that Foxp1 was expressed in the progenitor cells for the muscle, bone, and connective tissue. Foxp2 was expressed in subsets of bone and connective tissue progenitors but not in the myoblasts. Neither gene was expressed in the dental mesenchyme nor in the oral half of the palatal shelf undergoing extensive growth and morphogenesis. Together, we demonstrated for the first time that Foxp1 and Foxp2 are expressed during craniofacial development. Our data suggest that the Foxp genes may regulate development of the aboral and posterior regions of the jaw. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Engrailed negatively regulates the expression of cell adhesion molecules connectin and neuroglian in embryonic Drosophila nervous system.

    PubMed

    Siegler, M V; Jia, X X

    1999-02-01

    Engrailed is expressed in subsets of interneurons that do not express Connectin or appreciable Neuroglian, whereas other neurons that are Engrailed negative strongly express these adhesion molecules. Connectin and Neuroglian expression are virtually eliminated in interneurons when engrailed expression is driven ubiquitously in neurons, and greatly increased when engrailed genes are lacking in mutant embryos. The data suggest that Engrailed is normally a negative regulator of Connectin and neuroglian. These are the first two "effector" genes identified in the nervous system of Drosophila as regulatory targets for Engrailed. We argue that differential Engrailed expression is crucial in determining the pattern of expression of cell adhesion molecules and thus constitutes an important determinant of neuronal shape and perhaps connectivity.

  9. The ambiguous ripening nature of the fig (Ficus carica L.) fruit: a gene-expression study of potential ripening regulators and ethylene-related genes

    PubMed Central

    Freiman, Zohar E.; Rosianskey, Yogev; Dasmohapatra, Rajeswari; Kamara, Itzhak; Flaishman, Moshe A.

    2015-01-01

    The traditional definition of climacteric and non-climacteric fruits has been put into question. A significant example of this paradox is the climacteric fig fruit. Surprisingly, ripening-related ethylene production increases following pre- or postharvest 1-methylcyclopropene (1-MCP) application in an unexpected auto-inhibitory manner. In this study, ethylene production and the expression of potential ripening-regulator, ethylene-synthesis, and signal-transduction genes are characterized in figs ripening on the tree and following preharvest 1-MCP application. Fig ripening-related gene expression was similar to that in tomato and apple during ripening on the tree, but only in the fig inflorescence–drupelet section. Because the pattern in the receptacle is different for most of the genes, the fig drupelets developed inside the syconium are proposed to function as parthenocarpic true fruit, regulating ripening processes for the whole accessory fruit. Transcription of a potential ripening regulator, FcMADS8, increased during ripening on the tree and was inhibited following 1-MCP treatment. Expression patterns of the ethylene-synthesis genes FcACS2, FcACS4, and FcACO3 could be related to the auto-inhibition reaction of ethylene production in 1-MCP-treated fruit. Along with FcMADS8 suppression, gene expression analysis revealed upregulation of FcEBF1, and downregulation of FcEIL3 and several FcERFs by 1-MCP treatment. This corresponded with the high storability of the treated fruit. One FcERF was overexpressed in the 1-MCP-treated fruit, and did not share the increasing pattern of most FcERFs in the tree-ripened fig. This demonstrates the potential of this downstream ethylene-signal-transduction component as an ethylene-synthesis regulator, responsible for the non-climacteric auto-inhibition of ethylene production in fig. PMID:25956879

  10. Complex Expression of the Cellulolytic Transcriptome of Saccharophagus degradans † ▿

    PubMed Central

    Zhang, Haitao; Hutcheson, Steven W.

    2011-01-01

    Saccharophagus degradans is an aerobic marine bacterium that can degrade cellulose by the induced expression of an unusual cellulolytic system composed of multiple endoglucanases and glucosidases. To understand the regulation of the cellulolytic system, transcript levels for the genes predicted to contribute to the cellulolytic system were monitored by quantitative real-time PCR (qRT-PCR) during the transition to growth on cellulose. Four glucanases of the cellulolytic system exhibited basal expression during growth on glucose. All but one of the predicted cellulolytic system genes were induced strongly during growth on Avicel, with three patterns of expression observed. One group showed increased expression (up to 6-fold) within 4 h of the nutritional shift, with the relative expression remaining constant over the next 22 h. A second group of genes was strongly induced between 4 and 10 h after nutritional transfer, with relative expression declining thereafter. The third group of genes was slowly induced and was expressed maximally after 24 h. Cellodextrins and cellobiose, products of the predicted basally expressed endoglucanases, stimulated expression of representative cellulase genes. A model is proposed by which the activity of basally expressed endoglucanases releases cellodextrins from Avicel that are then perceived and transduced to initiate transcription of each of the regulated cellulolytic system genes forming an expression pattern. PMID:21705539

  11. Developmental regulation of N-methyl-D-aspartate- and kainate-type glutamate receptor expression in the rat spinal cord

    NASA Technical Reports Server (NTRS)

    Stegenga, S. L.; Kalb, R. G.

    2001-01-01

    Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.

  12. Dominance and Sexual Dimorphism Pervade the Salix purpurea L. Transcriptome

    DOE PAGES

    Carlson, Craig H.; Choi, Yongwook; Chan, Agnes P.; ...

    2017-09-01

    The heritability of gene expression is critical in understanding heterosis and is dependent on allele-specific regulation by local and remote factors in the genome. We used RNA-Seq to test whether variation in gene expression among F 1 and F 2 intraspecific Salix purpurea progeny is attributable to cis- and trans-regulatory divergence. We assessed the mode of inheritance based on gene expression levels and allele-specific expression for F1 and F2 intraspecific progeny in two distinct tissue types: shoot tip and stem internode. In addition, we explored sexually dimorphic patterns of inheritance and regulatory divergence among F 1 progeny individuals. We showmore » that in S. purpurea intraspecific crosses, gene expression inheritance largely exhibits a maternal dominant pattern, regardless of tissue type or pedigree. A significantly greater number of cis- and trans-regulated genes coincided with upregulation of the maternal parent allele in the progeny, irrespective of the magnitude, whereas the paternal allele was higher expressed for genes showing cis × trans or compensatory regulation. Importantly, consistent with previous genetic mapping results for sex in shrub willow, we have delimited sex-biased gene expression to a 2 Mb pericentromeric region on S. purpurea chr15 and further refined the sex determination region. Lastly, altogether, our results offer insight into the inheritance of gene expression in S. purpurea as well as evidence of sexually dimorphic expression which may have contributed to the evolution of dioecy in Salix.« less

  13. Dominance and Sexual Dimorphism Pervade the Salix purpurea L. Transcriptome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carlson, Craig H.; Choi, Yongwook; Chan, Agnes P.

    The heritability of gene expression is critical in understanding heterosis and is dependent on allele-specific regulation by local and remote factors in the genome. We used RNA-Seq to test whether variation in gene expression among F 1 and F 2 intraspecific Salix purpurea progeny is attributable to cis- and trans-regulatory divergence. We assessed the mode of inheritance based on gene expression levels and allele-specific expression for F1 and F2 intraspecific progeny in two distinct tissue types: shoot tip and stem internode. In addition, we explored sexually dimorphic patterns of inheritance and regulatory divergence among F 1 progeny individuals. We showmore » that in S. purpurea intraspecific crosses, gene expression inheritance largely exhibits a maternal dominant pattern, regardless of tissue type or pedigree. A significantly greater number of cis- and trans-regulated genes coincided with upregulation of the maternal parent allele in the progeny, irrespective of the magnitude, whereas the paternal allele was higher expressed for genes showing cis × trans or compensatory regulation. Importantly, consistent with previous genetic mapping results for sex in shrub willow, we have delimited sex-biased gene expression to a 2 Mb pericentromeric region on S. purpurea chr15 and further refined the sex determination region. Lastly, altogether, our results offer insight into the inheritance of gene expression in S. purpurea as well as evidence of sexually dimorphic expression which may have contributed to the evolution of dioecy in Salix.« less

  14. Seasonal Abscisic Acid Signal and a Basic Leucine Zipper Transcription Factor, DkbZIP5, Regulate Proanthocyanidin Biosynthesis in Persimmon Fruit1[C][W][OA

    PubMed Central

    Akagi, Takashi; Katayama-Ikegami, Ayako; Kobayashi, Shozo; Sato, Akihiko; Kono, Atsushi; Yonemori, Keizo

    2012-01-01

    Proanthocyanidins (PAs) are secondary metabolites that contribute to plant protection and crop quality. Persimmon (Diospyros kaki) has a unique characteristic of accumulating large amounts of PAs, particularly in its fruit. Normal astringent-type and mutant nonastringent-type fruits show different PA accumulation patterns depending on the seasonal expression patterns of DkMyb4, which is a Myb transcription factor (TF) regulating many PA pathway genes in persimmon. In this study, attempts were made to identify the factors involved in DkMyb4 expression and the resultant PA accumulation in persimmon fruit. Treatment with abscisic acid (ABA) and an ABA biosynthesis inhibitor resulted in differential changes in the expression patterns of DkMyb4 and PA biosynthesis in astringent-type and nonastringent-type fruits depending on the development stage. To obtain an ABA-signaling TF, we isolated a full-length basic leucine zipper (bZIP) TF, DkbZIP5, which is highly expressed in persimmon fruit. We also showed that ectopic DkbZIP5 overexpression in persimmon calluses induced the up-regulation of DkMyb4 and the resultant PA biosynthesis. In addition, a detailed molecular characterization using the electrophoretic mobility shift assay and transient reporter assay indicated that DkbZIP5 recognized ABA-responsive elements in the promoter region of DkMyb4 and acted as a direct regulator of DkMyb4 in an ABA-dependent manner. These results suggest that ABA signals may be involved in PA biosynthesis in persimmon fruit via DkMyb4 activation by DkbZIP5. PMID:22190340

  15. MicroRNA, mRNA, and protein expression link development and aging in human and macaque brain

    PubMed Central

    Somel, Mehmet; Guo, Song; Fu, Ning; Yan, Zheng; Hu, Hai Yang; Xu, Ying; Yuan, Yuan; Ning, Zhibin; Hu, Yuhui; Menzel, Corinna; Hu, Hao; Lachmann, Michael; Zeng, Rong; Chen, Wei; Khaitovich, Philipp

    2010-01-01

    Changes in gene expression levels determine differentiation of tissues involved in development and are associated with functional decline in aging. Although development is tightly regulated, the transition between development and aging, as well as regulation of post-developmental changes, are not well understood. Here, we measured messenger RNA (mRNA), microRNA (miRNA), and protein expression in the prefrontal cortex of humans and rhesus macaques over the species' life spans. We find that few gene expression changes are unique to aging. Instead, the vast majority of miRNA and gene expression changes that occur in aging represent reversals or extensions of developmental patterns. Surprisingly, many gene expression changes previously attributed to aging, such as down-regulation of neural genes, initiate in early childhood. Our results indicate that miRNA and transcription factors regulate not only developmental but also post-developmental expression changes, with a number of regulatory processes continuing throughout the entire life span. Differential evolutionary conservation of the corresponding genomic regions implies that these regulatory processes, although beneficial in development, might be detrimental in aging. These results suggest a direct link between developmental regulation and expression changes taking place in aging. PMID:20647238

  16. Patterning C. elegans: homeotic cluster genes, cell fates and cell migrations.

    PubMed

    Salser, S J; Kenyon, C

    1994-05-01

    Despite its simple body form, the nematode C. elegans expresses homeotic cluster genes similar to those of insects and vertebrates in the patterning of many cell types and tissues along the anteroposterior axis. In the ventral nerve cord, these genes program spatial patterns of cell death, fusion, division and neurotransmitter production; in migrating cells they regulate the direction and extent of movement. Nematode development permits an analysis at the cellular level of how homeotic cluster genes interact to specify cell fates, and how cell behavior can be regulated to assemble an organism.

  17. Vertebrate homologues of Frodo are dynamically expressed during embryonic development in tissues undergoing extensive morphogenetic movements.

    PubMed

    Hunter, Nina L; Hikasa, Hiroki; Dymecki, Susan M; Sokol, Sergei Y

    2006-01-01

    Frodo has been identified as a protein interacting with Dishevelled, an essential mediator of the Wnt signaling pathway, critical for the determination of cell fate and polarity in embryonic development. In this study, we use specific gene probes to characterize stage- and tissue-specific expression patterns of the mouse Frodo homologue and compare them with Frodo expression patterns in Xenopus embryos. In situ hybridization analysis of mouse Frodo transcripts demonstrates that, similar to Xenopus Frodo, mouse Frodo is expressed in primitive streak mesoderm, neuroectoderm, neural crest, presomitic mesoderm, and somites. In many cases, Frodo expression is confined to tissues undergoing extensive morphogenesis, suggesting that Frodo may be involved in the regulation of cell shape and motility. Highly conserved dynamic expression patterns of Frodo homologues indicate a similar function for these proteins in different vertebrates. 2005 Wiley-Liss, Inc.

  18. Potential roles for transposable elements in creating imprinted expression.

    PubMed

    Anderson, Sarah N; Springer, Nathan M

    2018-04-01

    Changes in gene expression can have profound effects on phenotype. Nature has provided many complex patterns of gene regulation such as imprinting. Imprinted genes exhibit differences in the expression of the maternal and paternal alleles, even though they reside in the same nucleus with access to the same trans-acting factors. Significant attention has been focused on the potential reasons that imprinted expression could be beneficial and stabilized by selection. However, less attention has focused on understanding how imprinted expression might arise or decay. We discuss the evidence for frequent turnover of imprinted expression based on evolutionary analyses in plants and the potential role for transposable elements (TEs) in creating imprinted expression patterns. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Gene Expression Networks Underlying Ovarian Development in Wild Largemouth Bass (Micropterus salmoides)

    PubMed Central

    Martyniuk, Christopher J.; Prucha, Melinda S.; Doperalski, Nicholas J.; Antczak, Philipp; Kroll, Kevin J.; Falciani, Francesco; Barber, David S.; Denslow, Nancy D.

    2013-01-01

    Background Oocyte maturation in fish involves numerous cell signaling cascades that are activated or inhibited during specific stages of oocyte development. The objectives of this study were to characterize molecular pathways and temporal gene expression patterns throughout a complete breeding cycle in wild female largemouth bass to improve understanding of the molecular sequence of events underlying oocyte maturation. Methods Transcriptomic analysis was performed on eight morphologically diverse stages of the ovary, including primary and secondary stages of oocyte growth, ovulation, and atresia. Ovary histology, plasma vitellogenin, 17β-estradiol, and testosterone were also measured to correlate with gene networks. Results Global expression patterns revealed dramatic differences across ovarian development, with 552 and 2070 genes being differentially expressed during both ovulation and atresia respectively. Gene set enrichment analysis (GSEA) revealed that early primary stages of oocyte growth involved increases in expression of genes involved in pathways of B-cell and T-cell receptor-mediated signaling cascades and fibronectin regulation. These pathways as well as pathways that included adrenergic receptor signaling, sphingolipid metabolism and natural killer cell activation were down-regulated at ovulation. At atresia, down-regulated pathways included gap junction and actin cytoskeleton regulation, gonadotrope and mast cell activation, and vasopressin receptor signaling and up-regulated pathways included oxidative phosphorylation and reactive oxygen species metabolism. Expression targets for luteinizing hormone signaling were low during vitellogenesis but increased 150% at ovulation. Other networks found to play a significant role in oocyte maturation included those with genes regulated by members of the TGF-beta superfamily (activins, inhibins, bone morphogenic protein 7 and growth differentiation factor 9), neuregulin 1, retinoid X receptor, and nerve growth factor family. Conclusions This study offers novel insight into the gene networks underlying vitellogenesis, ovulation and atresia and generates new hypotheses about the cellular pathways regulating oocyte maturation. PMID:23527095

  20. Finding new pathway-specific regulators by clustering method using threshold standard deviation based on DNA chip data of Streptomyces coelicolor.

    PubMed

    Yang, Yung-Hun; Kim, Ji-Nu; Song, Eunjung; Kim, Eunjung; Oh, Min-Kyu; Kim, Byung-Gee

    2008-09-01

    In order to identify the regulators involved in antibiotic production or time-specific cellular events, the messenger ribonucleic acid (mRNA) expression data of the two gene clusters, actinorhodin (ACT) and undecylprodigiosin (RED) biosynthetic genes, were clustered with known mRNA expression data of regulators from S. coelicolor using a filtering method based on standard deviation and clustering analysis. The result identified five regulators including two well-known regulators namely, SCO3579 (WlbA) and SCO6722 (SsgD). Using overexpression and deletion of the regulator genes, we were able to identify two regulators, i.e., SCO0608 and SCO6808, playing roles as repressors in antibiotics production and sporulation. This approach can be easily applied to mapping out new regulators related to any interesting target gene clusters showing characteristic expression patterns. The result can also be used to provide insightful information on the selection rules among a large number of regulators.

  1. Combining laser microdissection and RNA-seq to chart the transcriptional landscape of fungal development

    PubMed Central

    2012-01-01

    Background During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the protection and dispersal of sexual spores. Fruiting bodies contain a number of cell types not found in vegetative mycelium, and these morphological differences are thought to be mediated by changes in gene expression. However, little is known about the spatial distribution of gene expression in fungal development. Here, we used laser microdissection (LM) and RNA-seq to determine gene expression patterns in young fruiting bodies (protoperithecia) and non-reproductive mycelia of the ascomycete Sordaria macrospora. Results Quantitative analysis showed major differences in the gene expression patterns between protoperithecia and total mycelium. Among the genes strongly up-regulated in protoperithecia were the pheromone precursor genes ppg1 and ppg2. The up-regulation was confirmed by fluorescence microscopy of egfp expression under the control of ppg1 regulatory sequences. RNA-seq analysis of protoperithecia from the sterile mutant pro1 showed that many genes that are differentially regulated in these structures are under the genetic control of transcription factor PRO1. Conclusions We have generated transcriptional profiles of young fungal sexual structures using a combination of LM and RNA-seq. This allowed a high spatial resolution and sensitivity, and yielded a detailed picture of gene expression during development. Our data revealed significant differences in gene expression between protoperithecia and non-reproductive mycelia, and showed that the transcription factor PRO1 is involved in the regulation of many genes expressed specifically in sexual structures. The LM/RNA-seq approach will also be relevant to other eukaryotic systems in which multicellular development is investigated. PMID:23016559

  2. Up-regulated ephrinB3/EphB3 expression in intractable temporal lobe epilepsy patients and pilocarpine induced experimental epilepsy rat model.

    PubMed

    Huang, Hao; Li, Ruohan; Yuan, Jinxian; Zhou, Xin; Liu, Xi; Ou, Shu; Xu, Tao; Chen, Yangmei

    2016-05-15

    EphB family receptor tyrosine kinases, in cooperation with cell surface-bound ephrinB ligands, play a critical role in maintenance of dendritic spine morphogenesis, axons guidance, synaptogenesis, synaptic reorganization and plasticity in the central nervous system (CNS). However, the expression pattern of ephrinB/EphB in intractable temporal lobe epilepsy (TLE) and the underlying molecular mechanisms during epileptogenesis remain poorly understood. Here we investigated the expression pattern and cellular distribution of ephrinB/EphB in intractable TLE patients and lithium chloride-pilocarpine induced TLE rats using real-time quantitative polymerase chain reaction (RT-qPCR), immunohistochemistry, double-labeled immunofluorescence and Western blot analysis. Compared to control groups, ephrinB3 and EphB3 mRNA expression were significantly up-regulated in intractable TLE patients and TLE rats, while the mRNA expression trend of ephrinB1/2 and EphB1/2/4/6 in intractable TLE patients and TLE rats were inconsistent. Western blot analysis and semi-quantitative immunohistochemistry confirmed that ephrinB3 and EphB3 protein level were up-regulated in intractable TLE patients and TLE rats. At the same time, double-labeled immunofluorescence indicate that ephrinB3 was expressed mainly in the cytoplasm and protrusions of glia and neurons, while EphB3 was expressed mainly in the cytoplasm of neurons. Taken together, up-regulated expression of ephrinB3/EphB3 in intractable TLE patients and experimental TLE rats suggested that ephrinB3/EphB3 might be involved in the pathogenesis of TLE. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. VDR regulation of microRNA differs across prostate cell models suggesting extremely flexible control of transcription.

    PubMed

    Singh, Prashant K; Long, Mark D; Battaglia, Sebastiano; Hu, Qiang; Liu, Song; Sucheston-Campbell, Lara E; Campbell, Moray J

    2015-01-01

    The Vitamin D Receptor (VDR) is a member of the nuclear receptor superfamily and is of therapeutic interest in cancer and other settings. Regulation of microRNA (miRNA) by the VDR appears to be important to mediate its actions, for example, to control cell growth. To identify if and to what extent VDR-regulated miRNA patterns change in prostate cancer progression, we undertook miRNA microarray analyses in 7 cell models representing non-malignant and malignant prostate cells (RWPE-1, RWPE-2, HPr1, HPr1AR, LNCaP, LNCaP-C4-2, and PC-3). To focus on primary VDR regulatory events, we undertook expression analyses after 30 minutes treatment with 1α,25(OH)2D3. Across all models, 111 miRNAs were significantly modulated by 1α,25(OH)2D3 treatment. Of these, only 5 miRNAs were modulated in more than one cell model, and of these, only 3 miRNAs were modulated in the same direction. The patterns of miRNA regulation, and the networks they targeted, significantly distinguished the different cell types. Integration of 1α,25(OH)2D3-regulated miRNAs with published VDR ChIP-seq data showed significant enrichment of VDR peaks in flanking regions of miRNAs. Furthermore, mRNA and miRNA expression analyses in non-malignant RWPE-1 cells revealed patterns of miRNA and mRNA co-regulation; specifically, 13 significant reciprocal patterns were identified and these patterns were also observed in TCGA prostate cancer data. Lastly, motif search analysis revealed differential motif enrichment within VDR peaks flanking mRNA compared to miRNA genes. Together, this study revealed that miRNAs are rapidly regulated in a highly cell-type specific manner, and are significantly co-integrated with mRNA regulation.

  4. Expression Patterns of Three Genes Under Short and Long Term Cold Exposure in Thitarodes pui (Lepidoptera: Hepialidae), A Host of Ophiocordyceps sinensis.

    PubMed

    Min, Q; Cheng, S Y; Xi, J F; Ma, J; Xin, T R; Xia, B; Zou, Z W

      BACKGROUND: Thitarodes larvae are the host of the caterpillar fungus Ophiocordyceps sinensis. Low temperature is the main environmental limitation for larvae growth. To better understand the cold adaption process in T. pui larvae, the expression patterns of trehalose-6-phosphate synthase (TpTPS), heat shock protein 70 (TpHSP70), and heat shock protein 90 (TpHSP90) were investigated upon short and long-term exposure to 0°C. The 6th instar T. pui larvae were collected in July 2013. TpTPS was firstly sequenced and expression patterns of TpTPS, TpHSP70 and TpHSP90 were investigated using quantitative PCR. Full-length cDNA of TpTPS was 3,012 bp, with an open reading frame of 2,472 bp and an encoding protein of 823 amino acids. TpTPS up-regulation was induced by cold exposure. TpHSP70 expression is altered by cold exposure, but remained low. TpHSP90 expression was obviously up regulated in long-term cold stimulation. All three genes (TpTPS, TpHSP70 and TpHSP90) have likely contributed to cold tolerance in T. pui larvae, TpTPS and TpHSP90 potentially being more important.

  5. Cell Fusion Reprogramming Leads to a Specific Hepatic Expression Pattern during Mouse Bone Marrow Derived Hepatocyte Formation In Vivo

    PubMed Central

    Arza, Elvira; Alvarez-Barrientos, Alberto; Fabregat, Isabel; Garcia-Bravo, Maria; Meza, Nestor W.; Segovia, Jose C.

    2012-01-01

    The fusion of bone marrow (BM) hematopoietic cells with hepatocytes to generate BM derived hepatocytes (BMDH) is a natural process, which is enhanced in damaged tissues. However, the reprogramming needed to generate BMDH and the identity of the resultant cells is essentially unknown. In a mouse model of chronic liver damage, here we identify a modification in the chromatin structure of the hematopoietic nucleus during BMDH formation, accompanied by the loss of the key hematopoietic transcription factor PU.1/Sfpi1 (SFFV proviral integration 1) and gain of the key hepatic transcriptional regulator HNF-1A homeobox A (HNF-1A/Hnf1a). Through genome-wide expression analysis of laser captured BMDH, a differential gene expression pattern was detected and the chromatin changes observed were confirmed at the level of chromatin regulator genes. Similarly, Tranforming Growth Factor-β1 (TGF-β1) and neurotransmitter (e.g. Prostaglandin E Receptor 4 [Ptger4]) pathway genes were over-expressed. In summary, in vivo BMDH generation is a process in which the hematopoietic cell nucleus changes its identity and acquires hepatic features. These BMDHs have their own cell identity characterized by an expression pattern different from hematopoietic cells or hepatocytes. The role of these BMDHs in the liver requires further investigation. PMID:22457803

  6. Transcriptional regulation of arylalkylamine-N-acetyltransferase-2 gene in the pineal gland of the gilthead seabream.

    PubMed

    Zilberman-Peled, B; Appelbaum, L; Vallone, D; Foulkes, N S; Anava, S; Anzulovich, A; Coon, S L; Klein, D C; Falcón, J; Ron, B; Gothilf, Y

    2007-01-01

    Pineal serotonin-N-acetyltransferase (arylalkylamine-N-acetyltransferase; AANAT) is considered the key enzyme in the generation of circulating melatonin rhythms; the rate of melatonin production is determined by AANAT activity. In all the examined species, AANAT activity is regulated at the post-translational level and, to a variable degree, also at the transcriptional level. Here, the transcriptional regulation of pineal aanat (aanat2) of the gilthead seabream (Sparus aurata) was investigated. Real-time polymerase chain reaction quantification of aanat2 mRNA levels in the pineal gland collected throughout the 24-h cycle revealed a rhythmic expression pattern. In cultured pineal glands, the amplitude was reduced, but the daily rhythmic expression pattern was maintained under constant illumination, indicating a circadian clock-controlled regulation of seabream aanat2. DNA constructs were prepared in which green fluorescent protein was driven by the aanat2 promoters of seabream and Northern pike. In vivo transient expression analyses in zebrafish embryos indicated that these promoters contain the necessary elements to drive enhanced expression in the pineal gland. In the light-entrainable clock-containing PAC-2 zebrafish cell line, a stably transfected seabream aanat2 promoter-luciferase DNA construct exhibited a clock-controlled circadian rhythm of luciferase activity, characteristic for an E-box-driven expression. In NIH-3T3 cells, the seabream aanat2 promoter was activated by a synergistic action of BMAL/CLOCK and orthodenticle homeobox 5 (OTX5). Promoter sequence analyses revealed the presence of the photoreceptor conserved element and an extended E-box (i.e. the binding sites for BMAL/CLOCK and OTX5 that have been previously associated with pineal-specific and rhythmic gene expression). These results suggest that seabream aanat2 is a clock-controlled gene that is regulated by conserved mechanisms.

  7. Systematical analysis of cutaneous squamous cell carcinoma network of microRNAs, transcription factors, and target and host genes.

    PubMed

    Wang, Ning; Xu, Zhi-Wen; Wang, Kun-Hao

    2014-01-01

    MicroRNAs (miRNAs) are small non-coding RNA molecules found in multicellular eukaryotes which are implicated in development of cancer, including cutaneous squamous cell carcinoma (cSCC). Expression is controlled by transcription factors (TFs) that bind to specific DNA sequences, thereby controlling the flow (or transcription) of genetic information from DNA to messenger RNA. Interactions result in biological signal control networks. Molecular components involved in cSCC were here assembled at abnormally expressed, related and global levels. Networks at these three levels were constructed with corresponding biological factors in term of interactions between miRNAs and target genes, TFs and miRNAs, and host genes and miRNAs. Up/down regulation or mutation of the factors were considered in the context of the regulation and significant patterns were extracted. Participants of the networks were evaluated based on their expression and regulation of other factors. Sub-networks with two core TFs, TP53 and EIF2C2, as the centers are identified. These share self-adapt feedback regulation in which a mutual restraint exists. Up or down regulation of certain genes and miRNAs are discussed. Some, for example the expression of MMP13, were in line with expectation while others, including FGFR3, need further investigation of their unexpected behavior. The present research suggests that dozens of components, miRNAs, TFs, target genes and host genes included, unite as networks through their regulation to function systematically in human cSCC. Networks built under the currently available sources provide critical signal controlling pathways and frequent patterns. Inappropriate controlling signal flow from abnormal expression of key TFs may push the system into an incontrollable situation and therefore contributes to cSCC development.

  8. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  9. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herbert, Katharine J.; Holloway, Adele; Cook, Anthony L.

    2014-11-15

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylationmore » of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation of histone H4 (Lys 16). • Continual extended exposure to arsenic reorganises the pattern of SIRT1 and miR-34a promoter methylation.« less

  10. Prediction of epigenetically regulated genes in breast cancer cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines,more » which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identifed 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.« less

  11. Genome-wide analysis and expression profiling of the GRF gene family in oilseed rape (Brassica napus L.).

    PubMed

    Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na

    2017-07-15

    Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.

  12. Differential skeletal muscle proteome of high- and low-active mice

    PubMed Central

    Dangott, Lawrence J.; Schmitt, Emily E.; Vellers, Heather L.; Lightfoot, J. Timothy

    2014-01-01

    Physical inactivity contributes to cardiovascular disease, type II diabetes, obesity, and some types of cancer. While the literature is clear that there is genetic regulation of physical activity with existing gene knockout data suggesting that skeletal muscle mechanisms contribute to the regulation of activity, actual differences in end-protein expression between high- and low-active mice have not been investigated. This study used two-dimensional differential gel electrophoresis coupled with mass spectrometry to evaluate the proteomic differences between high-active (C57L/J) and low-active (C3H/HeJ) mice in the soleus and extensor digitorum longus (EDL). Furthermore, vivo-morpholinos were used to transiently knockdown candidate proteins to confirm their involvement in physical activity regulation. Proteins with higher expression patterns generally fell into the calcium-regulating and Krebs (TCA) cycle pathways in the high-active mice (e.g., annexin A6, P = 0.0031; calsequestrin 1; P = 0.000025), while the overexpressed proteins in the low-active mice generally fell into cytoskeletal structure- and electron transport chain-related pathways (e.g., ATPase, P = 0.031; NADH dehydrogenase, P = 0.027). Transient knockdown of annexin A6 and calsequestrin 1 protein of high-active mice with vivo-morpholinos resulted in decreased physical activity levels (P = 0.001). These data suggest that high- and low-active mice have unique protein expression patterns and that each pattern contributes to the peripheral capability to be either high- or low-active, suggesting that different specific mechanisms regulate activity leading to the high- or low-activity status of the animal. PMID:24505100

  13. Time course of gene expression during mouse skeletal muscle hypertrophy

    PubMed Central

    Lee, Jonah D.; England, Jonathan H.; Esser, Karyn A.; McCarthy, John J.

    2013-01-01

    The purpose of this study was to perform a comprehensive transcriptome analysis during skeletal muscle hypertrophy to identify signaling pathways that are operative throughout the hypertrophic response. Global gene expression patterns were determined from microarray results on days 1, 3, 5, 7, 10, and 14 during plantaris muscle hypertrophy induced by synergist ablation in adult mice. Principal component analysis and the number of differentially expressed genes (cutoffs ≥2-fold increase or ≥50% decrease compared with control muscle) revealed three gene expression patterns during overload-induced hypertrophy: early (1 day), intermediate (3, 5, and 7 days), and late (10 and 14 days) patterns. Based on the robust changes in total RNA content and in the number of differentially expressed genes, we focused our attention on the intermediate gene expression pattern. Ingenuity Pathway Analysis revealed a downregulation of genes encoding components of the branched-chain amino acid degradation pathway during hypertrophy. Among these genes, five were predicted by Ingenuity Pathway Analysis or previously shown to be regulated by the transcription factor Kruppel-like factor-15, which was also downregulated during hypertrophy. Moreover, the integrin-linked kinase signaling pathway was activated during hypertrophy, and the downregulation of muscle-specific micro-RNA-1 correlated with the upregulation of five predicted targets associated with the integrin-linked kinase pathway. In conclusion, we identified two novel pathways that may be involved in muscle hypertrophy, as well as two upstream regulators (Kruppel-like factor-15 and micro-RNA-1) that provide targets for future studies investigating the importance of these pathways in muscle hypertrophy. PMID:23869057

  14. Time course of gene expression during mouse skeletal muscle hypertrophy.

    PubMed

    Chaillou, Thomas; Lee, Jonah D; England, Jonathan H; Esser, Karyn A; McCarthy, John J

    2013-10-01

    The purpose of this study was to perform a comprehensive transcriptome analysis during skeletal muscle hypertrophy to identify signaling pathways that are operative throughout the hypertrophic response. Global gene expression patterns were determined from microarray results on days 1, 3, 5, 7, 10, and 14 during plantaris muscle hypertrophy induced by synergist ablation in adult mice. Principal component analysis and the number of differentially expressed genes (cutoffs ≥2-fold increase or ≥50% decrease compared with control muscle) revealed three gene expression patterns during overload-induced hypertrophy: early (1 day), intermediate (3, 5, and 7 days), and late (10 and 14 days) patterns. Based on the robust changes in total RNA content and in the number of differentially expressed genes, we focused our attention on the intermediate gene expression pattern. Ingenuity Pathway Analysis revealed a downregulation of genes encoding components of the branched-chain amino acid degradation pathway during hypertrophy. Among these genes, five were predicted by Ingenuity Pathway Analysis or previously shown to be regulated by the transcription factor Kruppel-like factor-15, which was also downregulated during hypertrophy. Moreover, the integrin-linked kinase signaling pathway was activated during hypertrophy, and the downregulation of muscle-specific micro-RNA-1 correlated with the upregulation of five predicted targets associated with the integrin-linked kinase pathway. In conclusion, we identified two novel pathways that may be involved in muscle hypertrophy, as well as two upstream regulators (Kruppel-like factor-15 and micro-RNA-1) that provide targets for future studies investigating the importance of these pathways in muscle hypertrophy.

  15. RNA-sequence analysis of gene expression from honeybees (Apis mellifera) infected with Nosema ceranae

    PubMed Central

    Fougeroux, André; Petit, Fabien; Anselmo, Anna; Gorni, Chiara; Cucurachi, Marco; Cersini, Antonella; Granato, Anna; Cardeti, Giusy; Formato, Giovanni; Mutinelli, Franco; Giuffra, Elisabetta; Williams, John L.; Botti, Sara

    2017-01-01

    Honeybees (Apis mellifera) are constantly subjected to many biotic stressors including parasites. This study examined honeybees infected with Nosema ceranae (N. ceranae). N. ceranae infection increases the bees energy requirements and may contribute to their decreased survival. RNA-seq was used to investigate gene expression at days 5, 10 and 15 Post Infection (P.I) with N. ceranae. The expression levels of genes, isoforms, alternative transcription start sites (TSS) and differential promoter usage revealed a complex pattern of transcriptional and post-transcriptional gene regulation suggesting that bees use a range of tactics to cope with the stress of N. ceranae infection. N. ceranae infection may cause reduced immune function in the bees by: (i)disturbing the host amino acids metabolism (ii) down-regulating expression of antimicrobial peptides (iii) down-regulation of cuticle coatings and (iv) down-regulation of odorant binding proteins. PMID:28350872

  16. X chromosome regulation: diverse patterns in development, tissues and disease

    PubMed Central

    Deng, Xinxian; Berletch, Joel B.; Nguyen, Di K.; Disteche, Christine M.

    2014-01-01

    Genes on the mammalian X chromosome are present in one copy in males and two copies in females. The complex mechanisms that regulate the X chromosome lead to evolutionary and physiological variability in gene expression between species, the sexes, individuals, developmental stages, tissues and cell types. In early development, delayed and incomplete X chromosome inactivation (XCI) in some species causes variability in gene expression. Additional diversity stems from escape from XCI and from mosaicism or XCI skewing in females. This causes sex-specific differences that manifest as differential gene expression and associated phenotypes. Furthermore, the complexity and diversity of X dosage regulation affect the severity of diseases caused by X-linked mutations. PMID:24733023

  17. Altered gene expression in tree shrew retina and retinal pigment epithelium produced by short periods of minus-lens wear.

    PubMed

    He, Li; Frost, Michael R; Siegwart, John T; Norton, Thomas T

    2018-03-01

    Hyperopic refractive error is detected by retinal neurons, which generate GO signals through a direct emmetropization signaling cascade: retinal pigment epithelium (RPE) into choroid and then into sclera, thereby increasing axial elongation. To examine signaling early in this cascade, we measured gene expression in the retina and RPE after short exposure to hyperopia produced by minus-lens wear. Gene expression in each tissue was compared with gene expression in combined retina + RPE. Starting 24 days after normal eye opening, three groups of juvenile tree shrews (n = 7 each) wore a monocular -5 D lens. The untreated fellow eye served as a control. The "6h" group wore the lens for 6 h; the "24h" group wore the lens for 24 h; each group provided separate retina and RPE tissues. Group "24hC" wore the lens for 24 h and provided combined retina + RPE tissue. Quantitative PCR was used to measure the relative differences (treated eye vs. control eye) in mRNA levels for 66 candidate genes. In the retina after 6 h, mRNA levels for seven genes were significantly regulated: EGR1 and FOS (early intermediate genes) were down-regulated in the treated eyes. Genes with secreted protein products, BMP2 and CTGF, were down-regulated, whilst FGF10, IL18, and SST were up-regulated. After 24 h the pattern changed; only one of the seven genes still showed differential expression; BMP2 was still down-regulated. Two new genes with secreted protein products, IGF2 and VIP, were up-regulated. In the RPE, consistent with its role in receiving, processing, and transmitting GO signaling, differential expression was found for genes whose protein products are at the cell surface, intracellular, in the nucleus, and are secreted. After 6 h, mRNA levels for 17 genes were down-regulated in the treated eyes, whilst four genes (GJA1, IGF2R, LRP2, and IL18) were up-regulated. After 24 h the pattern was similar; mRNA levels for 14 of the same genes were still down-regulated; only LRP2 remained up-regulated. mRNA levels for six genes no longer showed differential expression, whilst nine genes, not differentially expressed at 6 h, now showed differential expression. In the combined retina + RPE after 24 h, mRNA levels for only seven genes were differentially regulated despite the differential expression of many genes in the RPE. Four genes showed the same expression in combined tissue as in retina alone, including up-regulation of VIP despite significant VIP down-regulation in RPE. Thus, hyperopia-induced GO signaling, as measured by differential gene expression, differs in the retina and the RPE. Retinal gene expression changed between 6 h and 24 h of treatment, suggesting evolution of the retinal response. Gene expression in the RPE was similar at both time points, suggesting sustained signaling. The combined retina + RPE does not accurately represent gene expression in either retina or, especially, RPE. When gene expression signatures were compared with those in choroid and sclera, GO signaling, as encoded by differential gene expression, differs in each compartment of the direct emmetropization signaling cascade. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Genome-wide analysis of starch metabolism genes in potato (Solanum tuberosum L.).

    PubMed

    Van Harsselaar, Jessica K; Lorenz, Julia; Senning, Melanie; Sonnewald, Uwe; Sonnewald, Sophia

    2017-01-05

    Starch is the principle constituent of potato tubers and is of considerable importance for food and non-food applications. Its metabolism has been subject of extensive research over the past decades. Despite its importance, a description of the complete inventory of genes involved in starch metabolism and their genome organization in potato plants is still missing. Moreover, mechanisms regulating the expression of starch genes in leaves and tubers remain elusive with regard to differences between transitory and storage starch metabolism, respectively. This study aimed at identifying and mapping the complete set of potato starch genes, and to study their expression pattern in leaves and tubers using different sets of transcriptome data. Moreover, we wanted to uncover transcription factors co-regulated with starch accumulation in tubers in order to get insight into the regulation of starch metabolism. We identified 77 genomic loci encoding enzymes involved in starch metabolism. Novel isoforms of many enzymes were found. Their analysis will help to elucidate mechanisms of starch biosynthesis and degradation. Expression analysis of starch genes led to the identification of tissue-specific isoenzymes suggesting differences in the transcriptional regulation of starch metabolism between potato leaf and tuber tissues. Selection of genes predominantly expressed in developing potato tubers and exhibiting an expression pattern indicative for a role in starch biosynthesis enabled the identification of possible transcriptional regulators of tuber starch biosynthesis by co-expression analysis. This study provides the annotation of the complete set of starch metabolic genes in potato plants and their genomic localizations. Novel, so far undescribed, enzyme isoforms were revealed. Comparative transcriptome analysis enabled the identification of tuber- and leaf-specific isoforms of starch genes. This finding suggests distinct regulatory mechanisms in transitory and storage starch metabolism. Putative regulatory proteins of starch biosynthesis in potato tubers have been identified by co-expression and their expression was verified by quantitative RT-PCR.

  19. Comparative MicroRNA Expression Patterns in Fibroblasts after Low and High Doses of Low-LET Radiation Exposure

    NASA Technical Reports Server (NTRS)

    Maes, Olivier C.; Xu, Suying; Hada, Megumi; Wu, Honglu; Wang, Eugenia

    2007-01-01

    Exposure to ionizing radiation causes DNA damage to cells, and provokes a plethora of cellular responses controlled by unique gene-directed signaling pathways. MicroRNAs (miRNAs) are small (22-nucleotide), non-coding RNAs which functionally silence gene expression by either degrading the messages or inhibiting translation. Here we investigate radiation-dependent changes in these negative regulators by comparing the expression patterns of all 462 known human miRNAs in fibroblasts, after exposure to low (0.1 Gy) or high (2 Gy) doses of X-rays at 30 min, 2, 6 and 24 hrs post-treatment. The expression patterns of microRNAs after low and high doses of radiation show a similar qualitative down-regulation trend at early (0.5 hr) and late (24 hr) time points, with a quantitatively steeper slope following the 2 Gy exposures. Interestingly, an interruption of this downward trend is observed after the 2 Gy exposure, i.e. a significant up-regulation of microRNAs at 2 hrs, then reverting to the downward trend by 6 hrs; this interruption at the intermediate time point was not observed with the 0.1 Gy exposure. At the early time point (0.5 hr), candidate gene targets of selected down-regulated microRNAs, common to both 0.1 and 2 Gy exposures, were those functioning in chromatin remodeling. Candidate target genes of unique up-regulated microRNAs seen at a 2 hr intermediate time point, after the 2 Gy exposure only, are those involved in cell death signaling. Finally, putative target genes of down-regulated microRNAs seen at the late (24 hr) time point after either doses of radiation are those involved in the up-regulation of DNA repair, cell signaling and homeostasis. Thus we hypothesize that after radiation exposure, microRNAs acting as hub negative regulators for unique signaling pathways needed to be down-regulated so as to de-repress their target genes for the proper cellular responses, including DNA repair and cell maintenance. The unique microRNAs up-regulated at 2 hr after 2 Gy suggest the cellular response to functionally suppress the apoptotic death signaling reflex after exposure to high dose radiation. Further analyses with transcriptome and global proteomic profiling will validate the reciprocal expression of signature microRNAs selected in our radiation-exposed cells, and their candidate target gene families, and test our hypothesis that unique radiation-specific microRNAs are keys in governing signaling responses for damage control of this environmental hazard.

  20. A systematic expression analysis implicates Plexin-B2 and its ligand Sema4C in the regulation of the vascular and endocrine system.

    PubMed

    Zielonka, Matthias; Xia, Jingjing; Friedel, Roland H; Offermanns, Stefan; Worzfeld, Thomas

    2010-09-10

    Plexins serve as receptors for semaphorins and play important roles in the developing nervous system. Plexin-B2 controls decisive developmental programs in the neural tube and cerebellum. However, whether Plexin-B2 also regulates biological functions in adult nonneuronal tissues is unknown. Here we show by two methodologically independent approaches that Plexin-B2 is expressed in discrete cell types of several nonneuronal tissues in the adult mouse. In the vasculature, Plexin-B2 is selectively expressed in functionally specialized endothelial cells. In endocrine organs, Plexin-B2 localizes to the pancreatic islets of Langerhans and to both cortex and medulla of the adrenal gland. Plexin-B2 expression is also detected in certain types of immune and epithelial cells. In addition, we report on a systematic comparison of the expression patterns of Plexin-B2 and its ligand Sema4C, which show complementarity or overlap in some but not all tissues. Furthermore, we demonstrate that Plexin-B2 and its family member Plexin-B1 display largely nonredundant expression patterns. This work establishes Plexin-B2 and Sema4C as potential regulators of the vascular and endocrine system and provides an anatomical basis to understand the biological functions of this ligand-receptor pair. Copyright 2010 Elsevier Inc. All rights reserved.

  1. The mouse homeobox gene Noto regulates node morphogenesis, notochordal ciliogenesis, and left–right patterning

    PubMed Central

    Beckers, Anja; Alten, Leonie; Viebahn, Christoph; Andre, Philipp; Gossler, Achim

    2007-01-01

    The mouse homeobox gene Noto represents the homologue of zebrafish floating head (flh) and is expressed in the organizer node and in the nascent notochord. Previous analyses suggested that Noto is required exclusively for the formation of the caudal part of the notochord. Here, we show that Noto is also essential for node morphogenesis, controlling ciliogenesis in the posterior notochord, and the establishment of laterality, whereas organizer functions in anterior–posterior patterning are apparently not compromised. In mutant embryos, left–right asymmetry of internal organs and expression of laterality markers was randomized. Mutant posterior notochord regions were variable in size and shape, cilia were shortened with highly irregular axonemal microtubuli, and basal bodies were, in part, located abnormally deep in the cytoplasm. The transcription factor Foxj1, which regulates the dynein gene Dnahc11 and is required for the correct anchoring of basal bodies in lung epithelial cells, was down-regulated in mutant nodes. Likewise, the transcription factor Rfx3, which regulates cilia growth, was not expressed in Noto mutants, and various other genes important for cilia function or assembly such as Dnahc5 and Nphp3 were down-regulated. Our results establish Noto as an essential regulator of node morphogenesis and ciliogenesis in the posterior notochord, and suggest Noto acts upstream of Foxj1 and Rfx3. PMID:17884984

  2. Differential expression of homeobox-containing genes Msx-1 and Msx-2 and homeoprotein Msx-2 expression during chick craniofacial development.

    PubMed

    Nishikawa, K; Nakanishi, T; Aoki, C; Hattori, T; Takahashi, K; Taniguchi, S

    1994-03-01

    The expression pattern of chick Msx-1 and Msx-2 homeobox genes in craniofacial primordia was examined by in situ hybridization using cRNA probes. Both genes were expressed in the distal region of the facial primordia, where the distribution of Msx-2 expression was restricted distally within the Msx-1 expression domain. On the contrary, Msx-2 expression in the lateral choroid plexus and cranial skull was broader and more intensive than Msx-1 expression. Our findings suggest that these two genes cooperate to play differential roles in craniofacial development. Msx-2 protein was detected immunohistochemically, and its localization essentially corresponded to the mRNA expression pattern, substantiating the involvement of Msx-2 protein as a transcriptional regulator in developing limb and face.

  3. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru

    2007-06-29

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics inmore » their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated.« less

  4. Adaptation of video game UVW mapping to 3D visualization of gene expression patterns

    NASA Astrophysics Data System (ADS)

    Vize, Peter D.; Gerth, Victor E.

    2007-01-01

    Analysis of gene expression patterns within an organism plays a critical role in associating genes with biological processes in both health and disease. During embryonic development the analysis and comparison of different gene expression patterns allows biologists to identify candidate genes that may regulate the formation of normal tissues and organs and to search for genes associated with congenital diseases. No two individual embryos, or organs, are exactly the same shape or size so comparing spatial gene expression in one embryo to that in another is difficult. We will present our efforts in comparing gene expression data collected using both volumetric and projection approaches. Volumetric data is highly accurate but difficult to process and compare. Projection methods use UV mapping to align texture maps to standardized spatial frameworks. This approach is less accurate but is very rapid and requires very little processing. We have built a database of over 180 3D models depicting gene expression patterns mapped onto the surface of spline based embryo models. Gene expression data in different models can easily be compared to determine common regions of activity. Visualization software, both Java and OpenGL optimized for viewing 3D gene expression data will also be demonstrated.

  5. Transcriptional responses of metallothionein gene to different stress factors in Pacific abalone (Haliotis discus hannai).

    PubMed

    Lee, Sang Yoon; Nam, Yoon Kwon

    2016-11-01

    A novel metallothionein (MT) gene from the Pacific abalone H. discus hannai was characterized and its mRNA expression patterns (tissue distribution, developmental expression and differential expression in responsive to various in vivo stimulatory treatments) were examined. Abalone MT shares conserved structural features with previously known gastropod orthologs at both genomic (i.e., tripartite organization) and amino acid (conserved Cys motifs) levels. The 5'-flanking regulatory region of abalone MT gene displayed various transcription factor binding motifs particularly including ones related with metal regulation and stress/immune responses. Tissue distribution and basal expression patterns of MT mRNAs indicated a potential association between ovarian MT expression and sexual maturation. Developmental expression pattern suggested the maternal contribution of MT mRNAs to embryonic and early larval developments. Abalone MT mRNAs could be significantly induced by various heavy metals in different tissues (gill, hepatopancreas, muscle and hemocyte) in a tissue- and/or metal-dependent fashion. In addition, the abalone MT gene was highly modulated in responsive to other non-metal, stimulatory treatments such as immune challenge (LPS, polyI:C and bacterial injections), hypoxia (decrease from normoxia 8 ppm-2 ppm), thermal elevation (increase from 20 °C to 30 °C), and xenobiotic exposure (250 ppb of 17α-ethynylestradiol and 0.25 ppb of 2,3,7,8-tetrachlorodibenzodioxin) where differential expression patterns were toward either up- or down-regulation depending on types of stimulations and tissues examined. Taken together, our results highlight that MT is a multifunctional effector playing in wide criteria of cellular pathways especially associated with development and stress responses in this abalone species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Dynamic gene expression of Lin-28 during embryonic development in mouse and chicken.

    PubMed

    Yokoyama, Shigetoshi; Hashimoto, Megumi; Shimizu, Hirohito; Ueno-Kudoh, Hiroe; Uchibe, Kenta; Kimura, Ichiro; Asahara, Hiroshi

    2008-02-01

    The Caenorhabditis elegans heterochronic gene lin-28 regulates developmental timing in the nematode trunk. We report the dynamic expression patterns of Lin-28 homologues in mouse and chick embryos. Whole mount in situ hybridization revealed specific and intriguing expression patterns of Lin-28 in the developing mouse and chick limb bud. Mouse Lin-28 expression was detected in both the forelimb and hindlimb at E9.5, but disappeared from the forelimb at E10.5, and finally from the forelimb and hindlimb at E11.5. Chicken Lin-28, which was first detected in the limb primordium at stage 15/16, was also downregulated as the stage proceeded. The amino acid sequences of mouse and chicken Lin-28 genes are highly conserved and the similar expression patterns of Lin-28 during limb development in mouse and chicken suggest that this heterochronic gene is also conserved during vertebrate limb development.

  7. Disruption of an Evolutionarily Novel Synaptic Expression Pattern in Autism

    PubMed Central

    Jiang, Xi; Hu, Haiyang; Guijarro, Patricia; Mitchell, Amanda; Ely, John J.; Sherwood, Chet C.; Hof, Patrick R.; Qiu, Zilong; Pääbo, Svante; Akbarian, Schahram; Khaitovich, Philipp

    2016-01-01

    Cognitive defects in autism spectrum disorder (ASD) include socialization and communication: key behavioral capacities that separate humans from other species. Here, we analyze gene expression in the prefrontal cortex of 63 autism patients and control individuals, as well as 62 chimpanzees and macaques, from natal to adult age. We show that among all aberrant expression changes seen in ASD brains, a single aberrant expression pattern overrepresented in genes involved synaptic-related pathways is enriched in nucleotide variants linked to autism. Furthermore, only this pattern contains an excess of developmental expression features unique to humans, thus resulting in the disruption of human-specific developmental programs in autism. Several members of the early growth response (EGR) transcription factor family can be implicated in regulation of this aberrant developmental change. Our study draws a connection between the genetic risk architecture of autism and molecular features of cortical development unique to humans. PMID:27685936

  8. miRNA164-directed cleavage of ZmNAC1 confers lateral root development in maize (Zea mays L.).

    PubMed

    Li, Jing; Guo, Guanghui; Guo, Weiwei; Guo, Ganggang; Tong, Dan; Ni, Zhongfu; Sun, Qixin; Yao, Yingyin

    2012-11-21

    MicroRNAs are a class of small, non-coding RNAs that regulate gene expression by binding target mRNA, which leads to cleavage or translational inhibition. The NAC proteins, which include NAM, ATAF, and CUC, are a plant-specific transcription factor family with diverse roles in development and stress regulation. It has been reported that miR164 negatively regulates NAC1 expression, which in turn affects lateral root development in Arabidopsis; however, little is known about the involvement of the maize NAC family and miR164 in lateral root development. We collected 175 maize transcripts with NAC domains. Of these, 7 ZmNACs were putative targets for regulation by miR164. We isolated one gene, called TC258020 (designated ZmNAC1) from 2 maize inbred lines, 87-1 and Zong3. ZmNAC1 had a high expression level in roots and showed higher abundance (1.8 fold) in Zong3 relative to 87-1, which had less lateral roots than Zong3. There was a significant correlation between the expression level of ZmNAC1 and the lateral root density in the recombinant inbred line (RIL) population. Transgenic Arabidopsis that overexpressed ZmNAC1 had increased lateral roots in comparison to the wild type. These findings suggest that ZmNAC1 played a significant role in lateral root development. An allelic expression assay showed that trans-regulatory elements were the dominant mediators of ZmNAC1 differential expression in 87-1 and Zong3, and further analysis revealed that miR164 was a trans-element that guided the cleavage of endogenous ZmNAC1 mRNA. Both mature miR164 and miR164 precursors had higher expression in 87-1 than Zong3, which was the opposite of the expression pattern of ZmNAC1. Additionally, the allelic assay showed that the cis-regulatory element most likely affected Zm-miR164b's expression pattern. A β-glucuronidase (GUS) assay showed that the Zm-miR164b promoter had higher GUS activity in 87-1 than in Zong3. In addition, we detected miR164b expression in the RIL population, and the results indicated that miR164b had a higher expression level in the RILs containing 87-1 promoter than those containing Zong3 promoter. Our results indicate one possible pathway in maize by which differences in miR164b promoter activity resulted in a different expression pattern for mature miR164 which negatively regulates ZmNAC1 expression in 87-1 and Zong3, thereby contributing to a significantly different lateral root phenotype.

  9. Alcoholism and alternative splicing of candidate genes.

    PubMed

    Sasabe, Toshikazu; Ishiura, Shoichi

    2010-04-01

    Gene expression studies have shown that expression patterns of several genes have changed during the development of alcoholism. Gene expression is regulated not only at the level of transcription but also through alternative splicing of pre-mRNA. In this review, we discuss some of the evidence suggesting that alternative splicing of candidate genes such as DRD2 (encoding dopamine D2 receptor) may form the basis of the mechanisms underlying the pathophysiology of alcoholism. These reports suggest that aberrant expression of splice variants affects alcohol sensitivities, and alcohol consumption also regulates alternative splicing. Thus, investigations of alternative splicing are essential for understanding the molecular events underlying the development of alcoholism.

  10. Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes.

    PubMed

    Castaneda, Francisco; Rosin-Steiner, Sigrid; Jung, Klaus

    2006-12-21

    We previously found that ethanol at millimolar level (1 mM) activates the expression of transcription factors with subsequent regulation of apoptotic genes in human hepatocellular carcinoma (HCC) HepG2 cells. However, the role of ethanol on the expression of genes implicated in transcriptional and translational processes remains unknown. Therefore, the aim of this study was to characterize the effect of low concentration of ethanol on gene expression profiling in HepG2 cells using cDNA microarrays with especial interest in genes with transcriptional and translational function. The gene expression pattern observed in the ethanol-treated HepG2 cells revealed a relatively similar pattern to that found in the untreated control cells. The pairwise comparison analysis demonstrated four significantly up-regulated (COBRA1, ITGB4, STAU2, and HMGN3) genes and one down-regulated (ANK3) gene. All these genes exert their function on transcriptional and translational processes and until now none of these genes have been associated with ethanol. This functional genomic analysis demonstrates the reported interaction between ethanol and ethanol-regulated genes. Moreover, it confirms the relationship between ethanol-regulated genes and various signaling pathways associated with ethanol-induced apoptosis. The data presented in this study represents an important contribution toward the understanding of the molecular mechanisms of ethanol at low concentration in HepG2 cells, a HCC-derived cell line.

  11. Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes

    PubMed Central

    Castaneda, Francisco; Rosin-Steiner, Sigrid; Jung, Klaus

    2007-01-01

    We previously found that ethanol at millimolar level (1 mM) activates the expression of transcription factors with subsequent regulation of apoptotic genes in human hepatocellular carcinoma (HCC) HepG2 cells. However, the role of ethanol on the expression of genes implicated in transcriptional and translational processes remains unknown. Therefore, the aim of this study was to characterize the effect of low concentration of ethanol on gene expression profiling in HepG2 cells using cDNA microarrays with especial interest in genes with transcriptional and translational function. The gene expression pattern observed in the ethanol-treated HepG2 cells revealed a relatively similar pattern to that found in the untreated control cells. The pairwise comparison analysis demonstrated four significantly up-regulated (COBRA1, ITGB4, STAU2, and HMGN3) genes and one down-regulated (ANK3) gene. All these genes exert their function on transcriptional and translational processes and until now none of these genes have been associated with ethanol. This functional genomic analysis demonstrates the reported interaction between ethanol and ethanol-regulated genes. Moreover, it confirms the relationship between ethanol-regulated genes and various signaling pathways associated with ethanol-induced apoptosis. The data presented in this study represents an important contribution toward the understanding of the molecular mechanisms of ethanol at low concentration in HepG2 cells, a HCC-derived cell line. PMID:17211498

  12. Sequential changes in the expression of Wnt- and Notch-related genes in the vagina and uterus of ovariectomized mice after estrogen exposure.

    PubMed

    Nakamura, Takeshi; Miyagawa, Shinichi; Katsu, Yoshinao; Sato, Tomomi; Iguchi, Taisen; Ohta, Yasuhiko

    2012-01-01

    Estrogen regulates morphological changes in reproductive organs, such as the vagina and uterus, during the estrous cycles in mice. Estrogen depletion by ovariectomy in adults results in atrophy accompanied by apoptosis in vaginal and uterine cells, while estrogen treatment following ovariectomy elicits cell proliferation in both organs. Sequential changes in mRNA expression of wingless-related MMTV integration site (Wnt) and Notch signaling genes were analyzed in the vagina and uterus of ovariectomized adult mice after a single injection of 17β-estradiol to provide understanding over the molecular basis of differences in response to estrogen in these organs. We found estrogen-dependent up-regulation of Wnt4, Wnt5a and p21 and down-regulation of Wnt11, hairy/enhancer-of-split related with YRPW motif-1 (Hey1) and delta-like 4 (Dll4) in the vagina, and up-regulation of Wnt4, Wnt5a, Hey1, Heyl, Dll1, p21 and p53 and down-regulation of Wnt11, Hey2 and Dll4 in the uterus. The expression of Wnt4, Hey1, Hey2, Heyl, Dll1 and p53 showed different patterns after the estrogen injection. Expression patterns for Wnt5a, Wnt11, Dll4 and p21 in the vagina and uterus were similar, suggesting that these genes are involved in the proliferation of cells in both those organs in mice.

  13. Drp1 levels constitutively regulate mitochondrial dynamics and cell survival in cortical neurons.

    PubMed

    Uo, Takuma; Dworzak, Jenny; Kinoshita, Chizuru; Inman, Denise M; Kinoshita, Yoshito; Horner, Philip J; Morrison, Richard S

    2009-08-01

    Mitochondria exist as dynamic networks that are constantly remodeled through the opposing actions of fusion and fission proteins. Changes in the expression of these proteins alter mitochondrial shape and size, and may promote or inhibit the propagation of apoptotic signals. Using mitochondrially targeted EGFP or DsRed2 to identify mitochondria, we observed a short, distinctly tubular mitochondrial morphology in postnatal cortical neurons in culture and in retinal ganglion cells in vivo, whereas longer, highly interconnected mitochondrial networks were detected in cortical astrocytes in vitro and non-neuronal cells in the retina in vivo. Differential expression patterns of fusion and fission proteins, in part, appear to determine these morphological differences as neurons expressed markedly high levels of Drp1 and OPA1 proteins compared to non-neuronal cells. This finding was corroborated using optic tissue samples. Moreover, cortical neurons expressed several splice variants of Drp1 including a neuron-specific isoform which incorporates exon 3. Knockdown or dominant-negative interference of endogenous Drp1 significantly increased mitochondrial length in both neurons and non-neuronal cells, but caused cell death only in cortical neurons. Conversely, depletion of the fusion protein, Mfn2, but not Mfn1, caused extensive mitochondrial fission and cell death. Thus, Drp1 and Mfn2 in normal cortical neurons not only regulate mitochondrial morphology, but are also required for cell survival. The present findings point to unique patterns of Drp1 expression and selective vulnerability to reduced levels of Drp1 expression/activity in neurons, and demonstrate that the regulation of mitochondrial dynamics must be tightly regulated in neurons.

  14. Drp1 levels constitutively regulate mitochondrial dynamics and cell survival in cortical neurons

    PubMed Central

    Uo, Takuma; Dworzak, Jenny; Kinoshita, Chizuru; Inman, Denise M.; Kinoshita, Yoshito; Horner, Philip J.; Morrison, Richard S.

    2009-01-01

    Mitochondria exist as dynamic networks that are constantly remodeled through the opposing actions of fusion and fission proteins. Changes in the expression of these proteins alter mitochondrial shape and size, and may promote or inhibit the propagation of apoptotic signals. Using mitochondrially targeted EGFP or DsRed2 to identify mitochondria, we observed a short, distinctly tubular mitochondrial morphology in postnatal cortical neurons in culture and in retinal ganglion cells in vivo, whereas longer, highly interconnected mitochondrial networks were detected in cortical astrocytes in vitro and non-neuronal cells in the retina in vivo. Differential expression patterns of fusion and fission proteins, in part, appear to determine these morphological differences as neurons expressed markedly high levels of Drp1 and OPA1 proteins compared to non-neuronal cells. This finding was corroborated using optic tissue samples. Moreover, cortical neurons expressed several splice variants of Drp1 including a neuron-specific isoform which incorporates exon 3. Knockdown or dominant negative interference of endogenous Drp1 significantly increased mitochondrial length in both neurons and non-neuronal cells, but caused cell death only in cortical neurons. Conversely, depletion of the fusion protein, Mfn2, but not Mfn1, caused extensive mitochondrial fission and cell death. Thus, Drp1 and Mfn2 in normal cortical neurons not only regulate mitochondrial morphology, but are also required for cell survival. The present findings point to unique patterns of Drp1 expression and selective vulnerability to reduced levels of Drp1 expression/activity in neurons, and demonstrate that the regulation of mitochondrial dynamics must be tightly regulated in neurons. PMID:19445933

  15. Hindsight regulates photoreceptor axon targeting through transcriptional control of jitterbug/Filamin and multiple genes involved in axon guidance in Drosophila.

    PubMed

    Oliva, Carlos; Molina-Fernandez, Claudia; Maureira, Miguel; Candia, Noemi; López, Estefanía; Hassan, Bassem; Aerts, Stein; Cánovas, José; Olguín, Patricio; Sierralta, Jimena

    2015-09-01

    During axon targeting, a stereotyped pattern of connectivity is achieved by the integration of intrinsic genetic programs and the response to extrinsic long and short-range directional cues. How this coordination occurs is the subject of intense study. Transcription factors play a central role due to their ability to regulate the expression of multiple genes required to sense and respond to these cues during development. Here we show that the transcription factor HNT regulates layer-specific photoreceptor axon targeting in Drosophila through transcriptional control of jbug/Filamin and multiple genes involved in axon guidance and cytoskeleton organization.Using a microarray analysis we identified 235 genes whose expression levels were changed by HNT overexpression in the eye primordia. We analyzed nine candidate genes involved in cytoskeleton regulation and axon guidance, six of which displayed significantly altered gene expression levels in hnt mutant retinas. Functional analysis confirmed the role of OTK/PTK7 in photoreceptor axon targeting and uncovered Tiggrin, an integrin ligand, and Jbug/Filamin, a conserved actin- binding protein, as new factors that participate of photoreceptor axon targeting. Moreover, we provided in silico and molecular evidence that supports jbug/Filamin as a direct transcriptional target of HNT and that HNT acts partially through Jbug/Filamin in vivo to regulate axon guidance. Our work broadens the understanding of how HNT regulates the coordinated expression of a group of genes to achieve the correct connectivity pattern in the Drosophila visual system. © 2015 Wiley Periodicals, Inc. Develop Neurobiol 75: 1018-1032, 2015. © 2015 Wiley Periodicals, Inc.

  16. Large clusters of co-expressed genes in the Drosophila genome.

    PubMed

    Boutanaev, Alexander M; Kalmykova, Alla I; Shevelyov, Yuri Y; Nurminsky, Dmitry I

    2002-12-12

    Clustering of co-expressed, non-homologous genes on chromosomes implies their co-regulation. In lower eukaryotes, co-expressed genes are often found in pairs. Clustering of genes that share aspects of transcriptional regulation has also been reported in higher eukaryotes. To advance our understanding of the mode of coordinated gene regulation in multicellular organisms, we performed a genome-wide analysis of the chromosomal distribution of co-expressed genes in Drosophila. We identified a total of 1,661 testes-specific genes, one-third of which are clustered on chromosomes. The number of clusters of three or more genes is much higher than expected by chance. We observed a similar trend for genes upregulated in the embryo and in the adult head, although the expression pattern of individual genes cannot be predicted on the basis of chromosomal position alone. Our data suggest that the prevalent mechanism of transcriptional co-regulation in higher eukaryotes operates with extensive chromatin domains that comprise multiple genes.

  17. Various Regulatory Modes for Circadian Rhythmicity and Sexual Dimorphism in the Non-Neuronal Cardiac Cholinergic System.

    PubMed

    Oikawa, Shino; Kai, Yuko; Mano, Asuka; Ohata, Hisayuki; Nemoto, Takahiro; Kakinuma, Yoshihiko

    2017-08-01

    Cardiomyocytes possess a non-neuronal cardiac cholinergic system (NNCCS) regulated by a positive feedback system; however, its other regulatory mechanisms remain to be elucidated, which include the epigenetic control or regulation by the female sex steroid, estrogen. Here, the NNCCS was shown to possess a circadian rhythm; its activity was upregulated in the light-off phase via histone acetyltransferase (HAT) activity and downregulated in the light-on phase. Disrupting the circadian rhythm altered the physiological choline acetyltransferase (ChAT) expression pattern. The NNCCS circadian rhythm may be regulated by miR-345, independently of HAT, causing decreased cardiac ChAT expression. Murine cardiac ChAT expression and ACh contents were increased more in female hearts than in male hearts. This upregulation was downregulated by treatment with the estrogen receptor antagonist tamoxifen, and in contrast, estrogen reciprocally regulated cardiac miR-345 expression. These results suggest that the NNCCS is regulated by the circadian rhythm and is affected by sexual dimorphism.

  18. Expression and functional analyses of a Kinesin gene GhKIS13A1 from cotton (Gossypium hirsutum) fiber.

    PubMed

    Li, Yan-Jun; Zhu, Shou-Hong; Zhang, Xin-Yu; Liu, Yong-Chang; Xue, Fei; Zhao, Lan-Jie; Sun, Jie

    2017-06-12

    Cotton fiber, a natural fiber widely used in the textile industry, is differentiated from single cell of ovule epidermis. A large number of genes are believed to be involved in fiber formation, but so far only a few fiber genes have been isolated and functionally characterized in this developmental process. The Kinesin13 subfamily was found to play key roles during cell division and cell elongation, and was considered to be involved in the regulation of cotton fiber development. The full length of coding sequence of GhKIS13A1 was cloned using cDNA from cotton fiber for functional characterization. Expression pattern analysis showed that GhKIS13A1 maintained a lower expression level during cotton fiber development. Biochemical assay showed that GhKIS13A1 has microtubule binding activity and basal ATPase activity that can be activated significantly by the presence of microtubules. Overexpression of GhKIS13A1 in Arabidopsis reduced leaf trichomes and the percentage of three-branch trichomes, and increased two-branch and shriveled trichomes compared to wild-type. Additionally, the expression of GhKIS13A1 in the Arabidopsis Kinesin-13a-1 mutant rescued the defective trichome branching pattern of the mutant, making its overall trichome branching pattern back to normal. Our results suggested that GhKIS13A1 is functionally compatible with AtKinesin-13A regarding their role in regulating the number and branching pattern of leaf trichomes. Given the developmental similarities between cotton fibers and Arabidopsis trichomes, it is speculated that GhKIS13A1 may also be involved in the regulation of cotton fiber development.

  19. Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch

    PubMed Central

    Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

    2015-01-01

    Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance. PMID:26270529

  20. Cross-regulation in the mouse HoxB complex: the expression of Hoxb2 in rhombomere 4 is regulated by Hoxb1.

    PubMed

    Maconochie, M K; Nonchev, S; Studer, M; Chan, S K; Pöpperl, H; Sham, M H; Mann, R S; Krumlauf, R

    1997-07-15

    Correct regulation of the segment-restricted patterns of Hox gene expression is essential for proper patterning of the vertebrate hindbrain. We have examined the molecular basis of restricted expression of Hoxb2 in rhombomere 4 (r4), by using deletion analysis in transgenic mice to identify an r4 enhancer from the mouse gene. A bipartite Hox/Pbx binding motif is located within this enhancer, and in vitro DNA binding experiments showed that the vertebrate labial-related protein Hoxb1 will cooperatively bind to this site in a Pbx/Exd-dependent manner. The Hoxb2 r4 enhancer can be transactivated in vivo by the ectopic expression of Hoxb1, Hoxa1, and Drosophila labial in transgenic mice. In contrast, ectopic Hoxb2 and Hoxb4 are unable to induce expression, indicating that in vivo this enhancer preferentially responds to labial family members. Mutational analysis demonstrated that the bipartite Hox/Pbx motif is required for r4 enhancer activity and the responses to retinoids and ectopic Hox expression. Furthermore, three copies of the Hoxb2 motif are sufficient to mediate r4 expression in transgenic mouse embryos and a labial pattern in Drosophila embryos. This reporter expression in Drosophila embryos is dependent upon endogenous labial and exd, suggesting that the ability of this Hox/Pbx site to interact with labial-related proteins has been evolutionarily conserved. The endogenous Hoxb2 gene is no longer upregulated in r4 in Hoxb1 homozygous mutant embryos. On the basis of these experiments we conclude that the r4-restricted domain of Hoxb2 in the hindbrain is the result of a direct cross-regulatory interaction by Hoxb1 involving vertebrate Pbx proteins as cofactors. This suggests that part of the functional role of Hoxb1 in maintaining r4 identity may be mediated by the Hoxb2 gene.

  1. Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch.

    PubMed

    Zhao, Tian-Tian; Zhang, Jin; Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

    2015-01-01

    Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance.

  2. Temporal analysis of reciprocal miRNA-mRNA expression patterns predicts regulatory networks during differentiation in human skeletal muscle cells

    PubMed Central

    Sjögren, Rasmus J. O.; Egan, Brendan; Katayama, Mutsumi; Zierath, Juleen R.

    2014-01-01

    microRNAs (miRNAs) are short noncoding RNAs that regulate gene expression through posttranscriptional repression of target genes. miRNAs exert a fundamental level of control over many developmental processes, but their role in the differentiation and development of skeletal muscle from myogenic progenitor cells in humans remains incompletely understood. Using primary cultures established from human skeletal muscle satellite cells, we performed microarray profiling of miRNA expression during differentiation of myoblasts (day 0) into myotubes at 48 h intervals (day 2, 4, 6, 8, and 10). Based on a time-course analysis, we identified 44 miRNAs with altered expression [false discovery rate (FDR) < 5%, fold change > ±1.2] during differentiation, including the marked upregulation of the canonical myogenic miRNAs miR-1, miR-133a, miR-133b, and miR-206. Microarray profiling of mRNA expression at day 0, 4, and 10 identified 842 and 949 genes differentially expressed (FDR < 10%) at day 4 and 10, respectively. At day 10, 42% of altered transcripts demonstrated reciprocal expression patterns in relation to the directional change of their in silico predicted regulatory miRNAs based on analysis using Ingenuity Pathway Analysis microRNA Target Filter. Bioinformatic analysis predicted networks of regulation during differentiation including myomiRs miR-1/206 and miR-133a/b, miRNAs previously established in differentiation including miR-26 and miR-30, and novel miRNAs regulated during differentiation of human skeletal muscle cells such as miR-138-5p and miR-20a. These reciprocal expression patterns may represent new regulatory nodes in human skeletal muscle cell differentiation. This analysis serves as a reference point for future studies of human skeletal muscle differentiation and development in healthy and disease states. PMID:25547110

  3. Widespread Over-Expression of the X Chromosome in Sterile F1 Hybrid Mice

    PubMed Central

    Good, Jeffrey M.; Giger, Thomas; Dean, Matthew D.; Nachman, Michael W.

    2010-01-01

    The X chromosome often plays a central role in hybrid male sterility between species, but it is unclear if this reflects underlying regulatory incompatibilities. Here we combine phenotypic data with genome-wide expression data to directly associate aberrant expression patterns with hybrid male sterility between two species of mice. We used a reciprocal cross in which F1 males are sterile in one direction and fertile in the other direction, allowing us to associate expression differences with sterility rather than with other hybrid phenotypes. We found evidence of extensive over-expression of the X chromosome during spermatogenesis in sterile but not in fertile F1 hybrid males. Over-expression was most pronounced in genes that are normally expressed after meiosis, consistent with an X chromosome-wide disruption of expression during the later stages of spermatogenesis. This pattern was not a simple consequence of faster evolutionary divergence on the X chromosome, because X-linked expression was highly conserved between the two species. Thus, transcriptional regulation of the X chromosome during spermatogenesis appears particularly sensitive to evolutionary divergence between species. Overall, these data provide evidence for an underlying regulatory basis to reproductive isolation in house mice and underscore the importance of transcriptional regulation of the X chromosome to the evolution of hybrid male sterility. PMID:20941395

  4. Widespread over-expression of the X chromosome in sterile F₁hybrid mice.

    PubMed

    Good, Jeffrey M; Giger, Thomas; Dean, Matthew D; Nachman, Michael W

    2010-09-30

    The X chromosome often plays a central role in hybrid male sterility between species, but it is unclear if this reflects underlying regulatory incompatibilities. Here we combine phenotypic data with genome-wide expression data to directly associate aberrant expression patterns with hybrid male sterility between two species of mice. We used a reciprocal cross in which F₁ males are sterile in one direction and fertile in the other direction, allowing us to associate expression differences with sterility rather than with other hybrid phenotypes. We found evidence of extensive over-expression of the X chromosome during spermatogenesis in sterile but not in fertile F₁ hybrid males. Over-expression was most pronounced in genes that are normally expressed after meiosis, consistent with an X chromosome-wide disruption of expression during the later stages of spermatogenesis. This pattern was not a simple consequence of faster evolutionary divergence on the X chromosome, because X-linked expression was highly conserved between the two species. Thus, transcriptional regulation of the X chromosome during spermatogenesis appears particularly sensitive to evolutionary divergence between species. Overall, these data provide evidence for an underlying regulatory basis to reproductive isolation in house mice and underscore the importance of transcriptional regulation of the X chromosome to the evolution of hybrid male sterility.

  5. Expression and in vitro regulation of integrins by normal human urothelial cells.

    PubMed

    Southgate, J; Kennedy, W; Hutton, K A; Trejdosiewicz, L K

    1995-08-01

    Integrins are thought to be essential adhesion receptors for the maintenance of tissue histioarchitecture. The purpose of this study was to determine integrin expression patterns in the human stratified transitional epithelium of the urinary tract (urothelium). In situ expression patterns were compared with in vitro expression, using a normal cell culture model system in which the effects of cell stratification can be studied independently of differentiation. By immunohistological criteria, the urothelia of bladder, ureter and renal pelvis expressed alpha 2 beta 1 and alpha 3 beta 1 integrins in all layers at intercellular junctions, and cytoplasmically in the lower strata. By contrast, alpha 6 beta 4 and occasionally alpha v beta 4 were expressed only by basal cells and localised to the basal lamina. These expression patterns were unaltered in specimens where an inflammatory cell infiltrate was present. In long-term cultures of normal urothelial cells maintained in a low-Ca++ serum-free medium, the monolayer cultures expressed alpha 2 beta 1, alpha 3 beta 1 and alpha 5 beta 1 integrins at intercellular junctions and in cytoplasmic inclusions, whereas alpha 6 beta 4 was distributed in a random pattern over the substratum. Increasing exogenous Ca++ concentrations induced cell stratification and desmosome formation, but not cytodifferentiation. Under these conditions, alpha 6 beta 4 became cell-, rather than substratum-associated, localising particularly to filopodia and lamellipodia. Quantitation of integrin expression by flow cytometry confirmed increased surface expression of alpha 6 beta 4 in high Ca++ media, and also of alpha 3 and alpha 5, but not alpha 2, subunits. These results suggest that alpha 2 beta 1 and alpha 3 beta 1 integrins, although differentially regulated, are mainly involved in homotypic cell-cell interactions and the maintenance of a stratified morphology, whereas alpha 6 beta 4 is the principal integrin involved in substratum adhesion.

  6. Genome-scale gene expression characteristics define the follicular initiation and developmental rules during folliculogenesis.

    PubMed

    Shi, Kerong; He, Feng; Yuan, Xuefeng; Zhao, Yaofeng; Deng, Xuemei; Hu, Xiaoxiang; Li, Ning

    2013-08-01

    The ovarian follicle supplies a unique dynamic system for gametes that ensures the propagation of the species. During folliculogenesis, the vast majority of the germ cells are lost or inactivated because of ovarian follicle atresia, resulting in diminished reproductive potency and potential infertility. Understanding the underlying molecular mechanism of folliculogenesis rules is essential. Primordial (P), preantral (M), and large antral (L) porcine follicles were used to reveal their genome-wide gene expression profiles. Results indicate that primordial follicles (P) process a diverse gene expression pattern compared to growing follicles (M and L). The 5,548 differentially expressed genes display a similar expression mode in M and L, with a correlation coefficient of 0.892. The number of regulated (both up and down) genes in M is more than that in L. Also, their regulation folds in M (2-364-fold) are much more acute than in L (2-75-fold). Differentially expressed gene groups with different regulation patterns in certain follicular stages are identified and presumed to be closely related following follicular developmental rules. Interestingly, functional annotation analysis revealed that these gene groups feature distinct biological processes or molecular functions. Moreover, representative candidate genes from these gene groups have had their RNA or protein expressions within follicles confirmed. Our study emphasized genome-scale gene expression characteristics, which provide novel entry points for understanding the folliculogenesis rules on the molecular level, such as follicular initiation, atresia, and dominance. Transcriptional regulatory circuitries in certain follicular stages are expected to be found among the identified differentially expressed gene groups.

  7. Expression of bone morphogenetic proteins and Msx genes during root formation.

    PubMed

    Yamashiro, T; Tummers, M; Thesleff, I

    2003-03-01

    Like crown development, root formation is also regulated by interactions between epithelial and mesenchymml tissues. Bone morphogenetic proteins (BMPs), together with the transcription factors Msx1 and Msx2, play important roles in these interactions during early tooth morphogenesis. To investigate the involvement of this signaling pathway in root development, we analyzed the expression patterns of Bmp2, Bmp3, Bmp4, and Bmp7 as well as Msx1 and Msx2 in the roots of mouse molars. Bmp4 was expressed in the apical mesenchyme and Msx2 in the root sheath. However, Bmps were not detected in the root sheath epithelium, and Msx transcripts were absent from the underlying mesenchyme. These findings indicate that this Bmp signaling pathway, required for tooth initiation, does not regulate root development, but we suggest that root shape may be regulated by a mechanism similar to that regulating crown shape in cap-stage tooth germs. Msx2 expression continued in the epithelial cell rests of Malassez, and the nearby cementoblasts intensely expressed Bmp3, which may regulate some functions of the fragmented epithelium.

  8. Expression Patterns of CREBs in Oocyte Growth and Maturation of Fish

    PubMed Central

    Wang, De-Shou; Sudhakumari, Cheni-Chery; Kobayashi, Tohru; Nagahama, Yoshitaka

    2015-01-01

    In fish, oocyte meiotic maturation is regulated by 17α, 20β-dihydroxy-progesterone through cAMP. To study the role of cAMP response element binding protein (CREB) in meiotic maturation, we cloned and characterized the expression pattern of CREBs from two fish models, the Nile tilapia and catfish. In the Nile tilapia three different CREBs were identified where in CREB1 was found in many tissues including gonads with abundant expression in testis. CREB2, few amino acids shorter than CREB1, was expressed in several tissues with abundant expression in ovary. In addition, a 3’UTR variant form, CREB3 was exclusively found in ovary. During natural 14-day ovarian cycle of the Nile tilapia, CREB1 expression was stable throughout vitellogenesis with a sharp decrease on the day of spawning. In contrast, CREB2 remain unchanged throughout the ovarian cycle, however elevated in 11-day full-grown immature ovarian follicle and after hCG-induction. Interestingly, CREB3 expression was induced three folds on the day of spawning as well as during hCG-induced oocyte maturation. Based on the synergistic expression pattern, CREB1 is likely to control oocyte growth, whereas CREB 2 and 3 contribute to oocyte maturation in tilapia and the latter seems to be critical. In catfish, a single form of CREB showed a maximum expression during spawning phase and hCG-induced maturation both in vivo and in vitro augmented CREB expression. These results suggest that spatial and temporal expression of CREBs seems to be important for final oocyte maturation and may also regulate oocyte growth in fish. PMID:26700177

  9. The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

    PubMed

    Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

    2018-05-01

    Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Expression and enzymatic activity of phenylalanine ammonia-lyase and p-coumarate 3-hydroxylase in mango (Mangifera indica 'Ataulfo') during ripening.

    PubMed

    Palafox-Carlos, H; Contreras-Vergara, C A; Muhlia-Almazán, A; Islas-Osuna, M A; González-Aguilar, G A

    2014-05-16

    Phenylalanine ammonia lyase (PAL) and p-coumarate 3-hydroxylase (C3H) are key enzymes in the phenylpropanoid pathway. The relative expression of PAL and C3H was evaluated in mango fruit cultivar 'Ataulfo' in four ripening stages (RS1, RS2, RS3, and RS4) by quantitative polymerase chain reaction. In addition, enzyme activity of PAL and C3H was determined in mango fruits during ripening. The PAL levels were downregulated at the RS2 and RS3 stages, while C3H levels were upregulated in fruits only at RS3. The enzyme activity of PAL followed a pattern that was different from that of the PAL expression, thus suggesting regulation at several levels. For C3H, a regulation at the transcriptional level is suggested because a similar pattern was revealed by its activity and transcript level. In this study, the complexity of secondary metabolite biosynthesis regulation is emphasized because PAL and C3H enzymes are involved in the biosynthesis of several secondary metabolites that are active during all mango ripening stages.

  11. Altered invertase activities of symptomatic tissues on Beet severe curly top virus (BSCTV) infected Arabidopsis thaliana.

    PubMed

    Park, Jungan; Kim, Soyeon; Choi, Eunseok; Auh, Chung-Kyun; Park, Jong-Bum; Kim, Dong-Giun; Chung, Young-Jae; Lee, Taek-Kyun; Lee, Sukchan

    2013-09-01

    Arabidopsis thaliana infected with Beet severe curly top virus (BSCTV) exhibits systemic symptoms such as stunting of plant growth, callus induction on shoot tips, and curling of leaves and shoot tips. The regulation of sucrose metabolism is essential for obtaining the energy required for viral replication and the development of symptoms in BSCTV-infected A. thaliana. We evaluated the changed transcript level and enzyme activity of invertases in the inflorescence stems of BSCTV-infected A. thaliana. These results were consistent with the increased pattern of ribulose-1,5-bisphosphate carboxylase/oxygenase activity and photosynthetic pigment concentration in virus-infected plants to supply more energy for BSCTV multiplication. The altered gene expression of invertases during symptom development was functionally correlated with the differential expression patterns of D-type cyclins, E2F isoforms, and invertase-related genes. Taken together, our results indicate that sucrose sensing by BSCTV infection may regulate the expression of sucrose metabolism and result in the subsequent development of viral symptoms in relation with activation of cell cycle regulation.

  12. Homo sapiens exhibit a distinct pattern of CNV genes regulation: an important role of miRNAs and SNPs in expression plasticity.

    PubMed

    Dweep, Harsh; Kubikova, Nada; Gretz, Norbert; Voskarides, Konstantinos; Felekkis, Kyriacos

    2015-07-16

    Gene expression regulation is a complex and highly organized process involving a variety of genomic factors. It is widely accepted that differences in gene expression can contribute to the phenotypic variability between species, and that their interpretation can aid in the understanding of the physiologic variability. CNVs and miRNAs are two major players in the regulation of expression plasticity and may be responsible for the unique phenotypic characteristics observed in different lineages. We have previously demonstrated that a close interaction between these two genomic elements may have contributed to the regulation of gene expression during evolution. This work presents the molecular interactions between CNV and non CNV genes with miRNAs and other genomic elements in eight different species. A comprehensive analysis of these interactions indicates a unique nature of human CNV genes regulation as compared to other species. By using genes with short 3' UTR that abolish the "canonical" miRNA-dependent regulation, as a model, we demonstrate a distinct and tight regulation of human genes that might explain some of the unique features of human physiology. In addition, comparison of gene expression regulation between species indicated that there is a significant difference between humans and mice possibly questioning the effectiveness of the latest as experimental models of human diseases.

  13. Biphasic regulation of the transcription factor ABORTED MICROSPORES (AMS) is essential for tapetum and pollen development in Arabidopsis.

    PubMed

    Ferguson, Alison C; Pearce, Simon; Band, Leah R; Yang, Caiyun; Ferjentsikova, Ivana; King, John; Yuan, Zheng; Zhang, Dabing; Wilson, Zoe A

    2017-01-01

    Viable pollen is essential for plant reproduction and crop yield. Its production requires coordinated expression at specific stages during anther development, involving early meiosis-associated events and late pollen wall formation. The ABORTED MICROSPORES (AMS) transcription factor is a master regulator of sporopollenin biosynthesis, secretion and pollen wall formation in Arabidopsis. Here we show that it has complex regulation and additional essential roles earlier in pollen formation. An inducible-AMS reporter was created for functional rescue, protein expression pattern analysis, and to distinguish between direct and indirect targets. Mathematical modelling was used to create regulatory networks based on wild-type RNA and protein expression. Dual activity of AMS was defined by biphasic protein expression in anther tapetal cells, with an initial peak around pollen meiosis and then later during pollen wall development. Direct AMS-regulated targets exhibit temporal regulation, indicating that additional factors are associated with their regulation. We demonstrate that AMS biphasic expression is essential for pollen development, and defines distinct functional activities during early and late pollen development. Mathematical modelling suggests that AMS may competitively form a protein complex with other tapetum-expressed transcription factors, and that biphasic regulation is due to repression of upstream regulators and promotion of AMS protein degradation. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  14. Homo sapiens exhibit a distinct pattern of CNV genes regulation: an important role of miRNAs and SNPs in expression plasticity

    PubMed Central

    Dweep, Harsh; Kubikova, Nada; Gretz, Norbert; Voskarides, Konstantinos; Felekkis, Kyriacos

    2015-01-01

    Gene expression regulation is a complex and highly organized process involving a variety of genomic factors. It is widely accepted that differences in gene expression can contribute to the phenotypic variability between species, and that their interpretation can aid in the understanding of the physiologic variability. CNVs and miRNAs are two major players in the regulation of expression plasticity and may be responsible for the unique phenotypic characteristics observed in different lineages. We have previously demonstrated that a close interaction between these two genomic elements may have contributed to the regulation of gene expression during evolution. This work presents the molecular interactions between CNV and non CNV genes with miRNAs and other genomic elements in eight different species. A comprehensive analysis of these interactions indicates a unique nature of human CNV genes regulation as compared to other species. By using genes with short 3′ UTR that abolish the “canonical” miRNA-dependent regulation, as a model, we demonstrate a distinct and tight regulation of human genes that might explain some of the unique features of human physiology. In addition, comparison of gene expression regulation between species indicated that there is a significant difference between humans and mice possibly questioning the effectiveness of the latest as experimental models of human diseases. PMID:26178010

  15. Foxp2 Regulates Identities and Projection Patterns of Thalamic Nuclei During Development.

    PubMed

    Ebisu, Haruka; Iwai-Takekoshi, Lena; Fujita-Jimbo, Eriko; Momoi, Takashi; Kawasaki, Hiroshi

    2017-07-01

    The molecular mechanisms underlying the formation of the thalamus during development have been investigated intensively. Although transcription factors distinguishing the thalamic primordium from adjacent brain structures have been uncovered, those involved in patterning inside the thalamus are largely unclear. Here, we show that Foxp2, a member of the forkhead transcription factor family, regulates thalamic patterning during development. We found a graded expression pattern of Foxp2 in the thalamic primordium of the mouse embryo. The expression levels of Foxp2 were high in the posterior region and low in the anterior region of the thalamic primordium. In Foxp2 (R552H) knockin mice, which have a missense loss-of-function mutation in the forkhead domain of Foxp2, thalamic nuclei of the posterior region of the thalamus were shrunken, while those of the intermediate region were expanded. Consistently, Foxp2 (R552H) knockin mice showed changes in thalamocortical projection patterns. Our results uncovered important roles of Foxp2 in thalamic patterning and thalamocortical projections during development. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Timescales and bottlenecks in miRNA-dependent gene regulation.

    PubMed

    Hausser, Jean; Syed, Afzal Pasha; Selevsek, Nathalie; van Nimwegen, Erik; Jaskiewicz, Lukasz; Aebersold, Ruedi; Zavolan, Mihaela

    2013-12-03

    MiRNAs are post-transcriptional regulators that contribute to the establishment and maintenance of gene expression patterns. Although their biogenesis and decay appear to be under complex control, the implications of miRNA expression dynamics for the processes that they regulate are not well understood. We derived a mathematical model of miRNA-mediated gene regulation, inferred its parameters from experimental data sets, and found that the model describes well time-dependent changes in mRNA, protein and ribosome density levels measured upon miRNA transfection and induction. The inferred parameters indicate that the timescale of miRNA-dependent regulation is slower than initially thought. Delays in miRNA loading into Argonaute proteins and the slow decay of proteins relative to mRNAs can explain the typically small changes in protein levels observed upon miRNA transfection. For miRNAs to regulate protein expression on the timescale of a day, as miRNAs involved in cell-cycle regulation do, accelerated miRNA turnover is necessary.

  17. Intra- and extracellular lipid composition and associated gene expression patterns during pollen development in Brassica napus.

    PubMed

    Piffanelli, P; Ross, J H; Murphy, D J

    1997-03-01

    Pollen development in angiosperms is regulated by the interaction of products contributed by both the gametophytic (haploid) and sporophytic (diploid) genomes. In entomophilous species, lipids are major products of both sporophytic and gametophytic metabolism during pollen development. Mature pollen grains of Brassica napus are shown to contain three major acyl lipid pools as follows: (i) the extracellular tryphine mainly consisting of medium-chain neutral esters; (ii) the intracellular membranes, particularly endoplasmic reticulum, mainly containing phospholipids; and (iii) the intracellular storage lipids, which are mostly triacylglycerols. This paper reports on the kinetics of accumulation of these lipid classes during pollen maturation and the expression patterns of several lipid biosynthetic genes and their protein products that are differentially regulated in developing microspores/ pollen grains (gametophyte) and tapetal cells (sporophyte) of B. napus. Detailed analysis of three members of the stearoyl-ACP desaturase (sad) gene family by Northern blotting, in situ hybridization and RT-PCR showed that the same individual genes were expressed both in gametophytic and sporophytic tissues, although under different temporal regulation. In the tapetum, maximal expression of two marker genes for lipid biosynthesis (sad and ear) occurred at a bud length of 2-3 mm, and the corresponding gene products SAD and EAR were detected by Western blotting in 3-4 mm buds, coinciding with the maximal rates of tapetal lipid accumulation. These lipids are released following tapetal cell disintegration and are relocated to form the major structural component of the extracellular tryphine layer that coats the mature pollen grain. In contrast, in developing microspores/pollen grains, maximal expression of the lipid marker genes sad, ear, acp and cyb5 was at the 3-5 mm bud stages, with the SAD and EAR gene products detected in 4-7 mm buds. This pattern of expression coincided with accumulation of the intracellular storage and membrane lipid components of pollen. These results suggest that, although the same genes may be expressed in the sporophytic tapetal cells and in gametophytic tissues, they are regulated differentially leading to the production of the various contrasting lipidic structures that are assembled together to give rise to a viable, fertile pollen grain.

  18. Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

    PubMed Central

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-01-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

  19. Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

    PubMed

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-09-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

  20. Expression of the peroxisome proliferator-activated receptor γ (PPARγ) in human atherosclerosis and regulation in macrophages by colony stimulating factors and oxidized low density lipoprotein

    PubMed Central

    Ricote, Mercedes; Huang, Jannet; Fajas, Luis; Li, Andrew; Welch, John; Najib, Jamila; Witztum, Joseph L.; Auwerx, Johan; Palinski, Wulf; Glass, Christopher K.

    1998-01-01

    The peroxisome proliferator-activated receptor γ (PPARγ) is a ligand-dependent transcription factor that has been demonstrated to regulate fat cell development and glucose homeostasis. PPARγ is also expressed in a subset of macrophages and negatively regulates the expression of several proinflammatory genes in response to natural and synthetic ligands. We here demonstrate that PPARγ is expressed in macrophage foam cells of human atherosclerotic lesions, in a pattern that is highly correlated with that of oxidation-specific epitopes. Oxidized low density lipoprotein (oxLDL) and macrophage colony-stimulating factor, which are known to be present in atherosclerotic lesions, stimulated PPARγ expression in primary macrophages and monocytic cell lines. PPARγ mRNA expression was also induced in primary macrophages and THP-1 monocytic leukemia cells by the phorbol ester 12-O-tetradecanoylphorbol 13-acetate (TPA). Inhibition of protein kinase C blocked the induction of PPARγ expression by TPA, but not by oxLDL, suggesting that more than one signaling pathway regulates PPARγ expression in macrophages. TPA induced the expression of PPARγ in RAW 264.7 macrophages by increasing transcription from the PPARγ1 and PPARγ3 promoters. In concert, these observations provide insights into the regulation of PPARγ expression in activated macrophages and raise the possibility that PPARγ ligands may influence the progression of atherosclerosis. PMID:9636198

  1. Discovering causal signaling pathways through gene-expression patterns

    PubMed Central

    Parikh, Jignesh R.; Klinger, Bertram; Xia, Yu; Marto, Jarrod A.; Blüthgen, Nils

    2010-01-01

    High-throughput gene-expression studies result in lists of differentially expressed genes. Most current meta-analyses of these gene lists include searching for significant membership of the translated proteins in various signaling pathways. However, such membership enrichment algorithms do not provide insight into which pathways caused the genes to be differentially expressed in the first place. Here, we present an intuitive approach for discovering upstream signaling pathways responsible for regulating these differentially expressed genes. We identify consistently regulated signature genes specific for signal transduction pathways from a panel of single-pathway perturbation experiments. An algorithm that detects overrepresentation of these signature genes in a gene group of interest is used to infer the signaling pathway responsible for regulation. We expose our novel resource and algorithm through a web server called SPEED: Signaling Pathway Enrichment using Experimental Data sets. SPEED can be freely accessed at http://speed.sys-bio.net/. PMID:20494976

  2. Multiple environmental factors regulate the expression of the carbohydrate-selective OprB porin of Pseudomonas aeruginosa.

    PubMed

    Adewoye, L O; Worobec, E A

    1999-12-01

    In response to low extracellular glucose concentration, Pseudomonas aeruginosa induces the expression of the outer membrane carbohydrate-selective OprB porin. The promoter region of the oprB gene was cloned into a lacZ transcriptional fusion vector, and the construct was mobilized into P. aeruginosa OprB-deficient strain, WW100, to evaluate additional environmental factors that influence OprB porin gene expression. Growth temperature, pH of the growth medium, salicylate concentration, and carbohydrate source were found to differentially influence porin expression. This expression pattern was compared to those of whole-cell [14C]glucose uptake under conditions of high osmolarity, ionicity, variable pH, growth temperatures, and carbohydrate source. These studies revealed that the high-affinity glucose transport genes are down-regulated by salicylic acid, differentially regulated by pH and temperature, and are specifically responsive to exogenous glucose induction.

  3. Altered microRNA expression patterns in irradiated hematopoietic tissues suggest a sex-specific protective mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ilnytskyy, Yaroslav; Zemp, Franz J.; Koturbash, Igor

    To investigate involvement of miRNAs in radiation responses we used microRNAome profiling to analyze the sex-specific response of radiation sensitive hematopoietic lymphoid tissues. We show that radiation exposure resulted in a significant and sex-specific deregulation of microRNA expression in murine spleen and thymus tissues. Among the regulated miRNAs, we found that changes in expression of miR-34a and miR-7 may be involved in important protective mechanisms counteracting radiation cytotoxicity. We observed a significant increase in the expression of tumor-suppressor miR-34a, paralleled by a decrease in the expression of its target oncogenes NOTCH1, MYC, E2F3 and cyclin D1. Additionally, we show thatmore » miR-7 targets the lymphoid-specific helicase LSH, a pivotal regulator of DNA methylation and genome stability. While miR-7 was significantly down-regulated LSH was significantly up-regulated. These cellular changes may constitute an attempt to counteract radiation-induced hypomethylation. Tissue specificity of miRNA responses and possible regulation of miRNA expression upon irradiation are discussed.« less

  4. MiR-300 regulate the malignancy of breast cancer by targeting p53.

    PubMed

    Xu, Xiao-Heng; Li, Da-Wei; Feng, Hui; Chen, Hong-Mei; Song, Yan-Qiu

    2015-01-01

    In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of breast cancer (BC) cells. MicroRNA and protein expression patterns were compared between breast cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in MCF-7 breast cancer cells. We observed that miR-300 expression was frequently and dramatically up-regulated in human breast cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote breast cancer cell proliferation and invasion by regulating p53 expression. Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in breast cancer cell proliferation during breast tumorigenesis.

  5. MiR-300 regulate the malignancy of breast cancer by targeting p53

    PubMed Central

    Xu, Xiao-Heng; Li, Da-Wei; Feng, Hui; Chen, Hong-Mei; Song, Yan-Qiu

    2015-01-01

    Objective: In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of breast cancer (BC) cells. Methods: MicroRNA and protein expression patterns were compared between breast cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in MCF-7 breast cancer cells. Results: We observed that miR-300 expression was frequently and dramatically up-regulated in human breast cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote breast cancer cell proliferation and invasion by regulating p53 expression. Conclusion: Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in breast cancer cell proliferation during breast tumorigenesis. PMID:26221232

  6. Effect of Ppd-1 on the expression of flowering-time genes in vegetative and reproductive growth stages of wheat.

    PubMed

    Kitagawa, Satoshi; Shimada, Sanae; Murai, Koji

    2012-01-01

    The photoperiod sensitivity gene Ppd-1 influences the timing of flowering in temperate cereals such as wheat and barley. The effect of Ppd-1 on the expression of flowering-time genes was assessed by examining the expression levels of the vernalization genes VRN1 and VRN3/WFT and of two CONSTANS-like genes, WCO1 and TaHd1, during vegetative and reproductive growth stages. Two near-isogenic lines (NILs) were used: the first carried a photoperiod-insensitive allele of Ppd-1 (Ppd-1a-NIL), the other, a photoperiod-sensitive allele (Ppd-1b-NIL). We found that the expression pattern of VRN1 was similar in Ppd-1a-NIL and Ppd-1b-NIL plants, suggesting that VRN1 is not regulated by Ppd-1. Under long day conditions, VRN3/WFT showed similar expression patterns in Ppd-1a-NIL and Ppd-1b-NIL plants. However, expression differed greatly under short day conditions: VRN3/WFT expression was detected in Ppd-1a-NIL plants at the 5-leaf stage when they transited from vegetative to reproductive growth; very low expression was present in Ppd-1b-NIL throughout all growth stages. Thus, the Ppd-1b allele acts to down-regulate VRN3/WFT under short day conditions. WCO1 showed high levels of expression at the vegetative stage, which decreased during the phase transition and reproductive growth stages in both Ppd-1a-NIL and Ppd-1b-NIL plants under short day conditions. By contrast to WCO1, TaHd1 was up-regulated during the reproductive stage. The level of TaHd1 expression was much higher in Ppd-1a-NIL than the Ppd-1b-NIL plants, suggesting that the Ppd-1b allele down-regulates TaHd1 under short day conditions. The present study indicates that down-regulation of VRN3/WFT together with TaHd1 is the cause of late flowering in the Ppd-1b-NIL plants under short day conditions.

  7. Regulation of NlE74A on vitellogenin might be mediated by angiotensin converting enzyme through a fecundity-related SNP in the brown planthopper, Nilaparvata lugens.

    PubMed

    Sun, Zhongxiang; Shi, Qi; Xu, Cuicui; Wang, Rumeng; Wang, Huanhuan; Song, Yuanyuan; Zeng, Rensen

    2018-06-19

    The major yolk protein precursors (YPP) gene, vitellogenin (Vg), usually considered as a reproductive indicator and molecular marker for evaluating insect fecundity, is controlled by insect hormone (mainly ecdysteroids and juvenile hormone), transcription factors and many other fecundity-related genes. To better understand the underlying molecular regulation mechanisms of the NlVg in the brown planthopper Nilaparvata lugens (N. lugens), the correlation between one early ecdysone response gene E74 and one important fecundity-related gene angiotensin converting enzyme (ACE) on the regulation of Vg gene expression, was investigated. We first showed that the mRNA expression level of NlACE were significantly higher in a high-fecundity population (HFP) than a low-fecundity population (LFP) at different development stages, and knockdown of NlACE expression by RNA interference (RNAi) results in a reduced level of NlVg expression and N. lugens fecundity. Subsequently, we analyzed the promoter of NlACE and found an E74A binding site, which was also differentially expressed in HFP and LFP. Then a gene putatively encoding E74A, namely NlE74A, predominant in the ovary and fat body was cloned and characterized. Furthermore, the developmental profile during female adult and the tissue-specific expression pattern of NlACE and NlE74A were similar to the expression pattern of NlVg gene, implying that both NlACE and NlE74A may be involved in regulating the expression of NlVg. Finally, after injecting the dsRNA of NlE74A, the NlACE expression levels were significantly reduced simultaneously at 24 h and 48 h post-injection, and the NlVg expression level was significant reduced at 24 h post-injection and the downswing was more significant at 48 h post-injection. These results imply that regulation of NlE74A on NlVg transcription might be mediated by NlACE through the E74 binding site at the NlACE promoter region in N. lugens. Copyright © 2018. Published by Elsevier Inc.

  8. Sculpturing new muscle phenotypes

    NASA Technical Reports Server (NTRS)

    Babij, P.; Booth, F. W.

    1988-01-01

    Changes in the pattern of muscle activity are followed by new patterns of protein synthesis, both in the contractile elements and in the enzymes of energy metabolism. Although the signal transducers have not been identified, techniques of molecular biology have clearly shown that the adaptive responses are the regulated consequence of differential gene expression.

  9. Acidic digestion in a teleost: postprandial and circadian pattern of gastric pH, pepsin activity, and pepsinogen and proton pump mRNAs expression.

    PubMed

    Yúfera, Manuel; Moyano, Francisco J; Astola, Antonio; Pousão-Ferreira, Pedro; Martínez-Rodríguez, Gonzalo

    2012-01-01

    Two different modes for regulation of stomach acid secretion have been described in vertebrates. Some species exhibit a continuous acid secretion maintaining a low gastric pH during fasting. Others, as some teleosts, maintain a neutral gastric pH during fasting while the hydrochloric acid is released only after the ingestion of a meal. Those different patterns seem to be closely related to specific feeding habits. However, our recent observations suggest that this acidification pattern could be modified by changes in daily feeding frequency and time schedule. The aim of this study was to advance in understanding the regulation mechanisms of stomach digestion and pattern of acid secretion in teleost fish. We have examined the postprandial pattern of gastric pH, pepsin activity, and mRNA expression for pepsinogen and proton pump in white seabream juveniles maintained under a light/dark 12/12 hours cycle and receiving only one morning meal. The pepsin activity was analyzed according to the standard protocol buffering at pH 2 and using the actual pH measured in the stomach. The results show how the enzyme precursor is permanently available while the hydrochloric acid, which activates the zymogen fraction, is secreted just after the ingestion of food. Results also reveal that analytical protocol at pH 2 notably overestimates true pepsin activity in fish stomach. The expression of the mRNA encoding pepsinogen and proton pump exhibited almost parallel patterns, with notable increases during the darkness period and sharp decreases just before the morning meal. These results indicate that white seabream uses the resting hours for recovering the mRNA stock that will be quickly used during the feeding process. Our data clearly shows that both daily illumination pattern and feeding time are involved at different level in the regulation of the secretion of digestive juices.

  10. Regulatory Snapshots: integrative mining of regulatory modules from expression time series and regulatory networks.

    PubMed

    Gonçalves, Joana P; Aires, Ricardo S; Francisco, Alexandre P; Madeira, Sara C

    2012-01-01

    Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched processes related to these biological events were identified. Ranking scores further suggested ability to discern the primary role of a gene (target or regulator). Prototype is available at: http://kdbio.inesc-id.pt/software/regulatorysnapshots.

  11. The canonical Wnt signaling activator, R-spondin2, regulates craniofacial patterning and morphogenesis within the branchial arch through ectodermal-mesenchymal interaction

    PubMed Central

    Jin, Yong-Ri; Turcotte, Taryn J.; Crocker, Alison L.; Han, Xiang Hua; Yoon, Jeong Kyo

    2011-01-01

    R-spondins are a recently characterized family of secreted proteins that activate Wnt/β-catenin signaling. Herein, we determine R-spondin2 (Rspo2) function in craniofacial development in mice. Mice lacking a functional Rspo2 gene exhibit craniofacial abnormalities such as mandibular hypoplasia, maxillary and mandibular skeletal deformation, and cleft palate. We found that loss of the mouse Rspo2 gene significantly disrupted Wnt/β-catenin signaling and gene expression within the first branchial arch (BA1). Rspo2, which is normally expressed in BA1 mesenchymal cells, regulates gene expression through a unique ectoderm-mesenchyme interaction loop. The Rspo2 protein, potentially in combination with ectoderm-derived Wnt ligands, up-regulates Msx1 and Msx2 expression within mesenchymal cells. In contrast, Rspo2 regulates expression of the Dlx5, Dlx6, and Hand2 genes in mesenchymal cells via inducing expression of their upstream activator, Endothelin1 (Edn1), within ectodermal cells. Loss of Rspo2 also causes increased cell apoptosis, especially within the aboral (or caudal) domain of the BA1, resulting in hypoplasia of the BA1. Severely reduced expression of Fgf8, a survival factor for mesenchymal cells, in the ectoderm of Rspo2−/− embryos is likely responsible for increased cell apoptosis. Additionally, we found that cleft palate in Rspo2−/− mice is not associated with defects intrinsic to the palatal shelves. A possible cause of cleft palate is a delay of proper palatal shelf elevation that may result from the small mandible and a failure of lowering the tongue. Thus, our study identifies Rspo2 as a mesenchyme-derived factor that plays critical roles in regulating BA1 patterning and morphogenesis through ectodermal-mesenchymal interaction and a novel genetic factor for cleft palate. PMID:21237142

  12. Regulatory Snapshots: Integrative Mining of Regulatory Modules from Expression Time Series and Regulatory Networks

    PubMed Central

    Gonçalves, Joana P.; Aires, Ricardo S.; Francisco, Alexandre P.; Madeira, Sara C.

    2012-01-01

    Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched processes related to these biological events were identified. Ranking scores further suggested ability to discern the primary role of a gene (target or regulator). Prototype is available at: http://kdbio.inesc-id.pt/software/regulatorysnapshots. PMID:22563474

  13. Aniline exposure associated with up-regulated transcriptional responses of three glutathione S-transferase Delta genes in Drosophila melanogaster.

    PubMed

    Chan, Wen-Chiao; Chien, Yi-Chih; Chien, Cheng-I

    2015-03-01

    Complex transcriptional profile of glutathione S-transferase Delta cluster genes occurred in the developmental process of the fruit fly Drosophila melanogaster. The purpose of this project was to quantify the expression levels of Gst Delta class genes altered by aniline exposure and to understand the relationship between aniline dosages and the variation of Gst Delta genes expressed in D. melanogaster. Using RT-PCR expression assays, the expression patterns of the transcript mRNAs of the glutathione S-transferase Delta genes were revealed and their expression levels were measured at eggs, larvae, pupae and adults. The adult stage was selected for further dose-response assays. After analysis, the results indicated that three Gst Delta genes (Gst D2, Gst D5 and Gst D6) were found to show a peak of up-regulated transcriptional response at 6-8h of exposure of aniline. Furthermore, the dose-response relationship of their induction levels within the dose regiments (from 1.2 to 2.0 μl/tube) had been measured. The expression patterns and annotations of these genes were discussed in the context. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Microarray Data Analysis of Space Grown Arabidopsis Leaves for Genes Important in Vascular Patterning. Analysis of Space Grown Arabidopsis with Microarray Data from GeneLab: Identification of Genes Important in Vascular Patterning

    NASA Technical Reports Server (NTRS)

    Weitzel, A. J.; Wyatt, S. E.; Parsons-Wingerter, P.

    2016-01-01

    Venation patterning in leaves is a major determinant of photosynthesis efficiency because of its dependency on vascular transport of photo-assimilates, water, and minerals. Arabidopsis thaliana grown in microgravity show delayed growth and leaf maturation. Gene expression data from the roots, hypocotyl, and leaves of A. thaliana grown during spaceflight vs. ground control analyzed by Affymetrix microarray are available through NASA's GeneLab (GLDS-7). We analyzed the data for differential expression of genes in leaves resulting from the effects of spaceflight on vascular patterning. Two genes were found by preliminary analysis to be up-regulated during spaceflight that may be related to vascular formation. The genes are responsible for coding an ARGOS (Auxin-Regulated Gene Involved in Organ Size)-like protein (potentially affecting cell elongation in the leaves), and an F-box/kelch-repeat protein (possibly contributing to protoxylem specification). Further analysis that will focus on raw data quality assessment and a moderated t-test may further confirm up-regulation of the two genes and/or identify other gene candidates. Plants defective in these genes will then be assessed for phenotype by the mapping and quantification of leaf vascular patterning by NASA's VESsel GENeration (VESGEN) software to model specific vascular differences of plants grown in spaceflight.

  15. Systemic Analysis of Heat Shock Response Induced by Heat Shock and a Proteasome Inhibitor MG132

    PubMed Central

    Kim, Hee-Jung; Joo, Hye Joon; Kim, Yung Hee; Ahn, Soyeon; Chang, Jun; Hwang, Kyu-Baek; Lee, Dong-Hee; Lee, Kong-Joo

    2011-01-01

    The molecular basis of heat shock response (HSR), a cellular defense mechanism against various stresses, is not well understood. In this, the first comprehensive analysis of gene expression changes in response to heat shock and MG132 (a proteasome inhibitor), both of which are known to induce heat shock proteins (Hsps), we compared the responses of normal mouse fibrosarcoma cell line, RIF- 1, and its thermotolerant variant cell line, TR-RIF-1 (TR), to the two stresses. The cellular responses we examined included Hsp expressions, cell viability, total protein synthesis patterns, and accumulation of poly-ubiquitinated proteins. We also compared the mRNA expression profiles and kinetics, in the two cell lines exposed to the two stresses, using microarray analysis. In contrast to RIF-1 cells, TR cells resist heat shock caused changes in cell viability and whole-cell protein synthesis. The patterns of total cellular protein synthesis and accumulation of poly-ubiquitinated proteins in the two cell lines were distinct, depending on the stress and the cell line. Microarray analysis revealed that the gene expression pattern of TR cells was faster and more transient than that of RIF-1 cells, in response to heat shock, while both RIF-1 and TR cells showed similar kinetics of mRNA expression in response to MG132. We also found that 2,208 genes were up-regulated more than 2 fold and could sort them into three groups: 1) genes regulated by both heat shock and MG132, (e.g. chaperones); 2) those regulated only by heat shock (e.g. DNA binding proteins including histones); and 3) those regulated only by MG132 (e.g. innate immunity and defense related molecules). This study shows that heat shock and MG132 share some aspects of HSR signaling pathway, at the same time, inducing distinct stress response signaling pathways, triggered by distinct abnormal proteins. PMID:21738571

  16. Low temperature-induced DNA hypermethylation attenuates expression of RhAG, an AGAMOUS homolog, and increases petal number in rose (Rosa hybrida).

    PubMed

    Ma, Nan; Chen, Wen; Fan, Tiangang; Tian, Yaran; Zhang, Shuai; Zeng, Daxing; Li, Yonghong

    2015-10-05

    Flower development is central to angiosperm reproduction and is regulated by a broad range of endogenous and exogenous stimuli. It has been well documented that ambient temperature plays a key role in controlling flowering time; however, the mechanisms by which temperature regulates floral organ differentiation remain largely unknown. In this study, we show that low temperature treatment significantly increases petal number in rose (Rosa hybrida) through the promotion of stamen petaloidy. Quantitative RT-PCR analysis revealed that the expression pattern of RhAG, a rose homolog of the Arabidopsis thaliana AGAMOUS C-function gene, is associated with low temperature regulated flower development. Silencing of RhAG mimicked the impact of low temperature treatments on petal development by significantly increasing petal number through an increased production of petaloid stamens. In situ hybridization studies further revealed that low temperature restricts its spatial expression area. Analysis of DNA methylation level showed that low temperature treatment enhances the methylation level of the RhAG promoter, and a specific promoter region that was hypermethylated at CHH loci under low temperature conditions, was identified by bisulfite sequencing. This suggests that epigenetic DNA methylation contributes to the ambient temperature modulation of RhAG expression. Our results provide highlights in the role of RhAG gene in petal number determination and add a new layer of complexity in the regulation of floral organ development. We propose that RhAG plays an essential role in rose flower patterning by regulating petal development, and that low temperatures increase petal number, at least in part, by suppressing RhAG expression via enhancing DNA CHH hypermethylation of the RhAG promoter.

  17. Astrocytic glutamine synthetase is expressed in the neuronal somatic layers and down-regulated proportionally to neuronal loss in the human epileptic hippocampus.

    PubMed

    Papageorgiou, Ismini E; Valous, Nektarios A; Lahrmann, Bernd; Janova, Hana; Klaft, Zin-Juan; Koch, Arend; Schneider, Ulf C; Vajkoczy, Peter; Heppner, Frank L; Grabe, Niels; Halama, Niels; Heinemann, Uwe; Kann, Oliver

    2018-05-01

    Human mesial temporal lobe epilepsy (MTLE) features subregion-specific hippocampal neurodegeneration and reactive astrogliosis, including up-regulation of the glial fibrillary acidic protein (GFAP) and down-regulation of glutamine synthetase (GS). However, the regional astrocytic expression pattern of GFAP and GS upon MTLE-associated neurodegeneration still remains elusive. We assessed GFAP and GS expression in strict correlation with the local neuronal number in cortical and hippocampal surgical specimens from 16 MTLE patients using immunohistochemistry, stereology and high-resolution image analysis for digital pathology and whole-slide imaging. In the cortex, GS-positive (GS+) astrocytes are dominant in all neuronal layers, with a neuron to GS+ cell ratio of 2:1. GFAP-positive (GFAP+) cells are widely spaced, with a GS+ to GFAP+ cell ratio of 3:1-5:1. White matter astrocytes, on the contrary, express mainly GFAP and, to a lesser extent, GS. In the hippocampus, the neuron to GS+ cell ratio is approximately 1:1. Hippocampal degeneration is associated with a reduction of GS+ astrocytes, which is proportional to the degree of neuronal loss and primarily present in the hilus. Up-regulation of GFAP as a classical hallmark of reactive astrogliosis does not follow the GS-pattern and is prominent in the CA1. Reactive alterations were proportional to the neuronal loss in the neuronal somatic layers (stratum pyramidale and hilus), while observed to a lesser extent in the axonal/dendritic layers (stratum radiatum, molecular layer). We conclude that astrocytic GS is expressed in the neuronal somatic layers and, upon neurodegeneration, is down-regulated proportionally to the degree of neuronal loss. © 2018 Wiley Periodicals, Inc.

  18. Multiple correlation analyses revealed complex relationship between DNA methylation and mRNA expression in human peripheral blood mononuclear cells.

    PubMed

    Xie, Fang-Fei; Deng, Fei-Yan; Wu, Long-Fei; Mo, Xing-Bo; Zhu, Hong; Wu, Jian; Guo, Yu-Fan; Zeng, Ke-Qin; Wang, Ming-Jun; Zhu, Xiao-Wei; Xia, Wei; Wang, Lan; He, Pei; Bing, Peng-Fei; Lu, Xin; Zhang, Yong-Hong; Lei, Shu-Feng

    2018-01-01

    DNA methylation is an important regulator on the mRNA expression. However, a genome-wide correlation pattern between DNA methylation and mRNA expression in human peripheral blood mononuclear cells (PBMCs) is largely unknown. The comprehensive relationship between mRNA and DNA methylation was explored by using four types of correlation analyses and a genome-wide methylation-mRNA expression quantitative trait locus (eQTL) analysis in PBMCs in 46 unrelated female subjects. An enrichment analysis was performed to detect biological function for the detected genes. Single pair correlation coefficient (r T1 ) between methylation level and mRNA is moderate (-0.63-0.62) in intensity, and the negative and positive correlations are nearly equal in quantity. Correlation analysis on each gene (T4) found 60.1% genes showed correlations between mRNA and gene-based methylation at P < 0.05 and more than 5.96% genes presented very strong correlation (R T4  > 0.8). Methylation sites have regulation effects on mRNA expression in eQTL analysis, with more often observations in region of transcription start site (TSS). The genes under significant methylation regulation both in correlation analysis and eQTL analysis tend to cluster to the categories (e.g., transcription, translation, regulation of transcription) that are essential for maintaining the basic life activities of cells. Our findings indicated that DNA methylation has predictive regulation effect on mRNA with a very complex pattern in PBMCs. The results increased our understanding on correlation of methylation and mRNA and also provided useful clues for future epigenetic studies in exploring biological and disease-related regulatory mechanisms in PBMC.

  19. Identification of new modes of Dd-STATa regulation of gene expression in Dictyostelium by in situ hybridisation.

    PubMed

    Shimada, Nao; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi

    2004-09-01

    Signal Transducers and Activators of Transcription (STATs) are transcription factors which lie at the end of cytokine and growth signal transduction pathways. Dictyostelium Dd-STATa is a functional homologue of metazoan STATs. It is activated by cAMP and, at the slug stage, it translocates into the nuclei of the tip cells, which are a subset of the anterior, prestalk A (pstA) cells. Here we searched for novel Dd-STATa regulated genes by in situ hybridisation. A set of 54 cDNA clones whose gene expression patterns are known to be prestalk-specific (Maeda et al., 2003), were chosen as probes and we compared their expression patterns in parental and Dd-STATa-null strains. We identified 13 genes which are candidates for direct induction by Dd-STATa. In the parental strain, most of these genes are expressed in the cone shaped mass of pstAB cells which is located within the prestalk region. These cDNAs show little or no expression in the Dd-STATa-null strain. This contrasts markedly with the paradigmatic ecmB gene which is expressed in pstAB cells in parental cells, but which is expressed throughout the prestalk zone in the Dd-STATa-null strain. We also identified several genes which are normally expressed in pstA cells, or throughout the prestalk region, but whose expression is markedly down-regulated in the null mutant. Again, this contrasts with markers derived from the paradigmatic, ecmA gene which are expressed normally in the Dd-STATa-null strain. The identification of these novel genes provides valuable tools to investigate the role of Dd-STATa.

  20. Recrudescence Mechanisms and Gene Expression Profile of the Reproductive Tracts from Chickens during the Molting Period

    PubMed Central

    Ahn, Suzie E.; Lim, Chul-Hong; Lee, Jin-Young; Bae, Seung-Min; Kim, Jinyoung; Bazer, Fuller W.; Song, Gwonhwa

    2013-01-01

    The reproductive system of chickens undergoes dynamic morphological and functional tissue remodeling during the molting period. The present study identified global gene expression profiles following oviductal tissue regression and regeneration in laying hens in which molting was induced by feeding high levels of zinc in the diet. During the molting and recrudescence processes, progressive morphological and physiological changes included regression and re-growth of reproductive organs and fluctuations in concentrations of testosterone, progesterone, estradiol and corticosterone in blood. The cDNA microarray analysis of oviductal tissues revealed the biological significance of gene expression-based modulation in oviductal tissue during its remodeling. Based on the gene expression profiles, expression patterns of selected genes such as, TF, ANGPTL3, p20K, PTN, AvBD11 and SERPINB3 exhibited similar patterns in expression with gradual decreases during regression of the oviduct and sequential increases during resurrection of the functional oviduct. Also, miR-1689* inhibited expression of Sp1, while miR-17-3p, miR-22* and miR-1764 inhibited expression of STAT1. Similarly, chicken miR-1562 and miR-138 reduced the expression of ANGPTL3 and p20K, respectively. These results suggest that these differentially regulated genes are closely correlated with the molecular mechanism(s) for development and tissue remodeling of the avian female reproductive tract, and that miRNA-mediated regulation of key genes likely contributes to remodeling of the avian reproductive tract by controlling expression of those genes post-transcriptionally. The discovered global gene profiles provide new molecular candidates responsible for regulating morphological and functional recrudescence of the avian reproductive tract, and provide novel insights into understanding the remodeling process at the genomic and epigenomic levels. PMID:24098561

  1. Adolescent binge-pattern alcohol exposure alters genome-wide DNA methylation patterns in the hypothalamus of alcohol-naïve male offspring.

    PubMed

    Asimes, AnnaDorothea; Torcaso, Audrey; Pinceti, Elena; Kim, Chun K; Zeleznik-Le, Nancy J; Pak, Toni R

    2017-05-01

    Teenage binge drinking is a major health concern in the United States, with 21% of teenagers reporting binge-pattern drinking behavior in the previous 30 days. Recently, our lab showed that alcohol-naïve offspring of rats exposed to alcohol during adolescence exhibited altered gene expression profiles in the hypothalamus, a brain region involved in stress regulation. We employed Enhanced Reduced Representation Bisulfite Sequencing as an unbiased approach to test the hypothesis that parental exposure to binge-pattern alcohol during adolescence alters DNA methylation profiles in their alcohol-naïve offspring. Wistar rats were administered a repeated binge-ethanol exposure paradigm during early (postnatal day (PND) 37-44) and late (PND 67-74) adolescent development. Animals were mated 24 h after the last ethanol dose and subsequent offspring were produced. Analysis of male PND7 offspring revealed that offspring of alcohol-exposed parents exhibited differential DNA methylation patterns in the hypothalamus. The differentially methylated cytosines (DMCs) were distinct between offspring depending on which parent was exposed to ethanol. Moreover, novel DMCs were observed when both parents were exposed to ethanol and many DMCs from single parent ethanol exposure were not recapitulated with dual parent exposure. We also measured mRNA expression of several differentially methylated genes and some, but not all, showed correlative changes in expression. Importantly, methylation was not a direct predictor of expression levels, underscoring the complexity of transcriptional regulation. Overall, we demonstrate that adolescent binge ethanol exposure causes altered genome-wide DNA methylation patterns in the hypothalamus of alcohol-naïve offspring. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Adolescent binge-pattern alcohol exposure alters genome-wide DNA methylation patterns in the hypothalamus of alcohol-naïve male offspring

    PubMed Central

    Asimes, AnnaDorothea; Torcaso, Audrey; Pinceti, Elena; Kim, Chun K; Zeleznik-Le, Nancy J.; Pak, Toni R.

    2016-01-01

    Teenage binge drinking is a major health concern in the United States, with 21% of teenagers reporting binge-pattern drinking behavior in the last 30 days. Recently, our lab showed that alcohol-naïve offspring of rats exposed to alcohol during adolescence exhibited altered gene expression profiles in the hypothalamus, a brain region involved in stress regulation. We employed Enhanced Reduced Representation Bisulfite Sequencing as an unbiased approach to test the hypothesis that parental exposure to binge-pattern alcohol during adolescence alters DNA methylation profiles in their alcohol-naïve offspring. Wistar rats were administered a repeated binge-ethanol exposure paradigm during early (postnatal day (PND) 37-44) and late (PND 67-74) adolescent development. Animals were mated 24h after the last ethanol dose and subsequent offspring were produced. Analysis of male PND7 offspring revealed that offspring of alcohol-exposed parents exhibited differential DNA methylation patterns in the hypothalamus. The differentially methylated cytosines (DMCs) were distinct between offspring depending on which parent was exposed to ethanol. Moreover, novel DMCs were observed when both parents were exposed to ethanol and many DMCs from single parent ethanol exposure were not recapitulated with dual parent exposure. We also measured mRNA expression of several differentially methylated genes and some, but not all, showed correlative changes in expression. Importantly, methylation was not a direct predictor of expression levels, underscoring the complexity of transcriptional regulation. Overall, we demonstrate that adolescent binge ethanol exposure causes altered genome-wide DNA methylation patterns in the hypothalamus of alcohol-naïve offspring. PMID:27817987

  3. Global gene expression analyses of hematopoietic stem cell-like cell lines with inducible Lhx2 expression

    PubMed Central

    Richter, Karin; Wirta, Valtteri; Dahl, Lina; Bruce, Sara; Lundeberg, Joakim; Carlsson, Leif; Williams, Cecilia

    2006-01-01

    Background Expression of the LIM-homeobox gene Lhx2 in murine hematopoietic cells allows for the generation of hematopoietic stem cell (HSC)-like cell lines. To address the molecular basis of Lhx2 function, we generated HSC-like cell lines where Lhx2 expression is regulated by a tet-on system and hence dependent on the presence of doxycyclin (dox). These cell lines efficiently down-regulate Lhx2 expression upon dox withdrawal leading to a rapid differentiation into various myeloid cell types. Results Global gene expression of these cell lines cultured in dox was compared to different time points after dox withdrawal using microarray technology. We identified 267 differentially expressed genes. The majority of the genes overlapping with HSC-specific databases were those down-regulated after turning off Lhx2 expression and a majority of the genes overlapping with those defined as late progenitor-specific genes were the up-regulated genes, suggesting that these cell lines represent a relevant model system for normal HSCs also at the level of global gene expression. Moreover, in situ hybridisations of several genes down-regulated after dox withdrawal showed overlapping expression patterns with Lhx2 in various tissues during embryonic development. Conclusion Global gene expression analysis of HSC-like cell lines with inducible Lhx2 expression has identified genes putatively linked to self-renewal / differentiation of HSCs, and function of Lhx2 in organ development and stem / progenitor cells of non-hematopoietic origin. PMID:16600034

  4. Individual Differences in Automatic Emotion Regulation Interact with Primed Emotion Regulation during an Anger Provocation.

    PubMed

    Zhang, Jing; Lipp, Ottmar V; Hu, Ping

    2017-01-01

    The current study investigated the interactive effects of individual differences in automatic emotion regulation (AER) and primed emotion regulation strategy on skin conductance level (SCL) and heart rate during provoked anger. The study was a 2 × 2 [AER tendency (expression vs. control) × priming (expression vs. control)] between subject design. Participants were assigned to two groups according to their performance on an emotion regulation-IAT (differentiating automatic emotion control tendency and automatic emotion expression tendency). Then participants of the two groups were randomly assigned to two emotion regulation priming conditions (emotion control priming or emotion expression priming). Anger was provoked by blaming participants for slow performance during a subsequent backward subtraction task. In anger provocation, SCL of individuals with automatic emotion control tendencies in the control priming condition was lower than of those with automatic emotion control tendencies in the expression priming condition. However, SCL of individuals with automatic emotion expression tendencies did no differ in the automatic emotion control priming or the automatic emotion expression priming condition. Heart rate during anger provocation was higher in individuals with automatic emotion expression tendencies than in individuals with automatic emotion control tendencies regardless of priming condition. This pattern indicates an interactive effect of individual differences in AER and emotion regulation priming on SCL, which is an index of emotional arousal. Heart rate was only sensitive to the individual differences in AER, and did not reflect this interaction. This finding has implications for clinical studies of the use of emotion regulation strategy training suggesting that different practices are optimal for individuals who differ in AER tendencies.

  5. Characterization of basal gene expression trends over a diurnal cycle in Xiphophorus maculatus skin, brain and liver.

    PubMed

    Lu, Yuan; Reyes, Jose; Walter, Sean; Gonzalez, Trevor; Medrano, Geraldo; Boswell, Mikki; Boswell, William; Savage, Markita; Walter, Ronald

    2018-06-01

    Evolutionarily conserved diurnal circadian mechanisms maintain oscillating patterns of gene expression based on the day-night cycle. Xiphophorus fish have been used to evaluate transcriptional responses after exposure to various light sources and it was determined that each source incites distinct genetic responses in skin tissue. However, basal expression levels of genes that show oscillating expression patterns in day-night cycle, may affect the outcomes of such experiments, since basal gene expression levels at each point in the circadian path may influence the profile of identified light responsive genes. Lack of knowledge regarding diurnal fluctuations in basal gene expression patterns may confound the understanding of genetic responses to external stimuli (e.g., light) since the dynamic nature of gene expression implies animals subjected to stimuli at different times may be at very different stages within the continuum of genetic homeostasis. We assessed basal gene expression changes over a 24-hour period in 200 select Xiphophorus gene targets known to transcriptionally respond to various types of light exposure. We identified 22 genes in skin, 36 genes in brain and 28 genes in liver that exhibit basal oscillation of expression patterns. These genes, including known circadian regulators, produced the expected expression patterns over a 24-hour cycle when compared to circadian regulatory genes identified in other species, especially human and other vertebrate animal models. Our results suggest the regulatory network governing diurnal oscillating gene expression is similar between Xiphophorus and other vertebrates for the three Xiphophorus organs tested. In addition, we were able to categorize light responsive gene sets in Xiphophorus that do, and do not, exhibit circadian based oscillating expression patterns. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. The use of micropatterning to control smooth muscle myosin heavy chain expression and limit the response to transforming growth factor β1 in vascular smooth muscle cells

    PubMed Central

    Williams, Corin; Brown, Xin Q; Bartolak-Suki, Erzsebet; Ma, Hongwei; Chilkoti, Ashutosh; Wong, Joyce Y

    2010-01-01

    In the healthy artery, contractile vascular smooth muscle cells (VSMCs) have an elongated shape and are highly aligned but transition to a synthetic phenotype in culture, while additionally becoming well spread and randomly organized. Thus, controlling VSMC phenotype is a challenge in tissue engineering. In this study, we investigated the effects of micropatterning on contractile protein expression in VSMCs at low and high passage and in the presence of transforming growth factor beta 1 (TGFβ1). Micropatterning led to significantly decreased cell area, increased elongation, and increased alignment compared to non-patterned VSMCs independent of passage number. In the presence of serum, micropatterning led to increased smooth muscle myosin heavy chain (SM-MHC) and α-actin expression in low passage VSMCs, but had no effect on high passage VSMCs. Micropatterning was as effective as TGFβ1 in up-regulating SM-MHC at low passage; however, micropatterning limited VSMC response to TGFβ1 at both low and high passage. Investigation of TGFβ receptor 1 revealed higher expression in non-patterned VSMCs compared to patterned at high passage. Our studies demonstrate that micropatterning is an important regulator of SM-MHC expression in contractile VSMCs and that it may provide a mechanism for phenotype stabilization in the presence of growth factors. PMID:20858564

  7. Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

    PubMed

    Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

    2005-05-13

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

  8. The Expression of Glyceraldehyde-3-Phosphate Dehydrogenase Associated Cell Cycle (GACC) Genes Correlates with Cancer Stage and Poor Survival in Patients with Solid Tumors

    PubMed Central

    Wang, Dunrui; Moothart, Daniel R.; Lowy, Douglas R.; Qian, Xiaolan

    2013-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is often used as a stable housekeeping marker for constant gene expression. However, the transcriptional levels of GAPDH may be highly up-regulated in some cancers, including non-small cell lung cancers (NSCLC). Using a publically available microarray database, we identified a group of genes whose expression levels in some cancers are highly correlated with GAPDH up-regulation. The majority of the identified genes are cell cycle-dependent (GAPDH Associated Cell Cycle, or GACC). The up-regulation pattern of GAPDH positively associated genes in NSCLC is similar to that observed in cultured fibroblasts grown under conditions that induce anti-senescence. Data analysis demonstrated that up-regulated GAPDH levels are correlated with aberrant gene expression related to both glycolysis and gluconeogenesis pathways. Down-regulation of fructose-1,6-bisphosphatase (FBP1) in gluconeogenesis in conjunction with up-regulation of most glycolytic genes is closely related to high expression of GAPDH in the tumors. The data presented demonstrate that up-regulation of GAPDH positively associated genes is proportional to the malignant stage of various tumors and is associated with an unfavourable prognosis. Thus, this work suggests that GACC genes represent a potential new signature for cancer stage identification and disease prognosis. PMID:23620736

  9. In Vivo Regulation of Human Skeletal Muscle Gene Expression by Thyroid Hormone

    PubMed Central

    Clément, Karine; Viguerie, Nathalie; Diehn, Maximilian; Alizadeh, Ash; Barbe, Pierre; Thalamas, Claire; Storey, John D.; Brown, Patrick O.; Barsh, Greg S.; Langin, Dominique

    2002-01-01

    Thyroid hormones are key regulators of metabolism that modulate transcription via nuclear receptors. Hyperthyroidism is associated with increased metabolic rate, protein breakdown, and weight loss. Although the molecular actions of thyroid hormones have been studied thoroughly, their pleiotropic effects are mediated by complex changes in expression of an unknown number of target genes. Here, we measured patterns of skeletal muscle gene expression in five healthy men treated for 14 days with 75 μg of triiodothyronine, using 24,000 cDNA element microarrays. To analyze the data, we used a new statistical method that identifies significant changes in expression and estimates the false discovery rate. The 381 up-regulated genes were involved in a wide range of cellular functions including transcriptional control, mRNA maturation, protein turnover, signal transduction, cellular trafficking, and energy metabolism. Only two genes were down-regulated. Most of the genes are novel targets of thyroid hormone. Cluster analysis of triiodothyronine-regulated gene expression among 19 different human tissues or cell lines revealed sets of coregulated genes that serve similar biologic functions. These results define molecular signatures that help to understand the physiology and pathophysiology of thyroid hormone action. [The list of transcripts corresponding to up-regulated and down-regulated genes is available as a web supplement at http://www.genome.org.] PMID:11827947

  10. Gene Expression and Metabolite Profiling of Developing Highbush Blueberry Fruit Indicates Transcriptional Regulation of Flavonoid Metabolism and Activation of Abscisic Acid Metabolism1[W][OA

    PubMed Central

    Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A.; Zaharia, L. Irina; Schernthaner, Johann P.; Gesell, Andreas; Abrams, Suzanne R.; Kennedy, James A.; Constabel, C. Peter

    2012-01-01

    Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3′-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3′5′-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation of blueberry flavonoid biosynthesis. PMID:22086422

  11. Gene expression and metabolite profiling of developing highbush blueberry fruit indicates transcriptional regulation of flavonoid metabolism and activation of abscisic acid metabolism.

    PubMed

    Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A; Zaharia, L Irina; Schernthaner, Johann P; Gesell, Andreas; Abrams, Suzanne R; Kennedy, James A; Constabel, C Peter

    2012-01-01

    Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3'-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3'5'-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation of blueberry flavonoid biosynthesis.

  12. Identification of Methanococcus Jannaschii Proteins in 2-D Gel Electrophoresis Patterns by Mass Spectrometry

    DOE R&D Accomplishments Database

    Liang, X.

    1998-06-10

    The genome of Methanococcus jannaschii has been sequenced completely and has been found to contain approximately 1,770 predicted protein-coding regions. When these coding regions are expressed and how their expression is regulated, however, remain open questions. In this work, mass spectrometry was combined with two-dimensional gel electrophoresis to identify which proteins the genes produce under different growth conditions, and thus investigate the regulation of genes responsible for functions characteristic of this thermophilic representative of the methanogenic Archaea.

  13. Isolation of a transcription factor expressed in neural crest from the region of 22q11 deleted in DiGeorge syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wadey, R.; Roberts, C.; Daw, S.

    1994-09-01

    Deletions within chromosome 22q11 cause a wide variety of birth defects including DiGeorge syndrome and Shprintzen syndrome. We have defined a commonly deleted region of over 2 Mb, and a critical region of 300 kb. A gene, TUPLE1, has been isolated from this critical region encoding a transcriptional regulator similar to the yeast HIR1 histone regulator gene. Since it has been suggested that DGS results from a defective neural crest, the expression of Tuple1 was examined in whole mouse and chick embryos, tissue sections and neural tube explants: Tuple1 is expressed in a dynamic pattern with high levels in regionsmore » containing migrating crest. Prior to crest migration Tuple1 is expressed in a rhombomere-specific expression pattern. Later Tuple1 is expressed in discrete domains within the developing neural tube. A remarkable feature of the experiments was the detection of a similar dynamic pattern with sense probe; i.e., there is an antisense Tuple1 transcript. This was confirmed using RPA. Tuple1 is being screened for mutations in non-deletion patients and constructs assembled for homologous recombination in ES cells. Tuple1 maps to MMU16 extending the homology of linkage with human chromosome 22. From these data we predict that the human homologue of the murine scid mutation maps to 22q11.« less

  14. Patterning of inflorescences and flowers by the F-Box protein DOUBLE TOP and the LEAFY homolog ABERRANT LEAF AND FLOWER of petunia.

    PubMed

    Souer, Erik; Rebocho, Alexandra B; Bliek, Mattijs; Kusters, Elske; de Bruin, Robert A M; Koes, Ronald

    2008-08-01

    Angiosperms display a wide variety of inflorescence architectures differing in the positions where flowers or branches arise. The expression of floral meristem identity (FMI) genes determines when and where flowers are formed. In Arabidopsis thaliana, this is regulated via transcription of LEAFY (LFY), which encodes a transcription factor that promotes FMI. We found that this is regulated in petunia (Petunia hybrida) via transcription of a distinct gene, DOUBLE TOP (DOT), a homolog of UNUSUAL FLORAL ORGANS (UFO) from Arabidopsis. Mutation of DOT or its tomato (Solanum lycopersicum) homolog ANANTHA abolishes FMI. Ubiquitous expression of DOT or UFO in petunia causes very early flowering and transforms the inflorescence into a solitary flower and leaves into petals. Ectopic expression of DOT or UFO together with LFY or its homolog ABERRANT LEAF AND FLOWER (ALF) in petunia seedlings activates genes required for identity or outgrowth of organ primordia. DOT interacts physically with ALF, suggesting that it activates ALF by a posttranslational mechanism. Our findings suggest a wider role than previously thought for DOT and UFO in the patterning of flowers and indicate that the different roles of LFY and UFO homologs in the spatiotemporal control of floral identity in distinct species result from their divergent expression patterns.

  15. Phosphorylation of Trihelix Transcriptional Repressor ASR3 by MAP KINASE4 Negatively Regulates Arabidopsis Immunity

    PubMed Central

    Li, Bo; Jiang, Shan; Yu, Xiao; Cheng, Cheng; Chen, Sixue; Cheng, Yanbing; Yuan, Joshua S.; Jiang, Daohong; He, Ping; Shan, Libo

    2015-01-01

    Proper control of immune-related gene expression is crucial for the host to launch an effective defense response. Perception of microbe-associated molecular patterns (MAMPs) induces rapid and profound transcriptional reprogramming via unclear mechanisms. Here, we show that ASR3 (ARABIDOPSIS SH4-RELATED3) functions as a transcriptional repressor and plays a negative role in regulating pattern-triggered immunity (PTI) in Arabidopsis thaliana. ASR3 belongs to a plant-specific trihelix transcription factor family for which functional studies are lacking. MAMP treatments induce rapid phosphorylation of ASR3 at threonine 189 via MPK4, a mitogen-activated protein kinase that negatively regulates PTI responses downstream of multiple MAMP receptors. ASR3 possesses transcriptional repressor activity via its ERF-associated amphiphilic repression motifs and negatively regulates a large subset of flg22-induced genes. Phosphorylation of ASR3 by MPK4 enhances its DNA binding activity to suppress gene expression. Importantly, the asr3 mutant shows enhanced disease resistance to virulent bacterial pathogen infection, whereas transgenic plants overexpressing the wild-type or phospho-mimetic form of ASR3 exhibit compromised PTI responses. Our studies reveal a function of the trihelix transcription factors in plant innate immunity and provide evidence that ASR3 functions as a transcriptional repressor regulated by MAMP-activated MPK4 to fine-tune plant immune gene expression. PMID:25770109

  16. Embryonic expression of endothelins and their receptors in lamprey and frog reveals stem vertebrate origins of complex Endothelin signaling

    PubMed Central

    Square, Tyler; Jandzik, David; Cattell, Maria; Hansen, Andrew; Medeiros, Daniel Meulemans

    2016-01-01

    Neural crest cells (NCCs) are highly patterned embryonic cells that migrate along stereotyped routes to give rise to a diverse array of adult tissues and cell types. Modern NCCs are thought to have evolved from migratory neural precursors with limited developmental potential and patterning. How this occurred is poorly understood. Endothelin signaling regulates several aspects of NCC development, including their migration, differentiation, and patterning. In jawed vertebrates, Endothelin signaling involves multiple functionally distinct ligands (Edns) and receptors (Ednrs) expressed in various NCC subpopulations. To test the potential role of endothelin signaling diversification in the evolution of modern, highly patterned NCC, we analyzed the expression of the complete set of endothelin ligands and receptors in the jawless vertebrate, the sea lamprey (Petromyzon marinus). To better understand ancestral features of gnathostome edn and ednr expression, we also analyzed all known Endothelin signaling components in the African clawed frog (Xenopus laevis). We found that the sea lamprey has a gnathsotome-like complement of edn and ednr duplicates, and these genes are expressed in patterns highly reminiscent of their gnathostome counterparts. Our results suggest that the duplication and specialization of vertebrate Endothelin signaling coincided with the appearance of highly patterned and multipotent NCCs in stem vertebrates. PMID:27677704

  17. Induction of P450 genes in Nilaparvata lugens and Sogatella furcifera by two neonicotinoid insecticides.

    PubMed

    Yang, Yuan-Xue; Yu, Na; Zhang, Jian-Hua; Zhang, Yi-Xi; Liu, Ze-Wen

    2018-06-01

    Nilaparvata lugens and Sogatella furcifera are two primary planthoppers on rice throughout Asian countries and areas. Neonicotinoid insecticides, such as imidacloprid (IMI), have been extensively used to control rice planthoppers and IMI resistance consequently occurred with an important mechanism from the over-expression of P450 genes. The induction of P450 genes by IMI may increase the ability to metabolize this insecticide in planthoppers and increase the resistance risk. In this study, the induction of P450 genes was compared in S. furcifera treated with IMI and nitromethyleneimidazole (NMI), in two planthopper species by IMI lethal dose that kills 85% of the population (LD 85 ), and in N. lugens among three IMI doses (LD 15 , LD 50 and LD 85 ). When IMI and NMI at the LD 85 dose were applied to S. furcifera, the expression changes in most P450 genes were similar, including the up-regulation of nine genes and down-regulation of three genes. In terms of the expression changes in 12 homologous P450 genes between N. lugens and S. furcifera treated with IMI at the LD 85 dose, 10 genes had very similar patterns, such as up-regulation in seven genes, down-regulation in one gene and no significant changes in two genes. When three different IMI doses were applied to N. lugens, the changes in P450 gene expression were much different, such as up-regulation in four genes at all doses and dose-dependent regulation of the other nine genes. For example, CYP6AY1 could be induced by all IMI doses, while CYP6ER1 was only up-regulated by the LD 50 dose, although both genes were reported important in IMI resistance. In conclusion, P450 genes in two planthopper species showed similar regulation patterns in responding to IMI, and the two neonicotinoid insecticides had similar effects on P450 gene expression, although the regulation was often dose-dependent. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Suna, E-mail: wangs3@mail.nih.gov; Zhou, Yifu; Andreyev, Oleg

    Studying the proliferative ability of human bone marrow derived mesenchymal stem cells in hypoxic conditions can help us achieve the effective regeneration of ischemic injured myocardium. Cardiac-type fatty acid binding protein (FABP3) is a specific biomarker of muscle and heart tissue injury. This protein is purported to be involved in early myocardial development, adult myocardial tissue repair and responsible for the modulation of cell growth and proliferation. We have investigated the role of FABP3 in human bone marrow derived mesenchymal stem cells under ischemic conditions. MSCs from 12 donors were cultured either in standard normoxic or modified hypoxic conditions, andmore » the differential expression of FABP3 was tested by quantitative {sup RT}PCR and western blot. We also established stable FABP3 expression in MSCs and searched for variation in cellular proliferation and differentiation bioprocesses affected by hypoxic conditions. We identified: (1) the FABP3 differential expression pattern in the MSCs under hypoxic conditions; (2) over-expression of FABP3 inhibited the growth and proliferation of the MSCs; however, improved their survival in low oxygen environments; (3) the cell growth factors and positive cell cycle regulation genes, such as PCNA, APC, CCNB1, CCNB2 and CDC6 were all down-regulated; while the key negative cell cycle regulation genes TP53, BRCA1, CASP3 and CDKN1A were significantly up-regulated in the cells with FABP3 overexpression. Our data suggested that FABP3 was up-regulated under hypoxia; also negatively regulated the cell metabolic process and the mitotic cell cycle. Overexpression of FABP3 inhibited cell growth and proliferation via negative regulation of the cell cycle and down-regulation of cell growth factors, but enhances cell survival in hypoxic or ischemic conditions. - Highlights: • FABP3 expression pattern was studied in 12 human hypoxic-MSCs. • FABP3 mRNA and proteins are upregulated in the MSCs under hypoxic conditions. • Overexpression of FABP3 inhibits cell growth but advanced the MSC survival under hypoxia. • Overexpression of FABP3 down-regulate the cell cycle and stem cell signaling pathways.« less

  19. WEREWOLF and ENHANCER of GLABRA3 are interdependent regulators of the spatial expression pattern of GLABRA2 in Arabidopsis.

    PubMed

    Song, Sang-Kee; Kwak, Su-Hwan; Chang, Soo Chul; Schiefelbein, John; Lee, Myeong Min

    2015-11-06

    In multicellular organisms, cell fates are specified through differential regulation of transcription. Epidermal cell fates in the Arabidopsis thaliana root are precisely specified by several transcription factors, with the GLABRA2 (GL2) homeodomain protein acting at the farthest downstream in this process. To better understand the regulation of GL2 expression, we ectopically expressed WEREWOLF (WER) and ENHANCER OF GLABRA3 (EGL3) in various tissues and examined GL2 expression. Here we show that WER expressed ubiquitously in the root induced GL2 expression only in the root epidermis, whereas co-expression of WER and EGL3 induced GL2 expression in the corresponding tissues. We also found that GL3 accumulated in the nucleus at the early meristematic region and EGL3 accumulated later in the nucleus of epidermal cells. We further found that ectopic expression of WER and EGL3 in ground tissues inhibited GL2 expression in the epidermis. Our results suggest that the co-expression of WER and EGL3 is sufficient for driving GL2 and CPC expression. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).

    PubMed

    Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko

    2010-02-01

    GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.

  1. HIV promoter integration site primarily modulates transcriptional burst size rather than frequency.

    PubMed

    Skupsky, Ron; Burnett, John C; Foley, Jonathan E; Schaffer, David V; Arkin, Adam P

    2010-09-30

    Mammalian gene expression patterns, and their variability across populations of cells, are regulated by factors specific to each gene in concert with its surrounding cellular and genomic environment. Lentiviruses such as HIV integrate their genomes into semi-random genomic locations in the cells they infect, and the resulting viral gene expression provides a natural system to dissect the contributions of genomic environment to transcriptional regulation. Previously, we showed that expression heterogeneity and its modulation by specific host factors at HIV integration sites are key determinants of infected-cell fate and a possible source of latent infections. Here, we assess the integration context dependence of expression heterogeneity from diverse single integrations of a HIV-promoter/GFP-reporter cassette in Jurkat T-cells. Systematically fitting a stochastic model of gene expression to our data reveals an underlying transcriptional dynamic, by which multiple transcripts are produced during short, infrequent bursts, that quantitatively accounts for the wide, highly skewed protein expression distributions observed in each of our clonal cell populations. Interestingly, we find that the size of transcriptional bursts is the primary systematic covariate over integration sites, varying from a few to tens of transcripts across integration sites, and correlating well with mean expression. In contrast, burst frequencies are scattered about a typical value of several per cell-division time and demonstrate little correlation with the clonal means. This pattern of modulation generates consistently noisy distributions over the sampled integration positions, with large expression variability relative to the mean maintained even for the most productive integrations, and could contribute to specifying heterogeneous, integration-site-dependent viral production patterns in HIV-infected cells. Genomic environment thus emerges as a significant control parameter for gene expression variation that may contribute to structuring mammalian genomes, as well as be exploited for survival by integrating viruses.

  2. MicroRNA profiling of the murine hematopoietic system

    PubMed Central

    Monticelli, Silvia; Ansel, K Mark; Xiao, Changchun; Socci, Nicholas D; Krichevsky, Anna M; Thai, To-Ha; Rajewsky, Nikolaus; Marks, Debora S; Sander, Chris; Rajewsky, Klaus; Rao, Anjana; Kosik, Kenneth S

    2005-01-01

    Background MicroRNAs (miRNAs) are a class of recently discovered noncoding RNA genes that post-transcriptionally regulate gene expression. It is becoming clear that miRNAs play an important role in the regulation of gene expression during development. However, in mammals, expression data are principally based on whole tissue analysis and are still very incomplete. Results We used oligonucleotide arrays to analyze miRNA expression in the murine hematopoietic system. Complementary oligonucleotides capable of hybridizing to 181 miRNAs were immobilized on a membrane and probed with radiolabeled RNA derived from low molecular weight fractions of total RNA from several different hematopoietic and neuronal cells. This method allowed us to analyze cell type-specific patterns of miRNA expression and to identify miRNAs that might be important for cell lineage specification and/or cell effector functions. Conclusion This is the first report of systematic miRNA gene profiling in cells of the hematopoietic system. As expected, miRNA expression patterns were very different between hematopoietic and non-hematopoietic cells, with further subtle differences observed within the hematopoietic group. Interestingly, the most pronounced similarities were observed among fully differentiated effector cells (Th1 and Th2 lymphocytes and mast cells) and precursors at comparable stages of differentiation (double negative thymocytes and pro-B cells), suggesting that in addition to regulating the process of commitment to particular cellular lineages, miRNAs might have an important general role in the mechanism of cell differentiation and maintenance of cell identity. PMID:16086853

  3. Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids.

    PubMed

    Wang, Jianlin; Tian, Lu; Madlung, Andreas; Lee, Hyeon-Se; Chen, Meng; Lee, Jinsuk J; Watson, Brian; Kagochi, Trevor; Comai, Luca; Chen, Z Jeffrey

    2004-08-01

    Polyploidization is an abrupt speciation mechanism for eukaryotes and is especially common in plants. However, little is known about patterns and mechanisms of gene regulation during early stages of polyploid formation. Here we analyzed differential expression patterns of the progenitors' genes among successive selfing generations and independent lineages. The synthetic Arabidopsis allotetraploid lines were produced by a genetic cross between A. thaliana and A. arenosa autotetraploids. We found that some progenitors' genes are differentially expressed in early generations, whereas other genes are silenced in late generations or among different siblings within a selfing generation, suggesting that the silencing of progenitors' genes is rapidly and/or stochastically established. Moreover, a subset of genes is affected in autotetraploid and multiple independent allotetraploid lines and in A. suecica, a natural allotetraploid derived from A. thaliana and A. arenosa, indicating locus-specific susceptibility to ploidy-dependent gene regulation. The role of DNA methylation in silencing progenitors' genes is tested in DNA-hypomethylation transgenic lines of A. suecica using RNA interference (RNAi). Two silenced genes are reactivated in both ddm1- and met1-RNAi lines, consistent with the demethylation of centromeric repeats and gene-specific regions in the genome. A rapid and stochastic process of differential gene expression is reinforced by epigenetic regulation during polyploid formation and evolution. Copyright 2004 Genetics Society of America

  4. Increasing Sucrose Uptake Capacity of Wheat Grains Stimulates Storage Protein Synthesis1[W

    PubMed Central

    Weichert, Nicola; Saalbach, Isolde; Weichert, Heiko; Kohl, Stefan; Erban, Alexander; Kopka, Joachim; Hause, Bettina; Varshney, Alok; Sreenivasulu, Nese; Strickert, Marc; Kumlehn, Jochen; Weschke, Winfriede; Weber, Hans

    2010-01-01

    Increasing grain sink strength by improving assimilate uptake capacity could be a promising approach toward getting higher yield. The barley (Hordeum vulgare) sucrose transporter HvSUT1 (SUT) was expressed under control of the endosperm-specific Hordein B1 promoter (HO). Compared with the wild type, transgenic HOSUT grains take up more sucrose (Suc) in vitro, showing that the transgene is functional. Grain Suc levels are not altered, indicating that Suc fluxes are influenced rather than steady-state levels. HOSUT grains have increased percentages of total nitrogen and prolamins, which is reflected in increased levels of phenylalanine, tyrosine, tryptophan, isoleucine, and leucine at late grain development. Transcript profiling indicates specific stimulation of prolamin gene expression at the onset of storage phase. Changes in gene expression and metabolite levels related to carbon metabolism and amino acid biosynthesis suggest deregulated carbon-nitrogen balance, which together indicate carbon sufficiency and relative depletion of nitrogen. Genes, deregulated together with prolamin genes, might represent candidates, which respond positively to assimilate supply and are related to sugar-starch metabolism, cytokinin and brassinosteroid functions, cell proliferation, and sugar/abscisic acid signaling. Genes showing inverse expression patterns represent potential negative regulators. It is concluded that HvSUT1 overexpression increases grain protein content but also deregulates the metabolic status of wheat (Triticum aestivum) grains, accompanied by up-regulated gene expression of positive and negative regulators related to sugar signaling and assimilate supply. In HOSUT grains, alternating stimulation of positive and negative regulators causes oscillatory patterns of gene expression and highlights the capacity and great flexibility to adjust wheat grain storage metabolism in response to metabolic alterations. PMID:20018590

  5. Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

    NASA Technical Reports Server (NTRS)

    Frudakis, T. N.; Wilt, F.

    1995-01-01

    The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

  6. Differential regulation of msx genes in the development of the gonopodium, an intromittent organ, and of the "sword," a sexually selected trait of swordtail fishes (Xiphophorus).

    PubMed

    Zauner, Hans; Begemann, Gerrit; Marí-Beffa, Manuel; Meyer, Axel

    2003-01-01

    The possession of a conspicuous extension of colored ventral rays of the caudal fin in male fish of swordtails (genus Xiphophorus) is a prominent example for a trait that evolved by sexual selection. To understand the evolutionary history of this so-called sword molecularly, it is of interest to unravel the developmental pathways responsible for extended growth of sword rays during development of swordtail males. We isolated two msx genes and showed that they are differentially regulated during sword outgrowth. During sword growth in juvenile males, as well as during testosterone-induced sword development and fin ray regeneration in the sword after amputation, expression of msxC is markedly up-regulated in the sword forming fin rays. In contrast, msxE/1 is not differentially expressed in ventral and dorsal male fin rays, suggesting a link between the development of male secondary sexual characters in fins and up-regulation of msxC expression. In addition, we showed that msx gene expression patterns differ significantly between Xiphophorus and zebrafish. We also included in our study the gonopodium, a testosterone-dependent anal fin modification that serves as a fertilization organ in males of live-bearing fishes. Our finding that increased levels of msxC expression are associated with the testosterone-induced outgrowth of the gonopodium might suggest either that at least parts of the signaling pathways that pattern the evolutionary older gonopodium have been coopted to evolve a sexually selected innovation such as the sword or that increased msxC expression may be inherent to the growth process of long fin rays in general.

  7. Chicken Pleiotrophin: Regulation of Tissue Specific Expression by Estrogen in the Oviduct and Distinct Expression Pattern in the Ovarian Carcinomas

    PubMed Central

    Lim, Whasun; Kim, Jinyoung; Bazer, Fuller W.; Han, Jae Yong; Song, Gwonhwa

    2012-01-01

    Pleiotrophin (PTN) is a developmentally-regulated growth factor which is widely distributed in various tissues and also detected in many kinds of carcinomas. However, little is known about the PTN gene in chickens. In the present study, we found chicken PTN to be highly conserved with respect to mammalian PTN genes (91–92.6%) and its mRNA was most abundant in brain, heart and oviduct. This study focused on the PTN gene in the oviduct where it was detected in the glandular (GE) and luminal (LE) epithelial cells. Treatment of young chicks with diethylstilbesterol induced PTN mRNA and protein in GE and LE, but not in other cell types of the oviduct. Further, several microRNAs, specifically miR-499 and miR-1709 were discovered to influence PTN expression via its 3′-UTR which suggests that post-transcriptional regulation influences PTN expression in chickens. We also compared expression patterns and CpG methylation status of the PTN gene in normal and cancerous ovaries from chickens. Our results indicated that PTN is most abundant in the GE of adenocarcinoma of cancerous, but not normal ovaries of hens. Bisulfite sequencing revealed that 30- and 40% of −1311 and −1339 CpG sites are demethylated in ovarian cancer cells, respectively. Collectively, these results indicate that chicken PTN is a novel estrogen-induced gene expressed mainly in the oviductal epithelia implicating PTN regulation of oviduct development and egg formation, and also suggest that PTN is a biomarker for epithelial ovarian carcinoma that could be used for diagnosis and monitoring effects of therapies for the disease. PMID:22496782

  8. Characterization of a wheat (Triticum aestivum L.) expansin gene, TaEXPB23, involved in the abiotic stress response and phytohormone regulation.

    PubMed

    Han, Yang yang; Li, Ai xiu; Li, Feng; Zhao, Mei rong; Wang, Wei

    2012-05-01

    Expansins are proteins that are generally accepted to be key regulators of cell wall extension and plant growth. We examined the expression pattern of TaEXPB23, a wheat (Triticum aestivum L.) expansin gene, under exogenous phytohormone and abiotic stress treatments. In addition, we evaluated its function in the tolerance to salt stress and high temperature (HT) by overexpressing it in transgenic tobacco plants. In subcellular localization assays, TaEXPB23 localized to the cell wall. Expression analysis demonstrated that the transcription pattern of TaEXPB23 corresponded to wheat coleoptile growth. Real-time RT-PCR analysis revealed that TaEXPB23 transcript expression was upregulated by exogenous methyl jasmonate (MeJA) and salt stress, but downregulated by exogenous gibberellins (GA₃), ethylene (ET), indole-3-acetic acid (IAA) and α-naphthlcetic acid (NAA). Overexpression of TaEXPB23 in tobacco (tabacum) conferred tolerance to salt stress by enhancing water retention ability (WRA) and decreasing osmotic potential (OP). However, transgenic plants overexpressing TaEXPB23 did not show any improvement in the tolerance to HT stress. These results suggested that TaEXPB23 is regulated by phytohormones and is involved in the regulation of salt stress tolerance. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  9. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner

    PubMed Central

    Pai, Vaibhav P.; Willocq, Valerie; Pitcairn, Emily J.; Lemire, Joan M.; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A.

    2017-01-01

    ABSTRACT Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels (Ih currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal, Lefty, and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. PMID:28818840

  10. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner.

    PubMed

    Pai, Vaibhav P; Willocq, Valerie; Pitcairn, Emily J; Lemire, Joan M; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A; Levin, Michael

    2017-10-15

    Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels ( I h currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal , Lefty , and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. © 2017. Published by The Company of Biologists Ltd.

  11. Arabidopsis whole-transcriptome profiling defines the features of coordinated regulations that occur during secondary growth.

    PubMed

    Ko, Jae-Heung; Han, Kyung-Hwan

    2004-05-01

    Secondary growth in the inflorescence stems of Arabidopsis plants was induced by a combination of short-day and long-day treatments. The induced stems were divided into three different stem developmental stages (i.e., immature, intermediate, and mature) with regard to secondary growth. Whole transcriptome microarrays were used to examine the changes in global gene expression occurring at the different stem developmental stages. Over 70% of the Arabidopsis transcriptome was expressed in the stem tissues. In the mature stems with secondary growth, 567 genes were upregulated 5-fold or higher and 530 were downregulated, when compared to immature stems (with no secondary growth) and 10-day old seedlings (with no inflorescence stem). The transcription phenotypes obtained from the stems at different developmental stages largely confirm the existing insights into the biochemical processes involved in the sequential events that lead to wood formation. The major difference found between the stems undergoing secondary growth and only primary growth was in the expression profiles of transcriptional regulation-and signal transduction-related genes. An analysis of several shoot apical meristem (SAM) activity-related gene expression patterns in the stems indicated that the genetic control of secondary meristem activity might be governed by a different mechanism from that of SAM. The current study established the expression patterns of many unknown genes and identified candidate genes that are involved in the genetic regulation of secondary growth. The findings described in this report should improve our understanding of the molecular mechanisms that regulate the growth and development of the stem.

  12. Correlation analyses revealed global microRNA-mRNA expression associations in human peripheral blood mononuclear cells.

    PubMed

    Wang, Lan; Zhu, Jiang; Deng, Fei-Yan; Wu, Long-Fei; Mo, Xing-Bo; Zhu, Xiao-Wei; Xia, Wei; Xie, Fang-Fei; He, Pei; Bing, Peng-Fei; Qiu, Ying-Hua; Lin, Xiang; Lu, Xin; Zhang, Lei; Yi, Neng-Jun; Zhang, Yong-Hong; Lei, Shu-Feng

    2018-02-01

    MicroRNAs (miRNAs) can regulate gene expression through binding to complementary sites in the 3'-untranslated regions of target mRNAs, which will lead to existence of correlation in expression between miRNA and mRNA. However, the miRNA-mRNA correlation patterns are complex and remain largely unclear yet. To establish the global correlation patterns in human peripheral blood mononuclear cells (PBMCs), multiple miRNA-mRNA correlation analyses and expression quantitative trait locus (eQTL) analysis were conducted in this study. We predicted and achieved 861 miRNA-mRNA pairs (65 miRNAs, 412 mRNAs) using multiple bioinformatics programs, and found global negative miRNA-mRNA correlations in PBMC from all 46 study subjects. Among the 861 pairs of correlations, 19.5% were significant (P < 0.05) and ~70% were negative. The correlation network was complex and highlighted key miRNAs/genes in PBMC. Some miRNAs, such as hsa-miR-29a, hsa-miR-148a, regulate a cluster of target genes. Some genes, e.g., TNRC6A, are regulated by multiple miRNAs. The identified genes tend to be enriched in molecular functions of DNA and RNA binding, and biological processes such as protein transport, regulation of translation and chromatin modification. The results provided a global view of the miRNA-mRNA expression correlation profile in human PBMCs, which would facilitate in-depth investigation of biological functions of key miRNAs/mRNAs and better understanding of the pathogenesis underlying PBMC-related diseases.

  13. Expression analysis of G Protein-Coupled Receptors in mouse macrophages.

    PubMed

    Lattin, Jane E; Schroder, Kate; Su, Andrew I; Walker, John R; Zhang, Jie; Wiltshire, Tim; Saijo, Kaoru; Glass, Christopher K; Hume, David A; Kellie, Stuart; Sweet, Matthew J

    2008-04-29

    Monocytes and macrophages express an extensive repertoire of G Protein-Coupled Receptors (GPCRs) that regulate inflammation and immunity. In this study we performed a systematic micro-array analysis of GPCR expression in primary mouse macrophages to identify family members that are either enriched in macrophages compared to a panel of other cell types, or are regulated by an inflammatory stimulus, the bacterial product lipopolysaccharide (LPS). Several members of the P2RY family had striking expression patterns in macrophages; P2ry6 mRNA was essentially expressed in a macrophage-specific fashion, whilst P2ry1 and P2ry5 mRNA levels were strongly down-regulated by LPS. Expression of several other GPCRs was either restricted to macrophages (e.g. Gpr84) or to both macrophages and neural tissues (e.g. P2ry12, Gpr85). The GPCR repertoire expressed by bone marrow-derived macrophages and thioglycollate-elicited peritoneal macrophages had some commonality, but there were also several GPCRs preferentially expressed by either cell population. The constitutive or regulated expression in macrophages of several GPCRs identified in this study has not previously been described. Future studies on such GPCRs and their agonists are likely to provide important insights into macrophage biology, as well as novel inflammatory pathways that could be future targets for drug discovery.

  14. [Endoplasmic reticulum stress in INS-1-3 cell associated with the expression changes of MODY gene pathway].

    PubMed

    Liu, Y T; Li, S R; Wang, Z; Xiao, J Z

    2016-09-13

    Objective: To profile the gene expression changes associated with endoplasmic reticulum stress in INS-1-3 cells induced by thapsigargin (TG) and tunicamycin (TM). Methods: Normal cultured INS-1-3 cells were used as a control. TG and TM were used to induce endoplasmic reticulum stress in INS-1-3 cells. Digital gene expression profiling technique was used to detect differentially expressed gene. The changes of gene expression were detected by expression pattern clustering analysis, gene ontology (GO) function and pathway enrichment analysis. Real time polymerase chain reaction (RT-PCR) was used to verify the key changes of gene expression. Results: Compared with the control group, there were 57 (45 up-regulated, 12 down-regulated) and 135 (99 up-regulated, 36 down-regulated) differentially expressed genes in TG and TM group, respectively. GO function enrichment analyses indicated that the main enrichment was in the endoplasmic reticulum. In signaling pathway analysis, the identified pathways were related with endoplasmic reticulum stress, antigen processing and presentation, protein export, and most of all, the maturity onset diabetes of the young (MODY) pathway. Conclusion: Under the condition of endoplasmic reticulum stress, the related expression changes of transcriptional factors in MODY signaling pathway may be related with the impaired function in islet beta cells.

  15. Physiological and Molecular Analysis of Aluminium-Induced Organic Acid Anion Secretion from Grain Amaranth (Amaranthus hypochondriacus L.) Roots

    PubMed Central

    Fan, Wei; Xu, Jia-Meng; Lou, He-Qiang; Xiao, Chuan; Chen, Wei-Wei; Yang, Jian-Li

    2016-01-01

    Grain amaranth (Amaranthus hypochondriacus L.) is abundant in oxalate and can secrete oxalate under aluminium (Al) stress. However, the features of Al-induced secretion of organic acid anions (OA) and potential genes responsible for OA secretion are poorly understood. Here, Al-induced OA secretion in grain amaranth roots was characterized by ion charomatography and enzymology methods, and suppression subtractive hybridization (SSH) together with quantitative real-time PCR (qRT-PCR) was used to identify up-regulated genes that are potentially involved in OA secretion. The results showed that grain amaranth roots secrete both oxalate and citrate in response to Al stress. The secretion pattern, however, differs between oxalate and citrate. Neither lanthanum chloride (La) nor cadmium chloride (Cd) induced OA secretion. A total of 84 genes were identified as up-regulated by Al, in which six genes were considered as being potentially involved in OA secretion. The expression pattern of a gene belonging to multidrug and toxic compound extrusion (MATE) family, AhMATE1, was in close agreement with that of citrate secretion. The expression of a gene encoding tonoplast dicarboxylate transporter and four genes encoding ATP-binding cassette transporters was differentially regulated by Al stress, but the expression pattern was not correlated well with that of oxalate secretion. Our results not only reveal the secretion pattern of oxalate and citrate from grain amaranth roots under Al stress, but also provide some genetic information that will be useful for further characterization of genes involved in Al toxicity and tolerance mechanisms. PMID:27144562

  16. Physiological and Molecular Analysis of Aluminium-Induced Organic Acid Anion Secretion from Grain Amaranth (Amaranthus hypochondriacus L.) Roots.

    PubMed

    Fan, Wei; Xu, Jia-Meng; Lou, He-Qiang; Xiao, Chuan; Chen, Wei-Wei; Yang, Jian-Li

    2016-04-30

    Grain amaranth (Amaranthus hypochondriacus L.) is abundant in oxalate and can secrete oxalate under aluminium (Al) stress. However, the features of Al-induced secretion of organic acid anions (OA) and potential genes responsible for OA secretion are poorly understood. Here, Al-induced OA secretion in grain amaranth roots was characterized by ion charomatography and enzymology methods, and suppression subtractive hybridization (SSH) together with quantitative real-time PCR (qRT-PCR) was used to identify up-regulated genes that are potentially involved in OA secretion. The results showed that grain amaranth roots secrete both oxalate and citrate in response to Al stress. The secretion pattern, however, differs between oxalate and citrate. Neither lanthanum chloride (La) nor cadmium chloride (Cd) induced OA secretion. A total of 84 genes were identified as up-regulated by Al, in which six genes were considered as being potentially involved in OA secretion. The expression pattern of a gene belonging to multidrug and toxic compound extrusion (MATE) family, AhMATE1, was in close agreement with that of citrate secretion. The expression of a gene encoding tonoplast dicarboxylate transporter and four genes encoding ATP-binding cassette transporters was differentially regulated by Al stress, but the expression pattern was not correlated well with that of oxalate secretion. Our results not only reveal the secretion pattern of oxalate and citrate from grain amaranth roots under Al stress, but also provide some genetic information that will be useful for further characterization of genes involved in Al toxicity and tolerance mechanisms.

  17. Gonadal expression of Sf1 and aromatase during sex determination in the red-eared slider turtle (Trachemys scripta), a reptile with temperature-dependent sex determination.

    PubMed

    Ramsey, Mary; Shoemaker, Christina; Crews, David

    2007-12-01

    Many egg-laying reptiles have temperature-dependent sex determination (TSD), where the offspring sex is determined by incubation temperature during a temperature-sensitive period (TSP) in the middle third of development. The underlying mechanism transducing a temperature cue into an ovary or testis is unknown, but it is known that steroid hormones play an important role. During the TSP, exogenous application of estrogen can override a temperature cue and produce females, while blocking the activity of aromatase (Cyp19a1), the enzyme that converts testosterone to estradiol, produces males from a female-biased temperature. The production of estrogen is a key step in ovarian differentiation for many vertebrates, including TSD reptiles, and temperature-based differences in aromatase expression during the TSP may be a critical step in ovarian determination. Steroidogenic factor-1 (Sf1) is a key gene in vertebrate sex determination and regulates many steroidogenic enzymes, including aromatase. We find that Sf1 and aromatase are differentially expressed during sex determination in the red-eared slider turtle, Trachemys scripta elegans. Sf1 is expressed at higher levels during testis development while aromatase expression increases during ovary determination. We also assayed Sf1 and aromatase response to sex-reversing treatments via temperature or the modulation of estrogen availability. Sf1 expression was redirected to low-level female-specific patterns with feminizing temperature shift or exogenous estradiol application and redirected to more intense male-specific patterns with male-producing temperature shift or inhibition of aromatase activity. Conversely, aromatase expression was redirected to more intense female-specific patterns with female-producing treatment and redirected toward diffuse low-level male-specific patterns with masculinizing sex reversal. Our data do not lend support to a role for Sf1 in the regulation of aromatase expression during slider turtle sex determination, but do support a critical role for estrogen in ovarian development.

  18. Differential neonatal imprinting and regulation by estrogen of estrogen receptor subtypes alpha and beta and of the truncated estrogen receptor product (TERP-1) mRNA expression in the male rat pituitary.

    PubMed

    Tena-Sempere, M; Barreiro, M L; González, L C; Pinilla, L; Aguilar, E

    2001-11-01

    Two distinct nuclear estrogen receptors (ERs) have been identified, the classical one, renamed ERalpha, and the more recently cloned ERbeta. In a variety of tissues, gene expression of both receptor subtypes results in the generation of multiple transcripts encoding the full-length as well as several alternately spliced isoforms. In the rat pituitary, a truncated, tissue-specific variant of ERalpha, called TERP-1, has been identified and found able to modulate ERalpha and ERbeta activity. So far, its pattern of expression and hormonal regulation have been mostly studied in females. The present study was designed to analyze the pattern of expression of TERP-1 mRNA in the male rat pituitary at different stages of postnatal development, and to evaluate the impact of neonatal imprinting and estrogen treatment upon TERP-1 expression in the male pituitary. Assessment of TERP-1 mRNA levels by semi-quantitative RT-PCR, using a variant-specific primer pair, revealed that TERP-1 is also expressed in the male rat pituitary. Relative mRNA expression levels changed markedly during postnatal development, with moderate expression of the TERP-1 transcript at birth, barely detectable levels during the infantile-prepubertal period, and maximal values in adulthood. Expression of TERP-1 was sensitive to neonatal estrogen exposure, which resulted in a significant, persistent increase in mRNA levels from the infantile period until puberty. This phenomenon was not mimicked by neonatal blockade of endogenous GnRH. In addition, estrogen was able to acutely up-regulate pituitary TERP-1 mRNA expression levels in prepubertal (30-day-old) and adult (75-day-old) males. Interestingly, neonatal imprinting as well as acute estrogen treatment resulted in opposite effects on TERP-1 and full-length ERalpha and ERbeta transcripts, the latter being decreased under both conditions. In conclusion, our data indicate that TERP-1 mRNA is expressed in a developmentally regulated manner in the male rat pituitary, and is affected by neonatal estrogen imprinting and acute estrogen treatment. Regulation of TERP-1 expression by neonatal or acute estrogen treatment may thus represent an additional tuning mechanism for estrogen actions in the male rat pituitary. Copyright 2001 S. Karger AG, Basel

  19. Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata

    PubMed Central

    Brütting, Christoph; Schäfer, Martin; Vanková, Radomira; Gase, Klaus; Baldwin, Ian T.; Meldau, Stefan

    2016-01-01

    Plant defense metabolites are well-known to be regulated developmentally. The OD theory posits that a tissue’s fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness-value to the plant and therefore their defense allocations should be higher when compared to older leaves. The mechanisms which coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf cytokinin levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different cytokinin classes by using senescence- and chemically-inducible expression of cytokinin biosynthesis genes. Genetically modifying the levels of different cytokinins in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include cytokinins plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. PMID:27557345

  20. Miki (Mitotic Kinetics Regulator) Immunoexpression in Normal Liver, Cirrhotic Areas and Hepatocellular Carcinomas: a Preliminary Study with Clinical Relevance.

    PubMed

    Fernández-Vega, Iván; Santos-Juanes, Jorge; Camacho-Urkaray, Emma; Lorente-Gea, Laura; García, Beatriz; Gutiérrez-Corres, Francisco Borja; Quirós, Luis M; Guerra-Merino, Isabel; Aguirre, José Javier

    2018-02-12

    Hepatocellular carcinoma (HCC) is the most common type of primary malignant tumor in the liver. One of the main features of cancer survival is the generalized loss of growth control exhibited by cancer cells, and Miki is a protein related to the immunoglobulin superfamily that plays an important role in mitosis. We aim to study protein expression levels of Miki in non-tumoral liver and 20 HCCs recruited from a Pathology Department. Clinical information was also obtained. A tissue microarray was performed, and immunohistochemical techniques applied to study protein expression levels of Miki. In normal liver, Miki was weakly expressed, showing nuclear staining in the hepatocytes. Cirrhotic areas and HCCs showed a variety of staining patterns. Most HCC samples showed positive expression, with three different staining patterns being discernible: nuclear, cytoplasmic and mixed. Statistical analysis showed a significant association between grade of differentiation, Ki-67 proliferative index, survival rates and staining patterns. This study has revealed the positive expression of Miki in normal liver, cirrhotic areas and HCCs. Three different staining patterns of Miki expression with clinical relevance were noted in HCCs.

  1. Epidermal growth factor (EGF) receptor-ligand based molecular staging predicts prognosis in head and neck squamous cell carcinoma partly due to deregulated EGF- induced amphiregulin expression.

    PubMed

    Gao, Jian; Ulekleiv, Camilla H; Halstensen, Trond S

    2016-09-26

    Increased expression of epidermal growth factor receptor (EGFR) and its ligands is associated with poor prognosis and chemoresistance in many carcinoma types, but its role in head and neck squamous cell carcinoma (HNSCC) is unclear. Our aim was to clarify whether mRNA expression of EGFR-ligands was linked to prognosis and cisplatin resistance, and if so, which ligand was most important and how was the expression regulated. To examine the prognostic effect of EGFR-ligand expression, we analyzed tumorous mRNA expression in 399 HNSCC patients. The intracellular signaling pathways controlling epidermal growth factor (EGF)-induced amphiregulin (AREG) expression were examined in three oral squamous cell carcinoma (OSCC) cell lines. Effect of AREG on cisplatin resistance was examined by viability assays in four-, and by association in 11 OSCC cell lines. The patients were divided into five groups according to the median mRNA expression levels of four EGFR ligands, i.e. AREG, EGF, heparin-binding EGF-like growth factor (HBEGF) and beta-cellulin (BTC). The number of increased-expressed EGFR-ligands were progressively correlated to five-year survival, even in advanced TNM-stage IV patients, where five-year mortality increased from 26 % if tumor expressed none to one EGFR-ligand, to 45 % in three to four ligand expressing tumors. Thus, staging the tumor according to these EGFR-ligand mRNA expression pattern completely out performed TNM staging in predicting prognosis. Multivariate analysis identified AREG as the dominating predictor, and AREG was overexpressed in OSCC compared to tumors from other sites. Both EGF and HBEGF stimulation induced strong AREG increase in OSCC cell lines, which was partially mediated by the extracellular signal-regulated kinase 1/2 pathway, and negatively regulated by p38, c-Jun N-terminal kinase, and phosphoinositide-3 kinase. Although increased AREG mRNA expression predicted unfavorable prognosis in platinum treated HNSCC patients, AREG did not mediate cisplatin resistance in the OSCC cell lines. Increased tumorous mRNA expression of four EGFR ligands was progressively associated with poor prognosis in HNSCC. Thus, EGFR-ligands mRNA expression pattern may be a new prognostic biomarker. The tightly regulated EGF-induced AREG mRNA expression was partly lost in the OSCC cell lines and restoring its regulation may be a new target in cancer treatment. Not applicable as the clinical data of the 498 HNSCC patients and their mRNA expression profiles were collected from the open TCGA database: http://cancergenome.nih.gov/cancersselected/headandneck .

  2. Pattern of Expression of p53, Its Family Members, and Regulators during Early Ocular Development and in the Post-Mitotic Retina

    PubMed Central

    Vuong, Linda; Brobst, Daniel E.; Saadi, Anisse; Ivanovic, Ivana; Al-Ubaidi, Muayyad R.

    2012-01-01

    Purpose. Because of its role in cell cycle regulation and apoptosis, p53 may be involved in maintaining the post-mitotic state of the adult eye. To shed light on the role of p53 in retinal development and maintenance, this study investigated the pattern of expression of p53, its family members, and its regulators during the development of the mouse eye. Methods. Relative quantitative real-time PCR (qRT-PCR) was used to determine the steady-state levels of target transcripts in RNA extracted from wild-type mouse whole eyes or retinas between embryonic day (E) 15 and post-natal day (P) 30. Immunoblotting was used to compare the steady-state levels of the protein to that of the transcript. Results. Transcript and protein levels for p53 in the eye were highest at E17 and E18, respectively. However, both p53 transcript and protein levels dropped precipitously thereafter, and no protein was detected on immunoblots after P3. Expression patterns of p63, p73, Mdm2, Mdm4, and Yy1 did not follow that of p53. Immunohistochemistry analysis of the developing eye showed that both p53 and Mdm2 are abundantly expressed at E18 in all layers of the retinal neuroblast. Conclusions. Downregulation of p53 in the post-mitotic retina suggests that, although p53 may be involved in ocular and retinal development, it may play a minimal role in healthy adult retinal function. PMID:22714890

  3. Notch activates Wnt-4 signalling to control medio-lateral patterning of the pronephros.

    PubMed

    Naylor, Richard W; Jones, Elizabeth A

    2009-11-01

    Previous studies have highlighted a role for the Notch signalling pathway during pronephrogenesis in the amphibian Xenopus laevis, and in nephron development in the mammalian metanephros, yet a mechanism for this function remains elusive. Here, we further the understanding of how Notch signalling patterns the early X. laevis pronephros anlagen, a function that might be conserved in mammalian nephron segmentation. Our results indicate that early phase pronephric Notch signalling patterns the medio-lateral axis of the dorso-anterior pronephros anlagen, permitting the glomus and tubules to develop in isolation. We show that this novel function acts through the Notch effector gene hrt1 by upregulating expression of wnt4. Wnt-4 then patterns the proximal pronephric anlagen to establish the specific compartments that span the medio-lateral axis. We also identified pronephric expression of lunatic fringe and radical fringe that is temporally and spatially appropriate for a role in regulating Notch signalling in the dorso-anterior region of the pronephros anlagen. On the basis of these results, along with data from previous publications, we propose a mechanism by which the Notch signalling pathway regulates a Wnt-4 function that patterns the proximal pronephric anlagen.

  4. E-cadherin can replace N-cadherin during secretory-stage enamel development.

    PubMed

    Guan, Xiaomu; Bidlack, Felicitas B; Stokes, Nicole; Bartlett, John D

    2014-01-01

    N-cadherin is a cell-cell adhesion molecule and deletion of N-cadherin in mice is embryonic lethal. During the secretory stage of enamel development, E-cadherin is down-regulated and N-cadherin is specifically up-regulated in ameloblasts when groups of ameloblasts slide by one another to form the rodent decussating enamel rod pattern. Since N-cadherin promotes cell migration, we asked if N-cadherin is essential for ameloblast cell movement during enamel development. The enamel organ, including its ameloblasts, is an epithelial tissue and for this study a mouse strain with N-cadherin ablated from epithelium was generated. Enamel from wild-type (WT) and N-cadherin conditional knockout (cKO) mice was analyzed. μCT and scanning electron microscopy showed that thickness, surface structure, and prism pattern of the cKO enamel looked identical to WT. No significant difference in hardness was observed between WT and cKO enamel. Interestingly, immunohistochemistry revealed the WT and N-cadherin cKO secretory stage ameloblasts expressed approximately equal amounts of total cadherins. Strikingly, E-cadherin was not normally down-regulated during the secretory stage in the cKO mice suggesting that E-cadherin can compensate for the loss of N-cadherin. Previously it was demonstrated that bone morphogenetic protein-2 (BMP2) induces E- and N-cadherin expression in human calvaria osteoblasts and we show that the N-cadherin cKO enamel organ expressed significantly more BMP2 and significantly less of the BMP antagonist Noggin than did WT enamel organ. The E- to N-cadherin switch at the secretory stage is not essential for enamel development or for forming the decussating enamel rod pattern. E-cadherin can substitute for N-cadherin during these developmental processes. Bmp2 expression may compensate for the loss of N-cadherin by inducing or maintaining E-cadherin expression when E-cadherin is normally down-regulated. Notably, this is the first demonstration of a natural endogenous increase in E-cadherin expression due to N-cadherin ablation in a healthy developing tissue.

  5. A Malus Crabapple Chalcone Synthase Gene, McCHS, Regulates Red Petal Color and Flavonoid Biosynthesis

    PubMed Central

    Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, ‘Royalty’ and ‘Flame’, have dark red and white petals respectively, while the intermediate cultivar ‘Radiant’ has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in ‘Radiant’. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  6. Dissecting Embryonic Stem Cell Self-Renewal and Differentiation Commitment from Quantitative Models.

    PubMed

    Hu, Rong; Dai, Xianhua; Dai, Zhiming; Xiang, Qian; Cai, Yanning

    2016-10-01

    To model quantitatively embryonic stem cell (ESC) self-renewal and differentiation by computational approaches, we developed a unified mathematical model for gene expression involved in cell fate choices. Our quantitative model comprised ESC master regulators and lineage-specific pivotal genes. It took the factors of multiple pathways as input and computed expression as a function of intrinsic transcription factors, extrinsic cues, epigenetic modifications, and antagonism between ESC master regulators and lineage-specific pivotal genes. In the model, the differential equations of expression of genes involved in cell fate choices from regulation relationship were established according to the transcription and degradation rates. We applied this model to the Murine ESC self-renewal and differentiation commitment and found that it modeled the expression patterns with good accuracy. Our model analysis revealed that Murine ESC was an attractor state in culture and differentiation was predominantly caused by antagonism between ESC master regulators and lineage-specific pivotal genes. Moreover, antagonism among lineages played a critical role in lineage reprogramming. Our results also uncovered that the ordered expression alteration of ESC master regulators over time had a central role in ESC differentiation fates. Our computational framework was generally applicable to most cell-type maintenance and lineage reprogramming.

  7. The up-regulation of miR-300 in gastric cancer and its effects on cells malignancy

    PubMed Central

    Shen, Zhen; Li, Chunsheng; Zhang, Kai; Yu, Wei; Xiao, Huijie; Li, Bo; Liu, Tongjun

    2015-01-01

    Objective: In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of gastric cancer cells. Methods: MicroRNA and protein expression patterns were compared between gastric cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in AGS gastric cancer cells. Results: We observed that miR-300 expression was frequently and dramatically up-regulated in human gastric cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote gastric cancer cell proliferation and invasion by increasing p53 expression. Conclusion: Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in gastric cancer cell proliferation during gastric tumorigenesis. PMID:26221215

  8. The up-regulation of miR-300 in gastric cancer and its effects on cells malignancy.

    PubMed

    Shen, Zhen; Li, Chunsheng; Zhang, Kai; Yu, Wei; Xiao, Huijie; Li, Bo; Liu, Tongjun

    2015-01-01

    In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of gastric cancer cells. MicroRNA and protein expression patterns were compared between gastric cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in AGS gastric cancer cells. We observed that miR-300 expression was frequently and dramatically up-regulated in human gastric cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote gastric cancer cell proliferation and invasion by increasing p53 expression. Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in gastric cancer cell proliferation during gastric tumorigenesis.

  9. Mechanisms controlling neurite outgrowth in a pheochromocytoma cell line: The role of TRPC channels

    PubMed Central

    Kumar, Sanjay; Chakraborty, Saikat; Barbosa, Cindy; Brustovetsky, Tatiana; Brustovetsky, Nickolay; Obukhov, Alexander G.

    2014-01-01

    Transient Receptor Potential Canonical (TRPC) channels are implicated in modulating neurite outgrowth. The expression pattern of TRPC changes significantly during brain development, suggesting that fine-tuning TRPC expression may be important for orchestrating neuritogenesis. To study how alterations in the TRPC expression pattern affect neurite outgrowth, we used nerve growth factor (NGF)-differentiated rat pheochromocytoma 12 (PC12) cells, a model system for neuritogenesis. In PC12 cells, NGF markedly up-regulated TRPC1 and TRPC6 expression, but down-regulated TRPC5 expression while promoting neurite outgrowth. Overexpression of TRPC1 augmented, whereas TRPC5 overexpression decelerated NGF-induced neurite outgrowth. Conversely, shRNA-mediated knockdown of TRPC1 decreased, whereas shRNA-mediated knockdown of TRPC5 increased NGF-induced neurite extension. Endogenous TRPC1 attenuated the anti-neuritogenic effect of overexpressed TRPC5 in part by forming the heteromeric TRPC1–TRPC5 channels. Previous reports suggested that TRPC6 may facilitate neurite outgrowth. However, we found that TRPC6 overexpression slowed down neuritogenesis, whereas dominant negative TRPC6 (DN-TRPC6) facilitated neurite outgrowth in NGF-differentiated PC12 cells. Consistent with these findings, hyperforin, a neurite outgrowth promoting factor, decreased TRPC6 expression in NGF-differentiated PC12 cells. Using pharmacological and molecular biological approaches, we determined that NGF up-regulated TRPC1 and TRPC6 expression via a p75NTR-IKK2-dependent pathway that did not involve TrkA receptor signaling in PC12 cells. Similarly, NGF up-regulated TRPC1 and TRPC6 via an IKK2 dependent pathway in primary cultured hippocampal neurons. Thus, our data suggest that a balance of TRPC1, TRPC5, and TRPC6 expression determines neurite extension rate in neural cells, with TRPC6 emerging as an NGF-dependent “molecular damper” maintaining a submaximal velocity of neurite extension. PMID:21618530

  10. Two distinct auto-regulatory loops operate at the PU.1 locus in B cells and myeloid cells

    PubMed Central

    Leddin, Mathias; Perrod, Chiara; Hoogenkamp, Maarten; Ghani, Saeed; Assi, Salam; Heinz, Sven; Wilson, Nicola K.; Follows, George; Schönheit, Jörg; Vockentanz, Lena; Mosammam, Ali M.; Chen, Wei; Tenen, Daniel G.; Westhead, David R.; Göttgens, Berthold

    2011-01-01

    The transcription factor PU.1 occupies a central role in controlling myeloid and early B-cell development, and its correct lineage-specific expression is critical for the differentiation choice of hematopoietic progenitors. However, little is known of how this tissue-specific pattern is established. We previously identified an upstream regulatory cis element whose targeted deletion in mice decreases PU.1 expression and causes leukemia. We show here that the upstream regulatory cis element alone is insufficient to confer physiologic PU.1 expression in mice but requires the cooperation with other, previously unidentified elements. Using a combination of transgenic studies, global chromatin assays, and detailed molecular analyses we present evidence that PU.1 is regulated by a novel mechanism involving cross talk between different cis elements together with lineage-restricted autoregulation. In this model, PU.1 regulates its expression in B cells and macrophages by differentially associating with cell type–specific transcription factors at one of its cis-regulatory elements to establish differential activity patterns at other elements. PMID:21239694

  11. Cis-regulatory underpinnings of human GLI3 expression in embryonic craniofacial structures and internal organs.

    PubMed

    Abbasi, Amir A; Minhas, Rashid; Schmidt, Ansgar; Koch, Sabine; Grzeschik, Karl-Heinz

    2013-10-01

    The zinc finger transcription factor Gli3 is an important mediator of Sonic hedgehog (Shh) signaling. During early embryonic development Gli3 participates in patterning and growth of the central nervous system, face, skeleton, limb, tooth and gut. Precise regulation of the temporal and spatial expression of Gli3 is crucial for the proper specification of these structures in mammals and other vertebrates. Previously we reported a set of human intronic cis-regulators controlling almost the entire known repertoire of endogenous Gli3 expression in mouse neural tube and limbs. However, the genetic underpinning of GLI3 expression in other embryonic domains such as craniofacial structures and internal organs remain elusive. Here we demonstrate in a transgenic mice assay the potential of a subset of human/fish conserved non-coding sequences (CNEs) residing within GLI3 intronic intervals to induce reporter gene expression at known regions of endogenous Gli3 transcription in embryonic domains other than central nervous system (CNS) and limbs. Highly specific reporter expression was observed in craniofacial structures, eye, gut, and genitourinary system. Moreover, the comparison of expression patterns directed by these intronic cis-acting regulatory elements in mouse and zebrafish embryos suggests that in accordance with sequence conservation, the target site specificity of a subset of these elements remains preserved among these two lineages. Taken together with our recent investigations, it is proposed here that during vertebrate evolution the Gli3 expression control acquired multiple, independently acting, intronic enhancers for spatiotemporal patterning of CNS, limbs, craniofacial structures and internal organs. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  12. Efficient generation of transgenic reporter strains and analysis of expression patterns in Caenorhabditis elegans using Library MosSCI

    PubMed Central

    Kaymak, Ebru; Farley, Brian M.; Hay, Samantha A.; Li, Chihua; Ho, Samantha; Hartman, Daniel J.; Ryder, Sean P.

    2016-01-01

    Background In C. elegans, germline development and early embryogenesis rely on post-transcriptional regulation of maternally transcribed mRNAs. In many cases, the 3′UTR is sufficient to govern the expression patterns of these transcripts. Several RNA-binding proteins are required to regulate maternal mRNAs through the 3′UTR. Despite intensive efforts to map RNA-binding protein-mRNA interactions in vivo, the biological impact of most binding events remains unknown. Reporter studies using single copy integrated transgenes are essential to evaluate the functional consequences of interactions between RNA-binding proteins and their associated mRNAs. Results In this report, we present an efficient method of generating reporter strains with improved throughput by using a library variant of MosSCI transgenesis. Furthermore, using RNA interference, we identify the suite of RBPs that control the expression pattern of five different maternal mRNAs. Conclusions The results provide a generalizable and efficient strategy to assess the functional relevance of protein-RNA interactions in vivo, and reveal new regulatory connections between key RNA-binding proteins and their maternal mRNA targets. PMID:27294288

  13. Novel transcriptional networks regulated by CLOCK in human neurons.

    PubMed

    Fontenot, Miles R; Berto, Stefano; Liu, Yuxiang; Werthmann, Gordon; Douglas, Connor; Usui, Noriyoshi; Gleason, Kelly; Tamminga, Carol A; Takahashi, Joseph S; Konopka, Genevieve

    2017-11-01

    The molecular mechanisms underlying human brain evolution are not fully understood; however, previous work suggested that expression of the transcription factor CLOCK in the human cortex might be relevant to human cognition and disease. In this study, we investigated this novel transcriptional role for CLOCK in human neurons by performing chromatin immunoprecipitation sequencing for endogenous CLOCK in adult neocortices and RNA sequencing following CLOCK knockdown in differentiated human neurons in vitro. These data suggested that CLOCK regulates the expression of genes involved in neuronal migration, and a functional assay showed that CLOCK knockdown increased neuronal migratory distance. Furthermore, dysregulation of CLOCK disrupts coexpressed networks of genes implicated in neuropsychiatric disorders, and the expression of these networks is driven by hub genes with human-specific patterns of expression. These data support a role for CLOCK-regulated transcriptional cascades involved in human brain evolution and function. © 2017 Fontenot et al.; Published by Cold Spring Harbor Laboratory Press.

  14. Tissue specific characterisation of Lim-kinase 1 expression during mouse embryogenesis

    PubMed Central

    Lindström, Nils O.; Neves, Carlos; McIntosh, Rebecca; Miedzybrodzka, Zosia; Vargesson, Neil; Collinson, J. Martin

    2012-01-01

    The Lim-kinase (LIMK) proteins are important for the regulation of the actin cytoskeleton, in particular the control of actin nucleation and depolymerisation via regulation of cofilin, and hence may control a large number of processes during development, including cell tensegrity, migration, cell cycling, and axon guidance. LIMK1/LIMK2 knockouts disrupt spinal cord morphogenesis and synapse formation but other tissues and developmental processes that require LIMK are yet to be fully determined. To identify tissues and cell-types that may require LIMK, we characterised the pattern of LIMK1 protein during mouse embryogenesis. We showed that LIMK1 displays an expression pattern that is temporally dynamic and tissue-specific. In several tissues LIMK1 is detected in cell-types that also express Wilms’ tumour protein 1 and that undergo transitions between epithelial and mesenchymal states, including the pleura, epicardium, kidney nephrons, and gonads. LIMK1 was also found in a subset of cells in the dorsal retina, and in mesenchymal cells surrounding the peripheral nerves. This detailed study of the spatial and temporal expression of LIMK1 shows that LIMK1 expression is more dynamic than previously reported, in particular at sites of tissue–tissue interactions guiding multiple developmental processes. PMID:21167960

  15. Characterization and expression patterns of small RNAs in synthesized Brassica hexaploids.

    PubMed

    Shen, Yanyue; Zhao, Qin; Zou, Jun; Wang, Wenliang; Gao, Yi; Meng, Jinling; Wang, Jianbo

    2014-06-01

    Polyploidy has played an important role in promoting plant evolution through genomic merging and doubling. We used high-throughput sequencing to compare miRNA expression profiles between Brassica hexaploid and its parents. A total of 613, 784 and 742 known miRNAs were identified in Brassica rapa, Brassica carinata, and Brassica hexaploid, respectively. We detected 618 miRNAs were differentially expressed (log(2)Ratio ≥ 1, P ≤ 0.05) between Brassica hexaploid and its parents, and 425 miRNAs were non-additively expressed in Brassica hexaploid, which suggest a trend of non-additive miRNA regulation following hybridization and polyploidization. Remarkably, majority of the non-additively expressed miRNAs in the Brassica hexaploid are repressed, and there was a bias toward repression of B. rapa miRNAs, which is consistent with the progenitor-biased gene repression in the synthetic allopolyploids. In addition, we identified 653 novel mature miRNAs in Brassica hexaploid and its parents. Finally, we found that almost all the non-additive accumulation of siRNA clusters exhibited a low-parent pattern in Brassica hexaploid. Non-additive small RNA regulation is involved in a range of biological pathways, probably providing a driving force for variation and adaptation in allopolyploids.

  16. Pirin Inhibits Cellular Senescence in Melanocytic Cells

    PubMed Central

    Licciulli, Silvia; Luise, Chiara; Scafetta, Gaia; Capra, Maria; Giardina, Giuseppina; Nuciforo, Paolo; Bosari, Silvano; Viale, Giuseppe; Mazzarol, Giovanni; Tonelli, Chiara; Lanfrancone, Luisa; Alcalay, Myriam

    2011-01-01

    Cellular senescence has been widely recognized as a tumor suppressing mechanism that acts as a barrier to cancer development after oncogenic stimuli. A prominent in vivo model of the senescence barrier is represented by nevi, which are composed of melanocytes that, after an initial phase of proliferation induced by activated oncogenes (most commonly BRAF), are blocked in a state of cellular senescence. Transformation to melanoma occurs when genes involved in controlling senescence are mutated or silenced and cells reacquire the capacity to proliferate. Pirin (PIR) is a highly conserved nuclear protein that likely functions as a transcriptional regulator whose expression levels are altered in different types of tumors. We analyzed the expression pattern of PIR in adult human tissues and found that it is expressed in melanocytes and has a complex pattern of regulation in nevi and melanoma: it is rarely detected in mature nevi, but is expressed at high levels in a subset of melanomas. Loss of function and overexpression experiments in normal and transformed melanocytic cells revealed that PIR is involved in the negative control of cellular senescence and that its expression is necessary to overcome the senescence barrier. Our results suggest that PIR may have a relevant role in melanoma progression. PMID:21514450

  17. Dnmt1 regulates the myogenic lineage specification of muscle stem cells.

    PubMed

    Liu, Renjing; Kim, Kun-Yong; Jung, Yong-Wook; Park, In-Hyun

    2016-10-18

    DNA methylation is an important epigenetic mark that regulates gene expression. Dnmt1 plays an important role in maintaining DNA methylation patterns on daughter DNA strands. Studies have shed light into the functional role of Dnmt1 regulation in the hematopoietic and epidermal systems. Here we show that Dnmt1 is required for myogenesis. Loss of Dnmt1 results in reduced expression of myogenic genes and defects in myogenic differentiation. We have utilized a conditional knockout mouse approach to examine the functional consequences of Dnmt1 depletion specifically in the developing muscle. These mice were born runted, with smaller body weights, and reduced ability to form myotubes in vitro. We show that expression of Id-1, a negative regulator of myogenesis, is enhanced in Dnmt1-deficient cultures, leading to enhanced transdifferentiation of myoblasts toward the osteogenic lineage. Thus, these studies demonstrate that Dnmt1 influences cellular identity and determines lineage fidelity.

  18. Dnmt1 regulates the myogenic lineage specification of muscle stem cells

    PubMed Central

    Liu, Renjing; Kim, Kun-Yong; Jung, Yong-Wook; Park, In-Hyun

    2016-01-01

    DNA methylation is an important epigenetic mark that regulates gene expression. Dnmt1 plays an important role in maintaining DNA methylation patterns on daughter DNA strands. Studies have shed light into the functional role of Dnmt1 regulation in the hematopoietic and epidermal systems. Here we show that Dnmt1 is required for myogenesis. Loss of Dnmt1 results in reduced expression of myogenic genes and defects in myogenic differentiation. We have utilized a conditional knockout mouse approach to examine the functional consequences of Dnmt1 depletion specifically in the developing muscle. These mice were born runted, with smaller body weights, and reduced ability to form myotubes in vitro. We show that expression of Id-1, a negative regulator of myogenesis, is enhanced in Dnmt1-deficient cultures, leading to enhanced transdifferentiation of myoblasts toward the osteogenic lineage. Thus, these studies demonstrate that Dnmt1 influences cellular identity and determines lineage fidelity. PMID:27752090

  19. Optomotor-blind negatively regulates Drosophila eye development by blocking Jak/STAT signaling.

    PubMed

    Tsai, Yu-Chen; Grimm, Stefan; Chao, Ju-Lan; Wang, Shih-Chin; Hofmeyer, Kerstin; Shen, Jie; Eichinger, Fred; Michalopoulou, Theoni; Yao, Chi-Kuang; Chang, Chih-Hsuan; Lin, Shih-Han; Sun, Y Henry; Pflugfelder, Gert O

    2015-01-01

    Organ formation requires a delicate balance of positive and negative regulators. In Drosophila eye development, wingless (wg) is expressed at the lateral margins of the eye disc and serves to block retinal development. The T-box gene optomotor-blind (omb) is expressed in a similar pattern and is regulated by Wg. Omb mediates part of Wg activity in blocking eye development. Omb exerts its function primarily by blocking cell proliferation. These effects occur predominantly in the ventral margin. Our results suggest that the primary effect of Omb is the blocking of Jak/STAT signaling by repressing transcription of upd which encodes the Jak receptor ligand Unpaired.

  20. Tumor Cell Plasticity in Uveal Melanoma

    PubMed Central

    Folberg, Robert; Arbieva, Zarema; Moses, Jonas; Hayee, Amin; Sandal, Tone; Kadkol, ShriHari; Lin, Amy Y.; Valyi-Nagy, Klara; Setty, Suman; Leach, Lu; Chévez-Barrios, Patricia; Larsen, Peter; Majumdar, Dibyen; Pe’er, Jacob; Maniotis, Andrew J.

    2006-01-01

    The histological detection of laminin-rich vasculogenic mimicry patterns in human primary uveal melanomas is associated with death from metastases. We therefore hypothesized that highly invasive uveal melanoma cells forming vasculogenic mimicry patterns after exposure to a laminin-rich three-dimensional microenvironment would differentially express genes associated with invasive and metastatic behavior. However, we discovered that genes associated with differentiation (GDF15 and ATF3) and suppression of proliferation (CDKNa1/p21) were up-regulated in highly invasive uveal melanoma cells forming vasculogenic mimicry patterns, and genes associated with promotion of invasive and metastatic behavior such as CD44, CCNE2 (cyclin E2), THBS1 (thrombospondin 1), and CSPG2 (chondroitin sulfate proteoglycan; versican) were down-regulated. After forming vasculogenic mimicry patterns, uveal melanoma cells invaded only short distances, failed to replicate, and changed morphologically from the invasive epithelioid to the indolent spindle A phenotype. In human tissue samples, uveal melanoma cells within vasculogenic mimicry patterns assumed the spindle A morphology, and the expression of Ki67 was significantly reduced in adjacent melanoma cells. Thus, the generation of vasculogenic mimicry patterns is accompanied by dampening of the invasive and metastatic uveal melanoma genotype and phenotype and underscores the plasticity of these cells in response to cues from the microenvironment. PMID:17003493

  1. Expression patterns of the aquaporin gene family during renal development: influence of genetic variability.

    PubMed

    Parreira, Kleber S; Debaix, Huguette; Cnops, Yvette; Geffers, Lars; Devuyst, Olivier

    2009-08-01

    High-throughput analyses have shown that aquaporins (AQPs) belong to a cluster of genes that are differentially expressed during kidney organogenesis. However, the spatiotemporal expression patterns of the AQP gene family during tubular maturation and the potential influence of genetic variation on these patterns and on water handling remain unknown. We investigated the expression patterns of all AQP isoforms in fetal (E13.5 to E18.5), postnatal (P1 to P28), and adult (9 weeks) kidneys of inbred (C57BL/6J) and outbred (CD-1) mice. Using quantitative polymerase chain reaction (PCR), we evidenced two mRNA patterns during tubular maturation in C57 mice. The AQPs 1-7-11 showed an early (from E14.5) and progressive increase to adult levels, similar to the mRNA pattern observed for proximal tubule markers (Megalin, NaPi-IIa, OAT1) and reflecting the continuous increase in renal cortical structures during development. By contrast, AQPs 2-3-4 showed a later (E15.5) and more abrupt increase, with transient postnatal overexpression. Most AQP genes were expressed earlier and/or stronger in maturing CD-1 kidneys. Furthermore, adult CD-1 kidneys expressed more AQP2 in the collecting ducts, which was reflected by a significant delay in excreting a water load. The expression patterns of proximal vs. distal AQPs and the earlier expression in the CD-1 strain were confirmed by immunoblotting and immunostaining. These data (1) substantiate the clustering of important genes during tubular maturation and (2) demonstrate that genetic variability influences the regulation of the AQP gene family during tubular maturation and water handling by the mature kidney.

  2. Genomic Pangea: coordinate gene regulation and cell-specific chromosomal topologies.

    PubMed

    Laster, Kyle; Kosak, Steven T

    2010-06-01

    The eukaryotic nucleus is functionally organized. Gene loci, for example, often reveal altered localization patterns according to their developmental regulation. Whole chromosomes also demonstrate non-random nuclear positions, correlated with inherent characteristics such as gene density or size. Given that hundreds to thousands of genes are coordinately regulated in any given cell type, interest has grown in whether chromosomes may be specifically localized according to gene regulation. A synthesis of the evidence for preferential chromosomal organization suggests that, beyond basic characteristics, chromosomes can assume positions functionally related to gene expression. Moreover, analysis of total chromosome organization during cellular differentiation indicates that unique chromosome topologies, albeit probabilistic, in effect define a cell lineage. Future work with new techniques, including the advanced forms of the chromosome conformation capture (3C), and the development of next-generation whole-genome imaging approaches, will help to refine our view of chromosomal organization. We suggest that genomic organization during cellular differentiation should be viewed as a dynamic process, with gene expression patterns leading to chromosome associations that feed back on themselves, leading to the self-organization of the genome according to coordinate gene regulation. Copyright 2010 Elsevier Ltd. All rights reserved.

  3. The Ontogeny and Brain Distribution Dynamics of the Appetite Regulators NPY, CART and pOX in Larval Atlantic Cod (Gadus morhua L.)

    PubMed Central

    Le, Hoang T. M. D.; Angotzi, Anna Rita; Ebbesson, Lars O. E.; Karlsen, Ørjan

    2016-01-01

    Similar to many marine teleost species, Atlantic cod undergo remarkable physiological changes during the early life stages with concurrent and profound changes in feeding biology and ecology. In contrast to the digestive system, very little is known about the ontogeny and the localization of the centers that control appetite and feed ingestion in the developing brain of fish. We examined the expression patterns of three appetite regulating factors (orexigenic: neuropeptide Y, NPY; prepro-orexin, pOX and anorexigenic: cocaine- and amphetamine-regulated transcript, CART) in discrete brain regions of developing Atlantic cod using chromogenic and double fluorescent in situ hybridization. Differential temporal and spatial expression patterns for each appetite regulator were found from first feeding (4 days post hatch; dph) to juvenile stage (76 dph). Neurons expressing NPY mRNA were detected in the telencephalon (highest expression), diencephalon, and optic tectum from 4 dph onward. CART mRNA expression had a wider distribution along the anterior-posterior brain axis, including both telencephalon and diencephalon from 4 dph. From 46 dph, CART transcripts were also detected in the olfactory bulb, region of the nucleus of medial longitudinal fascicle, optic tectum and midbrain tegmentum. At 4 and 20 dph, pOX mRNA expression was exclusively found in the preoptic region, but extended to the hypothalamus at 46 and 76 dph. Co-expression of both CART and pOX genes were also observed in several hypothalamic neurons throughout larval development. Our results show that both orexigenic and anorexigenic factors are present in the telencephalon, diencephalon and mesencephalon in cod larvae. The telencephalon mostly contains key factors of hunger control (NPY), while the diencephalon, and particularly the hypothalamus may have a more complex role in modulating the multifunctional control of appetite in this species. As the larvae develop, the overall progression in temporal and spatial complexity of NPY, CART and pOX mRNAs expression might be correlated to the maturation of appetite control regulation. These observations suggest that teleost larvae continue to develop the regulatory networks underlying appetite control after onset of exogenous feeding. PMID:27100086

  4. The Ontogeny and Brain Distribution Dynamics of the Appetite Regulators NPY, CART and pOX in Larval Atlantic Cod (Gadus morhua L.).

    PubMed

    Le, Hoang T M D; Angotzi, Anna Rita; Ebbesson, Lars O E; Karlsen, Ørjan; Rønnestad, Ivar

    2016-01-01

    Similar to many marine teleost species, Atlantic cod undergo remarkable physiological changes during the early life stages with concurrent and profound changes in feeding biology and ecology. In contrast to the digestive system, very little is known about the ontogeny and the localization of the centers that control appetite and feed ingestion in the developing brain of fish. We examined the expression patterns of three appetite regulating factors (orexigenic: neuropeptide Y, NPY; prepro-orexin, pOX and anorexigenic: cocaine- and amphetamine-regulated transcript, CART) in discrete brain regions of developing Atlantic cod using chromogenic and double fluorescent in situ hybridization. Differential temporal and spatial expression patterns for each appetite regulator were found from first feeding (4 days post hatch; dph) to juvenile stage (76 dph). Neurons expressing NPY mRNA were detected in the telencephalon (highest expression), diencephalon, and optic tectum from 4 dph onward. CART mRNA expression had a wider distribution along the anterior-posterior brain axis, including both telencephalon and diencephalon from 4 dph. From 46 dph, CART transcripts were also detected in the olfactory bulb, region of the nucleus of medial longitudinal fascicle, optic tectum and midbrain tegmentum. At 4 and 20 dph, pOX mRNA expression was exclusively found in the preoptic region, but extended to the hypothalamus at 46 and 76 dph. Co-expression of both CART and pOX genes were also observed in several hypothalamic neurons throughout larval development. Our results show that both orexigenic and anorexigenic factors are present in the telencephalon, diencephalon and mesencephalon in cod larvae. The telencephalon mostly contains key factors of hunger control (NPY), while the diencephalon, and particularly the hypothalamus may have a more complex role in modulating the multifunctional control of appetite in this species. As the larvae develop, the overall progression in temporal and spatial complexity of NPY, CART and pOX mRNAs expression might be correlated to the maturation of appetite control regulation. These observations suggest that teleost larvae continue to develop the regulatory networks underlying appetite control after onset of exogenous feeding.

  5. Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

    NASA Technical Reports Server (NTRS)

    Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

    1995-01-01

    Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

  6. Developmental changes in facial expressions of emotions in the strange situation during the second year of life.

    PubMed

    Izard, Carroll E; Abe, Jo Ann A

    2004-09-01

    Infants' expressions of discrete emotions were coded during the more stressful episodes (4 through 8) of the Strange Situation at 13 and 18 months. The data showed a significant decrease in full-face expressions (more complex configurations of movements) and a significant increase in component expressions (simpler and more constrained patterns of movements). The authors interpreted this trend as a developmental change toward more regulated and less intense emotions. Consistent with this view, the aggregate index of infants' full-face negative emotion expressions, interpreted as reflecting relatively unregulated intense emotions, correlated significantly with maternal ratings of difficult temperament. The authors discuss alternative interpretations of the findings in terms of changes in reactivity/arousability and the emerging capacity for self-regulation. (c) 2004 APA, all rights reserved

  7. Expression of SLP-2 was associated with invasion of esophageal squamous cell carcinoma.

    PubMed

    Cao, Wenfeng; Zhang, Bin; Ding, Fang; Zhang, Weiran; Sun, Baocun; Liu, Zhihua

    2013-01-01

    Stomatin-like protein 2 (SLP-2), a member of the Stomatin superfamily, has been identified as an oncogenic-related protein and found to be up-regulated in multi-cancers. Nonetheless, the expression pattern and regulation of SLP-2 in human esophageal squamous cell carcinoma (ESCC) remain unexplored. Immunohistochemistry and immunofluorescence staining analysis were performed to show SLP-2 expression and location. RNAi method was used to inhibit specific protein expression. Transwell assay was done to investigate cells invasive capability. RT-PCR and Western blot analysis were used to detect mRNA and protein expression levels. Immunohistochemical analysis showed that up-regulation of SLP-2 was found in invasive front compared with cancer central tissue in ESCC. Inhibition of SLP-2 by SLP-2 siRNA can decrease ESCC cells invasive capability through MMP-2 dependent manner. Up-regulation of SLP-2 was effectively abrogated by the ERK1/2 inhibitors either PD98059 or U0126, but no effect was showed by the treatment of AKT inhibitors either LY294002 or MK-2206. So the regulation of SLP-2 was involved in activation of the MAPK/ERK pathway. We found that PMA/EGF could induce the up-regulated expression of SLP-2 probably through activating ERK signalling. The current study suggests that SLP-2 may represent an important molecular hallmark that is clinically relevant to the invasion of ESCC.

  8. Spatial and temporal expression patterns of auxin response transcription factors in the syncytium induced by the beet cyst nematode Heterodera schachtii in Arabidopsis.

    PubMed

    Hewezi, Tarek; Piya, Sarbottam; Richard, Geoffrey; Rice, J Hollis

    2014-09-01

    Plant-parasitic cyst nematodes induce the formation of a multinucleated feeding site in the infected root, termed the syncytium. Recent studies point to key roles of the phytohormone auxin in the regulation of gene expression and establishment of the syncytium. Nevertheless, information about the spatiotemporal expression patterns of the transcription factors that mediate auxin transcriptional responses during syncytium formation is limited. Here, we provide a gene expression map of 22 auxin response factors (ARFs) during the initiation, formation and maintenance stages of the syncytium induced by the cyst nematode Heterodera schachtii in Arabidopsis. We observed distinct and overlapping expression patterns of ARFs throughout syncytium development phases. We identified a set of ARFs whose expression is predominantly located inside the developing syncytium, whereas others are expressed in the neighbouring cells, presumably to initiate specific transcriptional programmes required for their incorporation within the developing syncytium. Our analyses also point to a role of certain ARFs in determining the maximum size of the syncytium. In addition, several ARFs were found to be highly expressed in fully developed syncytia, suggesting a role in maintaining the functional phenotype of mature syncytia. The dynamic distribution and overlapping expression patterns of various ARFs seem to be essential characteristics of ARF activity during syncytium development. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  9. Differential Accumulation of Sunflower Tetraubiquitin mRNAs during Zygotic Embryogenesis and Developmental Regulation of Their Heat-Shock Response.

    PubMed Central

    Almoguera, C.; Coca, M. A.; Jordano, J.

    1995-01-01

    We have isolated and sequenced Ha UbiS, a cDNA for a dry-seed-stored mRNA that encodes tetraubiquitin. We have observed differential accumulation of tetraubiquitin mRNAs during sunflower (Helianthus annuus L.) zygotic embryogenesis. These mRNAs were up-regulated during late embryogenesis and reached higher prevalence in the dry seed, where they were found to be associated mainly with provascular tissue. UbiS mRNA, as confirmed by Rnase A protection experiments, accumulated also in response to heat shock, but only in leaves and later during postgerminative development. These novel observations demonstrate expression during seed maturation of specific plant polyubiquitin transcripts and developmental regulation of their heat-shock response. Using ubiquitin antibodies we also detected discrete, seed-specific proteins with distinct temporal expression patterns during zygotic embryogenesis. Some of these patterns were concurrent with UbiS mRNA accumulation in seeds. The most abundant ubiquitin-reacting proteins found in mature seeds were small (16-22 kD) and acidic (isoelectric points of 6.1-7.4). Possible functional implications for UbiS expression elicited from these observations are discussed. PMID:12228401

  10. The Caenorhabditis elegans vulva: A post-embryonic gene regulatory network controlling organogenesis

    PubMed Central

    Ririe, Ted O.; Fernandes, Jolene S.; Sternberg, Paul W.

    2008-01-01

    The Caenorhabditis elegans vulva is an elegant model for dissecting a gene regulatory network (GRN) that directs postembryonic organogenesis. The mature vulva comprises seven cell types (vulA, vulB1, vulB2, vulC, vulD, vulE, and vulF), each with its own unique pattern of spatial and temporal gene expression. The mechanisms that specify these cell types in a precise spatial pattern are not well understood. Using reverse genetic screens, we identified novel components of the vulval GRN, including nhr-113 in vulA. Several transcription factors (lin-11, lin-29, cog-1, egl-38, and nhr-67) interact with each other and act in concert to regulate target gene expression in the diverse vulval cell types. For example, egl-38 (Pax2/5/8) stabilizes the vulF fate by positively regulating vulF characteristics and by inhibiting characteristics associated with the neighboring vulE cells. nhr-67 and egl-38 regulate cog-1, helping restrict its expression to vulE. Computational approaches have been successfully used to identify functional cis-regulatory motifs in the zmp-1 (zinc metalloproteinase) promoter. These results provide an overview of the regulatory network architecture for each vulval cell type. PMID:19104047

  11. Evolutionary conservation and expression of miR-10a-3p in olive flounder and rock bream.

    PubMed

    Jo, Ara; Im, Jennifer; Lee, Hee-Eun; Jang, Dongmin; Nam, Gyu-Hwi; Mishra, Anshuman; Kim, Woo-Jin; Kim, Won; Cha, Hee-Jae; Kim, Heui-Soo

    2017-09-10

    MicroRNAs (miRNAs) are small non-coding RNAs (ncRNAs) that mainly bind to the seed sequences located within the 3' untranslated region (3' UTR) of target genes. They perform an important biological function as regulators of gene expression. Different genes can be regulated by the same miRNA, whilst different miRNAs can be regulated by the same genes. Here, the evolutionary conservation and expression pattern of miR-10a-3p in olive flounder and rock bream was examined. Binding sites (AAAUUC) to seed region of the 3' UTR of target genes were highly conserved in various species. The expression pattern of miR-10a-3p was ubiquitous in the examined tissues, whilst its expression level was decreased in gill tissues infected by viral hemorrhagic septicemia virus (VHSV) compared to the normal control. In the case of rock bream, the spleen, kidney, and liver tissues showed dominant expression levels of miR-10a-3p. Only the liver tissues in the rock bream samples infected by the iridovirus indicated a dominant miR-10a-3p expression. The gene ontology (GO) analysis of predicted target genes for miR-10a-3p revealed that multiple genes are related to binding activity, catalytic activity, cell components as well as cellular and metabolic process. Overall the results imply that the miR-10a-3p could be used as a biomarker to detect VHSV infection in olive flounder and iridovirus infection in rock bream. In addition, the data provides fundamental information for further study of the complex interaction between miR-10a-3p and gene expression. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Activation of Ftz-F1-Responsive Genes through Ftz/Ftz-F1 Dependent Enhancers

    PubMed Central

    Field, Amanda; Xiang, Jie; Anderson, W. Ray; Graham, Patricia; Pick, Leslie

    2016-01-01

    The orphan nuclear receptor Ftz-F1 is expressed in all somatic nuclei in Drosophila embryos, but mutations result in a pair-rule phenotype. This was explained by the interaction of Ftz-F1 with the homeodomain protein Ftz that is expressed in stripes in the primordia of segments missing in either ftz-f1 or ftz mutants. Ftz-F1 and Ftz were shown to physically interact and coordinately activate the expression of ftz itself and engrailed by synergistic binding to composite Ftz-F1/Ftz binding sites. However, attempts to identify additional target genes on the basis of Ftz-F1/ Ftz binding alone has met with only limited success. To discern rules for Ftz-F1 target site selection in vivo and to identify additional target genes, a microarray analysis was performed comparing wildtype and ftz-f1 mutant embryos. Ftz-F1-responsive genes most highly regulated included engrailed and nine additional genes expressed in patterns dependent on both ftz and ftz-f1. Candidate enhancers for these genes were identified by combining BDTNP Ftz ChIP-chip data with a computational search for Ftz-F1 binding sites. Of eight enhancer reporter genes tested in transgenic embryos, six generated expression patterns similar to the corresponding endogenous gene and expression was lost in ftz mutants. These studies identified a new set of Ftz-F1 targets, all of which are co-regulated by Ftz. Comparative analysis of enhancers containing Ftz/Ftz-F1 binding sites that were or were not bona fide targets in vivo suggested that GAF negatively regulates enhancers that contain Ftz/Ftz-F1 binding sites but are not actually utilized. These targets include other regulatory factors as well as genes involved directly in morphogenesis, providing insight into how pair-rule genes establish the body pattern. PMID:27723822

  13. Androgen receptor regulated microRNA miR-182-5p promotes prostate cancer progression by targeting the ARRDC3/ITGB4 pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jingjing; Xu, Chen; Department of Orthopedics, Changzheng Hospital Affiliated to Second Military Medical University, 415th Feng Yang Road, Shanghai, 200003

    Abstracts: MicroRNAs (miRNAs) are important endogenous gene regulators that play key roles in prostate cancer development and metastasis. However, specific miRNA expression patterns in prostate cancer tissues from Chinese patients remain largely unknown. In this study, we compared miRNA expression patterns in 65 pairs of prostate cancer and para-cancer tissues by RNA sequencing and found that miR-182-5p was the most up-regulated miRNA in prostate cancer tissues. The result was validated using realtime PCR in 18 pairs of prostate cancer and para-cancer tissues. In in vitro analysis, it was confirmed that miR-182-5p promotes prostate cancer cell proliferation, invasion and migration and inhibitmore » apoptosis. In addition, the androgen receptor directly regulated the transcription of miR-182-5p, which could target to the 3′UTR of ARRDC3 mRNA and affect the expression of ARRDC3 and its downstream gene ITGB4. For the in vivo experiment, miR-182-5p overexpression also promoted the growth and progression of prostate cancer tumors. In this regard, we suggest that miR-182-5p may be a key androgen receptor-regulated factor that contributes to the development and metastasis of Chinese prostate cancers and may be a potential target for the early diagnosis and therapeutic studies of prostate cancer. -- Highlights: •miR-182-5p is the mostly up-regulated miRNA in Chinese prostate cancer. •miR-182-5p is regulated by androgen receptor. •miR-182-5p promotes prostate cancer progression. •miR-182-5p regulates ARRDC3/ITGB4 pathway.« less

  14. Akt1 Controls the Timing and Amplitude of Vascular Circadian Gene Expression

    PubMed Central

    Luciano, Amelia K.; Santana, Jeans M.; Velazquez, Heino; Sessa, William C.

    2017-01-01

    The AKT signaling pathway is important for circadian rhythms in mammals and flies (Drosophila). However, AKT signaling in mammals is more complicated since there are 3 isoforms of AKT, each performing slightly different functions. Here we study the most ubiquitous AKT isoform, Akt1, and its role at the organismal level in the central and vascular peripheral clocks. Akt1−/− mice exhibit relatively normal behavioral rhythms with only minor differences in circadian gene expression in the liver and heart. However, circadian gene expression in the Akt1−/− aorta, compared with control aorta, follows a distinct pattern. In the Akt1−/− aorta, positive regulators of circadian transcription have lower amplitude rhythms and peak earlier in the day, and negative circadian regulators are expressed at higher amplitudes and peak later in the day. In endothelial cells, negative circadian regulators exhibit an increased amplitude of expression, while the positive circadian regulators are arrhythmic with a decreased amplitude of expression. This indicates that Akt1 conditions the normal circadian rhythm in the vasculature more so than in other peripheral tissues where other AKT isoforms or kinases might be important for daily rhythms. PMID:28452287

  15. The expression of PTEN in the development of mouse cochlear lateral wall.

    PubMed

    Dong, Y; Sui, L; Yamaguchi, F; Kamitori, K; Hirata, Y; Hossain, A; Noguchi, C; Katagi, A; Nishio, M; Suzuki, A; Lou, X; Tokuda, M

    2014-01-31

    Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is a tumor suppressor gene that regulates various cell processes including proliferation, growth, synaptogenesis, neural and glioma stem/progenitor cell renewal. In addition, PTEN can regulate sensory cell proliferation and differentiation of hair bundles in the mammalian cochlea. In this study we use immunofluorescence, Western blot and reverse transcriptase-polymerase chain reaction (RT-PCR) to reveal the expression of PTEN in the developing cochlear lateral wall, which is crucial for regulating K(+) homeostasis. Relatively high levels of PTEN are initially expressed in the marginal cells (MCs) of the lateral wall at embryonic day (E) 17.5 when they start to differentiate. Similarly high levels are subsequently expressed in differentiating root cells (RCs) at postnatal day (P) 3 and then in spiral ligament fibrocytes (SLFs) at P 10. In the mature cochlea, PTEN expression is low or undetectable in MCs and SLFs but it remains high in RCs and their processes. The expression pattern for PTEN in the developing lateral wall suggests that it plays a critical role in the differentiation of the cellular pathways that regulate K(+) homeostasis in the cochlea. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  16. Regulation of Silk Genes by Hox and Homeodomain Proteins in the Terminal Differentiated Silk Gland of the Silkworm Bombyx mori

    PubMed Central

    Takiya, Shigeharu; Tsubota, Takuya; Kimoto, Mai

    2016-01-01

    The silk gland of the silkworm Bombyx mori is a long tubular organ that is divided into several subparts along its anteroposterior (AP) axis. As a trait of terminal differentiation of the silk gland, several silk protein genes are expressed with unique regional specificities. Most of the Hox and some of the homeobox genes are also expressed in the differentiated silk gland with regional specificities. The expression patterns of Hox genes in the silk gland roughly correspond to those in embryogenesis showing “colinearity”. The central Hox class protein Antennapedia (Antp) directly regulates the expression of several middle silk gland–specific silk genes, whereas the Lin-1/Isl-1/Mec3 (LIM)-homeodomain transcriptional factor Arrowhead (Awh) regulates the expression of posterior silk gland–specific genes for silk fiber proteins. We summarize our results and discuss the usefulness of the silk gland of Bombyx mori for analyzing the function of Hox genes. Further analyses of the regulatory mechanisms underlying the region-specific expression of silk genes will provide novel insights into the molecular bases for target-gene selection and regulation by Hox and homeodomain proteins. PMID:29615585

  17. Akt1 Controls the Timing and Amplitude of Vascular Circadian Gene Expression.

    PubMed

    Luciano, Amelia K; Santana, Jeans M; Velazquez, Heino; Sessa, William C

    2017-06-01

    The AKT signaling pathway is important for circadian rhythms in mammals and flies ( Drosophila). However, AKT signaling in mammals is more complicated since there are 3 isoforms of AKT, each performing slightly different functions. Here we study the most ubiquitous AKT isoform, Akt1, and its role at the organismal level in the central and vascular peripheral clocks. Akt1 -/- mice exhibit relatively normal behavioral rhythms with only minor differences in circadian gene expression in the liver and heart. However, circadian gene expression in the Akt1 -/- aorta, compared with control aorta, follows a distinct pattern. In the Akt1 -/- aorta, positive regulators of circadian transcription have lower amplitude rhythms and peak earlier in the day, and negative circadian regulators are expressed at higher amplitudes and peak later in the day. In endothelial cells, negative circadian regulators exhibit an increased amplitude of expression, while the positive circadian regulators are arrhythmic with a decreased amplitude of expression. This indicates that Akt1 conditions the normal circadian rhythm in the vasculature more so than in other peripheral tissues where other AKT isoforms or kinases might be important for daily rhythms.

  18. Hypoxia Stress Modifies Na+/K+-ATPase, H+/K+-ATPase, Na+/NH4+-ATPase, and nkaα1 Isoform Expression in the Brain of Immune-Challenged Air-Breathing Fish

    PubMed Central

    Peter, MC Subhash; Simi, Satheesan

    2017-01-01

    Fishes are equipped to sense stressful stimuli and are able to respond to environmental stressor such as hypoxia with varying pattern of stress response. The functional attributes of brain to hypoxia stress in relation to ion transport and its interaction during immune challenge have not yet delineated in fish. We, therefore, explored the pattern of ion transporter functions and messenger RNA (mRNA) expression of α1-subunit isoforms of Na+/K+-ATPase (NKA) in the brain segments, namely, prosencephalon (PC), mesencephalon (MC), and metencephalon (MeC) in an obligate air-breathing fish exposed either to hypoxia stress (30 minutes forced immersion in water) or challenged with zymosan treatment (25-200 ng g−1 for 24 hours) or both. Zymosan that produced nonspecific immune responses evoked differential regulation of NKA, H+/K+-ATPase (HKA), and Na+/NH4+-ATPase (NNA) in the varied brain segments. On the contrary, hypoxia stress that demanded activation of NKA in PC and MeC showed a reversed NKA activity pattern in MeC of immune-challenged fish. A compromised HKA and NNA regulation during hypoxia stress was found in immune-challenged fish, indicating the role of these brain ion transporters to hypoxia stress and immune challenges. The differential mRNA expression of α1-subunit isoforms of NKA, nkaα1a, nkaα1b, and nkaα1c, in hypoxia-stressed brain showed a shift in its expression pattern during hypoxia stress-immune interaction in PC and MC. Evidence is thus presented for the first time that ion transporters such as HKA and NNA along with NKA act as functional brain markers which respond differentially to both hypoxia stress and immune challenges. Taken together, the data further provide evidence for a differential Na+, K+, H+, and NH4+ ion signaling that exists in brain neuronal clusters during hypoxia stress-immune interaction as a result of modified regulations of NKA, HKA, and NNA transporter functions and nkaα1 isoform regulation. PMID:29238219

  19. Hypoxia Stress Modifies Na+/K+-ATPase, H+/K+-ATPase, [Formula: see text], and nkaα1 Isoform Expression in the Brain of Immune-Challenged Air-Breathing Fish.

    PubMed

    Peter, Mc Subhash; Simi, Satheesan

    2017-01-01

    Fishes are equipped to sense stressful stimuli and are able to respond to environmental stressor such as hypoxia with varying pattern of stress response. The functional attributes of brain to hypoxia stress in relation to ion transport and its interaction during immune challenge have not yet delineated in fish. We, therefore, explored the pattern of ion transporter functions and messenger RNA (mRNA) expression of α1-subunit isoforms of Na + /K + -ATPase (NKA) in the brain segments, namely, prosencephalon (PC), mesencephalon (MC), and metencephalon (MeC) in an obligate air-breathing fish exposed either to hypoxia stress (30 minutes forced immersion in water) or challenged with zymosan treatment (25-200 ng g -1 for 24 hours) or both. Zymosan that produced nonspecific immune responses evoked differential regulation of NKA, H + /K + -ATPase (HKA), and [Formula: see text] (NNA) in the varied brain segments. On the contrary, hypoxia stress that demanded activation of NKA in PC and MeC showed a reversed NKA activity pattern in MeC of immune-challenged fish. A compromised HKA and NNA regulation during hypoxia stress was found in immune-challenged fish, indicating the role of these brain ion transporters to hypoxia stress and immune challenges. The differential mRNA expression of α1-subunit isoforms of NKA, nkaα1a , nkaα1b , and nkaα1c , in hypoxia-stressed brain showed a shift in its expression pattern during hypoxia stress-immune interaction in PC and MC. Evidence is thus presented for the first time that ion transporters such as HKA and NNA along with NKA act as functional brain markers which respond differentially to both hypoxia stress and immune challenges. Taken together, the data further provide evidence for a differential Na + , K + , H + , and [Formula: see text] ion signaling that exists in brain neuronal clusters during hypoxia stress-immune interaction as a result of modified regulations of NKA, HKA, and NNA transporter functions and nkaα1 isoform regulation.

  20. Differential expression patterns of metastasis suppressor proteins in basal cell carcinoma.

    PubMed

    Bozdogan, Onder; Yulug, Isik G; Vargel, Ibrahim; Cavusoglu, Tarik; Karabulut, Ayse A; Karahan, Gurbet; Sayar, Nilufer

    2015-08-01

    Basal cell carcinomas (BCCs) are common malignant skin tumors. Despite having a significant invasion capacity, they metastasize only rarely. Our aim in this study was to detect the expression patterns of the NM23-H1, NDRG1, E-cadherin, RHOGDI2, CD82/KAI1, MKK4, and AKAP12 metastasis suppressor proteins in BCCs. A total of 96 BCC and 10 normal skin samples were included for the immunohistochemical study. Eleven frozen BCC samples were also studied by quantitative real time polymerase chain reaction (qRT-PCR) to detect the gene expression profile. NM23-H1 was strongly and diffusely expressed in all types of BCC. Significant cytoplasmic expression of NDRG1 and E-cadherin was also detected. However, AKAP12 and CD82/KAI1 expression was significantly decreased. The expressions of the other proteins were somewhere between the two extremes. Similarly, qRT-PCR analysis showed down-regulation of AKAP12 and up-regulation of NM23-H1 and NDRG1 in BCC. Morphologically aggressive BCCs showed significantly higher cytoplasmic NDRG1 expression scores and lower CD82/KAI1 scores than non-aggressive BCCs. The relatively preserved levels of NM23-H1, NDRG1, and E-cadherin proteins may have a positive effect on the non-metastasizing features of these tumors. © 2014 The International Society of Dermatology.

  1. Exposure to Nickel, Chromium, or Cadmium Causes Distinct Changes in the Gene Expression Patterns of a Rat Liver Derived Cell Line

    DTIC Science & Technology

    2011-11-16

    protein A (Rpa2), the minichromosome maintenance complex component genes which encode helicases, DNA ligase (Lig1), DNA polymerase e ( Pole and Pole2...and DNA polymerase d ( Pold1 and Pold2 ) are all up-regulated as a result of exposure to chromium (Figure 6), suggesting that there is an increase in...Exposure to Nickel, Chromium, or Cadmium Causes Distinct Changes in the Gene Expression Patterns of a Rat Liver Derived Cell Line Matthew G

  2. The segment polarity network is a robust developmental module

    NASA Astrophysics Data System (ADS)

    von Dassow, George; Meir, Eli; Munro, Edwin M.; Odell, Garrett M.

    2000-07-01

    All insects possess homologous segments, but segment specification differs radically among insect orders. In Drosophila, maternal morphogens control the patterned activation of gap genes, which encode transcriptional regulators that shape the patterned expression of pair-rule genes. This patterning cascade takes place before cellularization. Pair-rule gene products subsequently `imprint' segment polarity genes with reiterated patterns, thus defining the primordial segments. This mechanism must be greatly modified in insect groups in which many segments emerge only after cellularization. In beetles and parasitic wasps, for instance, pair-rule homologues are expressed in patterns consistent with roles during segmentation, but these patterns emerge within cellular fields. In contrast, although in locusts pair-rule homologues may not control segmentation, some segment polarity genes and their interactions are conserved. Perhaps segmentation is modular, with each module autonomously expressing a characteristic intrinsic behaviour in response to transient stimuli. If so, evolution could rearrange inputs to modules without changing their intrinsic behaviours. Here we suggest, using computer simulations, that the Drosophila segment polarity genes constitute such a module, and that this module is resistant to variations in the kinetic constants that govern its behaviour.

  3. MICA/B expression is inhibited by unfolded protein response and associated with poor prognosis in human hepatocellular carcinoma.

    PubMed

    Fang, Liang; Gong, Jiuyu; Wang, Ying; Liu, Rongrong; Li, Zengshan; Wang, Zhe; Zhang, Yun; Zhang, Chunmei; Song, Chaojun; Yang, Angang; Ting, Jenny P-Y; Jin, Boquan; Chen, Lihua

    2014-09-18

    MICA/B are major ligands for NK cell activating receptor NKG2D and previous studies showed that the serum level of soluble MICA (sMICA) is an independent prognostic factor for advanced human hepatocellular carcinoma. However, the correlation between cellular MICA/B expression pattern and human hepatocellular carcinoma progression has not been well explored. The unfolded protein response is one of the main causes of resistance to chemotherapy and radiotherapy in tumor cells. However, whether the UPR in HCC could regulate the expression levels of MICA/B and affect the sensitivity of HCC cells to NK cell cytolysis has not been established yet. MICA/B expression pattern was evaluated by immunohistochemistry and Kaplan-Meier survival analysis was done to explore the relationship between MICA/B expression level and patient survival. The protein and mRNA expression levels of MICA/B in SMMC7721 and HepG2 cells treated by tunicamycin were evaluated by flow cytometry, Western Blot and RT-PCR. The cytotoxicity analysis was performed with the CytoTox 96 Non-Radioactive LDH Cytotoxicity Assay. MICA/B was highly expressed in human hepatocellular carcinoma and the expression level was significantly and negatively associated with tumor-node metastasis (TNM) stages. Patients with low level of MICA/B expression showed a trend of shorter survival time. The unfolded protein response (UPR) downregulated the expression of MICA/B. This decreased protein expression occurred via post-transcriptional regulation and was associated with proteasomal degradation. Moreover, decreased expression level of MICA/B led to the attenuated sensitivity of human HCC to NK cell cytotoxicity. These new findings of the connection of MICA/B, UPR and NK cells may represent a new concrete theory of NK cell regulation in HCC, and suggest that targeting this novel NK cell-associated immune evasion pathway may be meaningful in treating patients with HCC.

  4. RNA-seq of the aging brain in the short-lived fish N. furzeri - conserved pathways and novel genes associated with neurogenesis.

    PubMed

    Baumgart, Mario; Groth, Marco; Priebe, Steffen; Savino, Aurora; Testa, Giovanna; Dix, Andreas; Ripa, Roberto; Spallotta, Francesco; Gaetano, Carlo; Ori, Michela; Terzibasi Tozzini, Eva; Guthke, Reinhard; Platzer, Matthias; Cellerino, Alessandro

    2014-12-01

    The brains of teleost fish show extensive adult neurogenesis and neuronal regeneration. The patterns of gene regulation during fish brain aging are unknown. The short-lived teleost fish Nothobranchius furzeri shows markers of brain aging including reduced learning performances, gliosis, and reduced adult neurogenesis. We used RNA-seq to quantify genome-wide transcript regulation and sampled five different time points to characterize whole-genome transcript regulation during brain aging of N. furzeri. Comparison with human datasets revealed conserved up-regulation of ribosome, lysosome, and complement activation and conserved down-regulation of synapse, mitochondrion, proteasome, and spliceosome. Down-regulated genes differ in their temporal profiles: neurogenesis and extracellular matrix genes showed rapid decay, synaptic and axonal genes a progressive decay. A substantial proportion of differentially expressed genes (~40%) showed inversion of their temporal profiles in the last time point: spliceosome and proteasome showed initial down-regulation and stress-response genes initial up-regulation. Extensive regulation was detected for chromatin remodelers of the DNMT and CBX families as well as members of the polycomb complex and was mirrored by an up-regulation of the H3K27me3 epigenetic mark. Network analysis showed extensive coregulation of cell cycle/DNA synthesis genes with the uncharacterized zinc-finger protein ZNF367 as central hub. In situ hybridization showed that ZNF367 is expressed in neuronal stem cell niches of both embryonic zebrafish and adult N. furzeri. Other genes down-regulated with age, not previously associated with adult neurogenesis and with similar patterns of expression are AGR2, DNMT3A, KRCP, MEX3A, SCML4, and CBX1. CBX7, on the other hand, was up-regulated with age. © 2014 The Authors. Aging cell published by the Anatomical Society and John Wiley & Sons Ltd.

  5. Hyperthyroidism differentially regulates neuropeptide S system in the rat brain.

    PubMed

    González, Carmen R; Martínez de Morentin, Pablo B; Martínez-Sánchez, Noelia; Gómez-Díaz, Consuelo; Lage, Ricardo; Varela, Luis; Diéguez, Carlos; Nogueiras, Rubén; Castaño, Justo P; López, Miguel

    2012-04-23

    Thyroid hormones play an important role in the regulation of energy balance, sleep and emotional behaviors. Neuropeptide S (NPS) is a recently discovered neuropeptide, regulating feeding, sleep and anxiety. Here, we examined the effect of hyperthyroidism on the gene and protein expression of neuropeptide S and its receptor (NPS-R) in the hypothalamus, brainstem and amygdala of rats. Our results showed that the expression of NPS and NPS-R was differentially modulated by hyperthyroidism in the rat brain. NPS and NPS-R mRNA and protein levels were decreased in the hypothalamus of hyperthyroid rats. Conversely NPS-R expression was highly increased in the brainstem and NPS and NPS-R expression were unchanged in the amygdala of these rats. These data suggest that changes in anxiety and food intake patterns observed in hyperthyroidism could be associated with changes in the expression of NPS and NPS-R. Thus, the NPS/NPS-R system may be involved in several hyperthyroidism-associated comorbidities. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Hepatic Leukemia Factor Promotes Resistance To Cell Death: Implications For Therapeutics and Chronotherapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Waters, Katrina M.; Sontag, Ryan L.; Weber, Thomas J.

    Physiological variation related to circadian rhythms and aberrant gene expression patterns are believed to modulate therapeutic efficacy, but the precise molecular determinants remain unclear. Here we examine the regulation of cell death by hepatic leukemia factor (HLF), which is an output regulator of circadian rhythms and is aberrantly expressed in human cancers, using an ectopic expression strategy in JB6 mouse epidermal cells and human keratinocytes. Ectopic HLF expression inhibited cell death in both JB6 cells and human keratinocytes, as induced by serum-starvation, tumor necrosis factor alpha and ionizing radiation. Microarray analysis indicates that HLF regulates a complex multi-gene transcriptional programmore » encompassing upregulation of anti-apoptotic genes, downregulation of pro-apoptotic genes, and many additional changes that are consistent with an anti-death program. Collectively, our results demonstrate that ectopic expression of HLF, an established transcription factor that cycles with circadian rhythms, can recapitulate many features associated with circadian-dependent physiological variation.« less

  7. Characterization of Cer-1 cis-regulatory region during early Xenopus development.

    PubMed

    Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

    2011-05-01

    Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

  8. Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

    PubMed Central

    Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

    2010-01-01

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

  9. Myh7b/miR-499 gene expression is transcriptionally regulated by MRFs and Eos

    PubMed Central

    Yeung, Fan; Chung, Eunhee; Guess, Martin G.; Bell, Matthew L.; Leinwand, Leslie A.

    2012-01-01

    The sarcomeric myosin gene, Myh7b, encodes an intronic microRNA, miR-499, which regulates cardiac and skeletal muscle biology, yet little is known about its transcriptional regulation. To identify the transcription factors involved in regulating Myh7b/miR-499 gene expression, we have mapped the transcriptional start sites and identified an upstream 6.2 kb region of the mouse Myh7b gene whose activity mimics the expression pattern of the endogenous Myh7b gene both in vitro and in vivo. Through promoter deletion analysis, we have mapped a distal E-box element and a proximal Ikaros site that are essential for Myh7b promoter activity in muscle cells. We show that the myogenic regulatory factors, MyoD, Myf5 and Myogenin, bind to the E-box, while a lymphoid transcription factor, Ikaros 4 (Eos), binds to the Ikaros motif. Further, we show that through physical interaction, MyoD and Eos form an active transcriptional complex on the chromatin to regulate the expression of the endogenous Myh7b/miR-499 gene in muscle cells. We also provide the first evidence that Eos can regulate expression of additional myosin genes (Myosin 1 and β-Myosin) via the miR-499/Sox6 pathway. Therefore, our results indicate a novel role for Eos in the regulation of the myofiber gene program. PMID:22638570

  10. A combinatorial code for pattern formation in Drosophila oogenesis.

    PubMed

    Yakoby, Nir; Bristow, Christopher A; Gong, Danielle; Schafer, Xenia; Lembong, Jessica; Zartman, Jeremiah J; Halfon, Marc S; Schüpbach, Trudi; Shvartsman, Stanislav Y

    2008-11-01

    Two-dimensional patterning of the follicular epithelium in Drosophila oogenesis is required for the formation of three-dimensional eggshell structures. Our analysis of a large number of published gene expression patterns in the follicle cells suggests that they follow a simple combinatorial code based on six spatial building blocks and the operations of union, difference, intersection, and addition. The building blocks are related to the distribution of inductive signals, provided by the highly conserved epidermal growth factor receptor and bone morphogenetic protein signaling pathways. We demonstrate the validity of the code by testing it against a set of patterns obtained in a large-scale transcriptional profiling experiment. Using the proposed code, we distinguish 36 distinct patterns for 81 genes expressed in the follicular epithelium and characterize their joint dynamics over four stages of oogenesis. The proposed combinatorial framework allows systematic analysis of the diversity and dynamics of two-dimensional transcriptional patterns and guides future studies of gene regulation.

  11. Proteomics analysis reveals a dynamic diurnal pattern of photosynthesis-related pathways in maize leaves.

    PubMed

    Feng, Dan; Wang, Yanwei; Lu, Tiegang; Zhang, Zhiguo; Han, Xiao

    2017-01-01

    Plant leaves exhibit differentiated patterns of photosynthesis rates under diurnal light regulation. Maize leaves show a single-peak pattern without photoinhibition at midday when the light intensity is maximized. This mechanism contributes to highly efficient photosynthesis in maize leaves. To understand the molecular basis of this process, an isobaric tag for relative and absolute quantitation (iTRAQ)-based proteomics analysis was performed to reveal the dynamic pattern of proteins related to photosynthetic reactions. Steady, single-peak and double-peak protein expression patterns were discovered in maize leaves, and antenna proteins in these leaves displayed a steady pattern. In contrast, the photosystem, carbon fixation and citrate pathways were highly controlled by diurnal light intensity. Most enzymes in the limiting steps of these pathways were major sites of regulation. Thus, maize leaves optimize photosynthesis and carbon fixation outside of light harvesting to adapt to the changes in diurnal light intensity at the protein level.

  12. Three Human Cell Types Respond to Multi-Walled Carbon Nanotubes and Titanium Dioxide Nanobelts with Cell-Specific Transcriptomic and Proteomic Expression Patterns.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tilton, Susan C.; Karin, Norman J.; Tolic, Ana

    2014-08-01

    The growing use of engineered nanoparticles (NPs) in commercial and medical applications raises the urgent need for tools that can predict NP toxicity. Global transcriptome and proteome analyses were conducted on three human cell types, exposed to two high aspect ratio NP types, to identify patterns of expression that might indicate high versus low NP toxicity. Three cell types representing the most common routes of human exposure to NPs, including macrophage-like (THP-1), small airway epithelial and intestinal (Caco-2/HT29-MTX) cells, were exposed to TiO2 nanobelts (TiO2-NB; high toxicity) and multi-walled carbon nanotubes (MWCNT; low toxicity) at low (10 µg/mL) and highmore » (100 µg/mL) concentrations for 1 and 24 h. Unique patterns of gene and protein expressions were identified for each cell type, with no differentially expressed (p < 0.05, 1.5-fold change) genes or proteins overlapping across all three cell types. While unique to each cell type, the early response was primarily independent of NP type, showing similar expression patterns in response to both TiO2-NB and MWCNT. The early response might, therefore, indicate a general response to insult. In contrast, the 24 h response was unique to each NP type. The most significantly (p < 0.05) enriched biological processes in THP-1 cells indicated TiO2-NB regulation of pathways associated with inflammation, apoptosis, cell cycle arrest, DNA replication stress and genomic instability, while MWCNT-regulated pathways indicated increased cell proliferation, DNA repair and anti-apoptosis. These two distinct sets of biological pathways might, therefore, underlie cellular responses to high and low NP toxicity, respectively.« less

  13. Exogenous plant hormones and cyclotide expression in Viola uliginosa (Violaceae).

    PubMed

    Slazak, Blazej; Jacobsson, Erik; Kuta, Elżbieta; Göransson, Ulf

    2015-09-01

    Plants from Violaceae produce cyclotides, peptides characterized by a circular peptide backbone and a cystine knot. This signature motif gives stability that can harness a wide spectrum of biological activities, with implications in plant defense and with applications in medicine and biotechnology. In the current work, cyclotide expressing in vitro cultures were established from Viola uliginosa. These cultures are useful models for studying biosynthesis of cyclotides and can also be used in their production. The cyclotide expression pattern is shown to be dependent on exogenous plant growth regulators, both on peptide and gene expression levels. The highest yields of cyclotides were obtained on media containing only a cytokinin and were correlated with storage material accumulation. Exposure to auxins decreased cyclotide production and caused shifting of the biosynthesis pattern to root specific cyclotides. The response to stimuli in terms of cyclotide expression pattern appears to be developmental, and related to polar auxin transportation and the auxin/cytokinin ratio regulating tissue differentiation. By the use of whole transcriptome shotgun sequencing (WTSS) and peptidomics, 20 cyclotide sequences from V. uliginosa (including 12 new) and 12 complete precursor proteins could be identified. The most abundant cyclotides were cycloviolacin O3 (CyO3), CyO8 and CyO13. A suspension culture was obtained that grew exponentially with a doubling time of approximately 3 days. After ten days of growth, the culture provided a yield of more than 4 mg CyO13 per gram dry mass. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. EXTRA-EMBRYONIC-SPECIFIC IMPRINTED EXPRESSION IS RESTRICTED TO DEFINED LINEAGES IN THE POST-IMPLANTATION EMBRYO

    PubMed Central

    Hudson, Quanah J.; Seidl, Christine I.M.; Kulinski, Tomasz M.; Huang, Ru; Warczok, Katarzyna E.; Bittner, Romana; Bartolomei, Marisa S.; Barlow, Denise P.

    2011-01-01

    A subset of imprinted genes in the mouse have been reported to show imprinted expression that is restricted to the placenta, a short-lived extra-embryonic organ. Notably these so-called 'placental-specific' imprinted genes are expressed from both parental alleles in embryo and adult tissues. The placenta is an embryonic-derived organ that is closely associated with maternal tissue and as a consequence, maternal contamination can be mistaken for maternal-specific imprinted expression. The complexity of the placenta, which arises from multiple embryonic lineages, poses additional problems in accurately assessing allele-specific repressive epigenetic modifications in genes that also show lineage-specific silencing in this organ. These problems require that extra evidence be obtained to support the imprinted status of genes whose imprinted expression is restricted to the placenta. We show here that the extra-embryonic visceral yolk sac (VYS), a nutritive membrane surrounding the developing embryo, shows a similar 'extra-embryonic-lineage-specific' pattern of imprinted expression. We present an improved enzymatic technique for separating the bilaminar VYS and show that this pattern of imprinted expression is restricted to the endoderm layer. Finally, we show that VYS 'extra-embryonic-lineage-specific' imprinted expression is regulated by DNA methylation in a similar manner as shown for genes showing multi-lineage imprinted expression in extra-embryonic, embryonic and adult tissues. These results show that the VYS is an improved model for studying the epigenetic mechanisms regulating extra-embryonic-lineage-specific imprinted expression. PMID:21354127

  15. Different gene expressions between cattle and yak provide insights into high-altitude adaptation.

    PubMed

    Wang, K; Yang, Y; Wang, L; Ma, T; Shang, H; Ding, L; Han, J; Qiu, Q

    2016-02-01

    DNA sequence variation has been widely reported as the genetic basis for adaptation, in both humans and other animals, to the hypoxic environment experienced at high altitudes. However, little is known about the patterns of gene expression underlying such hypoxic adaptations. In this study, we examined the differences in the transcriptomes of four organs (heart, kidney, liver and lung) between yak and cattle, a pair of closely related species distributed at high and low altitudes respectively. Of the four organs examined, heart shows the greatest differentiation between the two species in terms of gene expression profiles. Detailed analyses demonstrated that some genes associated with the oxygen supply system and the defense systems that respond to threats of hypoxia are differentially expressed. In addition, genes with significantly differentiated patterns of expression in all organs exhibited an unexpected uniformity of regulation along with an elevated frequency of nonsynonymous substitutions. This co-evolution of protein sequences and gene expression patterns is likely to be correlated with the optimization of the yak metabolic system to resist hypoxia. © 2015 Stichting International Foundation for Animal Genetics.

  16. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning.

    PubMed

    Albert, Nick W; Lewis, David H; Zhang, Huaibi; Schwinn, Kathy E; Jameson, Paula E; Davies, Kevin M

    2011-03-01

    We present an investigation of anthocyanin regulation over the entire petunia plant, determining the mechanisms governing complex floral pigmentation patterning and environmentally induced vegetative anthocyanin synthesis. DEEP PURPLE (DPL) and PURPLE HAZE (PHZ) encode members of the R2R3-MYB transcription factor family that regulate anthocyanin synthesis in petunia, and control anthocyanin production in vegetative tissues and contribute to floral pigmentation. In addition to these two MYB factors, the basic helix-loop-helix (bHLH) factor ANTHOCYANIN1 (AN1) and WD-repeat protein AN11, are also essential for vegetative pigmentation. The induction of anthocyanins in vegetative tissues by high light was tightly correlated to the induction of transcripts for PHZ and AN1. Interestingly, transcripts for PhMYB27, a putative R2R3-MYB active repressor, were highly expressed during non-inductive shade conditions and repressed during high light. The competitive inhibitor PhMYBx (R3-MYB) was expressed under high light, which may provide feedback repression. In floral tissues DPL regulates vein-associated anthocyanin pigmentation in the flower tube, while PHZ determines light-induced anthocyanin accumulation on exposed petal surfaces (bud-blush). A model is presented suggesting how complex floral and vegetative pigmentation patterns are derived in petunia in terms of MYB, bHLH and WDR co-regulators. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  17. CO2 induced seawater acidification impacts sea urchin larval development II: gene expression patterns in pluteus larvae.

    PubMed

    Stumpp, M; Dupont, S; Thorndyke, M C; Melzner, F

    2011-11-01

    Extensive use of fossil fuels is leading to increasing CO(2) concentrations in the atmosphere and causes changes in the carbonate chemistry of the oceans which represents a major sink for anthropogenic CO(2). As a result, the oceans' surface pH is expected to decrease by ca. 0.4 units by the year 2100, a major change with potentially negative consequences for some marine species. Because of their carbonate skeleton, sea urchins and their larval stages are regarded as likely to be one of the more sensitive taxa. In order to investigate sensitivity of pre-feeding (2 days post-fertilization) and feeding (4 and 7 days post-fertilization) pluteus larvae, we raised Strongylocentrotus purpuratus embryos in control (pH 8.1 and pCO(2) 41 Pa e.g. 399 μatm) and CO(2) acidified seawater with pH of 7.7 (pCO(2) 134 Pa e.g. 1318 μatm) and investigated growth, calcification and survival. At three time points (day 2, day 4 and day 7 post-fertilization), we measured the expression of 26 representative genes important for metabolism, calcification and ion regulation using RT-qPCR. After one week of development, we observed a significant difference in growth. Maximum differences in size were detected at day 4 (ca. 10% reduction in body length). A comparison of gene expression patterns using PCA and ANOSIM clearly distinguished between the different age groups (two-way ANOSIM: Global R=1) while acidification effects were less pronounced (Global R=0.518). Significant differences in gene expression patterns (ANOSIM R=0.938, SIMPER: 4.3% difference) were also detected at day 4 leading to the hypothesis that differences between CO(2) treatments could reflect patterns of expression seen in control experiments of a younger larva and thus a developmental artifact rather than a direct CO(2) effect. We found an up regulation of metabolic genes (between 10%and 20% in ATP-synthase, citrate synthase, pyruvate kinase and thiolase at day 4) and down regulation of calcification related genes (between 23% and 36% in msp130, SM30B, and SM50 at day 4). Ion regulation was mainly impacted by up regulation of Na(+)/K(+)-ATPase at day 4 (15%) and down regulation of NHE3 at day 4 (45%). We conclude that in studies in which a stressor induces an alteration in the speed of development, it is crucial to employ experimental designs with a high time resolution in order to correct for developmental artifacts. This helps prevent misinterpretation of stressor effects on organism physiology. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Prostacyclin synthase expression and epigenetic regulation in nonsmall cell lung cancer.

    PubMed

    Cathcart, Mary-Clare; Gray, Steven G; Baird, Anne-Marie; Boyle, Elaine; Gately, Kathy; Kay, Elaine; Cummins, Robert; Pidgeon, Graham P; O'Byrne, Kenneth J

    2011-11-15

    Prostacyclin synthase (PGIS) metabolizes prostaglandin H(2), into prostacyclin. This study aimed to determine the expression profile of PGIS in nonsmall cell lung cancer (NSCLC) and examine potential mechanisms involved in PGIS regulation. PGIS expression was examined in human NSCLC and matched controls by reverse transcriptase polymerase chain reaction (RT-PCR), Western analysis, and immunohistochemistry. A 204-patient NSCLC tissue microarray was stained for PGIS and cyclooxygenase 2 (COX2) expression. Staining intensity was correlated with clinical parameters. Epigenetic mechanisms underpinning PGIS promoter expression were examined using RT-PCR, methylation-specific PCR, and chromatin immunoprecipitation analysis. PGIS expression was reduced/absent in human NSCLC protein samples (P < .0001), but not mRNA relative to matched controls. PGIS tissue expression was higher in squamous cell carcinoma (P = .004) and in male patients (P < .05). No significant correlation of PGIS or COX2 expression with overall patient survival was observed, although COX2 was prognostic for short-term (2-year) survival (P < .001). PGIS mRNA expression was regulated by DNA CpG methylation and histone acetylation in NSCLC cell lines, with chromatin remodeling taking place directly at the PGIS gene. PGIS mRNA expression was increased by both demethylation agents and histone deacetylase inhibitors. Protein levels were unaffected by demethylation agents, whereas PGIS protein stability was negatively affected by histone deacetylase inhibitors. PGIS protein expression is reduced in NSCLC, and does not correlate with overall patient survival. PGIS expression is regulated through epigenetic mechanisms. Differences in expression patterns between mRNA and protein levels suggest that PGIS expression and protein stability are regulated post-translationally. PGIS protein stability may have an important therapeutic role in NSCLC. Copyright © 2011 American Cancer Society.

  19. The fitness cost of mis-splicing is the main determinant of alternative splicing patterns.

    PubMed

    Saudemont, Baptiste; Popa, Alexandra; Parmley, Joanna L; Rocher, Vincent; Blugeon, Corinne; Necsulea, Anamaria; Meyer, Eric; Duret, Laurent

    2017-10-30

    Most eukaryotic genes are subject to alternative splicing (AS), which may contribute to the production of protein variants or to the regulation of gene expression via nonsense-mediated messenger RNA (mRNA) decay (NMD). However, a fraction of splice variants might correspond to spurious transcripts and the question of the relative proportion of splicing errors to functional splice variants remains highly debated. We propose a test to quantify the fraction of AS events corresponding to errors. This test is based on the fact that the fitness cost of splicing errors increases with the number of introns in a gene and with expression level. We analyzed the transcriptome of the intron-rich eukaryote Paramecium tetraurelia. We show that in both normal and in NMD-deficient cells, AS rates strongly decrease with increasing expression level and with increasing number of introns. This relationship is observed for AS events that are detectable by NMD as well as for those that are not, which invalidates the hypothesis of a link with the regulation of gene expression. Our results show that in genes with a median expression level, 92-98% of observed splice variants correspond to errors. We observed the same patterns in human transcriptomes and we further show that AS rates correlate with the fitness cost of splicing errors. These observations indicate that genes under weaker selective pressure accumulate more maladaptive substitutions and are more prone to splicing errors. Thus, to a large extent, patterns of gene expression variants simply reflect the balance between selection, mutation, and drift.

  20. Hyperinnervation improves Xenopus laevis limb regeneration.

    PubMed

    Mitogawa, Kazumasa; Makanae, Aki; Satoh, Akira

    2018-01-15

    Xenopus laevis (an anuran amphibian) shows limb regeneration ability between that of urodele amphibians and that of amniotes. Xenopus frogs can initiate limb regeneration but fail to form patterned limbs. Regenerated limbs mainly consist of cone-shaped cartilage without any joints or branches. These pattern defects are thought to be caused by loss of proper expressions of patterning-related genes. This study shows that hyperinnervation surgery resulted in the induction of a branching regenerate. The hyperinnervated blastema allows the identification and functional analysis of the molecules controlling this patterning of limb regeneration. This paper focuses on the nerve affects to improve Xenopus limb patterning ability during regeneration. The nerve molecules, which regulate limb patterning, were also investigated. Blastemas grown in a hyperinnervated forelimb upregulate limb patterning-related genes (shh, lmx1b, and hoxa13). Nerves projecting their axons to limbs express some growth factors (bmp7, fgf2, fgf8, and shh). Inputs of these factors to a blastema upregulated some limb patterning-related genes and resulted in changes in the cartilage patterns in the regenerates. These results indicate that additional nerve factors enhance Xenopus limb patterning-related gene expressions and limb regeneration ability, and that bmp, fgf, and shh are candidate nerve substitute factors. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Expression of adhesion molecules and cytokeratin 20 in merkel cell carcinomas.

    PubMed

    Tanaka, Yasushi; Sano, Toshiaki; Qian, Zhi Rong; Hirokawa, Mitsuyoshi

    2004-01-01

    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine carcinoma of the skin. MCCs often show characteristic paranuclear dot-like immunopositivity for cytokeratin 20 (CK20), a globular aggregation of CK20 intermediate filaments. These aggregates typically form rhabdoid features and fibrous bodies and may be associated with a down-regulation in adhesion molecules (AMs). To date, the relationship between the expression of AMs and CK20 and clinicopathological findings in MCC has not been well examined. In this immunohistochemical study, we assessed the expression of AMs, CK20, and chromogranin A (CgA) on MCCs in 8 men and 23 women with this disease, and also characterized their clinicopathological features. This study is the largest of its kind that has been undertaken to date in Japanese patients. Compared to normal tissue, E-cadherin and alpha- and beta-catenins showed reduced membranous expression in 95.7%, 46.7%, and 45.2% of MCCs, respectively. Nuclear E-cadherin localization was seen in four tumors, all of which predominantly showed a CK20 dot pattern. However, there was no significant relationship between the membranous expression of AMs and a CK20 dot pattern. E-cadherin expression was significantly lower in tumors of > or =2 cm, and tumors negative for E-cadherin more frequently developed outside of the head and neck than within those regions. CgA was more intensely expressed in tumors with uniform nuclei and a dense lymphocytic infiltrate than in those that showed pleomorphisms and that had few, if any, infiltrating lymphocytes. These findings suggest that MCCs have a reduced expression of AMs and that down-regulation of E-cadherin expression may correlate with increased tumor aggressiveness. The fact that no significant relationship was demonstrable between the membranous expression of AMs and the CK20 expression pattern suggests that the mechanism of aggregation of intermediate filaments may be different in different types of tumors.

  2. Identification of a spatially specific enhancer element in the chicken Msx-2 gene that regulates its expression in the apical ectodermal ridge of the developing limb buds of transgenic mice.

    PubMed

    Sumoy, L; Wang, C K; Lichtler, A C; Pierro, L J; Kosher, R A; Upholt, W B

    1995-07-01

    Msx-2 is a member of the Msx family of homeobox-containing genes expressed in a variety of embryonic tissues involved in epithelial-mesenchymal interactions and pattern formation. In the developing chick limb bud, Msx-2 is expressed in the apical ectodermal ridge, which plays a crucial role in directing the growth and patterning of limb mesoderm. In addition, Msx-2 is expressed in the anterior nonskeletal-forming mesoderm of the limb bud, in the posterior necrotic zone, and in the interdigital mesenchyme. Studies of the altered expression patterns of Msx-2 in amelic and polydactylous mutant chick limbs have suggested that the apical ectodermal ridge and mesodermal domains of Msx-2 expression are independently regulated and that there might be separate cis-regulatory elements in the Msx-2 gene controlling its spatially distinct domains of expression. To test this hypothesis, we have isolated the chicken Msx-2 gene and have tested the ability of various regions of the gene to target expression of LacZ reporter gene to specific regions of the limbs of transgenic mice. A variety of these constructs are consistently expressed only in the apical ectodermal ridge and the ectoderm of the genital tubercle and are not expressed in the mesoderm of the limb bud or in other regions of the embryo where the endogenous Msx-2 gene is expressed. These results suggest the presence of spatially specific cis-regulatory elements in the Msx-2 gene. We identified a 348-bp region in the 5' flanking region of the Msx-2 gene which can act as an apical ectodermal ridge enhancer element when placed in reverse orientation in front of the reporter gene with transcription initiation directed by the minimal hsp68 promoter.

  3. Temporal and spatial expression patterns of Hedgehog receptors in the developing inner and middle ear.

    PubMed

    Shin, Jeong-Oh; Ankamreddy, Harinarayana; Jakka, Naga Mahesh; Lee, Seokwon; Kim, Un-Kyung; Bok, Jinwoong

    2017-01-01

    The mammalian inner ear is a complex organ responsible for balance and hearing. Sonic hedgehog (Shh), a member of the Hedgehog (Hh) family of secreted proteins, has been shown to play important roles in several aspects of inner ear development, including dorsoventral axial specification, cochlear elongation, tonotopic patterning, and hair cell differentiation. Hh proteins initiate a downstream signaling cascade by binding to the Patched 1 (Ptch1) receptor. Recent studies have revealed that other types of co-receptors can also mediate Hh signaling, including growth arrest-specific 1 (Gas1), cell-adhesion molecules-related/down-regulated by oncogenes (Cdon), and biregional Cdon binding protein (Boc). However, little is known about the role of these Hh co-receptors in inner ear development. In this study, we examined the expression patterns of Gas1, Cdon, and Boc, as well as that of Ptch1, in the developing mouse inner ear from otocyst (embryonic day (E) 9.5) until birth and in the developing middle ear at E15.5. Ptch1, a readout of Hh signaling, was expressed in a graded pattern in response to Shh signaling throughout development. Expression patterns of Gas1, Cdon, and Boc differed from that of Ptch1, and each Hh co-receptor was expressed in specific cells and domains in the developing inner and middle ear. These unique and differential expression patterns of Hh co-receptors suggest their roles in mediating various time- and space-specific functions of Shh during ear development.

  4. Transcriptome-Wide Changes in Chlamydomonas reinhardtii Gene Expression Regulated by Carbon Dioxide and the CO2-Concentrating Mechanism Regulator CIA5/CCM1[W][OA

    PubMed Central

    Fang, Wei; Si, Yaqing; Douglass, Stephen; Casero, David; Merchant, Sabeeha S.; Pellegrini, Matteo; Ladunga, Istvan; Liu, Peng; Spalding, Martin H.

    2012-01-01

    We used RNA sequencing to query the Chlamydomonas reinhardtii transcriptome for regulation by CO2 and by the transcription regulator CIA5 (CCM1). Both CO2 and CIA5 are known to play roles in acclimation to low CO2 and in induction of an essential CO2-concentrating mechanism (CCM), but less is known about their interaction and impact on the whole transcriptome. Our comparison of the transcriptome of a wild type versus a cia5 mutant strain under three different CO2 conditions, high CO2 (5%), low CO2 (0.03 to 0.05%), and very low CO2 (<0.02%), provided an entry into global changes in the gene expression patterns occurring in response to the interaction between CO2 and CIA5. We observed a massive impact of CIA5 and CO2 on the transcriptome, affecting almost 25% of all Chlamydomonas genes, and we discovered an array of gene clusters with distinctive expression patterns that provide insight into the regulatory interaction between CIA5 and CO2. Several individual clusters respond primarily to either CIA5 or CO2, providing access to genes regulated by one factor but decoupled from the other. Three distinct clusters clearly associated with CCM-related genes may represent a rich source of candidates for new CCM components, including a small cluster of genes encoding putative inorganic carbon transporters. PMID:22634760

  5. RNA-Seq Links the Transcription Factors AINTEGUMENTA and AINTEGUMENTA-LIKE6 to Cell Wall Remodeling and Plant Defense Pathways1[OPEN

    PubMed Central

    Bequette, Carlton J.; Fu, Zheng Qing; Loraine, Ann E.

    2016-01-01

    AINTEGUMENTA (ANT) and AINTEGUMENTA-LIKE6 (AIL6) are two related transcription factors in Arabidopsis (Arabidopsis thaliana) that have partially overlapping roles in several aspects of flower development, including floral organ initiation, identity specification, growth, and patterning. To better understand the biological processes regulated by these two transcription factors, we performed RNA sequencing (RNA-Seq) on ant ail6 double mutants. We identified thousands of genes that are differentially expressed in the double mutant compared with the wild type. Analyses of these genes suggest that ANT and AIL6 regulate floral organ initiation and growth through modifications to the cell wall polysaccharide pectin. We found reduced levels of demethylesterified homogalacturonan and altered patterns of auxin accumulation in early stages of ant ail6 flower development. The RNA-Seq experiment also revealed cross-regulation of AIL gene expression at the transcriptional level. The presence of a number of overrepresented Gene Ontology terms related to plant defense in the set of genes differentially expressed in ant ail6 suggest that ANT and AIL6 also regulate plant defense pathways. Furthermore, we found that ant ail6 plants have elevated levels of two defense hormones: salicylic acid and jasmonic acid, and show increased resistance to the bacterial pathogen Pseudomonas syringae. These results suggest that ANT and AIL6 regulate biological pathways that are critical for both development and defense. PMID:27208279

  6. Mapping gene expression patterns during myeloid differentiation using the EML hematopoietic progenitor cell line.

    PubMed

    Du, Yang; Campbell, Janee L; Nalbant, Demet; Youn, Hyewon; Bass, Ann C Hughes; Cobos, Everardo; Tsai, Schickwann; Keller, Jonathan R; Williams, Simon C

    2002-07-01

    The detailed examination of the molecular events that control the early stages of myeloid differentiation has been hampered by the relative scarcity of hematopoietic stem cells and the lack of suitable cell line models. In this study, we examined the expression of several myeloid and nonmyeloid genes in the murine EML hematopoietic stem cell line. Expression patterns for 19 different genes were examined by Northern blotting and RT-PCR in RNA samples from EML, a variety of other immortalized cell lines, and purified murine hematopoietic stem cells. Representational difference analysis (RDA) was performed to identify differentially expressed genes in EML. Expression patterns of genes encoding transcription factors (four members of the C/EBP family, GATA-1, GATA-2, PU.1, CBFbeta, SCL, and c-myb) in EML were examined and were consistent with the proposed functions of these proteins in hematopoietic differentiation. Expression levels of three markers of terminal myeloid differentiation (neutrophil elastase, proteinase 3, and Mac-1) were highest in EML cells at the later stages of differentiation. In a search for genes that were differentially expressed in EML cells during myeloid differentiation, six cDNAs were isolated. These included three known genes (lysozyme, histidine decarboxylase, and tryptophan hydroxylase) and three novel genes. Expression patterns of known genes in differentiating EML cells accurately reflected their expected expression patterns based on previous studies. The identification of three novel genes, two of which encode proteins that may act as regulators of hematopoietic differentiation, suggests that EML is a useful model system for the molecular analysis of hematopoietic differentiation.

  7. Novel R2R3-MYB transcription factors from Prunus Americana regulates differential patterns of anthocyanin accumulation in tobacco and citrus

    USDA-ARS?s Scientific Manuscript database

    The levels of anthocyanins in plants vary widely among cultivars, developmental stages and environmental stimuli. Previous studies have reported that the expression of various MYBs regulate anthocyanin pigmentation during growth and development. Here we examine the activity of three novel R2R3-MYB ...

  8. Novel R2R3-MYB transcription factors from Prunus americana regulate differential patterns of anthocyanin accumulation in tobacco and citrus

    USDA-ARS?s Scientific Manuscript database

    The level of anthocyanins in plants vary widely among cultivars, developmental stages and environmental stimuli. Previous studies have reported that the expression of various MYBs regulate anthocyanin pigmentation during growth and development. Here we examine the activity of three novel R2R3-MYB ...

  9. Sugar beet proteinase inhibitor (BvSTI) gene promoter is regulated by insects and wounding in transgenic Nicotiana benthamiana

    USDA-ARS?s Scientific Manuscript database

    A regulatory sequence from a serine proteinase inhibitor gene (BvSTIpro) shown to be up-regulated in resistant interactions with a root pest of sugar beet, the sugar beet root maggot, was fused to the ß-glucuronidase (GUS) reporter gene to characterize its expression patterns in transgenic Nicotiana...

  10. The spatiotemporal relationships between chondroitin sulfate proteoglycans and terminations of calcitonin gene related peptide and parvalbumin immunoreactive afferents in the spinal cord of mouse embryos.

    PubMed

    Wang, Liqing; Yu, Chao; Wang, Jun; Zhao, Hui; Chan, Sun-On

    2017-08-10

    Chondroitin sulfate (CS) proteoglycans (PGs) are a family of complex molecules in the extracellular matrix and cell surface that regulate axon growth and guidance during development of the central nervous system. In this study, the expression of CSPGs was investigated in the mouse spinal cord at late embryonic and neonatal stages using CS-56 antibody. CS immunoreactivity was observed abundantly in ventral regions of spinal cord of embryonic day (E) 15 embryos. At E16 to E18, CS expression spread dorsally, but never reached the superficial layers of the dorsal horn. This pattern was maintained until postnatal day 4, the latest stage examined. Antibodies against calcitonin gene related peptide (CGRP) and parvalbumin (PV) were employed to label primary afferents from nociceptors and proprioceptors, respectively. CGRP-immunoreactive fibers terminated in the superficial regions of the dorsal horn where CSPGs were weakly expressed, whereas PV-immunoreactive fibers were found in CSPG-rich regions in the ventral horn. Therefore, we conclude that CS expression is spatiotemporally regulated in the spinal cord, which correlates to the termination of sensory afferents. This pattern suggests a role of CSPGs on patterning afferents in the spinal cord, probably through a differential response of axons to these growth inhibitory molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. 17β-estradiol regulates the differentiation of cementoblasts via Notch signaling cascade

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liao, Jing; Zhou, Zeyuan; Huang, Li

    Estrogen has been well recognized as a key factor in the homeostasis of bone and periodontal tissue, but the way it regulates the activities of cementoblasts, the cell population maintaining cementum has not been fully understood. In this study, we examined the expression of estrogen receptor in OCCM-30 cells and the effect of 17β-estradiol (E2) on the proliferation and differentiation of OCCM-30 cells. We found that both estrogen receptor α and β were expressed in OCCM-30 cells. E2 exerted no significant influence on the proliferation of OCCM-30 cells, but inhibited the transcription and translation of BSP and Runx2 in the early phase of osteogenicmore » induction except the BSP mRNA. Afterwards in the late phase of osteogenic induction, E2 enhanced the transcription and translation of BSP and Runx2 and promoted the calcium deposition. In addition, the expression level of Notch1, NICD and Hey1 mRNAs responded to exogenous E2 in a pattern similar to that of the osteoblastic markers. DAPT could attenuate the effect of E2 on the expression of osteoblastic markers. These findings indicated that E2 might regulate the differentiation of cementoblasts via Notch signaling. - Highlights: • 17β-estradiol showed no significant effect on the proliferation of cementoblasts. • 17β-estradiol promoted the osteoblastic differentiation of cementoblasts despite of an early transient inhibition. • Notch signaling was regulated by 17β-estradiol and was responsible for mediating the effect of E2 on cementoblasts. • Hey1 might display an opposite expression pattern to Notch signaling in certain circumstances.« less

  12. Dynamic Organization of lncRNA and Circular RNA Regulators Collectively Controlled Cardiac Differentiation in Humans.

    PubMed

    Li, Yongsheng; Zhang, Jinwen; Huo, Caiqin; Ding, Na; Li, Junyi; Xiao, Jun; Lin, Xiaoyu; Cai, Benzhi; Zhang, Yunpeng; Xu, Juan

    2017-10-01

    Advances in developmental cardiology have increased our understanding of the early aspects of heart differentiation. However, understanding noncoding RNA (ncRNA) transcription and regulation during this process remains elusive. Here, we constructed transcriptomes for both long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) in four important developmental stages ranging from early embryonic to cardiomyocyte based on high-throughput sequencing datasets, which indicate the high stage-specific expression patterns of two ncRNA types. Additionally, higher similarities of samples within each stage were found, highlighting the divergence of samples collected from distinct cardiac developmental stages. Next, we developed a method to identify numerous lncRNA and circRNA regulators whose expression was significantly stage-specific and shifted gradually and continuously during heart differentiation. We inferred that these ncRNAs are important for the stages of cardiac differentiation. Moreover, transcriptional regulation analysis revealed that the expression of stage-specific lncRNAs is controlled by known key stage-specific transcription factors (TFs). In addition, circRNAs exhibited dynamic expression patterns independent from their host genes. Functional enrichment analysis revealed that lncRNAs and circRNAs play critical roles in pathways that are activated specifically during heart differentiation. We further identified candidate TF-ncRNA-gene network modules for each differentiation stage, suggesting the dynamic organization of lncRNAs and circRNAs collectively controlled cardiac differentiation, which may cause heart-related diseases when defective. Our study provides a foundation for understanding the dynamic regulation of ncRNA transcriptomes during heart differentiation and identifies the dynamic organization of novel key lncRNAs and circRNAs to collectively control cardiac differentiation. Copyright © 2017. Published by Elsevier B.V.

  13. TCL1A, a Novel Transcription Factor and a Coregulator of Nuclear Factor κB p65: Single Nucleotide Polymorphism and Estrogen Dependence.

    PubMed

    Ho, Ming-Fen; Lummertz da Rocha, Edroaldo; Zhang, Cheng; Ingle, James N; Goss, Paul E; Shepherd, Lois E; Kubo, Michiaki; Wang, Liewei; Li, Hu; Weinshilboum, Richard M

    2018-06-01

    T-cell leukemia 1A ( TCL1A ) single-nucleotide polymorphisms (SNPs) have been associated with aromatase inhibitor-induced musculoskeletal adverse events. We previously demonstrated that TCL1A is inducible by estradiol (E 2 ) and plays a critical role in the regulation of cytokines, chemokines, and Toll-like receptors in a TCL1A SNP genotype and estrogen-dependent fashion. Furthermore, TCLIA SNP-dependent expression phenotypes can be "reversed" by exposure to selective estrogen receptor modulators such as 4-hydroxytamoxifen (4OH-TAM). The present study was designed to comprehensively characterize the role of TCL1A in transcriptional regulation across the genome by performing RNA sequencing (RNA-seq) and chromatin immunoprecipitation sequencing (ChIP-seq) assays with lymphoblastoid cell lines. RNA-seq identified 357 genes that were regulated in a TCL1A SNP- and E 2 -dependent fashion with expression patterns that were 4OH-TAM reversible. ChIP-seq for the same cells identified 57 TCL1A binding sites that could be regulated by E 2 in a SNP-dependent fashion. Even more striking, nuclear factor- κ B (NF- κ B) p65 bound to those same DNA regions. In summary, TCL1A is a novel transcription factor with expression that is regulated in a SNP- and E 2 -dependent fashion-a pattern of expression that can be reversed by 4OH-TAM. Integrated RNA-seq and ChIP-seq results suggest that TCL1A also acts as a transcriptional coregulator with NF- κ B p65, an important immune system transcription factor. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

  14. The POU Transcription Factor Oct-1 Represses Virus-Induced Interferon A Gene Expression

    PubMed Central

    Mesplède, Thibault; Island, Marie-Laure; Christeff, Nicolas; Petek, Fahrettin; Doly, Janine; Navarro, Sébastien

    2005-01-01

    Alpha interferon (IFN-α) and IFN-β are able to interfere with viral infection. They exert a vast array of biologic functions, including growth arrest, cell differentiation, and immune system regulation. This regulation extends from innate immunity to cellular and humoral adaptive immune responses. A strict control of expression is needed to prevent detrimental effects of unregulated IFN. Multiple IFN-A subtypes are coordinately induced in human and mouse cells infected by virus and exhibit differences in expression of their individual mRNAs. We demonstrated that the weakly expressed IFN-A11 gene is negatively regulated after viral infection, due to a distal negative regulatory element, binding homeoprotein pituitary homeobox 1 (Pitx1). Here we show that the POU protein Oct-1 binds in vitro and in vivo to the IFN-A11 promoter and represses IFN-A expression upon interferon regulatory factor overexpression. Furthermore, we show that Oct-1-deficient MEFs exhibit increased in vivo IFN-A gene expression and increased antiviral activity. Finally, the IFN-A expression pattern is modified in Oct-1-deficient MEFs. The broad representation of effective and potent octamer-like sequences within IFN-A promoters suggests an important role for Oct-1 in IFN-A regulation. PMID:16166650

  15. Innate immunity phenotypic features point toward simultaneous raise of activation and modulation events following 17DD live attenuated yellow fever first-time vaccination.

    PubMed

    Martins, Marina Angela; Silva, Maria Luiza; Elói-Santos, Silvana Maria; Ribeiro, José Geraldo Leite; Peruhype-Magalhães, Vanessa; Marciano, Ana Paula Vieira; Homma, Akira; Kroon, Erna Geessien; Teixeira-Carvalho, Andréa; Martins-Filho, Olindo Assis

    2008-02-26

    Detailed multiparametric phenotypic investigation aiming to characterize the kinetics of the innate immune response in the peripheral blood following 17DD yellow fever (17DD-YF) first-time vaccination was performed. Results showed increased frequency of monocytes and NK cell subpopulations besides unexpected up-regulation of granulocytes activation status (CD28+/CD23+ and CD28+/HLA-DR+, respectively). Up-regulation of Fcgamma-R and IL-10-R expression emerge as putative events underlying the mixed pattern of phenotypic features triggered by the 17DD yellow fever (17DD-YF) vaccination. Mixed pattern of chemokine receptors expression further support our hypothesis that a parallel establishment of activation/modulation microenvironment plays a pivotal role in the protective immunity triggered by the 17DD-YF vaccine.

  16. Diametrical clustering for identifying anti-correlated gene clusters.

    PubMed

    Dhillon, Inderjit S; Marcotte, Edward M; Roshan, Usman

    2003-09-01

    Clustering genes based upon their expression patterns allows us to predict gene function. Most existing clustering algorithms cluster genes together when their expression patterns show high positive correlation. However, it has been observed that genes whose expression patterns are strongly anti-correlated can also be functionally similar. Biologically, this is not unintuitive-genes responding to the same stimuli, regardless of the nature of the response, are more likely to operate in the same pathways. We present a new diametrical clustering algorithm that explicitly identifies anti-correlated clusters of genes. Our algorithm proceeds by iteratively (i). re-partitioning the genes and (ii). computing the dominant singular vector of each gene cluster; each singular vector serving as the prototype of a 'diametric' cluster. We empirically show the effectiveness of the algorithm in identifying diametrical or anti-correlated clusters. Testing the algorithm on yeast cell cycle data, fibroblast gene expression data, and DNA microarray data from yeast mutants reveals that opposed cellular pathways can be discovered with this method. We present systems whose mRNA expression patterns, and likely their functions, oppose the yeast ribosome and proteosome, along with evidence for the inverse transcriptional regulation of a number of cellular systems.

  17. A novel approach for discovering condition-specific correlations of gene expressions within biological pathways by using cloud computing technology.

    PubMed

    Chang, Tzu-Hao; Wu, Shih-Lin; Wang, Wei-Jen; Horng, Jorng-Tzong; Chang, Cheng-Wei

    2014-01-01

    Microarrays are widely used to assess gene expressions. Most microarray studies focus primarily on identifying differential gene expressions between conditions (e.g., cancer versus normal cells), for discovering the major factors that cause diseases. Because previous studies have not identified the correlations of differential gene expression between conditions, crucial but abnormal regulations that cause diseases might have been disregarded. This paper proposes an approach for discovering the condition-specific correlations of gene expressions within biological pathways. Because analyzing gene expression correlations is time consuming, an Apache Hadoop cloud computing platform was implemented. Three microarray data sets of breast cancer were collected from the Gene Expression Omnibus, and pathway information from the Kyoto Encyclopedia of Genes and Genomes was applied for discovering meaningful biological correlations. The results showed that adopting the Hadoop platform considerably decreased the computation time. Several correlations of differential gene expressions were discovered between the relapse and nonrelapse breast cancer samples, and most of them were involved in cancer regulation and cancer-related pathways. The results showed that breast cancer recurrence might be highly associated with the abnormal regulations of these gene pairs, rather than with their individual expression levels. The proposed method was computationally efficient and reliable, and stable results were obtained when different data sets were used. The proposed method is effective in identifying meaningful biological regulation patterns between conditions.

  18. Expression analysis of G Protein-Coupled Receptors in mouse macrophages

    PubMed Central

    Lattin, Jane E; Schroder, Kate; Su, Andrew I; Walker, John R; Zhang, Jie; Wiltshire, Tim; Saijo, Kaoru; Glass, Christopher K; Hume, David A; Kellie, Stuart; Sweet, Matthew J

    2008-01-01

    Background Monocytes and macrophages express an extensive repertoire of G Protein-Coupled Receptors (GPCRs) that regulate inflammation and immunity. In this study we performed a systematic micro-array analysis of GPCR expression in primary mouse macrophages to identify family members that are either enriched in macrophages compared to a panel of other cell types, or are regulated by an inflammatory stimulus, the bacterial product lipopolysaccharide (LPS). Results Several members of the P2RY family had striking expression patterns in macrophages; P2ry6 mRNA was essentially expressed in a macrophage-specific fashion, whilst P2ry1 and P2ry5 mRNA levels were strongly down-regulated by LPS. Expression of several other GPCRs was either restricted to macrophages (e.g. Gpr84) or to both macrophages and neural tissues (e.g. P2ry12, Gpr85). The GPCR repertoire expressed by bone marrow-derived macrophages and thioglycollate-elicited peritoneal macrophages had some commonality, but there were also several GPCRs preferentially expressed by either cell population. Conclusion The constitutive or regulated expression in macrophages of several GPCRs identified in this study has not previously been described. Future studies on such GPCRs and their agonists are likely to provide important insights into macrophage biology, as well as novel inflammatory pathways that could be future targets for drug discovery. PMID:18442421

  19. RILES, a novel method for temporal analysis of the in vivo regulation of miRNA expression

    PubMed Central

    Ezzine, Safia; Vassaux, Georges; Pitard, Bruno; Barteau, Benoit; Malinge, Jean-Marc; Midoux, Patrick; Pichon, Chantal; Baril, Patrick

    2013-01-01

    Novel methods are required to investigate the complexity of microRNA (miRNA) biology and particularly their dynamic regulation under physiopathological conditions. Herein, a novel plasmid-based RNAi-Inducible Luciferase Expression System (RILES) was engineered to monitor the activity of endogenous RNAi machinery. When RILES is transfected in a target cell, the miRNA of interest suppresses the expression of a transcriptional repressor and consequently switch-ON the expression of the luciferase reporter gene. Hence, miRNA expression in cells is signed by the emission of bioluminescence signals that can be monitored using standard bioluminescence equipment. We validated this approach by monitoring in mice the expression of myomiRs-133, −206 and −1 in skeletal muscles and miRNA-122 in liver. Bioluminescence experiments demonstrated robust qualitative and quantitative data that correlate with the miRNA expression pattern detected by quantitative RT-PCR (qPCR). We further demonstrated that the regulation of miRNA-206 expression during the development of muscular atrophy is individual-dependent, time-regulated and more complex than the information generated by qPCR. As RILES is simple and versatile, we believe that this methodology will contribute to a better understanding of miRNA biology and could serve as a rationale for the development of a novel generation of regulatable gene expression systems with potential therapeutic applications. PMID:24013565

  20. RILES, a novel method for temporal analysis of the in vivo regulation of miRNA expression.

    PubMed

    Ezzine, Safia; Vassaux, Georges; Pitard, Bruno; Barteau, Benoit; Malinge, Jean-Marc; Midoux, Patrick; Pichon, Chantal; Baril, Patrick

    2013-11-01

    Novel methods are required to investigate the complexity of microRNA (miRNA) biology and particularly their dynamic regulation under physiopathological conditions. Herein, a novel plasmid-based RNAi-Inducible Luciferase Expression System (RILES) was engineered to monitor the activity of endogenous RNAi machinery. When RILES is transfected in a target cell, the miRNA of interest suppresses the expression of a transcriptional repressor and consequently switch-ON the expression of the luciferase reporter gene. Hence, miRNA expression in cells is signed by the emission of bioluminescence signals that can be monitored using standard bioluminescence equipment. We validated this approach by monitoring in mice the expression of myomiRs-133, -206 and -1 in skeletal muscles and miRNA-122 in liver. Bioluminescence experiments demonstrated robust qualitative and quantitative data that correlate with the miRNA expression pattern detected by quantitative RT-PCR (qPCR). We further demonstrated that the regulation of miRNA-206 expression during the development of muscular atrophy is individual-dependent, time-regulated and more complex than the information generated by qPCR. As RILES is simple and versatile, we believe that this methodology will contribute to a better understanding of miRNA biology and could serve as a rationale for the development of a novel generation of regulatable gene expression systems with potential therapeutic applications.

  1. A Hox Gene, Antennapedia, Regulates Expression of Multiple Major Silk Protein Genes in the Silkworm Bombyx mori*

    PubMed Central

    Tsubota, Takuya; Tomita, Shuichiro; Uchino, Keiro; Kimoto, Mai; Takiya, Shigeharu; Kajiwara, Hideyuki; Yamazaki, Toshimasa; Sezutsu, Hideki

    2016-01-01

    Hox genes play a pivotal role in the determination of anteroposterior axis specificity during bilaterian animal development. They do so by acting as a master control and regulating the expression of genes important for development. Recently, however, we showed that Hox genes can also function in terminally differentiated tissue of the lepidopteran Bombyx mori. In this species, Antennapedia (Antp) regulates expression of sericin-1, a major silk protein gene, in the silk gland. Here, we investigated whether Antp can regulate expression of multiple genes in this tissue. By means of proteomic, RT-PCR, and in situ hybridization analyses, we demonstrate that misexpression of Antp in the posterior silk gland induced ectopic expression of major silk protein genes such as sericin-3, fhxh4, and fhxh5. These genes are normally expressed specifically in the middle silk gland as is Antp. Therefore, the evidence strongly suggests that Antp activates these silk protein genes in the middle silk gland. The putative sericin-1 activator complex (middle silk gland-intermolt-specific complex) can bind to the upstream regions of these genes, suggesting that Antp directly activates their expression. We also found that the pattern of gene expression was well conserved between B. mori and the wild species Bombyx mandarina, indicating that the gene regulation mechanism identified here is an evolutionarily conserved mechanism and not an artifact of the domestication of B. mori. We suggest that Hox genes have a role as a master control in terminally differentiated tissues, possibly acting as a primary regulator for a range of physiological processes. PMID:26814126

  2. miR-152 regulated glioma cell proliferation and apoptosis via Runx2 mediated by DNMT1.

    PubMed

    Zhang, Peng; Sun, Hongwei; Yang, Bo; Luo, Wenzheng; Liu, Zengjin; Wang, Junkuan; Zuo, Yuchao

    2017-08-01

    Aberrant DNA methylation is associated with tumor onset and progression. Study has verified that the DNA methylation of miR-152 was mediated in many tumors, but whether it involved in glioblastomas was still unclear. This study enrolled 20 patients with glioma to analyze the expression pattern of miR-152. Real-time PCR and western blot were used to detect the mRNA or protein expression level, respectively. The relationship between miR-152 and runx2 was detected by Luciferase reporter assay. The methylation level of miR-152 was determined by methylation-specific PCR. Cell proliferation and apoptosis were detected by MTT and Annexin-FITC/PI assay. The expression of miR-152 was down-regulated while the expression of DNMT1 was up-regulated in both glioma tissue and cell lines. MiR-152 was hypermethylated and its expression was negatively correlated with DNMT in glioma cell lines. DNMT1 knockdown promoted the expression of miR-152, however, DNMT1 overexpression suppressed the expression of miR-152. MiR-152 overexpression promoted glioma cell apoptosis while miR-152 knockdown promoted cell proliferation. MiR-152 targets Runx2 to regulate its expression, Runx2 overexpression abolished the effects of miR-152 overexpression. MiR-152 regulated cell proliferation and apoptosis of glioma mediated by Runx2, while the mechanism of down regulated miR-152 in glioma tissues and cells was its hypermethylation. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  3. Lymphatic function is regulated by a coordinated expression of lymphangiogenic and anti-lymphangiogenic cytokines

    PubMed Central

    Zampell, Jamie C.; Avraham, Tomer; Yoder, Nicole; Fort, Nicholas; Yan, Alan; Weitman, Evan S.

    2012-01-01

    Lymphangiogenic cytokines such as vascular endothelial growth factor-C (VEGF-C) are critically required for lymphatic regeneration; however, in some circumstances, lymphatic function is impaired despite normal or elevated levels of these cytokines. The recent identification of anti-lymphangiogenic molecules such as interferon-γ (IFN-γ), transforming growth factor-β1, and endostatin has led us to hypothesize that impaired lymphatic function may represent a dysregulated balance in the expression of pro/anti-lymphangiogenic stimuli. We observed that nude mice have significantly improved lymphatic function compared with wild-type mice in a tail model of lymphedema. We show that gradients of lymphatic fluid stasis regulate the expression of lymphangiogenic cytokines (VEGF-A, VEGF-C, and hepatocyte growth factor) and that paradoxically the expression of these molecules is increased in wild-type mice. More importantly, we show that as a consequence of T-cell-mediated inflammation, these same gradients also regulate expression patterns of anti-lymphangiogenic molecules corresponding temporally and spatially with impaired lymphatic function in wild-type mice. We show that neutralization of IFN-γ significantly increases inflammatory lymph node lymphangiogenesis independently of changes in VEGF-A or VEGF-C expression, suggesting that alterations in the balance of pro- and anti-lymphangiogenic cytokine expression can regulate lymphatic vessel formation. In conclusion, we show that gradients of lymphatic fluid stasis regulate not only the expression of pro-lymphangiogenic cytokines but also potent suppressors of lymphangiogenesis as a consequence of T-cell inflammation and that modulation of the balance between these stimuli can regulate lymphatic function. PMID:21940662

  4. A Hox Gene, Antennapedia, Regulates Expression of Multiple Major Silk Protein Genes in the Silkworm Bombyx mori.

    PubMed

    Tsubota, Takuya; Tomita, Shuichiro; Uchino, Keiro; Kimoto, Mai; Takiya, Shigeharu; Kajiwara, Hideyuki; Yamazaki, Toshimasa; Sezutsu, Hideki

    2016-03-25

    Hoxgenes play a pivotal role in the determination of anteroposterior axis specificity during bilaterian animal development. They do so by acting as a master control and regulating the expression of genes important for development. Recently, however, we showed that Hoxgenes can also function in terminally differentiated tissue of the lepidopteranBombyx mori In this species,Antennapedia(Antp) regulates expression of sericin-1, a major silk protein gene, in the silk gland. Here, we investigated whether Antpcan regulate expression of multiple genes in this tissue. By means of proteomic, RT-PCR, and in situ hybridization analyses, we demonstrate that misexpression of Antpin the posterior silk gland induced ectopic expression of major silk protein genes such assericin-3,fhxh4, and fhxh5 These genes are normally expressed specifically in the middle silk gland as is Antp Therefore, the evidence strongly suggests that Antpactivates these silk protein genes in the middle silk gland. The putativesericin-1 activator complex (middle silk gland-intermolt-specific complex) can bind to the upstream regions of these genes, suggesting that Antpdirectly activates their expression. We also found that the pattern of gene expression was well conserved between B. moriand the wild species Bombyx mandarina, indicating that the gene regulation mechanism identified here is an evolutionarily conserved mechanism and not an artifact of the domestication of B. mori We suggest that Hoxgenes have a role as a master control in terminally differentiated tissues, possibly acting as a primary regulator for a range of physiological processes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Circadian gene expression regulates pulsatile gonadotropin-releasing hormone (GnRH) secretory patterns in the hypothalamic GnRH-secreting GT1-7 cell line.

    PubMed

    Chappell, Patrick E; White, Rachel S; Mellon, Pamela L

    2003-12-03

    Although it has long been established that episodic secretion of gonadotropin-releasing hormone (GnRH) from the hypothalamus is required for normal gonadotropin release, the molecular and cellular mechanisms underlying the synchronous release of GnRH are primarily unknown. We used the GT1-7 mouse hypothalamic cell line as a model for GnRH secretion, because these cells release GnRH in a pulsatile pattern similar to that observed in vivo. To explore possible molecular mechanisms governing secretory timing, we investigated the role of the molecular circadian clock in regulation of GnRH secretion. GT1-7 cells express many known core circadian clock genes, and we demonstrate that oscillations of these components can be induced by stimuli such as serum and the adenylyl cyclase activator forskolin, similar to effects observed in fibroblasts. Strikingly, perturbation of circadian clock function in GT1-7 cells by transient expression of the dominant-negative Clock-Delta19 gene disrupts normal ultradian patterns of GnRH secretion, significantly decreasing mean pulse frequency. Additionally, overexpression of the negative limb clock gene mCry1 in GT1-7 cells substantially increases GnRH pulse amplitude without a commensurate change in pulse frequency, demonstrating that an endogenous biological clock is coupled to the mechanism of neurosecretion in these cells and can regulate multiple secretory parameters. Finally, mice harboring a somatic mutation in the Clock gene are subfertile and exhibit a substantial increase in estrous cycle duration as revealed by examination of vaginal cytology. This effect persists in normal light/dark (LD) cycles, suggesting that a suprachiasmatic nucleus-independent endogenous clock in GnRH neurons is required for eliciting normal pulsatile patterns of GnRH secretion.

  6. Circadian Clock Gene Expression in the Coral Favia fragum over Diel and Lunar Reproductive Cycles

    PubMed Central

    Hoadley, Kenneth D.; Szmant, Alina M.; Pyott, Sonja J.

    2011-01-01

    Natural light cycles synchronize behavioral and physiological cycles over varying time periods in both plants and animals. Many scleractinian corals exhibit diel cycles of polyp expansion and contraction entrained by diel sunlight patterns, and monthly cycles of spawning or planulation that correspond to lunar moonlight cycles. The molecular mechanisms for regulating such cycles are poorly understood. In this study, we identified four molecular clock genes (cry1, cry2, clock and cycle) in the scleractinian coral, Favia fragum, and investigated patterns of gene expression hypothesized to be involved in the corals' diel polyp behavior and lunar reproductive cycles. Using quantitative PCR, we measured fluctuations in expression of these clock genes over both diel and monthly spawning timeframes. Additionally, we assayed gene expression and polyp expansion-contraction behavior in experimental corals in normal light:dark (control) or constant dark treatments. Well-defined and reproducible diel patterns in cry1, cry2, and clock expression were observed in both field-collected and the experimental colonies maintained under control light:dark conditions, but no pattern was observed for cycle. Colonies in the control light:dark treatment also displayed diel rhythms of tentacle expansion and contraction. Experimental colonies in the constant dark treatment lost diel patterns in cry1, cry2, and clock expression and displayed a diminished and less synchronous pattern of tentacle expansion and contraction. We observed no pattern in cry1, cry2, clock, or cycle expression correlated with monthly spawning events suggesting these genes are not involved in the entrainment of reproductive cycles to lunar light cycles in F. fragum. Our results suggest a molecular clock mechanism, potentially similar to that in described in fruit flies, exists within F. fragum. PMID:21573070

  7. The expression of miR-125b regulates angiogenesis during the recovery of heat-denatured HUVECs.

    PubMed

    Zhou, Situo; Zhang, Pihong; Liang, Pengfei; Huang, Xiaoyuan

    2015-06-01

    In previous studies we found that miR-125b was down-regulated in denatured dermis of deep partial thickness burn patients. Moreover, miR-125b inhibited tumor-angiogenesis associated with the decrease of ERBB2 and VEGF expression in ovarian cancer cells and breast cancer cells, etc. In this study, we investigated the expression patterns and roles of miR-125b during the recovery of denatured dermis and heat-denatured human umbilical vein endothelial cells (HUVECs). Deep partial thickness burns in Sprague-Dawley rats and the heat-denatured cells (52°C, 35 s) were used for analysis. Western blot analysis and real-time PCR were applied to evaluate the expression of miR-125b and ERBB2 and VEGF. The ability of angiogenesis in heat-denatured HUVECs was analyzed by scratch wound healing and tube formation assay after pri-miR-125b or anti-miR-125b transfection. miR-125b expression was time-dependent during the recovery of heat-denatured dermis and HUVECs. Moreover, miR-125b regulated ERBB2 mRNA and Protein Expression and regulated angiogenesis association with regulating the expression of VEGF in heat-denatured HUVECs. Taken together our results show that the expression of miR-125b is time-dependent and miR-125b plays a regulatory role of angiogenesis during wound healing after burns. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  8. Circadian clock gene LATE ELONGATED HYPOCOTYL directly regulates the timing of floral scent emission in Petunia

    PubMed Central

    Fenske, Myles P.; Hewett Hazelton, Kristen D.; Hempton, Andrew K.; Shim, Jae Sung; Yamamoto, Breanne M.; Riffell, Jeffrey A.; Imaizumi, Takato

    2015-01-01

    Flowers present a complex display of signals to attract pollinators, including the emission of floral volatiles. Volatile emission is highly regulated, and many species restrict emissions to specific times of the day. This rhythmic emission of scent is regulated by the circadian clock; however, the mechanisms have remained unknown. In Petunia hybrida, volatile emissions are dominated by products of the floral volatile benzenoid/phenylpropanoid (FVBP) metabolic pathway. Here we demonstrate that the circadian clock gene P. hybrida LATE ELONGATED HYPOCOTYL (LHY; PhLHY) regulates the daily expression patterns of the FVBP pathway genes and floral volatile production. PhLHY expression peaks in the morning, antiphasic to the expression of P. hybrida GIGANTEA (PhGI), the master scent regulator ODORANT1 (ODO1), and many other evening-expressed FVBP genes. Overexpression phenotypes of PhLHY in Arabidopsis caused an arrhythmic clock phenotype, which resembles those of LHY overexpressors. In Petunia, constitutive expression of PhLHY depressed the expression levels of PhGI, ODO1, evening-expressed FVBP pathway genes, and FVBP emission in flowers. Additionally, in the Petunia lines in which PhLHY expression was reduced, the timing of peak expression of PhGI, ODO1, and the FVBP pathway genes advanced to the morning. Moreover, PhLHY protein binds to cis-regulatory elements called evening elements that exist in promoters of ODO1 and other FVBP genes. Thus, our results imply that PhLHY directly sets the timing of floral volatile emission by restricting the expression of ODO1 and other FVBP genes to the evening in Petunia. PMID:26124104

  9. Circadian clock gene LATE ELONGATED HYPOCOTYL directly regulates the timing of floral scent emission in Petunia.

    PubMed

    Fenske, Myles P; Hewett Hazelton, Kristen D; Hempton, Andrew K; Shim, Jae Sung; Yamamoto, Breanne M; Riffell, Jeffrey A; Imaizumi, Takato

    2015-08-04

    Flowers present a complex display of signals to attract pollinators, including the emission of floral volatiles. Volatile emission is highly regulated, and many species restrict emissions to specific times of the day. This rhythmic emission of scent is regulated by the circadian clock; however, the mechanisms have remained unknown. In Petunia hybrida, volatile emissions are dominated by products of the floral volatile benzenoid/phenylpropanoid (FVBP) metabolic pathway. Here we demonstrate that the circadian clock gene P. hybrida LATE ELONGATED HYPOCOTYL (LHY; PhLHY) regulates the daily expression patterns of the FVBP pathway genes and floral volatile production. PhLHY expression peaks in the morning, antiphasic to the expression of P. hybrida GIGANTEA (PhGI), the master scent regulator ODORANT1 (ODO1), and many other evening-expressed FVBP genes. Overexpression phenotypes of PhLHY in Arabidopsis caused an arrhythmic clock phenotype, which resembles those of LHY overexpressors. In Petunia, constitutive expression of PhLHY depressed the expression levels of PhGI, ODO1, evening-expressed FVBP pathway genes, and FVBP emission in flowers. Additionally, in the Petunia lines in which PhLHY expression was reduced, the timing of peak expression of PhGI, ODO1, and the FVBP pathway genes advanced to the morning. Moreover, PhLHY protein binds to cis-regulatory elements called evening elements that exist in promoters of ODO1 and other FVBP genes. Thus, our results imply that PhLHY directly sets the timing of floral volatile emission by restricting the expression of ODO1 and other FVBP genes to the evening in Petunia.

  10. Identification of a functionally distinct truncated BDNF mRNA splice variant and protein in Trachemys scripta elegans.

    PubMed

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Li, Wei; Keifer, Joyce

    2013-01-01

    Brain-derived neurotrophic factor (BDNF) has a diverse functional role and complex pattern of gene expression. Alternative splicing of mRNA transcripts leads to further diversity of mRNAs and protein isoforms. Here, we describe the regulation of BDNF mRNA transcripts in an in vitro model of eyeblink classical conditioning and a unique transcript that forms a functionally distinct truncated BDNF protein isoform. Nine different mRNA transcripts from the BDNF gene of the pond turtle Trachemys scripta elegans (tBDNF) are selectively regulated during classical conditioning: exon I mRNA transcripts show no change, exon II transcripts are downregulated, while exon III transcripts are upregulated. One unique transcript that codes from exon II, tBDNF2a, contains a 40 base pair deletion in the protein coding exon that generates a truncated tBDNF protein. The truncated transcript and protein are expressed in the naïve untrained state and are fully repressed during conditioning when full-length mature tBDNF is expressed, thereby having an alternate pattern of expression in conditioning. Truncated BDNF is not restricted to turtles as a truncated mRNA splice variant has been described for the human BDNF gene. Further studies are required to determine the ubiquity of truncated BDNF alternative splice variants across species and the mechanisms of regulation and function of this newly recognized BDNF protein.

  11. Identification of a Functionally Distinct Truncated BDNF mRNA Splice Variant and Protein in Trachemys scripta elegans

    PubMed Central

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Li, Wei; Keifer, Joyce

    2013-01-01

    Brain-derived neurotrophic factor (BDNF) has a diverse functional role and complex pattern of gene expression. Alternative splicing of mRNA transcripts leads to further diversity of mRNAs and protein isoforms. Here, we describe the regulation of BDNF mRNA transcripts in an in vitro model of eyeblink classical conditioning and a unique transcript that forms a functionally distinct truncated BDNF protein isoform. Nine different mRNA transcripts from the BDNF gene of the pond turtle Trachemys scripta elegans (tBDNF) are selectively regulated during classical conditioning: exon I mRNA transcripts show no change, exon II transcripts are downregulated, while exon III transcripts are upregulated. One unique transcript that codes from exon II, tBDNF2a, contains a 40 base pair deletion in the protein coding exon that generates a truncated tBDNF protein. The truncated transcript and protein are expressed in the naïve untrained state and are fully repressed during conditioning when full-length mature tBDNF is expressed, thereby having an alternate pattern of expression in conditioning. Truncated BDNF is not restricted to turtles as a truncated mRNA splice variant has been described for the human BDNF gene. Further studies are required to determine the ubiquity of truncated BDNF alternative splice variants across species and the mechanisms of regulation and function of this newly recognized BDNF protein. PMID:23825634

  12. Proteomic analysis of fibroblastema formation in regenerating hind limbs of Xenopus laevis froglets and comparison to axolotl

    PubMed Central

    2014-01-01

    Background To gain insight into what differences might restrict the capacity for limb regeneration in Xenopus froglets, we used High Performance Liquid Chromatography (HPLC)/double mass spectrometry to characterize protein expression during fibroblastema formation in the amputated froglet hindlimb, and compared the results to those obtained previously for blastema formation in the axolotl limb. Results Comparison of the Xenopus fibroblastema and axolotl blastema revealed several similarities and significant differences in proteomic profiles. The most significant similarity was the strong parallel down regulation of muscle proteins and enzymes involved in carbohydrate metabolism. Regenerating Xenopus limbs differed significantly from axolotl regenerating limbs in several ways: deficiency in the inositol phosphate/diacylglycerol signaling pathway, down regulation of Wnt signaling, up regulation of extracellular matrix (ECM) proteins and proteins involved in chondrocyte differentiation, lack of expression of a key cell cycle protein, ecotropic viral integration site 5 (EVI5), that blocks mitosis in the axolotl, and the expression of several patterning proteins not seen in the axolotl that may dorsalize the fibroblastema. Conclusions We have characterized global protein expression during fibroblastema formation after amputation of the Xenopus froglet hindlimb and identified several differences that lead to signaling deficiency, failure to retard mitosis, premature chondrocyte differentiation, and failure of dorsoventral axial asymmetry. These differences point to possible interventions to improve blastema formation and pattern formation in the froglet limb. PMID:25063185

  13. Expression of ABA Metabolism-Related Genes Suggests Similarities and Differences Between Seed Dormancy and Bud Dormancy of Peach (Prunus persica)

    PubMed Central

    Wang, Dongling; Gao, Zhenzhen; Du, Peiyong; Xiao, Wei; Tan, Qiuping; Chen, Xiude; Li, Ling; Gao, Dongsheng

    2016-01-01

    Dormancy inhibits seed and bud growth of perennial plants until the environmental conditions are optimal for survival. Previous studies indicated that certain co-regulation pathways exist in seed and bud dormancy. In our study, we found that seed and bud dormancy are similar to some extent but show different reactions to chemical treatments that induce breaking of dormancy. Whether the abscisic acid (ABA) regulatory networks are similar in dormant peach seeds and buds is not well known; however, ABA is generally believed to play a critical role in seed and bud dormancy. In peach, some genes putatively involved in ABA synthesis and catabolism were identified and their expression patterns were studied to learn more about ABA homeostasis and the possible crosstalk between bud dormancy and seed dormancy mechanisms. The analysis demonstrated that two 9-cis-epoxycarotenoid dioxygenase-encoding genes seem to be key in regulating ABA biosynthesis to induce seed and bud dormancy. Three CYP707As play an overlapping role in controlling ABA inactivation, resulting in dormancy-release. In addition, Transcript analysis of ABA metabolism-related genes was much similar demonstrated that ABA pathways was similar in the regulation of vegetative and flower bud dormancy, whereas, expression patterns of ABA metabolism-related genes were different in seed dormancy showed that ABA pathway maybe different in regulating seed dormancy in peach. PMID:26793222

  14. Parathyroid hormone-dependent signaling pathways regulating genes in bone cells

    NASA Technical Reports Server (NTRS)

    Swarthout, John T.; D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Partridge, Nicola C.

    2002-01-01

    Parathyroid hormone (PTH) is an 84-amino-acid polypeptide hormone functioning as a major mediator of bone remodeling and as an essential regulator of calcium homeostasis. PTH and PTH-related protein (PTHrP) indirectly activate osteoclasts resulting in increased bone resorption. During this process, PTH changes the phenotype of the osteoblast from a cell involved in bone formation to one directing bone resorption. In addition to these catabolic effects, PTH has been demonstrated to be an anabolic factor in skeletal tissue and in vitro. As a result, PTH has potential medical application to the treatment of osteoporosis, since intermittent administration of PTH stimulates bone formation. Activation of osteoblasts by PTH results in expression of genes important for the degradation of the extracellular matrix, production of growth factors, and stimulation and recruitment of osteoclasts. The ability of PTH to drive changes in gene expression is dependent upon activation of transcription factors such as the activator protein-1 family, RUNX2, and cAMP response element binding protein (CREB). Much of the regulation of these processes by PTH is protein kinase A (PKA)-dependent. However, while PKA is linked to many of the changes in gene expression directed by PTH, PKA activation has been shown to inhibit mitogen-activated protein kinase (MAPK) and proliferation of osteoblasts. It is now known that stimulation of MAPK and proliferation by PTH at low concentrations is protein kinase C (PKC)-dependent in both osteoblastic and kidney cells. Furthermore, PTH has been demonstrated to regulate components of the cell cycle. However, whether this regulation requires PKC and/or extracellular signal-regulated kinases or whether PTH is able to stimulate other components of the cell cycle is unknown. It is possible that stimulation of this signaling pathway by PTH mediates a unique pattern of gene expression resulting in proliferation in osteoblastic and kidney cells; however, specific examples of this are still unknown. This review will focus on what is known about PTH-mediated cell signaling, and discuss the established or putative PTH-regulated pattern of gene expression in osteoblastic cells following treatment with catabolic (high) or anabolic (low) concentrations of the hormone.

  15. Complex and extensive post-transcriptional regulation revealed by integrative proteomic and transcriptomic analysis of metabolite stress response in Clostridium acetobutylicum.

    PubMed

    Venkataramanan, Keerthi P; Min, Lie; Hou, Shuyu; Jones, Shawn W; Ralston, Matthew T; Lee, Kelvin H; Papoutsakis, E Terry

    2015-01-01

    Clostridium acetobutylicum is a model organism for both clostridial biology and solvent production. The organism is exposed to its own toxic metabolites butyrate and butanol, which trigger an adaptive stress response. Integrative analysis of proteomic and RNAseq data may provide novel insights into post-transcriptional regulation. The identified iTRAQ-based quantitative stress proteome is made up of 616 proteins with a 15 % genome coverage. The differentially expressed proteome correlated poorly with the corresponding differential RNAseq transcriptome. Up to 31 % of the differentially expressed proteins under stress displayed patterns opposite to those of the transcriptome, thus suggesting significant post-transcriptional regulation. The differential proteome of the translation machinery suggests that cells employ a different subset of ribosomal proteins under stress. Several highly upregulated proteins but with low mRNA levels possessed mRNAs with long 5'UTRs and strong RBS scores, thus supporting the argument that regulatory elements on the long 5'UTRs control their translation. For example, the oxidative stress response rubrerythrin was upregulated only at the protein level up to 40-fold without significant mRNA changes. We also identified many leaderless transcripts, several displaying different transcriptional start sites, thus suggesting mRNA-trimming mechanisms under stress. Downregulation of Rho and partner proteins pointed to changes in transcriptional elongation and termination under stress. The integrative proteomic-transcriptomic analysis demonstrated complex expression patterns of a large fraction of the proteome. Such patterns could not have been detected with one or the other omic analyses. Our analysis proposes the involvement of specific molecular mechanisms of post-transcriptional regulation to explain the observed complex stress response.

  16. Major recent and independent changes in levels and patterns of expression have occurred at the b gene, a regulatory locus in maize.

    PubMed

    Selinger, D A; Chandler, V L

    1999-12-21

    The b locus encodes a transcription factor that regulates the expression of genes that produce purple anthocyanin pigment. Different b alleles are expressed in distinct tissues, causing tissue-specific anthocyanin production. Understanding how phenotypic diversity is produced and maintained at the b locus should provide models for how other regulatory genes, including those that influence morphological traits and development, evolve. We have investigated how different levels and patterns of pigmentation have evolved by determining the phenotypic and evolutionary relationships between 18 alleles that represent the diversity of b alleles in Zea mays. Although most of these alleles have few phenotypic differences, five alleles have very distinct tissue-specific patterns of pigmentation. Superimposing the phenotypes on the molecular phylogeny reveals that the alleles with strong and distinctive patterns of expression are closely related to alleles with weak expression, implying that the distinctive patterns have arisen recently. We have identified apparent insertions in three of the five phenotypically distinct alleles, and the fourth has unique upstream restriction fragment length polymorphisms relative to closely related alleles. The insertion in B-Peru has been shown to be responsible for its unique expression and, in the other two alleles, the presence of the insertion correlates with the phenotype. These results suggest that major changes in gene expression are probably the result of large-scale changes in DNA sequence and/or structure most likely mediated by transposable elements.

  17. Comparative interrogation of the developing xylem transcriptomes of two wood-forming species: Populus trichocarpa and Eucalyptus grandis.

    PubMed

    Hefer, Charles A; Mizrachi, Eshchar; Myburg, Alexander A; Douglas, Carl J; Mansfield, Shawn D

    2015-06-01

    Wood formation is a complex developmental process governed by genetic and environmental stimuli. Populus and Eucalyptus are fast-growing, high-yielding tree genera that represent ecologically and economically important species suitable for generating significant lignocellulosic biomass. Comparative analysis of the developing xylem and leaf transcriptomes of Populus trichocarpa and Eucalyptus grandis together with phylogenetic analyses identified clusters of homologous genes preferentially expressed during xylem formation in both species. A conserved set of 336 single gene pairs showed highly similar xylem preferential expression patterns, as well as evidence of high functional constraint. Individual members of multi-gene orthologous clusters known to be involved in secondary cell wall biosynthesis also showed conserved xylem expression profiles. However, species-specific expression as well as opposite (xylem versus leaf) expression patterns observed for a subset of genes suggest subtle differences in the transcriptional regulation important for xylem development in each species. Using sequence similarity and gene expression status, we identified functional homologs likely to be involved in xylem developmental and biosynthetic processes in Populus and Eucalyptus. Our study suggests that, while genes involved in secondary cell wall biosynthesis show high levels of gene expression conservation, differential regulation of some xylem development genes may give rise to unique xylem properties. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  18. Pod-1/Capsulin shows a sex- and stage-dependent expression pattern in the mouse gonad development and represses expression of Ad4BP/SF-1.

    PubMed

    Tamura, M; Kanno, Y; Chuma, S; Saito, T; Nakatsuji, N

    2001-04-01

    Mammalian sex-determination and differentiation are controlled by several genes, such as Sry, Sox-9, Dax-1 and Mullerian inhibiting substance (MIS), but their upstream and downstream genes are largely unknown. Ad4BP/SF-1, encoding a zinc finger transcription factor, plays important roles in gonadogenesis. Disruption of this gene caused disappearance of the urogenital system including the gonad. Ad4BP/SF-1, however, is also involved in the sex differentiation of the gonad at later stages, such as the regulation of steroid hormones and MIS. Pod-1/Capsulin, a member of basic helix-loop-helix transcription factors, is expressed in a pattern closely related but mostly complimentary to that of the Ad4BP/SF-1 expression in the developing gonad. In the co-transfection experiment using cultured cells, overexpression of Pod-1/Capsulin repressed expression of a reporter gene that carried the upstream regulatory region of the Ad4BP/SF-1 gene. Furthermore, forced expression of Pod-1/Capsulin repressed expression of Ad4BP/SF-1 in the Leydig cell-derived I-10 cells. These results suggest that Pod-1/Capsulin may play important roles in the development and sex differentiation of the mammalian gonad via transcriptional regulation of Ad4BP/SF-1.

  19. Identification of Regulatory Elements That Control PPARγ Expression in Adipocyte Progenitors

    PubMed Central

    Chou, Wen-Ling; Galmozzi, Andrea; Partida, David; Kwan, Kevin; Yeung, Hui; Su, Andrew I.; Saez, Enrique

    2013-01-01

    Adipose tissue renewal and obesity-driven expansion of fat cell number are dependent on proliferation and differentiation of adipose progenitors that reside in the vasculature that develops in coordination with adipose depots. The transcriptional events that regulate commitment of progenitors to the adipose lineage are poorly understood. Because expression of the nuclear receptor PPARγ defines the adipose lineage, isolation of elements that control PPARγ expression in adipose precursors may lead to discovery of transcriptional regulators of early adipocyte determination. Here, we describe the identification and validation in transgenic mice of 5 highly conserved non-coding sequences from the PPARγ locus that can drive expression of a reporter gene in a manner that recapitulates the tissue-specific pattern of PPARγ expression. Surprisingly, these 5 elements appear to control PPARγ expression in adipocyte precursors that are associated with the vasculature of adipose depots, but not in mature adipocytes. Characterization of these five PPARγ regulatory sequences may enable isolation of the transcription factors that bind these cis elements and provide insight into the molecular regulation of adipose tissue expansion in normal and pathological states. PMID:24009687

  20. Altered Cytokine Gene Expression in Peripheral Blood Monocytes across the Menstrual Cycle in Primary Dysmenorrhea: A Case-Control Study

    PubMed Central

    Ma, Hongyue; Hong, Min; Duan, Jinao; Liu, Pei; Fan, Xinsheng; Shang, Erxin; Su, Shulan; Guo, Jianming; Qian, Dawei; Tang, Yuping

    2013-01-01

    Primary dysmenorrhea is one of the most common gynecological complaints in young women, but potential peripheral immunologic features underlying this condition remain undefined. In this paper, we compared 84 common cytokine gene expression profiles of peripheral blood mononuclear cells (PBMCs) from six primary dysmenorrheic young women and three unaffected controls on the seventh day before (secretory phase), and the first (menstrual phase) and the fifth (regenerative phase) days of menstruation, using a real-time PCR array assay combined with pattern recognition and gene function annotation methods. Comparisons between dysmenorrhea and normal control groups identified 11 (nine increased and two decreased), 14 (five increased and nine decreased), and 15 (seven increased and eight decreased) genes with ≥2-fold difference in expression (P<0.05) in the three phases of menstruation, respectively. In the menstrual phase, genes encoding pro-inflammatory cytokines (IL1B, TNF, IL6, and IL8) were up-regulated, and genes encoding TGF-β superfamily members (BMP4, BMP6, GDF5, GDF11, LEFTY2, NODAL, and MSTN) were down-regulated. Functional annotation revealed an excessive inflammatory response and insufficient TGF-β superfamily member signals with anti-inflammatory consequences, which may directly contribute to menstrual pain. In the secretory and regenerative phases, increased expression of pro-inflammatory cytokines and decreased expression of growth factors were also observed. These factors may be involved in the regulation of decidualization, endometrium breakdown and repair, and indirectly exacerbate primary dysmenorrhea. This first study of cytokine gene expression profiles in PBMCs from young primary dysmenorrheic women demonstrates a shift in the balance between expression patterns of pro-inflammatory cytokines and TGF-β superfamily members across the whole menstrual cycle, underlying the peripheral immunologic features of primary dysmenorrhea. PMID:23390521

  1. Nonclassical Regulation of Transcription: Interchromosomal Interactions at the Malic enzyme Locus of Drosophila melanogaster

    PubMed Central

    Lum, Thomas E.; Merritt, Thomas J. S.

    2011-01-01

    Regulation of transcription can be a complex process in which many cis- and trans-interactions determine the final pattern of expression. Among these interactions are trans-interactions mediated by the pairing of homologous chromosomes. These trans-effects are wide ranging, affecting gene regulation in many species and creating complex possibilities in gene regulation. Here we describe a novel case of trans-interaction between alleles of the Malic enzyme (Men) locus in Drosophila melanogaster that results in allele-specific, non-additive gene expression. Using both empirical biochemical and predictive bioinformatic approaches, we show that the regulatory elements of one allele are capable of interacting in trans with, and modifying the expression of, the second allele. Furthermore, we show that nonlocal factors—different genetic backgrounds—are capable of significant interactions with individual Men alleles, suggesting that these trans-effects can be modified by both locally and distantly acting elements. In sum, these results emphasize the complexity of gene regulation and the need to understand both small- and large-scale interactions as more complete models of the role of trans-interactions in gene regulation are developed. PMID:21900270

  2. Deep sequencing of the Mexican avocado transcriptome, an ancient angiosperm with a high content of fatty acids.

    PubMed

    Ibarra-Laclette, Enrique; Méndez-Bravo, Alfonso; Pérez-Torres, Claudia Anahí; Albert, Victor A; Mockaitis, Keithanne; Kilaru, Aruna; López-Gómez, Rodolfo; Cervantes-Luevano, Jacob Israel; Herrera-Estrella, Luis

    2015-08-13

    Avocado (Persea americana) is an economically important tropical fruit considered to be a good source of fatty acids. Despite its importance, the molecular and cellular characterization of biochemical and developmental processes in avocado is limited due to the lack of transcriptome and genomic information. The transcriptomes of seeds, roots, stems, leaves, aerial buds and flowers were determined using different sequencing platforms. Additionally, the transcriptomes of three different stages of fruit ripening (pre-climacteric, climacteric and post-climacteric) were also analyzed. The analysis of the RNAseqatlas presented here reveals strong differences in gene expression patterns between different organs, especially between root and flower, but also reveals similarities among the gene expression patterns in other organs, such as stem, leaves and aerial buds (vegetative organs) or seed and fruit (storage organs). Important regulators, functional categories, and differentially expressed genes involved in avocado fruit ripening were identified. Additionally, to demonstrate the utility of the avocado gene expression atlas, we investigated the expression patterns of genes implicated in fatty acid metabolism and fruit ripening. A description of transcriptomic changes occurring during fruit ripening was obtained in Mexican avocado, contributing to a dynamic view of the expression patterns of genes involved in fatty acid biosynthesis and the fruit ripening process.

  3. Pleiotropic function of DLX3 in amelogenesis: from regulating pH and keratin expression to controlling enamel rod decussation.

    PubMed

    Duverger, Olivier; Morasso, Maria I

    2018-12-01

    DLX3 is essential for tooth enamel development and is so far the only transcription factor known to be mutated in a syndromic form of amelogenesis imperfecta. Through conditional deletion of Dlx3 in the dental epithelium in mouse, we have previously established the involvement of DLX3 in enamel pH regulation, as well as in controlling the expression of sets of keratins that contribute to enamel rod sheath formation. Here, we show that the decussation pattern of enamel rods was lost in conditional knockout animals, suggesting that DLX3 controls the coordinated migration of ameloblasts during enamel secretion. We further demonstrate that DLX3 regulates the expression of some components of myosin II complexes potentially involved in driving the movement of ameloblasts that leads to enamel rod decussation.

  4. Expression of the Fanconi anemia group A gene (Fanca) during mouse embryogenesis.

    PubMed

    Abu-Issa, R; Eichele, G; Youssoufian, H

    1999-07-15

    About 80% of all cases of Fanconi anemia (FA) can be accounted for by complementation groups A and C. To understand the relationship between these groups, we analyzed the expression pattern of the mouse FA group-A gene (Fanca) during embryogenesis and compared it with the known pattern of the group-C gene (Fancc). Northern analysis of RNA from mouse embryos at embryonic days 7, 11, 15, and 17 showed a predominant 4.5 kb band in all stages. By in situ hybridization, Fanca transcripts were found in the whisker follicles, teeth, brain, retina, kidney, liver, and limbs. There was also stage-specific variation in Fanca expression, particularly within the developing whiskers and the brain. Some tissues known to express Fancc (eg, gut) failed to show Fanca expression. These observations show that (1) Fanca is under both tissue- and stage-specific regulation in several tissues; (2) the expression pattern of Fanca is consistent with the phenotype of the human disease; and (3) Fanca expression is not necessarily coupled to that of Fancc. The presence of distinct tissue targets for FA genes suggests that some of the variability in the clinical phenotype can be attributed to the complementation group assignment.

  5. Hedgehog participates in the establishment of left-right asymmetry during amphioxus development by controlling Cerberus expression.

    PubMed

    Hu, Guangwei; Li, Guang; Wang, Hui; Wang, Yiquan

    2017-12-15

    Correct patterning of left-right (LR) asymmetry is essential during the embryonic development of bilaterians. Hedgehog (Hh) signaling is known to play a role in LR asymmetry development of mouse, chicken and sea urchin embryos by regulating Nodal expression. In this study, we report a novel regulatory mechanism for Hh in LR asymmetry development of amphioxus embryos. Our results revealed that Hh -/- embryos abolish Cerberus ( Cer ) transcription, with bilaterally symmetric expression of Nodal , Lefty and Pitx In consequence, Hh -/- mutants duplicated left-side structures and lost right-side characters, displaying an abnormal bilaterally symmetric body plan. These LR defects in morphology and gene expression could be rescued by Hh mRNA injection. Our results indicate that Hh participates in amphioxus LR patterning by controlling Cer gene expression. Curiously, however, upregulation of Hh signaling failed to alter the Cer expression pattern or LR morphology in amphioxus embryos, indicating that Hh might not provide an asymmetric cue for Cer expression. In addition, Hh is required for mouth opening in amphioxus, hinting at a homologous relationship between amphioxus and vertebrate mouth development. © 2017. Published by The Company of Biologists Ltd.

  6. Optomotor-Blind Negatively Regulates Drosophila Eye Development by Blocking Jak/STAT Signaling

    PubMed Central

    Tsai, Yu-Chen; Grimm, Stefan; Chao, Ju-Lan; Wang, Shih-Chin; Hofmeyer, Kerstin; Shen, Jie; Eichinger, Fred; Michalopoulou, Theoni; Yao, Chi-Kuang; Chang, Chih-Hsuan; Lin, Shih-Han; Sun, Y. Henry; Pflugfelder, Gert O.

    2015-01-01

    Organ formation requires a delicate balance of positive and negative regulators. In Drosophila eye development, wingless (wg) is expressed at the lateral margins of the eye disc and serves to block retinal development. The T-box gene optomotor-blind (omb) is expressed in a similar pattern and is regulated by Wg. Omb mediates part of Wg activity in blocking eye development. Omb exerts its function primarily by blocking cell proliferation. These effects occur predominantly in the ventral margin. Our results suggest that the primary effect of Omb is the blocking of Jak/STAT signaling by repressing transcription of upd which encodes the Jak receptor ligand Unpaired. PMID:25781970

  7. Characterization of the transcriptome profiles related to globin gene switching during in vitro erythroid maturation

    PubMed Central

    2012-01-01

    Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2 genes where expression was up-regulated over 28 days in culture. IPA for the 2,437 genes with > 1.5-fold induction identified the mitotic roles of polo-like kinase, aryl hydrocarbon receptor, cell cycle control, and ATM (Ataxia Telangiectasia Mutated Protein) signaling pathways; transcription factors identified included KLF1, GATA1 and NFE2 among others. Finally, profile-3 was generated from 1,579 genes with maximal expression at day 21, around the time of the γ/β-globin switch. IPA identified associations with cell cycle control, ATM, and aryl hydrocarbon receptor signaling pathways. Conclusions The transcriptome analysis completed with erythroid progenitors grown in vitro identified groups of genes with distinct expression profiles, which function in metabolic pathways associated with cell survival, hematopoiesis, blood cells activation, and inflammatory responses. This study represents the first report of a transcriptome analysis in human primary erythroid progenitors to identify transcription factors involved in hemoglobin switching. Our results also demonstrate that the in vitro liquid culture system is an excellent model to define mechanisms of global gene expression and the DNA-binding protein and signaling pathways involved in globin gene regulation. PMID:22537182

  8. The stem cell factor (SCF)/c-KIT system in carcinogenesis of reproductive tissues: What does the hormonal regulation tell us?

    PubMed

    Figueira, Marília I; Cardoso, Henrique J; Correia, Sara; Maia, Cláudio J; Socorro, Sílvia

    2017-10-01

    The tyrosine kinase receptor c-KIT and its ligand, the stem cell factor (SCF) are expressed in several tissues of male and female reproductive tract, playing an important role in the regulation of basic biological processes. The activation of c-KIT by SCF controls, cell survival and death, cell differentiation and migration. Also, the SCF/c-KIT system has been implicated in carcinogenesis of reproductive tissues due to its altered expression pattern or overactivation in consequence of gain-of-functions mutations. Over the years, it has also been shown that hormones, the primary regulators of reproductive function and causative agents in the case of hormone-dependent cancers, are also able to control the SCF/c-KIT tissue levels. Therefore, it is liable to suppose that disturbed SCF/c-KIT expression driven by (de)regulated hormone actions can be a relevant step towards carcinogenesis. The present review describes the SCF and c-KIT expression in cancers of reproductive tissues, discussing the implications of the hormonal regulation of the SCF/c-KIT system in cancer development. Understanding the relationship between hormonal imbalance and the SCF/c-KIT expression and activity would be relevant in the context of novel therapeutic approaches in reproductive cancers. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Gene expression patterns in four brain areas associate with quantitative measure of estrous behavior in dairy cows.

    PubMed

    Kommadath, Arun; Woelders, Henri; Beerda, Bonne; Mulder, Herman A; de Wit, Agnes A C; Veerkamp, Roel F; te Pas, Marinus F W; Smits, Mari A

    2011-04-19

    The decline noticed in several fertility traits of dairy cattle over the past few decades is of major concern. Understanding of the genomic factors underlying fertility, which could have potential applications to improve fertility, is very limited. Here, we aimed to identify and study those genes that associated with a key fertility trait namely estrous behavior, among genes expressed in four bovine brain areas (hippocampus, amygdala, dorsal hypothalamus and ventral hypothalamus), either at the start of estrous cycle, or at mid cycle, or regardless of the phase of cycle. An average heat score was calculated for each of 28 primiparous cows in which estrous behavior was recorded for at least two consecutive estrous cycles starting from 30 days post-partum. Gene expression was then measured in brain tissue samples collected from these cows, 14 of which were sacrificed at the start of estrus and 14 around mid cycle. For each brain area, gene expression was modeled as a function of the orthogonally transformed average heat score values using a Bayesian hierarchical mixed model. Genes whose expression patterns showed significant linear or quadratic relationships with heat scores were identified. These included genes expected to be related to estrous behavior as they influence states like socio-sexual behavior, anxiety, stress and feeding motivation (OXT, AVP, POMC, MCHR1), but also genes whose association with estrous behavior is novel and warrants further investigation. Several genes were identified whose expression levels in the bovine brain associated with the level of expression of estrous behavior. The genes OXT and AVP play major roles in regulating estrous behavior in dairy cows. Genes related to neurotransmission and neuronal plasticity are also involved in estrous regulation, with several genes and processes expressed in mid-cycle probably contributing to proper expression of estrous behavior in the next estrus. Studying these genes and the processes they control improves our understanding of the genomic regulation of estrous behavior expression.

  10. Cardiac-specific expression and hypertrophic upregulation of the feline Na(+)-Ca(2+) exchanger gene H1-promoter in a transgenic mouse model.

    PubMed

    Müller, Joachim G; Isomatsu, Yukihisa; Koushik, Srinagesh V; O'Quinn, Michael; Xu, Lin; Kappler, Christiana S; Hapke, Elizabeth; Zile, Michael R; Conway, Simon J; Menick, Donald R

    2002-02-08

    The NCX1 gene contains three promoters (H1, K1, and Br1), and as a result of alternative promoter usage and alternative splicing, there are multiple tissue-specific variants of the Na(+)-Ca(2+) exchanger. We have proposed that for NCX1, the H1 promoter regulates expression in the heart, the K1 promoter regulates expression in the kidney, and the Br1 promoter regulates expression in the brain as well as low-level ubiquitous expression. Here, using a transgenic mouse model, we test the role of the DNA region including -1831 to 67 bp of intron 1, encompassing exon H1 of the feline NCX1 gene (NCX1H1). The NCX1H1 promoter was sufficient for driving the normal spatiotemporal pattern of NCX1 expression in cardiac development. The luciferase reporter gene was expressed in a heart-restricted pattern both in early embryos (embryonic days 8 to 14) and in later embryos (after embryonic day 14), when NCX1 is also expressed in other tissues. In the adult, no luciferase activity was detected in the kidney, liver, spleen, uterus, or skeletal muscle; minimal activity was detected in the brain; and very high levels of luciferase expression were detected in the heart. Transverse aortic constriction-operated mice showed significantly increased left ventricular mass after 7 days. In addition, there was a 2-fold upregulation of NCX1H1 promoter activity in the left ventricle in animals after 7 days of pressure overload compared with both control and sham-operated animals. This work demonstrates that the NCX1H1 promoter directs cardiac-specific expression of the exchanger in both the embryo and adult and is also sufficient for the upregulation of NCX1 in response to pressure overload.

  11. Factors Regulating Vagal Sensory Development: Potential Role in Obesities of Developmental Origin

    PubMed Central

    Fox, Edward A.; Murphy, Michelle C.

    2008-01-01

    Contributors to increased obesity in children may include perinatal under- or overnutrition. Humans and rodents raised under these conditions develop obesity, which like obesities of other etiologies has been associated with increased meal size. Since vagal sensory innervation of the gastrointestinal (GI) tract transmits satiation signals that regulate meal size, one mechanism through which abnormal perinatal nutrition could increase meal size is by altering vagal development, possibly by causing changes in the expression of factors that control it. Therefore, we have begun to characterize development of vagal innervation of the GI tract and the expression patterns and functions of the genes involved in this process. Important events in development of mouse vagal GI innervation occurred between midgestation and the second postnatal week, suggesting they could be vulnerable to effects of abnormal nutrition preor postnatally. One gene investigated was brain- derived neurotrophic factor (BDNF), which regulates survival of a subpopulation of vagal sensory neurons. BDNF was expressed in some developing stomach wall tissues innervated by vagal afferents. At birth, mice deficient in BDNF exhibited a 50% reduction of putative intraganglionic laminar ending mechanoreceptor precursors, and a 50% increase in axons that had exited fiber bundles. Additionally, BDNF was required for patterning of individual axons and fiber bundles in the antrum and differentiation of intramuscular array mechanoreceptors in the forestomach. It will be important to determine whether abnormal perinatal environments alter development of vagal sensory innervation of the GI tract, involving effects on expression of BDNF, or other factors regulating vagal development. PMID:18234244

  12. Sex-lethal enables germline stem cell differentiation by down-regulating Nanos protein levels during Drosophila oogenesis

    PubMed Central

    Chau, Johnnie; Kulnane, Laura Shapiro; Salz, Helen K.

    2012-01-01

    Drosophila ovarian germ cells require Sex-lethal (Sxl) to exit from the stem cell state and to enter the differentiation pathway. Sxl encodes a female-specific RNA binding protein and in somatic cells serves as the developmental switch gene for somatic sex determination and X-chromosome dosage compensation. None of the known Sxl target genes are required for germline differentiation, leaving open the question of how Sxl promotes the transition from stem cell to committed daughter cell. We address the mechanism by which Sxl regulates this transition through the identification of nanos as one of its target genes. Previous studies have shown that Nanos protein is necessary for GSC self-renewal and is rapidly down-regulated in the daughter cells fated to differentiate in the adult ovary. We find that this dynamic expression pattern is limited to female germ cells and is under Sxl control. In the absence of Sxl, or in male germ cells, Nanos protein is continuously expressed. Furthermore, this female-specific expression pattern is dependent on the presence of canonical Sxl binding sites located in the nanos 3′ untranslated region. These results, combined with the observation that nanos RNA associates with the Sxl protein in ovarian extracts and loss and gain of function studies, suggest that Sxl enables the switch from germline stem cell to committed daughter cell by posttranscriptional down-regulation of nanos expression. These findings connect sexual identity to the stem cell self-renewal/differentiation decision and highlight the importance of posttranscriptional gene regulatory networks in controlling stem cell behavior. PMID:22645327

  13. Sex-lethal enables germline stem cell differentiation by down-regulating Nanos protein levels during Drosophila oogenesis.

    PubMed

    Chau, Johnnie; Kulnane, Laura Shapiro; Salz, Helen K

    2012-06-12

    Drosophila ovarian germ cells require Sex-lethal (Sxl) to exit from the stem cell state and to enter the differentiation pathway. Sxl encodes a female-specific RNA binding protein and in somatic cells serves as the developmental switch gene for somatic sex determination and X-chromosome dosage compensation. None of the known Sxl target genes are required for germline differentiation, leaving open the question of how Sxl promotes the transition from stem cell to committed daughter cell. We address the mechanism by which Sxl regulates this transition through the identification of nanos as one of its target genes. Previous studies have shown that Nanos protein is necessary for GSC self-renewal and is rapidly down-regulated in the daughter cells fated to differentiate in the adult ovary. We find that this dynamic expression pattern is limited to female germ cells and is under Sxl control. In the absence of Sxl, or in male germ cells, Nanos protein is continuously expressed. Furthermore, this female-specific expression pattern is dependent on the presence of canonical Sxl binding sites located in the nanos 3' untranslated region. These results, combined with the observation that nanos RNA associates with the Sxl protein in ovarian extracts and loss and gain of function studies, suggest that Sxl enables the switch from germline stem cell to committed daughter cell by posttranscriptional down-regulation of nanos expression. These findings connect sexual identity to the stem cell self-renewal/differentiation decision and highlight the importance of posttranscriptional gene regulatory networks in controlling stem cell behavior.

  14. OCTOPUS-LIKE 2, a novel player in Arabidopsis root and vascular development, reveals a key role for OCTOPUS family genes in root metaphloem sieve tube differentiation.

    PubMed

    Ruiz Sola, M Aguila; Coiro, Mario; Crivelli, Simona; Zeeman, Samuel C; Schmidt Kjølner Hansen, Signe; Truernit, Elisabeth

    2017-12-01

    Protophloem and metaphloem sieve tubes are essential for transporting carbohydrates and signalling molecules towards sink tissues. OCTOPUS (OPS) was previously identified as an important regulator of protophloem differentiation in Arabidopsis roots. Here, we investigated the role of OCTOPUS-LIKE 2 (OPL2), a gene homologous to OPS. OPL2 expression patterns were analysed, and functional equivalence of OPS and OPL2 was tested. Mutant and double mutant phenotypes were investigated. OPS and OPL2 displayed overlapping expression patterns and a high degree of functional overlap. A mutation in OPL2 revealed redundant functions of OPS and OPL2 in developmental processes in which OPS was known to play a role, notably cotyledon vascular patterning and protophloem development. Moreover, we also uncovered redundant roles for OPS and OPL2 in leaf vascular patterning and, most interestingly, metaphloem sieve tube differentiation. Our results reveal a novel OPS-like protein that, together with OPS, is an important regulator of vascular patterning, root growth and phloem development. OPS and OPL2 are the first genes identified that play a role in metaphloem sieve tube differentiation. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  15. Antagonism between the transcription factors NANOG and OTX2 specifies rostral or caudal cell fate during neural patterning transition.

    PubMed

    Su, Zhenghui; Zhang, Yanqi; Liao, Baojian; Zhong, Xiaofen; Chen, Xin; Wang, Haitao; Guo, Yiping; Shan, Yongli; Wang, Lihui; Pan, Guangjin

    2018-03-23

    During neurogenesis, neural patterning is a critical step during which neural progenitor cells differentiate into neurons with distinct functions. However, the molecular determinants that regulate neural patterning remain poorly understood. Here we optimized the "dual SMAD inhibition" method to specifically promote differentiation of human pluripotent stem cells (hPSCs) into forebrain and hindbrain neural progenitor cells along the rostral-caudal axis. We report that neural patterning determination occurs at the very early stage in this differentiation. Undifferentiated hPSCs expressed basal levels of the transcription factor orthodenticle homeobox 2 (OTX2) that dominantly drove hPSCs into the "default" rostral fate at the beginning of differentiation. Inhibition of glycogen synthase kinase 3β (GSK3β) through CHIR99021 application sustained transient expression of the transcription factor NANOG at early differentiation stages through Wnt signaling. Wnt signaling and NANOG antagonized OTX2 and, in the later stages of differentiation, switched the default rostral cell fate to the caudal one. Our findings have uncovered a mutual antagonism between NANOG and OTX2 underlying cell fate decisions during neural patterning, critical for the regulation of early neural development in humans. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Discretization provides a conceptually simple tool to build expression networks.

    PubMed

    Vass, J Keith; Higham, Desmond J; Mudaliar, Manikhandan A V; Mao, Xuerong; Crowther, Daniel J

    2011-04-18

    Biomarker identification, using network methods, depends on finding regular co-expression patterns; the overall connectivity is of greater importance than any single relationship. A second requirement is a simple algorithm for ranking patients on how relevant a gene-set is. For both of these requirements discretized data helps to first identify gene cliques, and then to stratify patients.We explore a biologically intuitive discretization technique which codes genes as up- or down-regulated, with values close to the mean set as unchanged; this allows a richer description of relationships between genes than can be achieved by positive and negative correlation. We find a close agreement between our results and the template gene-interactions used to build synthetic microarray-like data by SynTReN, which synthesizes "microarray" data using known relationships which are successfully identified by our method.We are able to split positive co-regulation into up-together and down-together and negative co-regulation is considered as directed up-down relationships. In some cases these exist in only one direction, with real data, but not with the synthetic data. We illustrate our approach using two studies on white blood cells and derived immortalized cell lines and compare the approach with standard correlation-based computations. No attempt is made to distinguish possible causal links as the search for biomarkers would be crippled by losing highly significant co-expression relationships. This contrasts with approaches like ARACNE and IRIS.The method is illustrated with an analysis of gene-expression for energy metabolism pathways. For each discovered relationship we are able to identify the samples on which this is based in the discretized sample-gene matrix, along with a simplified view of the patterns of gene expression; this helps to dissect the gene-sample relevant to a research topic--identifying sets of co-regulated and anti-regulated genes and the samples or patients in which this relationship occurs.

  17. Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata.

    PubMed

    Brütting, Christoph; Schäfer, Martin; Vanková, Radomíra; Gase, Klaus; Baldwin, Ian T; Meldau, Stefan

    2017-01-01

    Plant defense metabolites are well known to be regulated developmentally. The optimal defense (OD) theory posits that a tssue's fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness value to the plant, and therefore their defense allocations should be higher when compared with older leaves. The mechanisms that coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins (CKs) modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf CK levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different CK classes by using senescence- and chemically inducible expression of CK biosynthesis genes. Genetically modifying the levels of different CKs in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include CKs plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  18. The dorsoventral patterning of Musca domestica embryos: insights into BMP/Dpp evolution from the base of the lower cyclorraphan flies.

    PubMed

    Hodar, Christian; Cambiazo, Verónica

    2018-01-01

    In the last few years, accumulated information has indicated that the evolution of an extra-embryonic membrane in dipterans was accompanied by changes in the gene regulatory network controlled by the BMP/Dpp pathway, which is responsible for dorsal patterning in these insects. However, only comparative analysis of gene expression levels between distant species with two extra-embryonic membranes, like A. gambiae or C. albipunctata , and D. melanogaster, has been conducted. Analysis of gene expression in ancestral species, which evolved closer to the amnioserosa origin, could provide new insights into the evolution of dorsoventral patterning in dipterans. Here we describe the spatial expression of several key and downstream elements of the Dpp pathway and show the compared patterns of expression between Musca and Drosophila embryos, both dipterans with amnioserosa. Most of the analyzed gene showed a high degree of expression conservation, however, we found several differences in the gene expression pattern of M. domestica orthologs for sog and tolloid . Bioinformatics analysis of the promoter of both genes indicated that the variations could be related to the gain of several binding sites for the transcriptional factor Dorsal in the Md.tld promoter and Snail in the Md.sog enhancer . These altered expressions could explain the unclear formation of the pMad gradient in the M. domestica embryo, compared to the formation of the gradient in D. melanogaster. Gene expression changes during the dorsal-ventral patterning in insects contribute to the differentiation of extra-embryonic tissues as a consequence of changes in the gene regulatory network controlled by BMP/Dpp. In this work, in early M. domestica embryos, we identified the expression pattern of several genes members involved in the dorsoventral specification of the embryo. We believe that these data can contribute to understanding the evolution of the BMP/Dpp pathway, the regulation of BMP ligands, and the formation of a Dpp gradient in higher cyclorraphan flies.

  19. AutA and AutR, Two Novel Global Transcriptional Regulators, Facilitate Avian Pathogenic Escherichia coli Infection.

    PubMed

    Zhuge, Xiangkai; Tang, Fang; Zhu, Hongfei; Mao, Xiang; Wang, Shaohui; Wu, Zongfu; Lu, Chengping; Dai, Jianjun; Fan, Hongjie

    2016-04-26

    Bacteria can change its lifestyle during inhabiting in host niches where they survive and replicate by rapidly altering gene expression pattern to accommodate the new environment. In this study, two novel regulators in avian pathogenic Escherichia coli (APEC) were identified and designated as AutA and AutR. RT-PCR and β-galactosidase assay results showed that AutA and AutR co-regulated the expression of adhesin UpaB in APEC strain DE205B. Electrophoretic mobility shift assay showed that AutA and AutR could directly bind the upaB promoter DNA. In vitro transcription assay indicated that AutA could activate the upaB transcription, while AutR inhibited the upaB transcription due to directly suppressing the activating effect of AutA on UpaB expression. Transcriptome analysis showed that AutA and AutR coherently affected the expression of hundreds of genes. Our study confirmed that AutA and AutR co-regulated the expression of DE205B K1 capsule and acid resistance systems in E. coli acid fitness island (AFI). Moreover, phenotypic heterogeneity in expression of K1 capsule and acid resistance systems in AFI during host-pathogen interaction was associated with the regulation of AutA and AutR. Collectively speaking, our studies presented that AutA and AutR are involved in APEC adaptive lifestyle change to facilitate its infection.

  20. PABPN1-Dependent mRNA Processing Induces Muscle Wasting

    PubMed Central

    Raz, Yotam; van Putten, Maaike; Paniagua-Soriano, Guillem; Krom, Yvonne D.; Florea, Bogdan I.; Raz, Vered

    2016-01-01

    Poly(A) Binding Protein Nuclear 1 (PABPN1) is a multifunctional regulator of mRNA processing, and its expression levels specifically decline in aging muscles. An expansion mutation in PABPN1 is the genetic cause of oculopharyngeal muscle dystrophy (OPMD), a late onset and rare myopathy. Moreover, reduced PABPN1 expression correlates with symptom manifestation in OPMD. PABPN1 regulates alternative polyadenylation site (PAS) utilization. However, the impact of PAS utilization on cell and tissue function is poorly understood. We hypothesized that altered PABPN1 expression levels is an underlying cause of muscle wasting. To test this, we stably down-regulated PABPN1 in mouse tibialis anterior (TA) muscles by localized injection of adeno-associated viruses expressing shRNA to PABPN1 (shPab). We found that a mild reduction in PABPN1 levels causes muscle pathology including myofiber atrophy, thickening of extracellular matrix and myofiber-type transition. Moreover, reduced PABPN1 levels caused a consistent decline in distal PAS utilization in the 3’-UTR of a subset of OPMD-dysregulated genes. This alternative PAS utilization led to up-regulation of Atrogin-1, a key muscle atrophy regulator, but down regulation of proteasomal genes. Additionally reduced PABPN1 levels caused a reduction in proteasomal activity, and transition in MyHC isotope expression pattern in myofibers. We suggest that PABPN1-mediated alternative PAS utilization plays a central role in aging-associated muscle wasting. PMID:27152426

  1. Expression of SLP-2 Was Associated with Invasion of Esophageal Squamous Cell Carcinoma

    PubMed Central

    Cao, Wenfeng; Zhang, Bin; Ding, Fang; Zhang, Weiran; Sun, Baocun; Liu, Zhihua

    2013-01-01

    Introduction Stomatin-like protein 2 (SLP-2), a member of the Stomatin superfamily, has been identified as an oncogenic-related protein and found to be up-regulated in multi-cancers. Nonetheless, the expression pattern and regulation of SLP-2 in human esophageal squamous cell carcinoma (ESCC) remain unexplored. Methods Immunohistochemistry and immunofluorescence staining analysis were performed to show SLP-2 expression and location. RNAi method was used to inhibit specific protein expression. Transwell assay was done to investigate cells invasive capability. RT-PCR and Western blot analysis were used to detect mRNA and protein expression levels. Results Immunohistochemical analysis showed that up-regulation of SLP-2 was found in invasive front compared with cancer central tissue in ESCC. Inhibition of SLP-2 by SLP-2 siRNA can decrease ESCC cells invasive capability through MMP-2 dependent manner. Up-regulation of SLP-2 was effectively abrogated by the ERK1/2 inhibitors either PD98059 or U0126, but no effect was showed by the treatment of AKT inhibitors either LY294002 or MK-2206. So the regulation of SLP-2 was involved in activation of the MAPK/ERK pathway. Conclusions We found that PMA/EGF could induce the up-regulated expression of SLP-2 probably through activating ERK signalling. The current study suggests that SLP-2 may represent an important molecular hallmark that is clinically relevant to the invasion of ESCC. PMID:23667687

  2. Differential gene expression in small and large rainbow trout derived from two seasonal spawning groups

    PubMed Central

    2014-01-01

    Background Growth in fishes is regulated via many environmental and physiological factors and is shaped by the genetic background of each individual. Previous microarray studies of salmonid growth have examined fish experiencing either muscle wastage or accelerated growth patterns following refeeding, or the influence of growth hormone and transgenesis. This study determines the gene expression profiles of genetically unmanipulated large and small fish from a domesticated salmonid strain reared on a typical feeding regime. Gene expression profiles of white muscle and liver from rainbow trout (Oncorhynchus mykiss) from two seasonal spawning groups (September and December lots) within a single strain were examined when the fish were 15 months of age to assess the influence of season (late fall vs. onset of spring) and body size (large vs. small). Results Although IGFBP1 gene expression was up-regulated in the livers of small fish in both seasonal lots, few expression differences were detected in the liver overall. Faster growing Dec. fish showed a greater number of differences in white muscle expression compared to Sept. fish. Significant differences in the GO Generic Level 3 categories ‘response to external stimulus’, ‘establishment of localization’, and ‘response to stress’ were detected in white muscle tissue between large and small fish. Larger fish showed up-regulation of cytoskeletal component genes while many genes related to myofibril components of muscle tissue were up-regulated in small fish. Most of the genes up-regulated in large fish within the ‘response to stress’ category are involved in immunity while in small fish most of these gene functions are related to apoptosis. Conclusions A higher proportion of genes in white muscle compared to liver showed similar patterns of up- or down-regulation within the same size class across seasons supporting their utility as biomarkers for growth in rainbow trout. Differences between large and small Sept. fish in the ‘response to stress’ and ‘response to external stimulus’ categories for white muscle tissue, suggests that smaller fish have a greater inability to handle stress compared to the large fish. Sampling season had a significant impact on the expression of genes related to the growth process in rainbow trout. PMID:24450799

  3. The role of PPARδ signaling in the cardiovascular system.

    PubMed

    Ding, Yishu; Yang, Kevin D; Yang, Qinglin

    2014-01-01

    Peroxisome proliferator-activated receptors (PPARα, β/δ, and γ), members of the nuclear receptor transcription factor superfamily, play important roles in the regulation of metabolism, inflammation, and cell differentiation. All three PPAR subtypes are expressed in the cardiovascular system with various expression patterns. Among the three PPAR subtypes, PPARδ is the least studied but has arisen as a potential therapeutic target for cardiovascular and many other diseases. It is known that PPARδ is ubiquitously expressed and abundantly expressed in cardiomyocytes. Accumulated evidence illustrates the role of PPARδ in regulating cardiovascular function and determining pathological progression. In this chapter, we will discuss the current knowledge in the role of PPARδ in the cardiovascular system, the mechanistic insights, and the potential therapeutic utilization for treating cardiovascular disease. © 2014 Elsevier Inc. All rights reserved.

  4. SOCS3 promotes apoptosis of mammary differentiated cells.

    PubMed

    Le Provost, Fabienne; Miyoshi, Keiko; Vilotte, Jean-Luc; Bierie, Brian; Robinson, Gertraud W; Hennighausen, Lothar

    2005-12-30

    Growth and function of the mammary gland is regulated by cytokines and modulated by suppressor of cytokine signalling (SOCS) proteins. In vitro experiments demonstrated that SOCS3 can inhibit PRL induction of milk protein gene expression and STAT5 activation. We explored the SOCS3 expression pattern during mouse mammary development and its regulation by PRL and GH in wild-type and STAT5a-null mammary tissue. Our results suggest that, in vivo, PRL stimulates SOCS3 expression in stromal adipocytes, independently of STAT5a stimulation. In mammary epithelial cells, SOCS3 expression appears to be related to STAT3 activation. Together, our results are consistent with a role of SOCS3 in the mammary gland by promoting apoptosis of differentiated cells (adipocytes during gestation and epithelial cells during involution).

  5. Regulated expression of homeobox genes Msx-1 and Msx-2 in mouse mammary gland development suggests a role in hormone action and epithelial-stromal interactions.

    PubMed

    Friedmann, Y; Daniel, C W

    1996-07-10

    The murine homeobox genes Msx-1 and Msx-2 are related to the Drosophila msh gene and are expressed in a variety of tissues during mouse embryogenesis. We now report the developmentally regulated expression of Msx-1 and Msx-2 in the mouse mammary gland and show that their expression patterns point toward significant functional roles. Msx-1 and Msx-2 transcripts were present in glands of virgin mice and in glands of mice in early pregnancy, but transcripts decreased dramatically during late pregnancy. Low levels of Msx-1 transcripts were detected in glands from lactating animals and during the first days of involution, whereas Msx-2 expression was not detected during lactation or early involution. Expression of both genes increased gradually as involution progressed. Msx-2 but not Msx-1 expression was decreased following ovariectomy or following exposure to anti-estrogen implanted directly into the gland. Hormonal regulation of Msx-2 expression was confirmed when transcripts returned to normal levels after estrogen was administered to ovariectomized animals. In situ molecular hybridization for Msx-1 showed transcripts localized to the mammary epithelium, whereas Msx-2 expression was confined to the periductal stroma. Mammary stroma from which mammary epithelium had been removed did not transcribe detectable amounts of Msx-2, showing that expression is regulated by contiguous mammary epithelium, and indicating a role for these homeobox genes in mesenchymal-epithelial interactions during mammary development.

  6. Differential Anoxic Expression of Sugar-Regulated Genes Reveals Diverse Interactions between Sugar and Anaerobic Signaling Systems in Rice

    PubMed Central

    Lim, Mi-na; Lee, Sung-eun; Yim, Hui-kyeong; Kim, Jeong Hoe; Yoon, In Sun; Hwang, Yong-sic

    2013-01-01

    The interaction between the dual roles of sugar as a metabolic fuel and a regulatory molecule was unveiled by examining the changes in sugar signaling upon oxygen deprivation, which causes the drastic alteration in the cellular energy status. In our study, the expression of anaerobically induced genes is commonly responsive to sugar, either under the control of hexokinase or non-hexokinase mediated signaling cascades. Only sugar regulation via the hexokinase pathway was susceptible for O2 deficiency or energy deficit conditions evoked by uncoupler. Examination of sugar regulation of those genes under anaerobic conditions revealed the presence of multiple paths underlying anaerobic induction of gene expression in rice, subgrouped into three distinct types. The first of these, which was found in type-1 genes, involved neither sugar regulation nor additional anaerobic induction under anoxia, indicating that anoxic induction is a simple result from the release of sugar repression by O2-deficient conditions. In contrast, type-2 genes also showed no sugar regulation, albeit with enhanced expression under anoxia. Lastly, expression of type-3 genes is highly enhanced with sugar regulation sustained under anoxia. Intriguingly, the inhibition of the mitochondrial ATP synthesis can reproduce expression pattern of a specific set of anaerobically induced genes, implying that rice cells may sense O2 deprivation, partly via perception of the perturbed cellular energy status. Our study of interaction between sugar signaling and anaerobic conditions has revealed that sugar signaling and the cellular energy status are likely to communicate with each other and influence anaerobic induction of gene expression in rice. PMID:23852132

  7. miR-135A Regulates Preimplantation Embryo Development through Down-Regulation of E3 Ubiquitin Ligase Seven in Absentia Homolog 1A (SIAH1A) Expression

    PubMed Central

    Leung, Carmen O. N.; Ye, Tian-Min; Kwan, Peter C. K.; Lee, Kai-Fai; Yeung, William S. B.

    2011-01-01

    Background MicroRNAs (miRNAs) are small non-coding RNA molecules capable of regulating transcription and translation. Previously, a cluster of miRNAs that are specifically expressed in mouse zygotes but not in oocytes or other preimplantation stages embryos are identified by multiplex real-time polymerase chain reaction-based miRNA profiling. The functional role of one of these zygote-specific miRNAs, miR-135a, in preimplantation embryo development was investigated. Methodology/Principal Findings Microinjection of miR-135a inhibitor suppressed first cell cleavage in more than 30% of the zygotes. Bioinformatics analysis identified E3 Ubiquitin Ligase Seven In Absentia Homolog 1A (Siah1a) as a predicted target of miR-135a. Western blotting and 3′UTR luciferase functional assays demonstrated that miR-135a down-regulated the expression of Siah1 in HeLa cells and in mouse zygotes. Siah1a was expressed in preimplantation embryos and its expression pattern negatively correlated with that of miR-135a. Co-injection of Siah1a-specific antibody with miR-135a inhibitor partially nullified the effect of miR-135a inhibition. Proteasome inhibition by MG-132 revealed that miR-135a regulated proteasomal degradation and potentially controlled the expression of chemokinesin DNA binding protein (Kid). Conclusions/Significance The present study demonstrated for the first time that zygotic specific miRNA modulates the first cell cleavage through regulating expression of Siah1a. PMID:22132158

  8. Salt Stress Induced Variation in DNA Methylation Pattern and Its Influence on Gene Expression in Contrasting Rice Genotypes

    PubMed Central

    Karan, Ratna; DeLeon, Teresa; Biradar, Hanamareddy; Subudhi, Prasanta K.

    2012-01-01

    Background Salinity is a major environmental factor limiting productivity of crop plants including rice in which wide range of natural variability exists. Although recent evidences implicate epigenetic mechanisms for modulating the gene expression in plants under environmental stresses, epigenetic changes and their functional consequences under salinity stress in rice are underexplored. DNA methylation is one of the epigenetic mechanisms regulating gene expression in plant’s responses to environmental stresses. Better understanding of epigenetic regulation of plant growth and response to environmental stresses may create novel heritable variation for crop improvement. Methodology/Principal Findings Methylation sensitive amplification polymorphism (MSAP) technique was used to assess the effect of salt stress on extent and patterns of DNA methylation in four genotypes of rice differing in the degree of salinity tolerance. Overall, the amount of DNA methylation was more in shoot compared to root and the contribution of fully methylated loci was always more than hemi-methylated loci. Sequencing of ten randomly selected MSAP fragments indicated gene-body specific DNA methylation of retrotransposons, stress responsive genes, and chromatin modification genes, distributed on different rice chromosomes. Bisulphite sequencing and quantitative RT-PCR analysis of selected MSAP loci showed that cytosine methylation changes under salinity as well as gene expression varied with genotypes and tissue types irrespective of the level of salinity tolerance of rice genotypes. Conclusions/Significance The gene body methylation may have an important role in regulating gene expression in organ and genotype specific manner under salinity stress. Association between salt tolerance and methylation changes observed in some cases suggested that many methylation changes are not “directed”. The natural genetic variation for salt tolerance observed in rice germplasm may be independent of the extent and pattern of DNA methylation which may have been induced by abiotic stress followed by accumulation through the natural selection process. PMID:22761959

  9. miR-9 and miR-140-5p target FoxP2 and are regulated as a function of the social context of singing behavior in zebra finches.

    PubMed

    Shi, Zhimin; Luo, Guanzheng; Fu, Lijuan; Fang, Zhide; Wang, XiuJie; Li, XiaoChing

    2013-10-16

    Mutations in the FOXP2 gene cause speech and language impairments, accompanied by structural and functional abnormalities in brain regions underlying speech-related sensory-motor processing, including the striatum and cerebellum. The sequence and expression patterns of FOXP2 are highly conserved among higher vertebrates. In the zebra finch brain, FoxP2 is expressed in Area X, a striatal nucleus required for vocal learning, and reduced FoxP2 expression impairs dendritic development and vocal learning. The FoxP2 gene encodes a transcription factor that controls the expression of many downstream genes. However, how FOXP2 gene expression is regulated is not clearly understood. miRNAs regulate gene expression post-transcriptionally by targeting the 3'-untranslated regions (UTRs) of mRNAs, leading to translational suppression or mRNA degradation. In this study, we identified miR-9 and miR-140-5p as potential regulators of the FoxP2 gene. We show that both miR-9 and miR-140-5p target specific sequences in the FoxP2 3'-UTR and downregulate FoxP2 protein and mRNA expression in vitro. We also show that the expression of miR-9 and miR-140-5p in Area X of the zebra finch brain is regulated during song development in juvenile zebra finches. We further show that in adult zebra finches the expression of miR-9 and miR-140-5p in Area X is regulated as a function of the social context of song behavior in males singing undirected songs. Our findings reveal a post-transcriptional mechanism that regulates FoxP2 expression and suggest that social vocal behavior can influence the basal ganglia circuit controlling vocal learning via a miRNA-FoxP2 gene regulatory network.

  10. miR-9 and miR-140-5p Target FoxP2 and Are Regulated as a Function of the Social Context of Singing Behavior in Zebra Finches

    PubMed Central

    Shi, Zhimin; Luo, Guanzheng; Fu, Lijuan; Fang, Zhide; Wang, XiuJie

    2013-01-01

    Mutations in the FOXP2 gene cause speech and language impairments, accompanied by structural and functional abnormalities in brain regions underlying speech-related sensory-motor processing, including the striatum and cerebellum. The sequence and expression patterns of FOXP2 are highly conserved among higher vertebrates. In the zebra finch brain, FoxP2 is expressed in Area X, a striatal nucleus required for vocal learning, and reduced FoxP2 expression impairs dendritic development and vocal learning. The FoxP2 gene encodes a transcription factor that controls the expression of many downstream genes. However, how FOXP2 gene expression is regulated is not clearly understood. miRNAs regulate gene expression post-transcriptionally by targeting the 3′-untranslated regions (UTRs) of mRNAs, leading to translational suppression or mRNA degradation. In this study, we identified miR-9 and miR-140-5p as potential regulators of the FoxP2 gene. We show that both miR-9 and miR-140-5p target specific sequences in the FoxP2 3′-UTR and downregulate FoxP2 protein and mRNA expression in vitro. We also show that the expression of miR-9 and miR-140-5p in Area X of the zebra finch brain is regulated during song development in juvenile zebra finches. We further show that in adult zebra finches the expression of miR-9 and miR-140-5p in Area X is regulated as a function of the social context of song behavior in males singing undirected songs. Our findings reveal a post-transcriptional mechanism that regulates FoxP2 expression and suggest that social vocal behavior can influence the basal ganglia circuit controlling vocal learning via a miRNA-FoxP2 gene regulatory network. PMID:24133256

  11. The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

    USDA-ARS?s Scientific Manuscript database

    MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

  12. Histone modifications in the male germ line of Drosophila.

    PubMed

    Hennig, Wolfgang; Weyrich, Alexandra

    2013-02-22

    In the male germ line of Drosophila chromatin remains decondensed and highly transcribed during meiotic prophase until it is rapidly compacted. A large proportion of the cell cycle-regulated histone H3.1 is replaced by H3.3, a histone variant encoded outside the histone repeat cluster and not subject to cell cycle controlled expression. We investigated histone modification patterns in testes of D. melanogaster and D. hydei. In somatic cells of the testis envelope and in germ cells these modification patterns differ from those typically seen in eu- and heterochromatin of other somatic cells. During the meiotic prophase some modifications expected in active chromatin are not found or are found at low level. The absence of H4K16ac suggests that dosage compensation does not take place. Certain histone modifications correspond to either the cell cycle-regulated histone H3.1 or to the testis-specific variant H3.3. In spermatogonia we found H3K9 methylation in cytoplasmic histones, most likely corresponding to the H3.3 histone variant. Most histone modifications persist throughout the meiotic divisions. The majority of modifications persist until the early spermatid nuclei, and only a minority further persist until the final chromatin compaction stages before individualization of the spermatozoa. Histone modification patterns in the male germ line differ from expected patterns. They are consistent with an absence of dosage compensation of the X chromosome during the male meiotic prophase. The cell cycle-regulated histone variant H3.1 and H3.3, expressed throughout the cell cycle, also vary in their modification patterns. Postmeiotically, we observed a highly complex pattern of the histone modifications until late spermatid nuclear elongation stages. This may be in part due to postmeiotic transcription and in part to differential histone replacement during chromatin condensation.

  13. Diel pattern of circadian clock and storage protein gene expression in leaves and during seed filling in cowpea (Vigna unguiculata).

    PubMed

    Weiss, Julia; Terry, Marta I; Martos-Fuentes, Marina; Letourneux, Lisa; Ruiz-Hernández, Victoria; Fernández, Juan A; Egea-Cortines, Marcos

    2018-02-14

    Cowpea (Vigna unguiculata) is an important source of protein supply for animal and human nutrition. The major storage globulins VICILIN and LEGUMIN (LEG) are synthesized from several genes including LEGA, LEGB, LEGJ and CVC (CONVICILIN). The current hypothesis is that the plant circadian core clock genes are conserved in a wide array of species and that primary metabolism is to a large extent controlled by the plant circadian clock. Our aim was to investigate a possible link between gene expression of storage proteins and the circadian clock. We identified cowpea orthologues of the core clock genes VunLHY, VunTOC1, VunGI and VunELF3, the protein storage genes VunLEG, VunLEGJ, and VunCVC as well as nine candidate reference genes used in RT-PCR. ELONGATION FACTOR 1-A (ELF1A) resulted the most suitable reference gene. The clock genes VunELF3, VunGI, VunTOC1 and VunLHY showed a rhythmic expression profile in leaves with a typical evening/night and morning/midday phased expression. The diel patterns were not completely robust and only VungGI and VungELF3 retained a rhythmic pattern under free running conditions of darkness. Under field conditions, rhythmicity and phasing apparently faded during early pod and seed development and was regained in ripening pods for VunTOC1 and VunLHY. Mature seeds showed a rhythmic expression of VunGI resembling leaf tissue under controlled growth chamber conditions. Comparing time windows during developmental stages we found that VunCVC and VunLEG were significantly down regulated during the night in mature pods as compared to intermediate ripe pods, while changes in seeds were non-significant due to high variance. The rhythmic expression under field conditions was lost under growth chamber conditions. The core clock gene network is conserved in cowpea leaves showing a robust diel expression pattern except VunELF3 under growth chamber conditions. There appears to be a clock transcriptional reprogramming in pods and seeds compared to leaves. Storage protein deposition may be circadian regulated under field conditions but the strong environmental signals are not met under artificial growth conditions. Diel expression pattern in field conditions may result in better usage of energy for protein storage.

  14. Transcriptome Analysis of Shewanella oneidensis MR-1 in Response to Elevated Salt Conditions

    PubMed Central

    Liu, Yongqing; Gao, Weimin; Wang, Yue; Wu, Liyou; Liu, Xueduan; Yan, Tinfeng; Alm, Eric; Arkin, Adam; Thompson, Dorothea K.; Fields, Matthew W.; Zhou, Jizhong

    2005-01-01

    Whole-genomic expression patterns were examined in Shewanella oneidensis cells exposed to elevated sodium chloride. Genes involved in Na+ extrusion and glutamate biosynthesis were significantly up-regulated, and the majority of chemotaxis/motility-related genes were significantly down-regulated. The data also suggested an important role for metabolic adjustment in salt stress adaptation in S. oneidensis. PMID:15774893

  15. Investigation of protein expression profiles of erythritol-producing Candida magnoliae in response to glucose perturbation.

    PubMed

    Kim, Hyo Jin; Lee, Hyeong-Rho; Kim, Chang Sup; Jin, Yong-Su; Seo, Jin-Ho

    2013-08-15

    Protein expression patterns of an erythritol-producing yeast, Candida magnoliae, were analyzed to identify differentially expressed proteins in response to glucose perturbation. Specifically, wild type C. magnoliae was grown under high and low glucose conditions and the cells were harvested at both mid-exponential and erythritol production phases for proteomic studies. In order to analyze intracellular protein abundances from the harvested cells quantitatively, total intracellular proteins were extracted and applied to two-dimensional gel electrophoresis for separation and visualization of individual proteins. Among the proteins distributed in the range of pI 4-7 and molecular weight 29-97kDa, five osmo-responsive proteins were drastically changed in response to glucose perturbation. Hsp60 (Heat-shock protein 60), transaldolase and NADH:quinone oxidoreductase were down-regulated under the high glucose condition and Bro1 (BCK1-like Resistance to Osmotic shock) and Eno1 (enolase1) were up-regulated. These proteins are directly or indirectly related with cellular stress response. Importantly, protein expression patterns of Hsp60, Bro1 and Eno1 were strongly correlated with previous studies identifying the proteins perturbed by osmotic stress for other organisms including Saccharomyces cerevisiae. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. A molecular view of onychophoran segmentation.

    PubMed

    Janssen, Ralf

    2017-05-01

    This paper summarizes our current knowledge on the expression and assumed function of Drosophila and (other) arthropod segmentation gene orthologs in Onychophora, a closely related outgroup to Arthropoda. This includes orthologs of the so-called Drosophila segmentation gene cascade including the Hox genes, as well as other genetic factors and pathways involved in non-drosophilid arthropods. Open questions about and around the topic are addressed, such as the definition of segments in onychophorans, the unclear regulation of conserved expression patterns downstream of non-conserved factors, and the potential role of mesodermal patterning in onychophoran segmentation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Harnessing Solute Carrier Transporters for Precision Oncology.

    PubMed

    Nyquist, Michael D; Prasad, Bhagwat; Mostaghel, Elahe A

    2017-03-28

    Solute Carrier (SLC) transporters are a large superfamily of transmembrane carriers involved in the regulated transport of metabolites, nutrients, ions and drugs across cellular membranes. A subset of these solute carriers play a significant role in the cellular uptake of many cancer therapeutics, ranging from chemotherapeutics such as antimetabolites, topoisomerase inhibitors, platinum-based drugs and taxanes to targeted therapies such as tyrosine kinase inhibitors. SLC transporters are co-expressed in groups and patterns across normal tissues, suggesting they may comprise a coordinated regulatory circuit serving to mediate normal tissue functions. In cancer however, there are dramatic changes in expression patterns of SLC transporters. This frequently serves to feed the increased metabolic demands of the tumor cell for amino acids, nucleotides and other metabolites, but also presents a therapeutic opportunity, as increased transporter expression may serve to increase intracellular concentrations of substrate drugs. In this review, we examine the regulation of drug transporters in cancer and how this impacts therapy response, and discuss novel approaches to targeting therapies to specific cancers via tumor-specific aberrations in transporter expression. We propose that among the oncogenic changes in SLC transporter expression there exist emergent vulnerabilities that can be exploited therapeutically, extending the application of precision medicine from tumor-specific drug targets to tumor-specific determinants of drug uptake.

  18. Kcnh1 Voltage-gated Potassium Channels Are Essential for Early Zebrafish Development*

    PubMed Central

    Stengel, Rayk; Rivera-Milla, Eric; Sahoo, Nirakar; Ebert, Christina; Bollig, Frank; Heinemann, Stefan H.; Schönherr, Roland; Englert, Christoph

    2012-01-01

    The Kcnh1 gene encodes a voltage-gated potassium channel highly expressed in neurons and involved in tumor cell proliferation, yet its physiological roles remain unclear. We have used the zebrafish as a model to analyze Kcnh1 function in vitro and in vivo. We found that the kcnh1 gene is duplicated in teleost fish (i.e. kcnh1a and kcnh1b) and that both genes are maternally expressed during early development. In adult zebrafish, kcnh1a and kcnh1b have distinct expression patterns but share expression in brain and testis. Heterologous expression of both genes in Xenopus oocytes revealed a strong conservation of characteristic functional properties between human and fish channels, including a unique sensitivity to intracellular Ca2+/calmodulin and modulation of voltage-dependent gating by extracellular Mg2+. Using a morpholino antisense approach, we demonstrate a strong kcnh1 loss-of-function phenotype in developing zebrafish, characterized by growth retardation, delayed hindbrain formation, and embryonic lethality. This late phenotype was preceded by transcriptional up-regulation of known cell-cycle inhibitors (p21, p27, cdh2) and down-regulation of pro-proliferative factors, including cyclin D1, at 70% epiboly. These results reveal an unanticipated basic activity of kcnh1 that is crucial for early embryonic development and patterning. PMID:22927438

  19. Epigenetic control of vasopressin expression is maintained by steroid hormones in the adult male rat brain

    PubMed Central

    Auger, Catherine J.; Coss, Dylan; Auger, Anthony P.; Forbes-Lorman, Robin M.

    2011-01-01

    Although some DNA methylation patterns are altered by steroid hormone exposure in the developing brain, less is known about how changes in steroid hormone levels influence DNA methylation patterns in the adult brain. Steroid hormones act in the adult brain to regulate gene expression. Specifically, the expression of the socially relevant peptide vasopressin (AVP) within the bed nucleus of the stria terminalis (BST) of adult brain is dependent upon testosterone exposure. Castration dramatically reduces and testosterone replacement restores AVP expression within the BST. As decreases in mRNA expression are associated with increases in DNA promoter methylation, we explored the hypothesis that AVP expression in the adult brain is maintained through sustained epigenetic modifications of the AVP gene promoter. We find that castration of adult male rats resulted in decreased AVP mRNA expression and increased methylation of specific CpG sites within the AVP promoter in the BST. Similarly, castration significantly increased estrogen receptor α (ERα) mRNA expression and decreased ERα promoter methylation within the BST. These changes were prevented by testosterone replacement. This suggests that the DNA promoter methylation status of some steroid responsive genes in the adult brain is actively maintained by the presence of circulating steroid hormones. The maintenance of methylated or demethylated states of some genes in the adult brain by the presence of steroid hormones may play a role in the homeostatic regulation of behaviorally relevant systems. PMID:21368111

  20. Brassinosteroids control root epidermal cell fate via direct regulation of a MYB-bHLH-WD40 complex by GSK3-like kinases

    PubMed Central

    Cheng, Yinwei; Zhu, Wenjiao; Chen, Yuxiao; Ito, Shinsaku; Asami, Tadao; Wang, Xuelu

    2014-01-01

    In Arabidopsis, root hair and non-hair cell fates are determined by a MYB-bHLH-WD40 transcriptional complex and are regulated by many internal and environmental cues. Brassinosteroids play important roles in regulating root hair specification by unknown mechanisms. Here, we systematically examined root hair phenotypes in brassinosteroid-related mutants, and found that brassinosteroid signaling inhibits root hair formation through GSK3-like kinases or upstream components. We found that with enhanced brassinosteroid signaling, GL2, a cell fate marker for non-hair cells, is ectopically expressed in hair cells, while its expression in non-hair cells is suppressed when brassinosteroid signaling is reduced. Genetic analysis demonstrated that brassinosteroid-regulated root epidermal cell patterning is dependent on the WER-GL3/EGL3-TTG1 transcriptional complex. One of the GSK3-like kinases, BIN2, interacted with and phosphorylated EGL3, and EGL3s mutated at phosphorylation sites were retained in hair cell nuclei. BIN2 phosphorylated TTG1 to inhibit the activity of the WER-GL3/EGL3-TTG1 complex. Thus, our study provides insights into the mechanism of brassinosteroid regulation of root hair patterning. DOI: http://dx.doi.org/10.7554/eLife.02525.001 PMID:24771765

  1. Epidermal gene expression and ethnic pigmentation variations among individuals of Asian, European and African ancestry.

    PubMed

    Yin, Lanlan; Coelho, Sergio G; Ebsen, Dominik; Smuda, Christoph; Mahns, Andre; Miller, Sharon A; Beer, Janusz Z; Kolbe, Ludger; Hearing, Vincent J

    2014-10-01

    Differences in visible skin pigmentation give rise to the wide variation of skin colours seen in racial/ethnic populations. Skin pigmentation is important not only from cosmetic and psychological points of view, but more importantly because of its implications for the risk of all types of skin cancers, on photoaging, etc. Despite differences in those parameters in Caucasian and Asian skin types, they are remarkably similar in their production and distribution of melanins, and the mechanism(s) underlying their different characteristics have remained obscure. In this study, we used microarray analysis of skin suction blisters to investigate molecular differences underlying the determination of pigmentation in various skin types, and we used immunohistochemistry to validate the expression patterns of several interesting targets that were identified. Intriguingly, Caucasian and Asian skins had highly similar gene expression patterns that differed significantly from the pattern of African skin. The results of this study suggest the dynamic interactions of different types of cells in human skin that regulate its pigmentation, reveal that the known pigmentation genes have a limited contribution and uncover a new array of genes, including NINL and S100A4, that might be involved in that regulation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Laminin promotes vascular network formation in 3D in vitro collagen scaffolds by regulating VEGF uptake.

    PubMed

    Stamati, Katerina; Priestley, John V; Mudera, Vivek; Cheema, Umber

    2014-09-10

    Angiogenesis is an essential neovascularisation process, which if recapitulated in 3D in vitro, will provide better understanding of endothelial cell (EC) behaviour. Various cell types and growth factors are involved, with vascular endothelial growth factor (VEGF) and its receptors VEGFR1 and VEGFR2 key components. We were able to control the aggregation pattern of ECs in 3D collagen hydrogels, by varying the matrix composition and/or having a source of cells signalling angiogenic proteins. These aggregation patterns reflect the different developmental pathways that ECs take to form different sized tubular structures. Cultures with added laminin and thus increased expression of α6 integrin showed a significant increase (p<0.05) in VEGFR2 positive ECs and increased VEGF uptake. This resulted in the end-to-end network aggregation of ECs. In cultures without laminin and therefore low α6 integrin expression, VEGFR2 levels and VEGF uptake were significantly lower (p<0.05). These ECs formed contiguous sheets, analogous to the 'wrapping' pathway in development. We have identified a key linkage between integrin expression on ECs and their uptake of VEGF, regulated by VEGFR2, resulting in different aggregation patterns in 3D. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Role of the Hypothalamic-Pituitary-Adrenal Axis in Developmental Programming of Health and Disease

    PubMed Central

    Xiong, Fuxia; Zhang, Lubo

    2012-01-01

    Adverse environments during the fetal and neonatal development period may permanently program physiology and metabolism, and lead to increased risk of diseases in later life. Programming of the hypothalamic-pituitary-adrenal (HPA) axis is one of the key mechanisms that contribute to altered metabolism and response to stress. Programming of the HPA axis often involves epigenetic modification of the glucocorticoid receptor (GR) gene promoter, which influences tissue-specific GR expression patterns and response to stimuli. This review summarizes the current state of research on the HPA axis and programming of health and disease in the adult, focusing on the epigenetic regulation of GR gene expression patterns in response to fetal and neonatal stress. Aberrant GR gene expression patterns in the developing brain may have a significant negative impact on protection of the immature brain against hypoxic-ischemic encephalopathy in the critical period of development during and immediately after birth. PMID:23200813

  4. Mechanical Influences on Morphogenesis of the Knee Joint Revealed through Morphological, Molecular and Computational Analysis of Immobilised Embryos

    PubMed Central

    Roddy, Karen A.; Prendergast, Patrick J.; Murphy, Paula

    2011-01-01

    Very little is known about the regulation of morphogenesis in synovial joints. Mechanical forces generated from muscle contractions are required for normal development of several aspects of normal skeletogenesis. Here we show that biophysical stimuli generated by muscle contractions impact multiple events during chick knee joint morphogenesis influencing differential growth of the skeletal rudiment epiphyses and patterning of the emerging tissues in the joint interzone. Immobilisation of chick embryos was achieved through treatment with the neuromuscular blocking agent Decamethonium Bromide. The effects on development of the knee joint were examined using a combination of computational modelling to predict alterations in biophysical stimuli, detailed morphometric analysis of 3D digital representations, cell proliferation assays and in situ hybridisation to examine the expression of a selected panel of genes known to regulate joint development. This work revealed the precise changes to shape, particularly in the distal femur, that occur in an altered mechanical environment, corresponding to predicted changes in the spatial and dynamic patterns of mechanical stimuli and region specific changes in cell proliferation rates. In addition, we show altered patterning of the emerging tissues of the joint interzone with the loss of clearly defined and organised cell territories revealed by loss of characteristic interzone gene expression and abnormal expression of cartilage markers. This work shows that local dynamic patterns of biophysical stimuli generated from muscle contractions in the embryo act as a source of positional information guiding patterning and morphogenesis of the developing knee joint. PMID:21386908

  5. Potential Direct Regulators of the Drosophila yellow Gene Identified by Yeast One-Hybrid and RNAi Screens

    PubMed Central

    Kalay, Gizem; Lusk, Richard; Dome, Mackenzie; Hens, Korneel; Deplancke, Bart; Wittkopp, Patricia J.

    2016-01-01

    The regulation of gene expression controls development, and changes in this regulation often contribute to phenotypic evolution. Drosophila pigmentation is a model system for studying evolutionary changes in gene regulation, with differences in expression of pigmentation genes such as yellow that correlate with divergent pigment patterns among species shown to be caused by changes in cis- and trans-regulation. Currently, much more is known about the cis-regulatory component of divergent yellow expression than the trans-regulatory component, in part because very few trans-acting regulators of yellow expression have been identified. This study aims to improve our understanding of the trans-acting control of yellow expression by combining yeast-one-hybrid and RNAi screens for transcription factors binding to yellow cis-regulatory sequences and affecting abdominal pigmentation in adults, respectively. Of the 670 transcription factors included in the yeast-one-hybrid screen, 45 showed evidence of binding to one or more sequence fragments tested from the 5′ intergenic and intronic yellow sequences from D. melanogaster, D. pseudoobscura, and D. willistoni, suggesting that they might be direct regulators of yellow expression. Of the 670 transcription factors included in the yeast-one-hybrid screen, plus another TF previously shown to be genetically upstream of yellow, 125 were also tested using RNAi, and 32 showed altered abdominal pigmentation. Nine transcription factors were identified in both screens, including four nuclear receptors related to ecdysone signaling (Hr78, Hr38, Hr46, and Eip78C). This finding suggests that yellow expression might be directly controlled by nuclear receptors influenced by ecdysone during early pupal development when adult pigmentation is forming. PMID:27527791

  6. Tight Junction Protein 1a regulates pigment cell organisation during zebrafish colour patterning.

    PubMed

    Fadeev, Andrey; Krauss, Jana; Frohnhöfer, Hans Georg; Irion, Uwe; Nüsslein-Volhard, Christiane

    2015-04-27

    Zebrafish display a prominent pattern of alternating dark and light stripes generated by the precise positioning of pigment cells in the skin. This arrangement is the result of coordinated cell movements, cell shape changes, and the organisation of pigment cells during metamorphosis. Iridophores play a crucial part in this process by switching between the dense form of the light stripes and the loose form of the dark stripes. Adult schachbrett (sbr) mutants exhibit delayed changes in iridophore shape and organisation caused by truncations in Tight Junction Protein 1a (ZO-1a). In sbr mutants, the dark stripes are interrupted by dense iridophores invading as coherent sheets. Immuno-labelling and chimeric analyses indicate that Tjp1a is expressed in dense iridophores but down-regulated in the loose form. Tjp1a is a novel regulator of cell shape changes during colour pattern formation and the first cytoplasmic protein implicated in this process.

  7. The role of ZmWRKY4 in regulating maize antioxidant defense under cadmium stress.

    PubMed

    Hong, Changyong; Cheng, Dan; Zhang, Guoqiang; Zhu, Dandan; Chen, Yahua; Tan, Mingpu

    2017-01-22

    WRKY transcription factors act as positive regulators in abiotic stress responses by activation of the cellular antioxidant systems. However, there are few reports on the response of WRKY genes to cadmium (Cd) stress. In this study, the role of maize ZmWRKY4 in regulating antioxidant enzymes in Cd stress was investigated. The results indicated that Cd induced up-regulation of the expression and the activities of ZmWRKY4 and superoxide dismutase (SOD) and ascorbate peroxidase (APX). Transient expression and RNA interference (RNAi) silencing of ZmWRKY4 in maize mesophyll protoplasts further revealed that ZmWRKY4 was required for the abscisic acid (ABA)-induced increase in expression and activity of SOD and APX. Overexpression of ZmWRKY4 in protoplasts upregulated the expression and the activities of antioxidant enzymes, whereas ABA induced increases in the expression and the activities of antioxidant enzymes were blocked by the RNAi silencing of ZmWRKY4. Bioinformatic analysis indicated that ZmSOD4 and ZmcAPX both harbored two W-boxes, binding motif for WRKY transcription factors, in their promoter region. Intriguingly, ZmWRKY4 belongs to group I WRKYs with two WRKY domains. Moreover, the synchronized expression patterns indicate that ZmWRKY4 might play a critical role in either regulating the ZmSOD4 and ZmcAPX expression or cooperating with them in response to stress and phytohormone. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Differential expression of non-coding RNAs and continuous evolution of the X chromosome in testicular transcriptome of two mouse species.

    PubMed

    Homolka, David; Ivanek, Robert; Forejt, Jiri; Jansa, Petr

    2011-02-14

    Tight regulation of testicular gene expression is a prerequisite for male reproductive success, while differentiation of gene activity in spermatogenesis is important during speciation. Thus, comparison of testicular transcriptomes between closely related species can reveal unique regulatory patterns and shed light on evolutionary constraints separating the species. Here, we compared testicular transcriptomes of two closely related mouse species, Mus musculus and Mus spretus, which diverged more than one million years ago. We analyzed testicular expression using tiling arrays overlapping Chromosomes 2, X, Y and mitochondrial genome. An excess of differentially regulated non-coding RNAs was found on Chromosome 2 including the intronic antisense RNAs, intergenic RNAs and premature forms of Piwi-interacting RNAs (piRNAs). Moreover, striking difference was found in the expression of X-linked G6pdx gene, the parental gene of the autosomal retrogene G6pd2. The prevalence of non-coding RNAs among differentially expressed transcripts indicates their role in species-specific regulation of spermatogenesis. The postmeiotic expression of G6pdx in Mus spretus points towards the continuous evolution of X-chromosome silencing and provides an example of expression change accompanying the out-of-the X-chromosomal retroposition.

  9. Examination of the genetic basis for sexual dimorphism in the Aedes aegypti (dengue vector mosquito) pupal brain

    PubMed Central

    2014-01-01

    Background Most animal species exhibit sexually dimorphic behaviors, many of which are linked to reproduction. A number of these behaviors, including blood feeding in female mosquitoes, contribute to the global spread of vector-borne illnesses. However, knowledge concerning the genetic basis of sexually dimorphic traits is limited in any organism, including mosquitoes, especially with respect to differences in the developing nervous system. Methods Custom microarrays were used to examine global differences in female vs. male gene expression in the developing pupal head of the dengue vector mosquito, Aedes aegypti. The spatial expression patterns of a subset of differentially expressed transcripts were examined in the developing female vs. male pupal brain through in situ hybridization experiments. Small interfering RNA (siRNA)-mediated knockdown studies were used to assess the putative role of Doublesex, a terminal component of the sex determination pathway, in the regulation of sex-specific gene expression observed in the developing pupal brain. Results Transcripts (2,527), many of which were linked to proteolysis, the proteasome, metabolism, catabolic, and biosynthetic processes, ion transport, cell growth, and proliferation, were found to be differentially expressed in A. aegypti female vs. male pupal heads. Analysis of the spatial expression patterns for a subset of dimorphically expressed genes in the pupal brain validated the data set and also facilitated the identification of brain regions with dimorphic gene expression. In many cases, dimorphic gene expression localized to the optic lobe. Sex-specific differences in gene expression were also detected in the antennal lobe and mushroom body. siRNA-mediated gene targeting experiments demonstrated that Doublesex, a transcription factor with consensus binding sites located adjacent to many dimorphically expressed transcripts that function in neural development, is required for regulation of sex-specific gene expression in the developing A. aegypti brain. Conclusions These studies revealed sex-specific gene expression profiles in the developing A. aegypti pupal head and identified Doublesex as a key regulator of sexually dimorphic gene expression during mosquito neural development. PMID:25729562

  10. Unique patterns of organization and migration of FGF-expressing cells during Drosophila morphogenesis.

    PubMed

    Du, Lijuan; Zhou, Amy; Patel, Akshay; Rao, Mishal; Anderson, Kelsey; Roy, Sougata

    2017-07-01

    Fibroblast growth factors (FGF) are essential signaling proteins that regulate diverse cellular functions in developmental and metabolic processes. In Drosophila, the FGF homolog, branchless (bnl) is expressed in a dynamic and spatiotemporally restricted pattern to induce branching morphogenesis of the trachea, which expresses the Bnl-receptor, breathless (btl). Here we have developed a new strategy to determine bnl- expressing cells and study their interactions with the btl-expressing cells in the range of tissue patterning during Drosophila development. To enable targeted gene expression specifically in the bnl expressing cells, a new LexA based bnl enhancer trap line was generated using CRISPR/Cas9 based genome editing. Analyses of the spatiotemporal expression of the reporter in various embryonic stages, larval or adult tissues and in metabolic hypoxia, confirmed its target specificity and versatility. With this tool, new bnl expressing cells, their unique organization and functional interactions with the btl-expressing cells were uncovered in a larval tracheoblast niche in the leg imaginal discs, in larval photoreceptors of the developing retina, and in the embryonic central nervous system. The targeted expression system also facilitated live imaging of simultaneously labeled Bnl sources and tracheal cells, which revealed a unique morphogenetic movement of the embryonic bnl- source. Migration of bnl- expressing cells may create a dynamic spatiotemporal pattern of the signal source necessary for the directional growth of the tracheal branch. The genetic tool and the comprehensive profile of expression, organization, and activity of various types of bnl-expressing cells described in this study provided us with an important foundation for future research investigating the mechanisms underlying Bnl signaling in tissue morphogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Expression patterns of WRKY genes in di-haploid Populus simonii × P. nigra in response to salinity stress revealed by quantitative real-time PCR and RNA sequencing.

    PubMed

    Wang, Shengji; Wang, Jiying; Yao, Wenjing; Zhou, Boru; Li, Renhua; Jiang, Tingbo

    2014-10-01

    Spatio-temporal expression patterns of 13 out of 119 poplar WRKY genes indicated dynamic and tissue-specific roles of WRKY family proteins in salinity stress tolerance. To understand the expression patterns of poplar WRKY genes under salinity stress, 51 of the 119 WRKY genes were selected from di-haploid Populus simonii × P. nigra by quantitative real-time PCR (qRT-PCR). We used qRT-PCR to profile the expression of the top 13 genes under salinity stress across seven time points, and employed RNA-Seq platforms to cross-validate it. Results demonstrated that all the 13 WRKY genes were expressed in root, stem, and leaf tissues, but their expression levels and overall patterns varied notably in these tissues. Regarding overall gene expression in roots, the 13 genes were significantly highly expressed at all six time points after the treatment, reaching the plateau of expression at hour 9. In leaves, the 13 genes were similarly up-regulated from 3 to 12 h in response to NaCl treatment. In stems, however, expression levels of the 13 genes did not show significant changes after the NaCl treatment. Regarding individual gene expression across the time points and the three tissues, the 13 genes can be classified into three clusters: the lowly expressed Cluster 1 containing PthWRKY28, 45 and 105; intermediately expressed Clusters 2 including PthWRKY56, 88 and 116; and highly expressed Cluster 3 consisting of PthWRKY41, 44, 51, 61, 62, 75 and 106. In general, genes in Cluster 2 and 3 displayed a dynamic pattern of "induced amplification-recovering", suggesting that these WRKY genes and corresponding pathways may play a critical role in mediating salt response and tolerance in a dynamic and tissue-specific manner.

  12. Multiple abiotic stimuli are integrated in the regulation of rice gene expression under field conditions.

    PubMed

    Plessis, Anne; Hafemeister, Christoph; Wilkins, Olivia; Gonzaga, Zennia Jean; Meyer, Rachel Sarah; Pires, Inês; Müller, Christian; Septiningsih, Endang M; Bonneau, Richard; Purugganan, Michael

    2015-11-26

    Plants rely on transcriptional dynamics to respond to multiple climatic fluctuations and contexts in nature. We analyzed the genome-wide gene expression patterns of rice (Oryza sativa) growing in rainfed and irrigated fields during two distinct tropical seasons and determined simple linear models that relate transcriptomic variation to climatic fluctuations. These models combine multiple environmental parameters to account for patterns of expression in the field of co-expressed gene clusters. We examined the similarities of our environmental models between tropical and temperate field conditions, using previously published data. We found that field type and macroclimate had broad impacts on transcriptional responses to environmental fluctuations, especially for genes involved in photosynthesis and development. Nevertheless, variation in solar radiation and temperature at the timescale of hours had reproducible effects across environmental contexts. These results provide a basis for broad-based predictive modeling of plant gene expression in the field.

  13. Up-regulation of Wnt5a gene expression in the nitrofen-induced hypoplastic lung.

    PubMed

    Doi, Takashi; Puri, Prem

    2009-12-01

    The pathogenesis of pulmonary hypoplasia in nitrofen-induced congenital diaphragmatic hernia (CDH) still remains unclear. Wnt signaling pathways play a critical role in lung development. Whereas canonical Wnt signaling regulates branching morphogenesis during early lung development, the noncanonical Wnt5a controls late lung morphogenesis, including patterning of distal airway and vascular tubulogenesis (alveolarization). Overexpression of Wnt5a in transgenic mice and in the chick has been reported to result in severe pulmonary hypoplasia. We designed this study to test the hypothesis that the pulmonary Wnt5a gene expression is up-regulated in late stages of lung morphogenesis in CDH. Pregnant rats were exposed to either olive oil or nitrofen on day 9 of gestation (D9). Fetal lungs were harvested on D15, D18, and D21 and divided into 3 groups: control; nitrofen without CDH, CDH(-); and nitrofen with CDH, CDH(+) (n = 8 at each time-point, respectively). Wnt5a pulmonary gene expression was analyzed by real-time reverse transcription polymerase chain reaction. Immunohistochemistry was performed to evaluate Wnt5a protein expression at each time-point. Pulmonary relative mRNA expression levels of Wnt5a were significantly increased in CDH(-) and CDH(+) at D18 (1.61 +/- 0.92 and 1.81 +/- 1.20, respectively) and D21 (2.40 +/- 0.74* and 2.65 +/- 0.35*, respectively) compared to controls at D18 and D21 (0.90 +/- 0.17* and 1.69 +/- 0.53**, respectively) (*P < .05, **P < .001 vs control ). Strong Wnt5a immunoreactivity was seen in the distal epithelium at D18 and D21 in nitrofen-induced hypoplastic lung compared to controls. Up-regulation of pulmonary Wnt5a gene expression in the late lung morphogenesis may interfere with patterning of alveolarization, causing pulmonary hypoplasia in the nitrofen-induced CDH.

  14. Characterization and differential expression of three GnRH forms during reproductive development in cultured turbot Schophthalmus maximus

    NASA Astrophysics Data System (ADS)

    Zhao, Chunyan; Xu, Shihong; Feng, Chengcheng; Liu, Yifan; Yang, Yang; Wang, Yanfeng; Xiao, Yongshuang; Song, Zongcheng; Liu, Qinghua; Li, Jun

    2017-10-01

    Turbots (Schophthalmus maximus), one of the most important economic marine flatfish species, fail to undergo final spawning and spermiation naturally under artificial farming conditions. In vertebrates, reproduction is regulated by the brain-pituitary-gonadal axis (BPG-axis), and gonadotropin releasing hormone (GnRH) is one of its key components. Therefore, to better understand the physiology of reproduction in the turbot, three of the genes encoding GnRH subtypes—sbGnRH, cGnRH-II and sGnRH—were cloned and sequenced by isolating the cDNA sequences. The localizations and patterns of expression of their mRNAs were also evaluated during seasonal gonadal development. All three mRNAs were expressed abundantly in the brain; sbGnRH and sGnRH mRNAs were also detected in the gonads and pituitary gland, and sbGnRH expression was much higher than that of sGnRH, indicating the critical role of sbGnRH in regulating the BPG-axis. Moreover, the brain expression patterns of sbGnRH and sGnRH mRNAs showed an increased trend during gonadal development, peaking in mature stages. This indicated the direct regulation of gonadal development by the GnRH system. In addition, cGnRH-II mRNA expression showed no significant variations, suggesting that cGnRH-II is not critically involved in the control of reproduction. Further, the mRNA abundances of the three GnRH forms in the breeding season were significantly higher than those in immature and post-breeding stages in all analyzed brain areas. Therefore, we propose that sbGnRH is the most important hormone for the regulation of reproduction in turbot via the BPG-axis. These results will help in better understanding the reproductive endocrine mechanisms of turbots and lay the groundwork for additional studies aimed at comparing the reproductive physiology of wild individuals with those raised under artificial conditions.

  15. Tissue-Specific, Development-Dependent Phenolic Compounds Accumulation Profile and Gene Expression Pattern in Tea Plant [Camellia sinensis

    PubMed Central

    Li, Weiwei; Zhao, Lei; Meng, Fei; Wang, Yunsheng; Tan, Huarong; Yang, Hua; Wei, Chaoling; Wan, Xiaochun; Gao, Liping; Xia, Tao

    2013-01-01

    Phenolic compounds in tea plant [Camellia sinensis (L.)] play a crucial role in dominating tea flavor and possess a number of key pharmacological benefits on human health. The present research aimed to study the profile of tissue-specific, development-dependent accumulation pattern of phenolic compounds in tea plant. A total of 50 phenolic compounds were identified qualitatively using liquid chromatography in tandem mass spectrometry technology. Of which 29 phenolic compounds were quantified based on their fragmentation behaviors. Most of the phenolic compounds were higher in the younger leaves than that in the stem and root, whereas the total amount of proanthocyanidins were unexpectedly higher in the root. The expression patterns of 63 structural and regulator genes involved in the shikimic acid, phenylpropanoid, and flavonoid pathways were analyzed by quantitative real-time polymerase chain reaction and cluster analysis. Based on the similarity of their expression patterns, the genes were classified into two main groups: C1 and C2; and the genes in group C1 had high relative expression level in the root or low in the bud and leaves. The expression patterns of genes in C2-2-1 and C2-2-2-1 groups were probably responsible for the development-dependent accumulation of phenolic compounds in the leaves. Enzymatic analysis suggested that the accumulation of catechins was influenced simultaneously by catabolism and anabolism. Further research is recommended to know the expression patterns of various genes and the reason for the variation in contents of different compounds in different growth stages and also in different organs. PMID:23646127

  16. Expression of cholera toxin under non-AKI conditions in Vibrio cholerae El Tor induced by increasing the exposed surface of cultures.

    PubMed

    Sánchez, Joaquín; Medina, Gerardo; Buhse, Thomas; Holmgren, Jan; Soberón-Chavez, Gloria

    2004-03-01

    The regulatory systems controlling expression of the ctxAB genes encoding cholera toxin (CT) in the classical and El Tor biotypes of pathogenic Vibrio cholerae have been characterized and found to be almost identical. Notwithstanding this, special in vitro conditions, called AKI conditions, are required for El Tor bacteria to produce CT. The AKI conditions involve biphasic cultures. In phase 1 the organism is grown in a still tube for 4 h. In phase 2 the medium is poured into a flask to continue growth with shaking. Virtually no expression of CT occurs if this protocol is not followed. Here we demonstrated that CT expression takes place in single-phase still cultures if the volume-to-surface-area ratio is decreased, both under air and under an inert atmosphere. The expression of key genes involved in the regulation of CT production was analyzed, and we found that the expression pattern closely resembles the in vivo expression pattern.

  17. In vivo biomarker expression patterns are preserved in 3D cultures of Prostate Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Windus, Louisa C.E.; Kiss, Debra L.; Glover, Tristan

    2012-11-15

    Here we report that Prostate Cancer (PCa) cell-lines DU145, PC3, LNCaP and RWPE-1 grown in 3D matrices in contrast to conventional 2D monolayers, display distinct differences in cell morphology, proliferation and expression of important biomarker proteins associated with cancer progression. Consistent with in vivo growth rates, in 3D cultures, all PCa cell-lines were found to proliferate at significantly lower rates in comparison to their 2D counterparts. Moreover, when grown in a 3D matrix, metastatic PC3 cell-lines were found to mimic more precisely protein expression patterns of metastatic tumour formation as found in vivo. In comparison to the prostate epithelial cell-linemore » RWPE-1, metastatic PC3 cell-lines exhibited a down-regulation of E-cadherin and {alpha}6 integrin expression and an up-regulation of N-cadherin, Vimentin and {beta}1 integrin expression and re-expressed non-transcriptionally active AR. In comparison to the non-invasive LNCaP cell-lines, PC3 cells were found to have an up-regulation of chemokine receptor CXCR4, consistent with a metastatic phenotype. In 2D cultures, there was little distinction in protein expression between metastatic, non-invasive and epithelial cells. These results suggest that 3D cultures are more representative of in vivo morphology and may serve as a more biologically relevant model in the drug discovery pipeline. -- Highlights: Black-Right-Pointing-Pointer We developed and optimised 3D culturing techniques for Prostate Cancer cell-lines. Black-Right-Pointing-Pointer We investigated biomarker expression in 2D versus 3D culture techniques. Black-Right-Pointing-Pointer Metastatic PC3 cells re-expressed non-transcriptionally active androgen receptor. Black-Right-Pointing-Pointer Metastatic PCa cell lines retain in vivo-like antigenic profiles in 3D cultures.« less

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Yan; Chen, Yue Yi; Yang, Shu Guang

    Metallothioneins (MTs) are of low molecular mass, cysteine-rich proteins. They play an important role in the detoxification of heavy metals and homeostasis of intracellular metal ions, and protecting against intracellular oxidative damages. In this study a full-length cDNA of type 2 plant metallothioneins, HbMT2a, was isolated from 25 mM Polyethyleneglycol (PEG) stressed leaves of Hevea brasiliensis by RACE. The HbMT2a was 372 bp in length and had a 237 bp open reading frame (ORF) encoding for a protein of 78 amino acid residues with molecular mass of 7.772 kDa. The expression of HbMT2a in the detached leaves of rubber tree clone RY7-33-97more » was up-regulated by Me-JA, ABA, PEG, H{sub 2}O{sub 2}, Cu{sup 2+} and Zn{sup 2+}, but down-regulated by water. The role of HbMT2a protein in protecting against metal toxicity was demonstrated in vitro. PET-28a-HbMT2-beared Escherichia coli. Differential expression of HbMT2a upon treatment with 10 °C was observed in the detached leaves of rubber tree clone 93-114 which is cold-resistant and Reken501 which is cold-sensitive. The expression patterns of HbMT2a in the two rubber tree clones may be ascribed to a change in the level of endogenous H{sub 2}O{sub 2}. - Highlights: • Cloning an HbMT2a gene from rubber tree. • Analyzing expression patterns of HbMT2a upon abiotic stress and heavy metal stress. • Finding different expression patterns of HbMT2a among two Hevea germplasm. • The expressed protein of HbMT2a enhances copper and zinc tolerance in Escherichia coli.« less

  19. Evolution of Daily Gene Co-expression Patterns from Algae to Plants

    PubMed Central

    de los Reyes, Pedro; Romero-Campero, Francisco J.; Ruiz, M. Teresa; Romero, José M.; Valverde, Federico

    2017-01-01

    Daily rhythms play a key role in transcriptome regulation in plants and microalgae orchestrating responses that, among other processes, anticipate light transitions that are essential for their metabolism and development. The recent accumulation of genome-wide transcriptomic data generated under alternating light:dark periods from plants and microalgae has made possible integrative and comparative analysis that could contribute to shed light on the evolution of daily rhythms in the green lineage. In this work, RNA-seq and microarray data generated over 24 h periods in different light regimes from the eudicot Arabidopsis thaliana and the microalgae Chlamydomonas reinhardtii and Ostreococcus tauri have been integrated and analyzed using gene co-expression networks. This analysis revealed a reduction in the size of the daily rhythmic transcriptome from around 90% in Ostreococcus, being heavily influenced by light transitions, to around 40% in Arabidopsis, where a certain independence from light transitions can be observed. A novel Multiple Bidirectional Best Hit (MBBH) algorithm was applied to associate single genes with a family of potential orthologues from evolutionary distant species. Gene duplication, amplification and divergence of rhythmic expression profiles seems to have played a central role in the evolution of gene families in the green lineage such as Pseudo Response Regulators (PRRs), CONSTANS-Likes (COLs), and DNA-binding with One Finger (DOFs). Gene clustering and functional enrichment have been used to identify groups of genes with similar rhythmic gene expression patterns. The comparison of gene clusters between species based on potential orthologous relationships has unveiled a low to moderate level of conservation of daily rhythmic expression patterns. However, a strikingly high conservation was found for the gene clusters exhibiting their highest and/or lowest expression value during the light transitions. PMID:28751903

  20. Gene expression signatures in tree shrew choroid in response to three myopiagenic conditions

    PubMed Central

    He, Li; Frost, Michael R.; Siegwart, John T.; Norton, Thomas T.

    2014-01-01

    We examined gene expression in tree shrew choroid in response to three different myopiagenic conditions: minus lens (ML) wear, form deprivation (FD), and continuous darkness (DK). Four groups of tree shrews (n = 7 per group) were used. Starting 24 days after normal eye opening (days of visual experience [DVE]), the ML group wore a monocular −5 D lens for 2 days. The FD group wore a monocular translucent diffuser for 2 days. The DK group experienced continuous darkness binocularly for 11 days, starting at 17 DVE. An age-matched normal group was examined at 26 DVE. Quantitative PCR was used to measure the relative (treated eye vs. control eye) differences in mRNA levels in the choroid for 77 candidate genes. Small myopic changes were observed in the treated eyes (relative to the control eyes) of the ML group (−1.0 ± 0.2 D; mean ± SEM) and FD group (−1.9 ± 0.2 D). A larger myopia developed in the DK group (−4.4 ± 1.0 D) relative to Normal eyes (both groups, mean of right and left eyes). In the ML group, 28 genes showed significant differential mRNA expression; eighteen were down-regulated. A very similar pattern occurred in the FD group; twenty-seven of the same genes were similarly regulated, along with five additional genes. Fewer expression differences in the DK group were significant compared to normal or the control eyes of the ML and FD groups, but the pattern was similar to that of the ML and FD differential expression patterns. These data suggest that, at the level of the choroid, the gene expression signatures produced by “GO” emmetropization signals are highly similar despite the different visual conditions. PMID:25072854

  1. Epigenetic down-regulated DDX10 promotes cell proliferation through Akt/NF-κB pathway in ovarian cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gai, Muhuizi; Bo, Qifang; Qi, Lixia, E-mail: lixiaqi_dph@sina.com

    Ovarian cancer contributes to the majority of ovarian cancer, while the molecular mechanisms remain elusive. Recently, some DEAD box protein 1 has been reported play a tumor suppressor role in ovarian cancer progression. However, the functions of DEAD box protein (DDX) members in ovarian cancer development remain largely unknown. In current study, we retrieved GEO databases and surprisingly found that DDX10 is significantly down-regulated in ovarian cancer tissues compared with normal ovary. These findings suggest that DDX10 might also play a suppressive role in ovarian cancer. We then validated the down-regulated expression pattern of DDX10 in fresh ovarian cancer tissues.more » Furthermore, both loss- and gain-functions assays reveal that the down-regulated DDX10 could promote ovarian cancer proliferation in vitro and the xenograft subcutaneous tumor formation assays confirmed these findings in vivo. In addition, we found that DDX10 is epigenetic silenced by miR-155-5p in ovarian cancer. Moreover, we further preliminary illustrated that down-regulated DDX10 promotes ovarian cancer cell proliferation through Akt/NF-κB pathway. Taken together, in current study, we found a novel tumor suppressor, DDX10, is epigenetic silenced by miR-155-5p in ovarian cancer, and the down-regulated expression pattern of DDX10 promotes ovarian cancer proliferation through Akt/NF-κB pathway. Our findings shed the light that DDX families might be a novel for ovarian cancer treatment. - Highlights: • A novel DEAD box protein, DDX10 is significantly down-regulated in ovarian cancer tissues. • Down-regulated DDX10 promotes ovarian cancer cell proliferation and growth both in vitro and in vivo. • miR-155-5p is highly expressed in ovarian cancer tissues and epigenetically targets DDX10. • DDX10 and miR-155-5p regulates Akt/p65 axis in ovarian cancer cells.« less

  2. Diurnal Cycling Transcription Factors of Pineapple Revealed by Genome-Wide Annotation and Global Transcriptomic Analysis

    PubMed Central

    Sharma, Anupma; Wai, Ching Man; Ming, Ray

    2017-01-01

    Abstract Circadian clock provides fitness advantage by coordinating internal metabolic and physiological processes to external cyclic environments. Core clock components exhibit daily rhythmic changes in gene expression, and the majority of them are transcription factors (TFs) and transcription coregulators (TCs). We annotated 1,398 TFs from 67 TF families and 80 TCs from 20 TC families in pineapple, and analyzed their tissue-specific and diurnal expression patterns. Approximately 42% of TFs and 45% of TCs displayed diel rhythmic expression, including 177 TF/TCs cycling only in the nonphotosynthetic leaf tissue, 247 cycling only in the photosynthetic leaf tissue, and 201 cycling in both. We identified 68 TF/TCs whose cycling expression was tightly coupled between the photosynthetic and nonphotosynthetic leaf tissues. These TF/TCs likely coordinate key biological processes in pineapple as we demonstrated that this group is enriched in homologous genes that form the core circadian clock in Arabidopsis and includes a STOP1 homolog. Two lines of evidence support the important role of the STOP1 homolog in regulating CAM photosynthesis in pineapple. First, STOP1 responds to acidic pH and regulates a malate channel in multiple plant species. Second, the cycling expression pattern of the pineapple STOP1 and the diurnal pattern of malate accumulation in pineapple leaf are correlated. We further examined duplicate-gene retention and loss in major known circadian genes and refined their evolutionary relationships between pineapple and other plants. Significant variations in duplicate-gene retention and loss were observed for most clock genes in both monocots and dicots. PMID:28922793

  3. Molecular cloning, mRNA expression and tissue distribution analysis of Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors.

    PubMed

    Tian, Xue; Meng, Xiaolin; Wang, Liangyan; Song, Yunfei; Zhang, Danli; Ji, Yuankai; Li, Xuejun; Dong, Changsheng

    2015-01-25

    Slc7a11 encoding solute carrier family 7 member 11 (amionic amino acid transporter light chain, xCT), has been identified to be a critical genetic regulator of pheomelanin synthesis in hair and melanocytes. To better understand the molecular characterization of Slc7a11 and the expression patterns in skin of white versus brown alpaca (lama paco), we cloned the full length coding sequence (CDS) of alpaca Slc7a11 gene and analyzed the expression patterns using Real Time PCR, Western blotting and immunohistochemistry. The full length CDS of 1512bp encodes a 503 amino acid polypeptide. Sequence analysis showed that alpaca xCT contains 12 transmembrane regions consistent with the highly conserved amino acid permease (AA_permease_2) domain similar to other vertebrates. Sequence alignment and phylogenetic analysis revealed that alpaca xCT had the highest identity and shared the same branch with Camelus ferus. Real Time PCR and Western blotting suggested that xCT was expressed at significantly high levels in brown alpaca skin, and transcripts and protein possessed the same expression pattern in white and brown alpaca skins. Additionally, immunohistochemical analysis further demonstrated that xCT staining was robustly increased in the matrix and root sheath of brown alpaca skin compared with that of white. These results suggest that Slc7a11 functions in alpaca coat color regulation and offer essential information for further exploration on the role of Slc7a11 in melanogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Integrative analyses of conserved WNT clusters and their co-operative behaviour in human breast cancer

    PubMed Central

    Qurrat-ul-Ain; Seemab, Umair; Nawaz, Sulaman; Rashid, Sajid

    2011-01-01

    In human, WNT gene clusters are highly conserved at specie level and associated with carcinogenesis. Among them, WNT-10A and WNT-6 genes clustered in chromosome 2q35 are homologous to WNT-10B and WNT-1 located in chromosome 12q13, respectively. In an attempt to study co-regulation, the coordinated expression of these genes was monitored in human breast cancer tissues. As compared to normal tissue, both WNT-10A and WNT-10B genes exhibited lower expression while WNT-6 and WNT-1 showed increased expression in breast cancer tissues. The co-expression pattern was elaborated by detailed phylogenetic and syntenic analyses. Moreover, the intergenic and intragenic regions for these gene clusters were analyzed for studying the transcriptional regulation. In this context, adequate conserved binding sites for SOX and TCF family of transcriptional factors were observed. We propose that SOX9 and TCF4 may compete for binding at the promoters of WNT family genes thus regulating the disease phenotype. PMID:22355234

  5. Associations between transcriptional changes and protein phenotypes provide insights into immune regulation in corals.

    PubMed

    Fuess, Lauren E; Pinzόn C, Jorge H; Weil, Ernesto; Mydlarz, Laura D

    2016-09-01

    Disease outbreaks in marine ecosystems have driven worldwide declines of numerous taxa, including corals. Some corals, such as Orbicella faveolata, are particularly susceptible to disease. To explore the mechanisms contributing to susceptibility, colonies of O. faveolata were exposed to immune challenge with lipopolysaccharides. RNA sequencing and protein activity assays were used to characterize the response of corals to immune challenge. Differential expression analyses identified 17 immune-related transcripts that varied in expression post-immune challenge. Network analyses revealed several groups of transcripts correlated to immune protein activity. Several transcripts, which were annotated as positive regulators of immunity were included in these groups, and some were downregulated following immune challenge. Correlations between expression of these transcripts and protein activity results further supported the role of these transcripts in positive regulation of immunity. The observed pattern of gene expression and protein activity may elucidate the processes contributing to the disease susceptibility of species like O. faveolata. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Regulation of chromatin organization and inducible gene expression by a Drosophila insulator

    PubMed Central

    Wood, Ashley M.; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C.; Jones, Keith C.; Corces, Victor G.

    2011-01-01

    SUMMARY Insulators are multi-protein-DNA complexes thought to affect gene expression by mediating inter- and intra-chromosomal interactions. Drosophila insulators contain specific DNA binding proteins plus common components, such as CP190, that facilitate these interactions. Here we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to the DNA in order to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. PMID:21981916

  7. Regulation of chromatin organization and inducible gene expression by a Drosophila insulator.

    PubMed

    Wood, Ashley M; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C; Jones, Keith C; Corces, Victor G

    2011-10-07

    Insulators are multiprotein-DNA complexes thought to affect gene expression by mediating inter- and intrachromosomal interactions. Drosophila insulators contain specific DNA-binding proteins plus common components, such as CP190, that facilitate these interactions. Here, we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA-binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to DNA to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. An R2R3-MYB Transcription Factor Regulates Eugenol Production in Ripe Strawberry Fruit Receptacles1

    PubMed Central

    Medina-Puche, Laura; Molina-Hidalgo, Francisco Javier; Boersma, Maaike; Schuurink, Robert C.; López-Vidriero, Irene; Solano, Roberto; Franco-Zorrilla, José-Manuel; Caballero, José Luis; Blanco-Portales, Rosario; Muñoz-Blanco, Juan

    2015-01-01

    Eugenol is a volatile phenylpropanoid that contributes to flower and ripe fruit scent. In ripe strawberry (Fragaria × ananassa) fruit receptacles, eugenol is biosynthesized by eugenol synthase (FaEGS2). However, the transcriptional regulation of this process is still unknown. We have identified and functionally characterized an R2R3 MYB transcription factor (EMISSION OF BENZENOID II [FaEOBII]) that seems to be the orthologous gene of PhEOBII from Petunia hybrida, which contributes to the regulation of eugenol biosynthesis in petals. The expression of FaEOBII was ripening related and fruit receptacle specific, although high expression values were also found in petals. This expression pattern of FaEOBII correlated with eugenol content in both fruit receptacle and petals. The expression of FaEOBII was repressed by auxins and activated by abscisic acid, in parallel to the ripening process. In ripe strawberry receptacles, where the expression of FaEOBII was silenced, the expression of CINNAMYL ALCOHOL DEHYDROGENASE1 and FaEGS2, two structural genes involved in eugenol production, was down-regulated. A subsequent decrease in eugenol content in ripe receptacles was also observed, confirming the involvement of FaEOBII in eugenol metabolism. Additionally, the expression of FaEOBII was under the control of FaMYB10, another R2R3 MYB transcription factor that regulates the early and late biosynthetic genes from the flavonoid/phenylpropanoid pathway. In parallel, the amount of eugenol in FaMYB10-silenced receptacles was also diminished. Taken together, these data indicate that FaEOBII plays a regulating role in the volatile phenylpropanoid pathway gene expression that gives rise to eugenol production in ripe strawberry receptacles. PMID:25931522

  9. PU.1 regulates TCR expression by modulating GATA-3 activity

    PubMed Central

    Chang, Hua-Chen; Han, Ling; Jabeen, Rukhsana; Carotta, Sebastian; Nutt, Stephen L.; Kaplan, Mark H.

    2009-01-01

    The Ets transcription factor PU.1 is a master regulator for the development of multiple lineages during hematopoiesis. The expression pattern of PU.1 is dynamically regulated during early T lineage development in the thymus. We previously revealed that PU.1 delineates heterogeneity of effector Th2 populations. In this study, we further define the function of PU.1 on the Th2 phenotype using mice that specifically lack PU.1 in T cells using an lck-Cre transgene with a conditional Sfpi1 allele (Sfpi1lck-/-). While deletion of PU.1 by the lck-Cre transgene does not affect T cell development, Sfpi1lck-/- T cells have a lower activation threshold than wild type T cells. When TCR engagement is limiting, Sfpi1lck-/- T cells cultured in Th2 polarizing conditions secrete higher levels of Th2 cytokines and have greater cytokine homogeneity than wild type cells. We show that PU.1 modulates the levels of TCR expression in CD4+ T cells by regulating the DNA-binding activity of GATA-3 and limiting GATA-3 regulation of TCR gene expression. GATA-3 dependent regulation of TCR expression is also observed in Th1 and Th2 cells. In CD4+ T cells, PU.1 expression segregates into subpopulations of cells that have lower levels of surface TCR, suggesting that PU.1 contributes to the heterogeneity of TCR expression. Thus, we have identified a mechanism whereby increased GATA-3 function in the absence of the antagonizing activity of PU.1 leads to increased TCR expression, a reduced activation threshold and increased homogeneity in Th2 populations. PMID:19801513

  10. Selective rescue of selenoprotein expression in mice lacking a highly specialized methyl group in selenocysteine tRNA.

    PubMed

    Carlson, Bradley A; Xu, Xue-Ming; Gladyshev, Vadim N; Hatfield, Dolph L

    2005-02-18

    Selenocysteine (Sec) is the 21st amino acid in the genetic code. Its tRNA is variably methylated on the 2'-O-hydroxyl site of the ribosyl moiety at position 34 (Um34). Herein, we identified a role of Um34 in regulating the expression of some, but not all, selenoproteins. A strain of knock-out transgenic mice was generated, wherein the Sec tRNA gene was replaced with either wild type or mutant Sec tRNA transgenes. The mutant transgene yielded a tRNA that lacked two base modifications, N(6)-isopentenyladenosine at position 37 (i(6)A37) and Um34. Several selenoproteins, including glutathione peroxidases 1 and 3, SelR, and SelT, were not detected in mice rescued with the mutant transgene, whereas other selenoproteins, including thioredoxin reductases 1 and 3 and glutathione peroxidase 4, were expressed in normal or reduced levels. Northern blot analysis suggested that other selenoproteins (e.g. SelW) were also poorly expressed. This novel regulation of protein expression occurred at the level of translation and manifested a tissue-specific pattern. The available data suggest that the Um34 modification has greater influence than the i(6)A37 modification in regulating the expression of various mammalian selenoproteins and Um34 is required for synthesis of several members of this protein class. Many proteins that were poorly rescued appear to be involved in responses to stress, and their expression is also highly dependent on selenium in the diet. Furthermore, their mRNA levels are regulated by selenium and are subject to nonsense-mediated decay. Overall, this study described a novel mechanism of regulation of protein expression by tRNA modification that is in turn regulated by levels of the trace element, selenium.

  11. [Gene expression and activity regulation of two calmodulin binding protein kinases in tobacco seedling].

    PubMed

    Hua, Wei; Li, Rong-Jun; Liang, Shu-Ping; Lu, Ying-Tang

    2005-06-01

    Two different calmodulin-binding protein kinase cDNAs (NtCBK1/2) have been isolated from tobacco. To understand the CBK protein activity regulation, we compared the activity regulation of NtCBK1 and NtCBK2 by pH, Mg(2+) concentration and Na(+) concentration. We found the autophosphorylation of NtCBK1/2 reached the maximum in pH 7.5 and 8 respectively; Mg(2+) and Na(+) shown different effects on the activity of NtCBKs, high and low Mg(2+) concentrations both inhibited the activity of NtCBKs, but Na+ had little effect on the kinase activity. In addition, to obtain further insight about the physiological roles of individual NtCBKs, we detected the expression profiles of CBKs. The results revealed different patterns of expression of NtCBK1 and NtCBK2. Both are largely expressed in leaf and flower; but in stem and root, NtCBK1 gene had stronger expression than NtCBK2. NtCBK2 expression was induced by GA treatment, while NtCBK1 expression remained unchanged under GA treatment. Expression of both NtCBK1 and NtCBK2 increased in response to salt stress, the former to a greater extent, and both expressions did not change under high/low temperature, drought, NAA and ABA treatments.

  12. Tissue-specific NETs alter genome organization and regulation even in a heterologous system.

    PubMed

    de Las Heras, Jose I; Zuleger, Nikolaj; Batrakou, Dzmitry G; Czapiewski, Rafal; Kerr, Alastair R W; Schirmer, Eric C

    2017-01-02

    Different cell types exhibit distinct patterns of 3D genome organization that correlate with changes in gene expression in tissue and differentiation systems. Several tissue-specific nuclear envelope transmembrane proteins (NETs) have been found to influence the spatial positioning of genes and chromosomes that normally occurs during tissue differentiation. Here we study 3 such NETs: NET29, NET39, and NET47, which are expressed preferentially in fat, muscle and liver, respectively. We found that even when exogenously expressed in a heterologous system they can specify particular genome organization patterns and alter gene expression. Each NET affected largely different subsets of genes. Notably, the liver-specific NET47 upregulated many genes in HT1080 fibroblast cells that are normally upregulated in hepatogenesis, showing that tissue-specific NETs can favor expression patterns associated with the tissue where the NET is normally expressed. Similarly, global profiling of peripheral chromatin after exogenous expression of these NETs using lamin B1 DamID revealed that each NET affected the nuclear positioning of distinct sets of genomic regions with a significant tissue-specific component. Thus NET influences on genome organization can contribute to gene expression changes associated with differentiation even in the absence of other factors and overt cellular differentiation changes.

  13. Cell-fate specification in the epidermis: a common patterning mechanism in the root and shoot.

    PubMed

    Schiefelbein, John

    2003-02-01

    The specification of epidermal hairs in Arabidopsis provides a useful model for the study of pattern formation in plants. Although the distributions of hair cells in the root and shoot appear quite different, recent studies show that pattern formation in each relies on a common cassette of transcriptional regulators. During development in each organ, neighboring cells compete to express regulators that specify the primary cell fate (including WEREWOLF [WER]/GLABRA1 [GL1], GL3/bHLH, TRANSPARENT TESTA GLABRA [TTG], and GL2), as well as those that prevent their neighbors from adopting this fate (including CAPRICE [CPC] and TRIPTYCHON [TRY]). The basic mechanism of lateral inhibition with feedback that has been uncovered by recent studies provides a conceptual framework for understanding how patterns of cell fate in general may be specified during plant development.

  14. Identification and Characterization of MicroRNAs in Ovary and Testis of Nile Tilapia (Oreochromis niloticus) by Using Solexa Sequencing Technology

    PubMed Central

    Zhou, Yi; Yu, Fan; Gao, Yun; Luo, Yongju; Tang, Zhanyang; Guo, Zhongbao; Guo, Enyan; Gan, Xi; Zhang, Ming; Zhang, Yaping

    2014-01-01

    MicroRNAs (miRNAs) are endogenous non-coding small RNAs which play important roles in the regulation of gene expression by cleaving or inhibiting the translation of target gene transcripts. Thereinto, some specific miRNAs show regulatory activities in gonad development via translational control. In order to further understand the role of miRNA-mediated posttranscriptional regulation in Nile tilapia (Oreochromis niloticus) ovary and testis, two small RNA libraries of Nile tilapia were sequenced by Solexa small RNA deep sequencing methods. A total of 9,731,431 and 8,880,497 raw reads, representing 5,407,800 and 4,396,281 unique sequences were obtained from the sexually mature ovaries and testes, respectively. After comparing the small RNA sequences with the Rfam database, 1,432,210 reads in ovaries and 984,146 reads in testes were matched to the genome sequence of Nile tilapia. Bioinformatic analysis identified 764 mature miRNA, 209 miRNA-5p and 202 miRNA-3p were found in the two libraries, of which 525 known miRNAs are both expressed in the ovary and testis of Nile tilapia. Comparison of expression profiles of the testis, miR-727, miR-129 and miR-29 families were highly expressed in tilapia ovary. Additionally, miR-132, miR-212, miR-33a and miR-135b families, showed significant higher expression in testis compared with that in ovary. Furthermore, the expression patterns of the miRNAs were analyzed in different developmental stages of gonad. The result showed different expression patterns were observed during development of testis and ovary. In addition, the identification and characterization of differentially expressed miRNAs in the ovaries and testis of Nile tilapia provides important information on the role of miRNA in the regulation of the ovarian and testicular development and function. This data will be helpful to facilitate studies on the regulation of miRNAs during teleosts reproduction. PMID:24466258

  15. Characterization of a Tomato Xyloglucan Endotransglycosylase Gene That Is Down-Regulated by Auxin in Etiolated Hypocotyls1

    PubMed Central

    Catalá, Carmen; Rose, Jocelyn K.C.; York, William S.; Albersheim, Peter; Darvill, Alan G.; Bennett, Alan B.

    2001-01-01

    The reorganization of the cellulose-xyloglucan matrix is proposed to serve as an important mechanism in the control of strength and extensibility of the plant primary cell wall. One of the key enzymes associated with xyloglucan metabolism is xyloglucan endotransglycosylase (XET), which catalyzes the endocleavage and religation of xyloglucan molecules. As with other plant species, XETs are encoded by a gene family in tomato (Lycopersicon esculentum cv T5). In a previous study, we demonstrated that the tomato XET gene LeEXT was abundantly expressed in the rapidly expanding region of the etiolated hypocotyl and was induced to higher levels by auxin. Here, we report the identification of a new tomato XET gene, LeXET2, that shows a different spatial expression and diametrically opposite pattern of auxin regulation from LeEXT. LeXET2 was expressed more abundantly in the mature nonelongating regions of the hypocotyl, and its mRNA abundance decreased dramatically following auxin treatment of etiolated hypocotyl segments. Analysis of the effect of several plant hormones on LeXET2 expression revealed that the inhibition of LeXET2 mRNA accumulation also occurred with cytokinin treatment. LeXET2 mRNA levels increased significantly in hypocotyl segments treated with gibberellin, but this increase could be prevented by adding auxin or cytokinin to the incubation media. Recombinant LeXET2 protein obtained by heterologous expression in Pichia pastoris exhibited greater XET activity against xyloglucan from tomato than that from three other species. The opposite patterns of expression and differential auxin regulation of LeXET2 and LeEXT suggest that they encode XETs with distinct roles during plant growth and development. PMID:11706197

  16. RNA-Seq Analysis of Developing Pecan (Carya illinoinensis) Embryos Reveals Parallel Expression Patterns among Allergen and Lipid Metabolism Genes.

    PubMed

    Mattison, Christopher P; Rai, Ruhi; Settlage, Robert E; Hinchliffe, Doug J; Madison, Crista; Bland, John M; Brashear, Suzanne; Graham, Charles J; Tarver, Matthew R; Florane, Christopher; Bechtel, Peter J

    2017-02-22

    The pecan nut is a nutrient-rich part of a healthy diet full of beneficial fatty acids and antioxidants, but can also cause allergic reactions in people suffering from food allergy to the nuts. The transcriptome of a developing pecan nut was characterized to identify the gene expression occurring during the process of nut development and to highlight those genes involved in fatty acid metabolism and those that commonly act as food allergens. Pecan samples were collected at several time points during the embryo development process including the water, gel, dough, and mature nut stages. Library preparation and sequencing were performed using Illumina-based mRNA HiSeq with RNA from four time points during the growing season during August and September 2012. Sequence analysis with Trinotate software following the Trinity protocol identified 133,000 unigenes with 52,267 named transcripts and 45,882 annotated genes. A total of 27,312 genes were defined by GO annotation. Gene expression clustering analysis identified 12 different gene expression profiles, each containing a number of genes. Three pecan seed storage proteins that commonly act as allergens, Car i 1, Car i 2, and Car i 4, were significantly up-regulated during the time course. Up-regulated fatty acid metabolism genes that were identified included acyl-[ACP] desaturase and omega-6 desaturase genes involved in oleic and linoleic acid metabolism. Notably, a few of the up-regulated acyl-[ACP] desaturase and omega-6 desaturase genes that were identified have expression patterns similar to the allergen genes based upon gene expression clustering and qPCR analysis. These findings suggest the possibility of coordinated accumulation of lipids and allergens during pecan nut embryogenesis.

  17. Temporal and Embryonic Lineage-Dependent Regulation of Human Vascular SMC Development by NOTCH3

    PubMed Central

    Granata, Alessandra; Bernard, William G.; Zhao, Ning; Mccafferty, John; Lilly, Brenda

    2015-01-01

    Vascular smooth muscle cells (SMCs), which arise from multiple embryonic progenitors, have unique lineage-specific properties and this diversity may contribute to spatial patterns of vascular diseases. We developed in vitro methods to generate distinct vascular SMC subtypes from human pluripotent stem cells, allowing us to explore their intrinsic differences and the mechanisms involved in SMC development. Since Notch signaling is thought to be one of the several key regulators of SMC differentiation and function, we profiled the expression of Notch receptors, ligands, and downstream elements during the development of origin-specific SMC subtypes. NOTCH3 expression in our in vitro model varied in a lineage- and developmental stage-specific manner so that the highest expression in mature SMCs was in those derived from paraxial mesoderm (PM). This pattern was consistent with the high expression level of NOTCH3 observed in the 8–9 week human fetal descending aorta, which is populated by SMCs of PM origin. Silencing NOTCH3 in mature SMCs in vitro reduced SMC markers in cells of PM origin preferentially. Conversely, during early development, NOTCH3 was highly expressed in vitro in SMCs of neuroectoderm (NE) origin. Inhibition of NOTCH3 in early development resulted in a significant downregulation of specific SMC markers exclusively in the NE lineage. Corresponding to this prediction, the Notch3-null mouse showed reduced expression of Acta2 in the neural crest-derived SMCs of the aortic arch. Thus, Notch3 signaling emerges as one of the key regulators of vascular SMC differentiation and maturation in vitro and in vivo in a lineage- and temporal-dependent manner. PMID:25539150

  18. A distal modular enhancer complex acts to control pituitary- and nervous system-specific expression of the LHX3 regulatory gene.

    PubMed

    Mullen, Rachel D; Park, Soyoung; Rhodes, Simon J

    2012-02-01

    Lin-11, Isl-1, and Mec-3 (LIM)-homeodomain (HD)-class transcription factors are critical for many aspects of mammalian organogenesis. Of these, LHX3 is essential for pituitary gland and nervous system development. Pediatric patients with mutations in coding regions of the LHX3 gene have complex syndromes, including combined pituitary hormone deficiency and nervous system defects resulting in symptoms such as dwarfism, thyroid insufficiency, infertility, and developmental delay. The pathways underlying early pituitary development are poorly understood, and the mechanisms by which the LHX3 gene is regulated in vivo are not known. Using bioinformatic and transgenic mouse approaches, we show that multiple conserved enhancers downstream of the human LHX3 gene direct expression to the developing pituitary and spinal cord in a pattern consistent with endogenous LHX3 expression. Several transferable cis elements can individually guide nervous system expression. However, a single 180-bp minimal enhancer is sufficient to confer specific expression in the developing pituitary. Within this sequence, tandem binding sites recognized by the islet-1 (ISL1) LIM-HD protein are essential for enhancer activity in the pituitary and spine, and a pituitary homeobox 1 (PITX1) bicoid class HD element is required for spatial patterning in the developing pituitary. This study establishes ISL1 as a novel transcriptional regulator of LHX3 and describes a potential mechanism for regulation by PITX1. Moreover, these studies suggest models for analyses of the transcriptional pathways coordinating the expression of other LIM-HD genes and provide tools for the molecular analysis and genetic counseling of pediatric patients with combined pituitary hormone deficiency.

  19. A Distal Modular Enhancer Complex Acts to Control Pituitary- and Nervous System-Specific Expression of the LHX3 Regulatory Gene

    PubMed Central

    Mullen, Rachel D.; Park, Soyoung

    2012-01-01

    Lin-11, Isl-1, and Mec-3 (LIM)-homeodomain (HD)-class transcription factors are critical for many aspects of mammalian organogenesis. Of these, LHX3 is essential for pituitary gland and nervous system development. Pediatric patients with mutations in coding regions of the LHX3 gene have complex syndromes, including combined pituitary hormone deficiency and nervous system defects resulting in symptoms such as dwarfism, thyroid insufficiency, infertility, and developmental delay. The pathways underlying early pituitary development are poorly understood, and the mechanisms by which the LHX3 gene is regulated in vivo are not known. Using bioinformatic and transgenic mouse approaches, we show that multiple conserved enhancers downstream of the human LHX3 gene direct expression to the developing pituitary and spinal cord in a pattern consistent with endogenous LHX3 expression. Several transferable cis elements can individually guide nervous system expression. However, a single 180-bp minimal enhancer is sufficient to confer specific expression in the developing pituitary. Within this sequence, tandem binding sites recognized by the islet-1 (ISL1) LIM-HD protein are essential for enhancer activity in the pituitary and spine, and a pituitary homeobox 1 (PITX1) bicoid class HD element is required for spatial patterning in the developing pituitary. This study establishes ISL1 as a novel transcriptional regulator of LHX3 and describes a potential mechanism for regulation by PITX1. Moreover, these studies suggest models for analyses of the transcriptional pathways coordinating the expression of other LIM-HD genes and provide tools for the molecular analysis and genetic counseling of pediatric patients with combined pituitary hormone deficiency. PMID:22194342

  20. Uterine NDRG2 expression is increased at implantation sites during early pregnancy in mice, and its down-regulation inhibits decidualization of mouse endometrial stromal cells.

    PubMed

    Gu, Yan; Zhang, Xuan; Yang, Qian; Wang, Jian-mei; He, Ya-ping; Sun, Zhao-gui; Zhang, Hui-qin; Wang, Jian

    2015-05-27

    N-myc down-regulated gene 2 (NDRG2) is a tumor suppressor involved in cell proliferation and differentiation. The aim of this study was to determine the uterine expression pattern of this gene during early pregnancy in mice. Uterine NDRG2 mRNA and protein expression levels were determined by RT-PCR and Western blot analyses, respectively, during the peri-implantation period in mice. Immunohistochemical (IHC) analysis was performed to examine the spatial localization of NDRG2 expression in mouse uterine tissues. The in vitro decidualization model of mouse endometrial stromal cells (ESCs) was used to evaluate decidualization of ESCs following NDRG2 knock down by small interfering RNA (siRNA). Statistical significance was analyzed by one-way ANOVA using SPSS 19.0 software. Uterine NDRG2 gene expression was significantly up-regulated and was predominantly localized to the secondary decidual zone on days 5 and 8 of pregnancy in mice. Its increased expression was associated with artificial decidualization as well as the activation of delayed implantation. Furthermore, uterine NDRG2 expression was induced by estrogen and progesterone treatments. The in vitro decidualization of mouse ESCs was accompanied by up-regulation of NDRG2 expression, and knock down of its expression in these cells by siRNA inhibited the decidualization process. These results suggest that NDRG2 might play an important role in the process of decidualization during early pregnancy.

  1. Acute and Chronic Electroconvulsive Seizures (ECS) Differentially Regulate the Expression of Epigenetic Machinery in the Adult Rat Hippocampus.

    PubMed

    Pusalkar, Madhavi; Ghosh, Shreya; Jaggar, Minal; Husain, Basma Fatima Anwar; Galande, Sanjeev; Vaidya, Vidita A

    2016-09-01

    Electroconvulsive seizure treatment is a fast-acting antidepressant therapy that evokes rapid transcriptional, neurogenic, and behavioral changes. Epigenetic mechanisms contribute to altered gene regulation, which underlies the neurogenic and behavioral effects of electroconvulsive seizure. We hypothesized that electroconvulsive seizure may modulate the expression of epigenetic machinery, thus establishing potential alterations in the epigenetic landscape. We examined the influence of acute and chronic electroconvulsive seizure on the gene expression of histone modifiers, namely histone acetyltransferases, histone deacetylases, histone methyltransferases, and histone (lysine) demethylases as well as DNA modifying enzymes, including DNA methyltransferases, DNA demethylases, and methyl-CpG-binding proteins in the hippocampi of adult male Wistar rats using quantitative real time-PCR analysis. Further, we examined the influence of acute and chronic electroconvulsive seizure on global and residue-specific histone acetylation and methylation levels within the hippocampus, a brain region implicated in the cellular and behavioral effects of electroconvulsive seizure. Acute and chronic electroconvulsive seizure induced a primarily unique, and in certain cases bidirectional, regulation of histone and DNA modifiers, and methyl-CpG-binding proteins, with an overlapping pattern of gene regulation restricted to Sirt4, Mll3, Jmjd3, Gadd45b, Tet2, and Tet3. Global histone acetylation and methylation levels were predominantly unchanged, with the exception of a significant decline in H3K9 acetylation in the hippocampus following chronic electroconvulsive seizure. Electroconvulsive seizure treatment evokes the transcriptional regulation of several histone and DNA modifiers, and methyl-CpG-binding proteins within the hippocampus, with a predominantly distinct pattern of regulation induced by acute and chronic electroconvulsive seizure. © The Author 2016. Published by Oxford University Press on behalf of CINP.

  2. Acute and Chronic Electroconvulsive Seizures (ECS) Differentially Regulate the Expression of Epigenetic Machinery in the Adult Rat Hippocampus

    PubMed Central

    Pusalkar, Madhavi; Ghosh, Shreya; Jaggar, Minal; Husain, Basma Fatima Anwar; Galande, Sanjeev

    2016-01-01

    Background: Electroconvulsive seizure treatment is a fast-acting antidepressant therapy that evokes rapid transcriptional, neurogenic, and behavioral changes. Epigenetic mechanisms contribute to altered gene regulation, which underlies the neurogenic and behavioral effects of electroconvulsive seizure. We hypothesized that electroconvulsive seizure may modulate the expression of epigenetic machinery, thus establishing potential alterations in the epigenetic landscape. Methods: We examined the influence of acute and chronic electroconvulsive seizure on the gene expression of histone modifiers, namely histone acetyltransferases, histone deacetylases, histone methyltransferases, and histone (lysine) demethylases as well as DNA modifying enzymes, including DNA methyltransferases, DNA demethylases, and methyl-CpG-binding proteins in the hippocampi of adult male Wistar rats using quantitative real time-PCR analysis. Further, we examined the influence of acute and chronic electroconvulsive seizure on global and residue-specific histone acetylation and methylation levels within the hippocampus, a brain region implicated in the cellular and behavioral effects of electroconvulsive seizure. Results: Acute and chronic electroconvulsive seizure induced a primarily unique, and in certain cases bidirectional, regulation of histone and DNA modifiers, and methyl-CpG-binding proteins, with an overlapping pattern of gene regulation restricted to Sirt4, Mll3, Jmjd3, Gadd45b, Tet2, and Tet3. Global histone acetylation and methylation levels were predominantly unchanged, with the exception of a significant decline in H3K9 acetylation in the hippocampus following chronic electroconvulsive seizure. Conclusions: Electroconvulsive seizure treatment evokes the transcriptional regulation of several histone and DNA modifiers, and methyl-CpG-binding proteins within the hippocampus, with a predominantly distinct pattern of regulation induced by acute and chronic electroconvulsive seizure. PMID:27207907

  3. Expression profiling reveals Spot 42 small RNA as a key regulator in the central metabolism of Aliivibrio salmonicida

    PubMed Central

    2012-01-01

    Background Spot 42 was discovered in Escherichia coli nearly 40 years ago as an abundant, small and unstable RNA. Its biological role has remained obscure until recently, and is today implicated in having broader roles in the central and secondary metabolism. Spot 42 is encoded by the spf gene. The gene is ubiquitous in the Vibrionaceae family of gamma-proteobacteria. One member of this family, Aliivibrio salmonicida, causes cold-water vibriosis in farmed Atlantic salmon. Its genome encodes Spot 42 with 84% identity to E. coli Spot 42. Results We generated a A. salmonicida spf deletion mutant. We then used microarray and Northern blot analyses to monitor global effects on the transcriptome in order to provide insights into the biological roles of Spot 42 in this bacterium. In the presence of glucose, we found a surprisingly large number of ≥ 2X differentially expressed genes, and several major cellular processes were affected. A gene encoding a pirin-like protein showed an on/off expression pattern in the presence/absence of Spot 42, which suggests that Spot 42 plays a key regulatory role in the central metabolism by regulating the switch between fermentation and respiration. Interestingly, we discovered an sRNA named VSsrna24, which is encoded immediately downstream of spf. This new sRNA has an expression pattern opposite to that of Spot 42, and its expression is repressed by glucose. Conclusions We hypothesize that Spot 42 plays a key role in the central metabolism, in part by regulating the pyruvat dehydrogenase enzyme complex via pirin. PMID:22272603

  4. Widespread antisense transcription of Populus genome under drought.

    PubMed

    Yuan, Yinan; Chen, Su

    2018-06-06

    Antisense transcription is widespread in many genomes and plays important regulatory roles in gene expression. The objective of our study was to investigate the extent and functional relevance of antisense transcription in forest trees. We employed Populus, a model tree species, to probe the antisense transcriptional response of tree genome under drought, through stranded RNA-seq analysis. We detected nearly 48% of annotated Populus gene loci with antisense transcripts and 44% of them with co-transcription from both DNA strands. Global distribution of reads pattern across annotated gene regions uncovered that antisense transcription was enriched in untranslated regions while sense reads were predominantly mapped in coding exons. We further detected 1185 drought-responsive sense and antisense gene loci and identified a strong positive correlation between the expression of antisense and sense transcripts. Additionally, we assessed the antisense expression in introns and found a strong correlation between intronic expression and exonic expression, confirming antisense transcription of introns contributes to transcriptional activity of Populus genome under drought. Finally, we functionally characterized drought-responsive sense-antisense transcript pairs through gene ontology analysis and discovered that functional groups including transcription factors and histones were concordantly regulated at both sense and antisense transcriptional level. Overall, our study demonstrated the extensive occurrence of antisense transcripts of Populus genes under drought and provided insights into genome structure, regulation pattern and functional significance of drought-responsive antisense genes in forest trees. Datasets generated in this study serve as a foundation for future genetic analysis to improve our understanding of gene regulation by antisense transcription.

  5. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

    PubMed

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

    2002-07-26

    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  6. Genome-Wide Survey of Cold Stress Regulated Alternative Splicing in Arabidopsis thaliana with Tiling Microarray

    PubMed Central

    Leviatan, Noam; Alkan, Noam; Leshkowitz, Dena; Fluhr, Robert

    2013-01-01

    Alternative splicing plays a major role in expanding the potential informational content of eukaryotic genomes. It is an important post-transcriptional regulatory mechanism that can increase protein diversity and affect mRNA stability. Alternative splicing is often regulated in a tissue-specific and stress-responsive manner. Cold stress, which adversely affects plant growth and development, regulates the transcription and splicing of plant splicing factors. This can affect the pre-mRNA processing of many genes. To identify cold regulated alternative splicing we applied Affymetrix Arabidopsis tiling arrays to survey the transcriptome under cold treatment conditions. A novel algorithm was used for detection of statistically relevant changes in intron expression within a transcript between control and cold growth conditions. A reverse transcription polymerase chain reaction (RT-PCR) analysis of a number of randomly selected genes confirmed the changes in splicing patterns under cold stress predicted by tiling array. Our analysis revealed new types of cold responsive genes. While their expression level remains relatively unchanged under cold stress their splicing pattern shows detectable changes in the relative abundance of isoforms. The majority of cold regulated alternative splicing introduced a premature termination codon (PTC) into the transcripts creating potential targets for degradation by the nonsense mediated mRNA decay (NMD) process. A number of these genes were analyzed in NMD-defective mutants by RT-PCR and shown to evade NMD. This may result in new and truncated proteins with altered functions or dominant negative effects. The results indicate that cold affects both quantitative and qualitative aspects of gene expression. PMID:23776682

  7. Gene expression profile in mesenchymal stem cells derived from dental tissues and bone marrow

    PubMed Central

    Kim, Su-Hwan; Kim, Young-Sung; Lee, Su-Yeon; Kim, Kyoung-Hwa; Lee, Yong-Moo; Kim, Won-Kyung

    2011-01-01

    Purpose The aim of this study is to compare the gene expression profile in mesenchymal stem cells derived from dental tissues and bone marrow for characterization of dental stem cells. Methods We employed GeneChip analysis to the expression levels of approximately 32,321 kinds of transcripts in 5 samples of bone-marrow-derived mesenchymal stem cells (BMSCs) (n=1), periodontal ligament stem cells (PDLSCs) (n=2), and dental pulp stem cells (DPSCs) (n=2). Each cell was sorted by a FACS Vantage Sorter using immunocytochemical staining of the early mesenchymal stem cell surface marker STRO-1 before the microarray analysis. Results We identified 379 up-regulated and 133 down-regulated transcripts in BMSCs, 68 up-regulated and 64 down-regulated transcripts in PDLSCs, and 218 up-regulated and 231 down-regulated transcripts in DPSCs. In addition, anatomical structure development and anatomical structure morphogenesis gene ontology (GO) terms were over-represented in all three different mesenchymal stem cells and GO terms related to blood vessels, and neurons were over-represented only in DPSCs. Conclusions This study demonstrated the genome-wide gene expression patterns of STRO-1+ mesenchymal stem cells derived from dental tissues and bone marrow. The differences among the expression profiles of BMSCs, PDLSCs, and DPSCs were shown, and 999 candidate genes were found to be definitely up- or down-regulated. In addition, GOstat analyses of regulated gene products provided over-represented GO classes. These data provide a first step for discovering molecules key to the characteristics of dental stem cells. PMID:21954424

  8. The fibroblast-derived paracrine factor neuregulin-1 has a novel role in regulating the constitutive color and melanocyte function in human skin

    PubMed Central

    Choi, Wonseon; Wolber, Rainer; Gerwat, Wolfram; Mann, Tobias; Batzer, Jan; Smuda, Christoph; Liu, Hongfang; Kolbe, Ludger; Hearing, Vincent J.

    2010-01-01

    Interactions between melanocytes and neighboring cells in the skin are important in regulating skin color in humans. We recently demonstrated that the less pigmented and thicker skin on the palms and soles is regulated by underlying fibroblasts in those areas, specifically via a secreted factor (DKK1) that modulates Wnt signaling. In this study, we tested the hypothesis that dermal fibroblasts regulate the constitutive skin color of individuals ranging from very light to very dark. We used microarray analysis to compare gene expression patterns in fibroblasts derived from lighter skin types compared to darker skin types, with a focus on secreted proteins. We identified a number of genes that differ dramatically in expression and, among the expressed proteins, neuregulin-1, which is secreted by fibroblasts derived from dark skin, effectively increases the pigmentation of melanocytes in tissue culture and in an artificial skin model and regulates their growth, suggesting that it is one of the major factors determining human skin color. PMID:20736300

  9. The TORMOZ Gene Encodes a Nucleolar Protein Required for Regulated Division Planes and Embryo Development in Arabidopsis[W

    PubMed Central

    Griffith, Megan E.; Mayer, Ulrike; Capron, Arnaud; Ngo, Quy A.; Surendrarao, Anandkumar; McClinton, Regina; Jürgens, Gerd; Sundaresan, Venkatesan

    2007-01-01

    Embryogenesis in Arabidopsis thaliana is marked by a predictable sequence of oriented cell divisions, which precede cell fate determination. We show that mutation of the TORMOZ (TOZ) gene yields embryos with aberrant cell division planes and arrested embryos that appear not to have established normal patterning. The defects in toz mutants differ from previously described mutations that affect embryonic cell division patterns. Longitudinal division planes of the proembryo are frequently replaced by transverse divisions and less frequently by oblique divisions, while divisions of the suspensor cells, which divide only transversely, appear generally unaffected. Expression patterns of selected embryo patterning genes are altered in the mutant embryos, implying that the positional cues required for their proper expression are perturbed by the misoriented divisions. The TOZ gene encodes a nucleolar protein containing WD repeats. Putative TOZ orthologs exist in other eukaryotes including Saccharomyces cerevisiae, where the protein is predicted to function in 18S rRNA biogenesis. We find that disruption of the Sp TOZ gene results in cell division defects in Schizosaccharomyces pombe. Previous studies in yeast and animal cells have identified nucleolar proteins that regulate the exit from M phase and cytokinesis, including factors involved in pre-rRNA processing. Our study suggests that in plant cells, nucleolar functions might interact with the processes of regulated cell divisions and influence the selection of longitudinal division planes during embryogenesis. PMID:17616738

  10. Identification and characterization of proliferative retinopathy-related long noncoding RNAs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Rong-Mei; Wang, Xiao-Qun; Yao, Jin

    2015-09-25

    Proliferative vitreoretinopathy (PVR) is a serious complication of retinal detachment and vitreoretinal surgery, which can lead to severe vision reduction. Long non-coding RNAs (lncRNAs) play critical roles in many biological processes and disease development. We attempted to determine the role of lncRNAs in the setting of PVR. Microarray analysis revealed that 78 lncRNAs were abnormally expressed in the epiretinal membranes (ERMs) of PVR patients, including 48 up-regulated and 30 down-regulated lncRNA transcripts. We subsequently focus on one lncRNA, MALAT1, and investigated its expression pattern in the biofluid of PVR patients. MALAT1 was significantly up-regulated in the cellular and plasma fractionmore » of peripheral blood in PVR patients. MALAT1 expression was obviously reduced after PVR operation. In vitro experiments revealed the role of MALAT1 in regulating RPE proliferation and migration, which is critical for ERMs formation. This study suggests that lncRNAs are the potential regulators of PVR pathology. MALAT1 is a potential prognostic indicator and a target for the diagnosis and gene therapy for PVR diseases. - Highlights: • 78 lncRNAs are differentially expressed between PVR-ERMs and secondary ERMs. • MALAT1 level is elevated in the ERMs of PVR patients. • Circulating MALAT1 level is up-regulated in PVR patients. • MALAT1 knockdown regulates RPE proliferation and migration.« less

  11. The Kto-Skd complex can regulate ptc expression by interacting with Cubitus interruptus (Ci) in the Hedgehog signaling pathway.

    PubMed

    Mao, Feifei; Yang, Xiaofeng; Fu, Lin; Lv, Xiangdong; Zhang, Zhao; Wu, Wenqing; Yang, Siqi; Zhou, Zhaocai; Zhang, Lei; Zhao, Yun

    2014-08-08

    The hedgehog (Hh) signaling pathway plays a very important role in metazoan development by controlling pattern formation. Drosophila imaginal discs are subdivided into anterior and posterior compartments that derive from adjacent cell populations. The anterior/posterior (A/P) boundaries, which are critical to maintaining the position of organizers, are established by a complex mechanism involving Hh signaling. Here, we uncover the regulation of ptc in the Hh signaling pathway by two subunits of mediator complex, Kto and Skd, which can also regulate boundary location. Collectively, we provide further evidence that Kto-Skd affects the A/P-axial development of the whole wing disc. Kto can interact with Cubitus interruptus (Ci), bind to the Ci-binding region on ptc promoter, which are both regulated by Hh signals to down-regulate ptc expression. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. A role for SR proteins in plant stress responses.

    PubMed

    Duque, Paula

    2011-01-01

    Members of the SR (serine/arginine-rich) protein gene family are key players in the regulation of alternative splicing, an important means of generating proteome diversity and regulating gene expression. In plants, marked changes in alternative splicing are induced by a wide variety of abiotic stresses, suggesting a role for this highly versatile gene regulation mechanism in the response to environmental cues. In support of this notion, the expression of plant SR proteins is stress-regulated at multiple levels, with environmental signals controlling their own alternative splicing patterns, phosphorylation status and subcellular distribution. Most importantly, functional links between these RNA-binding proteins and plant stress tolerance are beginning to emerge, including a role in the regulation of abscisic acid (ABA) signaling. Future identification of the physiological mRNA targets of plant SR proteins holds much promise for the elucidation of the molecular mechanisms underlying their role in the response to abiotic stress.

  13. A role for SR proteins in plant stress responses

    PubMed Central

    2011-01-01

    Members of the SR (serine/arginine-rich) protein gene family are key players in the regulation of alternative splicing, an important means of generating proteome diversity and regulating gene expression. In plants, marked changes in alternative splicing are induced by a wide variety of abiotic stresses, suggesting a role for this highly versatile gene regulation mechanism in the response to environmental cues. In support of this notion, the expression of plant SR proteins is stress-regulated at multiple levels, with environmental signals controlling their own alternative splicing patterns, phosphorylation status and subcellular distribution. Most importantly, functional links between these RNA-binding proteins and plant stress tolerance are beginning to emerge, including a role in the regulation of abscisic acid (ABA) signaling. Future identification of the physiological mRNA targets of plant SR proteins holds much promise for the elucidation of the molecular mechanisms underlying their role in the response to abiotic stress. PMID:21258207

  14. Optimizing information flow in small genetic networks. IV. Spatial coupling

    NASA Astrophysics Data System (ADS)

    Sokolowski, Thomas R.; Tkačik, Gašper

    2015-06-01

    We typically think of cells as responding to external signals independently by regulating their gene expression levels, yet they often locally exchange information and coordinate. Can such spatial coupling be of benefit for conveying signals subject to gene regulatory noise? Here we extend our information-theoretic framework for gene regulation to spatially extended systems. As an example, we consider a lattice of nuclei responding to a concentration field of a transcriptional regulator (the input) by expressing a single diffusible target gene. When input concentrations are low, diffusive coupling markedly improves information transmission; optimal gene activation functions also systematically change. A qualitatively different regulatory strategy emerges where individual cells respond to the input in a nearly steplike fashion that is subsequently averaged out by strong diffusion. While motivated by early patterning events in the Drosophila embryo, our framework is generically applicable to spatially coupled stochastic gene expression models.

  15. Comparative studies of differential expression of chitinolytic enzymes encoded by chiA, chiB, chiC and nagA genes in Aspergillus nidulans.

    PubMed

    Pusztahelyi, T; Molnár, Z; Emri, T; Klement, E; Miskei, M; Kerékgyárto, J; Balla, J; Pócsi, I

    2006-01-01

    N-Acetyl-D-glucosamine, chito-oligomers and carbon starvation regulated chiA, chiB, and nagA gene expressions in Aspergillus nidulans cultures. The gene expression patterns of the main extracellular endochitinase ChiB and the N-acetyl-beta-D-glucosaminidase NagA were similar, and the ChiB-NagA enzyme system may play a morphological and/or nutritional role during autolysis. Alterations in the levels of reactive oxygen species or in the glutathione-glutathione disulfide redox balance, characteristic physiological changes developing in ageing and autolyzing fungal cultures, did not affect the regulation of either the growth-related chiA or the autolysis-coupled chiB genes although both of them were down-regulated under diamide stress. The transcription of the chiC gene with unknown physiological function was repressed by increased intracellular superoxide concentration.

  16. Signaling pathways regulating the expression of Prx1 and Prx2 in the Chick Mandibular Mesenchyme

    PubMed Central

    Doufexi, Aikaterini-El; Mina, Mina

    2009-01-01

    Prx1 and Prx2 are members of the aristaless-related homeobox genes shown to play redundant but essential roles in morphogenesis of the mandibular processes. To gain insight into the signaling pathways that regulate expression of Prx genes in the mandibular mesenchyme, we used the chick as a model system. We examined the patterns of gene expression in the face and the roles of signals derived from the epithelium on the expression of Prx genes in the mandibular mesenchyme. Our results demonstrated stage-dependent roles of mandibular epithelium on the expression of Prx in the mandibular mesenchyme and provide evidence for positive roles of members of the fibroblast and hedgehog families derived from mandibular epithelium on the expression of Prx genes in the mandibular mesenchyme. Our studies suggest that endothelin-1 signaling derived from the mesenchyme is involved in restricting the expression of Prx2 to the medial mandibular mesenchyme. PMID:18942149

  17. bullwinkle and shark regulate dorsal-appendage morphogenesis in Drosophila oogenesis.

    PubMed

    Tran, David H; Berg, Celeste A

    2003-12-01

    bullwinkle (bwk) regulates embryonic anteroposterior patterning and, through a novel germline-to-soma signal, morphogenesis of the eggshell dorsal appendages. We screened for dominant modifiers of the bullwinkle mooseantler eggshell phenotype and identified shark, which encodes an SH2-domain, ankyrin-repeat tyrosine kinase. At the onset of dorsal-appendage formation, shark is expressed in a punctate pattern in the squamous stretch cells overlying the nurse cells. Confocal microscopy with cell-type-specific markers demonstrates that the stretch cells act as a substrate for the migrating dorsal-appendage-forming cells and extend cellular projections towards them. Mosaic analyses reveal that shark is required in follicle cells for cell migration and chorion deposition. Proper shark RNA expression in the stretch cells requires bwk activity, while restoration of shark expression in the stretch cells suppresses the bwk dorsal-appendage phenotype. These results suggest that shark plays an important downstream role in the bwk-signaling pathway. Candidate testing implicates Src42A in a similar role, suggesting conservation with a vertebrate signaling pathway involving non-receptor tyrosine kinases.

  18. Physiological role of ghrelin as revealed by the ghrelin and GOAT knockout mice.

    PubMed

    Kang, Kihwa; Zmuda, Erik; Sleeman, Mark W

    2011-11-01

    Ghrelin is a gastric hormone that has been shown to regulate food intake and energy metabolism. One unique feature of ghrelin is that its activity is regulated post transcriptionally by ghrelin O-acyltransferase (GOAT) through the addition of fatty acid to the serine residue in the N terminal region. Despite much biochemical characterization, to date no other proteins have been shown to be specifically octonylated by GOAT, suggesting a unique matching of the acyl transferase for a single ligand, ghrelin. If this is indeed correct, then genetic deletion of ghrelin or GOAT should produce near identical phenotypes and there should be extensive overlap in expression patterns. This review summarizes the similarities and differences in the phenotypes with the genetic deletion of ghrelin and GOAT in the various knockout mouse lines reported to date. While there is considerable overlap in expression pattern between ghrelin and GOAT, the latter does exhibit some unique tissue expression that could suggest that additional peptides may be acylated and await discovery and characterization. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. LHP1 Regulates H3K27me3 Spreading and Shapes the Three-Dimensional Conformation of the Arabidopsis Genome

    PubMed Central

    Ariel, Federico; Latrasse, David; Mariappan, Kiruthiga Gayathri; Kim, Soon-Kap; Crespi, Martin; Hirt, Heribert; Bergounioux, Catherine; Raynaud, Cécile; Benhamed, Moussa

    2016-01-01

    Precise expression patterns of genes in time and space are essential for proper development of multicellular organisms. Dynamic chromatin conformation and spatial organization of the genome constitute a major step in this regulation to modulate developmental outputs. Polycomb repressive complexes (PRCs) mediate stable or flexible gene repression in response to internal and environmental cues. In Arabidopsis thaliana, LHP1 co-localizes with H3K27me3 epigenetic marks throughout the genome and interacts with PRC1 and PRC2 members as well as with a long noncoding RNA. Here, we show that LHP1 is responsible for the spreading of H3K27me3 towards the 3’ end of the gene body. We also identified a subset of LHP1-activated genes and demonstrated that LHP1 shapes local chromatin topology in order to control transcriptional co-regulation. Our work reveals a general role of LHP1 from local to higher conformation levels of chromatin configuration to determine its accessibility to define gene expression patterns. PMID:27410265

  20. On Expression Patterns and Developmental Origin of Human Brain Regions.

    PubMed

    Kirsch, Lior; Chechik, Gal

    2016-08-01

    Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

Top