Sample records for regulating surface expression

  1. Antagonistic Regulation of Cystic Fibrosis Transmembrane Conductance Regulator Cell Surface Expression by Protein Kinases WNK4 and Spleen Tyrosine Kinase ▿

    PubMed Central

    Mendes, Ana Isabel; Matos, Paulo; Moniz, Sónia; Luz, Simão; Amaral, Margarida D.; Farinha, Carlos M.; Jordan, Peter

    2011-01-01

    Members of the WNK (with-no-lysine [K]) subfamily of protein kinases regulate various ion channels involved in sodium, potassium, and chloride homeostasis by either inducing their phosphorylation or regulating the number of channel proteins expressed at the cell surface. Here, we describe findings demonstrating that the cell surface expression of the cystic fibrosis transmembrane conductance regulator (CFTR) is also regulated by WNK4 in mammalian cells. This effect of WNK4 is independent of the presence of kinase and involves interaction with and inhibition of spleen tyrosine kinase (Syk), which phosphorylates Tyr512 in the first nucleotide-binding domain 1 (NBD1) of CFTR. Transfection of catalytically active Syk into CFTR-expressing baby hamster kidney cells reduces the cell surface expression of CFTR, whereas that of WNK4 promotes it. This is shown by biotinylation of cell surface proteins, immunofluorescence microscopy, and functional efflux assays. Mutation of Tyr512 to either glutamic acid or phenylalanine is sufficient to alter CFTR surface levels. In human airway epithelial cells, downregulation of endogenous Syk and WNK4 confirms their roles as physiologic regulators of CFTR surface expression. Together, our results show that Tyr512 phosphorylation is a novel signal regulating the prevalence of CFTR at the cell surface and that WNK4 and Syk perform an antagonistic role in this process. PMID:21807898

  2. Reciprocal and activity-dependent regulation of surface AMPA and NMDA receptors in cultured neurons

    PubMed Central

    Li, Guo Hua; Jackson, Michael F; Orser, Beverley A; MacDonald, John F

    2010-01-01

    Activation of NMDA receptors (NMDARs) can modulate excitatory synaptic transmission in the central nervous system by dynamically altering the number of synaptic AMPA receptors (AMPARs). The surface expression of NMDARs themselves is also subject to modulation in an activity-dependent manner. In addition to NMDAR-induced changes in AMPAR expression, AMPARs have also been found to regulate their own surface expression, independently of NMDARs. However, whether or not AMPARs and NMDARs might reciprocally regulate their surface expression has not previously been systematically explored. We utilized surface biotinylation assays and stimulation protocols intended to selectively stimulate various glutamate receptor subpopulations (e.g. AMPARs vs NMDARs; synaptic vs extrasynaptic). We reveal that activation of synaptic NMDARs increases the surface expression of both NMDAR and AMPAR subunits, while activation of extrasynaptic NMDAR produces the opposite effect. Surprisingly, we find that selective activation of AMPARs reduces the surface expression of not only AMPARs but also of NMDARs. These results suggest that both AMPARs and NMDARs at synaptic sites are subject to modulation by multiple signalling pathways in an activity-dependent way. PMID:21383896

  3. Surface expression of NMDA receptor changes during memory consolidation in the crab Neohelice granulata

    PubMed Central

    Hepp, Yanil; Salles, Angeles; Carbo-Tano, Martin

    2016-01-01

    The aim of the present study was to analyze the surface expression of the NMDA-like receptors during the consolidation of contextual learning in the crab Neohelice granulata. Memory storage is based on alterations in the strength of synaptic connections between neurons. The glutamatergic synapses undergo various forms of N-methyl-D aspartate receptor (NMDAR)-dependent changes in strength, a process that affects the abundance of other receptors at the synapse and underlies some forms of learning and memory. Here we propose a direct regulation of the NMDAR. Changes in NMDAR's functionality might be induced by the modification of the subunit's expression or cellular trafficking. This trafficking does not only include NMDAR's movement between synaptic and extra-synaptic localizations but also the cycling between intracellular compartments and the plasma membrane, a process called surface expression. Consolidation of contextual learning affects the surface expression of the receptor without affecting its general expression. The surface expression of the GluN1 subunit of the NMDAR is down-regulated immediately after training, up-regulated 3 h after training and returns to naïve and control levels 24 h after training. The changes in NMDAR surface expression observed in the central brain are not seen in the thoracic ganglion. A similar increment in surface expression of GluN1 in the central brain is observed 3 h after administration of the competitive GABAA receptor antagonist, bicuculline. These consolidation changes are part of a plasticity event that first, during the down-regulation, stabilizes the trace and later, at 3-h post-training, changes the threshold for synapse activation. PMID:27421895

  4. CD40 expression in Wehi-164 cell line

    PubMed Central

    Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Moazzeni, Seyed Mohammad

    2010-01-01

    CD40-CD154 interaction is an important process for cellular and humoral immunity regulation and can be effective in the body’s defense against tumors. In the present study, we evaluated the expression of CD40 in Wehi-164 cell line. CD40 expressions on the cell surface and in the cytoplasm were assessed by flow cytometry and intracellular staining assay, respectively. Also, the mRNA expression was identified by real time-PCR. The obtained results showed the high mRNA and cytoplasmic protein expression of CD40 but no surface expression. These results suggest that the Wehi-164 cell line down regulates expression of CD40 on the surface for evasion of immune system. PMID:20496113

  5. CD40 expression in Wehi-164 cell line.

    PubMed

    Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Moazzeni, Seyed Mohammad

    2010-07-01

    CD40-CD154 interaction is an important process for cellular and humoral immunity regulation and can be effective in the body's defense against tumors. In the present study, we evaluated the expression of CD40 in Wehi-164 cell line. CD40 expressions on the cell surface and in the cytoplasm were assessed by flow cytometry and intracellular staining assay, respectively. Also, the mRNA expression was identified by real time-PCR. The obtained results showed the high mRNA and cytoplasmic protein expression of CD40 but no surface expression. These results suggest that the Wehi-164 cell line down regulates expression of CD40 on the surface for evasion of immune system.

  6. Expression of Master Regulators of T-cell, Helper T-cell and Follicular Helper T-cell Differentiation in Angioimmunoblastic T-cell Lymphoma.

    PubMed

    Matsumoto, Yosuke; Nagoshi, Hisao; Yoshida, Mihoko; Kato, Seiichi; Kuroda, Junya; Shimura, Kazuho; Kaneko, Hiroto; Horiike, Shigeo; Nakamura, Shigeo; Taniwaki, Masafumi

    2017-11-01

    Objective It has been postulated that the normal counterpart of angioimmunoblastic T-cell lymphoma (AITL) is the follicular helper T-cell (TFH). Recent immunological studies have identified several transcription factors responsible for T-cell differentiation. The master regulators associated with T-cell, helper T-cell (Th), and TFH differentiation are reportedly BCL11B, Th-POK, and BCL6, respectively. We explored the postulated normal counterpart of AITL with respect to the expression of the master regulators of T-cell differentiation. Methods We performed an immunohistochemical analysis in 15 AITL patients to determine the expression of the master regulators and several surface markers associated with T-cell differentiation. Results BCL11B was detected in 10 patients (67%), and the surface marker of T-cells (CD3) was detected in all patients. Only 2 patients (13%) expressed the marker of naïve T-cells (CD45RA), but all patients expressed the marker of effector T-cells (CD45RO). Nine patients expressed Th-POK (60%), and 7 (47%) expressed a set of surface antigens of Th (CD4-positive and CD8-negative). In addition, BCL6 and the surface markers of TFH (CXCL13, PD-1, and SAP) were detected in 11 (73%), 8 (53%), 14 (93%), and all patients, respectively. Th-POK-positive/BCL6-negative patients showed a significantly shorter overall survival (OS) than the other patients (median OS: 33.0 months vs. 74.0 months, p=0.020; log-rank test). Conclusion Many of the AITL patients analyzed in this study expressed the master regulators of T-cell differentiation. The clarification of the diagnostic significance and pathophysiology based on the expression of these master regulators in AITL is expected in the future.

  7. HFE interacts with the BMP type I receptor ALK3 to regulate hepcidin expression

    PubMed Central

    Wu, Xing-gang; Wang, Yang; Wu, Qian; Cheng, Wai-Hang; Liu, Wenjing; Zhao, Yueshui; Mayeur, Claire; Schmidt, Paul J.; Yu, Paul B.; Wang, Fudi

    2014-01-01

    Mutations in HFE are the most common cause of hereditary hemochromatosis (HH). HFE mutations result in reduced expression of hepcidin, a hepatic hormone, which negatively regulates iron absorption from the duodenum and iron release from macrophages. However, the mechanism by which HFE regulates hepcidin expression in hepatocytes is not well understood. It is known that the bone morphogenetic protein (BMP) pathway plays a central role in controlling hepcidin expression in the liver. Here we show that HFE overexpression increased Smad1/5/8 phosphorylation and hepcidin expression, whereas inhibition of BMP signaling abolished HFE-induced hepcidin expression in Hep3B cells. HFE was found to associate with ALK3, inhibiting ALK3 ubiquitination and proteasomal degradation and increasing ALK3 protein expression and accumulation on the cell surface. The 2 HFE mutants associated with HH, HFE C282Y and HFE H63D, regulated ALK3 protein ubiquitination and trafficking differently, but both failed to increase ALK3 cell-surface expression. Deletion of Hfe in mice resulted in a decrease in hepatic ALK3 protein expression. Our results provide evidence that HFE induces hepcidin expression via the BMP pathway: HFE interacts with ALK3 to stabilize ALK3 protein and increase ALK3 expression at the cell surface. PMID:24904118

  8. Co-Requirement of PICK1 Binding and PKC Phosphorylation for Stable Surface Expression of the Metabotropic Glutamate Receptor mGluR7

    PubMed Central

    Suh, Young Ho; Pelkey, Kenneth A.; Lavezzari, Gabriela; Roche, Paul A.; Huganir, Richard L.; McBain, Chris J.; Roche, Katherine W.

    2008-01-01

    SUMMARY The presynaptic metabotropic glutamate receptor (mGluR) mGluR7 modulates excitatory neurotransmission by regulating neurotransmitter release, and plays a critical role in certain forms of synaptic plasticity. Although the dynamic regulation of mGluR7 surface expression governs a novel form of metaplasticity in the hippocampus, little is known about the molecular mechanisms regulating mGluR7 trafficking. We now show that mGluR7 surface expression is stabilized by both PKC phosphorylation and by receptor binding to the PDZ domain-containing protein PICK1. Phosphorylation of mGluR7 on serine 862 (S862) inhibits CaM binding thereby increasing mGluR7 surface expression and receptor binding to PICK1. Furthermore, in mice lacking PICK1, PKC-dependent increases in mGluR7 phosphorylation and surface expression are diminished, and mGluR7-dependent plasticity at mossy fiber-interneuron hippocampal synapses is impaired. These data support a model in which PICK1 binding and PKC phosphorylation act together to stabilize mGluR7 on the cell surface in vivo. PMID:18549785

  9. Ras-Association Domain of Sorting Nexin 27 Is Critical for Regulating Expression of GIRK Potassium Channels

    PubMed Central

    Bodhinathan, Karthik; Taura, Jaume J.; Taylor, Natalie M.; Nettleton, Margaret Y.; Ciruela, Francisco; Slesinger, Paul A.

    2013-01-01

    G protein-gated inwardly rectifying potassium (GIRK) channels play an important role in regulating neuronal excitability. Sorting nexin 27b (SNX27b), which reduces surface expression of GIRK channels through a PDZ domain interaction, contains a putative Ras-association (RA) domain with unknown function. Deleting the RA domain in SNX27b (SNX27b-ΔRA) prevents the down-regulation of GIRK2c/GIRK3 channels. Similarly, a point mutation (K305A) in the RA domain disrupts regulation of GIRK2c/GIRK3 channels and reduces H-Ras binding in vitro. Finally, the dominant-negative H-Ras (S17N) occludes the SNX27b-dependent decrease in surface expression of GIRK2c/GIRK3 channels. Thus, the presence of a functional RA domain and the interaction with Ras-like G proteins comprise a novel mechanism for modulating SNX27b control of GIRK channel surface expression and cellular excitability. PMID:23536889

  10. β-Arrestin1 and Distinct CXCR4 Structures Are Required for Stromal Derived Factor-1 to Downregulate CXCR4 Cell-Surface Levels in Neuroblastoma

    PubMed Central

    Clift, Ian C.; Bamidele, Adebowale O.; Rodriguez-Ramirez, Christie; Kremer, Kimberly N.

    2014-01-01

    CXC chemokine receptor 4 (CXCR4) is a G protein–coupled receptor (GPCR) located on the cell surface that signals upon binding the chemokine stromal derived factor-1 (SDF-1; also called CXCL 12). CXCR4 promotes neuroblastoma proliferation and chemotaxis. CXCR4 expression negatively correlates with prognosis and drives neuroblastoma growth and metastasis in mouse models. All functions of CXCR4 require its expression on the cell surface, yet the molecular mechanisms that regulate CXCR4 cell-surface levels in neuroblastoma are poorly understood. We characterized CXCR4 cell-surface regulation in the related SH-SY5Y and SK-N-SH human neuroblastoma cell lines. SDF-1 treatment caused rapid down-modulation of CXCR4 in SH-SY5Y cells. Pharmacologic activation of protein kinase C similarly reduced CXCR4, but via a distinct mechanism. Analysis of CXCR4 mutants delineated two CXCR4 regions required for SDF-1 treatment to decrease cell-surface CXCR4 in neuroblastoma cells: the isoleucine-leucine motif at residues 328 and 329 and residues 343–352. In contrast, and unlike CXCR4 regulation in other cell types, serines 324, 325, 338, and 339 were not required. Arrestin proteins can bind and regulate GPCR cell-surface expression, often functioning together with kinases such as G protein–coupled receptor kinase 2 (GRK2). Using SK-N-SH cells which are naturally deficient in β-arrestin1, we showed that β-arrestin1 is required for the CXCR4 343–352 region to modulate CXCR4 cell-surface expression following treatment with SDF-1. Moreover, GRK2 overexpression enhanced CXCR4 internalization, via a mechanism requiring both β-arrestin1 expression and the 343–352 region. Together, these results characterize CXCR4 structural domains and β-arrestin1 as critical regulators of CXCR4 cell-surface expression in neuroblastoma. β-Arrestin1 levels may therefore influence the CXCR4-driven metastasis of neuroblastoma as well as prognosis. PMID:24452472

  11. Baclofen mediates neuroprotection on hippocampal CA1 pyramidal cells through the regulation of autophagy under chronic cerebral hypoperfusion

    PubMed Central

    Liu, Li; Li, Chang-jun; Lu, Yun; Zong, Xian-gang; Luo, Chao; Sun, Jun; Guo, Lian-jun

    2015-01-01

    GABA receptors play an important role in ischemic brain injury. Studies have indicated that autophagy is closely related to neurodegenerative diseases. However, during chronic cerebral hypoperfusion, the changes of autophagy in the hippocampal CA1 area, the correlation between GABA receptors and autophagy, and their influences on hippocampal neuronal apoptosis have not been well established. Here, we found that chronic cerebral hypoperfusion resulted in rat hippocampal atrophy, neuronal apoptosis, enhancement and redistribution of autophagy, down-regulation of Bcl-2/Bax ratio, elevation of cleaved caspase-3 levels, reduction of surface expression of GABAA receptor α1 subunit and an increase in surface and mitochondrial expression of connexin 43 (CX43) and CX36. Chronic administration of GABAB receptors agonist baclofen significantly alleviated neuronal damage. Meanwhile, baclofen could up-regulate the ratio of Bcl-2/Bax and increase the activation of Akt, GSK-3β and ERK which suppressed cytodestructive autophagy. The study also provided evidence that baclofen could attenuate the decrease in surface expression of GABAA receptor α1 subunit, and down-regulate surface and mitochondrial expression of CX43 and CX36, which might enhance protective autophagy. The current findings suggested that, under chronic cerebral hypoperfusion, the effects of GABAB receptors activation on autophagy regulation could reverse neuronal damage. PMID:26412641

  12. SRC Inhibition Reduces NR2B Surface Expression and Synaptic Plasticity in the Amygdala

    ERIC Educational Resources Information Center

    Sinai, Laleh; Duffy, Steven; Roder, John C.

    2010-01-01

    The Src protein tyrosine kinase plays a central role in the regulation of N-methyl-d-aspartate receptor (NMDAR) activity by regulating NMDAR subunit 2B (NR2B) surface expression. In the amygdala, NMDA-dependent synaptic plasticity resulting from convergent somatosensory and auditory inputs contributes to emotional memory; however, the role of Src…

  13. Regulation of CD93 cell surface expression by protein kinase C isoenzymes.

    PubMed

    Ikewaki, Nobunao; Kulski, Jerzy K; Inoko, Hidetoshi

    2006-01-01

    Human CD93, also known as complement protein 1, q subcomponent, receptor (C1qRp), is selectively expressed by cells with a myeloid lineage, endothelial cells, platelets, and microglia and was originally reported to be involved in the complement protein 1, q subcomponent (C1q)-mediated enhancement of phagocytosis. The intracellular molecular events responsible for the regulation of its expression on the cell surface, however, have not been determined. In this study, the effect of protein kinases in the regulation of CD93 expression on the cell surface of a human monocyte-like cell line (U937), a human NK-like cell line (KHYG-1), and a human umbilical vein endothelial cell line (HUV-EC-C) was investigated using four types of protein kinase inhibitors, the classical protein kinase C (cPKC) inhibitor Go6976, the novel PKC (nPKC) inhibitor Rottlerin, the protein kinase A (PKA) inhibitor H-89 and the protein tyrosine kinase (PTK) inhibitor herbimycin A at their optimum concentrations for 24 hr. CD93 expression was analyzed using flow cytometry and glutaraldehyde-fixed cellular enzyme-linked immunoassay (EIA) techniques utilizing a CD93 monoclonal antibody (mAb), mNI-11, that was originally established in our laboratory as a CD93 detection probe. The nPKC inhibitor Rottlerin strongly down-regulated CD93 expression on the U937 cells in a dose-dependent manner, whereas the other inhibitors had little or no effect. CD93 expression was down-regulated by Go6976, but not by Rottlerin, in the KHYG-1 cells and by both Rottlerin and Go6976 in the HUV-EC-C cells. The PKC stimulator, phorbol myristate acetate (PMA), strongly up-regulated CD93 expression on the cell surface of all three cell-lines and induced interleukin-8 (IL-8) production by the U937 cells and interferon-gamma (IFN-gamma) production by the KHYG-1 cells. In addition, both Go6976 and Rottlerin inhibited the up-regulation of CD93 expression induced by PMA and IL-8 or IFN-gamma production in the respective cell-lines. Whereas recombinant tumor necrosis factor-alpha (rTNF-alpha) slightly up-regulated CD93 expression on the U937 cells, recombinant interleukin-1beta (rIL-1beta), recombinant interleukin-2 (rIL-2), recombinant interferon-gamma (rIFN-gamma) and lipopolysaccharide (LPS) had no effect. Taken together, these findings indicate that the regulation of CD93 expression on these cells involves the PKC isoenzymes.

  14. Ubiquitination by the Membrane-associated RING-CH-8 (MARCH-8) Ligase Controls Steady-state Cell Surface Expression of Tumor Necrosis Factor-related Apoptosis Inducing Ligand (TRAIL) Receptor 1*

    PubMed Central

    van de Kooij, Bert; Verbrugge, Inge; de Vries, Evert; Gijsen, Merel; Montserrat, Veronica; Maas, Chiel; Neefjes, Jacques; Borst, Jannie

    2013-01-01

    The eleven members of the membrane-associated RING-CH (MARCH) ubiquitin ligase family are relatively unexplored. Upon exogenous (over)expression, a number of these ligases can affect the trafficking of membrane molecules. However, only for MARCH-1 endogenous functions have been demonstrated. For the other endogenous MARCH proteins, no functions or substrates are known. We report here that TRAIL-R1 is a physiological substrate of the endogenous MARCH-8 ligase. Human TRAIL-R1 and R2 play a role in immunosurveillance and are targets for cancer therapy, because they selectively induce apoptosis in tumor cells. We demonstrate that TRAIL-R1 is down-regulated from the cell surface, with great preference over TRAIL-R2, by exogenous expression of MARCH ligases that are implicated in endosomal trafficking, such as MARCH-1 and -8. MARCH-8 attenuated TRAIL-R1 cell surface expression and apoptosis signaling by virtue of its ligase activity. This suggested that ubiquitination of TRAIL-R1 was instrumental in its down-regulation by MARCH-8. Indeed, in cells with endogenous MARCH expression, TRAIL-R1 was ubiquitinated at steady-state, with the conserved membrane-proximal lysine 273 as one of the potential acceptor sites. This residue was also essential for the interaction of TRAIL-R1 with MARCH-1 and MARCH-8 and its down-regulation by these ligases. Gene silencing identified MARCH-8 as the endogenous ligase that ubiquitinates TRAIL-R1 and attenuates its cell surface expression. These findings reveal that endogenous MARCH-8 regulates the steady-state cell surface expression of TRAIL-R1. PMID:23300075

  15. Cell Surface Trafficking of TLR1 Is Differentially Regulated by the Chaperones PRAT4A and PRAT4B*

    PubMed Central

    Hart, Bryan E.; Tapping, Richard I.

    2012-01-01

    The subcellular localization of Toll-like receptors (TLRs) is critical to their ability to function as innate immune sensors of microbial infection. We previously reported that an I602S polymorphism of human TLR1 is associated with aberrant trafficking of the receptor to the cell surface, loss of responses to TLR1 agonists, and differential susceptibility to diseases caused by pathogenic mycobacteria. Through an extensive analysis of receptor deletion and point mutants we have discovered that position 602 resides within a short 6 amino acid cytoplasmic region that is required for TLR1 surface expression. This short trafficking motif, in conjunction with the adjacent transmembrane domain, is sufficient to direct TLR1 to the cell surface. A serine at position 602 interrupts this trafficking motif and prevents cell surface expression of TLR1. Additionally, we have found that ER-resident TLR chaperones, PRAT4A and PRAT4B, act as positive and negative regulators of TLR1 surface trafficking, respectively. Importantly, either over-expression of PRAT4A or knock-down of PRAT4B rescues cell surface expression of the TLR1 602S variant. We also report that IFN-γ treatment of primary human monocytes derived from homozygous 602S individuals rescues TLR1 cell surface trafficking and cellular responses to soluble agonists. This event appears to be mediated by PRAT4A whose expression is strongly induced in human monocytes by IFN-γ. Collectively, these results provide a mechanism for the differential trafficking of TLR1 I602S variants, and highlight the distinct roles for PRAT4A and PRAT4B in the regulation of TLR1 surface expression. PMID:22447933

  16. Regulation of T-lymphocyte motility, adhesion and de-adhesion by a cell surface mechanism directed by low density lipoprotein receptor-related protein 1 and endogenous thrombospondin-1.

    PubMed

    Talme, Toomas; Bergdahl, Eva; Sundqvist, Karl-Gösta

    2014-06-01

    T lymphocytes are highly motile and constantly reposition themselves between a free-floating vascular state, transient adhesion and migration in tissues. The regulation behind this unique dynamic behaviour remains unclear. Here we show that T cells have a cell surface mechanism for integrated regulation of motility and adhesion and that integrin ligands and CXCL12/SDF-1 influence motility and adhesion through this mechanism. Targeting cell surface-expressed low-density lipoprotein receptor-related protein 1 (LRP1) with an antibody, or blocking transport of LRP1 to the cell surface, perturbed the cell surface distribution of endogenous thrombospondin-1 (TSP-1) while inhibiting motility and potentiating cytoplasmic spreading on intercellular adhesion molecule 1 (ICAM-1) and fibronectin. Integrin ligands and CXCL12 stimulated motility and enhanced cell surface expression of LRP1, intact TSP-1 and a 130,000 MW TSP-1 fragment while preventing formation of a de-adhesion-coupled 110 000 MW TSP-1 fragment. The appearance of the 130 000 MW TSP-1 fragment was inhibited by the antibody that targeted LRP1 expression, inhibited motility and enhanced spreading. The TSP-1 binding site in the LRP1-associated protein, calreticulin, stimulated adhesion to ICAM-1 through intact TSP-1 and CD47. Shear flow enhanced cell surface expression of intact TSP-1. Hence, chemokines and integrin ligands up-regulate a dominant motogenic pathway through LRP1 and TSP-1 cleavage and activate an associated adhesion pathway through the LRP1-calreticulin complex, intact TSP-1 and CD47. This regulation of T-cell motility and adhesion makes pro-adhesive stimuli favour motile responses, which may explain why T cells prioritize movement before permanent adhesion.

  17. Small GTPase Rab17 Regulates the Surface Expression of Kainate Receptors but Not α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid (AMPA) Receptors in Hippocampal Neurons via Dendritic Trafficking of Syntaxin-4 Protein*

    PubMed Central

    Mori, Yasunori; Fukuda, Mitsunori; Henley, Jeremy M.

    2014-01-01

    Glutamate receptors are fundamental for control synaptic transmission, synaptic plasticity, and neuronal excitability. However, many of the molecular mechanisms underlying their trafficking remain elusive. We previously demonstrated that the small GTPase Rab17 regulates dendritic trafficking in hippocampal neurons. Here, we investigated the role(s) of Rab17 in AMPA receptor (AMPAR) and kainate receptor (KAR) trafficking. Although Rab17 knockdown did not affect surface expression of the AMPAR subunit GluA1 under basal or chemically induced long term potentiation conditions, it significantly reduced surface expression of the KAR subunit GluK2. Rab17 co-localizes with Syntaxin-4 in the soma, dendritic shaft, the tips of developing hippocampal neurons, and in spines. Rab17 knockdown caused Syntaxin-4 redistribution away from dendrites and into axons in developing hippocampal neurons. Syntaxin-4 knockdown reduced GluK2 but had no effect on GluA1 surface expression. Moreover, overexpression of constitutively active Rab17 promoted dendritic surface expression of GluK2 by enhancing Syntaxin-4 translocation to dendrites. These data suggest that Rab17 mediates the dendritic trafficking of Syntaxin-4 to selectively regulate dendritic surface insertion of GluK2-containing KARs in rat hippocampal neurons. PMID:24895134

  18. Neurotrophin responsiveness of sympathetic neurons is regulated by rapid mobilization of the p75 receptor to the cell surface through TrkA activation of Arf6.

    PubMed

    Edward Hickman, F; Stanley, Emily M; Carter, Bruce D

    2018-05-22

    The p75 neurotrophin receptor (p75NTR) plays an integral role in patterning the sympathetic nervous system during development. Initially, p75NTR is expressed at low levels as sympathetic axons project toward their targets, which enables neurotrophin-3 (NT3) to activate TrkA receptors and promote growth. Upon reaching nerve growth factor (NGF) producing tissues, p75NTR is up regulated resulting in formation of TrkA-p75 complexes, which are high affinity binding sites selective for NGF, thereby blunting NT3 signaling. The level of p75NTR expressed on the neuron surface is instrumental in regulating trophic factor response; however, the mechanisms by which p75NTR expression is regulated are poorly understood. Here, we demonstrate a rapid, translation independent increase in surface expression of p75NTR in response to NGF in rat sympathetic neurons. p75NTR was mobilized to the neuron surface from GGA3-postitive vesicles through activation of the GTPase Arf6, which was stimulated by NGF, but not NT3 binding to TrkA. Arf6 activation required PI3 kinase activity and was prevented by an inhibitor of the cytohesin family of Arf6 GEFs. Overexpression of a constitutively active Arf6 mutant (Q67L) was sufficient to significantly increase surface expression of p75NTR even in the absence of NGF. Functionally, expression of active Arf6 markedly attenuated the ability of NT3 to promote neuronal survival and neurite outgrowth while the NGF response was unaltered. These data suggest that NGF activation of Arf6 through TrkA is critical for the increase in p75NTR surface expression that enables the switch in neurotrophin responsiveness during development in the sympathetic nervous system. SIGNIFICANCE STATEMENT p75NTR is instrumental in the regulation of neuronal survival and apoptosis during development and is also implicated as a contributor to aberrant neurodegeneration in numerous conditions. Therefore, a better understanding of the mechanisms that mediate p75NTR surface availability, may provide insight into how and why neurodegenerative processes manifest and reveal new therapeutic targets. Results from this study indicate a novel mechanism by which p75NTR can be rapidly shuttled to the cell surface from existing intracellular pools and explores a unique pathway by which NGF regulates the sympathetic innervation of target tissues, which has profound consequences for the function of these organs. Copyright © 2018 the authors.

  19. SRC-like adaptor protein regulates B cell development and function.

    PubMed

    Dragone, Leonard L; Myers, Margaret D; White, Carmen; Sosinowski, Tomasz; Weiss, Arthur

    2006-01-01

    The avidity of BCRs and TCRs influences signal strength during processes of lymphocyte development. Avidity is determined by both the intrinsic affinity for Ag and surface levels of the Ag receptor. The Src-like adaptor protein (SLAP) is a regulator of TCR levels on thymocytes, and its deficiency alters thymocyte development. We hypothesized that SLAP, which is expressed in B cells, also is important in regulating BCR levels, signal strength, and B cell development. To test this hypothesis, we analyzed the B cell compartment in SLAP-deficient mice. We found increased splenic B cell numbers and decreased surface IgM levels on mature, splenic B cells deficient in SLAP. Immature bone marrow and splenic B cells from BCR-transgenic, SLAP-deficient mice were found to express higher surface levels of IgM. In contrast, mature splenic B cells from BCR-transgenic mice expressed decreased levels of surface BCR associated with decreased calcium flux and activation-induced markers, compared with controls. These data suggest that SLAP regulates BCR levels and signal strength during lymphocyte development.

  20. Leukocyte Cell Surface Proteinases: Regulation of Expression, Functions, and Mechanisms of Surface Localization

    PubMed Central

    Owen, Caroline A.

    2008-01-01

    A number of proteinases are expressed on the surface of leukocytes including members of the serine, metallo-, and cysteine proteinase superfamilies. Some proteinases are anchored to the plasma membrane of leukocytes by a transmembrane domain or a glycosyl phosphatidyl inositol (GPI) anchor. Other proteinases bind with high affinity to classical receptors, or with lower affinity to integrins, proteoglycans, or other leukocyte surface molecules. Leukocyte surface levels of proteinases are regulated by: 1) cytokines, chemokines, bacterial products, and growth factors which stimulate synthesis and/or release of proteinase by cells; 2) the availability of surface binding sites for proteinases; and/or 3) internalization or shedding of surface-bound proteinases. The binding of proteinases to leukocyte surfaces serves many functions including: 1) concentrating the activity of proteinases to the immediate pericellular environment; 2) facilitating pro-enzyme activation; 3) increasing proteinase stability and retention in the extracellular space; 4) regulating leukocyte function by proteinases signaling through cell surface binding sites or other surface proteins; and 5) protecting proteinases from inhibition by extracellular proteinase inhibitors. There is strong evidence that membrane-associated proteinases on leukocytes play critical roles in wound healing, inflammation, extracellular matrix remodeling, fibrinolysis, and coagulation. This review will outline the biology of membrane-associated proteinases expressed by leukocytes and their roles in physiologic and pathologic processes. PMID:18329945

  1. Regulation of surface expression of TRPV2 channels in the retinal pigment epithelium.

    PubMed

    Reichhart, Nadine; Keckeis, Susanne; Fried, Frederik; Fels, Gabriele; Strauss, Olaf

    2015-06-01

    The retinal pigment epithelium (RPE) interacts closely with the photoreceptors in fulfilling tasks of visual function. Since an understanding of the RPE function is essential for understanding the patho-mechanisms involved in vision loss, we explored the regulation of the vanilloid receptor subtype transient receptor potential TRPV2 channels that trigger insulin-like growth factor-1 (IGF-1)-induced vascular endothelial growth factor A (VEGF-A) secretion. Immunohistochemistry was used to assess TRPV2 expression in retinal cross-sections or ARPE-19 cells, and surface expression of TRPV2 was quantified using confocal microscopy. Membrane currents of ARPE-19 cells were recorded using a whole-cell configuration of the patch-clamp technique. TRPV2 expression was detected in the RPE of the mouse retina as well as in ARPE-19 cells. Increasing the temperature to 45 °C activated membrane conductance sensitive to SKF-96365 and ruthenium red in 60 % of cells. Preincubation with either cannabidiol (CBD) or IGF-1 led to a three- or fourfold increase in current density, respectively, in all cells, which was blocked by SKF-96365. In contrast to IGF-1, CBD stimulation of membrane conductance was further increased by heat. TRPV2 surface expression was increased by both IGF-1 and CBD, with the increase by CBD twice as large as that by IGF-1. The phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002 abolished the effects on membrane conductance and surface expression. Both CBD and IGF-1 enhance TRPV2 channel activity by specific proportions of both channel activation and PI 3-kinase-dependent surface expression: IGF-1 predominantly increases ion channel activity, whereas CBD is more active in increasing TRPV2 surface expression. Thus, differential regulation of TRPV2 surface expression is an important mechanism for modulating the responsiveness of the RPE to growth factors.

  2. Tumor-derived exosomes regulate expression of immune function-related genes in human T cell subsets.

    PubMed

    Muller, Laurent; Mitsuhashi, Masato; Simms, Patricia; Gooding, William E; Whiteside, Theresa L

    2016-02-04

    Tumor cell-derived exosomes (TEX) suppress functions of immune cells. Here, changes in the gene profiles of primary human T lymphocytes exposed in vitro to exosomes were evaluated. CD4(+) Tconv, CD8(+) T or CD4(+) CD39(+) Treg were isolated from normal donors' peripheral blood and co-incubated with TEX or exosomes isolated from supernatants of cultured dendritic cells (DEX). Expression levels of 24-27 immune response-related genes in these T cells were quantified by qRT-PCR. In activated T cells, TEX and DEX up-regulated mRNA expression levels of multiple genes. Multifactorial data analysis of ΔCt values identified T cell activation and the immune cell type, but not exosome source, as factors regulating gene expression by exosomes. Treg were more sensitive to TEX-mediated effects than other T cell subsets. In Treg, TEX-mediated down-regulation of genes regulating the adenosine pathway translated into high expression of CD39 and increased adenosine production. TEX also induced up-regulation of inhibitory genes in CD4(+) Tconv, which translated into a loss of CD69 on their surface and a functional decline. Exosomes are not internalized by T cells, but signals they carry and deliver to cell surface receptors modulate gene expression and functions of human T lymphocytes.

  3. Requirements for cell rounding and surface protein down-regulation by Ebola virus glycoprotein.

    PubMed

    Francica, Joseph R; Matukonis, Meghan K; Bates, Paul

    2009-01-20

    Ebola virus causes an acute hemorrhagic fever that is associated with high morbidity and mortality. The viral glycoprotein is thought to contribute to pathogenesis, though precise mechanisms are unknown. Cellular pathogenesis can be modeled in vitro by expression of the Ebola viral glycoprotein (GP) in cells, which causes dramatic morphological changes, including cell rounding and surface protein down-regulation. These effects are known to be dependent on the presence of a highly glycosylated region of the glycoprotein, the mucin domain. Here we show that the mucin domain from the highly pathogenic Zaire subtype of Ebola virus is sufficient to cause characteristic cytopathology when expressed in the context of a foreign glycoprotein. Similarly to full length Ebola GP, expression of the mucin domain causes rounding, detachment from the extracellular matrix, and the down-regulation of cell surface levels of beta1 integrin and major histocompatibility complex class 1. These effects were not seen when the mucin domain was expressed in the context of a glycophosphatidylinositol-anchored isoform of the foreign glycoprotein. In contrast to earlier analysis of full length Ebola glycoproteins, chimeras carrying the mucin domains from the Zaire and Reston strains appear to cause similar levels of down-modulation and cell detachment. Cytopathology associated with Ebola glycoprotein expression does not occur when GP expression is restricted to the endoplasmic reticulum. In contrast to a previously published report, our results demonstrate that GP-induced surface protein down-regulation is not mediated through a dynamin-dependent pathway. Overall, these results support a model in which the mucin domain of Ebola GP acts at the cell surface to induce protein down modulation and cytopathic effects.

  4. Estrogen-dependent regulation of sodium/hydrogen exchanger-3 (NHE3) expression via estrogen receptor β in proximal colon of pregnant mice.

    PubMed

    Choijookhuu, Narantsog; Sato, Yoko; Nishino, Tomoya; Endo, Daisuke; Hishikawa, Yoshitaka; Koji, Takehiko

    2012-05-01

    Although constipation is very common during pregnancy, the exact mechanism is unknown. We hypothesized that the involvement of estrogen receptor (ER) in the regulation of electrolyte transporter in the colon leads to constipation. In this study, the intestines of normal female ICR mouse and pregnant mice were examined for the expression of ERα and ERβ by immunohistochemistry and in situ hybridization. ERβ, but not ERα, was expressed in surface epithelial cells of the proximal, but not distal, colon on pregnancy days 10, 15, and 18, but not day 5, and the number of ERβ-positive cells increased significantly during pregnancy. Expression of NHE3, the gene that harbors estrogen response element, examined by immunohistochemistry and western blotting, was localized in the surface epithelial cells of the proximal colon and increased in parallel with ERβ expression. In ovariectomized mice, NHE3 expression was only marginal and was up-regulated after treatment with 17β-estradiol (E(2)), but not E(2) + ICI 182,780 (estrogen receptor antagonist). Moreover, knock-down of ERβ expression by electroporetically transfected siRNA resulted in a significant reduction of NHE3 expression. These results indicate that ERβ regulates the expression of NHE3 in the proximal colon of pregnant mice through estrogen action, suggesting the involvement of increased sodium absorption by up-regulated NHE3 in constipation during pregnancy.

  5. 1,25-Dihydroxyvitamin D3 up-regulates TLR10 while down-regulating TLR2, 4, and 5 in human monocyte THP-1.

    PubMed

    Verma, Rewa; Jung, Jong Hyeok; Kim, Jae Young

    2014-05-01

    In humans, there are ten Toll-like receptors (TLRs), among which TLR10 is the only orphan receptor whose function is unknown. In this study, we examined the effects of IFN-γ, LPS and 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] on TLR10 expression of human monocyte THP-1 and compared them with those of other surface TLRs such as TLR2, 4 and 5 to differentiate TLR10 from other TLRs. Surface TLR10 expression on THP-1 was significantly enhanced by the addition of IFN-γ or LPS in a fashion similar to that of other TLRs. However, TLR10 expression was differentially regulated by 1,25(OH)2D3. Surface TLR10 expression on THP-1 was significantly enhanced at 24h, reaching approximately two times the control level at 48h after treatment with 100nM 1,25(OH)2D3, while that of TLR2, 4 and 5 decreased gradually in response to treatment over time. 1,25(OH)2D3 at concentrations above 1nM markedly enhanced surface TLR10 expression, but concentrations below 1nM did not. TLR10 mRNA expression was also increased by 1,25(OH)2D3. We next screened for putative binding sites of nuclear vitamin D receptor (VDR) and its counterpart RXR-α within promoter of TLR genes using a transcription factor binding site-prediction program. The results revealed that TLR10 is the only receptor among the tested TLRs that has both a VDR and RXR-α binding site within its proximal promoter. To identify possible involvement of VDR/RXR in the 1,25(OH)2D3-induced TLR10 up-regulation, we engaged the VDR synthesis inhibitor, dexamethasone, and the RXR antagonist, 1,8-dihydroxyanthraquinone. We found that TLR10 up-regulation was significantly blocked with pre-treatment of these inhibitors. These findings indicate that surface TLR10 expression is differentially regulated by 1,25(OH)2D3 and mainly regulated at the transcriptional level via VDR/RXR-α. Overall, results presented herein suggest that TLR10 functions differently from other known surface TLRs under certain circumstances. Further study using primary cells is necessary to confirm the results of the present study. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Regulation of DREAM Expression by Group I mGluR

    PubMed Central

    Lee, Jinu; Kim, Insook; Oh, So Ra; Ko, Suk Jin; Lim, Mi Kyung; Kim, Dong Goo

    2011-01-01

    DREAM (downstream regulatory element antagonistic modulator) is a calcium-binding protein that regulates dynorphin expression, promotes potassium channel surface expression, and enhances presenilin processing in an expression level-dependent manner. However, no molecular mechanism has yet explained how protein levels of DREAM are regulated. Here we identified group I mGluR (mGluR1/5) as a positive regulator of DREAM protein expression. Overexpression of mGluR1/5 increased the cellular level of DREAM. Up-regulation of DREAM resulted in increased DREAM protein in both the nucleus and cytoplasm, where the protein acts as a transcriptional repressor and a modulator of its interacting proteins, respectively. DHPG (3,5-dihydroxyphenylglycine), a group I mGluR agonist, also up-regulated DREAM expression in cortical neurons. These results suggest that group I mGluR is the first identified receptor that may regulate DREAM activity in neurons. PMID:21660149

  7. Determinants in the β and δ subunit cytoplasmic loop regulate Golgi trafficking and surface expression of the muscle acetylcholine receptor.

    PubMed

    Rudell, Jolene Chang; Borges, Lucia S; Rudell, John B; Beck, Kenneth A; Ferns, Michael J

    2014-01-03

    The molecular determinants that govern nicotinic acetylcholine receptor (AChR) assembly and trafficking are poorly defined, and those identified operate largely during initial receptor biogenesis in the endoplasmic reticulum. To identify determinants that regulate later trafficking steps, we performed an unbiased screen using chimeric proteins consisting of CD4 fused to the muscle AChR subunit cytoplasmic loops. In C2 mouse muscle cells, we found that CD4-β and δ subunit loops were expressed at very low levels on the cell surface, whereas the other subunit loops were robustly expressed on the plasma membrane. The low surface expression of CD4-β and δ loops was due to their pronounced retention in the Golgi apparatus and also to their rapid internalization from the plasma membrane. Both retention and recovery were mediated by the proximal 25-28 amino acids in each loop and were dependent on an ordered sequence of charged and hydrophobic residues. Indeed, βK353L and δK351L mutations increased surface trafficking of the CD4-subunit loops by >6-fold and also decreased their internalization from the plasma membrane. Similarly, combined βK353L and δK351L mutations increased the surface levels of assembled AChR expressed in HEK cells to 138% of wild-type levels. This was due to increased trafficking to the plasma membrane and not decreased AChR turnover. These findings identify novel Golgi retention signals in the β and δ subunit loops that regulate surface trafficking of assembled AChR and may help prevent surface expression of unassembled subunits. Together, these results define molecular determinants that govern a Golgi-based regulatory step in nicotinic AChR trafficking.

  8. Transcriptomic analysis reveals metabolic switches and surface remodeling as key processes for stage transition in Trypanosoma cruzi

    PubMed Central

    Greif, Gonzalo; Rodriguez, Matias; Alvarez-Valin, Fernando

    2017-01-01

    American trypanosomiasis is a chronic and endemic disease which affects millions of people. Trypanosoma cruzi, its causative agent, has a life cycle that involves complex morphological and functional transitions, as well as a variety of environmental conditions. This requires a tight regulation of gene expression, which is achieved mainly by post-transcriptional regulation. In this work we conducted an RNAseq analysis of the three major life cycle stages of T. cruzi: amastigotes, epimastigotes and trypomastigotes. This analysis allowed us to delineate specific transcriptomic profiling for each stage, and also to identify those biological processes of major relevance in each state. Stage specific expression profiling evidenced the plasticity of T. cruzi to adapt quickly to different conditions, with particular focus on membrane remodeling and metabolic shifts along the life cycle. Epimastigotes, which replicate in the gut of insect vectors, showed higher expression of genes related to energy metabolism, mainly Krebs cycle, respiratory chain and oxidative phosphorylation related genes, and anabolism related genes associated to nucleotide and steroid biosynthesis; also, a general down-regulation of surface glycoprotein coding genes was seen at this stage. Trypomastigotes, living extracellularly in the bloodstream of mammals, express a plethora of surface proteins and signaling genes involved in invasion and evasion of immune response. Amastigotes mostly express membrane transporters and genes involved in regulation of cell cycle, and also express a specific subset of surface glycoprotein coding genes. In addition, these results allowed us to improve the annotation of the Dm28c genome, identifying new ORFs and set the stage for construction of networks of co-expression, which can give clues about coded proteins of unknown functions. PMID:28286708

  9. Thiols decrease cytokine levels and down-regulate the expression of CD30 on human allergen-specific T helper (Th) 0 and Th2 cells

    PubMed Central

    Bengtsson, Å; Lundberg, M; Avila-Cariño, J; Jacobsson, G; Holmgren, A; Scheynius, A

    2001-01-01

    The thiol antioxidant N-acetyl-l-cysteine (NAC), known as a precursor of glutathione (GSH), is used in AIDS treatment trials, as a chemoprotectant in cancer chemotherapy and in treatment of chronic bronchitis. In vitro, GSH and NAC are known to enhance T cell proliferation, production of IL-2 and up-regulation of the IL-2 receptor. The 120-kD CD30 surface antigen belongs to the tumour necrosis factor (TNF) receptor superfamily. It is expressed by activated T helper (Th) cells and its expression is sustained in Th2 cells. We have analysed the effect of GSH and NAC on the cytokine profile and CD30 expression on human allergen-specific T cell clones (TCC). TCC were stimulated with anti-CD3 antibodies in the presence of different concentrations of GSH and NAC. Both thiols caused a dose dependent down-regulation of IL-4, IL-5 and IFN-γ levels in Th0 and Th2 clones, with the most pronounced decrease of IL-4. Furthermore, they down-regulated the surface expression of CD30, and the levels of soluble CD30 (sCD30) in the culture supernatants were decreased. In contrast, the surface expression of CD28 or CD40 ligand (CD40L) was not significantly changed after treatment with 20 mm NAC. These results indicate that GSH and NAC favour a Th1 response by a preferential down-regulation of IL-4. In addition, the expression of CD30 was down regulated by GSH and NAC, suggesting that CD30 expression is dependent on IL-4, or modified by NAC. In the likely event that CD30 and its soluble counterpart prove to contribute to the pathogenesis in Th2 related diseases such as allergy, NAC may be considered as a future therapeutic agent in the treatment of these diseases. PMID:11298119

  10. McWRI1, a transcription factor of the AP2/SHEN family, regulates the biosynthesis of the cuticular waxes on the apple fruit surface under low temperature.

    PubMed

    Hao, Suxiao; Ma, Yiyi; Zhao, Shuang; Ji, Qianlong; Zhang, Kezhong; Yang, Mingfeng; Yao, Yuncong

    2017-01-01

    Cuticular waxes of plant and organ surfaces play an important role in protecting plants from biotic and abiotic stress and extending the freshness, storage time and shelf life in the post-harvest agricultural products. WRI1, a transcription factor of AP2/SHEN families, had been found to trigger the related genes taking part in the biosynthesis of seed oil in many plants. But whether WRI1 is involved in the biosynthesis of the cuticular waxes on the Malus fruits surface has been unclear. We investigated the changes of wax composition and structure, the related genes and WRI1 expression on Malus asiatica Nakai and sieversii fruits with the low temperature treatments, found that low temperature induced the up-regulated expression of McWRI1, which promoted gene expression of McKCS, McLACs and McWAX in very-long-chain fatty acid biosynthesis pathway, resulting in the accumulation of alkanes component and alteration of wax structure on the fruit surface. Corresponding results were verified in McWRI1 silenced by VIGS, and WRI1 silenced down-regulated the related genes on two kinds of fruits, it caused the diversity alteration in content of some alkanes, fatty acid and ester component in two kinds of fruits. We further conducted Y1H assay to find that McWRI1 transcription factor activated the promoter of McKCS, McLAC and McWAX to regulate their expression. These results demonstrated that McWRI1 is involved in regulating the genes related synthesis of very long chain fatty acid on surface of apple fruits in storage process, providing a highlight for improvement of the modified atmosphere storage of apple fruits.

  11. McWRI1, a transcription factor of the AP2/SHEN family, regulates the biosynthesis of the cuticular waxes on the apple fruit surface under low temperature

    PubMed Central

    Ji, Qianlong; Zhang, Kezhong; Yang, Mingfeng

    2017-01-01

    Cuticular waxes of plant and organ surfaces play an important role in protecting plants from biotic and abiotic stress and extending the freshness, storage time and shelf life in the post-harvest agricultural products. WRI1, a transcription factor of AP2/SHEN families, had been found to trigger the related genes taking part in the biosynthesis of seed oil in many plants. But whether WRI1 is involved in the biosynthesis of the cuticular waxes on the Malus fruits surface has been unclear. We investigated the changes of wax composition and structure, the related genes and WRI1 expression on Malus asiatica Nakai and sieversii fruits with the low temperature treatments, found that low temperature induced the up-regulated expression of McWRI1, which promoted gene expression of McKCS, McLACs and McWAX in very-long-chain fatty acid biosynthesis pathway, resulting in the accumulation of alkanes component and alteration of wax structure on the fruit surface. Corresponding results were verified in McWRI1 silenced by VIGS, and WRI1 silenced down-regulated the related genes on two kinds of fruits, it caused the diversity alteration in content of some alkanes, fatty acid and ester component in two kinds of fruits. We further conducted Y1H assay to find that McWRI1 transcription factor activated the promoter of McKCS, McLAC and McWAX to regulate their expression. These results demonstrated that McWRI1 is involved in regulating the genes related synthesis of very long chain fatty acid on surface of apple fruits in storage process, providing a highlight for improvement of the modified atmosphere storage of apple fruits. PMID:29073205

  12. GARP-TGF-β complexes negatively regulate regulatory T cell development and maintenance of peripheral CD4+ T cells in vivo.

    PubMed

    Zhou, Angela X; Kozhaya, Lina; Fujii, Hodaka; Unutmaz, Derya

    2013-05-15

    The role of surface-bound TGF-β on regulatory T cells (Tregs) and the mechanisms that mediate its functions are not well defined. We recently identified a cell-surface molecule called Glycoprotein A Repetitions Predominant (GARP), which is expressed specifically on activated Tregs and was found to bind latent TGF-β and mediate a portion of Treg suppressive activity in vitro. In this article, we address the role of GARP in regulating Treg and conventional T cell development and immune suppression in vivo using a transgenic mouse expressing GARP on all T cells. We found that, despite forced expression of GARP on all T cells, stimulation through the TCR was required for efficient localization of GARP to the cell surface. In addition, IL-2 signals enhanced GARP cell surface expression specifically on Tregs. GARP-transgenic CD4(+) T cells and Tregs, especially those expressing higher levels of GARP, were significantly reduced in the periphery. Mature Tregs, but not conventional CD4(+) T cells, were also reduced in the thymus. CD4(+) T cell reduction was more pronounced within the effector/memory subset, especially as the mouse aged. In addition, GARP-overexpressing CD4(+) T cells stimulated through the TCR displayed reduced proliferative capacity, which was restored by inhibiting TGF-β signaling. Furthermore, inhibiting TGF-β signals greatly enhanced surface expression of GARP on Tregs and blocked the induction of Foxp3 in activated CD4(+) T cells overexpressing GARP. These findings suggest a role for GARP in natural and induced Treg development through activation of bound latent TGF-β and signaling, which negatively regulates GARP expression on Tregs.

  13. ER-mitochondria contacts control surface glycan expression and sensitivity to killer lymphocytes in glioma stem-like cells.

    PubMed

    Bassoy, Esen Yonca; Kasahara, Atsuko; Chiusolo, Valentina; Jacquemin, Guillaume; Boydell, Emma; Zamorano, Sebastian; Riccadonna, Cristina; Pellegatta, Serena; Hulo, Nicolas; Dutoit, Valérie; Derouazi, Madiha; Dietrich, Pierre Yves; Walker, Paul R; Martinvalet, Denis

    2017-06-01

    Glioblastoma is a highly heterogeneous aggressive primary brain tumor, with the glioma stem-like cells (GSC) being more sensitive to cytotoxic lymphocyte-mediated killing than glioma differentiated cells (GDC). However, the mechanism behind this higher sensitivity is unclear. Here, we found that the mitochondrial morphology of GSCs modulates the ER-mitochondria contacts that regulate the surface expression of sialylated glycans and their recognition by cytotoxic T lymphocytes and natural killer cells. GSCs displayed diminished ER-mitochondria contacts compared to GDCs. Forced ER-mitochondria contacts in GSCs increased their cell surface expression of sialylated glycans and reduced their susceptibility to cytotoxic lymphocytes. Therefore, mitochondrial morphology and dynamism dictate the ER-mitochondria contacts in order to regulate the surface expression of certain glycans and thus play a role in GSC recognition and elimination by immune effector cells. Targeting the mitochondrial morphology, dynamism, and contacts with the ER could be an innovative strategy to deplete the cancer stem cell compartment to successfully treat glioblastoma. © 2017 The Authors.

  14. Insulin receptor substrate-2 regulates aerobic glycolysis in mouse mammary tumor cells via glucose transporter 1.

    PubMed

    Pankratz, Shannon L; Tan, Ernest Y; Fine, Yumiko; Mercurio, Arthur M; Shaw, Leslie M

    2009-01-23

    The insulin receptor substrate (IRS) proteins are cytoplasmic adaptor molecules that function as signaling intermediates downstream of activated cell surface receptors. Based on data implicating IRS-2 but not IRS-1 in breast cancer invasion, survival, and metastasis, we assessed the contribution of IRS-1 and IRS-2 to aerobic glycolysis, which is known to impact tumor growth and progression. For this purpose, we used tumor cell lines derived from transgenic mice that express the polyoma virus middle T antigen (PyV-MT) in the mammary gland and that are wild-type (WT) or null for either Irs-1 (Irs-1-/-) or Irs-2 (Irs-2-/-). Aerobic glycolysis, as assessed by the rate of lactic acid production and glucose consumption, was diminished significantly in Irs-2-/- cells when compared with WT and Irs-1-/- cells. Expression of exogenous Irs-2 in Irs-2-/- cells restored the rate of glycolysis to that observed in WT cells. The transcription factor FoxO1 does not appear to be involved in Irs-2-mediated glycolysis. However, Irs-2 does regulate the surface expression of glucose transporter 1 (Glut1) as assessed by flow cytometry using a Glut1-specific ligand. Suppression of Glut1 expression inhibits Irs-2-dependent invasion, which links glycolysis to mammary tumor progression. Irs-2 was shown to be important for mammalian target of rapamycin (mTor) activation, and Irs-2-dependent regulation of Glut1 surface expression is rapamycin-sensitive. Collectively, our data indicate that Irs-2, but not Irs-1, promotes invasion by sustaining the aerobic glycolysis of mouse mammary tumor cells and that it does so by regulating the mTor-dependent surface expression of Glut1.

  15. Library Screen Identifies Enterococcus faecalis CcpA, the Catabolite Control Protein A, as an Effector of Ace, a Collagen Adhesion Protein Linked to Virulence

    PubMed Central

    Gao, Peng; Pinkston, Kenneth L.; Bourgogne, Agathe; Cruz, Melissa R.; Garsin, Danielle A.; Murray, Barbara E.

    2013-01-01

    The Enterococcus faecalis cell wall-anchored protein Ace is an important virulence factor involved in cell adhesion and infection. Expression of Ace on the cell surface is affected by many factors, including stage of growth, culture temperature, and environmental components, such as serum, urine, and collagen. However, the mechanisms that regulate or modulate Ace display are not well understood. With interest in identifying genes associated with Ace expression, we utilized a whole-cell enzyme-linked immunosorbent assay (ELISA)-based screening method to identify mutants from a transposon insertion mutant library which exhibited distinct Ace surface expression profiles. We identified a ccpA insertion mutant which showed significantly decreased levels of Ace surface expression at early growth phase versus those of wild-type OG1RF. Confirmation of the observation was achieved through flow cytometry and complementation analysis. Compared to the wild type, the E. faecalis ccpA mutant had an impaired ability to adhere to collagen when grown to early exponential phase, consistent with the lack of Ace expression in the early growth phase. As a key component of carbon catabolite regulation, CcpA has been previously reported to play a critical role in regulating expression of proteins involved in E. faecalis carbohydrate uptake and utilization. Our discovery is the first to associate CcpA with the production of a major E. faecalis virulence factor, providing new insights into the regulation of E. faecalis pathogenesis. PMID:23974022

  16. Mucin gene expression is not regulated by estrogen and/or progesterone in the ocular surface epithelia of mice.

    PubMed

    Lange, Christine; Fernandez, Jolene; Shim, David; Spurr-Michaud, Sandra; Tisdale, Ann; Gipson, Ilene K

    2003-07-01

    Dry eye syndrome is prevalent in post-menopausal women, and post-menopausal women secrete less mucus in their reproductive tracts. Using a mouse model, the purpose of this study was to determine if estrogen and/or progesterone regulates Muc4 and Muc5AC gene expression in the ocular surface epithelia, as the hormones do in reproductive tract epithelia. Adult C57BL/6 mice were ovariectomized, and 19 days later, pellets containing estrogen, progesterone, or a combination were inserted subcutaneously. Ocular surface and reproductive tract tissues were harvested following seven days of hormone treatment. A control group consisted of ovariectomized mice that received no hormone treatment. Real-time reverse transcription-polymerase chain reaction was used to determine the tissue expression levels of mucin mRNA of each treatment group relative to the control. Muc4 mRNA expression levels were determined for the reproductive tract, and both Muc4 and Muc5AC expression levels were determined for the ocular surface epithelia. Muc4 and Muc5AC gene expression in ocular surface and Muc4 in reproductive tract epithelia was demonstrated by In Situ hybridization, and Muc4 and Muc5AC protein was demonstrated in the epithelia of animals in the experimental groups. The mRNA expression levels of Muc4 and Muc5AC and the immunofluorescence localization pattern in the ocular surface epithelia were not significantly different in any hormone treatment group when compared to the control ovariectomized group. By comparison, mice that were administered estrogen had a significant increase of Muc4 mRNA in the reproductive tract epithelia, progesterone given in combination with estrogen antagonized the upregulatory effects of estrogen in the reproductive tract, and the amount of Muc4 mRNA in the reproductive tract of progesterone-treated animals was not different from ovariectomized controls. Immunofluorescence localization of Muc4 in the reproductive tract epithelia of the experimental groups correlated to message levels, with lack of Muc4 protein detected in the control and progesterone groups. In comparison to reproductive tract epithelia, Muc4 and Muc5AC are not hormonally regulated by estrogen or progesterone in the ocular surface epithelia of mice. These data demonstrate that regulation of epithelial mucin genes is tissue specific.

  17. The nucleoid-associated protein Fis directly modulates the synthesis of cellulose, an essential component of pellicle-biofilms in the phytopathogenic bacterium Dickeya dadantii.

    PubMed

    Prigent-Combaret, Claire; Zghidi-Abouzid, Ouafa; Effantin, Géraldine; Lejeune, Philippe; Reverchon, Sylvie; Nasser, William

    2012-10-01

    Bacteria use biofilm structures to colonize surfaces and to survive in hostile conditions, and numerous bacteria produce cellulose as a biofilm matrix polymer. Hence, expression of the bcs operon, responsible for cellulose biosynthesis, must be finely regulated in order to allow bacteria to adopt the proper surface-associated behaviours. Here we show that in the phytopathogenic bacterium, Dickeya dadantii, production of cellulose is required for pellicle-biofilm formation and resistance to chlorine treatments. Expression of the bcs operon is growth phase-regulated and is stimulated in biofilms. Furthermore, we unexpectedly found that the nucleoid-associated protein and global regulator of virulence functions, Fis, directly represses bcs operon expression by interacting with an operator that is absent from the bcs operon of animal pathogenic bacteria and the plant pathogenic bacterium Pectobacterium. Moreover, production of cellulose enhances plant surface colonization by D. dadantii. Overall, these data suggest that cellulose production and biofilm formation may be important factors for surface colonization by D. dadantii and its subsequent survival in hostile environments. This report also presents a new example of how bacteria can modulate the action of a global regulator to co-ordinate basic metabolism, virulence and modifications of lifestyle. © 2012 Blackwell Publishing Ltd.

  18. Hepatitis B surface antigen gene expression is regulated by sex steroids and glucocorticoids in transgenic mice.

    PubMed Central

    Farza, H; Salmon, A M; Hadchouel, M; Moreau, J L; Babinet, C; Tiollais, P; Pourcel, C

    1987-01-01

    We have investigated the basis for liver-specific and sex-linked expression of hepatitis B surface antigen (HBsAg) gene in transgenic mice by monitoring the level of liver HBsAg mRNA and serum HBsAg at different stages of development and in response to sex-hormone regulation. Transcription of the HBsAg gene starts at day 15 of development, together with that of the albumin gene, and reaches a comparable level at birth. HBsAg mRNA level and HBsAg production are parallel in males and females during prenatal development and until the first month of life, but HBsAg gene expression increases 5-10 times in males at puberty. After castration, the level of expression decreases dramatically in both males and females and is subsequently increased by injection of testosterone or estradiol. Glucocorticoids also regulated positively expression of the HBsAg gene. Our results suggest that sex hormones play a role in hepatitis B virus gene expression during natural infection and could explain the difference in incidence of chronic carriers between men and women. Images PMID:3469661

  19. Dominant-Negative Regulation of Cell Surface Expression by a Pentapeptide Motif at the Extreme COOH Terminus of an Slo1 Calcium-Activated Potassium Channel Splice Variant

    PubMed Central

    Chiu, Yu-Hsin; Alvarez-Baron, Claudia; Kim, Eun Young

    2010-01-01

    Large-conductance Ca2+-activated K+ (BKCa) channels regulate the physiology of many cell types. A single vertebrate gene variously known as Slo1, KCa1.1, or KCNMA1 encodes the pore-forming subunits of BKCa channel but is expressed in a potentially very large number of alternative splice variants. Two splice variants of Slo1, Slo1VEDEC and Slo1QEERL, which differ at the extreme COOH terminus, show markedly different steady-state expression levels on the cell surface. Here we show that Slo1VEDEC and Slo1QEERL can reciprocally coimmunoprecipitate, indicating that they form heteromeric complexes. Moreover, coexpression of even small amounts of Slo1VEDEC markedly reduces surface expression of Slo1QEERL and total Slo1 as indicated by cell-surface biotinylation assays. The effects of Slo1VEDEC on steady-state surface expression can be attributed primarily to the last five residues of the protein based on surface expression of motif-swapped constructs of Slo1 in human embryonic kidney (HEK) 293T cells. In addition, the presence of the VEDEC motif at the COOH terminus of Slo1 channels is sufficient to confer a dominant-negative effect on cell surface expression of itself or other types of Slo1 subunits. Treating cells with short peptides containing the VEDEC motif increased surface expression of Slo1VEDEC channels transiently expressed in HEK293T cells and increased current through endogenous BKCa channels in mouse podocytes. Slo1VEDEC and Slo1QEERL channels are removed from the HEK293T cell surface with similar kinetics and to a similar extent, which suggests that the inhibitory effect of the VEDEC motif is exerted primarily on forward trafficking into the plasma membrane. PMID:20051533

  20. Cell Surface Galectin-9 Expressing Th Cells Regulate Th17 and Foxp3+ Treg Development by Galectin-9 Secretion

    PubMed Central

    Niki, Toshiro; Kadowaki, Takeshi; Ueno, Masaki; Nishi, Nozomu; Yamauchi, Akira; Hattori, Toshio; Masaki, Tsutomu; Hirashima, Mitsuomi

    2012-01-01

    Galectin-9 (Gal-9), a β-galactoside binding mammalian lectin, regulates immune responses by reducing pro-inflammatory IL-17-producing Th cells (Th17) and increasing anti-inflammatory Foxp3+ regulatory T cells (Treg) in vitro and in vivo. These functions of Gal-9 are thought to be exerted by binding to receptor molecules on the cell surface. However, Gal-9 lacks a signal peptide for secretion and is predominantly located in the cytoplasm, which raises questions regarding how and which cells secrete Gal-9 in vivo. Since Gal-9 expression does not necessarily correlate with its secretion, Gal-9-secreting cells in vivo have been elusive. We report here that CD4 T cells expressing Gal-9 on the cell surface (Gal-9+ Th cells) secrete Gal-9 upon T cell receptor (TCR) stimulation, but other CD4 T cells do not, although they express an equivalent amount of intracellular Gal-9. Gal-9+ Th cells expressed interleukin (IL)-10 and transforming growth factor (TGF)-β but did not express Foxp3. In a co-culture experiment, Gal-9+ Th cells regulated Th17/Treg development in a manner similar to that by exogenous Gal-9, during which the regulation by Gal-9+ Th cells was shown to be sensitive to a Gal-9 antagonist but insensitive to IL-10 and TGF-β blockades. Further elucidation of Gal-9+ Th cells in humans indicates a conserved role of these cells through evolution and implies the possible utility of these cells for diagnosis or treatment of immunological diseases. PMID:23144904

  1. [Effect of Shexiang Baoxin Pills on isoprenaline-induced myocardial cell hypertrophy and Cx43 expression].

    PubMed

    Tang, Fen; Jiang, Zhentao; Tan, Wenting; Long, Junrong; Liu, Shengquan; Chu, Chun

    2017-08-28

    To observe the effects of Shexiang Baoxin Pill (SBP) on isoprenaline (Iso)-induced changes in myocardial cell volume, shape, and connexin 43 (Cx43) expression.
 Methods: H9C2 myocardial cells were randomly divided into a control group, a Iso group and a Iso+SBP group. After 72 h of culture, the average surface area of H9C2 cells was measured under phase contrast microscope. Bicinchoninic acid (BCA) protein assay was carried out to determine the concentration of proteins. The survival rate of myocardial cells was measured by methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay, and the Cx43 expression was detected by Western blot.
 Results: The mean surface area and Cx43 concentration in Iso-treated myocardial cells were increased under the phase contrast microscope (P<0.05). Compared with the Iso group, the mean surface area was decreased, and the Cx43 concentration was reduced in the Iso+SBP group (both P<0.05). Compared with the control group, the Cx43 expression was obviously down-regulated in the H9C2 cells of the Iso group (P<0.05); while compared with the Iso group, the Cx43 expression was obviously up-regulated in the Iso+SBP group (P<0.05).
 Conclusion: Shexiang Baoxin Pills can prevent Iso-induced myocardial hypertrophy and down-regulate Cx43 expression.

  2. Protein Kinase WNK1 Promotes Cell Surface Expression of Glucose Transporter GLUT1 by Regulating a Tre-2/USP6-BUB2-Cdc16 Domain Family Member 4 (TBC1D4)-Rab8A Complex*

    PubMed Central

    Mendes, Ana Isabel; Matos, Paulo; Moniz, Sónia; Jordan, Peter

    2010-01-01

    One mechanism by which mammalian cells regulate the uptake of glucose is the number of glucose transporter proteins (GLUT) present at the plasma membrane. In insulin-responsive cells types, GLUT4 is released from intracellular stores through inactivation of the Rab GTPase activating protein Tre-2/USP6-BUB2-Cdc16 domain family member 4 (TBC1D4) (also known as AS160). Here we describe that TBC1D4 forms a protein complex with protein kinase WNK1 in human embryonic kidney (HEK293) cells. We show that WNK1 phosphorylates TBC1D4 in vitro and that the expression levels of WNK1 in these cells regulate surface expression of the constitutive glucose transporter GLUT1. WNK1 was found to increase the binding of TBC1D4 to regulatory 14-3-3 proteins while reducing its interaction with the exocytic small GTPase Rab8A. These effects were dependent on the catalytic activity because expression of a kinase-dead WNK1 mutant had no effect on binding of 14-3-3 and Rab8A, or on surface GLUT1 levels. Together, the data describe a pathway regulating constitutive glucose uptake via GLUT1, the expression level of which is related to several human diseases. PMID:20937822

  3. Cell recognition molecule L1 promotes embryonic stem cell differentiation through the regulation of cell surface glycosylation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Ying; Department of Clinical Laboratory, Second Affiliated Hospital of Dalian Medical University, Dalian 116023; Huang, Xiaohua

    2013-10-25

    Highlights: •Down-regulating FUT9 and ST3Gal4 expression blocks L1-induced neuronal differentiation of ESCs. •Up-regulating FUT9 and ST3Gal4 expression in L1-ESCs depends on the activation of PLCγ. •L1 promotes ESCs to differentiate into neuron through regulating cell surface glycosylation. -- Abstract: Cell recognition molecule L1 (CD171) plays an important role in neuronal survival, migration, differentiation, neurite outgrowth, myelination, synaptic plasticity and regeneration after injury. Our previous study has demonstrated that overexpressing L1 enhances cell survival and proliferation of mouse embryonic stem cells (ESCs) through promoting the expression of FUT9 and ST3Gal4, which upregulates cell surface sialylation and fucosylation. In the present study,more » we examined whether sialylation and fucosylation are involved in ESC differentiation through L1 signaling. RNA interference analysis showed that L1 enhanced differentiation of ESCs into neurons through the upregulation of FUT9 and ST3Gal4. Furthermore, blocking the phospholipase Cγ (PLCγ) signaling pathway with either a specific PLCγ inhibitor or knockdown PLCγ reduced the expression levels of both FUT9 and ST3Gal4 mRNAs and inhibited L1-mediated neuronal differentiation. These results demonstrate that L1 promotes neuronal differentiation from ESCs through the L1-mediated enhancement of FUT9 and ST3Gal4 expression.« less

  4. Galectin-9 binds to O-glycans on protein disulfide isomerase.

    PubMed

    Schaefer, Katrin; Webb, Nicholas E; Pang, Mabel; Hernandez-Davies, Jenny E; Lee, Katharine P; Gonzalez, Pascual; Douglass, Martin V; Lee, Benhur; Baum, Linda G

    2017-09-01

    Changes in the T cell surface redox environment regulate critical cell functions, such as cell migration, viral entry and cytokine production. Cell surface protein disulfide isomerase (PDI) contributes to the regulation of T cell surface redox status. Cell surface PDI can be released into the extracellular milieu or can be internalized by T cells. We have found that galectin-9, a soluble lectin expressed by T cells, endothelial cells and dendritic cells, binds to and retains PDI on the cell surface. While endogenous galectin-9 is not required for basal cell surface PDI expression, exogenous galectin-9 mediated retention of cell surface PDI shifted the disulfide/thiol equilibrium on the T cell surface. O-glycans on PDI are required for galectin-9 binding, and PDI recognition appears to be specific for galectin-9, as galectin-1 and galectin-3 do not bind PDI. Galectin-9 is widely expressed by immune and endothelial cells in inflamed tissues, suggesting that T cells would be exposed to abundant galectin-9, in cis and in trans, in infectious or autoimmune conditions. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Activity-dependent downregulation of M-Type (Kv7) K⁺ channels surface expression requires the activation of iGluRs/Ca²⁺/PKC signaling pathway in hippocampal neuron.

    PubMed

    Li, Cai; Lu, Qing; Huang, Pengcheng; Fu, Tianli; Li, Changjun; Guo, Lianjun; Xu, Xulin

    2015-08-01

    M-type (Kv7) K(+) channels, encoded by KCNQ2-KCNQ5 genes, play a pivotal role in controlling neuronal excitability. However, precisely how neuronal activity regulates Kv7 channel translocation has not yet been fully defined. Here we reported activity-dependent changes in Kv7 channel subunits Kv7.2 and Kv7.3 surface expression by glutamate (glu). In the present study, we found that treatment with glutamate rapidly caused a specific decrease in M-current as well as Kv7 channel surface expression in primary cultured hippocampal neurons. The glutamate effects were mimicked by NMDA and AMPA. The glutamate effects on Kv7 channels were partially attenuated by pre-treatment of NMDA receptors antagonist d,l-APV or AMPA-KA receptors antagonist CNQX. The signal required Ca(2+) influx through L-type Ca(2+) channel and intracellular Ca(2+) elevations. PKC activation was involved in the glutamate-induced reduction of Kv7 channel surface expression. Moreover, a significant reduction of Kv7 channel surface expression occurred following glycine-induced "chem"-LTP in vitro and hippocampus-dependent behavioral learning training in vivo. These results demonstrated that activity-dependent reduction of Kv7 channel surface expression through activation of ionotropic glutamate receptors (iGluRs)/Ca(2+)/PKC signaling pathway might be an important molecular mechanism for regulation of neuronal excitability and synaptic plasticity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. The effect of hydrophilic titanium surface modification on macrophage inflammatory cytokine gene expression.

    PubMed

    Hamlet, Stephen; Alfarsi, Mohammed; George, Roy; Ivanovski, Saso

    2012-05-01

    Chemical modification of microrough titanium dental implants to produce a hydrophilic surface with increased wettability and improved surface energy has been demonstrated clinically to achieve superior bone wound healing and osseointegration compared to that achieved with a microrough titanium surface alone. As the recruitment of the necessary osseoinductive precursors involved in bone wound healing and osseointegration to the wound site is facilitated by the action of cytokines, this study sought to determine the in vitro effect of hydrophilic surface modification on the expression of pro-inflammatory cytokines from adherent macrophages. The surface topography and composition of the titanium surfaces was characterized by scanning electron microscopy and X-ray photoelectron spectroscopy. Macrophage attachment and proliferation was assessed using an MTT assay. The expression of 84 pro-inflammatory cytokines and chemokines by adherent RAW 264.7 cells, a murine leukaemic monocyte cell line, was assessed by PCR array after 24 h culture on either smooth polished, sand-blasted acid-etched (SLA) or hydrophilic-modified SLA (SLActive) titanium surfaces. Following 24 h culture on titanium, surface microroughness activated pro-inflammatory cytokine gene transcription in RAW 264.7 cells. Although there was no significant difference in the degree of cellular attachment or proliferation of RAW 264.7 cells to the different titanium surfaces, by 24 h the hydrophilic surface elicited a gene expression profile with significant down-regulation of the key pro-inflammatory cytokines Tnfα, IL-1α, IL-1β and the chemokine Ccl-2. Down-regulation of the expression of pro-inflammatory cytokine genes may thus modulate the inflammatory response and may facilitate the enhanced bone wound healing and osseointegration observed clinically using implants with a microrough hydrophilic surface. © 2011 John Wiley & Sons A/S.

  7. The Class III Kinase Vps34 Promotes T Lymphocyte Survival through Regulating IL-7Rα Surface Expression

    PubMed Central

    McLeod, Ian X.; Zhou, Xiang; Li, Qi-Jing; Wang, Fan; He, You-Wen

    2011-01-01

    IL-7Rα mediated signals are essential for naive T lymphocyte survival. Recent studies show that IL-7Rα is internalized and either recycled to cell surface or degraded. However, how the intracellular process of IL-7Rα trafficking is regulated is unclear. Here we show that Vps34, the class III phosphatidylinositol 3-kinase, plays a critical role in proper IL-7Rα intracellular trafficking. Mice lacking Vps34 in T lymphocytes had a severely reduced T lymphocyte compartment. Vps34-deficient T lymphocytes exhibit increased death and reduced IL-7Rα surface expression, though three major forms of autophagy remain intact. Intracellular IL-7Rα in normal T lymphocytes at steady-state is trafficked through either early endosome/multivesicular bodies (MVB) to the late endosome-Golgi for surface expression or to the lysosome for degradation. However, Vps34-deficient T cells have mislocalized intracellular Eea1, HRS, and Vps36 protein levels, the combined consequence of which is the inability to mobilize internalized IL-7Rα into the retromer pathway for surface display. Our studies reveal that Vps34, though dispensible for autophagy induction, is a critical regulator of naïve T cell homeostasis, modulating IL-7Rα trafficking, signaling, and recycling. PMID:22021616

  8. REEPs Are Membrane Shaping Adapter Proteins That Modulate Specific G Protein-Coupled Receptor Trafficking by Affecting ER Cargo Capacity

    PubMed Central

    Ho, Vincent K.; Angelotti, Timothy

    2013-01-01

    Receptor expression enhancing proteins (REEPs) were identified by their ability to enhance cell surface expression of a subset of G protein-coupled receptors (GPCRs), specifically GPCRs that have proven difficult to express in heterologous cell systems. Further analysis revealed that they belong to the Yip (Ypt-interacting protein) family and that some REEP subtypes affect ER structure. Yip family comparisons have established other potential roles for REEPs, including regulation of ER-Golgi transport and processing/neuronal localization of cargo proteins. However, these other potential REEP functions and the mechanism by which they selectively enhance GPCR cell surface expression have not been clarified. By utilizing several REEP family members (REEP1, REEP2, and REEP6) and model GPCRs (α2A and α2C adrenergic receptors), we examined REEP regulation of GPCR plasma membrane expression, intracellular processing, and trafficking. Using a combination of immunolocalization and biochemical methods, we demonstrated that this REEP subset is localized primarily to ER, but not plasma membranes. Single cell analysis demonstrated that these REEPs do not specifically enhance surface expression of all GPCRs, but affect ER cargo capacity of specific GPCRs and thus their surface expression. REEP co-expression with α2 adrenergic receptors (ARs) revealed that this REEP subset interacts with and alter glycosidic processing of α2C, but not α2A ARs, demonstrating selective interaction with cargo proteins. Specifically, these REEPs enhanced expression of and interacted with minimally/non-glycosylated forms of α2C ARs. Most importantly, expression of a mutant REEP1 allele (hereditary spastic paraplegia SPG31) lacking the carboxyl terminus led to loss of this interaction. Thus specific REEP isoforms have additional intracellular functions besides altering ER structure, such as enhancing ER cargo capacity, regulating ER-Golgi processing, and interacting with select cargo proteins. Therefore, some REEPs can be further described as ER membrane shaping adapter proteins. PMID:24098485

  9. The TspanC8 Subgroup of Tetraspanins Interacts with A Disintegrin and Metalloprotease 10 (ADAM10) and Regulates Its Maturation and Cell Surface Expression*

    PubMed Central

    Haining, Elizabeth J.; Yang, Jing; Bailey, Rebecca L.; Khan, Kabir; Collier, Richard; Tsai, Schickwann; Watson, Steve P.; Frampton, Jon; Garcia, Paloma; Tomlinson, Michael G.

    2012-01-01

    A disintegrin and metalloprotease 10 (ADAM10) is a ubiquitous transmembrane metalloprotease that cleaves the extracellular regions from over 40 different transmembrane target proteins, including Notch and amyloid precursor protein. ADAM10 is essential for embryonic development and is also important in inflammation, cancer, and Alzheimer disease. However, ADAM10 regulation remains poorly understood. ADAM10 is compartmentalized into membrane microdomains formed by tetraspanins, which are a superfamily of 33 transmembrane proteins in humans that regulate clustering and trafficking of certain other transmembrane “partner” proteins. This is achieved by specific tetraspanin-partner interactions, but it is not clear which tetraspanins specifically interact with ADAM10. The aims of this study were to identify which tetraspanins interact with ADAM10 and how they regulate this metalloprotease. Co-immunoprecipitation identified specific ADAM10 interactions with Tspan5, Tspan10, Tspan14, Tspan15, Tspan17, and Tspan33/Penumbra. These are members of the largely unstudied TspanC8 subgroup of tetraspanins, all six of which promoted ADAM10 maturation. Different cell types express distinct repertoires of TspanC8 tetraspanins. Human umbilical vein endothelial cells express relatively high levels of Tspan14, the knockdown of which reduced ADAM10 surface expression and activity. Mouse erythrocytes express predominantly Tspan33, and ADAM10 expression was substantially reduced in the absence of this tetraspanin. In contrast, ADAM10 expression was normal on Tspan33-deficient mouse platelets in which Tspan14 is the major TspanC8 tetraspanin. These results define TspanC8 tetraspanins as essential regulators of ADAM10 maturation and trafficking to the cell surface. This finding has therapeutic implications because focusing on specific TspanC8-ADAM10 complexes may allow cell type- and/or substrate-specific ADAM10 targeting. PMID:23035126

  10. A conserved WW domain-like motif regulates invariant chain-dependent cell-surface transport of the NKG2D ligand ULBP2.

    PubMed

    Uhlenbrock, Franziska; van Andel, Esther; Andresen, Lars; Skov, Søren

    2015-08-01

    Malignant cells expressing NKG2D ligands on their cell surface can be directly sensed and killed by NKG2D-bearing lymphocytes. To ensure this immune recognition, accumulating evidence suggests that NKG2D ligands are trafficed via alternative pathways to the cell surface. We have previously shown that the NKG2D ligand ULBP2 traffics over an invariant chain (Ii)-dependent pathway to the cell surface. This study set out to elucidate how Ii regulates ULBP2 cell-surface transport: We discovered conserved tryptophan (Trp) residues in the primary protein sequence of ULBP1-6 but not in the related MICA/B. Substitution of Trp to alanine resulted in cell-surface inhibition of ULBP2 in different cancer cell lines. Moreover, the mutated ULBP2 constructs were retained and not degraded inside the cell, indicating a crucial role of this conserved Trp-motif in trafficking. Finally, overexpression of Ii increased surface expression of wt ULBP2 while Trp-mutants could not be expressed, proposing that this Trp-motif is required for an Ii-dependent cell-surface transport of ULBP2. Aberrant soluble ULBP2 is immunosuppressive. Thus, targeting a distinct protein module on the ULBP2 sequence could counteract this abnormal expression of ULBP2. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Rho-associated kinase (ROCK) inhibition reverses low cell activity on hydrophobic surfaces.

    PubMed

    Tian, Yu Shun; Kim, Hyun Jung; Kim, Hyun-Man

    2009-08-28

    Hydrophobic polymers do not offer an adequate scaffold surface for cells to attach, migrate, proliferate, and differentiate. Thus, hydrophobic scaffolds for tissue engineering have traditionally been physicochemically modified to enhance cellular activity. However, modifying the surface by chemical or physical treatment requires supplementary engineering procedures. In the present study, regulation of a cell signal transduction pathway reversed the low cellular activity on a hydrophobic surface without surface modification. Inhibition of Rho-associated kinase (ROCK) by Y-27632 markedly enhanced adhesion, migration, and proliferation of osteoblastic cells cultured on a hydrophobic polystyrene surface. ROCK inhibition regulated cell-cycle-related molecules on the hydrophobic surface. This inhibition also decreased expression of the inhibitors of cyclin-dependent kinases such as p21(cip1) and p27(kip1) and increased expression of cyclin A and D. These results indicate that defective cellular activity on the hydrophobic surface can be reversed by the control of a cell signal transduction pathway without physicochemical surface modification.

  12. Rapid down-regulation of γc on T cells in early SIV infection correlates with impairment of T-cell function.

    PubMed

    Xu, Huanbin; Wang, Xiaolei; Pahar, Bapi; Alvarez, Xavier; Rasmussen, Kelsi K; Lackner, Andrew A; Veazey, Ronald S

    2012-06-01

    The common γ(c) subunit molecule is shared among all γ(c) cytokines and clearly involved in T-cell function, but its role in HIV infection and immunity is not well understood. Here, we examined expression and function of γ(c) on T cells during SIV infection in Rhesus macaques. Surface γ(c) distribution was differentially expressed on CD4(+) and CD8(+) T cells, and CD4(+) naive/memory cell populations in various lymphoid tissues of normal macaques. However, surface γ(c) expression was rapidly and significantly down-regulated on T cells in acute infection with pathogenic SIV, compared to infection with a less virulent SHIV or controls and did not recover on CD8(+) T cells in the chronic stage. Moreover, the peripheral and CD4(+)T cell loss was inversely correlated with γ(c)(+) CD8(+) T cells in individual tissues. γ(c)(+) T cells were mainly functional as evidenced by higher cytokine secretion and proliferative capacity. Further in vitro experiments found that surface γ(c) expression could be down-regulated following high level of IL-7 treatment by both internalization and shedding. Down-regulation of γ(c) during early HIV/SIV infection may inhibit T-cell function, particularly of CD8(+) T cells, and, may be linked with immune failure and loss of viral containment.

  13. Modulation of tumor necrosis factor (TNF) receptor expression during monocytic differentiation by glucocorticoids.

    PubMed

    Goppelt-Struebe, M; Reiser, C O; Schneider, N; Grell, M

    1996-10-01

    Regulation of tumor necrosis factor receptors by glucocorticoids was investigated during phorbol ester-induced monocytic differentiation. As model system the human monocytic cell lines U937 and THP-1, which express both types of TNF receptors (TNF-R60 and TNF-R80), were differentiated with tetradecanoyl phorbol-13-acetate (TPA, 5 x 10(-9) M) in the presence or absence of dexamethasone (10(-9) - 10(-6) M). Expression of TNF receptors was determined at the mRNA level by Northern blot analysis and at the protein level by FACS analysis. During differentiation, TNF-R60 mRNA was down-regulated, whereas TNF-R80 mRNA levels were increased. Dexamethasone had no effect on TNF-R60 mRNA expression but attenuated TNF-R80 mRNA expression in both cell lines. Cell surface expression of TNF-R60 protein remained essentially unchanged during differentiation of THP-1 cells, whereas a rapid down-regulation of TNF-R80 was observed that was followed by a slow recovery. Surface expression of TNF-R80 was not affected by dexamethasone, whereas TNF-R60 expression was reduced by about 25%. These results indicate differential regulation of the two types of TNF receptors at the mRNA and protein level during monocytic differentiation. Glucocorticoids interfered with mRNA expression of TNF-R80 and protein expression of TNF-R60, but the rather limited effect leaves the question of its functional relevance open. In contrast to other cytokine systems, TNF receptors do not appear to be major targets of glucocorticoid action.

  14. Formation of a physiological complex between TRPV2 and RGA protein promotes cell surface expression of TRPV2.

    PubMed

    Stokes, Alexander J; Wakano, Clay; Del Carmen, Kimberly A; Koblan-Huberson, Murielle; Turner, Helen

    2005-03-01

    The transient receptor potential, sub-family Vanilloid (TRPV)(2) cation channel is activated in response to extreme temperature elevations in sensory neurons. However, TRPV2 is widely expressed in tissues with no sensory function, including cells of the immune system. Regulation of GRC, the murine homolog of TRPV2 has been studied in insulinoma cells and myocytes. GRC is activated in response to certain growth factors and neuropeptides, via a mechanism that involves regulated access of the channel to the plasma membrane. This is likely to be an important primary control mechanism for TRPV2 outside the CNS. Here, we report that a regulated trafficking step controls the access of TRPV2 to the cell surface in mast cells. In mast cells, elevations in cytosolic cAMP are sufficient to drive plasma membrane localization of TRPV2. We have previously proposed that the recombinase gene activator protein (RGA), a four-transmembrane domain, intracellular protein, associates with TRPV2 during the biosynthesis and early trafficking of the channel. We use a polyclonal antibody to RGA to confirm the formation of a physiological complex between RGA and TRPV2. Finally, we show that over-expression of the RGA protein potentiates the basal surface localization of TRPV2. We propose that trafficking and activation mechanisms intersect for TRPV2, and that cAMP mobilizing stimuli may regulate TRPV2 localization in non-sensory cells. RGA participates in the control of TRPV2 surface levels, and co-expression of RGA may be a key component of experimental systems that seek to study TRPV2 physiology.

  15. Type 3 fimbriae and biofilm formation are regulated by the transcriptional regulators MrkHI in Klebsiella pneumoniae.

    PubMed

    Johnson, Jeremiah G; Murphy, Caitlin N; Sippy, Jean; Johnson, Tylor J; Clegg, Steven

    2011-07-01

    Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression.

  16. Type 3 Fimbriae and Biofilm Formation Are Regulated by the Transcriptional Regulators MrkHI in Klebsiella pneumoniae▿

    PubMed Central

    Johnson, Jeremiah G.; Murphy, Caitlin N.; Sippy, Jean; Johnson, Tylor J.; Clegg, Steven

    2011-01-01

    Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression. PMID:21571997

  17. Relationship of CD86 surface marker expression and cytotoxicity on dendritic cells exposed to chemical allergen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hulette, Ben C.; Ryan, Cindy A.; Gildea, Lucy A.

    2005-12-01

    Human peripheral blood-derived dendritic cells (DC) respond to a variety of chemical allergens by up-regulating expression of the co-stimulatory molecule CD86. It has been postulated that this measure might provide the basis for an in vitro alternative approach for the identification of skin sensitizing chemicals. We recently reported that DC, exposed in culture to the highest non-cytotoxic concentrations of various chemical allergens, displayed marginal up-regulation of membrane CD86 expression; the interpretation being that such changes were insufficiently sensitive for the purposes of hazard identification. For the work presented here, immature DC were derived from human monocytes and treated with themore » chemical allergens 2,4-dinitrobenzenesulfonic acid (DNBS), nickel sulfate (NiSO{sub 4}), p-phenylenediamine (PPD), Bandrowski's base (BB), hydroquinone (HQ) and propyl gallate (PG) for 48 h at concentrations which induced both no to slight to moderate cytotoxicity. For comparison, DC were treated with the irritants sodium dodecyl sulfate (SDS), benzoic acid (BA), and benzalkonium chloride (BZC) at concentrations resulting in comparable levels of cytotoxicity. CD86 expression, as measured by flow cytometry, was consistently up-regulated (ranging from 162 to 386% control) on DC treated with concentrations of chemical allergens that induced approximately 10-15% cytotoxicity. The irritants BA and BZC did not induce up-regulation of CD86 expression when tested at concentrations that induced similar levels of cytotoxicity. SDS, however, up-regulated CD86 expression to 125-138% of control in 2/4 preparations when tested at concentrations which induced similar toxicity. Our results confirm that chemical allergens up-regulate CD86 expression on blood-derived DC and illustrate further that up-regulation of CD86 surface marker expression is more robust when DC are treated with concentrations of chemical allergen that induce slight to moderate cytotoxicity.« less

  18. Roles of Heparan Sulfate Sulfation in Dentinogenesis*

    PubMed Central

    Hayano, Satoru; Kurosaka, Hiroshi; Yanagita, Takeshi; Kalus, Ina; Milz, Fabian; Ishihara, Yoshihito; Islam, Md. Nurul; Kawanabe, Noriaki; Saito, Masahiro; Kamioka, Hiroshi; Adachi, Taiji; Dierks, Thomas; Yamashiro, Takashi

    2012-01-01

    Cell surface heparan sulfate (HS) is an essential regulator of cell signaling and development. HS traps signaling molecules, like Wnt in the glycosaminoglycan side chains of HS proteoglycans (HSPGs), and regulates their functions. Endosulfatases Sulf1 and Sulf2 are secreted at the cell surface to selectively remove 6-O-sulfate groups from HSPGs, thereby modifying the affinity of cell surface HSPGs for its ligands. This study provides molecular evidence for the functional roles of HSPG sulfation and desulfation in dentinogenesis. We show that odontogenic cells are highly sulfated on the cell surface and become desulfated during their differentiation to odontoblasts, which produce tooth dentin. Sulf1/Sulf2 double null mutant mice exhibit a thin dentin matrix and short roots combined with reduced expression of dentin sialophosphoprotein (Dspp) mRNA, encoding a dentin-specific extracellular matrix precursor protein, whereas single Sulf mutants do not show such defective phenotypes. In odontoblast cell lines, Dspp mRNA expression is potentiated by the activation of the Wnt canonical signaling pathway. In addition, pharmacological interference with HS sulfation promotes Dspp mRNA expression through activation of Wnt signaling. On the contrary, the silencing of Sulf suppresses the Wnt signaling pathway and subsequently Dspp mRNA expression. We also show that Wnt10a protein binds to cell surface HSPGs in odontoblasts, and interference with HS sulfation decreases the binding affinity of Wnt10a for HSPGs, which facilitates the binding of Wnt10a to its receptor and potentiates the Wnt signaling pathway, thereby up-regulating Dspp mRNA expression. These results demonstrate that Sulf-mediated desulfation of cellular HSPGs is an important modification that is critical for the activation of the Wnt signaling in odontoblasts and for production of the dentin matrix. PMID:22351753

  19. Inflammatory cytokine response to titanium chemical composition and nanoscale calcium phosphate surface modification.

    PubMed

    Hamlet, Stephen; Ivanovski, Saso

    2011-05-01

    Nanoscale surface modification of titanium dental implants with calcium phosphate (CaP) has been shown to achieve superior bone wound healing and osseointegration compared with smooth or microrough titanium surfaces alone. As bone healing has been shown to be influenced by the action of cytokines, this study examined whether changes in cytokine gene expression from RAW 264.7 cells cultured on commercially pure and titanium alloy (Ti-6Al-4V) microrough or nanoscale crystalline CaP-modified surfaces, may influence downstream events in bone wound healing and osseointegration. Whilst no significant difference in the attachment or proliferation of RAW 264.7 cells was observed, the nanoscale CaP-modified surface elicited a gene expression profile with marked down-regulation of a number of pro-inflammatory cytokines and chemokines. Inflammatory cytokine gene expression was further influenced by chemical composition, with lower levels of pro-inflammatory markers noted following exposure of the macrophage-like cells to titanium alloy (Ti-6Al-4V) compared with the commercially pure titanium surface. Down-regulation of pro-inflammatory cytokine gene expression (confirmed at the protein level for TNFα and CCL5), may thus facilitate the enhanced bone wound healing and osseointegration observed clinically with nanoscale calcium phosphate-modified implant surfaces. Copyright © 2011 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  20. Rapid down-regulation of γc on T cells in early SIV infection correlates with impairment of T-cell function

    PubMed Central

    Xu, Huanbin; Wang, Xiaolei; Pahar, Bapi; Alvarez, Xavier; Rasmussen, Kelsi K.; Lackner, Andrew A.; Veazey, Ronald S.

    2012-01-01

    The common γc subunit molecule is shared among all γc cytokines and clearly involved in T-cell function, but its role in HIV infection and immunity is not well understood. Here, we examined expression and function of γc on T cells during SIV infection in Rhesus macaques. Surface γc distribution was differentially expressed on CD4+ and CD8+ T cells, and CD4+ naive/memory cell populations in various lymphoid tissues of normal macaques. However, surface γc expression was rapidly and significantly down-regulated on T cells in acute infection with pathogenic SIV, compared to infection with a less virulent SHIV or controls and did not recover on CD8+ T cells in the chronic stage. Moreover, the peripheral and CD4+T cell loss was inversely correlated with γc+ CD8+ T cells in individual tissues. γc+ T cells were mainly functional as evidenced by higher cytokine secretion and proliferative capacity. Further in vitro experiments found that surface γc expression could be down-regulated following high level of IL-7 treatment by both internalization and shedding. Down-regulation of γc during early HIV/SIV infection may inhibit T-cell function, particularly of CD8+ T cells, and, may be linked with immune failure and loss of viral containment.—Xu, H., Wang, X., Pahar, B., Alvarez, X., Rasmussen, K. K., Lackner, A. A., Veazey, R. S. Rapid down-regulation of γc on T cells in early SIV infection correlates with impairment of T-cell function. PMID:22375017

  1. MicroRNA miR-328 Regulates Zonation Morphogenesis by Targeting CD44 Expression

    PubMed Central

    Wang, Chia-Hui; Lee, Daniel Y.; Deng, Zhaoqun; Jeyapalan, Zina; Lee, Shao-Chen; Kahai, Shireen; Lu, Wei-Yang; Zhang, Yaou; Yang, Burton B.

    2008-01-01

    Morphogenesis is crucial to initiate physiological development and tumor invasion. Here we show that a microRNA controls zonation morphogenesis by targeting hyaluronan receptor CD44. We have developed a novel system to study microRNA functions by generating constructs expressing pre-miRNAs and mature miRNAs. Using this system, we have demonstrated that expression of miR-328 reduced cell adhesion, aggregation, and migration, and regulated formation of capillary structure. Protein analysis indicated that miR-328 repressed CD44 expression. Activities of luciferase constructs harboring the target site in CD44, but not the one containing mutation, were repressed by miR-328. Zonation morphogenesis appeared in cells transfected by miR-328: miR-328-transfected cells were present on the surface of zonating structures while the control cells stayed in the middle. MiR-328-mediated CD44 actions was validated by anti-CD44 antibody, hyaluronidase, CD44 siRNA, and CD44 expression constructs. In vivo experiments showed that CD44-silencing cells appeared as layers on the surfaces of nodules or zonating structures. Immuno-histochemistry also exhibited CD44-negative cells on the surface layers of normal rat livers and the internal zones of Portal veins. Our results demonstrate that miR-328 targets CD44, which is essential in regulating zonation morphogenesis: silencing of CD44 expression is essential in sealing the zonation structures to facilitate their extension and to inhibit complex expansion. PMID:18560585

  2. MicroRNA miR-328 regulates zonation morphogenesis by targeting CD44 expression.

    PubMed

    Wang, Chia-Hui; Lee, Daniel Y; Deng, Zhaoqun; Jeyapalan, Zina; Lee, Shao-Chen; Kahai, Shireen; Lu, Wei-Yang; Zhang, Yaou; Yang, Burton B

    2008-06-18

    Morphogenesis is crucial to initiate physiological development and tumor invasion. Here we show that a microRNA controls zonation morphogenesis by targeting hyaluronan receptor CD44. We have developed a novel system to study microRNA functions by generating constructs expressing pre-miRNAs and mature miRNAs. Using this system, we have demonstrated that expression of miR-328 reduced cell adhesion, aggregation, and migration, and regulated formation of capillary structure. Protein analysis indicated that miR-328 repressed CD44 expression. Activities of luciferase constructs harboring the target site in CD44, but not the one containing mutation, were repressed by miR-328. Zonation morphogenesis appeared in cells transfected by miR-328: miR-328-transfected cells were present on the surface of zonating structures while the control cells stayed in the middle. MiR-328-mediated CD44 actions was validated by anti-CD44 antibody, hyaluronidase, CD44 siRNA, and CD44 expression constructs. In vivo experiments showed that CD44-silencing cells appeared as layers on the surfaces of nodules or zonating structures. Immuno-histochemistry also exhibited CD44-negative cells on the surface layers of normal rat livers and the internal zones of Portal veins. Our results demonstrate that miR-328 targets CD44, which is essential in regulating zonation morphogenesis: silencing of CD44 expression is essential in sealing the zonation structures to facilitate their extension and to inhibit complex expansion.

  3. Down-regulation of Pax6 is associated with abnormal differentiation of corneal epithelial cells in severe ocular surface diseases

    PubMed Central

    Li, W; Chen, Y-T; Hayashida, Y; Blanco, G; Kheirkah, A; He, H; Chen, S-Y; Liu, C-Y; Tseng, SCG

    2010-01-01

    Pax6 is the universal master control gene for eye morphogenesis. Other than retina and lens, Pax6 also expressed in the ocular surface epithelium from early gestation until the postnatal stage, in which little is known about the function of Pax6. In this study, corneal pannus tissues from patients with ocular surface diseases such as Stevens–Johnson syndrome (SJS), chemical burn, aniridia and recurrent pterygium were investigated. Our results showed that normal ocular surface epithelial cells expressed Pax6. However, corneal pannus epithelial cells from the above patients showed a decline or absence of Pax6 expression, accompanied by a decline or absence of K12 keratin but an increase of K10 keratin and filaggrin expression. Pannus basal epithelial cells maintained nuclear p63 expression and showed activated proliferation, evidenced by positive Ki67 and K16 keratin staining. On 3T3 fibroblast feeder layers, Pax6 immunostaining was negative in clones generated from epithelial cells harvested from corneal pannus from SJS or aniridia, but positive in those from the normal limbal epithelium; whereas western blots showed that some epithelial clones expanded from pannus retained Pax6 expression. Transient transfection of an adenoviral vector carrying EGFP–Pax6 transgenes into these Pax6− clones increased both Pax6 and K12 keratin expression. These results indicate that Pax6 helps to maintain the normal corneal epithelial phenotype postnatally, and that down-regulation of Pax6 is associated with abnormal epidermal differentiation in severe ocular surface diseases. Reintroduction of activation of the Pax6 gene might be useful in treating squamous metaplasia of the ocular surface epithelium. PMID:18027901

  4. Altered Expression of TAP-1 and Major Histocompatibility Complex Class I in Laryngeal Papillomatosis: Correlation of TAP-1 with Disease

    PubMed Central

    Vambutas, Andrea; Bonagura, Vincent R.; Steinberg, Bettie M.

    2000-01-01

    Recurrent respiratory papillomatosis (RRP) is an insidious disease caused by human papillomavirus (HPV) infection. It is characterized by a variable clinical course that can include frequent disease recurrence, significant morbidity, and occasional mortality. The mechanisms responsible for the variability in the clinical course and the persistence of latent HPV infection remain unknown. Effective T-cell-mediated clearance of HPV-infected cells may be defective in patients with RRP, leading to recurrent disease and failure to suppress latent HPV reactivation. This study describes the down-regulation of the transporter associated with antigen presentation (TAP-1) and the major histocompatibility complex (MHC) class I protein expression in laryngeal papilloma tissue biopsies and cell culture of primary explants. There was a statistically significant correlation between reduction of TAP-1 expression in biopsy tissues and rapid recurrence of disease. Patients with RRP had less frequent recurrence if their papillomas expressed TAP-1 at levels close to that of normal tissue, compared with those with very low expression of TAP-1, who had frequent recurrence (32 versus 5 weeks to the next surgical intervention). These findings suggest that HPV may evade immune recognition by down-regulating class I MHC cell surface expression via decreased TAP-1 levels. Expression of TAP-1 could be used for prognostic evaluation of disease severity. Gamma interferon was able to restore class I MHC expression at the surfaces of laryngeal papilloma cells in culture. This up-regulation of class I MHC antigen at the cell surface potentially allows the infected cell to become a target for the immune system again. This finding provides some promise for nonsurgical treatment of laryngeal papillomas. PMID:10618282

  5. Estrogen upregulates MICA/B expression in human non-small cell lung cancer through the regulation of ADAM17.

    PubMed

    Ren, Jing; Nie, Yunzhong; Lv, Mingming; Shen, Sunan; Tang, Ruijing; Xu, Yujun; Hou, Yayi; Zhao, Shuli; Wang, Tingting

    2015-11-01

    Estrogen is involved in promoting lung cancer cell division and metastasis. MICA and MICB function as ligands for NKG2D, an important immunoreceptor expressed on natural killer (NK) cells. However, whether estrogen regulates MICA/B expression and affects tumor immune escape remains unknown. In this study, we measured the mRNA levels of MICA, MICB and ADAM17in non-small cell lung cancer (NSCLC) cell lines treated with estrogen. Surface expression of MICA/B on LTEP-a2 and A549 was detected using flow cytometry. We demonstrate that both mRNA and secretory protein levels of MICA/B in lung adenocarcinoma cell lines were upregulated by estradiol. Estradiol enhanced the expression of ADAM17, which was associated with the secretion of MICA/B. This secretion of MICA/B downregulated the NKG2D receptor on the surface of NK92 cells and impaired the cytotoxic activity of NK cells. Estradiol enhanced the expression of ADAM17, which was associated with the secretion of MICA/B. Furthermore, a significant correlation between the concentration of estradiol and the expression of MICA was found in tumor tissues of NSCLC patients. Therefore, we conclude that estrogen can regulate the expression and secretion of MICA/B through ADAM17, which helps lung cancer cells escape NKG2D-mediated immune surveillance.

  6. Conserved regulation of mesenchymal gene expression by Fgf-8 in face and limb development.

    PubMed

    Tucker, A S; Al Khamis, A; Ferguson, C A; Bach, I; Rosenfeld, M G; Sharpe, P T

    1999-01-01

    Clim-2 (NLI, Lbd1) is one of two related mouse proteins that interact with Lim-domain homeoproteins. In the mouse, embryonic expression of Clim-2 is particularly pronounced in facial ectomesenchyme and limb bud mesenchyme in association with Lim genes, Lhx-6 and Lmx-1 respectively. We show that in common with both these Lim genes, Clim-2 expression is regulated by signals from overlying epithelium. In both the developing face and the limb buds we identify Fgf-8 as the likely candidate signalling molecule that regulates Clim-2 expression. We show that in the mandibular arch, as in the limb, Fgf-8 functions in combination with CD44, a cell surface binding protein, and that blocking CD44 binding results in inhibition of Fgf8-induced expression of Clim-2 and Lhx-6. Regulation of gene expression by Fgf8 in association with CD44 is thus conserved between limb and mandibular arch development.

  7. Induction of neural differentiation by electrically stimulated gene expression of NeuroD2.

    PubMed

    Mie, Masayasu; Endoh, Tamaki; Yanagida, Yasuko; Kobatake, Eiry; Aizawa, Masuo

    2003-02-13

    Regulation of cell differentiation is an important assignment for cellular engineering. One of the techniques for regulation is gene transfection into undifferentiated cells. Transient expression of NeuroD2, one of neural bHLH transcription factors, converted mouse N1E-115 neuroblastoma cells into differentiated neurons. The regulation of neural bHLH expression should be a novel strategy for cell differentiation. In this study, we tried to regulate neural differentiation by NeuroD2 gene inserted under the control of heat shock protein-70 (HSP) promoter, which can be activated by electrical stimulation. Mouse neuroblastoma cell line, N1E-115, was stably transfected with expression vector containing mouse NeuroD2 cDNA under HSP promoter. Transfected cells were cultured on the electrode surface and applied electrical stimulation. After stimulation, NeuroD2 expression was induced, and transfected cells adopt a neuronal morphology at 3 days after stimulation. These results suggest that neural differentiation can be induced by electrically stimulated gene expression of NeuroD2.

  8. Urokinase receptor expression involves tyrosine phosphorylation of phosphoglycerate kinase.

    PubMed

    Shetty, Praveenkumar; Velusamy, Thirunavukkarasu; Bhandary, Yashodhar P; Liu, Ming C; Shetty, Sreerama

    2010-02-01

    The interaction of urokinase-type plasminogen activator (uPA) with its receptor, uPAR, plays a central role in several pathophysiological processes, including cancer. uPA induces its own cell surface receptor expression through stabilization of uPAR mRNA. The mechanism involves binding of a 51 nt uPAR mRNA coding sequence with phosphoglycerate kinase (PGK) to down regulate cell surface uPAR expression. Tyrosine phosphorylation of PGK mediated by uPA treatment enhances uPAR mRNA stabilization. In contrast, inhibition of tyrosine phosphorylation augments PGK binding to uPAR mRNA and attenuates uPA-induced uPAR expression. Mapping the specific peptide region of PGK indicated that its first quarter (amino acids 1-100) interacts with uPAR mRNA. To determine if uPAR expression by uPA is regulated through activation of tyrosine residues of PGK, we mutated the specific tyrosine residue and tested mutant PGK for its ability to interfere with uPAR expression. Inhibition of tyrosine phosphorylation by mutating Y76 residue abolished uPAR expression induced by uPA treatment. These findings collectively demonstrate that Y76 residue present in the first quarter of the PGK molecule is involved in lung epithelial cell surface uPAR expression. This region can effectively mimic the function of a whole PGK molecule in inhibiting tumor cell growth.

  9. The breast cancer antigen 5T4 interacts with Rab11, and is a target and regulator of Rab11 mediated trafficking.

    PubMed

    Harris, Janelle L; Dave, Keyur; Gorman, Jeffrey; Khanna, Kum Kum

    2018-06-01

    5T4 is a transmembrane glycoprotein with limited expression in normal adult tissues and expression in some solid tumours. It is unclear whether 5T4 is preferentially expressed by stem or differentiated cell types. Modes of 5T4 regulation are unknown despite its ongoing development as a cancer immunotherapy target. Our aims were to clarify the differentiation status of 5T4 expressing cells in breast cancer and to understand the mechanism underlying 5T4 membrane presentation. We analysed 5T4 expression in breast cancer cell populations by flow cytometery and found that 5T4 is highly expressed on differentiated cells, where it localizes to focal adhesions. Using immunoprecipitation and mass spectrometry, we identified interactions between 5T4 and the membrane trafficking proteins Rab11, Rab18 and ARF6. Mechanistically we found that Rab11 and Rab18 have oppositional roles in controlling expression and surface presentation of 5T4. 5T4 depletion stabilizes Rab11 protein expression with a consequent stimulation transferrin surface labelling, indicating that 5T4 represses endocytic activity. Successful immunotherapeutic targeting of 5T4 requires surface presentation and different immunotherapy strategies require surface presentation versus endocytosis. While breast cancer cells with high 5T4 surface expression and rapid cell surface turnover would be susceptible to antibody-drug conjugates that rely on intracellular release, 5T4 positive cells with lower expression or lower turnover may still be responsive to T-cell mediated approaches. We find that endocytosis of 5T4 is strongly Rab11 dependent and as such Rab11 activity could affect the success or failure of 5T4-targetted immunotherapy, particularly for antibody-drug conjugate approaches. In fact, 5T4 itself represses Rab11 expression. This newly uncovered relationship between Rab11 and 5T4 suggests that breast tumours with high 5T4 expression may not have efficient endocytic uptake of 5T4-targetted immunotherapeutics. This should be considered when selecting amongst the different types of immunotherapies. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. The Nav1.2 channel is regulated by GSK3

    PubMed Central

    James, Thomas F.; Nenov, Miroslav N.; Wildburger, Norelle C.; Lichti, Cheryl; Luisi, Jonathan; Vergara, Fernanda; Panova-Electronova, Neli I.; Nilsson, Carol L.; Rudra, Jai; Green, Thomas A.; Labate, Demetrio; Laezza, Fernanda

    2015-01-01

    Background Phosphorylation plays an essential role in regulating the voltage-gated sodium (Nav) channels and excitability. Yet, a surprisingly limited number of kinases have been identified as regulators of Nav channels. Herein, we posited that glycogen synthase kinase 3 (GSK3), a critical kinase found associated with numerous brain disorders, might directly regulate neuronal Nav channels. Methods We used patch-clamp electrophysiology to record sodium currents from Nav1.2 channels stably expressed in HEK-293 cells. mRNA and protein levels were quantified with RT-PCR, Western blot, or confocal microscopy, and in vitro phosphorylation and mass spectrometry to identify phosphorylated residues. Results We found that exposure of cells to GSK3 inhibitor XIII significantly potentiates the peak current density of Nav1.2, a phenotype reproduced by silencing GSK3 with siRNA. Contrarily, overexpression of GSK3β suppressed Nav1.2-encoded currents. Neither mRNA nor total protein expression were changed upon GSK3 inhibition. Cell surface labeling of CD4-chimeric constructs expressing intracellular domains of the Nav1.2 channel indicates that cell surface expression of CD4-Nav1.2-Ctail was up-regulated upon pharmacological inhibition of GSK3, resulting in an increase of surface puncta at the plasma membrane. Finally, using in vitro phosphorylation in combination with high resolution mass spectrometry, we further demonstrate that GSK3β phosphorylates T1966 at the C-terminal tail of Nav1.2. Conclusion These findings provide evidence for a new mechanism by which GSK3 modulate Nav channel function via its C-terminal tail. General Significance These findings provide fundamental knowledge in understanding signaling dysfunction common in several neuropsychiatric disorders. PMID:25615535

  11. The N-terminal region of the dopamine D2 receptor, a rhodopsin-like GPCR, regulates correct integration into the plasma membrane and endocytic routes

    PubMed Central

    Cho, DI; Min, C; Jung, KS; Cheong, SY; Zheng, M; Cheong, SJ; Oak, MH; Cheong, JH; Lee, BK; Kim, KM

    2012-01-01

    BACKGROUND AND PURPOSE Functional roles of the N-terminal region of rhodopsin-like GPCR family remain unclear. Using dopamine D2 and D3 receptors as a model system, we probed the roles of the N-terminal region in the signalling, intracellular trafficking of receptor proteins, and explored the critical factors that determine the functionality of the N-terminal region. EXPERIMENTAL APPROACH The N-terminal region of the D2 receptor was gradually shortened or switched with that of the D3 receptor or a non-specific sequence (FLAG), or potential N-terminal glycosylation sites were mutated. Effects of these manipulations on surface expression, internalization, post-endocytic behaviours and signalling were determined. KEY RESULTS Shortening the N-terminal region of the D2 receptor enhanced receptor internalization and impaired surface expression and signalling; ligand binding, desensitization and down-regulation were not affected but their association with a particular microdomain, caveolae, was disrupted. Replacement of critical residues within the N-terminal region with the FLAG epitope failed to restore surface expression but partially restored the altered internalization and signalling. When the N-terminal regions were switched between D2 and D3 receptors, cell surface expression pattern of each receptor was switched. Mutations of potential N-terminal glycosylation sites inhibited surface expression but enhanced internalization of D2 receptors. CONCLUSIONS AND IMPLICATIONS Shortening of N-terminus or mutation of glycosylation sites located within the N-terminus enhanced receptor internalization but impaired the surface expression of D2 receptors. The N-terminal region of the D2 receptor, in a sequence-specific manner, controls the receptor's conformation and integration into the plasma membrane, which determine its subcellular localization, intracellular trafficking and signalling properties. PMID:22117524

  12. Sorting receptor Rer1 controls surface expression of muscle acetylcholine receptors by ER retention of unassembled alpha-subunits.

    PubMed

    Valkova, Christina; Albrizio, Marina; Röder, Ira V; Schwake, Michael; Betto, Romeo; Rudolf, Rüdiger; Kaether, Christoph

    2011-01-11

    The nicotinic acetylcholine receptor of skeletal muscle is composed of five subunits that are assembled in a stepwise manner. Quality control mechanisms ensure that only fully assembled receptors reach the cell surface. Here, we show that Rer1, a putative Golgi-ER retrieval receptor, is involved in the biogenesis of acetylcholine receptors. Rer1 is expressed in the early secretory pathway in the myoblast line C2C12 and in mouse skeletal muscle, and up-regulated during myogenesis. Upon down-regulation of Rer1 in C2C12 cells, unassembled acetylcholine receptor α-subunits escape from the ER and are transported to the plasma membrane and lysosomes, where they are degraded. As a result, the amount of fully assembled receptor at the cell surface is reduced. In vivo Rer1 knockdown and genetic inactivation of one Rer1 allele lead to significantly smaller neuromuscular junctions in mice. Our data show that Rer1 is a functionally important unique factor that controls surface expression of muscle acetylcholine receptors by localizing unassembled α-subunits to the early secretory pathway.

  13. Regulation of ocular surface inflammation by prostaglandin E receptor subtype EP3.

    PubMed

    Ueta, Mayumi

    2010-11-01

    We first investigated whether the prostaglandin (PG) E2-PGE receptor subtype EP3 axis regulates the development of murine experimental allergic conjunctivitis because it has been reported that this pathway negatively regulates allergic reactions in a murine allergic asthma model. We observed that EP3 is constitutively expressed in mice conjunctival epithelium. EP3 knockout mice demonstrated significantly increased eosinophil infiltration in conjunctiva after ragweed challenge compared with wild-type mice. Consistently, significantly higher expression of eotaxin-1 messenger RNA was observed in Ptger3-/- mice. Conversely, treatment of wild-type mice with an EP3-selective agonist significantly decreased eosinophil infiltration, which was blunted in Ptger3-/- mice. Expression of cyclooxygenase-2 and PGE synthases was upregulated and PGE2 content increased in the eyelids after ragweed challenge. These data suggest that PGE2 acts on EP3 in the conjunctival epithelium and downregulates the progression of experimental allergic conjunctivitis. We next examined and compared the expression of EP3 in human conjunctival epithelium in various ocular surface diseases. Human conjunctival epithelium expressed EP3-specific messenger RNA and EP3 protein. Although we could clearly find positive signals in the conjunctival epithelium from patients with noninflammatory ocular surface diseases such as conjunctivochalasis and pterygium, we could not find positive signals in that from those with inflammatory disorders such as Stevens-Johnson syndrome and ocular cicatricial pemphigoid. Likewise, expression of the PGE receptor subtype EP4 was clearly found in the conjunctival epithelium from patients with conjunctivochalasis and pterygium but not from patients with Stevens-Johnson syndrome and ocular cicatricial pemphigoid.

  14. The Staphylococcus aureus Global Regulator MgrA Modulates Clumping and Virulence by Controlling Surface Protein Expression

    PubMed Central

    Crosby, Heidi A.; Schlievert, Patrick M.; Merriman, Joseph A.; King, Jessica M.; Salgado-Pabón, Wilmara; Horswill, Alexander R.

    2016-01-01

    Staphylococcus aureus is a human commensal and opportunistic pathogen that causes devastating infections in a wide range of locations within the body. One of the defining characteristics of S. aureus is its ability to form clumps in the presence of soluble fibrinogen, which likely has a protective benefit and facilitates adhesion to host tissue. We have previously shown that the ArlRS two-component regulatory system controls clumping, in part by repressing production of the large surface protein Ebh. In this work we show that ArlRS does not directly regulate Ebh, but instead ArlRS activates expression of the global regulator MgrA. Strains lacking mgrA fail to clump in the presence of fibrinogen, and clumping can be restored to an arlRS mutant by overexpressing either arlRS or mgrA, indicating that ArlRS and MgrA constitute a regulatory pathway. We used RNA-seq to show that MgrA represses ebh, as well as seven cell wall-associated proteins (SraP, Spa, FnbB, SasG, SasC, FmtB, and SdrD). EMSA analysis showed that MgrA directly represses expression of ebh and sraP. Clumping can be restored to an mgrA mutant by deleting the genes for Ebh, SraP and SasG, suggesting that increased expression of these proteins blocks clumping by steric hindrance. We show that mgrA mutants are less virulent in a rabbit model of endocarditis, and virulence can be partially restored by deleting the genes for the surface proteins ebh, sraP, and sasG. While mgrA mutants are unable to clump, they are known to have enhanced biofilm capacity. We demonstrate that this increase in biofilm formation is partially due to up-regulation of SasG, a surface protein known to promote intercellular interactions. These results confirm that ArlRS and MgrA constitute a regulatory cascade, and that they control expression of a number of genes important for virulence, including those for eight large surface proteins. PMID:27144398

  15. S-acylation dependent post-translational cross-talk regulates large conductance calcium- and voltage- activated potassium (BK) channels

    PubMed Central

    Shipston, Michael J.

    2014-01-01

    Mechanisms that control surface expression and/or activity of large conductance calcium-activated potassium (BK) channels are important determinants of their (patho)physiological function. Indeed, BK channel dysfunction is associated with major human disorders ranging from epilepsy to hypertension and obesity. S-acylation (S-palmitoylation) represents a major reversible, post-translational modification controlling the properties and function of many proteins including ion channels. Recent evidence reveals that both pore-forming and regulatory subunits of BK channels are S-acylated and control channel trafficking and regulation by AGC-family protein kinases. The pore-forming α-subunit is S-acylated at two distinct sites within the N- and C-terminus, each site being regulated by different palmitoyl acyl transferases (zDHHCs) and acyl thioesterases (APTs). S-acylation of the N-terminus controls channel trafficking and surface expression whereas S-acylation of the C-terminal domain determines regulation of channel activity by AGC-family protein kinases. S-acylation of the regulatory β4-subunit controls ER exit and surface expression of BK channels but does not affect ion channel kinetics at the plasma membrane. Furthermore, a significant number of previously identified BK-channel interacting proteins have been shown, or are predicted to be, S-acylated. Thus, the BK channel multi-molecular signaling complex may be dynamically regulated by this fundamental post-translational modification and thus S-acylation likely represents an important determinant of BK channel physiology in health and disease. PMID:25140154

  16. The HTLV-I tax protein transcriptionally modulates OX40 antigen expression.

    PubMed

    Pankow, R; Dürkop, H; Latza, U; Krause, H; Kunzendorf, U; Pohl, T; Bulfone-Paus, S

    2000-07-01

    OX40 is a member of the TNF receptor family, expressed on activated T cells. It is the only costimulatory T cell molecule known to be specifically up-regulated in human T cell leukemia virus type-I (HTLV-I)-producing cells. In a T cell line, OX40 surface expression was shown to be induced by HTLV-I Tax alone. To understand molecular mechanisms of OX40 gene regulation and modulation by HTLV-I Tax, we have cloned the human OX40 gene and analyzed its 5'-flanking region. By reporter gene analysis with progressive 5' deletions from nucleotides -1259 to -64, we have defined a 157-bp DNA fragment as a minimal promoter for constitutive expression. In addition, we show that in the OX40+ cell line, Co, Tax is able to further increase OX40 surface expression. Up-regulation of OX40 promoter activity by Tax requires two upstream NF-kappaB sites, which are not active in the constitutive OX40 expression. Their deletion abrogates Tax responsiveness in reporter gene analysis. The site-directed mutagenesis of each NF-kappaB site demonstrates that cooperative NF-kappaB binding is a prerequisite for Tax-directed activity as neither site alone is sufficient for a full Tax responsiveness of the OX40 promoter. Upon Tax expression, both sites bind p65 and c-Rel. These data provide new insight into the direct regulation of OX40 by Tax and add to our understanding of the possible role of the OX40/OX40 ligand system in the proliferation of HTLV-I+ T cells.

  17. A kainate receptor subunit promotes the recycling of the neuron-specific K+-Cl- co-transporter KCC2 in hippocampal neurons.

    PubMed

    Pressey, Jessica C; Mahadevan, Vivek; Khademullah, C Sahara; Dargaei, Zahra; Chevrier, Jonah; Ye, Wenqing; Huang, Michelle; Chauhan, Alamjeet K; Meas, Steven J; Uvarov, Pavel; Airaksinen, Matti S; Woodin, Melanie A

    2017-04-14

    Synaptic inhibition depends on a transmembrane gradient of chloride, which is set by the neuron-specific K + -Cl - co-transporter KCC2. Reduced KCC2 levels in the neuronal membrane contribute to the generation of epilepsy, neuropathic pain, and autism spectrum disorders; thus, it is important to characterize the mechanisms regulating KCC2 expression. In the present study, we determined the role of KCC2-protein interactions in regulating total and surface membrane KCC2 expression. Using quantitative immunofluorescence in cultured mouse hippocampal neurons, we discovered that the kainate receptor subunit GluK2 and the auxiliary subunit Neto2 significantly increase the total KCC2 abundance in neurons but that GluK2 exclusively increases the abundance of KCC2 in the surface membrane. Using a live cell imaging assay, we further determined that KCC2 recycling primarily occurs within 1-2 h and that GluK2 produces an ∼40% increase in the amount of KCC2 recycled to the membrane during this time period. This GluK2-mediated increase in surface recycling translated to a significant increase in KCC2 expression in the surface membrane. Moreover, we found that KCC2 recycling is enhanced by protein kinase C-mediated phosphorylation of the GluK2 C-terminal residues Ser-846 and Ser-868. Lastly, using gramicidin-perforated patch clamp recordings, we found that the GluK2-mediated increase in KCC2 recycling to the surface membrane translates to a hyperpolarization of the reversal potential for GABA (E GABA ). In conclusion, our results have revealed a mechanism by which kainate receptors regulate KCC2 expression in the hippocampus. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Regulation of Eosinophil Recruitment and Activation by Galectins in Allergic Asthma.

    PubMed

    Rao, Savita P; Ge, Xiao Na; Sriramarao, P

    2017-01-01

    Eosinophils are differentiated granulocytes that are recruited from the bone marrow to sites of inflammation via the vascular system. Allergic asthma is characterized by the presence of large numbers of eosinophils in the lungs and airways. Due to their capacity to rapidly release inflammatory mediators such as cytokines, chemokines, growth factors, and cytotoxic granule proteins upon stimulation, eosinophils play a critical role in pro-inflammatory processes in allergen-exposed lungs. Identifying key players and understanding the molecular mechanisms directing eosinophil trafficking and recruitment to inflamed airways is a key to developing therapeutic strategies to limit their influx. Recent studies have brought to light the important role of glycans and glycan binding proteins in regulating recruitment of eosinophils. In addition to the role of previously identified eosinophil- and endothelial-expressed adhesion molecules in mediating eosinophil trafficking and recruitment to the inflamed airways, studies have also indicated a role for galectins (galectin-3) in this process. Galectins are mammalian lectins expressed by various cell types including eosinophils. Intracellularly, they can regulate biological processes such as cell motility. Extracellularly, galectins interact with β-galactosides in cell surface-expressed glycans to regulate cellular responses like production of inflammatory mediators, cell adhesion, migration, and apoptosis. Eosinophils express galectins intracellularly or on the cell surface where they interact with cell surface glycoconjugate receptors. Depending on the type (galectin-1, -3, etc.) and location (extracellular or intracellular, endogenous or exogenously delivered), galectins differentially regulate eosinophil recruitment, activation, and apoptosis and thus exert a pro- or anti-inflammatory outcome. Here, we have reviewed information pertaining to galectins (galectin-1, -3 -9, and -10) that are expressed by eosinophils themselves and/or other cells that play a role in eosinophil recruitment and function in the context of allergic asthma and their potential use as disease biomarkers or therapeutic targets for immunomodulation.

  19. Tyrosine Phosphorylation of the Human Serotonin Transporter: A Role in the Transporter Stability and Function

    PubMed Central

    Annamalai, Balasubramaniam; Mannangatti, Padmanabhan; Arapulisamy, Obulakshmi; Shippenberg, Toni S.; Jayanthi, Lankupalle D.

    2012-01-01

    The serotonin (5-HT) transporter (SERT) regulates serotoninergic neurotransmission by clearing 5-HT released into the synaptic space. Phosphorylation of SERT on serine and threonine mediates SERT regulation. Whether tyrosine phosphorylation regulates SERT is unknown. Here, we tested the hypothesis that tyrosine-phosphorylation of SERT regulates 5-HT transport. In support of this, alkali-resistant 32P-labeled SERT was found in rat platelets, and Src-tyrosine kinase inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo [3,4,d]pyrimidine (PP2) decreased platelet SERT function and expression. In human placental trophoblast cells expressing SERT, PP2 reduced transporter function, expression, and stability. Although siRNA silencing of Src expression decreased SERT function and expression, coexpression of Src resulted in PP2-sensitive increases in SERT function and expression. PP2 treatment markedly decreased SERT protein stability. Compared with WT-SERT, SERT tyrosine mutants Y47F and Y142F exhibited reduced 5-HT transport despite their higher total and cell surface expression levels. Moreover, Src-coexpression increased total and cell surface expression of Y47F and Y142F SERT mutants without affecting their 5-HT transport capacity. It is noteworthy that Y47F and Y142F mutants exhibited higher protein stability compared with WT-SERT. However, similar to WT-SERT, PP2 treatment decreased the stability of Y47F and Y142F mutants. Furthermore, compared with WT-SERT, Y47F and Y142F mutants exhibited lower basal tyrosine phosphorylation and no further enhancement of tyrosine phosphorylation in response to Src coexpression. These results provide the first evidence that SERT tyrosine phosphorylation supports transporter protein stability and 5HT transport. PMID:21992875

  20. Sustained neurotensin exposure promotes cell surface recruitment of NTS2 receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perron, Amelie; Sharif, Nadder; Gendron, Louis

    2006-05-12

    In this study, we investigated whether persistent agonist stimulation of NTS2 receptors gives rise to down-regulation, in light of reports that their activation induced long-lasting effects. To address this issue, we incubated COS-7 cells expressing the rat NTS2 with neurotensin (NT) for up to 24 h and measured resultant cell surface [{sup 125}I]-NT binding. We found that NTS2-expressing cells retained the same surface receptor density despite efficient internalization mechanisms. This preservation was neither due to NTS2 neosynthesis nor recycling since it was not blocked by cycloheximide or monensin. However, it appeared to involve translocation of spare receptors from internal stores,more » as NT induced NTS2 migration from trans-Golgi network to endosome-like structures. This stimulation-induced regulation of cell surface NTS2 receptors was even more striking in rat spinal cord neurons. Taken together, these results suggest that sustained NTS2 activation promotes recruitment of intracellular receptors to the cell surface, thereby preventing functional desensitization.« less

  1. MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells

    PubMed Central

    Riepsaame, Joey; van Oudenaren, Adri; den Broeder, Berlinda J. H.; van IJcken, Wilfred F. J.; Pothof, Joris; Leenen, Pieter J. M.

    2013-01-01

    Dendritic cell (DC) maturation is a tightly regulated process that requires coordinated and timed developmental cues. Here we investigate whether microRNAs are involved in this process. We identify microRNAs in mouse GM-CSF-generated, monocyte-related DC (GM-DC) that are differentially expressed during both spontaneous and LPS-induced maturation and characterize M-CSF receptor (M-CSFR), encoded by the Csf1r gene, as a key target for microRNA-mediated regulation in the final step toward mature DC. MicroRNA-22, -34a, and -155 are up-regulated in mature MHCIIhi CD86hi DC and mediate Csf1r mRNA and protein down-regulation. Experimental inhibition of Csf1r-targeting microRNAs in vitro results not only in sustained high level M-CSFR protein expression but also in impaired DC maturation upon stimulation by LPS. Accordingly, over-expression of Csf1r in GM-DC inhibits terminal differentiation. Taken together, these results show that developmentally regulated microRNAs control Csf1r expression, supplementing previously identified mechanisms that regulate its transcription and protein surface expression. Furthermore, our data indicate a novel function for Csf1r in mouse monocyte-derived DC, showing that down-regulation of M-CSFR expression is essential for final DC maturation. PMID:24198819

  2. Cloning of B cell-specific membrane tetraspanning molecule BTS possessing B cell proliferation-inhibitory function.

    PubMed

    Suenaga, Tadahiro; Arase, Hisashi; Yamasaki, Sho; Kohno, Masayuki; Yokosuka, Tadashi; Takeuchi, Arata; Hattori, Takamichi; Saito, Takashi

    2007-11-01

    Lymphocyte proliferation is regulated by signals through antigen receptors, co-stimulatory receptors, and other positive and negative modulators. Several membrane tetraspanning molecules are also involved in the regulation of lymphocyte growth and death. We cloned a new B cell-specific tetraspanning (BTS) membrane molecule, which is similar to CD20 in terms of expression, structure and function. BTS is specifically expressed in the B cell line and its expression is increased after the pre-B cell stage. BTS is expressed in intracellular granules and on the cell surface. Overexpression of BTS in immature B cell lines induces growth retardation through inhibition of cell cycle progression and cell size increase without inducing apoptosis. This inhibitory function is mediated predominantly by the N terminus of BTS. The development of mature B cells is inhibited in transgenic mice expressing BTS, suggesting that BTS is involved in the in vivo regulation of B cells. These results indicate that BTS plays a role in the regulation of cell division and B cell growth.

  3. Regulation of cytokine receptors by Golgi N-glycan processing and endocytosis.

    PubMed

    Partridge, Emily A; Le Roy, Christine; Di Guglielmo, Gianni M; Pawling, Judy; Cheung, Pam; Granovsky, Maria; Nabi, Ivan R; Wrana, Jeffrey L; Dennis, James W

    2004-10-01

    The Golgi enzyme beta1,6 N-acetylglucosaminyltransferase V (Mgat5) is up-regulated in carcinomas and promotes the substitution of N-glycan with poly N-acetyllactosamine, the preferred ligand for galectin-3 (Gal-3). Here, we report that expression of Mgat5 sensitized mouse cells to multiple cytokines. Gal-3 cross-linked Mgat5-modified N-glycans on epidermal growth factor and transforming growth factor-beta receptors at the cell surface and delayed their removal by constitutive endocytosis. Mgat5 expression in mammary carcinoma was rate limiting for cytokine signaling and consequently for epithelial-mesenchymal transition, cell motility, and tumor metastasis. Mgat5 also promoted cytokine-mediated leukocyte signaling, phagocytosis, and extravasation in vivo. Thus, conditional regulation of N-glycan processing drives synchronous modification of cytokine receptors, which balances their surface retention against loss via endocytosis.

  4. The FasX Small Regulatory RNA Negatively Regulates the Expression of Two Fibronectin-Binding Proteins in Group A Streptococcus.

    PubMed

    Danger, Jessica L; Makthal, Nishanth; Kumaraswami, Muthiah; Sumby, Paul

    2015-12-01

    The group A Streptococcus (GAS; Streptococcus pyogenes) causes more than 700 million human infections each year. The success of this pathogen can be traced in part to the extensive arsenal of virulence factors that are available for expression in temporally and spatially specific manners. To modify the expression of these virulence factors, GAS use both protein- and RNA-based regulators, with the best-characterized RNA-based regulator being the small regulatory RNA (sRNA) FasX. FasX is a 205-nucleotide sRNA that contributes to GAS virulence by enhancing the expression of the thrombolytic secreted virulence factor streptokinase and by repressing the expression of the collagen-binding cell surface pili. Here, we have expanded the FasX regulon, showing that this sRNA also negatively regulates the expression of the adhesion- and internalization-promoting, fibronectin-binding proteins PrtF1 and PrtF2. FasX posttranscriptionally regulates the expression of PrtF1/2 through a mechanism that involves base pairing to the prtF1 and prtF2 mRNAs within their 5' untranslated regions, overlapping the mRNA ribosome-binding sites. Thus, duplex formation between FasX and the prtF1 and prtF2 mRNAs blocks ribosome access, leading to an inhibition of mRNA translation. Given that FasX positively regulates the expression of the spreading factor streptokinase and negatively regulates the expression of the collagen-binding pili and of the fibronectin-binding PrtF1/2, our data are consistent with FasX functioning as a molecular switch that governs the transition of GAS between the colonization and dissemination stages of infection. More than half a million deaths each year are a consequence of infections caused by GAS. Insights into how this pathogen regulates the production of proteins during infection may facilitate the development of novel therapeutic or preventative regimens aimed at inhibiting this activity. Here, we have expanded insight into the regulatory activity of the GAS small RNA FasX. In addition to identifying that FasX reduces the abundance of the cell surface-located fibronectin-binding proteins PrtF1/2, fibronectin is present in high abundance in human tissues, and we have determined the mechanism behind this regulation. Importantly, as FasX is the only mechanistically characterized regulatory RNA in GAS, it serves as a model RNA in this and related pathogens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Select Rab GTPases Regulate the Pulmonary Endothelium via Endosomal Trafficking of Vascular Endothelial-Cadherin.

    PubMed

    Chichger, Havovi; Braza, Julie; Duong, Huetran; Boni, Geraldine; Harrington, Elizabeth O

    2016-06-01

    Pulmonary edema occurs in settings of acute lung injury, in diseases, such as pneumonia, and in acute respiratory distress syndrome. The lung interendothelial junctions are maintained in part by vascular endothelial (VE)-cadherin, an adherens junction protein, and its surface expression is regulated by endocytic trafficking. The Rab family of small GTPases are regulators of endocytic trafficking. The key trafficking pathways are regulated by Rab4, -7, and -9. Rab4 regulates the recycling of endosomes to the cell surface through a rapid-shuttle process, whereas Rab7 and -9 regulate trafficking to the late endosome/lysosome for degradation or from the trans-Golgi network to the late endosome, respectively. We recently demonstrated a role for the endosomal adaptor protein, p18, in regulation of the pulmonary endothelium through enhanced recycling of VE-cadherin to adherens junction. Thus, we hypothesized that Rab4, -7, and -9 regulate pulmonary endothelial barrier function through modulating trafficking of VE-cadherin-positive endosomes. We used Rab mutants with varying activities and associations to the endosome to study endothelial barrier function in vitro and in vivo. Our study demonstrates a key role for Rab4 activation and Rab9 inhibition in regulation of vascular permeability through enhanced VE-cadherin expression at the interendothelial junction. We further showed that endothelial barrier function mediated through Rab4 is dependent on extracellular signal-regulated kinase phosphorylation and activity. Thus, we demonstrate that Rab4 and -9 regulate VE-cadherin levels at the cell surface to modulate the pulmonary endothelium through extracellular signal-regulated kinase-dependent and -independent pathways, respectively. We propose that regulating select Rab GTPases represents novel therapeutic strategies for patients suffering with acute respiratory distress syndrome.

  6. An interactive network of elastase, secretases, and PAR-2 protein regulates CXCR1 receptor surface expression on neutrophils.

    PubMed

    Bakele, Martina; Lotz-Havla, Amelie S; Jakowetz, Anja; Carevic, Melanie; Marcos, Veronica; Muntau, Ania C; Gersting, Soeren W; Hartl, Dominik

    2014-07-25

    CXCL8 (IL-8) recruits and activates neutrophils through the G protein-coupled chemokine receptor CXCR1. We showed previously that elastase cleaves CXCR1 and thereby impairs antibacterial host defense. However, the molecular intracellular machinery involved in this process remained undefined. Here we demonstrate by using flow cytometry, confocal microscopy, subcellular fractionation, co-immunoprecipitation, and bioluminescence resonance energy transfer that combined α- and γ-secretase activities are functionally involved in elastase-mediated regulation of CXCR1 surface expression on human neutrophils, whereas matrix metalloproteases are dispensable. We further demonstrate that PAR-2 is stored in mobilizable compartments in neutrophils. Bioluminescence resonance energy transfer and co-immunoprecipitation studies showed that secretases, PAR-2, and CXCR1 colocalize and physically interact in a novel protease/secretase-chemokine receptor network. PAR-2 blocking experiments provided evidence that elastase increased intracellular presenilin-1 expression through PAR-2 signaling. When viewed in combination, these studies establish a novel functional network of elastase, secretases, and PAR-2 that regulate CXCR1 expression on neutrophils. Interfering with this network could lead to novel therapeutic approaches in neutrophilic diseases, such as cystic fibrosis or rheumatoid arthritis.

  7. An Interactive Network of Elastase, Secretases, and PAR-2 Protein Regulates CXCR1 Receptor Surface Expression on Neutrophils*

    PubMed Central

    Bakele, Martina; Lotz-Havla, Amelie S.; Jakowetz, Anja; Carevic, Melanie; Marcos, Veronica; Muntau, Ania C.; Gersting, Soeren W.; Hartl, Dominik

    2014-01-01

    CXCL8 (IL-8) recruits and activates neutrophils through the G protein-coupled chemokine receptor CXCR1. We showed previously that elastase cleaves CXCR1 and thereby impairs antibacterial host defense. However, the molecular intracellular machinery involved in this process remained undefined. Here we demonstrate by using flow cytometry, confocal microscopy, subcellular fractionation, co-immunoprecipitation, and bioluminescence resonance energy transfer that combined α- and γ-secretase activities are functionally involved in elastase-mediated regulation of CXCR1 surface expression on human neutrophils, whereas matrix metalloproteases are dispensable. We further demonstrate that PAR-2 is stored in mobilizable compartments in neutrophils. Bioluminescence resonance energy transfer and co-immunoprecipitation studies showed that secretases, PAR-2, and CXCR1 colocalize and physically interact in a novel protease/secretase-chemokine receptor network. PAR-2 blocking experiments provided evidence that elastase increased intracellular presenilin-1 expression through PAR-2 signaling. When viewed in combination, these studies establish a novel functional network of elastase, secretases, and PAR-2 that regulate CXCR1 expression on neutrophils. Interfering with this network could lead to novel therapeutic approaches in neutrophilic diseases, such as cystic fibrosis or rheumatoid arthritis. PMID:24914212

  8. The norepinephrine transporter and its regulation.

    PubMed

    Mandela, Prashant; Ordway, Gregory A

    2006-04-01

    For many years, the norepinephrine transporter (NET) was considered a 'static' protein that contributed to the termination of the action of norepinephrine in the synapse of noradrenergic neurons. The concept that the NET is dynamically regulated, adjusting noradrenergic transmission by changing its function and/or expression, was considered initially in the mid 1980s. Since that time, a plethora of studies demonstrate that the NET is regulated by several intracellular and extracellular signaling molecules, and that phosphorylation of the NET is a major pathway regulating its cell surface expression and thereby its function. The NET is a target of action of a number of drugs that are used long-term therapeutically or abused chronically. This has driven numerous investigations of how the NET and its function are regulated by long-term exposure to drugs. While repeated exposure to many drugs has been shown to affect NET function and expression, the intracellular mechanisms for these effects remains elusive.

  9. A novel phenoxazine derivative suppresses surface IgM expression in DT40 B cell line

    PubMed Central

    Gao, Sanyang; Takano, Tomoko; Sada, Kiyonao; He, Jinsong; Noda, Chiseko; Hori-Tamura, Naoko; Tomoda, Akio; Yamamura, Hirohei

    2002-01-01

    2-amino-4, 4α-dihydro-4α, 7-dimethyl-3H-phenoxazine-3-one (Phx) has been demonstrated to be an actinomycin D-like phenoxazine, and to display anti-tumour activity. In this study, we report on the effect of Phx on B cell antigen receptor (BCR) and receptor-mediated signalling in DT40 B cells. Treatment of B cells with Phx for 12 h inhibited BCR-stimulated tyrosine phosphorylation of cellular proteins. B cells exposed to Phx exhibited down-regulation of surface IgM which is part of BCR. In contracts with actinomycin D, Phx rapidly reduced the expression of IgM without decreasing the expression of other signalling molecules. Analysis with confocal microscopy demonstrated that Phx treatment reduced IgM expression both at the cell surface and inside the cell. Treatment of B cells with Phx resulted in the reduction of IgM secretion. Since MG-132, a proteasomal inhibitor, restored IgM contents to the control levels, Phx has the specific effect of accelerating IgM degradation. These results suggest that Phx down-regulates the expression of IgM and inhibits BCR-mediated signalling and IgM secretion. Phx may be useful as an immunosuppressive agent for therapeutic purposes. PMID:12411404

  10. Protective Vaccination against Blood-Stage Malaria of Plasmodium chabaudi: Differential Gene Expression in the Liver of Balb/c Mice toward the End of Crisis Phase

    PubMed Central

    Al-Quraishy, Saleh A.; Dkhil, Mohamed A.; Abdel-Baki, Abdel-Azeem A.; Delic, Denis; Wunderlich, Frank

    2016-01-01

    Protective vaccination induces self-healing of otherwise fatal blood-stage malaria of Plasmodium chabaudi in female Balb/c mice. To trace processes critically involved in self-healing, the liver, an effector against blood-stage malaria, is analyzed for possible changes of its transcriptome in vaccination-protected in comparison to non-protected mice toward the end of the crisis phase. Gene expression microarray analyses reveal that vaccination does not affect constitutive expression of mRNA and lincRNA. However, malaria induces significant (p < 0.01) differences in hepatic gene and lincRNA expression in vaccination-protected vs. non-vaccinated mice toward the end of crisis phase. In vaccination-protected mice, infections induce up-regulations of 276 genes and 40 lincRNAs and down-regulations of 200 genes and 43 lincRNAs, respectively, by >3-fold as compared to the corresponding constitutive expressions. Massive up-regulations, partly by >100-fold, are found for genes as RhD, Add2, Ank1, Ermap, and Slc4a, which encode proteins of erythrocytic surface membranes, and as Gata1 and Gfi1b, which encode transcription factors involved in erythrocytic development. Also, Cldn13 previously predicted to be expressed on erythroblast surfaces is up-regulated by >200-fold, though claudins are known as main constituents of tight junctions acting as paracellular barriers between epithelial cells. Other genes are up-regulated by <100- and >10-fold, which can be subgrouped in genes encoding proteins known to be involved in mitosis, in cell cycle regulation, and in DNA repair. Our data suggest that protective vaccination enables the liver to respond to P. chabaudi infections with accelerated regeneration and extramedullary erythropoiesis during crisis, which contributes to survival of otherwise lethal blood-stage malaria. PMID:27471498

  11. Tyrosine phosphorylation–dependent activation of TRPC6 regulated by PLC-γ1 and nephrin: effect of mutations associated with focal segmental glomerulosclerosis

    PubMed Central

    Kanda, Shoichiro; Harita, Yutaka; Shibagaki, Yoshio; Sekine, Takashi; Igarashi, Takashi; Inoue, Takafumi; Hattori, Seisuke

    2011-01-01

    Transient receptor potential canonicals (TRPCs) play important roles in the regulation of intracellular calcium concentration. Mutations in the TRPC6 gene are found in patients with focal segmental glomerulosclerosis (FSGS), a proteinuric disease characterized by dysregulated function of renal glomerular epithelial cells (podocytes). There is as yet no clear picture for the activation mechanism of TRPC6 at the molecular basis, however, and the association between its channel activity and pathogenesis remains unclear. We demonstrate here that tyrosine phosphorylation of TRPC6 induces a complex formation with phospholipase C (PLC)-γ1, which is prerequisite for TRPC6 surface expression. Furthermore, nephrin, an adhesion protein between the foot processes of podocytes, binds to phosphorylated TRPC6 via its cytoplasmic domain, competitively inhibiting TRPC6–PLC-γ1 complex formation, TRPC6 surface localization, and TRPC6 activation. Importantly, FSGS-associated mutations render the mutated TRPC6s insensitive to nephrin suppression, thereby promoting their surface expression and channel activation. These results delineate the mechanism of TRPC6 activation regulated by tyrosine phosphorylation, and imply the cell type–specific regulation, which correlates the FSGS mutations with deregulated TRPC6 channel activity. PMID:21471003

  12. Regulation and Gene Expression Profiling of NKG2D Positive Human Cytomegalovirus-Primed CD4+ T-Cells

    PubMed Central

    Jensen, Helle; Folkersen, Lasse; Skov, Søren

    2012-01-01

    NKG2D is a stimulatory receptor expressed by natural killer (NK) cells, CD8+ T-cells, and γδ T-cells. NKG2D expression is normally absent from CD4+ T-cells, however recently a subset of NKG2D+ CD4+ T-cells has been found, which is specific for human cytomegalovirus (HCMV). This particular subset of HCMV-specific NKG2D+ CD4+ T-cells possesses effector-like functions, thus resembling the subsets of NKG2D+ CD4+ T-cells found in other chronic inflammations. However, the precise mechanism leading to NKG2D expression on HCMV-specific CD4+ T-cells is currently not known. In this study we used genome-wide analysis of individual genes and gene set enrichment analysis (GSEA) to investigate the gene expression profile of NKG2D+ CD4+ T-cells, generated from HCMV-primed CD4+ T-cells. We show that the HCMV-primed NKG2D+ CD4+ T-cells possess a higher differentiated phenotype than the NKG2D– CD4+ T-cells, both at the gene expression profile and cytokine profile. The ability to express NKG2D at the cell surface was primarily determined by the activation or differentiation status of the CD4+ T-cells and not by the antigen presenting cells. We observed a correlation between CD94 and NKG2D expression in the CD4+ T-cells following HCMV stimulation. However, knock-down of CD94 did not affect NKG2D cell surface expression or signaling. In addition, we show that NKG2D is recycled at the cell surface of activated CD4+ T-cells, whereas it is produced de novo in resting CD4+ T-cells. These findings provide novel information about the gene expression profile of HCMV-primed NKG2D+ CD4+ T-cells, as well as the mechanisms regulating NKG2D cell surface expression. PMID:22870231

  13. Regulation and gene expression profiling of NKG2D positive human cytomegalovirus-primed CD4+ T-cells.

    PubMed

    Jensen, Helle; Folkersen, Lasse; Skov, Søren

    2012-01-01

    NKG2D is a stimulatory receptor expressed by natural killer (NK) cells, CD8(+) T-cells, and γδ T-cells. NKG2D expression is normally absent from CD4(+) T-cells, however recently a subset of NKG2D(+) CD4(+) T-cells has been found, which is specific for human cytomegalovirus (HCMV). This particular subset of HCMV-specific NKG2D(+) CD4(+) T-cells possesses effector-like functions, thus resembling the subsets of NKG2D(+) CD4(+) T-cells found in other chronic inflammations. However, the precise mechanism leading to NKG2D expression on HCMV-specific CD4(+) T-cells is currently not known. In this study we used genome-wide analysis of individual genes and gene set enrichment analysis (GSEA) to investigate the gene expression profile of NKG2D(+) CD4(+) T-cells, generated from HCMV-primed CD4(+) T-cells. We show that the HCMV-primed NKG2D(+) CD4(+) T-cells possess a higher differentiated phenotype than the NKG2D(-) CD4(+) T-cells, both at the gene expression profile and cytokine profile. The ability to express NKG2D at the cell surface was primarily determined by the activation or differentiation status of the CD4(+) T-cells and not by the antigen presenting cells. We observed a correlation between CD94 and NKG2D expression in the CD4(+) T-cells following HCMV stimulation. However, knock-down of CD94 did not affect NKG2D cell surface expression or signaling. In addition, we show that NKG2D is recycled at the cell surface of activated CD4(+) T-cells, whereas it is produced de novo in resting CD4(+) T-cells. These findings provide novel information about the gene expression profile of HCMV-primed NKG2D(+) CD4(+) T-cells, as well as the mechanisms regulating NKG2D cell surface expression.

  14. The Plasmodium falciparum transcriptome in severe malaria reveals altered expression of genes involved in important processes including surface antigen–encoding var genes

    PubMed Central

    Tonkin-Hill, Gerry Q.; Trianty, Leily; Noviyanti, Rintis; Nguyen, Hanh H. T.; Sebayang, Boni F.; Lampah, Daniel A.; Marfurt, Jutta; Cobbold, Simon A.; Rambhatla, Janavi S.; McConville, Malcolm J.; Rogerson, Stephen J.; Brown, Graham V.; Day, Karen P.; Price, Ric N.; Anstey, Nicholas M.

    2018-01-01

    Within the human host, the malaria parasite Plasmodium falciparum is exposed to multiple selection pressures. The host environment changes dramatically in severe malaria, but the extent to which the parasite responds to—or is selected by—this environment remains unclear. From previous studies, the parasites that cause severe malaria appear to increase expression of a restricted but poorly defined subset of the PfEMP1 variant, surface antigens. PfEMP1s are major targets of protective immunity. Here, we used RNA sequencing (RNAseq) to analyse gene expression in 44 parasite isolates that caused severe and uncomplicated malaria in Papuan patients. The transcriptomes of 19 parasite isolates associated with severe malaria indicated that these parasites had decreased glycolysis without activation of compensatory pathways; altered chromatin structure and probably transcriptional regulation through decreased histone methylation; reduced surface expression of PfEMP1; and down-regulated expression of multiple chaperone proteins. Our RNAseq also identified novel associations between disease severity and PfEMP1 transcripts, domains, and smaller sequence segments and also confirmed all previously reported associations between expressed PfEMP1 sequences and severe disease. These findings will inform efforts to identify vaccine targets for severe malaria and also indicate how parasites adapt to—or are selected by—the host environment in severe malaria. PMID:29529020

  15. Fluorogenic Green-Inside Red-Outside (GIRO) Labeling Approach Reveals Adenylyl Cyclase-Dependent Control of BKα Surface Expression

    PubMed Central

    2015-01-01

    The regulation of surface levels of protein is critical for proper cell function and influences properties including cell adhesion, ion channel contributions to current flux, and the sensitivity of surface receptors to ligands. Here we demonstrate a two-color labeling system in live cells using a single fluorogen activating peptide (FAP) based fusion tag, which enables the rapid and simultaneous quantification of surface and internal proteins. In the nervous system, BK channels can regulate neural excitability and neurotransmitter release, and the surface trafficking of BK channels can be modulated by signaling cascades and assembly with accessory proteins. Using this labeling approach, we examine the dynamics of BK channel surface expression in HEK293 cells. Surface pools of the pore-forming BKα subunit were stable, exhibiting a plasma membrane half-life of >10 h. Long-term activation of adenylyl cyclase by forskolin reduced BKα surface levels by 30%, an effect that could not be attributed to increased bulk endocytosis of plasma membrane proteins. This labeling approach is compatible with microscopic imaging and flow cytometry, providing a solid platform for examining protein trafficking in living cells. PMID:26301573

  16. The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism

    PubMed Central

    Bermingham, Daniel P.; Snider, Sam L.; Miller, David M.

    2017-01-01

    The neurotransmitter dopamine (DA) regulates multiple behaviors across phylogeny, with disrupted DA signaling in humans associated with addiction, attention-deficit/ hyperactivity disorder, schizophrenia, and Parkinson's disease. The DA transporter (DAT) imposes spatial and temporal limits on DA action, and provides for presynaptic DA recycling to replenish neurotransmitter pools. Molecular mechanisms that regulate DAT expression, trafficking, and function, particularly in vivo, remain poorly understood, though recent studies have implicated rho-linked pathways in psychostimulant action. To identify genes that dictate the ability of DAT to sustain normal levels of DA clearance, we pursued a forward genetic screen in Caenorhabditis elegans based on the phenotype swimming-induced paralysis (Swip), a paralytic behavior observed in hermaphrodite worms with loss-of-function dat-1 mutations. Here, we report the identity of swip-13, which encodes a highly conserved ortholog of the human atypical MAP kinase ERK8. We present evidence that SWIP-13 acts presynaptically to insure adequate levels of surface DAT expression and DA clearance. Moreover, we provide in vitro and in vivo evidence supporting a conserved pathway involving SWIP-13/ERK8 activation of Rho GTPases that dictates DAT surface expression and function. SIGNIFICANCE STATEMENT Signaling by the neurotransmitter dopamine (DA) is tightly regulated by the DA transporter (DAT), insuring efficient DA clearance after release. Molecular networks that regulate DAT are poorly understood, particularly in vivo. Using a forward genetic screen in the nematode Caenorhabditis elegans, we implicate the atypical mitogen activated protein kinase, SWIP-13, in DAT regulation. Moreover, we provide in vitro and in vivo evidence that SWIP-13, as well as its human counterpart ERK8, regulate DAT surface availability via the activation of Rho proteins. Our findings implicate a novel pathway that regulates DA synaptic availability and that may contribute to risk for disorders linked to perturbed DA signaling. Targeting this pathway may be of value in the development of therapeutics in such disorders. PMID:28842414

  17. Comparative analysis of cell wall surface glycan expression in Candida albicans and Saccharomyces cerevisiae yeasts by flow cytometry.

    PubMed

    Martínez-Esparza, M; Sarazin, A; Jouy, N; Poulain, D; Jouault, T

    2006-07-31

    The yeast Candida albicans is an opportunistic pathogen, part of the normal human microbial flora that causes infections in immunocompromised individuals with a high morbidity and mortality levels. Recognition of yeasts by host cells is based on components of the yeast cell wall, which are considered part of its virulence attributes. Cell wall glycans play an important role in the continuous interchange that regulates the balance between saprophytism and parasitism, and also between resistance and infection. Some of these molecular entities are expressed both by the pathogenic yeast C. albicans and by Saccharomyces cerevisiae, a related non-pathogenic yeast, involving similar molecular mechanisms and receptors for recognition. In this work we have exploited flow cytometry methods for probing surface glycans of the yeasts. We compared glycan expression by C. albicans and by S. cerevisiae, and studied the effect of culture conditions. Our results show that the expression levels of alpha- and beta-linked mannosides as well as beta-glucans can be successfully evaluated by flow cytometry methods using different antibodies independent of agglutination reactions. We also found that the surface expression pattern of beta-mannosides detected by monoclonal or polyclonal antibodies are differently modulated during the growth course. These data indicate that the yeast beta-mannosides exposed on mannoproteins and/or phospholipomannan are increased in stationary phase, whereas those linked to mannan are not affected by the yeast growth phase. The cytometric method described here represents a useful tool to investigate to what extent C. albicans is able to regulate its glycan surface expression and therefore modify its virulence properties.

  18. Analysis of immune activation and clinical events in acute infectious mononucleosis.

    PubMed

    Williams, Hilary; Macsween, Karen; McAulay, Karen; Higgins, Craig; Harrison, Nadine; Swerdlow, Anthony; Britton, Kate; Crawford, Dorothy

    2004-07-01

    The symptoms of infectious mononucleosis (IM) are thought to be caused by T cell activation and cytokine production. Surface lymphocyte activation marker (SLAM)-associated protein (SAP) regulates lymphocyte activation via signals from cell-surface CD244 (2B4) and SLAM (CD150). We followed T cell activation via this SAP/SLAM/CD244 pathway in IM and analyzed whether the results were associated with clinical severity. At diagnosis, SAP, SLAM, and CD244 were significantly up-regulated on CD4 and CD8 T cells; expression decreased during IM, but CD244 and SLAM levels remained higher on CD8 cells 40 days later. There were significantly more lymphocytes expressing CD8 and CD244/CD8 in patients with severe sore throat. The expression of CD8 alone and CD244 on CD8 cells correlated with increased virus load. We suggest that T cells expressing CD244 and SLAM are responsible for the clinical features of IM but that the control of activation is maintained by parallel increased expression of SAP.

  19. Quorum-sensing regulators in Gram-positive bacteria: 'cherchez le peptide'.

    PubMed

    Monnet, V; Gardan, R

    2015-07-01

    Gram-positive bacteria can regulate gene expression at the population level via a mechanism known as quorum sensing. Oligopeptides serve as the signaling molecules; they are secreted and then are either detected at the bacterial surface by two-component systems or reinternalized via an oligopeptide transport system. In the latter case, imported peptides interact with cognate regulators (phosphatases or transcriptional regulators) that modulate the expression of target genes. These regulators help control crucial functions such as virulence, persistence, conjugation and competence and have been reported in bacilli, enterococci and streptococci. They form the rapidly growing RRNPP group. In this issue of Molecular Microbiology, Hoover et al. (2015) highlight the group's importance: they have identified a new family of regulators, Tprs (Transcription factor regulated by a Phr peptide), which work with internalized Phr-like peptides. The mechanisms underlying the expression of the genes that encode these internalized peptides are poorly documented. However, Hoover et al. (2015) have provided a new insight: an environmental molecule, glucose, can inhibit expression of the Phr-like peptide gene via catabolic repression. This previously undescribed regulatory pathway, controlling the production of a bacteriocin, might influence Streptococcus pneumonia's fitness in the nasopharynx, where galactose is present. © 2015 John Wiley & Sons Ltd.

  20. Modulation of Candida albicans virulence by bacterial biofilms on titanium surfaces.

    PubMed

    Cavalcanti, Yuri Wanderley; Wilson, Melanie; Lewis, Michael; Del-Bel-Cury, Altair Antoninha; da Silva, Wander José; Williams, David W

    2016-01-01

    Whilst Candida albicans occurs in peri-implant biofilms, its role in peri-implantitis remains unclear. This study therefore examined the virulence of C. albicans in mixed-species biofilms on titanium surfaces. Biofilms of C. albicans (Ca), C. albicans with streptococci (Streptococcus sanguinis, S. mutans) (Ca-Ss-Sm) and those incorporating Porphyromonas gingivalis (Ca-Pg and Ca-Ss-Sm-Pg) were developed. Expression of C. albicans genes associated with adhesion (ALS1, ALS3, HWP1) and hydrolytic enzymes (SAP2, SAP4, SAP6, PLD1) was measured and hyphal production by C. albicans quantified. Compared with Ca biofilms, significant (p<0.05) up-regulation of ALS3, HWP1, SAP2 and SAP6, and hyphal production occurred in biofilms containing streptococci (Ca-Ss-Sm). In Ca-Pg biofilms, down-regulation of HWP1 and SAP4 expression, with reduced hyphal production occurred. Ca-Ss-Sm-Pg biofilms had increased hyphal proportions and up-regulation of ALS3, SAP2 and SAP6. In conclusion, C. albicans expressed virulence factors in biofilms that could contribute to peri-implantitis, but this was dependent on associated bacterial species.

  1. Palmitoylation of the β4-Subunit Regulates Surface Expression of Large Conductance Calcium-activated Potassium Channel Splice Variants*

    PubMed Central

    Chen, Lie; Bi, Danlei; Tian, Lijun; McClafferty, Heather; Steeb, Franziska; Ruth, Peter; Knaus, Hans Guenther; Shipston, Michael J.

    2013-01-01

    Regulatory β-subunits of large conductance calcium- and voltage-activated potassium (BK) channels play an important role in generating functional diversity and control of cell surface expression of the pore forming α-subunits. However, in contrast to α-subunits, the role of reversible post-translational modification of intracellular residues on β-subunit function is largely unknown. Here we demonstrate that the human β4-subunit is S-acylated (palmitoylated) on a juxtamembrane cysteine residue (Cys-193) in the intracellular C terminus of the regulatory β-subunit. β4-Subunit palmitoylation is important for cell surface expression and endoplasmic reticulum (ER) exit of the β4-subunit alone. Importantly, palmitoylated β4-subunits promote the ER exit and surface expression of the pore-forming α-subunit, whereas β4-subunits that cannot be palmitoylated do not increase ER exit or surface expression of α-subunits. Strikingly, however, this palmitoylation- and β4-dependent enhancement of α-subunit surface expression was only observed in α-subunits that contain a putative trafficking motif (… REVEDEC) at the very C terminus of the α-subunit. Engineering this trafficking motif to other C-terminal α-subunit splice variants results in α-subunits with reduced surface expression that can be rescued by palmitoylated, but not depalmitoylated, β4-subunits. Our data reveal a novel mechanism by which palmitoylated β4-subunit controls surface expression of BK channels through masking of a trafficking motif in the C terminus of the α-subunit. As palmitoylation is dynamic, this mechanism would allow precise control of specific splice variants to the cell surface. Our data provide new insights into how complex interplay between the repertoire of post-transcriptional and post-translational mechanisms controls cell surface expression of BK channels. PMID:23504458

  2. Regulation of CRIg Expression and Phagocytosis in Human Macrophages by Arachidonate, Dexamethasone, and Cytokines

    PubMed Central

    Gorgani, Nick N.; Thathaisong, Umaporn; Mukaro, Violet R.S.; Poungpair, Ornnuthchar; Tirimacco, Amanda; Hii, Charles S.T.; Ferrante, Antonio

    2011-01-01

    Although the importance of the macrophage complement receptor immunoglobulin (CRIg) in the phagocytosis of complement opsonized bacteria and in inflammation has been established, the regulation of CRIg expression remains undefined. Because cellular activation during inflammation leads to the release of arachidonate, a stimulator of leukocyte function, we sought to determine whether arachidonate regulates CRIg expression. Adding arachidonate to maturing human macrophages and to prematured CRIg+ macrophages caused a significant decrease in the expression of cell-surface CRIg and CRIg mRNA. This effect was independent of the metabolism of arachidonate via the cyclooxygenase and lipoxygenase pathways, because it was not inhibited by the nonsteroidal anti-inflammatory drugs indomethacin and nordihydroguaiaretic acid. Studies with specific pharmacological inhibitors of arachidonate-mediated signaling pathways showed that protein kinase C was involved. Administration of dexamethasone to macrophages caused an increase in CRIg expression. Studies with proinflammatory and immunosuppressive cytokines showed that IL-10 increased, but interferon-γ, IL-4, and transforming growth factor-β1 decreased CRIg expression on macrophages. This down- and up-regulation of CRIg expression was reflected in a decrease and increase, respectively, in the phagocytosis of complement opsonized Candida albicans. These data suggest that a unique inflammatory mediator network regulates CRIg expression and point to a mechanism by which arachidonate and dexamethasone have reciprocal effects on inflammation. PMID:21741936

  3. THE AP-2 CLATHRIN ADAPTOR MEDIATES ENDOCYTOSIS OF AN INHIBITORY KILLER CELL Ig-LIKE RECEPTOR (KIR) IN HUMAN NK CELLS1

    PubMed Central

    Purdy, Amanda K.; Alvarez-Arias, Diana A.; Oshinsky, Jennifer; James, Ashley M.; Serebriiskii, Ilya; Campbell, Kerry S.

    2014-01-01

    Stable surface expression of human inhibitory killer cell immunoglobulin-like receptors (KIR) is critical for controlling NK cell function and maintaining NK cell tolerance toward normal MHC-I+ cells. Our recent experiments, however, have found that antibody-bound KIR3DL1 (3DL1) readily leaves the cell surface and undergoes endocytosis to early/recycling endosomes and subsequently to late endosomes. We found that 3DL1 internalization is at least partially mediated by an interaction between the μ2 subunit of the AP-2 clathrin adaptor complex and ITIM tyrosine residues in the cytoplasmic domain of 3DL1. Disruption of the 3DL1/μ2 interaction, either by mutation of the ITIM tyrosines in 3DL1 or mutation of μ2, significantly diminished endocytosis and increased surface expression of 3DL1 in human primary NK cells and cell lines. Furthermore, we found that the 3DL1/AP-2 interaction is diminished upon antibody engagement with the receptor, as compared to untreated cells. Thus, we have identified AP-2-mediated endocytosis as a mechanism regulating the surface levels of inhibitory KIR though their ITIM domains. Based upon our results, we propose a model in which non-engaged KIR are internalized by this mechanism, whereas engagement with MHC-I ligand would diminish AP-2 binding, thereby prolonging stable receptor surface expression and promoting inhibitory function. Furthermore, this ITIM-mediated mechanism may similarly regulate the surface expression of other inhibitory immune receptors. PMID:25238755

  4. Cell surface localization of the 78 kD glucose regulated protein (GRP 78) induced by thapsigargin.

    PubMed

    Delpino, A; Piselli, P; Vismara, D; Vendetti, S; Colizzi, V

    1998-01-01

    In the present study it was found that the synthesis of the 78 kD glucose-regulated protein (GRP 78 or BIP) is vigorously induced in human rabdomiosarcoma cells (TE 671/RD) following both short-term (1 h) and prolonged (18 h) exposure to 100 nM thapsigargin (Tg). Flow cytometric analysis with a specific anti-GRP 78 polyclonal antibody showed that Tg-treated cells express the GRP 78 on the plasma membrane. Cell surface localization of the Tg-induced GRP 78 was confirmed by biotinylation of membrane-exposed proteins and subsequent isolation of the biotin-labelled proteins by streptavidin/agarose affinity chromatography. It was found that a fraction of the Tg-induced GRP 78 is present among the biotin-labelled, surface-exposed, proteins. Conversely, the GRP 78 immunoprecipitated from unfractionated lysates of Tg-treated and biotin-reacted cells was found to be biotinylated. This is the first report demonstrating surface expression of GRP 78 in cells exposed to a specific GRP 78-inducing stimulus.

  5. Identification of Novel 14-3-3 Residues That Are Critical for Isoform-specific Interaction with GluN2C to Regulate N-Methyl-d-aspartate (NMDA) Receptor Trafficking*

    PubMed Central

    Chung, Connie; Wu, Wei-Hua; Chen, Bo-Shiun

    2015-01-01

    The 14-3-3 family of proteins is widely distributed in the CNS where they are major regulators of essential neuronal functions. There are seven known mammalian 14-3-3 isoforms (ζ,, τ, ϵ, η, β, and σ), which generally function as adaptor proteins. Previously, we have demonstrated that 14-3-3ϵ isoform dynamically regulates forward trafficking of GluN2C-containing NMDA receptors (NMDARs) in cerebellar granule neurons, that when expressed on the surface, promotes neuronal survival following NMDA-induced excitotoxicity. Here, we report 14-3-3 isoform-specific binding and functional regulation of GluN2C. In particular, we show that GluN2C C-terminal domain (CTD) binds to all 14-3-3 isoforms except 14-3-3σ, and binding is dependent on GluN2C serine 1096 phosphorylation. Co-expression of 14-3-3 (ζ and ϵ) and GluN1/GluN2C promotes the forward delivery of receptors to the cell surface. We further identify novel residues serine 145, tyrosine 178, and cysteine 189 on α-helices 6, 7, and 8, respectively, within ζ-isoform as part of the GluN2C binding motif and independent of the canonical peptide binding groove. Mutation of these conserved residues abolishes GluN2C binding and has no functional effect on GluN2C trafficking. Reciprocal mutation of alanine 145, histidine 180, and isoleucine 191 on 14-3-3σ isoform promotes GluN2C binding and surface expression. Moreover, inhibiting endogenous 14-3-3 using a high-affinity peptide inhibitor, difopein, greatly diminishes GluN2C surface expression. Together, these findings highlight the isoform-specific structural and functional differences within the 14-3-3 family of proteins, which determine GluN2C binding and its essential role in targeting the receptor to the cell surface to facilitate glutamatergic neurotransmission. PMID:26229101

  6. Amyloid Precursor-like Protein 2 Increases the Endocytosis, Instability, and Turnover of the H2-Kd MHC Class I Molecule1

    PubMed Central

    Tuli, Amit; Sharma, Mahak; McIlhaney, Mary M.; Talmadge, James E.; Naslavsky, Naava; Caplan, Steve; Solheim, Joyce C.

    2008-01-01

    The defense against the invasion of viruses and tumors relies on the presentation of viral and tumor-derived peptides to cytotoxic T lymphocytes by cell surface major histocompatibility complex (MHC) class I molecules. Previously, we showed that the ubiquitously expressed protein amyloid precursor-like protein 2 (APLP2) associates with the folded form of the MHC class I molecule Kd. In the current study, APLP2 was found to associate with folded Kd molecules following their endocytosis and to increase the amount of endocytosed Kd. In addition, increased expression of APLP2 was shown to decrease Kd surface expression and thermostability. Correspondingly, Kd thermostability and surface expression were increased by down-regulation of APLP2 expression. Overall, these data suggest that APLP2 modulates the stability and endocytosis of Kd molecules. PMID:18641335

  7. Genomic Methylation Inhibits Expression of Hepatitis B Virus Envelope Protein in Transgenic Mice: A Non-Infectious Mouse Model to Study Silencing of HBV Surface Antigen Genes.

    PubMed

    Graumann, Franziska; Churin, Yuri; Tschuschner, Annette; Reifenberg, Kurt; Glebe, Dieter; Roderfeld, Martin; Roeb, Elke

    2015-01-01

    The Hepatitis B virus genome persists in the nucleus of virus infected hepatocytes where it serves as template for viral mRNA synthesis. Epigenetic modifications, including methylation of the CpG islands contribute to the regulation of viral gene expression. The present study investigates the effects of spontaneous age dependent loss of hepatitis B surface protein- (HBs) expression due to HBV-genome specific methylation as well as its proximate positive effects in HBs transgenic mice. Liver and serum of HBs transgenic mice aged 5-33 weeks were analyzed by Western blot, immunohistochemistry, serum analysis, PCR, and qRT-PCR. From the third month of age hepatic loss of HBs was observed in 20% of transgenic mice. The size of HBs-free area and the relative number of animals with these effects increased with age and struck about 55% of animals aged 33 weeks. Loss of HBs-expression was strongly correlated with amelioration of serum parameters ALT and AST. In addition lower HBs-expression went on with decreased ER-stress. The loss of surface protein expression started on transcriptional level and appeared to be regulated epigenetically by DNA methylation. The amount of the HBs-expression correlated negatively with methylation of HBV DNA in the mouse genome. Our data suggest that methylation of specific CpG sites controls gene expression even in HBs-transgenic mice with truncated HBV genome. More important, the loss of HBs expression and intracellular aggregation ameliorated cell stress and liver integrity. Thus, targeted modulation of HBs expression may offer new therapeutic approaches. Furthermore, HBs-transgenic mice depict a non-infectious mouse model to study one possible mechanism of HBs gene silencing by hypermethylation.

  8. Vascular endothelial growth factor A (VEGF-A) decreases expression and secretion of pleiotrophin in a VEGF receptor-independent manner.

    PubMed

    Poimenidi, Evangelia; Theodoropoulou, Christina; Koutsioumpa, Marina; Skondra, Lamprini; Droggiti, Eirini; van den Broek, Marloes; Koolwijk, Pieter; Papadimitriou, Evangelia

    2016-05-01

    Vascular endothelial growth factor A (VEGF-A) is a key molecule in angiogenesis acting through VEGF receptors (VEGFRs), ανβ3 integrin, receptor protein tyrosine phosphatase beta/zeta (RPTPβ/ζ) and cell surface nucleolin (NCL). Pleiotrophin (PTN) stimulates endothelial cell migration and limits the angiogenic effects of VEGF-A165 to the levels of its own effect, possibly acting as a VEGF-A165 modifier. Since PTN and VEGF-A165 share receptors and actions on endothelial cells, in the present work we studied whether and how VEGF-A165 affects PTN expression or secretion. VEGF-A165 decreased PTN mRNA and protein levels acting at the transcriptional level. Bevacizumab, a selective VEGFR2 tyrosine kinase inhibitor and down-regulation of VEGFR2 expression by siRNA did not affect this decrease, suggesting that it is VEGFR-independent. VEGF-A121 also decreased PTN mRNA and protein levels, suggesting that heparin binding of VEGF-A165 is not involved. Blockage of cell surface NCL, lack of expression or mutation of β3 integrin and down-regulation of RPTPβ/ζ abolished the inhibitory effect of VEGF-A165 on PTN expression and secretion. Down-regulation of endogenous PTN in endothelial cells enhanced VEGF-A165-induced increase in migration and tube formation on matrigel. Collectively, these data suggest that VEGF-A down-regulates PTN expression and secretion through the RPTPβ/ζ-ανβ3-NCL axis to enhance its own effect on cell migration and further highlight the role of RPTPβ/ζ in VEGF-A actions. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Abiotic stress of ambient cold temperature regulates the host receptivity to pathogens by cell surfaced sialic acids.

    PubMed

    Moon, Seong-Cheol; Joo, Su-Yeon; Chung, Tae-Wook; Choi, Hee-Jung; Park, Mi-Ju; Choi, Hee-Jin; Bae, Sung-Jin; Kim, Keuk-Jun; Kim, Cheorl-Ho; Joo, Myungsoo; Ha, Ki-Tae

    2016-07-29

    Ambient cold temperature, as an abiotic stress, regulates the survival, stability, transmission, and infection of pathogens. However, the effect of cold temperature on the host receptivity to the pathogens has not been fully studied. In this study, the expression of terminal α-2,3- and α-2,6-sialic acids were increased in murine lung tissues, especially bronchial epithelium, by exposure to cold condition. The expression of several sialyltransferases were also increased by exposure to cold temperature. Furthermore, in human bronchial epithelial BEAS-2B cells, the expressions of α-2,3- and α-2,6-sialic acids, and mRNA levels of sialyltransferases were increased in the low temperature condition at 33 °C. On the other hand, the treatment of Lith-Gly, a sialyltransferase inhibitor, blocked the cold-induced expression of sialic acids on surface of BEAS-2B cells. The binding of influenza H1N1 hemagglutinin (HA) toward BEAS-2B cells cultured at low temperature condition was increased, compared to 37 °C. In contrast, the cold-increased HA binding was blocked by treatment of lithocholicglycine and sialyl-N-acetyl-D-lactosamines harboring α-2,3- and α-2,6-sialyl motive. These results suggest that the host receptivity to virus at cold temperature results from the expressions of α-2,3- and α-2,6-sialic acids through the regulation of sialyltransferase expression. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. How did nature engineer the highest surface lipid accumulation among plants? Exceptional expression of acyl-lipid-associated genes for the assembly of extracellular triacylglycerol by Bayberry ( Myrica pensylvanica ) fruits

    DOE PAGES

    Simpson, Jeffrey P.; Thrower, Nicholas; Ohlrogge, John B.

    2016-02-09

    Bayberry (Myrica pensylvanica) fruits are covered with a remarkably thick layer of crystalline wax consisting of triacylglycerol (TAG) and diacylglycerol (DAG) esterified exclusively with saturated fatty acids. As the only plant known to accumulate soluble glycerolipids as a major component of surface waxes, Bayberry represents a novel system to investigate neutral lipid biosynthesis and lipid secretion by vegetative plant cells. The assembly of Bayberry wax is distinct from conventional TAG and other surface waxes, and instead proceeds through a pathway related to cutin synthesis (Simpson and Ohlrogge, 2016). In this study, microscopic examination revealed that the fruit tissue that producesmore » and secretes wax (Bayberry knobs) is fully developed before wax accumulates and that wax is secreted to the surface without cell disruption. Comparison of transcript expression to genetically related tissues (Bayberry leaves, M. rubra fruits), cutin-rich tomato and cherry fruit epidermis, and to oil-rich mesocarp and seeds, revealed exceptionally high expression of 13 transcripts for acyl-lipid metabolism together with down-regulation of fatty acid oxidases and desaturases. The predicted protein sequences of the most highly expressed lipid-related enzyme-encoding transcripts in Bayberry knobs are 100% identical to the sequences from Bayberry leaves,which do not produce surface DAG or TAG. Together, these results indicate that TAG biosynthesis and secretion in Bayberry is achieved by both up and down-regulation of a small subset of genes related to the biosynthesis of cutin and saturated fatty acids, and also implies that modifications in gene expression, rather than evolution of new gene functions, was the major mechanism by which Bayberry evolved its specialized lipid metabolism.« less

  11. Multiple facets of sialomucin complex/MUC4, a membrane mucin and erbb2 ligand, in tumors and tissues (Y2K update).

    PubMed

    Carraway, K L; Price-Schiavi, S A; Komatsu, M; Idris, N; Perez, A; Li, P; Jepson, S; Zhu, X; Carvajal, M E; Carraway, C A

    2000-01-01

    Sialomucin complex (SMC, MUC4) is a high Mr glycoprotein heterodimer, composed of mucin (ASGP-1) and transmembrane (ASGP-2) subunits. ASGP-2 contains two EGF-like domains and acts as an intramembrane ligand for the receptor tyrosine kinase ErbB2. Transfection studies with SMC DNAs showed that SMC expression could markedly reduce both cell-cell and cell-matrix interactions in vitro and increase the growth of primary tumors and the formation of metastatic foci of human A375 melanoma cells as xenotransplants in nude mice, possibly through the ability to suppress apoptosis. SMC is expressed in most vulnerable epithelia as a protective agent, which is found in both membrane and soluble forms at luminal surfaces and secreted into fluids such as milk and tears. SMC appears to be constitutively expressed by most accessible epithelia, notable exceptions being the mammary gland and uterine luminal epithelium, in which it is tightly regulated during pregnancy. Down-regulation at the luminal uterine surface appears necessary for blastocyst implantation. TGF-b is a potent repressor of SMC expression in the mammary gland and uterus, though by different mechanisms. These combined results suggest that SMC has multiple functions in epithelia and is tightly regulated in those tissues where its special functions are required.

  12. Sildenafil prevents the up-regulation of transient receptor potential canonical channels in the development of cardiomyocyte hypertrophy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiso, Hironori; Ohba, Takayoshi; Iino, Kenji

    2013-07-05

    Highlights: •Transient receptor potential canonical (TRPC1, 3 and 6) are up-regulated by ET-1. •Sildenafil inhibited hypertrophic responses (BNP, Ca entry, NFAT activation). •Sildenafil suppressed TRPC1, 3 and 6 expression. -- Abstract: Background: Transient receptor potential canonical (TRPCs) channels are up-regulated in the development of cardiac hypertrophy. Sildenafil inhibits TRPC6 activation and expression, leading to the prevention of cardiac hypertrophy. However, the effects of sildenafil on the expression of other TRPCs remain unknown. We hypothesized that in addition to its effects of TRPC6, sildenafil blocks the up-regulation of other TRPC channels to suppress cardiomyocyte hypertrophy. Methods and results: In cultured neonatalmore » rat cardiomyocytes, a 48 h treatment with 10 nM endothelin (ET)-1 induced hypertrophic responses characterized by nuclear factor of activated T cells activation and enhancement of brain natriuretic peptide expression and cell surface area. Co-treatment with sildenafil (1 μM, 48 h) inhibited these ET-1-induced hypertrophic responses. Although ET-1 enhanced the gene expression of TRPCs, sildenafil inhibited the enhanced gene expression of TRPC1, C3 and C6. Moreover, co-treatment with sildenafil abolished the augmentation of SOCE in the hypertrophied cardiomyocytes. Conclusions: These results suggest that sildenafil inhibits cardiomyocyte hypertrophy by suppressing the up-regulation of TRPC expression.« less

  13. Src-like adaptor protein down-regulates T cell receptor (TCR)-CD3 expression by targeting TCRzeta for degradation.

    PubMed

    Myers, Margaret D; Dragone, Leonard L; Weiss, Arthur

    2005-07-18

    Src-like adaptor protein (SLAP) down-regulates expression of the T cell receptor (TCR)-CD3 complex during a specific stage of thymocyte development when the TCR repertoire is selected. Consequently, SLAP-/- thymocytes display alterations in thymocyte development. Here, we have studied the mechanism of SLAP function. We demonstrate that SLAP-deficient thymocytes have increased TCRzeta chain expression as a result of a defect in TCRzeta degradation. Failure to degrade TCRzeta leads to an increased pool of fully assembled TCR-CD3 complexes that are capable of recycling back to the cell surface. We also provide evidence that SLAP functions in a pathway that requires the phosphorylated TCRzeta chain and the Src family kinase Lck, but not ZAP-70 (zeta-associated protein of 70 kD). These studies reveal a unique mechanism by which SLAP contributes to the regulation of TCR expression during a distinct stage of thymocyte development.

  14. A Heme-responsive Regulator Controls Synthesis of Staphyloferrin B in Staphylococcus aureus*♦

    PubMed Central

    Laakso, Holly A.; Marolda, Cristina L.; Pinter, Tyler B.; Stillman, Martin J.; Heinrichs, David E.

    2016-01-01

    Staphylococcus aureus possesses a multitude of mechanisms by which it can obtain iron during growth under iron starvation conditions. It expresses an effective heme acquisition system (the iron-regulated surface determinant system), it produces two carboxylate-type siderophores staphyloferrin A and staphyloferrin B (SB), and it expresses transporters for many other siderophores that it does not synthesize. The ferric uptake regulator protein regulates expression of genes encoding all of these systems. Mechanisms of fine-tuning expression of iron-regulated genes, beyond simple iron regulation via ferric uptake regulator, have not been uncovered in this organism. Here, we identify the ninth gene of the sbn operon, sbnI, as encoding a ParB/Spo0J-like protein that is required for expression of genes in the sbn operon from sbnD onward. Expression of sbnD–I is drastically decreased in an sbnI mutant, and the mutant does not synthesize detectable SB during early phases of growth. Thus, SB-mediated iron acquisition is impaired in an sbnI mutant strain. We show that the protein forms dimers and tetramers in solution and binds to DNA within the sbnC coding region. Moreover, we show that SbnI binds heme and that heme-bound SbnI does not bind DNA. Finally, we show that providing exogenous heme to S. aureus growing in an iron-free medium results in delayed synthesis of SB. This is the first study in S. aureus that identifies a DNA-binding regulatory protein that senses heme to control gene expression for siderophore synthesis. PMID:26534960

  15. Expression of Death Receptor 4 Is Positively Regulated by MEK/ERK/AP-1 Signaling and Suppressed upon MEK Inhibition*

    PubMed Central

    Yao, Weilong; Oh, You-Take; Deng, Jiusheng; Yue, Ping; Deng, Liang; Huang, Henry; Zhou, Wei; Sun, Shi-Yong

    2016-01-01

    Death receptor 4 (DR4) is a cell surface receptor for tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and triggers apoptosis upon ligation with TRAIL or aggregation. MEK/ERK signaling is a well known and the best-studied effector pathway downstream of Ras and Raf. This study focuses on determining the impact of pharmacological MEK inhibition on DR4 expression and elucidating the underlying mechanism. We found that several MEK inhibitors including MEK162, AZD6244, and PD0325901 effectively decreased DR4 protein levels including cell surface DR4 in different cancer cell lines. Accordingly, pre-treatment of TRAIL-sensitive cancer cell lines with a MEK inhibitor desensitized them to TRAIL-induced apoptosis. These results indicate that MEK inhibition negatively regulates DR4 expression and cell response to TRAIL-induced apoptosis. MEK inhibitors did not alter DR4 protein stability, rather decreased its mRNA levels, suggesting a transcriptional regulation. In contrast, enforced activation of MEK/ERK signaling by expressing ectopic B-Raf (V600E) or constitutively activated MEK1 (MEK1-CA) or MEK2 (MEK2-CA) activated ERK and increased DR4 expression; these effects were inhibited when a MEK inhibitor was present. Promoter analysis through deletion and mutation identified the AP-1 binding site as an essential response element for enhancing DR4 transactivation by MEK1-CA. Furthermore, inhibition of AP-1 by c-Jun knockdown abrogated the ability of MEK1-CA to increase DR4 promoter activity and DR4 expression. These results suggest an essential role of AP-1 in mediating MEK/ERK activation-induced DR4 expression. Our findings together highlight a previously undiscovered mechanism that positively regulates DR4 expression through activation of the MEK/ERK/AP-1 signaling pathway. PMID:27576686

  16. Gene expression profiling reveals different molecular patterns in G-protein coupled receptor signaling pathways between early- and late-onset preeclampsia.

    PubMed

    Liang, Mengmeng; Niu, Jianmin; Zhang, Liang; Deng, Hua; Ma, Jian; Zhou, Weiping; Duan, Dongmei; Zhou, Yuheng; Xu, Huikun; Chen, Longding

    2016-04-01

    Early-onset preeclampsia and late-onset preeclampsia have been regarded as two different phenotypes with heterogeneous manifestations; To gain insights into the pathogenesis of the two traits, we analyzed the gene expression profiles in preeclamptic placentas. A whole genome-wide microarray was used to determine the gene expression profiles in placental tissues from patients with early-onset (n = 7; <34 weeks), and late-onset (n = 8; >36 weeks) preeclampsia and their controls who delivered preterm (n = 5; <34 weeks) or at term (n = 5; >36 weeks). Genes were termed differentially expressed if they showed a fold-change ≥ 2 and q-value < 0.05. Quantitative real-time reverse transcriptase PCR was used to verify the results. Western blotting was performed to verify the expressions of secreted genes at the protein level. Six hundred twenty-seven genes were differentially expressed in early-compared with late-onset preeclampsia (177 genes were up-regulated and 450 were down-regulated). Gene ontology analysis identified significant alterations in several biological processes; the top two were immune response and cell surface receptor linked signal transduction. Among the cell surface receptor linked signal transduction-related, differentially expressed genes, those involved in the G-protein coupled receptor protein signaling pathway were significantly enriched. G-protein coupled receptor signaling pathway related genes, such as GPR124 and MRGPRF, were both found to be down-regulated in early-onset preeclampsia. The results were consistent with those of western blotting that the abundance of GPR124 was lower in early-onset compared with late-onset preeclampsia. The different gene expression profiles reflect the different levels of transcription regulation between the two conditions and supported the hypothesis that they are separate disease entities. Moreover, the G-protein coupled receptor signaling pathway related genes may contribute to the mechanism underlying early- and late-onset preeclampsia. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Dual Effects of Cell Free Supernatants from Lactobacillus acidophilus and Lactobacillus rhamnosus GG in Regulation of MMP-9 by Up-Regulating TIMP-1 and Down-Regulating CD147 in PMA- Differentiated THP-1 Cells

    PubMed Central

    Maghsood, Faezeh; Mirshafiey, Abbas; Farahani, Mohadese M.; Modarressi, Mohammad Hossein; Jafari, Parvaneh; Motevaseli, Elahe

    2018-01-01

    Objective Recent studies have reported dysregulated expression of matrix metalloproteinases (MMPs), especially MMP-2, MMP-9, tissue inhibitor of metalloproteinase-1, -2 (TIMP-1, TIMP-2), and extracellular matrix metalloproteinase inducer (EMMPRIN/CD147) in activated macrophages of patients with inflammatory diseases. Therefore, MMP-2, MMP-9, and their regulators may represent a new target for treatment of inflammatory diseases. Probiotics, which are comprised of lactic acid bacteria, have the potential to modulate inflammatory responses. In this experimental study, we investigated the anti-inflammatory effects of cell-free supernatants (CFS) from Lactobacillus acidophilus (L. acidophilus) and L. rhamnosus GG (LGG) in phorbol myristate acetate (PMA)-differentiated THP-1 cells. Materials and Methods In this experimental study, PMA-differentiated THP-1 cells were treated with CFS from L. acidophilus, LGG and uninoculated bacterial growth media (as a control). The expression of MMP-2, MMP-9, TIMP-1, and TIMP-2 mRNAs were determined using real-time quantitative reverse transcription polymerase chain reaction (RT- PCR). The levels of cellular surface expression of CD147 were assessed by flow cytometry, and the gelatinolytic activity of MMP-2 and MMP-9 were determined by zymography. Results Our results showed that CFS from both L. acidophilus and LGG significantly inhibited the gene expression of MMP-9 (P=0.0011 and P=0.0005, respectively), increased the expression of TIMP-1 (P<0.0001), decreased the cell surface expression of CD147 (P=0.0307 and P=0.0054, respectively), and inhibited the gelatinolytic activity of MMP-9 (P=0.0003 and P<0.0001, respectively) in PMA-differentiated THP-1 cells. Although, MMP-2 expression and activity and TIMP-2 expression remained unchanged. Conclusion Our results indicate that CFS from L. acidophilus and LGG possess anti-inflammatory properties and can modulate the inflammatory response. PMID:29105390

  18. Regulation of protease-activated receptor 1 signaling by the adaptor protein complex 2 and R4 subfamily of regulator of G protein signaling proteins.

    PubMed

    Chen, Buxin; Siderovski, David P; Neubig, Richard R; Lawson, Mark A; Trejo, Joann

    2014-01-17

    The G protein-coupled protease-activated receptor 1 (PAR1) is irreversibly proteolytically activated by thrombin. Hence, the precise regulation of PAR1 signaling is important for proper cellular responses. In addition to desensitization, internalization and lysosomal sorting of activated PAR1 are critical for the termination of signaling. Unlike most G protein-coupled receptors, PAR1 internalization is mediated by the clathrin adaptor protein complex 2 (AP-2) and epsin-1, rather than β-arrestins. However, the function of AP-2 and epsin-1 in the regulation of PAR1 signaling is not known. Here, we report that AP-2, and not epsin-1, regulates activated PAR1-stimulated phosphoinositide hydrolysis via two different mechanisms that involve, in part, a subset of R4 subfamily of "regulator of G protein signaling" (RGS) proteins. A significantly greater increase in activated PAR1 signaling was observed in cells depleted of AP-2 using siRNA or in cells expressing a PAR1 (420)AKKAA(424) mutant with defective AP-2 binding. This effect was attributed to AP-2 modulation of PAR1 surface expression and efficiency of G protein coupling. We further found that ectopic expression of R4 subfamily members RGS2, RGS3, RGS4, and RGS5 reduced activated PAR1 wild-type signaling, whereas signaling by the PAR1 AKKAA mutant was minimally affected. Intriguingly, siRNA-mediated depletion analysis revealed a function for RGS5 in the regulation of signaling by the PAR1 wild type but not the AKKAA mutant. Moreover, activation of the PAR1 wild type, and not the AKKAA mutant, induced Gαq association with RGS3 via an AP-2-dependent mechanism. Thus, AP-2 regulates activated PAR1 signaling by altering receptor surface expression and through recruitment of RGS proteins.

  19. The distribution of IL-13 receptor alpha1 expression on B cells, T cells and monocytes and its regulation by IL-13 and IL-4.

    PubMed

    Graber, P; Gretener, D; Herren, S; Aubry, J P; Elson, G; Poudrier, J; Lecoanet-Henchoz, S; Alouani, S; Losberger, C; Bonnefoy, J Y; Kosco-Vilbois, M H; Gauchat, J F

    1998-12-01

    To study the expression of IL-13 receptor alpha1 (IL-13Ralpha1), specific monoclonal antibodies (mAb) were generated. Surface expression of the IL-13Ralpha1 on B cells, monocytes and T cells was assessed by flow cytometry using these specific mAb. Among tonsillar B cells, the expression was the highest on the IgD+ CD38- B cell subpopulation which is believed to represent naive B cells. Expression was also detectable on a large fraction of the IgD-CD38- B cells but not on CD38+ B cells. Activation under conditions which promote B cell Ig class switching up-regulated the expression of the receptor. However, the same stimuli had an opposite effect for IL-13Ralpha1 expression levels on monocytes. While IL-13Ralpha1 mRNA was clearly detectable in T cell preparations, no surface expression was detected. However, permeabilization of the T cells showed a clear intracellular expression of the receptor. A soluble form of the receptor was immunoprecipitated from the supernatant of activated peripheral T cells, suggesting that T cell IL-13Ralpha1 might have functions unrelated to the capacity to form a type II IL-4/IL-13R with IL-4Ralpha.

  20. Short-term sleep deprivation impairs spatial working memory and modulates expression levels of ionotropic glutamate receptor subunits in hippocampus.

    PubMed

    Xie, Meilan; Yan, Jie; He, Chao; Yang, Li; Tan, Gang; Li, Chao; Hu, Zhian; Wang, Jiali

    2015-06-01

    Hippocampus-dependent learning memory is sensitive to sleep deprivation (SD). Although the ionotropic glutamate receptors play a vital role in synaptic plasticity and learning and memory, however, whether the expression of these receptor subunits is modulated by sleep loss remains unclear. In the present study, western blotting was performed by probing with specific antibodies against the ionotropic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunits GluA1, GluA2, GluA3, and against the N-methyl-d-aspartate (NMDA) glutamate receptor subunits GluN1, GluN2A, GluN2B. In hippocampus, down regulation of surface GluA1 and GluN2A surface expression were observed in both SD groups. However, surface expression level of GluA2, GluA3, GluN1 and GluN2B was significantly up-regulated in 8h-SD rats when compared to the 4h-SD rats. In parallel with the complex changes in AMPA and NMDA receptor subunit expressions, we found the 8h-SD impaired rat spatial working memory in 30-s-delay T-maze task, whereas no impairment of spatial learning was observed in 4h-SD rats. These results indicate that sleep loss alters the relative expression levels of the AMPA and NMDA receptors, thus affects the synaptic strength and capacity for plasticity and partially contributes to spatial memory impairment. Copyright © 2015. Published by Elsevier B.V.

  1. PSD-95 stabilizes NMDA receptors by inducing the degradation of STEP61.

    PubMed

    Won, Sehoon; Incontro, Salvatore; Nicoll, Roger A; Roche, Katherine W

    2016-08-09

    Phosphorylation regulates surface and synaptic expression of NMDA receptors (NMDARs). Both the tyrosine kinase Fyn and the tyrosine phosphatase striatal-enriched protein tyrosine phosphatase (STEP) are known to target the NMDA receptor subunit GluN2B on tyrosine 1472, which is a critical residue that mediates NMDAR endocytosis. STEP reduces the surface expression of NMDARs by promoting dephosphorylation of GluN2B Y1472, whereas the synaptic scaffolding protein postsynaptic density protein 95 (PSD-95) stabilizes the surface expression of NMDARs. However, nothing is known about a potential functional interaction between STEP and PSD-95. We now report that STEP61 binds to PSD-95 but not to other PSD-95 family members. We find that PSD-95 expression destabilizes STEP61 via ubiquitination and degradation by the proteasome. Using subcellular fractionation, we detect low amounts of STEP61 in the PSD fraction. However, STEP61 expression in the PSD is increased upon knockdown of PSD-95 or in vivo as detected in PSD-95-KO mice, demonstrating that PSD-95 excludes STEP61 from the PSD. Importantly, only extrasynaptic NMDAR expression and currents were increased upon STEP knockdown, as is consistent with low STEP61 localization in the PSD. Our findings support a dual role for PSD-95 in stabilizing synaptic NMDARs by binding directly to GluN2B but also by promoting synaptic exclusion and degradation of the negative regulator STEP61.

  2. PSD-95 stabilizes NMDA receptors by inducing the degradation of STEP61

    PubMed Central

    Won, Sehoon; Incontro, Salvatore; Nicoll, Roger A.; Roche, Katherine W.

    2016-01-01

    Phosphorylation regulates surface and synaptic expression of NMDA receptors (NMDARs). Both the tyrosine kinase Fyn and the tyrosine phosphatase striatal-enriched protein tyrosine phosphatase (STEP) are known to target the NMDA receptor subunit GluN2B on tyrosine 1472, which is a critical residue that mediates NMDAR endocytosis. STEP reduces the surface expression of NMDARs by promoting dephosphorylation of GluN2B Y1472, whereas the synaptic scaffolding protein postsynaptic density protein 95 (PSD-95) stabilizes the surface expression of NMDARs. However, nothing is known about a potential functional interaction between STEP and PSD-95. We now report that STEP61 binds to PSD-95 but not to other PSD-95 family members. We find that PSD-95 expression destabilizes STEP61 via ubiquitination and degradation by the proteasome. Using subcellular fractionation, we detect low amounts of STEP61 in the PSD fraction. However, STEP61 expression in the PSD is increased upon knockdown of PSD-95 or in vivo as detected in PSD-95–KO mice, demonstrating that PSD-95 excludes STEP61 from the PSD. Importantly, only extrasynaptic NMDAR expression and currents were increased upon STEP knockdown, as is consistent with low STEP61 localization in the PSD. Our findings support a dual role for PSD-95 in stabilizing synaptic NMDARs by binding directly to GluN2B but also by promoting synaptic exclusion and degradation of the negative regulator STEP61. PMID:27457929

  3. Spdef Null Mice Lack Conjunctival Goblet Cells and Provide a Model of Dry Eye

    PubMed Central

    Marko, Christina K.; Menon, Balaraj B.; Chen, Gang; Whitsett, Jeffrey A.; Clevers, Hans; Gipson, Ilene K.

    2014-01-01

    Goblet cell numbers decrease within the conjunctival epithelium in drying and cicatrizing ocular surface diseases. Factors regulating goblet cell differentiation in conjunctival epithelium are unknown. Recent data indicate that the transcription factor SAM-pointed domain epithelial-specific transcription factor (Spdef) is essential for goblet cell differentiation in tracheobronchial and gastrointestinal epithelium of mice. Using Spdef−/− mice, we determined that Spdef is required for conjunctival goblet cell differentiation and that Spdef−/− mice, which lack conjunctival goblet cells, have significantly increased corneal surface fluorescein staining and tear volume, a phenotype consistent with dry eye. Microarray analysis of conjunctival epithelium in Spdef−/− mice revealed down-regulation of goblet cell–specific genes (Muc5ac, Tff1, Gcnt3). Up-regulated genes included epithelial cell differentiation/keratinization genes (Sprr2h, Tgm1) and proinflammatory genes (Il1-α, Il-1β, Tnf-α), all of which are up-regulated in dry eye. Interestingly, four Wnt pathway genes were down-regulated. SPDEF expression was significantly decreased in the conjunctival epithelium of Sjögren syndrome patients with dry eye and decreased goblet cell mucin expression. These data demonstrate that Spdef is required for conjunctival goblet cell differentiation and down-regulation of SPDEF may play a role in human dry eye with goblet cell loss. Spdef−/− mice have an ocular surface phenotype similar to that in moderate dry eye, providing a new, more convenient model for the disease. PMID:23665202

  4. Spdef null mice lack conjunctival goblet cells and provide a model of dry eye.

    PubMed

    Marko, Christina K; Menon, Balaraj B; Chen, Gang; Whitsett, Jeffrey A; Clevers, Hans; Gipson, Ilene K

    2013-07-01

    Goblet cell numbers decrease within the conjunctival epithelium in drying and cicatrizing ocular surface diseases. Factors regulating goblet cell differentiation in conjunctival epithelium are unknown. Recent data indicate that the transcription factor SAM-pointed domain epithelial-specific transcription factor (Spdef) is essential for goblet cell differentiation in tracheobronchial and gastrointestinal epithelium of mice. Using Spdef(-/-) mice, we determined that Spdef is required for conjunctival goblet cell differentiation and that Spdef(-/-) mice, which lack conjunctival goblet cells, have significantly increased corneal surface fluorescein staining and tear volume, a phenotype consistent with dry eye. Microarray analysis of conjunctival epithelium in Spdef(-/-) mice revealed down-regulation of goblet cell-specific genes (Muc5ac, Tff1, Gcnt3). Up-regulated genes included epithelial cell differentiation/keratinization genes (Sprr2h, Tgm1) and proinflammatory genes (Il1-α, Il-1β, Tnf-α), all of which are up-regulated in dry eye. Interestingly, four Wnt pathway genes were down-regulated. SPDEF expression was significantly decreased in the conjunctival epithelium of Sjögren syndrome patients with dry eye and decreased goblet cell mucin expression. These data demonstrate that Spdef is required for conjunctival goblet cell differentiation and down-regulation of SPDEF may play a role in human dry eye with goblet cell loss. Spdef(-/-) mice have an ocular surface phenotype similar to that in moderate dry eye, providing a new, more convenient model for the disease. Copyright © 2013 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  5. DAP12 impacts trafficking and surface stability of killer immunoglobulin-like receptors on natural killer cells

    PubMed Central

    Mulrooney, Tiernan J.; Posch, Phillip E.; Hurley, Carolyn Katovich

    2013-01-01

    KIR aid in the regulation of NK cell activity. In this study, the effect of the interaction between the KIR2DS and their adapter, DAP12, was investigated beyond the previously defined signaling function. Flow cytometry analysis showed enhanced KIR2DS surface expression on NKL cells when cotransfected with DAP12. Conversely, KIR2DS4 surface expression on primary cells was decreased when the cells were treated with DAP12-specific siRNA. Treatment of the KIR2DS and DAP12-transfected cells with CHX or BFA repressed KIR2DS surface expression, revealing a role for DAP12 in trafficking newly synthesized KIR to the cell surface. Immunoprecipitation of DAP12 revealed an interaction of DAP12 with an immature isoform of KIR2DS, indicating that the interaction likely initiates within the ER. An internalization assay demonstrated a significant impact of DAP12 on KIR2DS surface stability. Confocal microscopy showed that internalized KIR2DS molecules are recruited to lysosomal compartments independent of DAP12 expression. Our results suggest that in vivo conditions that adversely affect DAP12 expression will indirectly reduce surface expression and stability of KIR2DS. These effects could significantly impact ligand recognition and strength of signaling through KIR2DS molecules. PMID:23715743

  6. A Human-Specific α7-Nicotinic Acetylcholine Receptor Gene in Human Leukocytes: Identification, Regulation and the Consequences of CHRFAM7A Expression

    PubMed Central

    Costantini, Todd W; Dang, Xitong; Yurchyshyna, Maryana V; Coimbra, Raul; Eliceiri, Brian P; Baird, Andrew

    2015-01-01

    The human genome contains a variant form of the α7-nicotinic acetylcholine receptor (α7nAChR) gene that is uniquely human. This CHRFAM7A gene arose during human speciation and recent data suggests that its expression alters ligand tropism of the normally homopentameric human α7-AChR ligand-gated cell surface ion channel that is found on the surface of many different cell types. To understand its possible significance in regulating inflammation in humans, we investigated its expression in normal human leukocytes and leukocyte cell lines, compared CHRFAM7A expression to that of the CHRNA7 gene, mapped its promoter and characterized the effects of stable CHRFAM7A overexpression. We report here that CHRFAM7A is highly expressed in human leukocytes but that the levels of both CHRFAM7A and CHRNA7 mRNAs were independent and varied widely. To this end, mapping of the CHRFAM7A promoter in its 5′-untranslated region (UTR) identified a unique 1-kb sequence that independently regulates CHRFAM7A gene expression. Because overexpression of CHRFAM7A in THP1 cells altered the cell phenotype and modified the expression of genes associated with focal adhesion (for example, FAK, P13K, Akt, rho, GEF, Elk1, CycD), leukocyte transepithelial migration (Nox, ITG, MMPs, PKC) and cancer (kit, kitL, ras, cFos cyclinD1, Frizzled and GPCR), we conclude that CHRFAM7A is biologically active. Most surprisingly however, stable CHRFAM7A overexpression in THP1 cells upregulated CHRNA7, which, in turn, led to increased binding of the specific α7nAChR ligand, bungarotoxin, on the THP1 cell surface. Taken together, these data confirm the close association between CHRFAM7A and CHRNA7 expression, establish a biological consequence to CHRFAM7A expression in human leukocytes and support the possibility that this human-specific gene might contribute to, and/or gauge, a human-specific response to inflammation. PMID:25860877

  7. Expression and nutritional regulation of the (pro)renin receptor in rat visceral adipose tissue.

    PubMed

    Achard, V; Tassistro, V; Boullu-Ciocca, S; Grino, M

    2011-12-01

    Early life nutritional environment plays an important role in the development of visceral adipose tissue and interacts with nutritional regulations in adulthood, leading to metabolic dysregulations. We hypothesized that the renin-angiotensin system may play a role in the programming-induced development of visceral adipose tissue. We studied, using a model of programming of overweight and glucose intolerance, obtained by post-natal overfeeding with consecutive highfat diet, the status of plasma renin activity and mesenteric adipose renin-angiotensin system, including the recently identified (pro)renin receptor, in adult rats. Post-natal overfeeding or high-fat feeding lead to overweight with increased visceral fat mass and adipocytes surface. When both paradigms were associated, adipocytes surface showed a disproportionate increase. A strong immunoreactivity for (pro)renin receptor was found in stromal cells. Plasma renin activity increased in programmed animals whereas (pro)renin receptor expressing cells density was stimulated by high-fat diet. There was a positive, linear relationship between plasma renin activity and (pro)renin receptor expressing cells density and adipocytes surface. Our experiments demonstrate that association of post-natal overfeeding and high-fat diet increased plasma renin activity and adipose (pro)renin receptor expression. Such phenomenon could explain, at least in part, the associated disproportionate adipocyte hypertrophy and its accompanying increased glucose intolerance.

  8. Ephrinb1 and Ephrinb2 Are Associated with Interleukin-7 Receptor α and Retard Its Internalization from the Cell Surface*

    PubMed Central

    Luo, Hongyu; Wu, Zenghui; Qi, Shijie; Jin, Wei; Han, Bing; Wu, Jiangping

    2011-01-01

    IL-7 plays vital roles in thymocyte development, T cell homeostasis, and the survival of these cells. IL-7 receptor α (IL-7Rα) on thymocytes and T cells is rapidly internalized upon IL-7 ligation. Ephrins (Efns) are cell surface molecules and ligands of the largest receptor kinase family, Eph kinases. We discovered that T cell-specific double gene knock-out (dKO) of Efnb1 and Efnb2 in mice led to reduced IL-7Rα expression in thymocytes and T cells, and that IL-7Rα down-regulation was accelerated in dKO CD4 cells upon IL-7 treatment. On the other hand, Efnb1 and Efnb2 overexpression on T cell lymphoma EL4 cells retarded IL-7Rα down-regulation. dKO T cells manifested compromised STAT5 activation and homeostatic proliferation, an IL-7-dependent process. Fluorescence resonance energy transfer and immunoprecipitation demonstrated that Efnb1 and Efnb2 interacted physically with IL-7Rα. Such interaction likely retarded IL-7Rα internalization, as Efnb1 and Efnb2 were not internalized. Therefore, we revealed a novel function of Efnb1 and Efnb2 in stabilizing IL-7Rα expression at the post-translational level, and a previously unknown modus operandi of Efnbs in the regulation of expression of other vital cell surface receptors. PMID:22069310

  9. BIG1, a brefeldin A-inhibited guanine nucleotide-exchange protein modulates ABCA1 trafficking and function

    PubMed Central

    Lin, Sisi; Zhou, Chun; Neufeld, Edward; Wang, Yu-Hua; Xu, Suo-Wen; Lu, Liang; Wang, Ying; Liu, Zhi-Ping; Li, Dong; Li, Cuixian; Chen, Shaorui; Le, Kang; Huang, Heqing; Liu, Peiqing; Moss, Joel; Vaughan, Martha; Shen, Xiaoyan

    2013-01-01

    Objective Cell surface localization and intracellular trafficking of ATP-binding cassette transporter A-1 (ABCA1) are essential for its function. However, regulation of these activities is still largely unknown. Brefeldin A (BFA), a uncompetitive inhibitor of brefeldin A-inhibited guanine nucleotide-exchange proteins (BIGs), disturbs the intracellular distribution of ABCA1, and thus inhibits cholesterol efflux. This study aimed to define the possible roles of BIGs in regulating ABCA1 trafficking and cholesterol efflux, and further to explore the potential mechanism. Methods and Results By vesicle immunoprecipitation, we found that BIG1 was associated with ABCA1 in vesicles preparation from rat liver. BIG1 depletion reduced surface ABCA1 on HepG2 cells and inhibited by 60% cholesterol release. In contrast, BIG1 over-expression increased surface ABCA1 and cholesterol secretion. With partial restoration of BIG1 through over-expression in BIG1-depleted cells, surface ABCA1 was also restored. Biotinylation and glutathione cleavage revealed that BIG1 siRNA dramatically decreased the internalization and recycling of ABCA1. This novel function of BIG1 was dependent on the guanine nucleotide-exchange activity and achieved through activation of ADP-ribosylation factor 1 (ARF1). Conclusions BIG1, through its ability to activate ARF1, regulates cell surface levels and function of ABCA1, indicating a transcription-independent mechanism for controlling ABCA1 action. PMID:23220274

  10. The role of extracellular matrix metalloproteinase inducer (EMMPRIN) in the regulation of bovine endometrial cell functions.

    PubMed

    Mishra, Birendra; Kizaki, Keiichiro; Sato, Takashi; Ito, Akira; Hashizume, Kazuyoshi

    2012-06-01

    Extracellular matrix metalloproteinase inducer (EMMPRIN) is a cell surface glycoprotein that stimulates the production of several matrix metalloproteinases (MMPs) for tissue remodeling. Previously, we detected EMMPRIN in the bovine endometrium, and it is mainly expressed in the luminal and glandular epithelium whereas MMPs are expressed in the underlying stroma. From this expression pattern, we hypothesized that EMMPRIN may regulate stromal MMPs in endometrial cell functions. To test this hypothesis, a coculture of epithelial and stromal cells was performed using a transwell system. In the coculture, epithelial cells were cultured on the insert membrane and stromal cell on the surface of well plates. Expression of stromal MMP-2 and MMP-14 was significantly higher in coculture with epithelial cell. Further, with the addition of anti-EMMPRIN antibody into the epithelial cell compartment, the expression of stromal EMMPRIN and MMP-2 and MMP-14 was decreased. To identify the active site of EMMPRIN for the augmentation of MMPs, EMMPRIN synthetic peptides that correspond to the extracellular loop domain-I (EM1, EM2, EM3, and EM4) were added into the epithelial cell compartment, and only EM2 at a higher dose interfered with EMMPRIN-mediated expression of MMP-14. Next, we examined the effects of progesterone and/or estrogen on the expression of EMMPRIN, MMP-2, and MMP-14. Progesterone (300 nM) significantly stimulated the expression of EMMPRIN but had no effects on any of the MMPs. These results suggest that EMMPRIN derived from epithelial cells regulates MMPs in the endometrium under progesterone-rich conditions and may thereby modulate bovine endometrial cell functions during gestation.

  11. The melanocortin receptor agonist NDP-MSH impairs the allostimulatory function of dendritic cells.

    PubMed

    Rennalls, La'Verne P; Seidl, Thomas; Larkin, James M G; Wellbrock, Claudia; Gore, Martin E; Eisen, Tim; Bruno, Ludovica

    2010-04-01

    As alpha-melanocyte-stimulating hormone (alpha-MSH) is released by immunocompetent cells and has potent immunosuppressive properties, it was determined whether human dendritic cells (DCs) express the receptor for this hormone. Reverse transcription-polymerase chain reaction detected messenger RNA specific for all of the known melanocortin receptors in DCs. Mixed lymphocyte reactions also revealed that treatment with [Nle(4), DPhe(7)]-alpha-MSH (NDP-MSH), a potent alpha-MSH analogue, significantly reduced the ability of DCs to stimulate allogeneic T cells. The expression of various cell surface adhesion, maturation and costimulatory molecules on DCs was also investigated. Although treatment with NDP-MSH did not alter the expression of CD83 and major histocompatibility complex class I and II, the surface expression of CD86 (B7.2), intercellular adhesion molecule (ICAM-1/CD54) and CD1a was reduced. In summary, our data indicate that NDP-MSH inhibits the functional activity of DCs, possibly by down-regulating antigen-presenting and adhesion molecules and that these events may be mediated via the extracellular signal-regulated kinase 1 and 2 pathway.

  12. Benzoxazole derivatives suppress lipopolysaccharide-induced mast cell activation.

    PubMed

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Choo, Hea-Young Park; Lee, Kyung Ho

    2018-05-01

    Mast cells are central regulators of allergic inflammation that function by releasing various proallergic inflammatory mediators, including histamine, eicosanoids and proinflammatory cytokines. Occasionally, bacterial infections may initiate or worsen allergic inflammation. A number of studies have indicated that activation of lipoxygenase in mast cells positive regulates allergic inflammatory responses by generating leukotrienes and proinflammatory cytokines. In the present study, the effects of benzoxazole derivatives on the lipopolysaccharide (LPS)‑induced expression of proinflammatory cytokines, production of histamine and surface expression of co‑stimulatory molecules on bone marrow-derived mast cells (BMMCs) were studied. The benzoxazole derivatives significantly reduced the expression of interleukin (IL)‑1β, IL‑6, IL‑13, tumor necrosis factor‑α, perilipin (PLIN) 2, and PLIN3 in BMMCs treated with LPS. Furthermore, histamine production was suppressed in BMMCs treated with LPS, or treated with phorbol-12-myristate-13-acetate/ionomycin. Benzoxazole derivatives marginally affected the surface expression of cluster of differentiation (CD)80 and CD86 on BMMCs in the presence of LPS, although LPS alone did not increase the expression of those proteins. Therefore, benzoxazole derivatives inhibited the secretion of proinflammatory cytokines in mast cells and may be potential candidate anti‑allergic agents to suppress mast cell activation.

  13. N-CADHERIN PRODOMAIN CLEAVAGE REGULATES SYNAPSE FORMATION IN VIVO

    PubMed Central

    Latefi, Nazlie S.; Pedraza, Liliana; Schohl, Anne; Li, Ziwei; Ruthazer, Edward S.

    2009-01-01

    Cadherins are initially synthesized bearing a prodomain that is thought to limit adhesion during early stages of biosynthesis. Functional cadherins lack this prodomain, raising the intriguing possibility that cells may utilize prodomain cleavage as a means to temporally or spatially regulate adhesion after delivery of cadherin to the cell surface. In support of this idea, immunostaining for the prodomain of zebrafish N-cadherin revealed enriched labeling at neuronal surfaces at the soma and along axonal processes. To determine whether post-translational cleavage of the prodomain affects synapse formation, we imaged Rohon-Beard cells in zebrafish embryos expressing GFP-tagged wild-type N-cadherin (NCAD-GFP) or a GFP-tagged N-cadherin mutant expressing an uncleavable prodomain (PRON-GFP) rendering it non-adhesive. NCAD-GFP accumulated at synaptic microdomains in a developmentally regulated manner, and its overexpression transiently accelerated synapse formation. PRON-GFP was much more diffusely distributed along the axon and its overexpression delayed synapse formation. Our results support the notion that N-cadherin serves to stabilize pre- to postsynaptic contacts early in synapse development and suggests that regulated cleavage of the N-cadherin prodomain may be a mechanism by which the kinetics of synaptogenesis are regulated. PMID:19365814

  14. Surface Expression of Hsp25 and Hsp72 Differentially Regulates Tumor Growth and Metastasis

    PubMed Central

    Bausero, María A.; Page, Diana T.; Osinaga, Eduardo; Asea, Alexzander

    2006-01-01

    The expression of unique surface structures on tumors that allow for recognition and activation of host immunocompetent cells plays an important role in determining tumor growth and/or metastasis. Recent studies have identified an important role for heat shock proteins (Hsp) in antitumor surveillance; however, the exact role of Hsp expressed on the surface of tumors has not been fully addressed. In this study, we show that 4T1 mammary adenocarcinoma cells sorted for high Hsp25 surface expression (Hsp25high) grow significantly faster than cells sorted for intermediate Hsp25 surface expression (Hsp25intermediate) or wild-type 4T1 cells implanted into the abdominal breast gland of female BALB/c mice (p < 0.05). In addition, histological examination of lung tissues revealed that Hsp25high 4T1 cells metastasized to the lungs more aggressively than either Hsp25intermediate or wild-type 4T1 cells (p < 0.05). Exposure of 4T1 cells to nonlethal heat shock (43°C, 30 min) induced the surface expression of Hsp72 and a concomitant reduction in Hsp25 surface expression. The growth and metastastic potential of Hsp72+ 4T1 cells was significantly less than that of Hsp25high, Hsp25intermediate or wild-type 4T1 cells (p < 0.05). Taken together, these studies identify an important role for expression of Hsp25 and Hsp72 during tumor growth and metastatic spread which might be helpful in the design of antimetastatic therapies. PMID:15627887

  15. Surface expression of Hsp25 and Hsp72 differentially regulates tumor growth and metastasis.

    PubMed

    Bausero, María A; Page, Diana T; Osinaga, Eduardo; Asea, Alexzander

    2004-01-01

    The expression of unique surface structures on tumors that allow for recognition and activation of host immunocompetent cells plays an important role in determining tumor growth and/or metastasis. Recent studies have identified an important role for heat shock proteins (Hsp) in antitumor surveillance; however, the exact role of Hsp expressed on the surface of tumors has not been fully addressed. In this study, we show that 4T1 mammary adenocarcinoma cells sorted for high Hsp25 surface expression (Hsp25(high)) grow significantly faster than cells sorted for intermediate Hsp25 surface expression (Hsp25(intermediate)) or wild-type 4T1 cells implanted into the abdominal breast gland of female BALB/c mice (p < 0.05). In addition, histological examination of lung tissues revealed that Hsp25(high) 4T1 cells metastasized to the lungs more aggressively than either Hsp25(intermediate) or wild-type 4T1 cells (p < 0.05). Exposure of 4T1 cells to nonlethal heat shock (43 degrees C, 30 min) induced the surface expression of Hsp72 and a concomitant reduction in Hsp25 surface expression. The growth and metastastic potential of Hsp72(+) 4T1 cells was significantly less than that of Hsp25(high), Hsp25(intermediate) or wild-type 4T1 cells (p < 0.05). Taken together, these studies identify an important role for expression of Hsp25 and Hsp72 during tumor growth and metastatic spread which might be helpful in the design of antimetastatic therapies. Copyright 2004 S. Karger AG, Basel.

  16. Reduction of CD147 surface expression on primary T cells leads to enhanced cell proliferation.

    PubMed

    Biegler, Brian; Kasinrerk, Watchara

    2012-12-01

    CD147 is a ubiquitously expressed membrane glycoprotein that has numerous functional associations in health and disease. However, the molecular mechanisms by which CD147 participates in these processes are unclear. Establishing physiologically relevant silencing of CD147 in primary T cells could provide clues essential for elucidating some aspects of CD147 biology. To date, achieving the knockdown of CD147 in primary T cells has remained elusive. Utilizing RNA interference and the Nucleofector transfection system, we were able to reduce the expression of CD147 in primary T cells. Comparison of basic functions, such as proliferation and CD25 expression, were then made between control populations and populations with reduced expression. Up-regulation of CD147 was found upon T-cell activation, indicating a role in T-cell responses. To better understand the possible importance of this up-regulation, we knocked down the expression of CD147 using RNA interference. When compared to control populations the CD147 knockdown populations exhibited increased proliferation. This alteration of cell proliferation, however, was not linked to a change in CD25 expression. We achieved reduction of CD147 surface expression in primary T cells by siRNA-mediated gene silencing. Our results point to CD147 having a possible negative regulatory role in T cell-mediated immune responses.

  17. Novel down-regulatory mechanism of the surface expression of the vasopressin V2 receptor by an alternative splice receptor variant.

    PubMed

    Sarmiento, José M; Añazco, Carolina C; Campos, Danae M; Prado, Gregory N; Navarro, Javier; González, Carlos B

    2004-11-05

    In rat kidney, two alternatively spliced transcripts are generated from the V2 vasopressin receptor gene. The large transcript (1.2 kb) encodes the canonical V2 receptor, whereas the small transcript encodes a splice variant displaying a distinct sequence corresponding to the putative seventh transmembrane domain and the intracellular C terminus of the V2 receptor. This work showed that the small spliced transcript is translated in the rat kidney collecting tubules. However, the protein encoded by the small transcript (here called the V2b splice variant) is retained inside the cell, in contrast to the preferential surface distribution of the V2 receptor (here called the V2a receptor). Cells expressing the V2b splice variant do not exhibit binding to 3H-labeled vasopressin. Interestingly, we found that expression of the splice variant V2b down-regulates the surface expression of the V2a receptor, most likely via the formation of V2a.V2b heterodimers as demonstrated by co-immunoprecipitation and fluorescence resonance energy transfer experiments between the V2a receptor and the V2b splice variant. The V2b splice variant would then be acting as a dominant negative. The effect of the V2b splice variant is specific, as it does not affect the surface expression of the G protein-coupled interleukin-8 receptor (CXCR1). Furthermore, the sequence encompassing residues 242-339, corresponding to the C-terminal domain of the V2b splice variant, also down-regulates the surface expression of the V2a receptor. We suggest that some forms of nephrogenic diabetes insipidus are due to overexpression of the splice variant V2b, which could retain the wild-type V2a receptor inside the cell via the formation of V2a.V2b heterodimers.

  18. T-cell receptor revision: friend or foe?

    PubMed

    Hale, J Scott; Fink, Pamela J

    2010-04-01

    T-cell receptor (TCR) revision is a process of tolerance induction by which peripheral T cells lose surface expression of an autoreactive TCR, reinduce expression of the recombinase machinery, rearrange genes encoding extrathymically generated TCRs for antigen, and express these new receptors on the cell surface. We discuss the evidence for this controversial tolerance mechanism below. Despite the apparent heresy of post-thymic gene rearrangement, we argue here that TCR revision follows the rules obeyed by maturing thymocytes undergoing gene recombination. Expression of the recombinase is carefully controlled both spatially and temporally, and may be initiated by loss of signals through surface TCRs. The resulting TCR repertoire is characterized by its diversity, self major histocompatibility complex restriction, self tolerance, and ability to mount productive immune responses specific for foreign antigens. Hence, TCR revision is a carefully regulated process of tolerance induction that can contribute to the protection of the individual against invading pathogens while preserving the integrity of self tissue.

  19. Endothelial cell regulation of leukocyte infiltration in inflammatory tissues

    PubMed Central

    Mantovani, A.; Introna, M.; Dejana, E.

    1995-01-01

    Endothelial cells play an important, active role in the onset and regulation of inflammatory and immune reactions. Through the production of chemokines they attract leukocytes and activate their adhesive receptors. This leads to the anchorage of leukocytes to the adhesive molecules expressed on the endothelial surface. Leukocyte adhesion to endothelial cells is frequently followed by their extravasation. The mechanisms which regulate the passage of leukocytes through endothelial clefts remain to be clarified. Many indirect data suggest that leukocytes might transfer signals to endothelial cells both through the release of active agents and adhesion to the endothelial cell surface. Adhesive molecules (such as PECAM) on the endothelial cell surface might also ‘direct’ leukocytes through the intercellular junction by haptotaxis. The information available on the molecular structure and functional properties of endothelial chemokines, adhesive molecules or junction organization is still fragmentary. Further work is needed to clarify how they interplay in regulating leukocyte infiltration into tissues. PMID:18475659

  20. The roles of protein disulphide isomerase family A, member 3 (ERp57) and surface thiol/disulphide exchange in human spermatozoa-zona pellucida binding.

    PubMed

    Wong, Chi-Wai; Lam, Kevin K W; Lee, Cheuk-Lun; Yeung, William S B; Zhao, Wei E; Ho, Pak-Chung; Ou, Jian-Ping; Chiu, Philip C N

    2017-04-01

    Are multimeric sperm plasma membrane protein complexes, ERp57 and sperm surface thiol content involved in human spermatozoa-zona pellucida (ZP) interaction? ERp57 is a component of a multimeric spermatozoa-ZP receptor complex involved in regulation of human spermatozoa-ZP binding via up-regulation of sperm surface thiol content. A spermatozoon acquires its fertilization capacity within the female reproductive tract by capacitation. Spermatozoa-ZP receptor is suggested to be a composite structure that is assembled into a functional complex during capacitation. Sperm surface thiol content is elevated during capacitation. ERp57 is a protein disulphide isomerase that modulates the thiol-disulphide status of proteins. The binding ability and components of protein complexes in extracted membrane protein fractions of spermatozoa were studied. The roles of capacitation, thiol-disulphide reagent treatments and ERp57 on sperm functions and sperm surface thiol content were assessed. Spermatozoa were obtained from semen samples from normozoospermic men. Human oocytes were obtained from an assisted reproduction programme. Blue native polyacrylamide gel electrophoresis, western ligand blotting and mass spectrometry were used to identify the components of solubilized ZP/ZP3-binding complexes. The localization and expression of sperm surface thiol and ERp57 were studied by immunostaining and sperm surface protein biotinylation followed by western blotting. Sperm functions were assessed by standard assays. Several ZP-binding complexes were isolated from the cell membrane of capacitated spermatozoa. ERp57 was a component of one of these complexes. Capacitation significantly increased the sperm surface thiol content, acrosomal thiol distribution and ERp57 expression on sperm surface. Sperm surface thiol and ERp57 immunoreactivity were localized to the acrosomal region of spermatozoa, a region responsible for ZP-binding. Up-regulation of the surface thiol content or ERp57 surface expression in vitro stimulated ZP-binding capacity of human spermatozoa. Blocking of ERp57 function by specific antibody or inhibitors against ERp57 reduced the surface thiol content and ZP-binding capacity of human spermatozoa. N/A. The mechanisms by which up-regulation of surface thiol content stimulates spermatozoa-ZP binding have not been depicted. Thiol-disulphide exchange is a crucial event in capacitation. ERp57 modulates the event and the subsequent fertilization process. Modulation of the surface thiol content of the spermatozoa of subfertile men may help to increase fertilization rate in assisted reproduction. This work was supported by The Hong Kong Research Grant Council Grant HKU764611 and HKU764512M to P.C.N.C. The authors have no competing interests. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  1. H-NS regulates the Vibrio parahaemolyticus type VI secretion system 1

    PubMed Central

    Salomon, Dor; Klimko, John A.

    2014-01-01

    The marine bacterium Vibrio parahaemolyticus, a major cause of food-borne gastroenteritis, employs a type VI secretion system 1 (T6SS1), a recently discovered protein secretion system, to combat competing bacteria. Environmental signals such as temperature, salinity, cell density and surface sensing, as well as the quorum-sensing master regulator OpaR, were previously reported to regulate T6SS1 activity and expression. In this work, we set out to identify additional transcription regulators that control the tightly regulated T6SS1 activity. To this end, we determined the effect of deletions in several known virulence regulators and in two regulators encoded within the T6SS1 gene cluster on expression and secretion of the core T6SS component Hcp1 and on T6SS1-mediated anti-bacterial activity. We report that VP1391 and VP1407, transcriptional regulators encoded within the T6SS1 gene cluster, are essential for T6SS1 activity. Moreover, we found that H-NS, a bacterial histone-like nucleoid structuring protein, which mediates transcription silencing of horizontally acquired genes, serves as a repressor of T6SS1. We also show that activation of surface sensing and high salt conditions alleviate the H-NS-mediated repression. Our results shed light on the complex network of environmental signals and transcription regulators that govern the tight regulation over T6SS1 activity. PMID:24987102

  2. Heterogeneous expression and regulation of CD40 in human hepatocellular carcinoma.

    PubMed

    Holub, Margareta; Zakeri, Schaker M; Lichtenberger, Cornelia; Pammer, Johannes; Paolini, Pierre; Leifeld, Ludger; Rockenschaub, Susanne; Wolschek, Markus F; Steger, Günther; Willheim, Martin; Gangl, Alfred; Reinisch, Walter

    2003-02-01

    CD40, a member of the tumour necrosis factor receptor family, plays a major role in adaptive immune responses and contributes to cancer surveillance. Conflicting results have been reported recently on the expression and function of CD40 in carcinomas. The aim of the present study was to investigate the role of CD40 in human hepatoma. CD40 expression was examined in hepatomas and derived cell lines by immunohistochemistry, flow cytometry and reverse transcriptase polymerase chain reaction. We investigated in hepatoma cell lines the regulation of CD40 by pro-inflammatory cytokines and the effects of its ligation with soluble CD40L on the expression of co-stimulatory and pro-apoptotic cell-surface molecules and survival. CD40 was detected with a similar frequency of about 40% in hepatoma specimens and derived cell lines but not in normal hepatocytes. Tumour necrosis factor alpha and its combination with interferon gamma upregulated CD40 only in intrinsically positive cell lines. CD40 ligation had no effect on cell viability or surface expression of CD54, CD80, CD86 or CD95. CD40 is expressed variably in human hepatoma and enhanced by distinct pro-inflammatory cytokines. The lack of detectable effects of CD40 ligation does not support a major role of this molecule in hepatocellular carcinoma biology.

  3. Multiple Genes Repress Motility in Uropathogenic Escherichia coli Constitutively Expressing Type 1 Fimbriae▿ †

    PubMed Central

    Simms, Amy N.; Mobley, Harry L. T.

    2008-01-01

    Two surface organelles of uropathogenic Escherichia coli (UPEC), flagella and type 1 fimbriae, are critical for colonization of the urinary tract but mediate opposite actions. Flagella propel bacteria through urine and along mucus layers, while type 1 fimbriae allow bacteria to adhere to specific receptors present on uroepithelial cells. Constitutive expression of type 1 fimbriae leads to repression of motility and chemotaxis in UPEC strain CFT073, suggesting that UPEC may coordinately regulate motility and adherence. To identify genes involved in this regulation of motility by type 1 fimbriae, transposon mutagenesis was performed on a phase-locked type 1 fimbrial ON variant of strain CFT073 (CFT073 fim L-ON), followed by a screen for restoration of motility in soft agar. Functions of the genes identified included attachment, metabolism, transport, DNA mismatch repair, and transcriptional regulation, and a number of genes had hypothetical function. Isogenic deletion mutants of these genes were also constructed in CFT073 fim L-ON. Motility was partially restored in six of these mutants, including complementable mutations in four genes encoding known transcriptional regulators, lrhA, lrp, slyA, and papX; a mismatch repair gene, mutS; and one hypothetical gene, ydiV. Type 1 fimbrial expression in these mutants was unaltered, and the majority of these mutants expressed larger amounts of flagellin than the fim L-ON parental strain. Our results indicate that repression of motility in CFT073 fim L-ON is not solely due to the constitutive expression of type 1 fimbriae on the surfaces of the bacteria and that multiple genes may contribute to this repression. PMID:18359812

  4. Anterior segment dysgenesis correlation with epithelial-mesenchymal transition in Smad4 knockout mice.

    PubMed

    Li, Jing; Qin, Yu; Zhao, Fang-Kun; Wu, Di; He, Xue-Fei; Liu, Jia; Zhao, Jiang-Yue; Zhang, Jin-Song

    2016-01-01

    To explore the molecular mechanisms in lens development and the pathogenesis of Peters anomaly in Smad4 defective mice. Le-Cre transgenic mouse line was employed to inactivate Smad4 in the surface ectoderm selectively. Pathological techniques were used to reveal the morphological changes of the anterior segment in Smad4 defective eye. Immunohistochemical staining was employed to observe the expression of E-cadherin, N-cadherin and α-SMA in anterior segment of Smad4 defective mice and control mice at embryonic (E) day 16.5. Real-time quantitative polymerase chain reaction (qPCR) was performed to detect the expression of Snail, Zeb1, Zeb2 and Twist2 in lens of Smad4 defective mice and control mice at E16.5. Statistical evaluations were performed using the unpaired Student's t-test (two-tailed) by SPSS 11.0 software. Conditional deletion of Smad4 on eye surface ectoderm resulted in corneal dysplasia, iridocorneal angle closure, corneolenticular adhesions and cataract resembling Peters anomaly. Loss of Smad4 function inhibited E-cadherin expression in the lens epithelium cells and corneal epithelium cells in Smad4 defective eye. Expression of N-cadherin was up-regulated in corneal epithelium and corneal stroma. Both E-cadherin and N-cadherin were down-regulated at the future trabecular meshwork region in mutant eye. The qPCR results showed that the expression of Twist2 was increased significantly in the mutant lens (P<0.01). Smad4 is essential to eye development and likely a candidate pathogenic gene to Peters anomaly by regulating epithelial-mesenchymal transition. Twist2 can be regulated by Smad4 and plays an essential role in lens development.

  5. The expression of the β-defensins hBD-2 and hBD-3 is differentially regulated by NF-κB and MAPK/AP-1 pathways in an in vitro model of Candida esophagitis

    PubMed Central

    Steubesand, Nadine; Kiehne, Karlheinz; Brunke, Gabriele; Pahl, Rene; Reiss, Karina; Herzig, Karl-Heinz; Schubert, Sabine; Schreiber, Stefan; Fölsch, Ulrich R; Rosenstiel, Philip; Arlt, Alexander

    2009-01-01

    Background Candida albicans resides on epithelial surfaces as part of the physiological microflora. However, under certain conditions it may cause life-threatening infections like Candida sepsis. Human β-defensins (hBDs) are critical components of host defense at mucosal surfaces and we have recently shown that hBD-2 and hBD-3 are upregulated in Candida esophagitis. We therefore studied the role of Candidate signalling pathways in order to understand the mechanisms involved in regulation of hBD-expression by C. albicans. We used the esophageal cell line OE21 and analysed the role of paracrine signals from polymorphonuclear leukocytes (PMN) in an in vitro model of esophageal candidiasis. Results Supernatants of C. albicans or indirect coculture with C. albicans induces upregulation of hBD-2 and hBD-3 expression. PMNs strongly amplifies C. albicans-mediated induction of hBDs. By EMSA we demonstrate that C. albicans activates NF-κB and AP-1 in OE21 cells. Inhibition of these pathways revealed that hBD-2 expression is synergistically regulated by both NF-κB and AP-1. In contrast hBD-3 expression is independent of NF-κB and relies solely on an EGFR/MAPK/AP-1-dependent pathway. Conclusion Our analysis of signal transduction events demonstrate a functional interaction of epithelial cells with PMNs in response to Candida infection involving divergent signalling events that differentially govern hBD-2 and hBD-3 expression. PMID:19523197

  6. ICAM-1-expressing neutrophils exhibit enhanced effector functions in murine models of endotoxemia.

    PubMed

    Woodfin, Abigail; Beyrau, Martina; Voisin, Mathieu-Benoit; Ma, Bin; Whiteford, James R; Hordijk, Peter L; Hogg, Nancy; Nourshargh, Sussan

    2016-02-18

    Intracellular adhesion molecule-1 (ICAM-1) is a transmembrane glycoprotein expressed on the cell surface of numerous cell types such as endothelial and epithelial cells, vascular smooth muscle cells, and certain leukocyte subsets. With respect to the latter, ICAM-1 has been detected on neutrophils in several clinical and experimental settings, but little is known about the regulation of expression or function of neutrophil ICAM-1. In this study, we report on the de novo induction of ICAM-1 on the cell surface of murine neutrophils by lipopolysaccharide (LPS), tumor necrosis factor, and zymosan particles in vitro. The induction of neutrophil ICAM-1 was associated with enhanced phagocytosis of zymosan particles and reactive oxygen species (ROS) generation. Conversely, neutrophils from ICAM-1-deficient mice were defective in these effector functions. Mechanistically, ICAM-1-mediated intracellular signaling appeared to support neutrophil ROS generation and phagocytosis. In vivo, LPS-induced inflammation in the mouse cremaster muscle and peritoneal cavity led to ICAM-1 expression on intravascular and locally transmigrated neutrophils. The use of chimeric mice deficient in ICAM-1 on myeloid cells demonstrated that neutrophil ICAM-1 was not required for local neutrophil transmigration, but supported optimal intravascular and extravascular phagocytosis of zymosan particles. Collectively, the present results shed light on regulation of expression and function of ICAM-1 on neutrophils and identify it as an additional regulator of neutrophil effector responses in host defense. © 2016 by The American Society of Hematology.

  7. Quantitative proteomic analysis of the Salmonella-lettuce interaction

    PubMed Central

    Zhang, Yuping; Nandakumar, Renu; Bartelt-Hunt, Shannon L; Snow, Daniel D; Hodges, Laurie; Li, Xu

    2014-01-01

    Human pathogens can internalize food crops through root and surface uptake and persist inside crop plants. The goal of the study was to elucidate the global modulation of bacteria and plant protein expression after Salmonella internalizes lettuce. A quantitative proteomic approach was used to analyse the protein expression of Salmonella enterica serovar Infantis and lettuce cultivar Green Salad Bowl 24 h after infiltrating S. Infantis into lettuce leaves. Among the 50 differentially expressed proteins identified by comparing internalized S. Infantis against S. Infantis grown in Luria Broth, proteins involved in glycolysis were down-regulated, while one protein involved in ascorbate uptake was up-regulated. Stress response proteins, especially antioxidant proteins, were up-regulated. The modulation in protein expression suggested that internalized S. Infantis might utilize ascorbate as a carbon source and require multiple stress response proteins to cope with stresses encountered in plants. On the other hand, among the 20 differentially expressed lettuce proteins, proteins involved in defense response to bacteria were up-regulated. Moreover, the secreted effector PipB2 of S. Infantis and R proteins of lettuce were induced after bacterial internalization into lettuce leaves, indicating human pathogen S. Infantis triggered the defense mechanisms of lettuce, which normally responds to plant pathogens. PMID:24512637

  8. Human Cytomegalovirus UL18 Utilizes US6 for Evading the NK and T-Cell Responses

    PubMed Central

    Kim, Youngkyun; Park, Boyoun; Cho, Sunglim; Shin, Jinwook; Cho, Kwangmin; Jun, Youngsoo; Ahn, Kwangseog

    2008-01-01

    Human cytomegalovirus (HCMV) US6 glycoprotein inhibits TAP function, resulting in down-regulation of MHC class I molecules at the cell surface. Cells lacking MHC class I molecules are susceptible to NK cell lysis. HCMV expresses UL18, a MHC class I homolog that functions as a surrogate to prevent host cell lysis. Despite a high level of sequence and structural homology between UL18 and MHC class I molecules, surface expression of MHC class I, but not UL18, is down regulated by US6. Here, we describe a mechanism of action by which HCMV UL18 avoids attack by the self-derived TAP inhibitor US6. UL18 abrogates US6 inhibition of ATP binding by TAP and, thereby, restores TAP-mediated peptide translocation. In addition, UL18 together with US6 interferes with the physical association between MHC class I molecules and TAP that is required for optimal peptide loading. Thus, regardless of the recovery of TAP function, surface expression of MHC class I molecules remains decreased. UL18 represents a unique immune evasion protein that has evolved to evade both the NK and the T cell immune responses. PMID:18688275

  9. The type II cGMP dependent protein kinase regulates GluA1 levels at the plasma membrane of developing cerebellar granule cells

    PubMed Central

    Incontro, Salvatore; Ciruela, Francisco; Ziff, Edward; Hofmann, Franz; Sánchez-Prieto, José; Torres, Magdalena

    2014-01-01

    Trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) is regulated by specific interactions with other proteins and by post-translational mechanisms, such as phosphorylation. We have found that the type II cGMP-dependent protein kinase (cGKII) phosphorylates GluA1 (formerly GluR1) at S845, augmenting the surface expression of AMPARs at both synaptic and extrasynaptic sites. Activation of cGKII by 8-Br-cGMP enhances the surface expression of GluA1, whereas its inhibition or suppression effectively diminished the expression of this protein at the cell surface. In granule cells, NMDA receptor activation (NMDAR) stimulates nitric oxide and cGMP production, which in turn activates cGKII and induces the phosphorylation of GluA1, promoting its accumulation in the plasma membrane. GluA1 is mainly incorporated into calcium permeable AMPARs as exposure to 8-Br-cGMP or NMDA activation enhanced AMPA-elicited calcium responses that are sensitive to NASPM inhibition. We summarize evidence for an increase of calcium permeable AMPA receptors downstream of NMDA receptor activation that might be relevant for granule cell development and plasticity. PMID:23545413

  10. PU.1 regulates TCR expression by modulating GATA-3 activity

    PubMed Central

    Chang, Hua-Chen; Han, Ling; Jabeen, Rukhsana; Carotta, Sebastian; Nutt, Stephen L.; Kaplan, Mark H.

    2009-01-01

    The Ets transcription factor PU.1 is a master regulator for the development of multiple lineages during hematopoiesis. The expression pattern of PU.1 is dynamically regulated during early T lineage development in the thymus. We previously revealed that PU.1 delineates heterogeneity of effector Th2 populations. In this study, we further define the function of PU.1 on the Th2 phenotype using mice that specifically lack PU.1 in T cells using an lck-Cre transgene with a conditional Sfpi1 allele (Sfpi1lck-/-). While deletion of PU.1 by the lck-Cre transgene does not affect T cell development, Sfpi1lck-/- T cells have a lower activation threshold than wild type T cells. When TCR engagement is limiting, Sfpi1lck-/- T cells cultured in Th2 polarizing conditions secrete higher levels of Th2 cytokines and have greater cytokine homogeneity than wild type cells. We show that PU.1 modulates the levels of TCR expression in CD4+ T cells by regulating the DNA-binding activity of GATA-3 and limiting GATA-3 regulation of TCR gene expression. GATA-3 dependent regulation of TCR expression is also observed in Th1 and Th2 cells. In CD4+ T cells, PU.1 expression segregates into subpopulations of cells that have lower levels of surface TCR, suggesting that PU.1 contributes to the heterogeneity of TCR expression. Thus, we have identified a mechanism whereby increased GATA-3 function in the absence of the antagonizing activity of PU.1 leads to increased TCR expression, a reduced activation threshold and increased homogeneity in Th2 populations. PMID:19801513

  11. Rescue of the colony-stimulating factor 1 (CSF-1)-nullizygous mouse (Csf1(op)/Csf1(op)) phenotype with a CSF-1 transgene and identification of sites of local CSF-1 synthesis.

    PubMed

    Ryan, G R; Dai, X M; Dominguez, M G; Tong, W; Chuan, F; Chisholm, O; Russell, R G; Pollard, J W; Stanley, E R

    2001-07-01

    Colony-stimulating factor 1 (CSF-1) regulates the survival, proliferation, and differentiation of mononuclear phagocytes. It is expressed as a secreted glycoprotein or proteoglycan found in the circulation or as a biologically active cell-surface glycoprotein. To investigate tissue CSF-1 regulation, CSF-1-null Csf1(op)/Csf1(op) mice expressing transgenes encoding the full-length membrane-spanning CSF-1 precursor driven by 3.13 kilobases of the mouse CSF-1 promoter and first intron were characterized. Transgene expression corrected the gross osteopetrotic, neurologic, weight, tooth, and reproductive defects of Csf1(op)/Csf1(op) mice. Detailed analysis of one transgenic line revealed that circulating CSF-1, tissue macrophage numbers, hematopoietic tissue cellularity, and hematopoietic parameters were normalized. Tissue CSF-1 levels were normal except for elevations in 4 secretory tissues. Skin fibroblasts from the transgenic mice secreted normal amounts of CSF-1 but also expressed some cell-surface CSF-1. Also, lacZ driven by the same promoter/first intron revealed beta-galactosidase expression in hematopoietic, reproductive, and other tissue locations proximal to CSF-1 cellular targets, consistent with local regulation by CSF-1 at these sites. These studies indicate that the 3.13-kilobase promoter/first intron confers essentially normal CSF-1 expression. They also pinpoint new cellular sites of CSF-1 expression, including ovarian granulosa cells, mammary ductal epithelium, testicular Leydig cells, serous acinar cells of salivary gland, Paneth cells of the small intestine, as well as local sites in several other tissues.

  12. Burn-injury affects gut-associated lymphoid tissues derived CD4+ T cells.

    PubMed

    Fazal, Nadeem; Shelip, Alla; Alzahrani, Alhusain J

    2013-01-01

    After scald burn-injury, the intestinal immune system responds to maintain immune balance. In this regard CD4+T cells in Gut-Associated Lymphoid Tissues (GALT), like mesenteric lymph nodes (MLN) and Peyer's patches (PP) respond to avoid immune suppression following major injury such as burn. Therefore, we hypothesized that the gut CD4+T cells become dysfunctional and turn the immune homeostasis towards depression of CD4+ T cell-mediated adaptive immune responses. In the current study we show down regulation of mucosal CD4+ T cell proliferation, IL-2 production and cell surface marker expression of mucosal CD4+ T cells moving towards suppressive-type. Acute burn-injury lead to up-regulation of regulatory marker (CD25+), down regulation of adhesion (CD62L, CD11a) and homing receptor (CD49d) expression, and up-regulation of negative co-stimulatory (CTLA-4) molecule. Moreover, CD4+CD25+ T cells of intestinal origin showed resistance to spontaneous as well as induced apoptosis that may contribute to suppression of effector CD4+ T cells. Furthermore, gut CD4+CD25+ T cells obtained from burn-injured animals were able to down-regulate naïve CD4+ T cell proliferation following adoptive transfer of burn-injured CD4+CD25+ T cells into sham control animals, without any significant effect on cell surface activation markers. Together, these data demonstrate that the intestinal CD4+ T cells evolve a strategy to promote suppressive CD4+ T cell effector responses, as evidenced by enhanced CD4+CD25+ T cells, up-regulated CTLA-4 expression, reduced IL-2 production, tendency towards diminished apoptosis of suppressive CD4+ T cells, and thus lose their natural ability to regulate immune homeostasis following acute burn-injury and prevent immune paralysis.

  13. Global transcriptomic analysis of model human cell lines exposed to surface-modified gold nanoparticles: the effect of surface chemistry

    NASA Astrophysics Data System (ADS)

    Grzincic, E. M.; Yang, J. A.; Drnevich, J.; Falagan-Lotsch, P.; Murphy, C. J.

    2015-01-01

    Gold nanoparticles (Au NPs) are attractive for biomedical applications not only for their remarkable physical properties, but also for the ease of which their surface chemistry can be manipulated. Many applications involve functionalization of the Au NP surface in order to improve biocompatibility, attach targeting ligands or carry drugs. However, changes in cells exposed to Au NPs of different surface chemistries have been observed, and little is known about how Au NPs and their surface coatings may impact cellular gene expression. The gene expression of two model human cell lines, human dermal fibroblasts (HDF) and prostate cancer cells (PC3) was interrogated by microarray analysis of over 14 000 human genes. The cell lines were exposed to four differently functionalized Au NPs: citrate, poly(allylamine hydrochloride) (PAH), and lipid coatings combined with alkanethiols or PAH. Gene functional annotation categories and weighted gene correlation network analysis were used in order to connect gene expression changes to common cellular functions and to elucidate expression patterns between Au NP samples. Coated Au NPs affect genes implicated in proliferation, angiogenesis, and metabolism in HDF cells, and inflammation, angiogenesis, proliferation apoptosis regulation, survival and invasion in PC3 cells. Subtle changes in surface chemistry, such as the initial net charge, lability of the ligand, and underlying layers greatly influence the degree of expression change and the type of cellular pathway affected.Gold nanoparticles (Au NPs) are attractive for biomedical applications not only for their remarkable physical properties, but also for the ease of which their surface chemistry can be manipulated. Many applications involve functionalization of the Au NP surface in order to improve biocompatibility, attach targeting ligands or carry drugs. However, changes in cells exposed to Au NPs of different surface chemistries have been observed, and little is known about how Au NPs and their surface coatings may impact cellular gene expression. The gene expression of two model human cell lines, human dermal fibroblasts (HDF) and prostate cancer cells (PC3) was interrogated by microarray analysis of over 14 000 human genes. The cell lines were exposed to four differently functionalized Au NPs: citrate, poly(allylamine hydrochloride) (PAH), and lipid coatings combined with alkanethiols or PAH. Gene functional annotation categories and weighted gene correlation network analysis were used in order to connect gene expression changes to common cellular functions and to elucidate expression patterns between Au NP samples. Coated Au NPs affect genes implicated in proliferation, angiogenesis, and metabolism in HDF cells, and inflammation, angiogenesis, proliferation apoptosis regulation, survival and invasion in PC3 cells. Subtle changes in surface chemistry, such as the initial net charge, lability of the ligand, and underlying layers greatly influence the degree of expression change and the type of cellular pathway affected. Electronic supplementary information (ESI) available: UV-Vis spectra of Au NPs, the most significantly changed genes of HDF cells after Au NP incubation under GO accession number GO:0007049 ``cell cycle'', detailed information about the primer/probe sets used for RT-PCR validation of results. See DOI: 10.1039/c4nr05166a

  14. Proteomic Plasma Membrane Profiling Reveals an Essential Role for gp96 in the Cell Surface Expression of LDLR Family Members, Including the LDL Receptor and LRP6

    PubMed Central

    2012-01-01

    The endoplasmic reticulum chaperone gp96 is required for the cell surface expression of a narrow range of proteins, including toll-like receptors (TLRs) and integrins. To identify a more comprehensive repertoire of proteins whose cell surface expression is dependent on gp96, we developed plasma membrane profiling (PMP), a technique that combines SILAC labeling with selective cell surface aminooxy-biotinylation. This approach allowed us to compare the relative abundance of plasma membrane (PM) proteins on gp96-deficient versus gp96-reconstituted murine pre-B cells. Analysis of unfractionated tryptic peptides initially identified 113 PM proteins, which extended to 706 PM proteins using peptide prefractionation. We confirmed a requirement for gp96 in the cell surface expression of certain TLRs and integrins and found a marked decrease in cell surface expression of four members of the extended LDL receptor family (LDLR, LRP6, Sorl1 and LRP8) in the absence of gp96. Other novel gp96 client proteins included CD180/Ly86, important in the B-cell response to lipopolysaccharide. We highlight common structural motifs in these client proteins that may be recognized by gp96, including the beta-propeller and leucine-rich repeat. This study therefore identifies the extended LDL receptor family as an important new family of proteins whose cell surface expression is regulated by gp96. PMID:22292497

  15. Proteomic plasma membrane profiling reveals an essential role for gp96 in the cell surface expression of LDLR family members, including the LDL receptor and LRP6.

    PubMed

    Weekes, Michael P; Antrobus, Robin; Talbot, Suzanne; Hör, Simon; Simecek, Nikol; Smith, Duncan L; Bloor, Stuart; Randow, Felix; Lehner, Paul J

    2012-03-02

    The endoplasmic reticulum chaperone gp96 is required for the cell surface expression of a narrow range of proteins, including toll-like receptors (TLRs) and integrins. To identify a more comprehensive repertoire of proteins whose cell surface expression is dependent on gp96, we developed plasma membrane profiling (PMP), a technique that combines SILAC labeling with selective cell surface aminooxy-biotinylation. This approach allowed us to compare the relative abundance of plasma membrane (PM) proteins on gp96-deficient versus gp96-reconstituted murine pre-B cells. Analysis of unfractionated tryptic peptides initially identified 113 PM proteins, which extended to 706 PM proteins using peptide prefractionation. We confirmed a requirement for gp96 in the cell surface expression of certain TLRs and integrins and found a marked decrease in cell surface expression of four members of the extended LDL receptor family (LDLR, LRP6, Sorl1 and LRP8) in the absence of gp96. Other novel gp96 client proteins included CD180/Ly86, important in the B-cell response to lipopolysaccharide. We highlight common structural motifs in these client proteins that may be recognized by gp96, including the beta-propeller and leucine-rich repeat. This study therefore identifies the extended LDL receptor family as an important new family of proteins whose cell surface expression is regulated by gp96.

  16. CD4-CCR5 interaction in intracellular compartments contributes to receptor expression at the cell surface

    PubMed Central

    Achour, Lamia; Scott, Mark G.H.; Shirvani, Hamasseh; Thuret, Alain; Bismuth, Georges; Labbé-Jullié, Catherine; Marullo, Stefano

    2009-01-01

    The association of CD4, a glycoprotein involved in T cell development and antigen recognition, and CCR5, a chemotactic G protein-coupled receptor, which regulates trafficking and effector functions of immune cells, forms the main receptor for the human immunodeficiency virus HIV. We observed that the vast majority of CCR5 is maintained within the intracellular compartments of primary T lymphocytes and in a monocytic cell line, contrasting with its relative low density at the cell surface. The CCR5-CD4 association, which occurs in the endoplasmic reticulum, enhanced CCR5 export to the plasma membrane in a concentration–dependent manner, whereas inhibition of endogenous CD4 with small interfering RNAs decreased cell surface expression of endogenous CCR5. This effect was specific for CCR5, as CD4 did not affect cell distribution of CXCR4, the other HIV co-receptor. These results reveal a previously unappreciated role of CD4, which contributes to regulate CCR5 export to the plasma membrane. PMID:19064722

  17. Gonadotropin-Releasing Hormone Regulates Expression of the DNA Damage Repair Gene, Fanconi anemia A, in Pituitary Gonadotroph Cells1

    PubMed Central

    Larder, Rachel; Chang, Lynda; Clinton, Michael; Brown, Pamela

    2007-01-01

    Gonadal function is critically dependant on regulated secretion of the gonadotropin hormones from anterior pituitary gonadotroph cells. Gonadotropin biosynthesis and release is triggered by the binding of hypothalamic GnRH to GnRH receptor expressed on the gonadotroph cell surface. The repertoire of regulatory molecules involved in this process are still being defined. We used the mouse LβT2 gonadotroph cell line, which expresses both gonadotropin hormones, as a model to investigate GnRH regulation of gene expression and differential display reverse transcription-polymerase chain reaction (RT-PCR) to identify and isolate hormonally induced changes. This approach identified Fanconi anemia a (Fanca), a gene implicated in DNA damage repair, as a differentially expressed transcript. Mutations in Fanca account for the majority of cases of Fanconi anemia (FA), a recessively inherited disease identified by congenital defects, bone marrow failure, infertility, and cancer susceptibility. We confirmed expression and hormonal regulation of Fanca mRNA by quantitative RT-PCR, which showed that GnRH induced a rapid, transient increase in Fanca mRNA. Fanca protein was also acutely upregulated after GnRH treatment of LβT2 cells. In addition, Fanca gene expression was confined to mature pituitary gonadotrophs and adult mouse pituitary and was not expressed in the immature αT3-1 gonadotroph cell line. Thus, this study extends the expression profile of Fanca into a highly specialized endocrine cell and demonstrates hormonal regulation of expression of the Fanca locus. We suggest that this regulatory mechanism may have a crucial role in the GnRH-response mechanism of mature gonadotrophs and perhaps the etiology of FA. PMID:15128600

  18. Gonadotropin-releasing hormone regulates expression of the DNA damage repair gene, Fanconi anemia A, in pituitary gonadotroph cells.

    PubMed

    Larder, Rachel; Chang, Lynda; Clinton, Michael; Brown, Pamela

    2004-09-01

    Gonadal function is critically dependant on regulated secretion of the gonadotropin hormones from anterior pituitary gonadotroph cells. Gonadotropin biosynthesis and release is triggered by the binding of hypothalamic GnRH to GnRH receptor expressed on the gonadotroph cell surface. The repertoire of regulatory molecules involved in this process are still being defined. We used the mouse L beta T2 gonadotroph cell line, which expresses both gonadotropin hormones, as a model to investigate GnRH regulation of gene expression and differential display reverse transcription-polymerase chain reaction (RT-PCR) to identify and isolate hormonally induced changes. This approach identified Fanconi anemia a (Fanca), a gene implicated in DNA damage repair, as a differentially expressed transcript. Mutations in Fanca account for the majority of cases of Fanconi anemia (FA), a recessively inherited disease identified by congenital defects, bone marrow failure, infertility, and cancer susceptibility. We confirmed expression and hormonal regulation of Fanca mRNA by quantitative RT-PCR, which showed that GnRH induced a rapid, transient increase in Fanca mRNA. Fanca protein was also acutely upregulated after GnRH treatment of L beta T2 cells. In addition, Fanca gene expression was confined to mature pituitary gonadotrophs and adult mouse pituitary and was not expressed in the immature alpha T3-1 gonadotroph cell line. Thus, this study extends the expression profile of Fanca into a highly specialized endocrine cell and demonstrates hormonal regulation of expression of the Fanca locus. We suggest that this regulatory mechanism may have a crucial role in the GnRH-response mechanism of mature gonadotrophs and perhaps the etiology of FA.

  19. Cell surface GRP78 facilitates hepatoma cells proliferation and migration by activating IGF-IR.

    PubMed

    Yin, Yancun; Chen, Chen; Chen, Jinliang; Zhan, Renhui; Zhang, Qiang; Xu, Xiaoyan; Li, Defang; Li, Minjing

    2017-07-01

    The 78kDa glucose regulated protein (GRP78) is a multifunctional chaperone that is involved in a variety of cellular processes. Insulin like growth factor I receptor (IGF-IR) often aberrant expresses in many types of tumor cells. The IGF-IR signaling plays key roles in carcinogenesis and maintenance of the malignant phenotype. The crosstalk between GRP78 and IGF-IR molecules has not well been illuminated. Here, we demonstrated a reciprocal regulation of GRP78 expression and IGF-IR pathway activation. IGF-I induced GRP78 expression in hepatoma cells. IGF-IR knockdown or IGF-IR inhibitor repressed GRP78 expression. Both phosphatidylinositol 3-kianase (PI3K) and mitogen-activated protein kinase (MAPK) pathways involved in IGF-I induction of GRP78 expression. Interestingly, treatment of hepatoma cells with IGF-I re-distributes GRP78 from endoplasmic reticulum (ER) to cell surface and promotes its physical interaction with IGF-IR. Also, GRP78 promotes IGF-IR phosphorylation and activation. Blocked of GRP78 by small interfering RNA or inhibition of GRP78 function by (-)-epigallocatechin gallate (EGCG) blocks IGF-I induced IGF-IR phosphorylation and its downstream signaling. Further, blocked cell surface GRP78 with antibody inhibits IGF-I stimulated cellular proliferation and migration. These data reveal an essential role for the molecular chaperone GRP78 in IGF-IR signaling and implicate the use of GRP78 inhibitors in blocking IGF-IR signaling in hepatoma cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Acquisition of negative complement regulators by the saprophyte Leptospira biflexa expressing LigA or LigB confers enhanced survival in human serum

    PubMed Central

    Castiblanco-Valencia, Mónica M.; Fraga, Tatiana R.; Breda, Leandro C.D.; Vasconcellos, Sílvio A.; Figueira, Cláudio P.; Picardeau, Mathieu; Wunder, Elsio; Ko, Albert I.; Barbosa, Angela S.; Isaac, Lourdes

    2017-01-01

    Leptospiral immunoglobulin-like (Lig) proteins are surface exposed molecules present in pathogenic but not in saprophytic Leptospira species. We have previously shown that Lig proteins interact with the soluble complement regulators Factor H (FH), FH like-1 (FHL-1), FH related-1 (FHR-1) and C4b Binding Protein (C4BP). In this study, we used the saprophyte L. biflexa serovar Patoc as a surrogate host to address the specific role of LigA and LigB proteins in leptospiral complement evasion. L. biflexa expressing LigA or LigB was able to acquire FH and C4BP. Bound complement regulators retained their cofactor activities of FI in the proteolytic cleavage of C3b and C4b. Moreover, heterologous expression of ligA and ligB genes in the saprophyte L. biflexa enhanced bacterial survival in human serum. Complement deposition on lig-transformed L. biflexa was assessed by flow cytometry analysis. With regard to MAC deposition, L. biflexa expressing LigA or LigB presented an intermediate profile: MAC deposition levels were greater than those found in the pathogenic L. interrogans, but lower than those observed for L. biflexa wildtype. In conclusion, Lig proteins contribute to in vitro control of complement activation on the leptospiral surface, promoting an increased bacterial survival in human serum. PMID:26976804

  1. Differential Expression of Osteo-Modulatory Molecules in Periodontal Ligament Stem Cells in Response to Modified Titanium Surfaces

    PubMed Central

    Kim, So Yeon; Yoo, Ji-Yeon; Ohe, Joo-Young; Lee, Jung-Woo; Moon, Ji-Hoi; Kwon, Yong-Dae; Heo, Jung Sun

    2014-01-01

    This study assessed differential gene expression of signaling molecules involved in osteogenic differentiation of periodontal ligament stem cells (PDLSCs) subjected to different titanium (Ti) surface types. PDLSCs were cultured on tissue culture polystyrene (TCPS), and four types of Ti discs (PT, SLA, hydrophilic PT (pmodPT), and hydrophilic SLA (modSLA)) with no osteoinductive factor and then osteogenic activity, including alkaline phosphatase (ALP) activity, mRNA expression of runt-related gene 2, osterix, FOSB, FRA1, and protein levels of osteopontin and collagen type IA, were examined. The highest osteogenic activity appeared in PDLSCs cultured on SLA, compared with the TCPS and other Ti surfaces. The role of surface properties in affecting signaling molecules to modulate PDLSC behavior was determined by examining the regulation of Wnt pathways. mRNA expression of the canonical Wnt signaling molecules, Wnt3a and β-catenin, was higher on SLA and modSLA than on smooth surfaces, but gene expression of the calcium-dependent Wnt signaling molecules Wnt5a, calmodulin, and NFATc1 was increased significantly on PT and pmodPT. Moreover, integrin α2/β1, sonic hedgehog, and Notch signaling molecules were affected differently by each surface modification. In conclusion, surface roughness and hydrophilicity can affect differential Wnt pathways and signaling molecules, targeting the osteogenic differentiation of PDLSCs. PMID:25057487

  2. Differential expression of osteo-modulatory molecules in periodontal ligament stem cells in response to modified titanium surfaces.

    PubMed

    Kim, So Yeon; Yoo, Ji-Yeon; Ohe, Joo-Young; Lee, Jung-Woo; Moon, Ji-Hoi; Kwon, Yong-Dae; Heo, Jung Sun

    2014-01-01

    This study assessed differential gene expression of signaling molecules involved in osteogenic differentiation of periodontal ligament stem cells (PDLSCs) subjected to different titanium (Ti) surface types. PDLSCs were cultured on tissue culture polystyrene (TCPS), and four types of Ti discs (PT, SLA, hydrophilic PT (pmodPT), and hydrophilic SLA (modSLA)) with no osteoinductive factor and then osteogenic activity, including alkaline phosphatase (ALP) activity, mRNA expression of runt-related gene 2, osterix, FOSB, FRA1, and protein levels of osteopontin and collagen type IA, were examined. The highest osteogenic activity appeared in PDLSCs cultured on SLA, compared with the TCPS and other Ti surfaces. The role of surface properties in affecting signaling molecules to modulate PDLSC behavior was determined by examining the regulation of Wnt pathways. mRNA expression of the canonical Wnt signaling molecules, Wnt3a and β-catenin, was higher on SLA and modSLA than on smooth surfaces, but gene expression of the calcium-dependent Wnt signaling molecules Wnt5a, calmodulin, and NFATc1 was increased significantly on PT and pmodPT. Moreover, integrin α2/β1, sonic hedgehog, and Notch signaling molecules were affected differently by each surface modification. In conclusion, surface roughness and hydrophilicity can affect differential Wnt pathways and signaling molecules, targeting the osteogenic differentiation of PDLSCs.

  3. Gene expression of cell surface antigens in the early phase of murine influenza pneumonia determined by a cDNA expression array technique.

    PubMed

    Sakai, Shinya; Mantani, Naoki; Kogure, Toshiaki; Ochiai, Hiroshi; Shimada, Yutaka; Terasawa, Katsutoshi

    2002-12-01

    Influenza virus is a worldwide health problem with significant economic consequences. To study the gene expression pattern induced by influenza virus infection, it is useful to reveal the pathogenesis of influenza virus infection; but this has not been well examined, especially in vivo study. To assess the influence of influenza virus infection on gene expression in mice, mRNA levels in the lung and tracheal tissue 48 h after infection were investigated by cDNA array analysis. Four-week-old outbred, specific pathogen free strain, ICR female mice were infected by intra-nasal inoculation of a virus solution under ether anesthesia. The mice were sacrificed 48 h after infection and the tracheas and lungs were removed. To determine gene expression, the membrane-based microtechnique with an Atlas cDNA expression array (mouse 1.2 array II) was performed in accordance with the manual provided. We focused on the expression of 46 mRNAs for cell surface antigens. Of these 46 mRNAs that we examined, four (CD1d2 antigen, CD39 antigen-like 1, CD39 antigen-like 3, CD68 antigen) were up-regulated and one (CD36 antigen) was down-regulated. Although further studies are required, these data suggest that these molecules play an important role in influenza virus infection, especially the phase before specific immunity.

  4. Differential regulation of membrane-associated mucins in the human ocular surface epithelium.

    PubMed

    Hori, Yuichi; Spurr-Michaud, Sandra; Russo, Cindy Leigh; Argüeso, Pablo; Gipson, Ilene K

    2004-01-01

    Membrane-associated mucins present in the apical cells of the ocular surface epithelium (MUC1, -4, and -16) are believed to contribute to the maintenance of a hydrated and wet-surfaced epithelial phenotype. Serum and retinoic acid (RA) have been used to treat drying ocular surface diseases. The goal of this study was to determine whether serum or RA regulates the production of membrane-associated mucins in human conjunctival epithelial cells. A telomerase-immortalized human conjunctival epithelial cell line (HCjE) was used. Cells were cultured in serum-free medium to confluence and then cultured with either 10% calf serum or with 100 nM RA for 0 to 72 hours. Conventional RT-PCR was used to determine the expression of retinoic acid receptors (RARs) and quantitative real-time PCR was used to investigate the mRNA expression of MUC1, -4, and -16. Protein levels were assayed by immunoblot analysis, using the antibodies HMFG-2, 1G8, or OC125, which are specific to MUC1, -4 and -16, respectively. To determine whether RA-associated MUC4 mRNA induction is a direct or indirect effect, HCjE cells were treated with RA and the protein synthesis inhibitor cycloheximide (1.0 microg/mL) for 12 hours. MUC1 and -16, but not -4, mRNAs were detectable in HCjE cells grown in serum-free medium. Real-time PCR revealed that MUC4 mRNA was significantly induced by serum 3 hours after its addition, and that MUC1 and MUC16 mRNA levels were significantly upregulated at 72 hours. Western blot analysis demonstrated that the MUC1, -4, and -16 proteins increased over time after addition of serum. Conventional RT-PCR analysis demonstrated that RAR-alpha and -gamma mRNA were expressed in native human conjunctival tissue as well as in the HCjE cells. Treatment with RA upregulated the expression of both MUC4 and -16 mRNA and protein, but MUC1 was unaffected. Because the protein synthesis inhibitor cycloheximide did not prevent the RA-associated induction of MUC4 mRNA, the action of RA on the MUC4 promoter may be direct. The membrane-associated mucins of the ocular surface epithelia, MUC1, -4, and -16, are differentially regulated by serum and RA in the telomerase-immortalized human conjunctival epithelial cell line. Serum derived from vessels in the conjunctiva may play an important role in mucin regulation in the ocular surface epithelia. These data also support the clinical efficacy of autologous serum and RA application in patients with ocular surface diseases. Furthermore, the data suggest that MUC4 and -16 are particularly important hydrophilic molecules involved in maintenance of a healthy ocular surface.

  5. Gene expression profile in mesenchymal stem cells derived from dental tissues and bone marrow

    PubMed Central

    Kim, Su-Hwan; Kim, Young-Sung; Lee, Su-Yeon; Kim, Kyoung-Hwa; Lee, Yong-Moo; Kim, Won-Kyung

    2011-01-01

    Purpose The aim of this study is to compare the gene expression profile in mesenchymal stem cells derived from dental tissues and bone marrow for characterization of dental stem cells. Methods We employed GeneChip analysis to the expression levels of approximately 32,321 kinds of transcripts in 5 samples of bone-marrow-derived mesenchymal stem cells (BMSCs) (n=1), periodontal ligament stem cells (PDLSCs) (n=2), and dental pulp stem cells (DPSCs) (n=2). Each cell was sorted by a FACS Vantage Sorter using immunocytochemical staining of the early mesenchymal stem cell surface marker STRO-1 before the microarray analysis. Results We identified 379 up-regulated and 133 down-regulated transcripts in BMSCs, 68 up-regulated and 64 down-regulated transcripts in PDLSCs, and 218 up-regulated and 231 down-regulated transcripts in DPSCs. In addition, anatomical structure development and anatomical structure morphogenesis gene ontology (GO) terms were over-represented in all three different mesenchymal stem cells and GO terms related to blood vessels, and neurons were over-represented only in DPSCs. Conclusions This study demonstrated the genome-wide gene expression patterns of STRO-1+ mesenchymal stem cells derived from dental tissues and bone marrow. The differences among the expression profiles of BMSCs, PDLSCs, and DPSCs were shown, and 999 candidate genes were found to be definitely up- or down-regulated. In addition, GOstat analyses of regulated gene products provided over-represented GO classes. These data provide a first step for discovering molecules key to the characteristics of dental stem cells. PMID:21954424

  6. Targeting Prostate Cancer Stemlike Cells through Cell Surface Expressed GRP78

    DTIC Science & Technology

    2016-12-01

    NOTES 14. ABSTRACT This study investigated a function for cell surface GRP78 in regulating prostate cancer stem -like cells . In year 1, we showed that...enrichment of cell surface GRP78+ cancer stem like cells in sphere culture. We also showed that the signaling axis activated by cell surface GRP78 is...but not the GRP78(-) cells , exhibited cancer stem -like cell behavior. Furthermore an GRP78 monoclonal antibody inhibited sphere forming ability of

  7. Changes in root hydraulic conductivity facilitate the overall hydraulic response of rice (Oryza sativa L.) cultivars to salt and osmotic stress.

    PubMed

    Meng, Delong; Fricke, Wieland

    2017-04-01

    The aim of the present work was to assess the significance of changes in root AQP gene expression and hydraulic conductivity (Lp) in the regulation of water balance in two hydroponically-grown rice cultivars (Azucena, Bala) which differ in root morphology, stomatal regulation and aquaporin (AQP) isoform expression. Plants were exposed to NaCl (25 mM, 50 mM) and osmotic stress (5%, 10% PEG6000). Root Lp was determined for exuding root systems (osmotic forces driving water uptake; 'exudation Lp') and transpiring plants (hydrostatic forces dominating; 'transpiration-Lp'). Gene expression was analysed by qPCR. Stress treatments caused a consistent and significant decrease in plant growth, transpirational water loss, stomatal conductance, shoot-to-root surface area ratio and root Lp. Comparison of exudation-with transpiration-Lp supported a significant contribution of AQP-facilitated water flow to root water uptake. Changes in root Lp in response to treatments were correlated much stronger with root morphological characteristics, such as the number of main and lateral roots, surface area ratio of root to shoot and plant transpiration rate than with AQP gene expression. Changes in root Lp, involving AQP function, form an integral part of the plant hydraulic response to stress and facilitate changes in the root-to-shoot surface area ratio, transpiration and stomatal conductance. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. CD44 staining of cancer stem-like cells is influenced by down-regulation of CD44 variant isoforms and up-regulation of the standard CD44 isoform in the population of cells that have undergone epithelial-to-mesenchymal transition.

    PubMed

    Biddle, Adrian; Gammon, Luke; Fazil, Bilal; Mackenzie, Ian C

    2013-01-01

    CD44 is commonly used as a cell surface marker of cancer stem-like cells in epithelial tumours, and we have previously demonstrated the existence of two different CD44(high) cancer stem-like cell populations in squamous cell carcinoma, one having undergone epithelial-to-mesenchymal transition and the other maintaining an epithelial phenotype. Alternative splicing of CD44 variant exons generates a great many isoforms, and it is not known which isoforms are expressed on the surface of the two different cancer stem-like cell phenotypes. Here, we demonstrate that cancer stem-like cells with an epithelial phenotype predominantly express isoforms containing the variant exons, whereas the cancer stem-like cells that have undergone an epithelial-to-mesenchymal transition down-regulate these variant isoforms and up-regulate expression of the standard CD44 isoform that contains no variant exons. In addition, we find that enzymatic treatments used to dissociate cells from tissue culture or fresh tumour specimens cause destruction of variant CD44 isoforms at the cell surface whereas expression of the standard CD44 isoform is preserved. This results in enrichment within the CD44(high) population of cancer stem-like cells that have undergone an epithelial-to-mesenchymal transition and depletion from the CD44(high) population of cancer stem-like cells that maintain an epithelial phenotype, and therefore greatly effects the characteristics of any cancer stem-like cell population isolated based on expression of CD44. As well as effecting the CD44(high) population, enzymatic treatment also reduces the percentage of the total epithelial cancer cell population staining CD44-positive, with potential implications for studies that aim to use CD44-positive staining as a prognostic indicator. Analyses of the properties of cancer stem-like cells are largely dependent on the ability to accurately identify and assay these populations. It is therefore critical that consideration be given to use of multiple cancer stem-like cell markers and suitable procedures for cell isolation in order that the correct populations are assayed.

  9. RACK1 interacts with filamin-A to regulate plasma membrane levels of the cystic fibrosis transmembrane conductance regulator

    PubMed Central

    Smith, Laura; Litman, Paul; Kohli, Ekta; Amick, Joseph; Page, Richard C.; Misra, Saurav

    2013-01-01

    Mutations in cystic fibrosis transmembrane regulator (CFTR), a chloride channel in the apical membranes of secretory epithelial cells, underlie the fatal genetic disorder cystic fibrosis. Certain CFTR mutations, including the common mutation ΔF508-CFTR, result in greatly decreased levels of active CFTR at the apical membrane. Direct interactions between CFTR and the cytoskeletal adaptors filamin-A (FlnA) and Na+/H+ exchanger regulatory factor 1 (NHERF1) stabilize the expression and localization of CFTR at the plasma membrane. The scaffold protein receptor for activated C kinase 1 (RACK1) also stabilizes CFTR surface expression; however, RACK1 does not interact directly with CFTR and its mechanism of action is unknown. In the present study, we report that RACK1 interacts directly with FlnA in vitro and in a Calu-3 airway epithelial cell line. We mapped the interaction between RACK1 and FlnA to the WD4 and WD6 repeats of RACK1 and to a segment of the large rod domain of FlnA, consisting of immunoglobulin-like repeats 8–15. Disruption of the RACK1-FlnA interaction causes a reduction in CFTR surface levels. Our results suggest that a novel RACK1-FlnA interaction is an important regulator of CFTR surface localization. PMID:23636454

  10. Activation of p44/42 in Human Natural Killer Cells Decreases Cell-surface Protein Expression: Relationship to Tributyltin-induced alterations of protein expression

    PubMed Central

    Dudimah, Fred D.; Abraha, Abraham; Wang, Xiaofei; Whalen, Margaret M.

    2010-01-01

    Tributyltin (TBT) activates the mitogen activated protein kinase (MAPK), p44/42 in human natural killer (NK) cells. TBT also reduces NK cytotoxic function and decreases the expression of several NK-cell proteins. To understand the role that p44/42 activation plays in TBT-induced loss of NK cell function, we have investigated how selective activation of p44/42 by phorbol 12-myristate 13-acetate (PMA) affects NK cells. Previously we showed that PMA caused losses of lytic function similar to those seen with TBT exposures. Here we examined activation of p44/42 in the regulation of NK-cell protein expression and how this regulation may explain the protein expression changes seen with TBT exposures. NK cells exposed to PMA were examined for levels of cell-surface proteins, granzyme mRNA, and perforin mRNA expression. The expression of CD11a, CD16, CD18, and CD56 were reduced, perforin mRNA levels were unchanged and granzyme mRNA levels were increased. To verify that activation of p44/42 was responsible for the alterations seen in CD11a, CD16, CD18, and CD56 with PMA, NK cells were treated with the p44/42 pathway inhibitor (PD98059) prior to PMA exposures. In the presence of PD98059, PMA caused no decreases in the expression of the cell-surface proteins. Results of these studies indicate that the activation of p44/42 may lead to the loss of NK cell cytotoxic function by decreasing the expression of CD11a, CD16, CD18, and CD56. Further, activation of p44/42 appears to be at least in part responsible for the TBT-induced decreases in expression of CD16, CD18, and CD56. PMID:20883105

  11. Distinct mechanisms underlie adaptation of proximal tubule Na+/H+ exchanger isoform 3 in response to chronic metabolic and respiratory acidosis.

    PubMed

    Silva, Pedro Henrique Imenez; Girardi, Adriana Castello Costa; Neri, Elida Adalgisa; Rebouças, Nancy Amaral

    2012-04-01

    The Na(+/)H(+) exchanger isoform 3 (NHE3) is essential for HCO(3)(-) reabsorption in renal proximal tubules. The expression and function of NHE3 must adapt to acid-base conditions. The goal of this study was to elucidate the mechanisms responsible for higher proton secretion in proximal tubules during acidosis and to evaluate whether there are differences between metabolic and respiratory acidosis with regard to NHE3 modulation and, if so, to identify the relevant parameters that may trigger these distinct adaptive responses. We achieved metabolic acidosis by lowering HCO(3)(-) concentration in the cell culture medium and respiratory acidosis by increasing CO(2) tension in the incubator chamber. We found that cell-surface NHE3 expression was increased in response to both forms of acidosis. Mild (pH 7.21 ± 0.02) and severe (6.95 ± 0.07) metabolic acidosis increased mRNA levels, at least in part due to up-regulation of transcription, whilst mild (7.11 ± 0.03) and severe (6.86 ± 0.01) respiratory acidosis did not up-regulate NHE3 expression. Analyses of the Nhe3 promoter region suggested that the regulatory elements sensitive to metabolic acidosis are located between -466 and -153 bp, where two consensus binding sites for SP1, a transcription factor up-regulated in metabolic acidosis, were localised. We conclude that metabolic acidosis induces Nhe3 promoter activation, which results in higher mRNA and total protein level. At the plasma membrane surface, NHE3 expression was increased in metabolic and respiratory acidosis alike, suggesting that low pH is responsible for NHE3 displacement to the cell surface.

  12. Developmentally Regulated Expression of the Nerve Growth Factor Receptor Gene in the Periphery and Brain

    NASA Astrophysics Data System (ADS)

    Buck, C. R.; Martinez, Humberto J.; Black, Ira B.; Chao, Moses V.

    1987-05-01

    Nerve growth factor (NGF) regulates development and maintenance of function of peripheral sympathetic and sensory neurons. A potential role for the trophic factor in brain has been detected only recently. The ability of a cell to respond to NGF is due, in part, to expression of specific receptors on the cell surface. To study tissue-specific expression of the NGF receptor gene, we have used sensitive cRNA probes for detection of NGF receptor mRNA. Our studies indicate that the receptor gene is selectively and specifically expressed in sympathetic (superior cervical) and sensory (dorsal root) ganglia in the periphery, and by the septum-basal forebrain centrally, in the neonatal rat in vivo. Moreover, examination of tissues from neonatal and adult rats reveals a marked reduction in steady-state NGF receptor mRNA levels in sensory ganglia. In contrast, a 2- to 4-fold increase was observed in the basal forebrain and in the sympathetic ganglia over the same time period. Our observations suggest that NGF receptor mRNA expression is developmentally regulated in specific areas of the nervous system in a differential fashion.

  13. Regulation of expression of the ligand for CD40 on T helper lymphocytes.

    PubMed

    Castle, B E; Kishimoto, K; Stearns, C; Brown, M L; Kehry, M R

    1993-08-15

    Activated Th cells deliver contact-dependent signals to resting B lymphocytes that initiate and drive B cell proliferation. Recently, a ligand for the B lymphocyte membrane protein, CD40, has been identified that delivers contact-dependent Th cell signals to B cells. A dimeric soluble form of CD40 was produced and used to further characterize the regulation of expression of the CD40 ligand. Expression of the CD40 ligand was rapidly induced after Th lymphocyte activation, and its stability depended upon whether Th cells were activated with soluble or plastic-bound stimuli. Th cells activated with soluble stimuli rapidly turned over cell-surface CD40 ligand whereas Th cells activated with plastic-bound stimuli exhibited more stable CD40 ligand expression for up to 48 h. Removal of activated Th cells from the plastic-bound stimulus resulted in a rapid turnover of CD40 ligand, suggesting that continuous stimulation could maintain CD40 ligand expression. Ligation by soluble CD40 could also stabilize expression of CD40 ligand on the Th cell surface. Both CD40 ligand and IL-2 were transiently synthesized from 1 to 12 h after Th cell activation and had similar kinetics of synthesis. In Con A-activated Th cells newly synthesized CD40 ligand exhibited an initial high turnover (1.5 h t1/2) and after 5 h of Th cell activation became more stable (10-h t1/2). In Th cells activated with plastic-bound anti-CD3, CD40 ligand exhibited a similar biphasic turnover except that the rapid turnover phase began significantly later. This delay could allow more time for newly synthesized CD40 ligand to assemble or associate with other molecules and thus become stabilized on the cell surface. Newly synthesized CD40 ligand in Con A-activated Th cells appeared to not be efficient in delivering Th cell-dependent contact signals to resting B cells, implying the need for assembly or accessory proteins. Regulation of CD40 ligand expression was consistent with all the characteristics of Th cell-delivered contact signals to B cells and may contribute to the high degree of specificity in B cell responses.

  14. The Nuclear Pore-Associated TREX-2 Complex Employs Mediator to Regulate Gene Expression

    PubMed Central

    Schneider, Maren; Hellerschmied, Doris; Schubert, Tobias; Amlacher, Stefan; Vinayachandran, Vinesh; Reja, Rohit; Pugh, B. Franklin; Clausen, Tim; Köhler, Alwin

    2015-01-01

    Summary Nuclear pore complexes (NPCs) influence gene expression besides their established function in nuclear transport. The TREX-2 complex localizes to the NPC basket and affects gene-NPC interactions, transcription, and mRNA export. How TREX-2 regulates the gene expression machinery is unknown. Here, we show that TREX-2 interacts with the Mediator complex, an essential regulator of RNA Polymerase (Pol) II. Structural and biochemical studies identify a conserved region on TREX-2, which directly binds the Mediator Med31/Med7N submodule. TREX-2 regulates assembly of Mediator with the Cdk8 kinase and is required for recruitment and site-specific phosphorylation of Pol II. Transcriptome and phenotypic profiling confirm that TREX-2 and Med31 are functionally interdependent at specific genes. TREX-2 additionally uses its Mediator-interacting surface to regulate mRNA export suggesting a mechanism for coupling transcription initiation and early steps of mRNA processing. Our data provide mechanistic insight into how an NPC-associated adaptor complex accesses the core transcription machinery. PMID:26317468

  15. Regulation of fibrillins and modulators of TGFβ in fetal bovine and human ovaries.

    PubMed

    Bastian, Nicole A; Bayne, Rosemary A; Hummitzsch, Katja; Hatzirodos, Nicholas; Bonner, Wendy M; Hartanti, Monica D; Irving-Rodgers, Helen F; Anderson, Richard A; Rodgers, Raymond J

    2016-08-01

    Fibrillins 1-3 are stromal extracellular matrix proteins that play important roles in regulating TGFβ activity, which stimulates fibroblasts to proliferate and synthesize collagen. In the developing ovary, the action of stroma is initially necessary for the formation of ovigerous cords and subsequently for the formation of follicles and the surface epithelium of the ovary. FBN3 is highly expressed only in early ovarian development and then it declines. In contrast, FBN1 and 2 are upregulated in later ovarian development. We examined the expression of FBN1-3 in bovine and human fetal ovaries. We used cell dispersion and monolayer culture, cell passaging and tissue culture. Cells were treated with growth factors, hormones or inhibitors to assess the regulation of expression of FBN1-3 When bovine fetal ovarian tissue was cultured, FBN3 expression declined significantly. Treatment with TGFβ-1 increased FBN1 and FBN2 expression in bovine fibroblasts, but did not affect FBN3 expression. Additionally, in cultures of human fetal ovarian fibroblasts (9-17weeks gestational age), the expression of FBN1 and FBN2 increased with passage, whereas FBN3 dramatically decreased. Treatment with activin A and a TGFβ family signaling inhibitor, SB431542, differentially regulated the expression of a range of modulators of TGFβ signaling and of other growth factors in cultured human fetal ovarian fibroblasts suggesting that TGFβ signaling is differentially involved in the regulation of ovarian fibroblasts. Additionally, since the changes in FBN1-3 expression that occur in vitro are those that occur with increasing gestational age in vivo, we suggest that the fetal ovarian fibroblasts mature in vitro. © 2016 Society for Reproduction and Fertility.

  16. Tetraspanin CD9 modulates human lymphoma cellular proliferation via histone deacetylase activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herr, Michael J.; Department of Medicine, The University of Tennessee Health Science Center, Memphis, TN 38163; Department of Molecular Sciences, The University of Tennessee Health Science Center, Memphis, TN 38163

    2014-05-16

    Highlights: • CD9 is differentially expressed in human Burkitt’s lymphoma cells. • We found that CD9 expression promotes these cells proliferation. • CD9 expression also increases HDAC activity. • HDAC inhibition decreased both cell proliferation and importantly CD9 expression. • CD9 may dictate HDAC efficacy and play a role in HDAC regulation. - Abstract: Non-Hodgkin Lymphoma (NHL) is a type of hematological malignancy that affects two percent of the overall population in the United States. Tetraspanin CD9 is a cell surface protein that has been thoroughly demonstrated to be a molecular facilitator of cellular phenotype. CD9 expression varies in twomore » human lymphoma cell lines, Raji and BJAB. In this report, we investigated the functional relationship between CD9 and cell proliferation regulated by histone deacetylase (HDAC) activity in these two cell lines. Introduction of CD9 expression in Raji cells resulted in significantly increased cell proliferation and HDAC activity compared to Mock transfected Raji cells. The increase in CD9–Raji cell proliferation was significantly inhibited by HDAC inhibitor (HDACi) treatment. Pretreatment of BJAB cells with HDAC inhibitors resulted in a significant decrease in endogenous CD9 mRNA and cell surface expression. BJAB cells also displayed decreased cell proliferation after HDACi treatment. These results suggest a significant relationship between CD9 expression and cell proliferation in human lymphoma cells that may be modulated by HDAC activity.« less

  17. Correlation of the expression of YY1 and Fas cell surface death receptor with apoptosis of peripheral blood mononuclear cells, and the development of multiple organ dysfunction in children with sepsis.

    PubMed

    Reséndiz-Martínez, Judith; Asbun-Bojalil, Juan; Huerta-Yepez, Sara; Vega, Mario

    2017-05-01

    Multiple organ dysfunction (MOD) is a lethal complication in children with sepsis. Apoptosis of several cell types is involved in this process, and it is associated with increased Fas cell surface death receptor (Fas) expression. As YY1 transcription factor (YY1) negatively regulates the expression of Fas in cancer models, and is associated with the clinical outcome, it may be important in MOD. The present study aimed to determine the association between the expression of Fas, YY1 and apoptosis in children with sepsis, and its association with MOD, these factors were analyzed in 30 pediatric patients that had been diagnosed with sepsis. Peripheral blood mononuclear cells were purified from patients, and YY1 and Fas protein expression was assessed by immunocytochemistry. Apoptosis was determined by terminal deoxynucleotidyl transferase dUTP nick‑end labeling. Sepsis was monitored using clinical parameters, pediatric logistic organ dysfunction (PELOD) score and the pediatric mortality index. The results demonstrated that Fas expression was directly correlated with apoptosis levels and the expression of YY1 was inversely correlated with apoptosis levels. Patients with high levels of apoptosis exhibited increased disease severity and poor clinical outcome. Notably, the findings of the present study demonstrated that there were higher survival rates in patients with high YY1 expression, compared with those with low YY1 expression. Additionally, patients with MOD exhibited lower proportions of apoptotic cells compared with sepsis patients without MOD. Furthermore, the PELOD score was positively correlated with Fas and inversely correlated with YY1 expression. Finally, high apoptosis and low YY1 expression were prognostic factors associated with poor survival rates. These data suggested that YY1 may be important for apoptosis induction via the regulation of Fas during sepsis. Therefore, Fas may be a potential therapeutic target to prevent MOD through regulation of YY1 expression. Furthermore, YY1 and Fas expression in PBMCs may be used to as prognostic markers.

  18. Correlation of the expression of YY1 and Fas cell surface death receptor with apoptosis of peripheral blood mononuclear cells, and the development of multiple organ dysfunction in children with sepsis

    PubMed Central

    Reséndiz-Martínez, Judith; Asbun-Bojalil, Juan; Huerta-Yepez, Sara; Vega, Mario

    2017-01-01

    Multiple organ dysfunction (MOD) is a lethal complication in children with sepsis. Apoptosis of several cell types is involved in this process, and it is associated with increased Fas cell surface death receptor (Fas) expression. As YY1 transcription factor (YY1) negatively regulates the expression of Fas in cancer models, and is associated with the clinical outcome, it may be important in MOD. The present study aimed to determine the association between the expression of Fas, YY1 and apoptosis in children with sepsis, and its association with MOD, these factors were analyzed in 30 pediatric patients that had been diagnosed with sepsis. Peripheral blood mononuclear cells were purified from patients, and YY1 and Fas protein expression was assessed by immunocytochemistry. Apoptosis was determined by terminal deoxynucleotidyl transferase dUTP nick-end labeling. Sepsis was monitored using clinical parameters, pediatric logistic organ dysfunction (PELOD) score and the pediatric mortality index. The results demonstrated that Fas expression was directly correlated with apoptosis levels and the expression of YY1 was inversely correlated with apoptosis levels. Patients with high levels of apoptosis exhibited increased disease severity and poor clinical outcome. Notably, the findings of the present study demonstrated that there were higher survival rates in patients with high YY1 expression, compared with those with low YY1 expression. Additionally, patients with MOD exhibited lower proportions of apoptotic cells compared with sepsis patients without MOD. Furthermore, the PELOD score was positively correlated with Fas and inversely correlated with YY1 expression. Finally, high apoptosis and low YY1 expression were prognostic factors associated with poor survival rates. These data suggested that YY1 may be important for apoptosis induction via the regulation of Fas during sepsis. Therefore, Fas may be a potential therapeutic target to prevent MOD through regulation of YY1 expression. Furthermore, YY1 and Fas expression in PBMCs may be used to as prognostic markers. PMID:28447715

  19. Transcriptional and posttranscriptional regulation of class I major histocompatibility complex genes following transformation with human adenoviruses.

    PubMed Central

    Shemesh, J; Rotem-Yehudar, R; Ehrlich, R

    1991-01-01

    Transformation of rodent cells by human adenoviruses is a well-established model system for studying the expression, regulation, and function of class I antigens. In this report, we demonstrate that the highly oncogenic adenovirus type 12 operates at the transcriptional and posttranscriptional levels in regulating the activity of major histocompatibility complex class I genes and products in transformed cells. Adenovirus type 12 suppresses the cell surface expression of class I antigens in most cell lines. Nevertheless, in a number of cell lines suppression is the result of reduction in the amount of stable specific mRNA, while in another group of cell lines suppression involves interference with processing of a posttranscriptional product. The two mechanisms operate both for the endogenous H-2 genes and for a miniature swine class I transgene that is expressed in the cells. Images PMID:1895404

  20. PDZK1 binding and serine phosphorylation regulate subcellular trafficking of organic anion transport protein 1a1

    PubMed Central

    Choi, Jo H.; Murray, John W.

    2011-01-01

    Although perturbation of organic anion transport protein (oatp) cell surface expression can result in drug toxicity, little is known regarding mechanisms regulating its subcellular distribution. Many members of the oatp family, including oatp1a1, have a COOH-terminal PDZ consensus binding motif that interacts with PDZK1, while serines upstream of this site (S634 and S635) can be phosphorylated. Using oatp1a1 as a prototypical member of the oatp family, we prepared plasmids in which these serines were mutated to glutamic acid [E634E635 (oatp1a1EE), phosphomimetic] or alanine [A634A635 (oatp1a1AA), nonphosphorylatable]. Distribution of oatp1a1AA and oatp1a1EE was largely intracellular in transfected human embryonic kidney (HEK) 293T cells. Cotransfection with a plasmid encoding PDZK1 revealed that oatp1a1AA was now expressed largely on the cell surface, while oatp1a1EE remained intracellular. To quantify these changes, studies were performed in HuH7 cells stably transfected with these oatp1a1 plasmids. These cells endogenously express PDZK1. Surface biotinylation at 4°C followed by shift to 37°C showed that oatp1a1EE internalizes quickly compared with oatp1a1AA. To examine a physiological role for phosphorylation in oatp1a1 subcellular distribution, studies were performed in rat hepatocytes exposed to extracellular ATP, a condition that stimulates serine phosphorylation of oatp1a1 via activity of a purinergic receptor. Internalization of oatp1a1 under these conditions was rapid. Thus, although PDZK1 binding is required for optimal cell surface expression of oatp1a1, phosphorylation provides a mechanism for fast regulation of the distribution of oatp1a1 between the cell surface and intracellular vesicular pools. Identification of the proteins and motor molecules that mediate these trafficking events represents an important area for future study. PMID:21183661

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Simpson, Jeffrey P.; Thrower, Nicholas; Ohlrogge, John B.

    Bayberry (Myrica pensylvanica) fruits are covered with a remarkably thick layer of crystalline wax consisting of triacylglycerol (TAG) and diacylglycerol (DAG) esterified exclusively with saturated fatty acids. As the only plant known to accumulate soluble glycerolipids as a major component of surface waxes, Bayberry represents a novel system to investigate neutral lipid biosynthesis and lipid secretion by vegetative plant cells. The assembly of Bayberry wax is distinct from conventional TAG and other surface waxes, and instead proceeds through a pathway related to cutin synthesis (Simpson and Ohlrogge, 2016). In this study, microscopic examination revealed that the fruit tissue that producesmore » and secretes wax (Bayberry knobs) is fully developed before wax accumulates and that wax is secreted to the surface without cell disruption. Comparison of transcript expression to genetically related tissues (Bayberry leaves, M. rubra fruits), cutin-rich tomato and cherry fruit epidermis, and to oil-rich mesocarp and seeds, revealed exceptionally high expression of 13 transcripts for acyl-lipid metabolism together with down-regulation of fatty acid oxidases and desaturases. The predicted protein sequences of the most highly expressed lipid-related enzyme-encoding transcripts in Bayberry knobs are 100% identical to the sequences from Bayberry leaves,which do not produce surface DAG or TAG. Together, these results indicate that TAG biosynthesis and secretion in Bayberry is achieved by both up and down-regulation of a small subset of genes related to the biosynthesis of cutin and saturated fatty acids, and also implies that modifications in gene expression, rather than evolution of new gene functions, was the major mechanism by which Bayberry evolved its specialized lipid metabolism.« less

  2. Hypoxia-inducible factor regulates alphavbeta3 integrin cell surface expression.

    PubMed

    Cowden Dahl, Karen D; Robertson, Sarah E; Weaver, Valerie M; Simon, M Celeste

    2005-04-01

    Hypoxia-inducible factor (HIF)-deficient placentas exhibit a number of defects, including changes in cell fate adoption, lack of fetal angiogenesis, hypocellularity, and poor invasion into maternal tissue. HIF is a heterodimeric transcription factor consisting of alpha and beta aryl hydrocarbon receptor nuclear translocator or ARNT) subunits. We used undifferentiated trophoblast stem (TS) cells to characterize HIF-dependent adhesion, migration, and invasion. Arnt(-/-) and Hifalpha(-/-) TS cells exhibit reduced adhesion and migration toward vitronectin compared with wild-type cells. Furthermore, this defect is associated with decreased cell surface expression of integrin alphavbeta3 and significantly decreased expression of this integrin in focal adhesions. Because of the importance of adhesion and migration in tumor progression (in addition to placental development), we examined the affect of culturing B16F0 melanoma cells in 1.5% oxygen (O(2)). Culturing B16F0 melanoma cells at 1.5% O(2) resulted in increased alphavbeta3 integrin surface expression and increased adhesion to and migration toward vitronectin. Together, these data suggest that HIF and O(2) tension influence placental invasion and tumor migration by increasing cell surface expression of alphavbeta3 integrin.

  3. Hypoxia-inducible Factor Regulates αvβ3 Integrin Cell Surface Expression

    PubMed Central

    Cowden Dahl, Karen D.; Robertson, Sarah E.; Weaver, Valerie M.; Simon, M. Celeste

    2005-01-01

    Hypoxia-inducible factor (HIF)-deficient placentas exhibit a number of defects, including changes in cell fate adoption, lack of fetal angiogenesis, hypocellularity, and poor invasion into maternal tissue. HIF is a heterodimeric transcription factor consisting of α and β aryl hydrocarbon receptor nuclear translocator or ARNT) subunits. We used undifferentiated trophoblast stem (TS) cells to characterize HIF-dependent adhesion, migration, and invasion. Arnt-/- and Hifα-/- TS cells exhibit reduced adhesion and migration toward vitronectin compared with wild-type cells. Furthermore, this defect is associated with decreased cell surface expression of integrin αvβ3 and significantly decreased expression of this integrin in focal adhesions. Because of the importance of adhesion and migration in tumor progression (in addition to placental development), we examined the affect of culturing B16F0 melanoma cells in 1.5% oxygen (O2). Culturing B16F0 melanoma cells at 1.5% O2 resulted in increased αvβ3 integrin surface expression and increased adhesion to and migration toward vitronectin. Together, these data suggest that HIF and O2 tension influence placental invasion and tumor migration by increasing cell surface expression of αvβ3 integrin. PMID:15689487

  4. How did nature engineer the highest surface lipid accumulation among plants? Exceptional expression of acyl-lipid-associated genes for the assembly of extracellular triacylglycerol by Bayberry (Myrica pensylvanica) fruits.

    PubMed

    Simpson, Jeffrey P; Thrower, Nicholas; Ohlrogge, John B

    2016-09-01

    Bayberry (Myrica pensylvanica) fruits are covered with a remarkably thick layer of crystalline wax consisting of triacylglycerol (TAG) and diacylglycerol (DAG) esterified exclusively with saturated fatty acids. As the only plant known to accumulate soluble glycerolipids as a major component of surface waxes, Bayberry represents a novel system to investigate neutral lipid biosynthesis and lipid secretion by vegetative plant cells. The assembly of Bayberry wax is distinct from conventional TAG and other surface waxes, and instead proceeds through a pathway related to cutin synthesis (Simpson and Ohlrogge, 2016). In this study, microscopic examination revealed that the fruit tissue that produces and secretes wax (Bayberry knobs) is fully developed before wax accumulates and that wax is secreted to the surface without cell disruption. Comparison of transcript expression to genetically related tissues (Bayberry leaves, M. rubra fruits), cutin-rich tomato and cherry fruit epidermis, and to oil-rich mesocarp and seeds, revealed exceptionally high expression of 13 transcripts for acyl-lipid metabolism together with down-regulation of fatty acid oxidases and desaturases. The predicted protein sequences of the most highly expressed lipid-related enzyme-encoding transcripts in Bayberry knobs are 100% identical to the sequences from Bayberry leaves, which do not produce surface DAG or TAG. Together, these results indicate that TAG biosynthesis and secretion in Bayberry is achieved by both up and down-regulation of a small subset of genes related to the biosynthesis of cutin and saturated fatty acids, and also implies that modifications in gene expression, rather than evolution of new gene functions, was the major mechanism by which Bayberry evolved its specialized lipid metabolism. This article is part of a Special Issue entitled: Plant Lipid Biology edited by Kent D. Chapman and Ivo Feussner. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Inhibition of Fas (CD95) expression and Fas-mediated apoptosis by oncogenic Ras.

    PubMed

    Fenton, R G; Hixon, J A; Wright, P W; Brooks, A D; Sayers, T J

    1998-08-01

    The ras oncogene plays an important role in the multistep progression to cancer by activation of signal transduction pathways that contribute to aberrant growth regulation. Although many of these effects are cell autonomous, the ras oncogene also regulates the expression of genes that alter host/tumor interactions. We now extend the mechanisms through which ras promotes tumor survival by demonstrating that oncogenic Ras inhibits expression of the fas gene and renders Ras-transformed cells resistant to Fas-induced apoptosis. A panel of Ras-transformed clones exhibited a marked inhibition in fas mRNA and Fas cell surface expression as compared with untransformed parental cell lines. Fas expression was induced by culture in the presence of IFN-gamma + tumor necrosis factor alpha; however, the maximal level attained in Ras transformants was approximately 10-fold below the level of untransformed cells. Whereas untransformed cells were sensitive to apoptotic death induced by cross-linking surface Fas (especially after cytokine treatment), Ras-transformed cells were very resistant to Fas-induced death even under the most stringent assay conditions. To demonstrate that this resistance was mediated by oncogenic Ras and not secondary genetic events, pools of Ras-transformed cells were generated using a highly efficient retroviral transduction technique. Transformed pools were assayed 6 days after infection and demonstrated a marked decrease in fas gene expression and Fas-mediated apoptosis. Oncogenic Ras did not promote general resistance to apoptosis, because ectopic expression of a fas cDNA in Ras-transformed cells restored sensitivity to Fas-induced apoptosis. These data indicate that oncogenic Ras inhibits basal levels of expression of the fas gene, and although cytokine signal transduction pathways are functional in these cells, the level of surface Fas expression remains below the threshold required for induction of apoptosis. These data identify a mechanism by which Ras-transformed cells may escape from host-mediated immune destruction.

  6. A Stable Human-Cell System Overexpressing Cystic Fibrosis Transmembrane Conductance Regulator Recombinant Protein at the Cell Surface

    PubMed Central

    Dai, Qun; Aleksandrov, Andrei A.; Bajrami, Bekim; Diego, Pamela Ann; Wu, Xing; Ray, Marjorie; Naren, Anjaparavanda P.; Riordan, John R.; Yao, Xudong; DeLucas, Lawrence J.; Urbatsch, Ina L.; Kappes, John C.

    2015-01-01

    Recent human clinical trials results demonstrated successful treatment for certain genetic forms of cystic fibrosis (CF). To extend treatment opportunities to those afflicted with other genetic forms of CF disease, structural and biophysical characterization of CF transmembrane conductance regulator (CFTR) is urgently needed. In this study, CFTR was modified with various tags, including a His10 purification tag, the SUMOstar (SUMO*) domain, an extracellular FLAG epitope, or an enhanced green fluorescent protein (EGFP), each alone or in various combinations. Expressed in HEK293 cells, recombinant CFTR proteins underwent complex glycosylation, compartmentalized with the plasma membrane, and exhibited regulated chloride-channel activity with only modest alterations in channel conductance and gating kinetics. Surface CFTR expression level was enhanced by the presence of SUMO* on the N-terminus. Quantitative mass-spectrometric analysis indicated approximately 10% of the total recombinant CFTR (SUMO*-CFTRFLAG-EGFP) localized to the plasma membrane. Trial purification using dodecylmaltoside for membrane protein extraction reproducibly recovered 178 ± 56 μg SUMO*-CFTRFLAG-EGFP per billion cells at 80% purity. Fluorescence size-exclusion chromatography indicated purified CFTR was monodisperse. These findings demonstrate a stable mammalian cell expression system capable of producing human CFTR of sufficient quality and quantity to augment futrure CF drug discovery efforts, including biophysical and structural studies. PMID:25577540

  7. Investigation of energy gene expressions and community structures of free and attached acidophilic bacteria in chalcopyrite bioleaching.

    PubMed

    Zhu, Jianyu; Jiao, Weifeng; Li, Qian; Liu, Xueduan; Qin, Wenqing; Qiu, Guanzhou; Hu, Yuehua; Chai, Liyuan

    2012-12-01

    In order to better understand the bioleaching mechanism, expression of genes involved in energy conservation and community structure of free and attached acidophilic bacteria in chalcopyrite bioleaching were investigated. Using quantitative real-time PCR, we studied the expression of genes involved in energy conservation in free and attached Acidithiobacillus ferrooxidans during bioleaching of chalcopyrite. Sulfur oxidation genes of attached A. ferrooxidans were up-regulated while ferrous iron oxidation genes were down-regulated compared with free A. ferrooxidans in the solution. The up-regulation may be induced by elemental sulfur on the mineral surface. This conclusion was supported by the results of HPLC analysis. Sulfur-oxidizing Acidithiobacillus thiooxidans and ferrous-oxidizing Leptospirillum ferrooxidans were the members of the mixed culture in chalcopyrite bioleaching. Study of the community structure of free and attached bacteria showed that A. thiooxidans dominated the attached bacteria while L. ferrooxidans dominated the free bacteria. With respect to available energy sources during bioleaching of chalcopyrite, sulfur-oxidizers tend to be on the mineral surfaces whereas ferrous iron-oxidizers tend to be suspended in the aqueous phase. Taken together, these results indicate that the main role of attached acidophilic bacteria was to oxidize elemental sulfur and dissolution of chalcopyrite involved chiefly an indirect bioleaching mechanism.

  8. Synaptopodin Limits TRPC6 Podocyte Surface Expression and Attenuates Proteinuria.

    PubMed

    Yu, Hao; Kistler, Andreas; Faridi, Mohd Hafeez; Meyer, James Otto; Tryniszewska, Beata; Mehta, Dolly; Yue, Lixia; Dryer, Stuart; Reiser, Jochen

    2016-11-01

    Gain-of-function mutations of classic transient receptor potential channel 6 (TRPC6) were identified in familial FSGS, and increased expression of wild-type TRPC6 in glomeruli is observed in several human acquired proteinuric diseases. Synaptopodin, an actin binding protein that is important in maintaining podocyte function, is downregulated in various glomerular diseases. Here, we investigated whether synaptopodin maintains podocyte function by regulating podocyte surface expression and activity of TRPC6. We show indirect interaction and nonrandom association of synaptopodin and TRPC6 in podocytes. Knockdown of synaptopodin in cultured mouse podocytes increased the expression of TRPC6 at the plasma membrane, whereas overexpression of synaptopodin decreased it. Mechanistically, synaptopodin-dependent TRPC6 surface expression required functional actin and microtubule cytoskeletons. Overexpression of wild-type or FSGS-inducing mutant TRPC6 in synaptopodin-depleted podocytes enhanced TRPC6-mediated calcium influx and induced apoptosis. In vivo, knockdown of synaptopodin also caused increased podocyte surface expression of TRPC6. Administration of cyclosporin A, which stabilizes synaptopodin, reduced LPS-induced proteinuria significantly in wild-type mice but to a lesser extent in TRPC6 knockout mice. Furthermore, administration of cyclosporin A reversed the LPS-induced increase in podocyte surface expression of TRPC6 in wild-type mice. Our findings suggest that alteration in synaptopodin levels under disease conditions may modify intracellular TRPC6 channel localization and activity, which further contribute to podocyte dysfunction. Reducing TRPC6 surface levels may be a new approach to restoring podocyte function. Copyright © 2016 by the American Society of Nephrology.

  9. Etanercept Promotes Bone Formation via Suppression of Dickkopf-1 Expression in Rats with Collagen-Induced Arthritis

    PubMed Central

    Tanida, Atsushi; Kishimoto, Yuji; Okano, Toru; Hagino, Hiroshi

    2013-01-01

    Background Various clinical reports suggest etanercept (ETN) has some efficacy in bone formation in rheumatoid arthritis (RA). To examine this effect, we investigated the gene expression of cytokines relevant to osteoblast/osteoclast differentiation, and evaluated histomorphometric findings in mature rats with collagen-induced arthritis (CIA). Methods Total RNA was extracted from knee joints with CIA after ETN or placebo administration. Subsequently, realtime-PCR was carried out to quantify the mRNAs encoding Wnt-1, Dickkopf-1 (DKK-1), receptor activator of nuclear factor kappa-B ligand (RANKL), osteoprotegelin (OPG) and TNF (tumor necrosis factor)-alpha. In histomorphometric analysis, the infiltrating pannus volume and pannus surface, and the following items in contact with pannus surface were measured: osteoclast number, osteoid surface, osteoid volume and labeling surface. These were evaluated in the distal femur with CIA with or without ETN administration. Results TNF-alpha, RANKL and OPG mRNA expressions, linked to osteoclastogenesis, were not significantly different with or without ETN administration. ETN administration significantly increased Wnt-1 mRNA expression, the osteoblast promoter, and decreased DKK-1 mRNA expression, the Wnt signal inhibitor. In histomorphometric analysis, pannus volume, pannus surface and osteoclast number, parameters of bone destruction, were not significantly different among groups. Osteoid volume, osteoid surface and labeling surface, parameters of bone formation, increased significantly with ETN administration. Conclusion Our results suggest that ETN suppresses DDK-1 expression, and, as a result, Wnt expression is promoted and osteoblastogenesis becomes more active, independent of the regulation of osteoclast activity. Marked bone formation is attributed to the fact that ETN directly promotes osteoblastogenesis, not as a result of suppressing osteoclastogenesis. PMID:24031147

  10. Transcriptome analysis of Neisseria meningitidis in human whole blood and mutagenesis studies identify virulence factors involved in blood survival.

    PubMed

    Echenique-Rivera, Hebert; Muzzi, Alessandro; Del Tordello, Elena; Seib, Kate L; Francois, Patrice; Rappuoli, Rino; Pizza, Mariagrazia; Serruto, Davide

    2011-05-01

    During infection Neisseria meningitidis (Nm) encounters multiple environments within the host, which makes rapid adaptation a crucial factor for meningococcal survival. Despite the importance of invasion into the bloodstream in the meningococcal disease process, little is known about how Nm adapts to permit survival and growth in blood. To address this, we performed a time-course transcriptome analysis using an ex vivo model of human whole blood infection. We observed that Nm alters the expression of ≈30% of ORFs of the genome and major dynamic changes were observed in the expression of transcriptional regulators, transport and binding proteins, energy metabolism, and surface-exposed virulence factors. In particular, we found that the gene encoding the regulator Fur, as well as all genes encoding iron uptake systems, were significantly up-regulated. Analysis of regulated genes encoding for surface-exposed proteins involved in Nm pathogenesis allowed us to better understand mechanisms used to circumvent host defenses. During blood infection, Nm activates genes encoding for the factor H binding proteins, fHbp and NspA, genes encoding for detoxifying enzymes such as SodC, Kat and AniA, as well as several less characterized surface-exposed proteins that might have a role in blood survival. Through mutagenesis studies of a subset of up-regulated genes we were able to identify new proteins important for survival in human blood and also to identify additional roles of previously known virulence factors in aiding survival in blood. Nm mutant strains lacking the genes encoding the hypothetical protein NMB1483 and the surface-exposed proteins NalP, Mip and NspA, the Fur regulator, the transferrin binding protein TbpB, and the L-lactate permease LctP were sensitive to killing by human blood. This increased knowledge of how Nm responds to adaptation in blood could also be helpful to develop diagnostic and therapeutic strategies to control the devastating disease cause by this microorganism.

  11. Transcriptome Analysis of Neisseria meningitidis in Human Whole Blood and Mutagenesis Studies Identify Virulence Factors Involved in Blood Survival

    PubMed Central

    Del Tordello, Elena; Seib, Kate L.; Francois, Patrice; Rappuoli, Rino; Pizza, Mariagrazia; Serruto, Davide

    2011-01-01

    During infection Neisseria meningitidis (Nm) encounters multiple environments within the host, which makes rapid adaptation a crucial factor for meningococcal survival. Despite the importance of invasion into the bloodstream in the meningococcal disease process, little is known about how Nm adapts to permit survival and growth in blood. To address this, we performed a time-course transcriptome analysis using an ex vivo model of human whole blood infection. We observed that Nm alters the expression of ≈30% of ORFs of the genome and major dynamic changes were observed in the expression of transcriptional regulators, transport and binding proteins, energy metabolism, and surface-exposed virulence factors. In particular, we found that the gene encoding the regulator Fur, as well as all genes encoding iron uptake systems, were significantly up-regulated. Analysis of regulated genes encoding for surface-exposed proteins involved in Nm pathogenesis allowed us to better understand mechanisms used to circumvent host defenses. During blood infection, Nm activates genes encoding for the factor H binding proteins, fHbp and NspA, genes encoding for detoxifying enzymes such as SodC, Kat and AniA, as well as several less characterized surface-exposed proteins that might have a role in blood survival. Through mutagenesis studies of a subset of up-regulated genes we were able to identify new proteins important for survival in human blood and also to identify additional roles of previously known virulence factors in aiding survival in blood. Nm mutant strains lacking the genes encoding the hypothetical protein NMB1483 and the surface-exposed proteins NalP, Mip and NspA, the Fur regulator, the transferrin binding protein TbpB, and the L-lactate permease LctP were sensitive to killing by human blood. This increased knowledge of how Nm responds to adaptation in blood could also be helpful to develop diagnostic and therapeutic strategies to control the devastating disease cause by this microorganism. PMID:21589640

  12. DYRK1A-mediated phosphorylation of GluN2A at Ser(1048) regulates the surface expression and channel activity of GluN1/GluN2A receptors.

    PubMed

    Grau, Cristina; Arató, Krisztina; Fernández-Fernández, José M; Valderrama, Aitana; Sindreu, Carlos; Fillat, Cristina; Ferrer, Isidre; de la Luna, Susana; Altafaj, Xavier

    2014-01-01

    N-methyl-D-aspartate glutamate receptors (NMDARs) play a pivotal role in neural development and synaptic plasticity, as well as in neurological disease. Since NMDARs exert their function at the cell surface, their density in the plasma membrane is finely tuned by a plethora of molecules that regulate their production, trafficking, docking and internalization in response to external stimuli. In addition to transcriptional regulation, the density of NMDARs is also influenced by post-translational mechanisms like phosphorylation, a modification that also affects their biophysical properties. We previously described the increased surface expression of GluN1/GluN2A receptors in transgenic mice overexpressing the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), suggesting that DYRK1A regulates NMDARs. Here we have further investigated whether the density and activity of NMDARs were modulated by DYRK1A phosphorylation. Accordingly, we show that endogenous DYRK1A is recruited to GluN2A-containing NMDARs in the adult mouse brain, and we identify a DYRK1A phosphorylation site at Ser(1048) of GluN2A, within its intracellular C-terminal domain. Mechanistically, the DYRK1A-dependent phosphorylation of GluN2A at Ser(1048) hinders the internalization of GluN1/GluN2A, causing an increase of surface GluN1/GluN2A in heterologous systems, as well as in primary cortical neurons. Furthermore, GluN2A phosphorylation at Ser(1048) increases the current density and potentiates the gating of GluN1/GluN2A receptors. We conclude that DYRK1A is a direct regulator of NMDA receptors and we propose a novel mechanism for the control of NMDAR activity in neurons.

  13. DYRK1A-mediated phosphorylation of GluN2A at Ser1048 regulates the surface expression and channel activity of GluN1/GluN2A receptors

    PubMed Central

    Grau, Cristina; Arató, Krisztina; Fernández-Fernández, José M.; Valderrama, Aitana; Sindreu, Carlos; Fillat, Cristina; Ferrer, Isidre; de la Luna, Susana; Altafaj, Xavier

    2014-01-01

    N-methyl-D-aspartate glutamate receptors (NMDARs) play a pivotal role in neural development and synaptic plasticity, as well as in neurological disease. Since NMDARs exert their function at the cell surface, their density in the plasma membrane is finely tuned by a plethora of molecules that regulate their production, trafficking, docking and internalization in response to external stimuli. In addition to transcriptional regulation, the density of NMDARs is also influenced by post-translational mechanisms like phosphorylation, a modification that also affects their biophysical properties. We previously described the increased surface expression of GluN1/GluN2A receptors in transgenic mice overexpressing the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), suggesting that DYRK1A regulates NMDARs. Here we have further investigated whether the density and activity of NMDARs were modulated by DYRK1A phosphorylation. Accordingly, we show that endogenous DYRK1A is recruited to GluN2A-containing NMDARs in the adult mouse brain, and we identify a DYRK1A phosphorylation site at Ser1048 of GluN2A, within its intracellular C-terminal domain. Mechanistically, the DYRK1A-dependent phosphorylation of GluN2A at Ser1048 hinders the internalization of GluN1/GluN2A, causing an increase of surface GluN1/GluN2A in heterologous systems, as well as in primary cortical neurons. Furthermore, GluN2A phosphorylation at Ser1048 increases the current density and potentiates the gating of GluN1/GluN2A receptors. We conclude that DYRK1A is a direct regulator of NMDA receptors and we propose a novel mechanism for the control of NMDAR activity in neurons. PMID:25368549

  14. Urokinase receptor and CXCR4 are regulated by common microRNAs in leukaemia cells

    PubMed Central

    Alfano, Daniela; Gorrasi, Anna; Li Santi, Anna; Ricci, Patrizia; Montuori, Nunzia; Selleri, Carmine; Ragno, Pia

    2015-01-01

    The urokinase-type plasminogen activator (uPA) receptor (uPAR) focuses uPA proteolytic activity on the cell membrane, promoting localized degradation of extracellular matrix (ECM), and binds vitronectin (VN), mediating cell adhesion to the ECM. uPAR-bound uPA and VN induce proteolysis-independent intracellular signalling, regulating cell adhesion, migration, survival and proliferation. uPAR cross-talks with CXCR4, the receptor for the stroma-derived factor 1 chemokine. CXCR4 is crucial in the trafficking of hematopoietic stem cells from/to the bone marrow, which involves also uPAR. Both uPAR and CXCR4 are expressed in acute myeloid leukaemia (AML), with a lower expression in undifferentiated and myeloid subsets, and higher expression in myelomonocytic and promyelocytic subsets. We hypothesized a microRNA (miR)-mediated co-regulation of uPAR and CXCR4 expression, which could allow their cross-talk at the cell surface. We identified three miRs, miR-146a, miR-335 and miR-622, regulating the expression of both uPAR and CXCR4 in AML cell lines. Indeed, these miRs directly target the 3′untranslated region of both uPAR- and CXCR4-mRNAs; accordingly, uPAR/CXCR4 expression is reduced by their overexpression in AML cells and increased by their specific inhibitors. Overexpression of all three miRs impairs migration, invasion and proliferation of myelomonocytic cells. Interestingly, we observed an inverse relationship between uPAR/CXCR4 expression and miR-146a and miR-335 levels in AML blasts, suggesting their possible role in the regulation of uPAR/CXCR4 expression also in vivo. PMID:26082201

  15. Expression of cholera toxin under non-AKI conditions in Vibrio cholerae El Tor induced by increasing the exposed surface of cultures.

    PubMed

    Sánchez, Joaquín; Medina, Gerardo; Buhse, Thomas; Holmgren, Jan; Soberón-Chavez, Gloria

    2004-03-01

    The regulatory systems controlling expression of the ctxAB genes encoding cholera toxin (CT) in the classical and El Tor biotypes of pathogenic Vibrio cholerae have been characterized and found to be almost identical. Notwithstanding this, special in vitro conditions, called AKI conditions, are required for El Tor bacteria to produce CT. The AKI conditions involve biphasic cultures. In phase 1 the organism is grown in a still tube for 4 h. In phase 2 the medium is poured into a flask to continue growth with shaking. Virtually no expression of CT occurs if this protocol is not followed. Here we demonstrated that CT expression takes place in single-phase still cultures if the volume-to-surface-area ratio is decreased, both under air and under an inert atmosphere. The expression of key genes involved in the regulation of CT production was analyzed, and we found that the expression pattern closely resembles the in vivo expression pattern.

  16. T-cell receptor revision: friend or foe?

    PubMed Central

    Hale, J Scott; Fink, Pamela J

    2010-01-01

    T-cell receptor (TCR) revision is a process of tolerance induction by which peripheral T cells lose surface expression of an autoreactive TCR, reinduce expression of the recombinase machinery, rearrange genes encoding extrathymically generated TCRs for antigen, and express these new receptors on the cell surface. We discuss the evidence for this controversial tolerance mechanism below. Despite the apparent heresy of post-thymic gene rearrangement, we argue here that TCR revision follows the rules obeyed by maturing thymocytes undergoing gene recombination. Expression of the recombinase is carefully controlled both spatially and temporally, and may be initiated by loss of signals through surface TCRs. The resulting TCR repertoire is characterized by its diversity, self major histocompatibility complex restriction, self tolerance, and ability to mount productive immune responses specific for foreign antigens. Hence, TCR revision is a carefully regulated process of tolerance induction that can contribute to the protection of the individual against invading pathogens while preserving the integrity of self tissue. PMID:20201984

  17. New insights into the roles of megalin/LRP2 and the regulation of its functional expression.

    PubMed

    Marzolo, María-Paz; Farfán, Pamela

    2011-01-01

    Since the discovery of the low-density lipoprotein receptor (LDLR) and its association with familial hypercholesterolemia in the early 1980s, a family of structurally related proteins has been discovered that has apolipoprotein E as a common ligand, and the broad functions of its members have been described. LRP2, or megalin, is a member of the LDLR family and was initially called gp330. Megalin is an endocytic receptor expressed on the apical surface of several epithelial cells that internalizes a variety of ligands including nutrients, hormones and their carrier proteins, signaling molecules, morphogens, and extracellular matrix proteins. Once internalized, these ligands are directed to the lysosomal degradation pathway or transported by transcytosis from one side of the cell to the opposite membrane. The availability of megalin at the cell surface is controlled by several regulatory mechanisms, including the phosphorylation of its cytoplasmic domain by GSK3, the proteolysis of the extracellular domain at the cell surface (shedding), the subsequent intramembrane proteolysis of the transmembrane domain by the gamma-secretase complex, and exosome secretion. Based on the important roles of its ligands and its tissue expression pattern, megalin has been recognized as an important component of many pathological conditions, including diabetic nephropathy, Lowe syndrome, Dent disease, Alzheimer's disease (AD) and gallstone disease. In addition, the expression of megalin and some of its ligands in the central and peripheral nervous system suggests a role for this receptor in neural regeneration processes. Despite its obvious importance, the regulation of megalin expression is poorly understood. In this review, we describe the functions of megalin and its association with certain pathological conditions as well as the current understanding of the mechanisms that underlie the control of megalin expression.

  18. Regulation of Cardiac ATP-sensitive Potassium Channel Surface Expression by Calcium/Calmodulin-dependent Protein Kinase II*

    PubMed Central

    Sierra, Ana; Zhu, Zhiyong; Sapay, Nicolas; Sharotri, Vikas; Kline, Crystal F.; Luczak, Elizabeth D.; Subbotina, Ekaterina; Sivaprasadarao, Asipu; Snyder, Peter M.; Mohler, Peter J.; Anderson, Mark E.; Vivaudou, Michel; Zingman, Leonid V.; Hodgson-Zingman, Denice M.

    2013-01-01

    Cardiac ATP-sensitive potassium (KATP) channels are key sensors and effectors of the metabolic status of cardiomyocytes. Alteration in their expression impacts their effectiveness in maintaining cellular energy homeostasis and resistance to injury. We sought to determine how activation of calcium/calmodulin-dependent protein kinase II (CaMKII), a central regulator of calcium signaling, translates into reduced membrane expression and current capacity of cardiac KATP channels. We used real-time monitoring of KATP channel current density, immunohistochemistry, and biotinylation studies in isolated hearts and cardiomyocytes from wild-type and transgenic mice as well as HEK cells expressing wild-type and mutant KATP channel subunits to track the dynamics of KATP channel surface expression. Results showed that activation of CaMKII triggered dynamin-dependent internalization of KATP channels. This process required phosphorylation of threonine at 180 and 224 and an intact 330YSKF333 endocytosis motif of the KATP channel Kir6.2 pore-forming subunit. A molecular model of the μ2 subunit of the endocytosis adaptor protein, AP2, complexed with Kir6.2 predicted that μ2 docks by interaction with 330YSKF333 and Thr-180 on one and Thr-224 on the adjacent Kir6.2 subunit. Phosphorylation of Thr-180 and Thr-224 would favor interactions with the corresponding arginine- and lysine-rich loops on μ2. We concluded that calcium-dependent activation of CaMKII results in phosphorylation of Kir6.2, which promotes endocytosis of cardiac KATP channel subunits. This mechanism couples the surface expression of cardiac KATP channels with calcium signaling and reveals new targets to improve cardiac energy efficiency and stress resistance. PMID:23223335

  19. Pseudorabies virus-induced suppression of major histocompatibility complex class I antigen expression.

    PubMed Central

    Mellencamp, M W; O'Brien, P C; Stevenson, J R

    1991-01-01

    The ability of pseudorabies virus (PrV) to down-modulate expression of major histocompatibility complex class I antigens in murine and porcine cells was investigated. When quantified by flow cytometry, surface expression of class I Kk and Dk antigens on PrV-infected cells decreased by 60% or more. Down-modulation was associated with a decrease in total cellular class I antigens, indicating regulation at the transcriptional or posttranscriptional level. PrV did not suppress expression of transferrin receptor, suggesting a selective regulatory mechanism. Images PMID:1851884

  20. Aft2, a Novel Transcription Regulator, Is Required for Iron Metabolism, Oxidative Stress, Surface Adhesion and Hyphal Development in Candida albicans

    PubMed Central

    Xu, Ning; Cheng, Xinxin; Yu, Qilin; Qian, Kefan; Ding, Xiaohui; Liu, Ruming; Zhang, Biao; Xing, Laijun; Li, Mingchun

    2013-01-01

    Morphological transition and iron metabolism are closely relevant to Candida albicans pathogenicity and virulence. In our previous study, we demonstrated that C. albicans Aft2 plays an important role in ferric reductase activity and virulence. Here, we further explored the roles of C. albicans Aft2 in numerous cellular processes. We found that C. albicans Aft2 exhibited an important role in iron metabolism through bi-directional regulation effects on iron-regulon expression. Deletion of AFT2 reduced cellular iron accumulation under iron-deficient conditions. Furthermore, both reactive oxygen species (ROS) generation and superoxide dismutase (SOD) activity were remarkably increased in the aft2Δ/Δ mutant, which were thought to be responsible for the defective responses to oxidative stress. However, we found that over-expression of C. albicans AFT2 under the regulation of the strong PGK1 promoter could not effectively rescue Saccharomyces cerevisiae aft1Δ mutant defects in some cellular processes, such as cell-wall assembly, ion homeostasis and alkaline resistance, suggesting a possibility that C. albicans Aft2 weakened its functional role of regulating some cellular metabolism during the evolutionary process. Interestingly, deletion of AFT2 in C. albicans increased cell surface hydrophobicity, cell flocculation and the ability of adhesion to polystyrene surfaces. In addition, our results also revealed that C. albicans Aft2 played a dual role in regulating hypha-specific genes under solid and liquid hyphal inducing conditions. Deletion of AFT2 caused an impaired invasive growth in solid medium, but an increased filamentous aggregation and growth in liquid conditions. Moreover, iron deficiency and environmental cues induced nuclear import of Aft2, providing additional evidence for the roles of Aft2 in transcriptional regulation. PMID:23626810

  1. Use of whole genome expression analysis in the toxicity screening of nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fröhlich, Eleonore, E-mail: eleonore.froehlich@medunigraz.at; Meindl, Claudia; Wagner, Karin

    2014-10-15

    The use of nanoparticles (NPs) offers exciting new options in technical and medical applications provided they do not cause adverse cellular effects. Cellular effects of NPs depend on particle parameters and exposure conditions. In this study, whole genome expression arrays were employed to identify the influence of particle size, cytotoxicity, protein coating, and surface functionalization of polystyrene particles as model particles and for short carbon nanotubes (CNTs) as particles with potential interest in medical treatment. Another aim of the study was to find out whether screening by microarray would identify other or additional targets than commonly used cell-based assays formore » NP action. Whole genome expression analysis and assays for cell viability, interleukin secretion, oxidative stress, and apoptosis were employed. Similar to conventional assays, microarray data identified inflammation, oxidative stress, and apoptosis as affected by NP treatment. Application of lower particle doses and presence of protein decreased the total number of regulated genes but did not markedly influence the top regulated genes. Cellular effects of CNTs were small; only carboxyl-functionalized single-walled CNTs caused appreciable regulation of genes. It can be concluded that regulated functions correlated well with results in cell-based assays. Presence of protein mitigated cytotoxicity but did not cause a different pattern of regulated processes. - Highlights: • Regulated functions were screened using whole genome expression assays. • Polystyrene particles regulated more genes than short carbon nanotubes. • Protein coating of polystyrene particles did not change regulation pattern. • Functions regulated by microarray were confirmed by cell-based assay.« less

  2. Mitochondrial F1Fo-ATP synthase translocates to cell surface in hepatocytes and has high activity in tumor-like acidic and hypoxic environment.

    PubMed

    Ma, Zhan; Cao, Manlin; Liu, Yiwen; He, Yiqing; Wang, Yingzhi; Yang, Cuixia; Wang, Wenjuan; Du, Yan; Zhou, Muqing; Gao, Feng

    2010-08-01

    F1Fo-ATP synthase was originally thought to exclusively locate in the inner membrane of the mitochondria. However, recent studies prove the existence of ectopic F1Fo-ATP synthase on the outside of the cell membrane. Ectopic ATP synthase was proposed as a marker for tumor target therapy. Nevertheless, the protein transport mechanism of the ectopic ATP synthase is still unclear. The specificity of the ectopic ATP synthase, with regard to tumors, is questioned because of its widespread expression. In the current study, we constructed green fluorescent protein-ATP5B fusion protein and introduced it into HepG2 cells to study the localization of the ATP synthase. The expression of ATP5B was analyzed in six cell lines with different 'malignancies'. These cells were cultured in both normal and tumor-like acidic and hypoxic conditions. The results suggested that the ectopic expression of ATP synthase is a consequence of translocation from the mitochondria. The expression and catalytic activity of ectopic ATP synthase were similar on the surface of malignant cells as on the surface of less malignant cells. Interestingly, the expression of ectopic ATP synthase was not up-regulated in tumor-like acidic and hypoxic microenvironments. However, the catalytic activity of ectopic ATP synthase was up-regulated in tumor-like microenvironments. Therefore, the specificity of ectopic ATP synthase for tumor target therapy relies on the high level of catalytic activity that is observed in acidic and hypoxic microenvironments in tumor tissues.

  3. Impaired granulocyte oxidative burst and decreased expression of leucocyte adhesion molecule-1 (LAM-1) in patients with Wegener's granulomatosis.

    PubMed Central

    Riecken, B; Gutfleisch, J; Schlesier, M; Peter, H H

    1994-01-01

    Neutrophils are the target of autoantibodies in Wegener's granulomatosis (WG). In this study, granulocyte function and surface marker expression were investigated in patients with WG. The oxidative burst in response to phorbol myristate acetate (PMA) was tested with granulocytes of 25 patients with histologically proven WG. A significantly diminished percentage of oxygen radical-producing cells was found in patients with active disease. Surface antigen expression of CD11b and LAM-1 was analysed on granulocytes of 20 patients with WG. Whereas the expression of CD11b was normal, surface expression of LAM-1 was decreased in nine cases with WG. The decrease of LAM-1 correlated with disease activity. Phagocytosis of Escherichia coli was tested in 10 patients with WG, and normal values were found in all cases. We conclude that down-regulation of LAM-1 may be a marker of disease activity in WG. The altered response to PMA may indicate functional changes in granulocyte reactivity due to autoantibody-induced damage of the granulocyte membrane. PMID:7512009

  4. Acquisition of negative complement regulators by the saprophyte Leptospira biflexa expressing LigA or LigB confers enhanced survival in human serum.

    PubMed

    Castiblanco-Valencia, Mónica M; Fraga, Tatiana R; Breda, Leandro C D; Vasconcellos, Sílvio A; Figueira, Cláudio P; Picardeau, Mathieu; Wunder, Elsio; Ko, Albert I; Barbosa, Angela S; Isaac, Lourdes

    2016-05-01

    Leptospiral immunoglobulin-like (Lig) proteins are surface exposed molecules present in pathogenic but not in saprophytic Leptospira species. We have previously shown that Lig proteins interact with the soluble complement regulators Factor H (FH), FH like-1 (FHL-1), FH related-1 (FHR-1) and C4b Binding Protein (C4BP). In this study, we used the saprophyte L. biflexa serovar Patoc as a surrogate host to address the specific role of LigA and LigB proteins in leptospiral complement evasion. L. biflexa expressing LigA or LigB was able to acquire FH and C4BP. Bound complement regulators retained their cofactor activities of FI in the proteolytic cleavage of C3b and C4b. Moreover, heterologous expression of ligA and ligB genes in the saprophyte L. biflexa enhanced bacterial survival in human serum. Complement deposition on lig-transformed L. biflexa was assessed by flow cytometry analysis. With regard to MAC deposition, L. biflexa expressing LigA or LigB presented an intermediate profile: MAC deposition levels were greater than those found in the pathogenic L. interrogans, but lower than those observed for L. biflexa wildtype. In conclusion, Lig proteins contribute to in vitro control of complement activation on the leptospiral surface, promoting an increased bacterial survival in human serum. Copyright © 2016 European Federation of Immunological Societies. All rights reserved.

  5. Fetal exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin induces expression of the chemokine genes Cxcl4 and Cxcl7 in the perinatal mouse brain.

    PubMed

    Mitsui, Tetsuo; Taniguchi, Naofumi; Kawasaki, Nobuchika; Kagami, Yoshihiro; Arita, Jun

    2011-04-01

    Fetal exposure to dioxins affects brain development and influences behaviors in human and laboratory animals. However, the cellular target and mechanisms of the neurotoxic action of dioxins are largely unknown. To investigate the molecular basis for the neurotoxicity of dioxins, pregnant C57BL/6 mice were exposed to 5 µg kg(-1) body weight of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) by a single gavage on gestational day 12.5 (GD 12.5), and gene expression of the whole fetal brain at GD 18.5 was profiled by DNA microarray analysis. The analysis revealed that the expression of two chemokine genes, Cxcl4 and Cxcl7, was up-regulated by TCDD exposure. Real-time PCR analysis verified that they were up-regulated by TCDD in both male and female brains, while the mRNA levels of a majority of other chemokines and their receptor genes were not affected. The up-regulation was TCDD dose-dependent and peaked at GD 15.5-18.5. In situ hybridization analysis showed that the Cxcl4 mRNA expression was localized in part of the surface of cerebral cortex and that the level was increased by TCDD treatment. These results suggest that Cxcl4 and Cxcl7 play a role in the development of neurobehavioral alterations that are triggered by in utero TCDD exposure and later surface in adults. Copyright © 2011 John Wiley & Sons, Ltd.

  6. Signal Regulatory Protein α Negatively Regulates β2 Integrin-Mediated Monocyte Adhesion, Transendothelial Migration and Phagocytosis

    PubMed Central

    Liu, Dan-Qing; Li, Li-Min; Guo, Ya-Lan; Bai, Rui; Wang, Chen; Bian, Zhen; Zhang, Chen-Yu; Zen, Ke

    2008-01-01

    Background Signal regulate protein α (SIRPα) is involved in many functional aspects of monocytes. Here we investigate the role of SIRPα in regulating β2 integrin-mediated monocyte adhesion, transendothelial migration (TEM) and phagocytosis. Methodology/Principal Findings THP-1 monocytes/macropahges treated with advanced glycation end products (AGEs) resulted in a decrease of SIRPα expression but an increase of β2 integrin cell surface expression and β2 integrin-mediated adhesion to tumor necrosis factor-α (TNFα)–stimulated human microvascular endothelial cell (HMEC-1) monolayers. In contrast, SIRPα overexpression in THP-1 cells showed a significant less monocyte chemotactic protein-1 (MCP-1)–triggered cell surface expression of β2 integrins, in particular CD11b/CD18. SIRPα overexpression reduced β2 integrin-mediated firm adhesion of THP-1 cells to either TNFα–stimulated HMEC-1 monolayers or to immobilized intercellular adhesion molecule-1 (ICAM-1). SIRPα overexpression also reduced MCP-1–initiated migration of THP-1 cells across TNFα–stimulated HMEC-1 monolayers. Furthermore, β2 integrin-mediated THP-1 cell spreading and actin polymerization in response to MCP-1, and phagocytosis of bacteria were both inhibited by SIRPα overexpression. Conclusions/Significance SIRPα negatively regulates β2 integrin-mediated monocyte adhesion, transendothelial migration and phagocytosis, thus may serve as a critical molecule in preventing excessive activation and accumulation of monocytes in the arterial wall during early stage of atherosclerosis. PMID:18820737

  7. Type IV pili mechanochemically regulate virulence factors in Pseudomonas aeruginosa.

    PubMed

    Persat, Alexandre; Inclan, Yuki F; Engel, Joanne N; Stone, Howard A; Gitai, Zemer

    2015-06-16

    Bacteria have evolved a wide range of sensing systems to appropriately respond to environmental signals. Here we demonstrate that the opportunistic pathogen Pseudomonas aeruginosa detects contact with surfaces on short timescales using the mechanical activity of its type IV pili, a major surface adhesin. This signal transduction mechanism requires attachment of type IV pili to a solid surface, followed by pilus retraction and signal transduction through the Chp chemosensory system, a chemotaxis-like sensory system that regulates cAMP production and transcription of hundreds of genes, including key virulence factors. Like other chemotaxis pathways, pili-mediated surface sensing results in a transient response amplified by a positive feedback that increases type IV pili activity, thereby promoting long-term surface attachment that can stimulate additional virulence and biofilm-inducing pathways. The methyl-accepting chemotaxis protein-like chemosensor PilJ directly interacts with the major pilin subunit PilA. Our results thus support a mechanochemical model where a chemosensory system measures the mechanically induced conformational changes in stretched type IV pili. These findings demonstrate that P. aeruginosa not only uses type IV pili for surface-specific twitching motility, but also as a sensor regulating surface-induced gene expression and pathogenicity.

  8. IL-10 down-regulates T cell activation by antigen-presenting liver sinusoidal endothelial cells through decreased antigen uptake via the mannose receptor and lowered surface expression of accessory molecules.

    PubMed

    Knolle, P A; Uhrig, A; Hegenbarth, S; Löser, E; Schmitt, E; Gerken, G; Lohse, A W

    1998-12-01

    Our study demonstrates that antigen-presenting liver sinusoidal endothelial cells (LSEC) induce production of interferon-gamma (IFN-gamma) from cloned Th1 CD4+ T cells. We show that LSEC used the mannose receptor for antigen uptake, which further strengthened the role of LSEC as antigen-presenting cell (APC) population in the liver. The ability of LSEC to activate cloned CD4+ T cells antigen-specifically was down-regulated by exogenous prostaglandin E2 (PGE2) and by IL-10. We identify two separate mechanisms by which IL-10 down-regulated T cell activation through LSEC. IL-10 decreased the constitutive surface expression of MHC class II as well as of the accessory molecules CD80 and CD86 on LSEC. Furthermore, IL-10 diminished mannose receptor activity in LSEC. Decreased antigen uptake via the mannose receptor and decreased expression of accessory molecules may explain the down-regulation of T cell activation through IL-10. Importantly, the expression of low numbers of antigen on MHC II in the absence of accessory signals on LSEC may lead to induction of anergy in T cells. Because PGE2 and IL-10 are released from LSEC or Kupffer cells (KC) in response to those concentrations of endotoxin found physiologically in portal venous blood, it is possible that the continuous presence of these mediators and their negative effect on the local APC may explain the inability of the liver to induce T cell activation and to clear chronic infections. Our results support the notion that antigen presentation by LSEC in the hepatic microenvironment contributes to the observed inability to mount an effective cell-mediated immune response in the liver.

  9. Memory Enhancement by Targeting Cdk5 Regulation of NR2B

    PubMed Central

    Plattner, Florian; Hernandéz, Adan; Kistler, Tara M.; Pozo, Karine; Zhong, Ping; Yuen, Eunice Y.; Tan, Chunfeng; Hawasli, Ammar H.; Cooke, Sam F.; Nishi, Akinori; Guo, Ailan; Wiederhold, Thorsten; Yan, Zhen; Bibb, James A.

    2014-01-01

    SUMMARY Many psychiatric and neurological disorders are characterized by learning and memory deficits, for which cognitive enhancement is considered a valid treatment strategy. The N-methyl-D-aspartate receptor (NMDAR) is a prime target for the development of cognitive enhancers due to its fundamental role in learning and memory. In particular, the NMDAR subunit NR2B improves synaptic plasticity and memory when over-expressed in neurons. However, NR2B regulation is not well understood and no therapies potentiating NMDAR function have been developed. Here, we show that serine 1116 of NR2B is phosphorylated by cyclin-dependent kinase 5 (Cdk5). Cdk5-dependent NR2B phosphorylation is regulated by neuronal activity and controls the receptor’s cell surface expression. Disrupting NR2B-Cdk5 interaction using a small interfering peptide (siP) increases NR2B surface levels, facilitates synaptic transmission, and improves memory formation in vivo. Our results reveal a novel regulatory mechanism critical to NR2B function that can be targeted for the development of cognitive enhancers. PMID:24607229

  10. Effect of Chinese herbal compound Naofucong () on the inflammatory process induced by high glucose in BV-2 cells.

    PubMed

    Jing, Guang-Chan; Zhang, Meng-Ren; Ji, Chao; Zuo, Ping-Ping; Liu, Yu-Qin; Gu, Bei

    2016-11-01

    To determine the effect of medicated serum of Chinese herbal compound Naofucong (, NFC) on the microglia BV-2 cells viability and the transcription and expression of interleukin-6 (IL-6) and tumor necrosis factor α (TNF-α) in microglia BV-2 cells to further explore the mechanisms underlying the protective effect of NFC on inflammatory process induced by high glucose. The microglia BV-2 cells incubated in vitro were divided into different groups: the control group (25 mmol/L glucose), the model group (75 mmol/L glucose), high glucose media containing different dose medicated serum of NFC. After being cultured for 24 h, changes in IL-6 and TNF-α were measured by quantitative real-time polymerase chain reaction and enzyme-linked immunosorbent assay. The expression of surface marker CD11b of activated microglia was measured by confocal laser scanning microscope and Western blot. Nuclear factor-κB (NF-κB) p-p65 expression was analyzed by Western blot. The model group obviously increased the expression of microglial surface marker CD11b and NF-κB p-p65 (all P<0.01), induced a signifificant up-regulation of release and the mRNA expression of IL-6 and TNF-α (P<0.01 or P<0.05). The medicated serum of NFC could obviously down-regulate the transcription and expression of surface marker CD11 b and NF-κB p-p65 (all P<0.01), and inhibit the mRNA and protein expression (P<0.01 or P<0.05) of inflflammatory cytokines, such as IL-6 and TNF-α, in microglia BV-2 cells cultured with high glucose for 24 h. The inhibition of microglial activation and IL-6 and TNF-α expression induced by high glucose may at least partly explain NFC therapeutic effects on diabetes-associated cognitive decline diseases. Its underlying mechanism could probably be related to the inhibition of NFC on NF-κB phosphorylation.

  11. WNK4 inhibits plasma membrane targeting of NCC through regulation of syntaxin13 SNARE formation.

    PubMed

    Chung, Woo Young; Park, Hyun Woo; Han, Jung Woo; Lee, Min Goo; Kim, Joo Young

    2013-12-01

    WNK4, a serine/threonine kinase, plays a critical role in the expression of membrane proteins in the cell surface; however, the underlying mechanism of WNK4 is not clear. Here, we demonstrate that WNK4 inhibits the fusion of plasma membrane delivering vesicle with sorting/recycling endosome through disrupting SNARE formation of syntaxin13, an endosomal t-SNARE and VAMP2, the v-SNARE in plasma membrane delivering vesicle. Their interaction and co-localization were enhanced by hyperosmotic stimulation which is known for WNK4 activation. The kinase domain of WNK4 interacts with the transmembrane domain (TM) of syntaxin13 and this interaction was abolished when the TM was replaced with that of syntaxin16. Interestingly, cell fractionation using sucrose gradients revealed that WNK4 inhibited the formation of the syntaxin13/VAMP2 SNARE complex in the endosomal compartment, but not syntaxin16/VAMP2 or syntaxin13/VAMP7. Syntaxin13 was not phosphorylated by WNK4 and WNK4KI also showed the same binding strength and similar inhibitory regulation on SNARE formation of syntaxin13. Physiological relevance of this mechanism was proved with the expression of NCC (Na(+) C1(-) co-transporter) in the cell surface. The inhibiting activity of WNK4 on surface expression of NCC was abolished by syntaxin13 siRNA transfection. These results suggest that WNK4 attenuates PM targeting of NCC proteins through regulation of syntaxin13 SNARE complex formation with VAMP2 in recycling and sorting endosome. © 2013.

  12. Hyaluronan as an Immune Regulator in Human Diseases

    PubMed Central

    NOBLE, PAUL W.; LIANG, JIURONG; JIANG, DIANHUA

    2010-01-01

    Accumulation and turnover of extracellular matrix components are the hallmarks of tissue injury. Fragmented hyaluronan stimulates the expression of inflammatory genes by a variety of immune cells at the injury site. Hyaluronan binds to a number of cell surface proteins on a variety of cell types. Hyaluronan fragments signal through both Toll-like receptor (TLR) 4 and TLR2 as well as CD44 to stimulate inflammatory genes in inflammatory cells. Hyaluronan is also present on the cell surface of epithelial cells and provides protection against tissue damage by interacting with TLR2 and TLR4 on these parenchymal cells. Hyaluronan and hyaluronan-binding proteins regulate inflammation, tissue injury and repair through regulating inflammatory cell recruitment, release of inflammatory cytokines, and stem cell migration. This review focuses on the role of hyaluronan as an immune regulator in human diseases. PMID:21248167

  13. Promoting Thiol Expression Increases The Durability of Antitumor T cell Functions

    PubMed Central

    Scurti, Gina; Thyagarajan, Krishnamurthy; Kaur, Navtej; Husain, Shahid; Fang, Quan; Naga, Osama S.; Simms, Patricia; Beeson, Gyda; Voelkel-Johnson, Christina; Garrett-Mayer, Elizabeth; Beeson, Craig C.; Nishimura, Michael I.; Mehrotra, Shikhar

    2014-01-01

    Ex vivo-expanded CD8+ T cells used for adoptive immunotherapy generally acquire an effector memory-like phenotype (TEM cells). With regard to therapeutic applications, two undesired features of this phenotype in vivo are limited persistence and reduced anti-tumor efficacy, relative to CD8+ T cells with a central memory-like phenotype (TCM cells). Further, there is incomplete knowledge about all the differences between TEM and TCM cells that may influence tumor treatment outcomes. Given that TCM cells survive relatively longer in oxidative tumor microenvironments, we investigated the hypothesis that TCM possess relatively greater anti-oxidative capacity than TEM cells. Here we report that TCM cells exhibit a relative increase compared to TEM cells in expression of cell surface thiols, a key target of cellular redox controls, along with other antioxidant molecules. Increased expression of redox regulators in TCM cells inversely correlated with the generation of reactive oxygen and nitrogen species, proliferative capacity and glycolytic enzyme levels. Notably, TCR-transduced T cells pretreated with thiol donors, such as N-acetyl cysteine or rapamycin, up-regulated thiol levels and antioxidant genes. A comparison of anti-tumor CD8+ T cell populations on the basis of surface thiol expression showed that thiol-high cells persisted longer in vivo and exerted superior tumor control. Our results suggest that higher levels of reduced cell surface thiols are a key characteristic of T cells that can control tumor growth, and that profiling this biomarker may have benefits to T cell adoptive immunotherapy protocols. PMID:25164014

  14. STEAP: A prostate-specific cell-surface antigen highly expressed in human prostate tumors

    PubMed Central

    Hubert, Rene S.; Vivanco, Igor; Chen, Emily; Rastegar, Shiva; Leong, Kahan; Mitchell, Steve C.; Madraswala, Rashida; Zhou, Yanhong; Kuo, James; Raitano, Arthur B.; Jakobovits, Aya; Saffran, Douglas C.; Afar, Daniel E. H.

    1999-01-01

    In search of novel genes expressed in metastatic prostate cancer, we subtracted cDNA isolated from benign prostatic hypertrophic tissue from cDNA isolated from a prostate cancer xenograft model that mimics advanced disease. One novel gene that is highly expressed in advanced prostate cancer encodes a 339-amino acid protein with six potential membrane-spanning regions flanked by hydrophilic amino- and carboxyl-terminal domains. This structure suggests a potential function as a channel or transporter protein. This gene, named STEAP for six-transmembrane epithelial antigen of the prostate, is expressed predominantly in human prostate tissue and is up-regulated in multiple cancer cell lines, including prostate, bladder, colon, ovarian, and Ewing sarcoma. Immunohistochemical analysis of clinical specimens demonstrates significant STEAP expression at the cell–cell junctions of the secretory epithelium of prostate and prostate cancer cells. Little to no staining was detected at the plasma membranes of normal, nonprostate human tissues, except for bladder tissue, which expressed low levels of STEAP at the cell membrane. Protein analysis located STEAP at the cell surface of prostate-cancer cell lines. Our results support STEAP as a cell-surface tumor-antigen target for prostate cancer therapy and diagnostic imaging. PMID:10588738

  15. HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells

    PubMed Central

    Gornalusse, Germán G.; Hirata, Roli K.; Funk, Sarah; Riolobos, Laura; Lopes, Vanda S.; Manske, Gabriel; Prunkard, Donna; Colunga, Aric G.; Hanafi, Laïla-Aïcha; Clegg, Dennis O.; Turtle, Cameron; Russell, David W.

    2017-01-01

    Polymorphisms in the human leukocyte antigen (HLA) class I genes can cause the rejection of pluripotent stem cell (PSC)-derived products in allogeneic recipients. Disruption of the Beta-2 Microglobulin (B2M) gene eliminates surface expression of all class I molecules, but leaves the cells vulnerable to lysis by natural killer (NK) cells. Here we show that this ‘missing self’ response can be prevented by forced expression of minimally polymorphic HLA-E molecules. We use adeno-associated virus (AAV)-mediated gene editing to knock in HLA-E genes at the B2M locus in human PSCs in a manner that confers inducible, regulated, surface expression of HLA-E single-chain dimers (fused to B2M) or trimers (fused to B2M and a peptide antigen), without surface expression of HLA-A, B or C. These HLA-engineered PSCs and their differentiated derivatives are not recognized as allogeneic by CD8+ T cells, do not bind anti-HLA antibodies, and are resistant to NK-mediated lysis. Our approach provides a potential source of universal donor cells for applications where the differentiated derivatives lack HLA class II expression. PMID:28504668

  16. HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells.

    PubMed

    Gornalusse, Germán G; Hirata, Roli K; Funk, Sarah E; Riolobos, Laura; Lopes, Vanda S; Manske, Gabriel; Prunkard, Donna; Colunga, Aric G; Hanafi, Laïla-Aïcha; Clegg, Dennis O; Turtle, Cameron; Russell, David W

    2017-08-01

    Polymorphisms in the human leukocyte antigen (HLA) class I genes can cause the rejection of pluripotent stem cell (PSC)-derived products in allogeneic recipients. Disruption of the Beta-2 Microglobulin (B2M) gene eliminates surface expression of all class I molecules, but leaves the cells vulnerable to lysis by natural killer (NK) cells. Here we show that this 'missing-self' response can be prevented by forced expression of minimally polymorphic HLA-E molecules. We use adeno-associated virus (AAV)-mediated gene editing to knock in HLA-E genes at the B2M locus in human PSCs in a manner that confers inducible, regulated, surface expression of HLA-E single-chain dimers (fused to B2M) or trimers (fused to B2M and a peptide antigen), without surface expression of HLA-A, B or C. These HLA-engineered PSCs and their differentiated derivatives are not recognized as allogeneic by CD8 + T cells, do not bind anti-HLA antibodies and are resistant to NK-mediated lysis. Our approach provides a potential source of universal donor cells for applications where the differentiated derivatives lack HLA class II expression.

  17. Relationship between Expression of Cellular Receptor-27.8 kDa and Lymphocystis Disease Virus (LCDV) Infection.

    PubMed

    Wu, Ronghua; Tang, Xiaoqian; Sheng, Xiuzhen; Zhan, Wenbin

    2015-01-01

    The 27.8 kDa membrane protein from flounder (Paralichthys olivaceus) gill (FG) cells was previously identified as a putative cellular receptor involved in lymphocystis disease virus (LCDV) infection. In this paper, the expression of receptor-27.8 kDa (27.8R) and LCDV loads in FG cells and hirame natural embryo (HINAE) cells were investigated upon LCDV infection and anti-27.8R monoclonal antibody (MAb) treatment. The results showed the 27.8R was expressed and co-localized with LCDV in both FG and HINAE cell surface. After LCDV infection, the expression of 27.8R exhibited a dose-dependent up-regulation with the increasing of LCDV titers, and demonstrated a tendency to increase firstly and then decrease during a time course up to 9 days; LCDV copies showed a similar variation trend to the 27.8R expression, however, it reached the highest level later than did the 27.8R expression. Additionally, the 27.8R expression and LCDV copies in FG cells were higher than those in HINAE cells. In the presence of increasing concentration of the anti-27.8R MAbs, the up-regulation of 27.8R expression and the copy numbers of LCDV significantly declined post LCDV infection, and the cytopathic effect induced by LCDV in the two cell lines was accordingly reduced, indicating anti-27.8R MAbs pre-incubation could inhibit the up-regulation of 27.8R expression and LCDV infection. These results suggested that LCDV infection could induce up-regulation of 27.8R expression, which in turn increased susceptibility and availability of FG and HINAE cells for LCDV entry, providing important new insights into the LCDV replication cycle and the interaction between this virus and the host cells.

  18. Relationship between Expression of Cellular Receptor-27.8kDa and Lymphocystis Disease Virus (LCDV) Infection

    PubMed Central

    Wu, Ronghua; Tang, Xiaoqian; Sheng, Xiuzhen; Zhan, Wenbin

    2015-01-01

    The 27.8kDa membrane protein from flounder (Paralichthys olivaceus) gill (FG) cells was previously identified as a putative cellular receptor involved in lymphocystis disease virus (LCDV) infection. In this paper, the expression of receptor-27.8kDa (27.8R) and LCDV loads in FG cells and hirame natural embryo (HINAE) cells were investigated upon LCDV infection and anti-27.8R monoclonal antibody (MAb) treatment. The results showed the 27.8R was expressed and co-localized with LCDV in both FG and HINAE cell surface. After LCDV infection, the expression of 27.8R exhibited a dose-dependent up-regulation with the increasing of LCDV titers, and demonstrated a tendency to increase firstly and then decrease during a time course up to 9 days; LCDV copies showed a similar variation trend to the 27.8R expression, however, it reached the highest level later than did the 27.8R expression. Additionally, the 27.8R expression and LCDV copies in FG cells were higher than those in HINAE cells. In the presence of increasing concentration of the anti-27.8R MAbs, the up-regulation of 27.8R expression and the copy numbers of LCDV significantly declined post LCDV infection, and the cytopathic effect induced by LCDV in the two cell lines was accordingly reduced, indicating anti-27.8R MAbs pre-incubation could inhibit the up-regulation of 27.8R expression and LCDV infection. These results suggested that LCDV infection could induce up-regulation of 27.8R expression, which in turn increased susceptibility and availability of FG and HINAE cells for LCDV entry, providing important new insights into the LCDV replication cycle and the interaction between this virus and the host cells. PMID:26024218

  19. The N-terminal domain of the thermo-regulated surface protein PrpA of Enterococcus faecium binds to fibrinogen, fibronectin and platelets

    PubMed Central

    Guzmán Prieto, Ana M.; Urbanus, Rolf T.; Zhang, Xinglin; Bierschenk, Damien; Koekman, C. Arnold; van Luit-Asbroek, Miranda; Ouwerkerk, Janneke P.; Pape, Marieke; Paganelli, Fernanda L.; Wobser, Dominique; Huebner, Johannes; Hendrickx, Antoni P. A.; Bonten, Marc J. M.; Willems, Rob J. L.; van Schaik, Willem

    2015-01-01

    Enterococcus faecium is a commensal of the mammalian gastrointestinal tract, but is also found in non-enteric environments where it can grow between 10 °C and 45 °C. E. faecium has recently emerged as a multi-drug resistant nosocomial pathogen. We hypothesized that genes involved in the colonization and infection of mammals exhibit temperature-regulated expression control and we therefore performed a transcriptome analysis of the clinical isolate E. faecium E1162, during mid-exponential growth at 25 °C and 37 °C. One of the genes that exhibited differential expression between 25 °C and 37 °C, was predicted to encode a peptidoglycan-anchored surface protein. The N-terminal domain of this protein is unique to E. faecium and closely related enterococci, while the C-terminal domain is homologous to the Streptococcus agalactiae surface protein BibA. This region of the protein contains proline-rich repeats, leading us to name the protein PrpA for proline-rich protein A. We found that PrpA is a surface-exposed protein which is most abundant during exponential growth at 37 °C in E. faecium E1162. The heterologously expressed and purified N-terminal domain of PrpA was able to bind to the extracellular matrix proteins fibrinogen and fibronectin. In addition, the N-terminal domain of PrpA interacted with both non-activated and activated platelets. PMID:26675410

  20. The N-terminal domain of the thermo-regulated surface protein PrpA of Enterococcus faecium binds to fibrinogen, fibronectin and platelets.

    PubMed

    Guzmán Prieto, Ana M; Urbanus, Rolf T; Zhang, Xinglin; Bierschenk, Damien; Koekman, C Arnold; van Luit-Asbroek, Miranda; Ouwerkerk, Janneke P; Pape, Marieke; Paganelli, Fernanda L; Wobser, Dominique; Huebner, Johannes; Hendrickx, Antoni P A; Bonten, Marc J M; Willems, Rob J L; van Schaik, Willem

    2015-12-17

    Enterococcus faecium is a commensal of the mammalian gastrointestinal tract, but is also found in non-enteric environments where it can grow between 10 °C and 45 °C. E. faecium has recently emerged as a multi-drug resistant nosocomial pathogen. We hypothesized that genes involved in the colonization and infection of mammals exhibit temperature-regulated expression control and we therefore performed a transcriptome analysis of the clinical isolate E. faecium E1162, during mid-exponential growth at 25 °C and 37 °C. One of the genes that exhibited differential expression between 25 °C and 37 °C, was predicted to encode a peptidoglycan-anchored surface protein. The N-terminal domain of this protein is unique to E. faecium and closely related enterococci, while the C-terminal domain is homologous to the Streptococcus agalactiae surface protein BibA. This region of the protein contains proline-rich repeats, leading us to name the protein PrpA for proline-rich protein A. We found that PrpA is a surface-exposed protein which is most abundant during exponential growth at 37 °C in E. faecium E1162. The heterologously expressed and purified N-terminal domain of PrpA was able to bind to the extracellular matrix proteins fibrinogen and fibronectin. In addition, the N-terminal domain of PrpA interacted with both non-activated and activated platelets.

  1. High cell surface death receptor expression determines type I versus type II signaling.

    PubMed

    Meng, Xue Wei; Peterson, Kevin L; Dai, Haiming; Schneider, Paula; Lee, Sun-Hee; Zhang, Jin-San; Koenig, Alexander; Bronk, Steve; Billadeau, Daniel D; Gores, Gregory J; Kaufmann, Scott H

    2011-10-14

    Previous studies have suggested that there are two signaling pathways leading from ligation of the Fas receptor to induction of apoptosis. Type I signaling involves Fas ligand-induced recruitment of large amounts of FADD (FAS-associated death domain protein) and procaspase 8, leading to direct activation of caspase 3, whereas type II signaling involves Bid-mediated mitochondrial perturbation to amplify a more modest death receptor-initiated signal. The biochemical basis for this dichotomy has previously been unclear. Here we show that type I cells have a longer half-life for Fas message and express higher amounts of cell surface Fas, explaining the increased recruitment of FADD and subsequent signaling. Moreover, we demonstrate that cells with type II Fas signaling (Jurkat or HCT-15) can signal through a type I pathway upon forced receptor overexpression and that shRNA-mediated Fas down-regulation converts cells with type I signaling (A498) to type II signaling. Importantly, the same cells can exhibit type I signaling for Fas and type II signaling for TRAIL (TNF-α-related apoptosis-inducing ligand), indicating that the choice of signaling pathway is related to the specific receptor, not some other cellular feature. Additional experiments revealed that up-regulation of cell surface death receptor 5 levels by treatment with 7-ethyl-10-hydroxy-camptothecin converted TRAIL signaling in HCT116 cells from type II to type I. Collectively, these results suggest that the type I/type II dichotomy reflects differences in cell surface death receptor expression.

  2. Altered gene expression in tree shrew retina and retinal pigment epithelium produced by short periods of minus-lens wear.

    PubMed

    He, Li; Frost, Michael R; Siegwart, John T; Norton, Thomas T

    2018-03-01

    Hyperopic refractive error is detected by retinal neurons, which generate GO signals through a direct emmetropization signaling cascade: retinal pigment epithelium (RPE) into choroid and then into sclera, thereby increasing axial elongation. To examine signaling early in this cascade, we measured gene expression in the retina and RPE after short exposure to hyperopia produced by minus-lens wear. Gene expression in each tissue was compared with gene expression in combined retina + RPE. Starting 24 days after normal eye opening, three groups of juvenile tree shrews (n = 7 each) wore a monocular -5 D lens. The untreated fellow eye served as a control. The "6h" group wore the lens for 6 h; the "24h" group wore the lens for 24 h; each group provided separate retina and RPE tissues. Group "24hC" wore the lens for 24 h and provided combined retina + RPE tissue. Quantitative PCR was used to measure the relative differences (treated eye vs. control eye) in mRNA levels for 66 candidate genes. In the retina after 6 h, mRNA levels for seven genes were significantly regulated: EGR1 and FOS (early intermediate genes) were down-regulated in the treated eyes. Genes with secreted protein products, BMP2 and CTGF, were down-regulated, whilst FGF10, IL18, and SST were up-regulated. After 24 h the pattern changed; only one of the seven genes still showed differential expression; BMP2 was still down-regulated. Two new genes with secreted protein products, IGF2 and VIP, were up-regulated. In the RPE, consistent with its role in receiving, processing, and transmitting GO signaling, differential expression was found for genes whose protein products are at the cell surface, intracellular, in the nucleus, and are secreted. After 6 h, mRNA levels for 17 genes were down-regulated in the treated eyes, whilst four genes (GJA1, IGF2R, LRP2, and IL18) were up-regulated. After 24 h the pattern was similar; mRNA levels for 14 of the same genes were still down-regulated; only LRP2 remained up-regulated. mRNA levels for six genes no longer showed differential expression, whilst nine genes, not differentially expressed at 6 h, now showed differential expression. In the combined retina + RPE after 24 h, mRNA levels for only seven genes were differentially regulated despite the differential expression of many genes in the RPE. Four genes showed the same expression in combined tissue as in retina alone, including up-regulation of VIP despite significant VIP down-regulation in RPE. Thus, hyperopia-induced GO signaling, as measured by differential gene expression, differs in the retina and the RPE. Retinal gene expression changed between 6 h and 24 h of treatment, suggesting evolution of the retinal response. Gene expression in the RPE was similar at both time points, suggesting sustained signaling. The combined retina + RPE does not accurately represent gene expression in either retina or, especially, RPE. When gene expression signatures were compared with those in choroid and sclera, GO signaling, as encoded by differential gene expression, differs in each compartment of the direct emmetropization signaling cascade. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  4. Comparative Transcriptome Analysis of Desulfovibrio Vulgaris Grown in Planktonic Culture and Mature Biofilm on a Steel Surface

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Weiwen; Culley, David E.; Nie, Lei

    2007-08-01

    The build-up of biofilms of sulphate -reducing bacteria (SRB) on metals surfaces may lead to severe corrosion of iron. To understand the processes at molecular level, in this study, a whole-genome oligonucleotide microarray was used to examine differential expression patterns between planktonic populations and mature biofilm of model SRB species Desulfovibrio vulgaris. Statistical analysis revealed that 472 genes were differentially expressed (1.5 fold or more with a p value less than 0.025) when comparing biofilm to planktonic cells. Among the differentially expressed genes were several that corresponded to biofilm formation genes identified in many aerobic bacterial biofilms (i.e., Pseudomonas speciesmore » and Escherichia coli), such as down-regulation of genes encoding flagellin, flagellar motor switch protein and chemotaxis proteins involved in cell motility and induction of genes encoding sugar transferase and glycogen synthase involved in exopolysaccharide biosynthesis. In addition, D. vulgaris biofilm-bound cells exhibited decreased transcription of genes involved in protein synthesis, energy metabolism and sulfate reduction, as well as genes involved in general stress responses. These findings were all consistent with early suggestion that the average physiology of biofilm cells were similar to planktonic cells of stationary phases. Most notably, up-regulation of large number of outer membrane proteins was observed in D. vulgaris biofilm. Although their function is still unknown, the higher expression of these genes in D. vulgaris biofilm could implicate important roles formation and maintenance of multi-cellular consortium on metal surface. The study provided insights into the metabolic networks associated with D. vulgaris biofilm formation and maintenance on an iron surface.« less

  5. Tim2 is expressed in mouse fetal hepatocytes and regulates their differentiation.

    PubMed

    Watanabe, Natsumi; Tanaka, Minoru; Suzuki, Kaori; Kumanogoh, Atsushi; Kikutani, Hitoshi; Miyajima, Atsushi

    2007-05-01

    Liver development is regulated by various extracellular molecules such as cytokines and cell surface proteins. Although several such regulators have been identified, additional molecules are likely to be involved in liver development. To identify such molecules, we employed the signal sequence trap (SST) method to screen cDNAs encoding a secreted or membrane protein from fetal liver and obtained a number of clones. Among them, we found that T cell immunoglobulin and mucin domain 2 (Tim2) was expressed specifically on immature hepatocytes in the fetal liver. Tim2 has been shown to regulate immune responses, but its role in liver development had not been studied. We have examined the possible role of Tim2 in hepatocyte differentiation. At first, we prepared a soluble Tim2 fusion protein consisting of its extracellular domain and the Fc domain of human IgG (Tim2-hFc) and found that it bound to fetal and adult hepatocytes, suggesting that there are Tim2-binding molecules on hepatocytes. Second, Tim2-hFc inhibited the differentiation of hepatocytes in fetal liver primary culture, i.e., the expression of mature hepatic enzymes and accumulation of glycogen were severely reduced. Third, Tim2-hFc also inhibited proliferation of fetal hepatocytes. Fourth, down-regulation of Tim2 expression by small interfering RNA (siRNA) enhanced the expression of liver differentiation marker genes. It is strongly suggested that Tim2 is involved in the differentiation of fetal hepatocytes.

  6. Dynamic balance between master transcription factors determines the fates and functions of CD4 T cell and innate lymphoid cell subsets

    PubMed Central

    2017-01-01

    CD4 T cells, including T regulatory cells (Treg cells) and effector T helper cells (Th cells), and recently identified innate lymphoid cells (ILCs) play important roles in host defense and inflammation. Both CD4 T cells and ILCs can be classified into distinct lineages based on their functions and the expression of lineage-specific genes, including those encoding effector cytokines, cell surface markers, and key transcription factors. It was first recognized that each lineage expresses a specific master transcription factor and the expression of these factors is mutually exclusive because of cross-regulation among these factors. However, recent studies indicate that the master regulators are often coexpressed. Furthermore, the expression of master regulators can be dynamic and quantitative. In this review, we will first discuss similarities and differences between the development and functions of CD4 T cell and ILC subsets and then summarize recent literature on quantitative, dynamic, and cell type–specific balance between the master transcription factors in determining heterogeneity and plasticity of these subsets. PMID:28630089

  7. Early Hematopoietic Zinc Finger Protein Prevents Tumor Cell Recognition by Natural Killer Cells1

    PubMed Central

    La Rocca, Rosanna; Fulciniti, Mariateresa; Lakshmikanth, Tadepally; Mesuraca, Maria; Ali, Talib Hassan; Mazzei, Valerio; Amodio, Nicola; Catalano, Lucio; Rotoli, Bruno; Ouerfelli, Ouathek; Grieco, Michele; Gulletta, Elio; Bond, Heather M.; Morrone, Giovanni; Ferrone, Soldano; Carbone, Ennio

    2009-01-01

    Early hematopoietic zinc finger/zinc finger protein 521 (EHZF/ZNF521) is a novel zinc finger protein expressed in hematopoietic stem and progenitor cells and is down-regulated during their differentiation. Its transcript is also abundant in some hematopoietic malignancies. Analysis of the changes in the antigenic profile of cells transfected with EHZF cDNA revealed up-regulation of HLA class I cell surface expression. This phenotypic change was associated with an increased level of HLA class I H chain, in absence of detectable changes in the expression of other Ag-processing machinery components. Enhanced resistance of target cells to NK cell-mediated cytotoxicity was induced by enforced expression of EHZF in the cervical carcinoma cell line HeLa and in the B lymphoblastoid cell line IM9. Preincubation of transfected cells with HLA class I Ag-specific mAb restored target cell susceptibility to NK cell-mediated lysis, indicating a specific role for HLA class I Ag up-regulation in the NK resistance induced by EHZF. A potential clinical significance of these findings is further suggested by the inverse correlation between EHZF and MHC class I expression levels, and autologous NK susceptibility of freshly explanted multiple myeloma cells. PMID:19342626

  8. Regulation of EMMPRIN (CD147) on monocyte subsets in patients with symptomatic coronary artery disease.

    PubMed

    Sturhan, Henrik; Ungern-Sternberg, Saskia N I v; Langer, Harald; Gawaz, Meinrad; Geisler, Tobias; May, Andreas E; Seizer, Peter

    2015-06-01

    The role of individual monocyte subsets in inflammatory cardiovascular diseases is insufficiently understood. Although the Extracellular Matrix Metalloproteinase Inducer (EMMPRIN) regulates important processes for inflammation such as MMP-release, its expression and regulation on monocyte subsets has not been characterized. In this clinical study, blood was obtained from 80 patients with stable coronary artery disease (CAD), 49 with acute myocardial infarction (AMI) and 34 healthy controls. Monocytes were divided into 3 subsets: CD14(++)CD16(-) (low), CD14(++)CD16(+) (intermediate), CD14(+)CD16(++) (high) according to phenotypic markers analyzed by flow cytometry. Surface expression of EMMPRIN was evaluated and compared with CD36 and CD47 expression. In all patients, EMMPRIN expression was significantly different among monocyte subsets with the highest expression on "classical" CD14(++)CD16(-) monocytes. EMMPRIN was upregulated on all monocyte subsets in patients with AMI as compared to patients with stable CAD. Notably, neither CD47 nor CD36 revealed a significant difference in patients with AMI compared to patients with stable CAD. EMMPRIN could serve as a marker for classical monocytes, which is upregulated in patients with acute myocardial infarction. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Immune regulation by CD40-CD40-l interactions - 2; Y2K update.

    PubMed

    van Kooten, C

    2000-11-01

    CD40 is a cell surface receptor, which belongs to the TNF-R family, and which was first identified and functionally characterized on B lymphocytes. However, in recent years it has become clear that CD40 is expressed much broader, including expression on monocytes, dendritic cells, endothelial cells and epithelial cells. Therefore it is now thought that CD40 plays a more general role in immune regulation. The present paper reviews recent developments in this field of research, with main emphasis on CD40 signal transduction and on in vivo functions of CD40/CD40-L interactions.

  10. The transcriptional programme of Salmonella enterica serovar Typhimurium reveals a key role for tryptophan metabolism in biofilms

    PubMed Central

    2009-01-01

    Background Biofilm formation enhances the capacity of pathogenic Salmonella bacteria to survive stresses that are commonly encountered within food processing and during host infection. The persistence of Salmonella within the food chain has become a major health concern, as biofilms can serve as a reservoir for the contamination of food products. While the molecular mechanisms required for the survival of bacteria on surfaces are not fully understood, transcriptional studies of other bacteria have demonstrated that biofilm growth triggers the expression of specific sets of genes, compared with planktonic cells. Until now, most gene expression studies of Salmonella have focused on the effect of infection-relevant stressors on virulence or the comparison of mutant and wild-type bacteria. However little is known about the physiological responses taking place inside a Salmonella biofilm. Results We have determined the transcriptomic and proteomic profiles of biofilms of Salmonella enterica serovar Typhimurium. We discovered that 124 detectable proteins were differentially expressed in the biofilm compared with planktonic cells, and that 10% of the S. Typhimurium genome (433 genes) showed a 2-fold or more change in the biofilm compared with planktonic cells. The genes that were significantly up-regulated implicated certain cellular processes in biofilm development including amino acid metabolism, cell motility, global regulation and tolerance to stress. We found that the most highly down-regulated genes in the biofilm were located on Salmonella Pathogenicity Island 2 (SPI2), and that a functional SPI2 secretion system regulator (ssrA) was required for S. Typhimurium biofilm formation. We identified STM0341 as a gene of unknown function that was needed for biofilm growth. Genes involved in tryptophan (trp) biosynthesis and transport were up-regulated in the biofilm. Deletion of trpE led to decreased bacterial attachment and this biofilm defect was restored by exogenous tryptophan or indole. Conclusions Biofilm growth of S. Typhimurium causes distinct changes in gene and protein expression. Our results show that aromatic amino acids make an important contribution to biofilm formation and reveal a link between SPI2 expression and surface-associated growth in S. Typhimurium. PMID:20003355

  11. FOXP3, CBLB and ITCH gene expression and cytotoxic T lymphocyte antigen 4 expression on CD4+CD25high T cells in multiple sclerosis

    PubMed Central

    Sellebjerg, F; Krakauer, M; Khademi, M; Olsson, T; Sørensen, P S

    2012-01-01

    Expression of the forkhead box protein 3 (FoxP3) transcription factor is regulated by the E3 ubiquitin ligases Itch and Cbl-b and induces regulatory activity CD4+CD25high T cells. Treatment with interferon (IFN)-β enhances regulatory T cell activity in multiple sclerosis (MS). We studied the phenotype of CD4+CD25high T cells in MS by flow cytometry and its relationship with expression of the FOXP3, ITCH and CBLB genes. We found that untreated MS patients had lower cell surface expression of cytotoxic T lymphocyte antigen 4 (CTLA-4) on CD4+CD25high T cells and higher intracellular CTLA-4 expression than healthy controls. Cell surface expression of CTLA-4 on CD4+CD25high T cells correlated with expression of FOXP3 mRNA in untreated patients and increased significantly with time from most recent injection in patients treated with IFN-β. FOXP3 mRNA expression correlated with CBLB and ITCH and T helper type 2 cytokine mRNA expression in MS patients. These data link expression of FOXP3, CBLB and ITCH mRNA and CTLA-4 expression on the surface of CD4+CD25high T cell in MS. We hypothesize that this may reflect alterations in the inhibitory effect of CTLA-4 or in regulatory T cell function. PMID:23039885

  12. Use of a dynamic in vitro attachment and invasion system (DIVAS) to determine influence of growth rate on invasion of respiratory epithelial cells by group B Streptococcus.

    PubMed

    Malin, G; Paoletti, L C

    2001-11-06

    Expression of capsular polysaccharide (CPS) and some surface proteins by group B Streptococcus (GBS) is regulated by growth rate. We hypothesized that precise control of GBS growth, and thus surface-expressed components, could modulate the ability of GBS to invade eukaryotic cells. To test this hypothesis, a dynamic in vitro attachment and invasion system (DIVAS) was developed that combines the advantages of bacterial growth in continuous culture with tissue culture. Tissue culture flasks were modified with inlet and outlet ports to permit perfusion of GBS. Encapsulated type III GBS strains M781 and COH1 and strains COH1-11 and COH1-13 (transposon mutants of COH1 that express an asialo CPS or are acapsular, respectively) were grown in continuous culture in a chemically defined medium at fast mass doubling time (t(d) = 1.8 h) and slow (t(d) = 11 h) growth rates, conditions previously shown to induce and repress, respectively, type III CPS expression. Encapsulated GBS strains invaded A549 respiratory epithelial cells 20- to 700-fold better at the fast than at the slow growth rate, suggesting a role for CPS. However, unencapsulated GBS were also invasive but only when cultured at the fast growth rate, which indicates that GBS invasion is independent of CPS expression and can be regulated by growth rate. Growth rate-dependent invasion occurred when GBS was grown in continuous culture under glucose-defined, thiamine-defined, and undefined nutrient limitations. These results suggest a growth rate-dependent regulation of GBS pathogenesis and demonstrate the usefulness of DIVAS as a tool in studies of host-microbe interactions.

  13. Mammalian target of rapamycin signalling modulates amino acid uptake by regulating transporter cell surface abundance in primary human trophoblast cells.

    PubMed

    Rosario, Fredrick J; Kanai, Yoshikatsu; Powell, Theresa L; Jansson, Thomas

    2013-02-01

    Abnormal fetal growth increases the risk for perinatal complications and predisposes for the development of obesity, diabetes and cardiovascular disease later in life. Emerging evidence suggests that changes in placental amino acid transport directly contribute to altered fetal growth. However, the molecular mechanisms regulating placental amino acid transport are largely unknown. Here we combined small interfering (si) RNA-mediated silencing approaches with protein expression/localization and functional studies in cultured primary human trophoblast cells to test the hypothesis that mammalian target of rapamycin complex 1 (mTORC1) and 2 (mTORC2) regulate amino acid transporters by post-translational mechanisms. Silencing raptor (inhibits mTORC1) or rictor (inhibits mTORC2) markedly decreased basal System A and System L amino acid transport activity but had no effect on growth factor-stimulated amino acid uptake. Simultaneous inhibition of mTORC1 and 2 completely inhibited both basal and growth factor-stimulated amino acid transport activity. In contrast, mTOR inhibition had no effect on serotonin transport. mTORC1 or mTORC2 silencing markedly decreased the plasma membrane expression of specific System A (SNAT2, SLC38A2) and System L (LAT1, SLC7A5) transporter isoforms without affecting global protein expression. In conclusion, mTORC1 and mTORC2 regulate human trophoblast amino acid transporters by modulating the cell surface abundance of specific transporter isoforms. This is the first report showing regulation of amino acid transport by mTORC2. Because placental mTOR activity and amino acid transport are decreased in human intrauterine growth restriction our data are consistent with the possibility that dysregulation of placental mTOR plays an important role in the development of abnormal fetal growth.

  14. Mendelian and non-mendelian mutations affecting surface antigen expression in Paramecium tetraurelia.

    PubMed Central

    Epstein, L M; Forney, J D

    1984-01-01

    A screening procedure was devised for the isolation of X-ray-induced mutations affecting the expression of the A immobilization antigen (i-antigen) in Paramecium tetraurelia. Two of the mutations isolated by this procedure proved to be in modifier genes. The two genes are unlinked to each other and unlinked to the structural A i-antigen gene. These are the first modifier genes identified in a Paramecium sp. that affect surface antigen expression. Another mutation was found to be a deletion of sequences just downstream from the A i-antigen gene. In cells carrying this mutation, the A i-antigen gene lies in close proximity to the end of a macronuclear chromosome. The expression of the A i-antigen is not affected in these cells, demonstrating that downstream sequences are not important for the regulation and expression of the A i-antigen gene. A stable cell line was also recovered which shows non-Mendelian inheritance of a macronuclear deletion of the A i-antigen gene. This mutant does not contain the gene in its macronucleus, but contains a complete copy of the gene in its micronucleus. In the cytoplasm of wild-type animals, the micronuclear gene is included in the developing macronucleus; in the cytoplasm of the mutant, the incorporation of the A i-antigen gene into the macronucleus is inhibited. This is the first evidence that a mechanism is available in ciliates to control the expression of a gene by regulating its incorporation into developing macronuclei. Images PMID:6092921

  15. Molecular cloning and chromosomal mapping of bone marrow stromal cell surface gene, BST2, that may be involved in pre-B-cell growth

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ishikawa, Jun; Kaisho, Tsuneyasu; Tomizawa, Hitoshi

    1995-04-10

    Bone marrow stromal cells regulate B-cell growth and development through their surface molecules and cytokines. In this study, we generated a mAb, RS38, that recognized a novel human membrane protein, BST-2, expressed on bone marrow stromal cell lines and synovial cell lines. We cloned a cDNA encoding BST-2 from a rheumatoid arthritis-derived synovial cell line. BST-2 is a 30- to 36-kDa type II transmembrane protein, consisting of 180 amino acids. The BST-2 gene (HGMW-approved symbol BST2) is located on chromosome 19p13.2. BST-2 is expressed not only on certain bone marrow stromal cell lines but also on various normal tissues, althoughmore » its expression pattern is different from that of another bone marrow stromal cell surface molecule, BST-1. BST-2 surface expression on fibroblast cell lines facilitated the stromal cell-dependent growth of a murine bone marrow-derived pre-B-cell line, DW34. The results suggest that BST-2 may be involved in pre-B-cell growth. 45 refs., 7 figs., 2 tabs.« less

  16. CD44 Staining of Cancer Stem-Like Cells Is Influenced by Down-Regulation of CD44 Variant Isoforms and Up-Regulation of the Standard CD44 Isoform in the Population of Cells That Have Undergone Epithelial-to-Mesenchymal Transition

    PubMed Central

    Biddle, Adrian; Gammon, Luke; Fazil, Bilal; Mackenzie, Ian C.

    2013-01-01

    CD44 is commonly used as a cell surface marker of cancer stem-like cells in epithelial tumours, and we have previously demonstrated the existence of two different CD44high cancer stem-like cell populations in squamous cell carcinoma, one having undergone epithelial-to-mesenchymal transition and the other maintaining an epithelial phenotype. Alternative splicing of CD44 variant exons generates a great many isoforms, and it is not known which isoforms are expressed on the surface of the two different cancer stem-like cell phenotypes. Here, we demonstrate that cancer stem-like cells with an epithelial phenotype predominantly express isoforms containing the variant exons, whereas the cancer stem-like cells that have undergone an epithelial-to-mesenchymal transition down-regulate these variant isoforms and up-regulate expression of the standard CD44 isoform that contains no variant exons. In addition, we find that enzymatic treatments used to dissociate cells from tissue culture or fresh tumour specimens cause destruction of variant CD44 isoforms at the cell surface whereas expression of the standard CD44 isoform is preserved. This results in enrichment within the CD44high population of cancer stem-like cells that have undergone an epithelial-to-mesenchymal transition and depletion from the CD44high population of cancer stem-like cells that maintain an epithelial phenotype, and therefore greatly effects the characteristics of any cancer stem-like cell population isolated based on expression of CD44. As well as effecting the CD44high population, enzymatic treatment also reduces the percentage of the total epithelial cancer cell population staining CD44-positive, with potential implications for studies that aim to use CD44-positive staining as a prognostic indicator. Analyses of the properties of cancer stem-like cells are largely dependent on the ability to accurately identify and assay these populations. It is therefore critical that consideration be given to use of multiple cancer stem-like cell markers and suitable procedures for cell isolation in order that the correct populations are assayed. PMID:23437366

  17. Emotional labor actors: a latent profile analysis of emotional labor strategies.

    PubMed

    Gabriel, Allison S; Daniels, Michael A; Diefendorff, James M; Greguras, Gary J

    2015-05-01

    Research on emotional labor focuses on how employees utilize 2 main regulation strategies-surface acting (i.e., faking one's felt emotions) and deep acting (i.e., attempting to feel required emotions)-to adhere to emotional expectations of their jobs. To date, researchers largely have considered how each strategy functions to predict outcomes in isolation. However, this variable-centered perspective ignores the possibility that there are subpopulations of employees who may differ in their combined use of surface and deep acting. To address this issue, we conducted 2 studies that examined surface acting and deep acting from a person-centered perspective. Using latent profile analysis, we identified 5 emotional labor profiles-non-actors, low actors, surface actors, deep actors, and regulators-and found that these actor profiles were distinguished by several emotional labor antecedents (positive affectivity, negative affectivity, display rules, customer orientation, and emotion demands-abilities fit) and differentially predicted employee outcomes (emotional exhaustion, job satisfaction, and felt inauthenticity). Our results reveal new insights into the nature of emotion regulation in emotional labor contexts and how different employees may characteristically use distinct combinations of emotion regulation strategies to manage their emotional expressions at work. (c) 2015 APA, all rights reserved.

  18. Kidney protection against ischemia/reperfusion injury by myofibrillogenesis regulator-1.

    PubMed

    Wang, Xiaoreng; Tao, Tianqi; Ding, Rui; Song, Dandan; Liu, Mi; Xie, Yuansheng; Liu, Xiuhua

    2014-01-01

    Ischemia/reperfusion (I/R) injury is characterized by cytoskeletal reorganization and loss of polarity in proximal tubule epithelial cells. Previously, we showed that myofibrillogenesis regulator (MR)-1 promoted actin organization in cardiomyocytes. MR-1 is also expressed in the kidney. In this study, we investigated MR-1 expression in acute renal failure induced by I/R in Sprague-Dawley rats. We determined the MR-1 expression and the ratio of fibrous actin (F-actin) to globular actin (G-actin). HK-2 cells were treated with or without hypoxia/reoxygenation (H/R), and MR-1 levels were increased by adenoviral overexpression or silenced by RNA interference. I/R and H/R resulted in cellular injury and decreases of MR-1, the F-/G-actin ratio, and myosin light chain (MLC)-2. MR-1 overexpression attenuated H/R-induced cell injury and loss of surface membrane polarity of actin. MR-1 overexpression also increased the expression and phosphorylation of MLC-2 and MLC kinase, which were decreased in MR-1-silenced and H/R-treated cells. Together, these data show that MR-1 promoted actin polarity on the membrane surface and protected HK-2 cells from H/R injury. The mechanism might involve the rapid organization of F-actin through the upregulation and phosphorylation of MLC-2.

  19. Leucocyte protein Trojan, a possible regulator of apoptosis.

    PubMed

    Petrov, Petar; Syrjänen, Riikka; Uchida, Tatsuya; Vainio, Olli

    2017-02-01

    Trojan is a leucocyte-specific protein, cloned from chicken embryonic thymocyte cDNA library. The molecule is a type I transmembrane protein with an extracellular CCP domain, followed by two FN3 domains. Its cytoplasmic tail is predicted to possess a MAPK docking and a PKA phosphorylation sites. Trojan has been proposed to have an anti-apoptotic role based on its differential expression on developing thymocyte subpopulations. Using a chicken cell line, our in vitro studies showed that upon apoptosis induction, Trojan expression rises dramatically on the surface of surviving cells and gradually decreases towards its normal levels as cells recover. When sorted based on their expression levels of Trojan, cells with high expression appeared less susceptible to apoptotic induction than those bearing no or low levels of Trojan on their surface. The mechanism by which the molecule exerts its function is yet to be discovered. We found that cells overexpressing Trojan from a cDNA plasmid show elevated steady-state levels of intracellular calcium, suggesting the molecule is able to transmit cytoplasmic signals. The mechanistic nature of Trojan-induced signalling is a target of future investigation. In this article, we conducted a series of experiments that suggest Trojan as an anti-apoptotic regulator. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  20. Cellular prion protein controls stem cell-like properties of human glioblastoma tumor-initiating cells.

    PubMed

    Corsaro, Alessandro; Bajetto, Adriana; Thellung, Stefano; Begani, Giulia; Villa, Valentina; Nizzari, Mario; Pattarozzi, Alessandra; Solari, Agnese; Gatti, Monica; Pagano, Aldo; Würth, Roberto; Daga, Antonio; Barbieri, Federica; Florio, Tullio

    2016-06-21

    Prion protein (PrPC) is a cell surface glycoprotein whose misfolding is responsible for prion diseases. Although its physiological role is not completely defined, several lines of evidence propose that PrPC is involved in self-renewal, pluripotency gene expression, proliferation and differentiation of neural stem cells. Moreover, PrPC regulates different biological functions in human tumors, including glioblastoma (GBM). We analyzed the role of PrPC in GBM cell pathogenicity focusing on tumor-initiating cells (TICs, or cancer stem cells, CSCs), the subpopulation responsible for development, progression and recurrence of most malignancies. Analyzing four GBM CSC-enriched cultures, we show that PrPC expression is directly correlated with the proliferation rate of the cells. To better define its role in CSC biology, we knocked-down PrPC expression in two of these GBM-derived CSC cultures by specific lentiviral-delivered shRNAs. We provide evidence that CSC proliferation rate, spherogenesis and in vivo tumorigenicity are significantly inhibited in PrPC down-regulated cells. Moreover, PrPC down-regulation caused loss of expression of the stemness and self-renewal markers (NANOG, Sox2) and the activation of differentiation pathways (i.e. increased GFAP expression). Our results suggest that PrPC controls the stemness properties of human GBM CSCs and that its down-regulation induces the acquisition of a more differentiated and less oncogenic phenotype.

  1. Cellular prion protein controls stem cell-like properties of human glioblastoma tumor-initiating cells

    PubMed Central

    Corsaro, Alessandro; Bajetto, Adriana; Thellung, Stefano; Begani, Giulia; Villa, Valentina; Nizzari, Mario; Pattarozzi, Alessandra; Solari, Agnese; Gatti, Monica; Pagano, Aldo; Würth, Roberto; Daga, Antonio; Barbieri, Federica; Florio, Tullio

    2016-01-01

    Prion protein (PrPC) is a cell surface glycoprotein whose misfolding is responsible for prion diseases. Although its physiological role is not completely defined, several lines of evidence propose that PrPC is involved in self-renewal, pluripotency gene expression, proliferation and differentiation of neural stem cells. Moreover, PrPC regulates different biological functions in human tumors, including glioblastoma (GBM). We analyzed the role of PrPC in GBM cell pathogenicity focusing on tumor-initiating cells (TICs, or cancer stem cells, CSCs), the subpopulation responsible for development, progression and recurrence of most malignancies. Analyzing four GBM CSC-enriched cultures, we show that PrPC expression is directly correlated with the proliferation rate of the cells. To better define its role in CSC biology, we knocked-down PrPC expression in two of these GBM-derived CSC cultures by specific lentiviral-delivered shRNAs. We provide evidence that CSC proliferation rate, spherogenesis and in vivo tumorigenicity are significantly inhibited in PrPC down-regulated cells. Moreover, PrPC down-regulation caused loss of expression of the stemness and self-renewal markers (NANOG, Sox2) and the activation of differentiation pathways (i.e. increased GFAP expression). Our results suggest that PrPC controls the stemness properties of human GBM CSCs and that its down-regulation induces the acquisition of a more differentiated and less oncogenic phenotype. PMID:27229535

  2. The lymphocytic cholinergic system and its contribution to the regulation of immune activity.

    PubMed

    Kawashima, Koichiro; Fujii, Takeshi

    2003-12-26

    Lymphocytes express most of the cholinergic components found in the nervous system, including acetylcholine (ACh), choline acetyltransferase (ChAT), high affinity choline transporter, muscarinic and nicotinic ACh receptors (mAChRs and nAChRs, respectively), and acetylcholinesterase. Stimulation of T and B cells with ACh or another mAChR agonist elicits intracellular Ca2+ signaling, up-regulation of c-fos expression, increased nitric oxide synthesis and IL-2-induced signal transduction, probably via M3 and M5 mAChR-mediated pathways. Acute stimulation of nAChRs with ACh or nicotine causes rapid and transient Ca2+ signaling in T and B cells, probably via alpha7 nAChR subunit-mediated pathways. Chronic nicotine stimulation, by contrast, down-regulates nAChR expression and suppresses T cell activity. Activation of T cells with phytohemagglutinin or antibodies against cell surface molecules enhances lymphocytic cholinergic transmission by activating expression of ChAT and M5 mAChR, which is suggestive of local cholinergic regulation of immune system activity. This idea is supported by the facts that lymphocytic cholinergic activity reflects well the changes in immune system function seen in animal models of immune deficiency and immune acceleration. Collectively, these data provide a compelling picture in which lymphocytes constitute a cholinergic system that is independent of cholinergic nerves, and which is involved in the regulation of immune function.

  3. Surface-Displayed IL-10 by Recombinant Lactobacillus plantarum Reduces Th1 Responses of RAW264.7 Cells Stimulated with Poly(I:C) or LPS.

    PubMed

    Cai, Ruopeng; Jiang, Yanlong; Yang, Wei; Yang, Wentao; Shi, Shaohua; Shi, Chunwei; Hu, Jingtao; Gu, Wei; Ye, Liping; Zhou, Fangyu; Gong, Qinglong; Han, Wenyu; Yang, Guilian; Wang, Chunfeng

    2016-02-01

    Recently, poly-γ-glutamic acid synthetase A (pgsA) has been applied to display exogenous proteins on the surface of Lactobacillus casei or Lactococcus lactis, which results in a surfacedisplayed component of bacteria. However, the ability of carrying genes encoded by plasmids and the expression efficiency of recombinant bacteria can be somewhat affected by the longer gene length of pgsA (1,143 bp); therefore, a truncated gene, pgsA, was generated based on the characteristics of pgsA by computational analysis. Using murine IL-10 as an exogenous gene, recombinant Lactobacillus plantarum was constructed and the capacity of the surface-displayed protein and functional differences between exogenous proteins expressed by these strains were evaluated. Surface expression of IL-10 on both recombinant bacteria with anchorins and the higher expression levels in L. plantarum-pgsA'-IL-10 were confirmed by western blot assay. Most importantly, up-regulation of IL-1β, IL-6, TNF-α, IFN-γ, and the nuclear transcription factor NF-κB p65 in RAW264.7 cells after stimulation with Poly(I:C) or LPS was exacerbated after co-culture with L. plantarum-pgsA. By contrast, IL-10 expressed by these recombinant strains could reduce these factors, and the expression of these factors was associated with recombinant strains that expressed anchorin (especially in L. plantarum-pgsA'-IL-10) and was significantly lower compared with the anchorin-free strains. These findings indicated that exogenous proteins could be successfully displayed on the surface of L. plantarum by pgsA or pgsA', and the expression of recombinant bacteria with pgsA' was superior compared with bacteria with pgsA.

  4. In vivo regulation of Bcl6 and T follicular helper cell development1

    PubMed Central

    Poholek, Amanda C.; Hansen, Kyle; Hernandez, Sairy G.; Eto, Danelle; Chandele, Anmol; Weinstein, Jason S.; Dong, Xuemei; Odegard, Jared M.; Kaech, Susan M.; Dent, Alexander L.; Crotty, Shane; Craft, Joe

    2010-01-01

    Follicular helper T (TFH) cells, defined by expression of the surface markers CXCR5 and PD-1 and synthesis of IL-21, require upregulation of the transcriptional repressor Bcl6 for their development and function in B cell maturation in germinal centers. We have explored the role of B cells, and the cytokines IL-6 and IL-21, in the in vivo regulation of Bcl6 expression and TFH cell development. We found that TFH cells are characterized by a Bcl6-dependent downregulation of P-selectin glycoprotein ligand-1 (PSGL1, a CCL19- and CCL21-binding protein), indicating that, like CXCR5 and PD-1 upregulation, modulation of PSGL1 expression is part of the TFH cell program of differentiation. B cells were neither required for initial upregulation of Bcl6 nor PSGL1 downregulation, suggesting these events preceded T-B cell interactions, although they were required for full development of the TFH cell phenotype, including CXCR5 and PD-1 upregulation, and IL-21 synthesis. Bcl6 upregulation and TFH cell differentiation were independent of IL-6 and IL-21, revealing that either cytokine is not absolutely required for development of Bcl6+ TFH cells in vivo. These data increase our understanding of Bcl6 regulation in TFH cells and their differentiation in vivo, and identifies a new surface marker that may be functionally relevant in this subset. PMID:20519643

  5. Onco-GPCR signaling and dysregulated expression of microRNAs in human cancer.

    PubMed

    Nohata, Nijiro; Goto, Yusuke; Gutkind, J Silvio

    2017-01-01

    The G-protein-coupled receptor (GPCR) family is the largest family of cell-surface receptors involved in signal transduction. Aberrant expression of GPCRs and G proteins are frequently associated with prevalent human diseases, including cancer. In fact, GPCRs represent the therapeutic targets of more than a quarter of the clinical drugs currently on the market. MiRNAs (miRNAs) are also aberrantly expressed in many human cancers, and they have significant roles in the initiation, development and metastasis of human malignancies. Recent studies have revealed that dysregulation of miRNAs and their target genes expression are associated with cancer progression. The emerging information suggests that miRNAs play an important role in the fine tuning of many signaling pathways, including GPCR signaling. We summarize our current knowledge of the individual functions of miRNAs regulated by GPCRs and GPCR signaling-associated molecules, and miRNAs that regulate the expression and activity of GPCRs, their endogenous ligands and their coupled heterotrimeric G proteins in human cancer.

  6. Proximity-Based Differential Single-Cell Analysis of the Niche to Identify Stem/Progenitor Cell Regulators.

    PubMed

    Silberstein, Lev; Goncalves, Kevin A; Kharchenko, Peter V; Turcotte, Raphael; Kfoury, Youmna; Mercier, Francois; Baryawno, Ninib; Severe, Nicolas; Bachand, Jacqueline; Spencer, Joel A; Papazian, Ani; Lee, Dongjun; Chitteti, Brahmananda Reddy; Srour, Edward F; Hoggatt, Jonathan; Tate, Tiffany; Lo Celso, Cristina; Ono, Noriaki; Nutt, Stephen; Heino, Jyrki; Sipilä, Kalle; Shioda, Toshihiro; Osawa, Masatake; Lin, Charles P; Hu, Guo-Fu; Scadden, David T

    2016-10-06

    Physiological stem cell function is regulated by secreted factors produced by niche cells. In this study, we describe an unbiased approach based on the differential single-cell gene expression analysis of mesenchymal osteolineage cells close to, and further removed from, hematopoietic stem/progenitor cells (HSPCs) to identify candidate niche factors. Mesenchymal cells displayed distinct molecular profiles based on their relative location. We functionally examined, among the genes that were preferentially expressed in proximal cells, three secreted or cell-surface molecules not previously connected to HSPC biology-the secreted RNase angiogenin, the cytokine IL18, and the adhesion molecule Embigin-and discovered that all of these factors are HSPC quiescence regulators. Therefore, our proximity-based differential single-cell approach reveals molecular heterogeneity within niche cells and can be used to identify novel extrinsic stem/progenitor cell regulators. Similar approaches could also be applied to other stem cell/niche pairs to advance the understanding of microenvironmental regulation of stem cell function. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Dipeptidyl peptidase IV (DPPIV) enzyme activity on immature T-cell line R1.1 is down-regulated by dynorphin-A(1-17) as a non-substrate inhibitor.

    PubMed

    Gabrilovac, Jelka; Abramić, Marija; Uzarević, Branka; Andreis, Ana; Poljak, Ljiljana

    2003-05-30

    In this study we examined surface expression of CD26 and the corresponding enzyme activity of dipeptidyl peptidase IV (DPPIV) on the cells of immature murine T-cell line, R1.1. The data obtained have shown that R1.1 cells express high density of surface CD26 as compared to normal thymus cells. This was associated with strong enzyme activity, which, based on substrates and inhibitor specificity, corresponded to DPPIV. The DPPIV enzyme activity of R1.1 cells was 10 times stronger than that found on normal murine thymus cells (V(max) = 39 micromol/min/10(6) cells, vs 3.7 micromol/min/10(6) cells, respectively). Upon activation with anti-CD3, up-regulation of both membrane CD26, as well as of DPPIV enzyme activity on R1.1 cells were observed. The finding of strong DPPIV on R1.1 cells makes them suitable model for testing putative substrates/inhibitors of the enzyme in its natural microenvironment. Since in addition to strong DPPIV, R1.1 cells also express kappa opioid receptors (KOR) [European Journal of Pharmacology 227 (1992) 257], we tested the effect of dynorphin-A(1-17), an endogenous opioid peptide with KOR selectivity, on DPPIV of R1.1 cells. Dynorphin-A(1-17) down-regulated DPPIV in a dose-dependent manner, with the potency similar to that of substance P, a known natural DPPIV substrate [Journal of Pharmacology and Experimental Therapeutics 260 (1992) 1257]. DPPIV down-regulation was resistant to bestatin and thiorphan, the inhibitors of two cell surface peptidases (APN and NEP, respectively) with potential of dynorphin-A(1-17) degradation, suggesting that the mechanism underlying the observed effect does not involve degradative products of dynorphin-A(1-17). DPPIV down-regulation was also resistent to KOR antagonist, NBI, suggesting that the mechanism underlying the observed phenomenon involves neither cointernalization of KOR and DPPIV. Collectively, cells of immature T cell line, R1.1 exert strong DPPIV enzyme activity, which could be down-regulated in the presence of dynorphin-A(1-17) by mechanism that presumably includes non-substrate inhibition. By down-regulating DPPIV, dynorphin-A(1-17) may indirectly affect activity and/or specificity of natural substrates of DPPIV, such as substance P, RANTES, and endomorphins.

  8. Regulation of STIM1 and SOCE by the ubiquitin-proteasome system (UPS).

    PubMed

    Keil, Jeffrey M; Shen, Zhouxin; Briggs, Steven P; Patrick, Gentry N

    2010-10-18

    The ubiquitin proteasome system (UPS) mediates the majority of protein degradation in eukaryotic cells. The UPS has recently emerged as a key degradation pathway involved in synapse development and function. In order to better understand the function of the UPS at synapses we utilized a genetic and proteomic approach to isolate and identify novel candidate UPS substrates from biochemically purified synaptic membrane preparations. Using these methods, we have identified Stromal interacting molecule 1 (STIM1). STIM1 is as an endoplasmic reticulum (ER) calcium sensor that has been shown to regulate store-operated Ca(2+) entry (SOCE). We have characterized STIM1 in neurons, finding STIM1 is expressed throughout development with stable, high expression in mature neurons. As in non-excitable cells, STIM1 is distributed in a membranous and punctate fashion in hippocampal neurons. In addition, a population of STIM1 was found to exist at synapses. Furthermore, using surface biotinylation and live-cell labeling methods, we detect a subpopulation of STIM1 on the surface of hippocampal neurons. The role of STIM1 as a regulator of SOCE has typically been examined in non-excitable cell types. Therefore, we examined the role of the UPS in STIM1 and SOCE function in HEK293 cells. While we find that STIM1 is ubiquitinated, its stability is not altered by proteasome inhibitors in cells under basal conditions or conditions that activate SOCE. However, we find that surface STIM1 levels and thapsigargin (TG)-induced SOCE are significantly increased in cells treated with proteasome inhibitors. Additionally, we find that the overexpression of POSH (Plenty of SH3's), an E3 ubiquitin ligase recently shown to be involved in the regulation of Ca(2+) homeostasis, leads to decreased STIM1 surface levels. Together, these results provide evidence for previously undescribed roles of the UPS in the regulation of STIM1 and SOCE function.

  9. High Cell Surface Expression of CD4 Allows Distinction of CD4+CD25+ Antigen-specific Effector T Cells from CD4+CD25+ Regulatory T Cells in Murine Experimental Autoimmune Encephalomyelitis

    PubMed Central

    Li, Jinzhu; Ridgway, William; Fathman, C. Garrison; Tse, Harley Y.; Shaw, Michael K.

    2008-01-01

    Analysis of T regulatory cells (Treg) and T effector cells (Teff) in experimental autoimmune encephalomyelitis is complicated by the fact that both cell types express CD4 and CD25. We demonstrate that encephalitogenic T cells, following antigen recognition, up regulate cell surface expression of CD4. The CD4high sub-population contains all of the antigen response as shown by proliferation and cytokine secretion, and only these cells are capable of transferring EAE to naive animals. On the other hand, a FACS separable CD25+ sub-population of cells displayed consistent levels of CD4 prior to and after antigen stimulation. These cells displayed characteristics of Treg, such as expressing high levels of the Foxp3 gene and the ability to suppress mitogenic T cell responses. PMID:17920698

  10. Comparison of Expression Profiles in Ovarian Epithelium In Vivo and Ovarian Cancer Identifies Novel Candidate Genes Involved in Disease Pathogenesis

    PubMed Central

    Emmanuel, Catherine; Gava, Natalie; Kennedy, Catherine; Balleine, Rosemary L.; Sharma, Raghwa; Wain, Gerard; Brand, Alison; Hogg, Russell; Etemadmoghadam, Dariush; George, Joshy; Birrer, Michael J.; Clarke, Christine L.; Chenevix-Trench, Georgia; Bowtell, David D. L.; Harnett, Paul R.; deFazio, Anna

    2011-01-01

    Molecular events leading to epithelial ovarian cancer are poorly understood but ovulatory hormones and a high number of life-time ovulations with concomitant proliferation, apoptosis, and inflammation, increases risk. We identified genes that are regulated during the estrous cycle in murine ovarian surface epithelium and analysed these profiles to identify genes dysregulated in human ovarian cancer, using publically available datasets. We identified 338 genes that are regulated in murine ovarian surface epithelium during the estrous cycle and dysregulated in ovarian cancer. Six of seven candidates selected for immunohistochemical validation were expressed in serous ovarian cancer, inclusion cysts, ovarian surface epithelium and in fallopian tube epithelium. Most were overexpressed in ovarian cancer compared with ovarian surface epithelium and/or inclusion cysts (EpCAM, EZH2, BIRC5) although BIRC5 and EZH2 were expressed as highly in fallopian tube epithelium as in ovarian cancer. We prioritised the 338 genes for those likely to be important for ovarian cancer development by in silico analyses of copy number aberration and mutation using publically available datasets and identified genes with established roles in ovarian cancer as well as novel genes for which we have evidence for involvement in ovarian cancer. Chromosome segregation emerged as an important process in which genes from our list of 338 were over-represented including two (BUB1, NCAPD2) for which there is evidence of amplification and mutation. NUAK2, upregulated in ovarian surface epithelium in proestrus and predicted to have a driver mutation in ovarian cancer, was examined in a larger cohort of serous ovarian cancer where patients with lower NUAK2 expression had shorter overall survival. In conclusion, defining genes that are activated in normal epithelium in the course of ovulation that are also dysregulated in cancer has identified a number of pathways and novel candidate genes that may contribute to the development of ovarian cancer. PMID:21423607

  11. The herpes simplex virus receptor nectin-1 is down-regulated after trans-interaction with glycoprotein D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stiles, Katie M.; Center for Oral Health Research, School of Dental Medicine University of Pennsylvania, Philadelphia, PA 19104; Milne, Richard S.B.

    2008-03-30

    During herpes simplex virus (HSV) entry, membrane fusion occurs either on the cell surface or after virus endocytosis. In both cases, binding of glycoprotein D (gD) to a receptor such as nectin-1 or HVEM is required. In this study, we co-cultured cells expressing gD with nectin-1 expressing cells to investigate the effects of gD on nectin-1 at cell contacts. After overnight co-cultures with gD expressing cells, there was a down-regulation of nectin-1 in B78H1-C10, SY5Y, A431 and HeLa cells, which HSV enters by endocytosis. In contrast, on Vero cells, which HSV enters at the plasma membrane, nectin-1 was not down-regulated.more » Further analysis of B78H1-derived cells showed that nectin-1 down-regulation corresponds to the ability of gD to bind nectin-1 and is achieved by internalization and low-pH-dependent degradation of nectin-1. Moreover, gD is necessary for virion internalization in B78H1 cells expressing nectin-1. These data suggest that the determinants of gD-mediated internalization of nectin-1 may direct HSV to an endocytic pathway during entry.« less

  12. NLP is a novel transcription regulator involved in VSG expression site control in Trypanosoma brucei.

    PubMed

    Narayanan, Mani Shankar; Kushwaha, Manish; Ersfeld, Klaus; Fullbrook, Alexander; Stanne, Tara M; Rudenko, Gloria

    2011-03-01

    Trypanosoma brucei mono-allelically expresses one of approximately 1500 variant surface glycoprotein (VSG) genes while multiplying in the mammalian bloodstream. The active VSG is transcribed by RNA polymerase I in one of approximately 15 telomeric VSG expression sites (ESs). T. brucei is unusual in controlling gene expression predominantly post-transcriptionally, and how ESs are mono-allelically controlled remains a mystery. Here we identify a novel transcription regulator, which resembles a nucleoplasmin-like protein (NLP) with an AT-hook motif. NLP is key for ES control in bloodstream form T. brucei, as NLP knockdown results in 45- to 65-fold derepression of the silent VSG221 ES. NLP is also involved in repression of transcription in the inactive VSG Basic Copy arrays, minichromosomes and procyclin loci. NLP is shown to be enriched on the 177- and 50-bp simple sequence repeats, the non-transcribed regions around rDNA and procyclin, and both active and silent ESs. Blocking NLP synthesis leads to downregulation of the active ES, indicating that NLP plays a role in regulating appropriate levels of transcription of ESs in both their active and silent state. Discovery of the unusual transcription regulator NLP provides new insight into the factors that are critical for ES control.

  13. Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

    PubMed

    Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

    2018-06-01

    To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

  14. Alpha-Secretase ADAM10 Regulation: Insights into Alzheimer’s Disease Treatment

    PubMed Central

    Peron, Rafaela; Vatanabe, Izabela Pereira; Manzine, Patricia Regina; Camins, Antoni

    2018-01-01

    ADAM (a disintegrin and metalloproteinase) is a family of widely expressed, transmembrane and secreted proteins of approximately 750 amino acids in length with functions in cell adhesion and proteolytic processing of the ectodomains of diverse cell-surface receptors and signaling molecules. ADAM10 is the main α-secretase that cleaves APP (amyloid precursor protein) in the non-amyloidogenic pathway inhibiting the formation of β-amyloid peptide, whose accumulation and aggregation leads to neuronal degeneration in Alzheimer’s disease (AD). ADAM10 is a membrane-anchored metalloprotease that sheds, besides APP, the ectodomain of a large variety of cell-surface proteins including cytokines, adhesion molecules and notch. APP cleavage by ADAM10 results in the production of an APP-derived fragment, sAPPα, which is neuroprotective. As increased ADAM10 activity protects the brain from β-amyloid deposition in AD, this strategy has been proved to be effective in treating neurodegenerative diseases, including AD. Here, we describe the physiological mechanisms regulating ADAM10 expression at different levels, aiming to propose strategies for AD treatment. We report in this review on the physiological regulation of ADAM10 at the transcriptional level, by epigenetic factors, miRNAs and/or translational and post-translational levels. In addition, we describe the conditions that can change ADAM10 expression in vitro and in vivo, and discuss how this knowledge may help in AD treatment. Regulation of ADAM10 is achieved by multiple mechanisms that include transcriptional, translational and post-translational strategies, which we will summarize in this review. PMID:29382156

  15. Reversible epigenetic down-regulation of MHC molecules by devil facial tumour disease illustrates immune escape by a contagious cancer

    PubMed Central

    Siddle, Hannah V.; Kreiss, Alexandre; Tovar, Cesar; Yuen, Chun Kit; Cheng, Yuanyuan; Belov, Katherine; Swift, Kate; Pearse, Anne-Maree; Hamede, Rodrigo; Jones, Menna E.; Skjødt, Karsten; Woods, Gregory M.; Kaufman, Jim

    2013-01-01

    Contagious cancers that pass between individuals as an infectious cell line are highly unusual pathogens. Devil facial tumor disease (DFTD) is one such contagious cancer that emerged 16 y ago and is driving the Tasmanian devil to extinction. As both a pathogen and an allograft, DFTD cells should be rejected by the host–immune response, yet DFTD causes 100% mortality among infected devils with no apparent rejection of tumor cells. Why DFTD cells are not rejected has been a question of considerable confusion. Here, we show that DFTD cells do not express cell surface MHC molecules in vitro or in vivo, due to down-regulation of genes essential to the antigen-processing pathway, such as β2-microglobulin and transporters associated with antigen processing. Loss of gene expression is not due to structural mutations, but to regulatory changes including epigenetic deacetylation of histones. Consequently, MHC class I molecules can be restored to the surface of DFTD cells in vitro by using recombinant devil IFN-γ, which is associated with up-regulation of the MHC class II transactivator, a key transcription factor with deacetylase activity. Further, expression of MHC class I molecules by DFTD cells can occur in vivo during lymphocyte infiltration. These results explain why T cells do not target DFTD cells. We propose that MHC-positive or epigenetically modified DFTD cells may provide a vaccine to DFTD. In addition, we suggest that down-regulation of MHC molecules using regulatory mechanisms allows evolvability of transmissible cancers and could affect the evolutionary trajectory of DFTD. PMID:23479617

  16. Sr-doped nanowire modification of Ca-Si-based coatings for improved osteogenic activities and reduced inflammatory reactions

    NASA Astrophysics Data System (ADS)

    Li, Kai; Hu, Dandan; Xie, Youtao; Huang, Liping; Zheng, Xuebin

    2018-02-01

    Biomedical coatings for orthopedic implants should facilitate osseointegration and mitigate implant-induced inflammatory reactions. In our study, Ca-Si coatings with Sr-containing nanowire-like structures (NW-Sr-CS) were achieved via hydrothermal treatment. In order to identify the effect of nanowire-like topography and Sr dopant on the biological properties of Ca-Si-based coatings, the original Ca-Si coating, Ca-Si coatings modified with nanoplate (NP-CS) and similar nanowire-like structure (NW-CS) were fabricated as the control. Surface morphology, phase composition, surface area, zeta potential and ion release of these coatings were characterized. The in vitro osteogenic activities and immunomodulatory properties were evaluated with bone marrow stromal cells (BMSCs) and RAW 264.7 cells, a mouse macrophage cell line. Compared with the CS and NP-CS coatings, the NW-CS coating possessed a larger surface area and pore volume, beneficial protein adsorption, up-regulated the expression levels of integrin β1, Vinculin and focal adhesion kinase and promoted cell spreading. Furthermore, the NW-CS coating significantly enhanced the osteogenic differentiation and mineralization as indicated by the up-regulation of ALP activity, mineralized nodule formation and osteoblastogenesis-related gene expression. With the introduction of Sr, the NW-Sr-CS coatings exerted a greater effect on the BMSC proliferation rate, calcium sensitive receptor gene expression as well as PKC and ERK1/2 phosphorylation. In addition, the Sr-doped coatings significantly up-regulated the ratio of OPG/RANKL in the BMSCs. The NW-Sr-CS coatings could modulate the polarization of macrophages towards the wound-healing M2 phenotype, reduce the mRNA expression levels of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) and enhance anti-inflammatory cytokines (IL-1ra, IL-10). The Sr-doped nanowire modification may be a valuable approach to enhance osteogenic activities and reduce inflammatory reactions.

  17. Retention in the Golgi apparatus and expression on the cell surface of Cfr/Esl-1/Glg-1/MG-160 are regulated by two distinct mechanisms.

    PubMed

    Miyaoka, Yuichiro; Kato, Hidenori; Ebato, Kazuki; Saito, Shigeru; Miyata, Naoko; Imamura, Toru; Miyajima, Atsushi

    2011-11-15

    Cfr (cysteine-rich fibroblast growth factor receptor) is an Fgf (fibroblast growth factor)-binding protein without a tyrosine kinase. We have shown previously that Cfr is involved in Fgf18 signalling via Fgf receptor 3c. However, as Cfr is also known as Glg (Golgi apparatus protein)-1 or MG-160 and occurs in the Golgi apparatus, it remains unknown how the distribution of Cfr is regulated. In the present study, we performed a mutagenic analysis of Cfr to show that two distinct regions contribute to its distribution and stability. First, the C-terminal region retains Cfr in the Golgi apparatus. Secondly, the Cfr repeats in the extracellular juxtamembrane region destabilizes Cfr passed through the Golgi apparatus. This destabilization does not depend on the cleavage and secretion of the extracellular domain of Cfr. Furthermore, we found that Cfr with a GPI (glycosylphosphatidylinositol) anchor was predominantly expressed on the cell surface in Ba/F3 cells and affected Fgf18 signalling in a similar manner to the full-length Cfr, indicating that the interaction of Cfr with Fgfs on the cell surface is important for its function in Fgf signalling. These results suggest that the expression of Cfr in the Golgi apparatus and on the plasma membrane is finely tuned through two distinct mechanisms for exhibiting different functions.

  18. Fluoxetine ameliorates cognitive impairments induced by chronic cerebral hypoperfusion via down-regulation of HCN2 surface expression in the hippocampal CA1 area in rats.

    PubMed

    Luo, Pan; Zhang, Xiaoxue; Lu, Yun; Chen, Cheng; Li, Changjun; Zhou, Mei; Lu, Qing; Xu, Xulin; Shen, Guanxin; Guo, Lianjun

    2016-01-01

    Chronic cerebral hypoperfusion (CCH) causes cognitive impairments and increases the risk of Alzheimer's disease (AD) and vascular dementia (VD) through several biologically plausible pathways, yet the underlying neurobiological mechanisms are still poorly understood. In this study, we investigated whether fluoxetine, a selective serotonin reuptake inhibitor (SSRI), could play a neuroprotective role against chronic cerebral hypoperfusion injury and to clarify underlying mechanisms of its efficacy. Rats were subjected to permanent bilateral occlusion of the common carotid arteries (two-vessel occlusion, 2VO). Two weeks later, rats were treated with 30 mg/kg fluoxetine (intragastric injection, i.g.) for 6 weeks. Cognitive function was evaluated by Morris water maze (MWM) and novel objects recognition (NOR) test. Long-term potentiation (LTP) was used to address the underlying synaptic mechanisms. Western blotting was used to quantify the protein levels. Our results showed that fluoxetine treatment significantly improved the cognitive impairments caused by 2VO, accompanied with a reversion of 2VO-induced inhibitory of LTP. Furthermore, 2VO caused an up-regulation of hyperpolarization-activated cyclic nucleotide-gated channel 2 (HCN2) surface expressions in the hippocampal CA1 area and fluoxetine also effectively recovered the disorder of HCN2 surface expressions, which may be a possible mechanism that fluoxetine treatment ameliorates cognitive impairments in rats with CCH. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Identification of Salmonella enterica Serovar Typhimurium Genes Regulated during Biofilm Formation on Cholesterol Gallstone Surfaces

    PubMed Central

    Gonzalez-Escobedo, Geoffrey

    2013-01-01

    Salmonella spp. are able to form biofilms on abiotic and biotic surfaces. In vivo studies in our laboratory have shown that Salmonella can form biofilms on the surfaces of cholesterol gallstones in the gallbladders of mice and human carriers. Biofilm formation on gallstones has been demonstrated to be a mechanism of persistence. The purpose of this work was to identify and evaluate Salmonella sp. cholesterol-dependent biofilm factors. Differential gene expression analysis between biofilms on glass or cholesterol-coated surfaces and subsequent quantitative real-time PCR (qRT-PCR) revealed that type 1 fimbria structural genes and a gene encoding a putative outer membrane protein (ycfR) were specifically upregulated in Salmonella enterica serovar Typhimurium biofilms grown on cholesterol-coated surfaces. Spatiotemporal expression of ycfR and FimA verified their regulation during biofilm development on cholesterol-coated surfaces. Surprisingly, confocal and scanning electron microscopy demonstrated that a mutant of type 1 fimbria structural genes (ΔfimAICDHF) and a ycfR mutant showed increased biofilm formation on cholesterol-coated surfaces. In vivo experiments using Nramp1+/+ mice harboring gallstones showed that only the ΔycfR mutant formed extensive biofilms on mouse gallstones at 7 and 21 days postinfection; ΔfimAICDHF was not observed on gallstone surfaces after the 7-day-postinfection time point. These data suggest that in Salmonella spp., wild-type type 1 fimbriae are important for attachment to and/or persistence on gallstones at later points of chronic infection, whereas YcfR may represent a specific potential natural inhibitor of initial biofilm formation on gallstones. PMID:23897604

  20. Als1 and Als3 regulate the intracellular uptake of copper ions when Candida albicans biofilms are exposed to metallic copper surfaces.

    PubMed

    Zheng, Sha; Chang, Wenqiang; Li, Chen; Lou, Hongxiang

    2016-05-01

    Copper surfaces possess efficient antimicrobial effect. Here, we reported that copper surfaces could inactivate Candida albicans biofilms within 40 min. The intracellular reactive oxygen species in C. albicans biofilms were immediately stimulated during the contact of copper surfaces, which might be an important factor for killing the mature biofilms. Copper release assay demonstrated that the copper ions automatically released from the surface of 1 mm thick copper coupons with over 99.9% purity are not the key determinant for the copper-mediated killing action. The susceptibility test to copper surfaces by using C. albicans mutant strains, which were involved in efflux pumps, adhesins, biofilms formation or osmotic stress response showed that als1/als1 and als3/als3 displayed higher resistance to the copper surface contact than other mutants did. The intracellular concentration of copper ions was lower in als1/als1 and als3/als3 than that in wild-type strain. Transcriptional analysis revealed that the expression of copper transporter-related gene, CRP1, was significantly increased in als1/als1, als3/als3, suggesting a potential role of ALS1 and ALS3 in absorbing ions by regulating the expression of CRP1 This study provides a potential application in treating pathogenic fungi by using copper surfaces and uncovers the roles of ALS1 and ALS3 in absorbing copper ions for C. albicans. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Gordon Conference on Microbial Adhesion

    DTIC Science & Technology

    1988-07-01

    00-11:45 a.m. * antigen A and dextranase in Streptococcus mutans colonization. B. Uhlin, Regulation of pilus-adhesin 11:45-12:30 p.m.expression in E...surfaces. In addition, the role of bacterium-bacterium co- aggregation processes was considered. Why does Streptococcus sanguis have such a high affinity...attachment of bacteria to saliva-coated surfaces? Why is S. mutans poorly adherent yet highly cariogenic? What are the characteri-tics of strcptococcal

  2. Amyloid Precursor-like Protein 2 Association with HLA Class I Molecules

    PubMed Central

    Tuli, Amit; Sharma, Mahak; Wang, Xiaojian; Simone, Laura C.; Capek, Haley L.; Cate, Steven; Hildebrand, William H.; Naslavsky, Naava; Caplan, Steve; Solheim, Joyce C.

    2009-01-01

    Amyloid precursor-like protein 2 (APLP2) is a ubiquitously expressed protein. The previously demonstrated functions for APLP2 include binding to the mouse major histocompatibility complex (MHC) class I molecule H-2Kd and down regulating its cell surface expression. In this study, we have investigated the interaction of APLP2 with the human leukocyte antigen (HLA) class I molecule in human tumor cell lines. APLP2 was readily detected in pancreatic, breast, and prostate tumor lines, although it was found only in very low amounts in lymphoma cell lines. In a pancreatic tumor cell line, HLA class I was extensively co-localized with APLP2 in vesicular compartments following endocytosis of HLA class I molecules. In pancreatic, breast, and prostate tumor lines, APLP2 was bound to the HLA class I molecule. APLP2 was found to bind to HLA-A24, and more strongly to HLA-A2. Increased expression of APLP2 resulted in reduced surface expression of HLA-A2 and HLA-A24. Overall, these studies demonstrate that APLP2 binds to the HLA class I molecule, co-localizes with it in intracellular vesicles, and reduces the level of HLA class I molecule cell surface expression. PMID:19184004

  3. [Effect of Endomorphin-1 on Maturation and Expression of TLR4 in Peripheral Blood Dendritic Cells Induced by High Glucose].

    PubMed

    Liu, Chuan-Miao; Yang, Tian-Hua; Huang, Min; Zhou, Cheng; Li, Yong-Hai; Li, Zheng-Hong

    2018-06-01

    To investigate the effects of endomorphin-1 (EM-1) on the maturation phenotype, cytokine secretion, T cell proliferation and TLR4 expression in human peripheral blood dendritic cells (PBDCs) stimulated and induced by high glucose, and to explore the regulatory mechanism of EM-1 on DC immune function. Peripheral blood mononuclear cells (PBMNCs) were induced into immature dendritic cells (imDCs). The high glucose was used as the stimulating factor, and the EM-1 was used as the interventional factor. Then, the experiments were divided into normal glucose group (NG group), high glucose group (HG group), high glucose plus EM-1 group (EM group) and high glucose plus EM-1 and naloxone group (Nal group), respectively. The PBDC's phenotype changes were detected by flow cytometry; ELISA was used to detect the changes of cytokines secreted by PBDCs co-cultured with autologous lymphocytes; CFSE was used to detect the proliferation of T lymphocytes. TLR4 expression on PBDC surface was detected by RT-PCR. Compared with HG group, the expression of PBDC surface molecules CD86, CCR7 and CD36 was up-regulated in EM group (P<0.01), while the change of CD83 expression was not statistically significant. However, IL-12 and IL-10 secreted by PBDCs and the proliferation index of T-lymphocytes stimulated by PBDCs were both decreased in EM group. Compared with EM group, the expression of CD86, CCR7 and CD36 was decreased in Nal group (P<0.01), while the expression of CD83 was almost unchanged (P>0.05). T-lymphocyte proliferation index was increased very significantly in Nal group (P<0.01). The gray ratio of TLR4 in HG group was higher than that in NG group, while the gray ratio in EM group's was very significantly lower than that in HG group's (P<0.01). These results indicate that the high glucose can promote the expression of PBDC TLR4, while the EM-1 inhibits the expression of TLR4. EM-1 up-regulates the expression of PBDC surface molecules CD86, CCR7 and CD36 stimulated and induced by high glucose, but inhibites the induction of PBDC to maturity by high glucose. And the secreted inflammatory cytokines IL-12 and IL-10 inhibites the proliferation of T lymphocytes derived from PBDCs, while naloxone inhibites the effect of EM-1. EM-1 inhibites the expression of TLR4 on PBDC surface induced by high glucose.

  4. CD70 is downregulated by interaction with CD27

    PubMed Central

    Kuka, Mirela; Munitic, Ivana; Torchia, Maria Letizia Giardino; Ashwell, Jonathan D.

    2013-01-01

    Engagement of the receptor CD27 by CD70 affects the magnitude and quality of T cell responses in a variety of infection models, and exaggerated signaling via this pathway results in enhanced immune responses and autoimmunity. One means by which signaling is regulated is tight control of cell surface CD70, which is expressed on dendritic, T, and B cells only upon activation. Here we show that there is a second level of regulation. First, although undetectable on the cell surface by flow cytometry, immature dendritic cells (DC) have a small pool of CD70 that continuously recycles from the plasma membrane. In addition, surface levels of CD70 on DC and T cells were higher in mice deficient in CD27, or on DC for which the interaction between CD70 and CD27 was precluded by blocking antibodies. Binding of CD70 by its receptor resulted in downregulation of CD70 transcription and protein levels, suggesting that CD70-mediated “reverse signals” regulate its own levels. Therefore, the ability of CD70 to trigger costimulation is self-regulated when it binds its complementary receptor. PMID:23913967

  5. Rapid Steroid Hormone Actions Initiated at the Cell Surface and the Receptors that Mediate Them with an Emphasis on Recent Progress in Fish Models

    PubMed Central

    Thomas, Peter

    2011-01-01

    In addition to the classic genomic mechanism of steroid action mediated by activation of intracellular nuclear receptors, there is now extensive evidence that steroids also activate receptors on the cell surface to initiate rapid intracellular signaling and biological responses that are often nongenomic. Recent progress in our understanding of rapid, cell surface-initiated actions of estrogens, progestins, androgens and corticosteroids and the identities of the membrane receptors that act as their intermediaries is briefly reviewed with a special emphasis on studies in teleost fish. Two recently discovered novel proteins with seven-transmembrane domains, G protein-coupled receptor 30 (GPR30), and membrane progestin receptors (mPRs) have the ligand binding and signaling characteristics of estrogen and progestin membrane receptors, respectively, but their functional significance is disputed by some researchers. GPR30 is expressed on the cell surface of fish oocytes and mediates estrogen inhibition of oocyte maturation. mPRα is also expressed on the oocyte cell surface and is the intermediary in progestin induction of oocyte maturation in fish. Recent results suggest there is cross-talk between these two hormonal pathways and that there is reciprocal down-regulation of GPR30 and mPRα expression by estrogens and progestins at different phases of oocyte development to regulate the onset of oocyte maturation. There is also evidence in fish that mPRs are involved in progestin induction of sperm hypermotility and anti-apoptotic actions in ovarian follicle cells. Nonclassical androgen and corticosteroid actions have also been described in fish models but the membrane receptors mediating these actions have not been identified. PMID:22154643

  6. Leptin-mediated regulation of MT1-MMP localization is KIF1B dependent and enhances gastric cancer cell invasion.

    PubMed

    Dong, Zhaogang; Xu, Xiaofei; Du, Lutao; Yang, Yongmei; Cheng, Huanhuan; Zhang, Xin; Li, Zewu; Wang, Lili; Li, Juan; Liu, Hui; Qu, Xun; Wang, Chuanxin

    2013-05-01

    Leptin overexpression is closely correlated with gastric cancer (GC) invasion, but its exact effect and the underlying mechanism in tumorigenesis remain poorly understood. Membrane type 1-matrix metalloproteinase (MT1-MMP), a surface-anchored 'master switch' proteinase, is overexpressed and plays crucial roles in tumor invasion. Here, we characterized the influence of leptin on the generation and surface localization of MT1-MMP in GC and elucidated its molecular mechanisms. Our results revealed that leptin promoted GC cell invasion in vitro by upregulating MT1-MMP expression. Furthermore, cell surface biotinylation assay and flow cytometry demonstrated that the surface expression of MT1-MMP was also enhanced by leptin, and knockdown of kinesin family member 1B (KIF1B, a microtubule plus end-directed monomeric motor protein) by small interference RNA inhibited this process. Notably, coimmunoprecipitation analysis indicated that leptin enhanced the interaction of MT1-MMP with KIF1B in a time-dependent manner, which consequently contributed to GC cell invasion. Moreover, leptin increased MT1-MMP or KIF1B expression by the protein kinase B (AKT) pathway and extracellular signal-regulated kinase 1/2 partially participated in this process. However, only AKT was implicated in the leptin-mediated membrane localization of MT1-MMP. Immunohistochemistry analysis revealed that leptin, MT1-MMP and KIF1B are overexpressed in GC tissues, and they positively correlated with clinical stage and lymph node metastasis. These observations indicate that this regulatory network exists in vivo. Taken together, our findings suggest that leptin is an effective intracellular stimulator of MT1-MMP and that leptin-enhanced cell surface localization of MT1-MMP is dependent on KIF1B, which consequently plays a critical role in GC invasion.

  7. Brain region-selective cellular redistribution of mGlu5 but not GABA(B) receptors following methamphetamine-induced associative learning.

    PubMed

    Herrold, Amy A; Voigt, Robin M; Napier, T Celeste

    2011-12-01

    Alterations in receptor expression and distribution between cell surface and cytoplasm are means by which psychostimulants regulate neurotransmission. Metabotropic glutamate receptor group I, subtype 5 (mGluR5) and GABA(B) receptors (GABA(B) R) are critically involved in the development and expression of stimulant-induced behaviors, including conditioned place preference (CPP), an index of drug-seeking. However, it is not known if psychostimulant-induced CPP alters the trafficking of these receptors. To fill this gap, this study used methamphetamine (Meth)-induced CPP in rats to ascertain if receptor changes occur in limbic brain regions that regulate drug-seeking, the medial prefrontal cortex (mPFC), nucleus accumbens (NAc), and ventral pallidum (VP). To do so, ex vivo tissue was assessed for changes in expression and surface vs. intracellular distribution of mGluR5 and GABA(B) Rs. There was a decrease in the surface to intracellular ratio of mGluR5 in the mPFC in Meth-conditioned rats, commensurate with an increase in intracellular levels. mGluR5 levels in the NAc or the VP were unaltered. There were no changes for GABA(B) R in any brain region assayed. This ex vivo snapshot of metabotropic glutamate and GABA receptor cellular distribution following induction of Meth-induced CPP is the first report to determine if these receptors are differentially altered after Meth-induced CPP. The results suggest that this Meth treatment paradigm likely induced a compensatory change in mGluR5 surface to intracellular ratio such that the surface remains unaltered while an increase in intracellular protein occurred. Copyright © 2011 Wiley-Liss, Inc.

  8. Structural Insights into the Regulation of Foreign Genes in Salmonella by the Hha/H-NS Complex*

    PubMed Central

    Ali, Sabrina S.; Whitney, John C.; Stevenson, James; Robinson, Howard; Howell, P. Lynne; Navarre, William Wiley

    2013-01-01

    The bacterial nucleoid-associated proteins Hha and H-NS jointly repress horizontally acquired genes in Salmonella, including essential virulence loci encoded within Salmonella pathogenicity islands. Hha is known to interact with the N-terminal dimerization domain of H-NS; however, the manner in which this interaction enhances transcriptional silencing is not understood. To further understand this process, we solved the x-ray crystal structure of Hha in complex with the N-terminal dimerization domain of H-NS (H-NS(1–46)) to 3.2 Å resolution. Two monomers of Hha bind to symmetrical sites on either side of the H-NS(1–46) dimer. Disruption of the Hha/H-NS interaction by the H-NS site-specific mutation I11A results in increased expression of the Hha/H-NS co-regulated gene hilA without affecting the expression levels of proV, a target gene repressed by H-NS in an Hha-independent fashion. Examination of the structure revealed a cluster of conserved basic amino acids that protrude from the surface of Hha on the opposite side of the Hha/H-NS(1–46) interface. Hha mutants with a diminished positively charged surface maintain the ability to interact with H-NS but can no longer regulate hilA. Increased expression of the hilA locus did not correspond to significant depletion of H-NS at the promoter region in chromatin immunoprecipitation assays. However, in vitro, we find Hha improves H-NS binding to target DNA fragments. Taken together, our results show for the first time how Hha and H-NS interact to direct transcriptional repression and reveal that a positively charged surface of Hha enhances the silencing activity of H-NS nucleoprotein filaments. PMID:23515315

  9. Up-regulated ephrinB3/EphB3 expression in intractable temporal lobe epilepsy patients and pilocarpine induced experimental epilepsy rat model.

    PubMed

    Huang, Hao; Li, Ruohan; Yuan, Jinxian; Zhou, Xin; Liu, Xi; Ou, Shu; Xu, Tao; Chen, Yangmei

    2016-05-15

    EphB family receptor tyrosine kinases, in cooperation with cell surface-bound ephrinB ligands, play a critical role in maintenance of dendritic spine morphogenesis, axons guidance, synaptogenesis, synaptic reorganization and plasticity in the central nervous system (CNS). However, the expression pattern of ephrinB/EphB in intractable temporal lobe epilepsy (TLE) and the underlying molecular mechanisms during epileptogenesis remain poorly understood. Here we investigated the expression pattern and cellular distribution of ephrinB/EphB in intractable TLE patients and lithium chloride-pilocarpine induced TLE rats using real-time quantitative polymerase chain reaction (RT-qPCR), immunohistochemistry, double-labeled immunofluorescence and Western blot analysis. Compared to control groups, ephrinB3 and EphB3 mRNA expression were significantly up-regulated in intractable TLE patients and TLE rats, while the mRNA expression trend of ephrinB1/2 and EphB1/2/4/6 in intractable TLE patients and TLE rats were inconsistent. Western blot analysis and semi-quantitative immunohistochemistry confirmed that ephrinB3 and EphB3 protein level were up-regulated in intractable TLE patients and TLE rats. At the same time, double-labeled immunofluorescence indicate that ephrinB3 was expressed mainly in the cytoplasm and protrusions of glia and neurons, while EphB3 was expressed mainly in the cytoplasm of neurons. Taken together, up-regulated expression of ephrinB3/EphB3 in intractable TLE patients and experimental TLE rats suggested that ephrinB3/EphB3 might be involved in the pathogenesis of TLE. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Regulation of AMPA receptor localization in lipid rafts

    PubMed Central

    Hou, Qingming; Huang, Yunfei; Amato, Stephen; Snyder, Solomon H.; Huganir, Richard L.; Man, Heng-Ye

    2009-01-01

    Lipid rafts are special microdomains enriched in cholesterol, sphingolipids and certain proteins, and play important roles in a variety of cellular functions including signal transduction and protein trafficking. We report that in cultured cortical and hippocampal neurons the distribution of lipid rafts is development-dependent. Lipid rafts in mature neurons exist on the entire cell-surface and display a high degree of mobility. AMPA receptors co-localize and associate with lipid rafts in the plasma membrane. The association of AMPARs with rafts is under regulation; through the NOS–NO pathway, NMDA receptor activity increases AMPAR localization in rafts. During membrane targeting, AMPARs insert into or at close proximity of the surface raft domains. Perturbation of lipid rafts dramatically suppresses AMPA receptor exocytosis, resulting in significant reduction in AMPAR cell-surface expression. PMID:18411055

  11. Betaglycan expression is transcriptionally up-regulated during skeletal muscle differentiation. Cloning of murine betaglycan gene promoter and its modulation by MyoD, retinoic acid, and transforming growth factor-beta.

    PubMed

    Lopez-Casillas, Fernando; Riquelme, Cecilia; Perez-Kato, Yoshiaki; Ponce-Castaneda, M Veronica; Osses, Nelson; Esparza-Lopez, Jose; Gonzalez-Nunez, Gerardo; Cabello-Verrugio, Claudio; Mendoza, Valentin; Troncoso, Victor; Brandan, Enrique

    2003-01-03

    Betaglycan is a membrane-anchored proteoglycan co-receptor that binds transforming growth factor beta (TGF-beta) via its core protein and basic fibroblast growth factor through its glycosaminoglycan chains. In this study we evaluated the expression of betaglycan during the C(2)C(12) skeletal muscle differentiation. Betaglycan expression, as determined by Northern and Western blot, was up-regulated during the conversion of myoblasts to myotubes. The mouse betaglycan gene promoter was cloned, and its sequence showed putative binding sites for SP1, Smad3, Smad4, muscle regulatory factor elements such as MyoD and MEF2, and retinoic acid receptor. Transcriptional activity of the mouse betaglycan promoter reporter was also up-regulated in differentiating C(2)C(12) cells. We found that MyoD, but not myogenin, stimulated this transcriptional activity even in the presence of high serum. Betaglycan promoter activity was increased by RA and inhibited by the three isoforms of TGF-beta. On the other hand, basic fibroblast growth factor, BMP-2, and hepatocyte growth factor/scatter factor, which are inhibitors of myogenesis, had little effect. In myotubes, up-regulated betaglycan was also detectable by TGF-beta affinity labeling and immunofluorescence microscopy studies. The latter indicated that betaglycan was localized both on the cell surface and in the ECM. Forced expression of betaglycan in C(2)C(12) myoblasts increases their responsiveness to TGF-beta2, suggesting that it performs a TGF-beta presentation function in this cell lineage. These results indicate that betaglycan expression is up-regulated during myogenesis and that MyoD and RA modulate its expression by a mechanism that is independent of myogenin.

  12. RNA polymerase II conserved protein domains as platforms for protein-protein interactions

    PubMed Central

    García-López, M Carmen

    2011-01-01

    RNA polymerase II establishes many protein-protein interactions with transcriptional regulators to coordinate gene expression, but little is known about protein domains involved in the contact with them. We use a new approach to look for conserved regions of the RNA pol II of S. cerevisiae located at the surface of the structure of the complex, hypothesizing that they might be involved in the interaction with transcriptional regulators. We defined five different conserved domains and demonstrate that all of them make contact with transcriptional regulators. PMID:21922063

  13. TGF-β signaling directly regulates transcription and functional expression of the electrogenic sodium bicarbonate cotransporter 1, NBCe1 (SLC4A4), via Smad4 in mouse astrocytes.

    PubMed

    Khakipoor, Shokoufeh; Ophoven, Christian; Schrödl-Häußel, Magdalena; Feuerstein, Melanie; Heimrich, Bernd; Deitmer, Joachim W; Roussa, Eleni

    2017-08-01

    The electrogenic sodium bicarbonate cotransporter NBCe1 (SLC4A4) expressed in astrocytes regulates intracellular and extracellular pH. Here, we introduce transforming growth factor beta (TGF-β) as a novel regulator of NBCe1 transcription and functional expression. Using hippocampal slices and primary hippocampal and cortical astrocyte cultures, we investigated regulation of NBCe1 and elucidated the underlying signaling pathways by RT-PCR, immunoblotting, immunofluorescence, intracellular H( + ) recording using the H( + ) -sensitive dye 2',7'-bis-(carboxyethyl)-5-(and-6)-carboxyfluorescein, mink lung epithelial cell (MLEC) assay, and chromatin immunoprecipitation. Activation of TGF-β signaling significantly upregulated transcript, protein, and surface expression of NBCe1. These effects were TGF-β receptor-mediated and suppressed following inhibition of JNK and Smad signaling. Moreover, 4-aminopyridine (4AP)-dependent NBCe1 regulation requires TGF-β. TGF-β increased the rate and amplitude of intracellular H + changes upon challenging NBCe1 in wild-type astrocytes but not in cortical astrocytes from Slc4a4-deficient mice. A Smad4 binding sequence was identified in the NBCe1 promoter and Smad4 binding increased after activation of TGF-β signaling. The data show for the first time that NBCe1 is a direct target of TGF-β/Smad4 signaling. Through activation of the canonical pathway TGF-β acts directly on NBCe1 by binding of Smad4 to the NBCe1 promoter and regulating its transcription, followed by increased protein expression and transport activity. © 2017 The Authors GLIA Published by Wiley Periodicals, Inc.

  14. Lactobacillus rhamnosus CNCMI-4317 Modulates Fiaf/Angptl4 in Intestinal Epithelial Cells and Circulating Level in Mice

    PubMed Central

    Jacouton, Elsa; Mach, Núria; Cadiou, Julie; Lapaque, Nicolas; Clément, Karine; Doré, Joël; van Hylckama Vlieg, Johan E. T.; Smokvina, Tamara; Blottière, Hervé M

    2015-01-01

    Background and Objectives Identification of new targets for metabolic diseases treatment or prevention is required. In this context, FIAF/ANGPTL4 appears as a crucial regulator of energy homeostasis. Lactobacilli are often considered to display beneficial effect for their hosts, acting on different regulatory pathways. The aim of the present work was to study the effect of several lactobacilli strains on Fiaf gene expression in human intestinal epithelial cells (IECs) and on mice tissues to decipher the underlying mechanisms. Subjects and Methods Nineteen lactobacilli strains have been tested on HT–29 human intestinal epithelial cells for their ability to regulate Fiaf gene expression by RT-qPCR. In order to determine regulated pathways, we analysed the whole genome transcriptome of IECs. We then validated in vivo bacterial effects using C57BL/6 mono-colonized mice fed with normal chow. Results We identified one strain (Lactobacillus rhamnosus CNCMI–4317) that modulated Fiaf expression in IECs. This regulation relied potentially on bacterial surface-exposed molecules and seemed to be PPAR-γ independent but PPAR-α dependent. Transcriptome functional analysis revealed that multiple pathways including cellular function and maintenance, lymphoid tissue structure and development, as well as lipid metabolism were regulated by this strain. The regulation of immune system and lipid and carbohydrate metabolism was also confirmed by overrepresentation of Gene Ontology terms analysis. In vivo, circulating FIAF protein was increased by the strain but this phenomenon was not correlated with modulation Fiaf expression in tissues (except a trend in distal small intestine). Conclusion We showed that Lactobacillus rhamnosus CNCMI–4317 induced Fiaf expression in human IECs, and increased circulating FIAF protein level in mice. Moreover, this effect was accompanied by transcriptome modulation of several pathways including immune response and metabolism in vitro. PMID:26439630

  15. Beneficial Autoimmunity at Body Surfaces – Immune Surveillance and Rapid Type 2 Immunity Regulate Tissue Homeostasis and Cancer

    PubMed Central

    Dalessandri, Tim; Strid, Jessica

    2014-01-01

    Epithelial cells (ECs) line body surface tissues and provide a physicochemical barrier to the external environment. Frequent microbial and non-microbial challenges such as those imposed by mechanical disruption, injury or exposure to noxious environmental substances including chemicals, carcinogens, ultraviolet-irradiation, or toxins cause activation of ECs with release of cytokines and chemokines as well as alterations in the expression of cell-surface ligands. Such display of epithelial stress is rapidly sensed by tissue-resident immunocytes, which can directly interact with self-moieties on ECs and initiate both local and systemic immune responses. ECs are thus key drivers of immune surveillance at body surface tissues. However, ECs have a propensity to drive type 2 immunity (rather than type 1) upon non-invasive challenge or stress – a type of immunity whose regulation and function still remain enigmatic. Here, we review the induction and possible role of type 2 immunity in epithelial tissues and propose that rapid immune surveillance and type 2 immunity are key regulators of tissue homeostasis and carcinogenesis. PMID:25101088

  16. Human leukocyte antigen E in human cytomegalovirus infection: friend or foe?

    PubMed

    Gong, Fang; Song, Shengli; Lv, Guozhong; Pan, Yuhong; Zhang, Dongqing; Jiang, Hong

    2012-07-01

    Human cytomegalovirus (HCMV) is a well-studied β-herpesvirus virus, which adopts a variety of strategies to evade immune surveillance. It has been reported that in HCMV-infected cells, classical major histocompatibility (MHC) class I molecules are down-regulated, but the MHC class Ib molecule human leukocyte antigen (HLA)-E is normally expressed or even overexpressed on the cell surface. HLA-E has been first described to interact with CD94/NKG2 receptors expressed mainly on the surface of natural killer (NK) cells, thus confining its role to the regulation of NK-cell function. The engagement of CD94/NKG2A with HLA-E, with a signal peptide of the HCMV glycoprotein UL40, usually induces inhibitory signals. However, HLA-E also serves as a ligand for the TCR expressed by αβCD8(+) T cells. Recognition of peptides presented by HLA-E may result in CD8(+) effector T-cell activation. These findings will help to understand more on both pathogenic and protective roles of HLA-E in HCMV infection. In this review, we discussed recent studies about the roles of HLA-E in HCMV infection.

  17. Functional and genomic analyses of FOXP3-transduced Jurkat-T cells as regulatory T (Treg)-like cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Joon-Young; Kim, Han-Jong; Hurt, Elaine M.

    2007-10-12

    FOXP3, a forkhead transcription factor is essential for the development and function of CD4{sup +}CD25{sup +} regulatory T cells (Tregs). In contrast to conversion of murine naive T cells to Tregs by transduction of Foxp3, it is controversial whether ectopic expression of FOXP3 in human CD4{sup +} T cells is sufficient for acquisition of suppressive activity. Here, we show that retroviral transduction of FOXP3 induces a Treg phenotype in human leukemic CD4{sup +} Jurkat-T cells, evidenced by increased expression of Treg-associated cell surface markers as well as inhibition of cytokine production. Furthermore, FOXP3-transduced Jurkat-T cells suppress the proliferation of humanmore » CD4{sup +}CD25{sup -} T cells. Additionally, DNA microarray analysis identifies Treg-related genes regulated by FOXP3. Our study demonstrates that enforced expression of FOXP3 confers Treg-like properties on Jurkat-T cells, which can be a convenient and efficient Treg-like cell model for further study to identify Treg cell surface markers and target genes regulated by FOXP3.« less

  18. Gene regulation by mechanical forces

    NASA Technical Reports Server (NTRS)

    Oluwole, B. O.; Du, W.; Mills, I.; Sumpio, B. E.

    1997-01-01

    Endothelial cells are subjected to various mechanical forces in vivo from the flow of blood across the luminal surface of the blood vessel. The purpose of this review was to examine the data available on how these mechanical forces, in particular cyclic strain, affect the expression and regulation of endothelial cell function. Studies from various investigators using models of cyclic strain in vitro have shown that various vasoactive mediators such as nitric oxide and prostacyclin are induced by the effect of mechanical deformation, and that the expression of these mediators may be regulated at the transcription level by mechanical forces. There also seems to be emerging evidence that endothelial cells may also act as mechanotransducers, whereby the transmission of external forces induces various cytoskeletal changes and second messenger cascades. Furthermore, it seems these forces may act on specific response elements of promoter genes.

  19. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  20. Targeted Disruption of a Ring-infected Erythrocyte Surface Antigen (RESA)-like Export Protein Gene in Plasmodium falciparum Confers Stable Chondroitin 4-Sulfate Cytoadherence Capacity*

    PubMed Central

    Goel, Suchi; Muthusamy, Arivalagan; Miao, Jun; Cui, Liwang; Salanti, Ali; Winzeler, Elizabeth A.; Gowda, D. Channe

    2014-01-01

    The Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family proteins mediate the adherence of infected erythrocytes to microvascular endothelia of various organs, including the placenta, thereby contributing to cerebral, placental, and other severe malaria pathogenesis. Several parasite proteins, including KAHRP and PfEMP3, play important roles in the cytoadherence by mediating the clustering of PfEMP1 in rigid knoblike structures on the infected erythrocyte surface. The lack of a subtelomeric region of chromosome 2 that contains kahrp and pfemp3 causes reduced cytoadherence. In this study, microarray transcriptome analysis showed that the absence of a gene cluster, comprising kahrp, pfemp3, and four other genes, results in the loss of parasitized erythrocytes adhering to chondroitin 4-sulfate (C4S). The role of one of these genes, PF3D7_0201600/PFB0080c, which encodes PHISTb (Plasmodium helical interspersed subtelomeric b) domain-containing RESA-like protein 1 expressed on the infected erythrocyte surface, was investigated. Disruption of PFB0080c resulted in increased var2csa transcription and VAR2CSA surface expression, leading to higher C4S-binding capacity of infected erythrocytes. Further, PFB0080c-knock-out parasites stably maintained the C4S adherence through many generations of growth. Although the majority of PFB0080c-knock-out parasites bound to C4S even after culturing for 6 months, a minor population bound to both C4S and CD36. These results strongly suggest that the loss of PFB0080c markedly compromises the var gene switching process, leading to a marked reduction in the switching rate and additional PfEMP1 expression by a minor population of parasites. PFB0080c interacts with VAR2CSA and modulates knob-associated Hsp40 expression. Thus, PFB0080c may regulate VAR2CSA expression through these processes. Overall, we conclude that PFB0080c regulates PfEMP1 expression and the parasite's cytoadherence. PMID:25342752

  1. Intracellular Acidosis Promotes Mitochondrial Apoptosis Pathway: Role of EMMPRIN Down-regulation via Specific Single-chain Fv Intrabody

    PubMed Central

    Thammasit, Patcharin; Sangboonruang, Sirikwan; Suwanpairoj, Supattara; Khamaikawin, Wannisa; Intasai, Nutjeera; Kasinrerk, Watchara; Tayapiwatana, Chatchai; Tragoolpua, Khajornsak

    2015-01-01

    Extracellular matrix metalloproteinase inducer (EMMPRIN) is a human leukocyte surface molecule that is enriched on the surface of many cancer cells, and it plays an important role in proliferation and metastasis. In this study, we utilized the chimeric adenoviral vector Ad5/F35 carrying gene encoding scFv against EMMPRIN (scFv-M6-1B9) to down-regulate EMMPRIN cell surface expression and investigated programmed cell death response in colorectal cancer (CRC) cell, Caco-2. The scFv-M6-1B9 intrabody exhibits robust activity in reducing EMMPRIN cell surface expression. This approach led to the inducing of apoptosis, which was relative to the increasing of apoptotic bodies in sub-G1 peak, phosphatidylserine externalization, as well as TUNEL-positive cells. In addition, real-time RT-PCR and western blotting analysis indicated that apoptosis was enhanced through the mitochondrial pathway, a marked reduction of Bcl-2, leading to the translocation of cytochrome c and also the dramatic activation of caspase-3. Moreover, carcinoembryonic antigen (CEA), a tumor marker for CRC, was found to have significantly diminished in both secreted protein and mRNA levels. In conclusion, these findings suggest that EMMPRIN down-regulation by scFv-M6-1B9 intrabody has great potential in enhancing the efficacy of apoptosis induction through the mitochondrial pathway and in effecting a decline in the CEA level. Thus, its benefits could be applied to project the future prospects for targeted gene therapy and therapeutic application in monitoring colorectal cancer. PMID:25663946

  2. DSG2 Is a Functional Cell Surface Marker for Identification and Isolation of Human Pluripotent Stem Cells.

    PubMed

    Park, Jongjin; Son, Yeonsung; Lee, Na Geum; Lee, Kyungmin; Lee, Dong Gwang; Song, Jinhoi; Lee, Jaemin; Kim, Seokho; Cho, Min Ji; Jang, Ju-Hong; Lee, Jangwook; Park, Jong-Gil; Kim, Yeon-Gu; Kim, Jang-Seong; Lee, Jungwoon; Cho, Yee Sook; Park, Young-Jun; Han, Baek Soo; Bae, Kwang-Hee; Han, Seungmin; Kang, Byunghoon; Haam, Seungjoo; Lee, Sang-Hyun; Lee, Sang Chul; Min, Jeong-Ki

    2018-06-08

    Pluripotent stem cells (PSCs) represent the most promising clinical source for regenerative medicine. However, given the cellular heterogeneity within cultivation and safety concerns, the development of specific and efficient tools to isolate a pure population and eliminate all residual undifferentiated PSCs from differentiated derivatives is a prerequisite for clinical applications. In this study, we raised a monoclonal antibody and identified its target antigen as desmoglein-2 (DSG2). DSG2 co-localized with human PSC (hPSC)-specific cell surface markers, and its expression was rapidly downregulated upon differentiation. The depletion of DSG2 markedly decreased hPSC proliferation and pluripotency marker expression. In addition, DSG2-negative population in hPSCs exhibited a notable suppression in embryonic body and teratoma formation. The actions of DSG2 in regulating the self-renewal and pluripotency of hPSCs were predominantly exerted through the regulation of β-catenin/Slug-mediated epithelial-to-mesenchymal transition. Our results demonstrate that DSG2 is a valuable PSC surface marker that is essential for the maintenance of PSC self-renewal. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Tonic ubiquitylation controls T-cell receptor:CD3 complex expression during T-cell development.

    PubMed

    Wang, Haopeng; Holst, Jeff; Woo, Seng-Ryong; Guy, Cliff; Bettini, Matt; Wang, Yao; Shafer, Aaron; Naramura, Mayumi; Mingueneau, Michaël; Dragone, Leonard L; Hayes, Sandra M; Malissen, Bernard; Band, Hamid; Vignali, Dario A A

    2010-04-07

    Expression of the T-cell receptor (TCR):CD3 complex is tightly regulated during T-cell development. The mechanism and physiological role of this regulation are unclear. Here, we show that the TCR:CD3 complex is constitutively ubiquitylated in immature double positive (DP) thymocytes, but not mature single positive (SP) thymocytes or splenic T cells. This steady state, tonic CD3 monoubiquitylation is mediated by the CD3varepsilon proline-rich sequence, Lck, c-Cbl, and SLAP, which collectively trigger the dynamin-dependent downmodulation, lysosomal sequestration and degradation of surface TCR:CD3 complexes. Blocking this tonic ubiquitylation by mutating all the lysines in the CD3 cytoplasmic tails significantly upregulates TCR levels on DP thymocytes. Mimicking monoubiquitylation by expression of a CD3zeta-monoubiquitin (monoUb) fusion molecule significantly reduces TCR levels on immature thymocytes. Moreover, modulating CD3 ubiquitylation alters immunological synapse (IS) formation and Erk phosphorylation, thereby shifting the signalling threshold for positive and negative selection, and regulatory T-cell development. Thus, tonic TCR:CD3 ubiquitylation results in precise regulation of TCR expression on immature T cells, which is required to maintain the fidelity of T-cell development.

  4. Tonic ubiquitylation controls T-cell receptor:CD3 complex expression during T-cell development

    PubMed Central

    Wang, Haopeng; Holst, Jeff; Woo, Seng-Ryong; Guy, Cliff; Bettini, Matt; Wang, Yao; Shafer, Aaron; Naramura, Mayumi; Mingueneau, Michaël; Dragone, Leonard L; Hayes, Sandra M; Malissen, Bernard; Band, Hamid; Vignali, Dario A A

    2010-01-01

    Expression of the T-cell receptor (TCR):CD3 complex is tightly regulated during T-cell development. The mechanism and physiological role of this regulation are unclear. Here, we show that the TCR:CD3 complex is constitutively ubiquitylated in immature double positive (DP) thymocytes, but not mature single positive (SP) thymocytes or splenic T cells. This steady state, tonic CD3 monoubiquitylation is mediated by the CD3ɛ proline-rich sequence, Lck, c-Cbl, and SLAP, which collectively trigger the dynamin-dependent downmodulation, lysosomal sequestration and degradation of surface TCR:CD3 complexes. Blocking this tonic ubiquitylation by mutating all the lysines in the CD3 cytoplasmic tails significantly upregulates TCR levels on DP thymocytes. Mimicking monoubiquitylation by expression of a CD3ζ-monoubiquitin (monoUb) fusion molecule significantly reduces TCR levels on immature thymocytes. Moreover, modulating CD3 ubiquitylation alters immunological synapse (IS) formation and Erk phosphorylation, thereby shifting the signalling threshold for positive and negative selection, and regulatory T-cell development. Thus, tonic TCR:CD3 ubiquitylation results in precise regulation of TCR expression on immature T cells, which is required to maintain the fidelity of T-cell development. PMID:20150895

  5. JAK2 and MPL protein levels determine TPO-induced megakaryocyte proliferation vs differentiation

    PubMed Central

    Besancenot, Rodolphe; Roos-Weil, Damien; Tonetti, Carole; Abdelouahab, Hadjer; Lacout, Catherine; Pasquier, Florence; Willekens, Christophe; Rameau, Philippe; Lecluse, Yann; Micol, Jean-Baptiste; Constantinescu, Stefan N.; Vainchenker, William; Solary, Eric

    2014-01-01

    Megakaryopoiesis is a 2-step differentiation process, regulated by thrombopoietin (TPO), on binding to its cognate receptor myeloproliferative leukemia (MPL). This receptor associates with intracytoplasmic tyrosine kinases, essentially janus kinase 2 (JAK2), which regulates MPL stability and cell-surface expression, and mediates TPO-induced signal transduction. We demonstrate that JAK2 and MPL mediate TPO-induced proliferation arrest and megakaryocytic differentiation of the human megakaryoblastic leukemia cell line UT7-MPL. A decrease in JAK2 or MPL protein expression, and JAK2 chemical inhibition, suppress this antiproliferative action of TPO. The expression of JAK2 and MPL, which progressively increases along normal human megakaryopoiesis, is decreased in platelets of patients diagnosed with JAK2- or MPL-mutated essential thrombocytemia and primary myelofibrosis, 2 myeloproliferative neoplasms in which megakaryocytes (MKs) proliferate excessively. Finally, low doses of JAK2 chemical inhibitors are shown to induce a paradoxical increase in MK production, both in vitro and in vivo. We propose that JAK2 and MPL expression levels regulate megakaryocytic proliferation vs differentiation in both normal and pathological conditions, and that JAK2 chemical inhibitors could promote a paradoxical thrombocytosis when used at suboptimal doses. PMID:25143485

  6. JAK2 and MPL protein levels determine TPO-induced megakaryocyte proliferation vs differentiation.

    PubMed

    Besancenot, Rodolphe; Roos-Weil, Damien; Tonetti, Carole; Abdelouahab, Hadjer; Lacout, Catherine; Pasquier, Florence; Willekens, Christophe; Rameau, Philippe; Lecluse, Yann; Micol, Jean-Baptiste; Constantinescu, Stefan N; Vainchenker, William; Solary, Eric; Giraudier, Stéphane

    2014-09-25

    Megakaryopoiesis is a 2-step differentiation process, regulated by thrombopoietin (TPO), on binding to its cognate receptor myeloproliferative leukemia (MPL). This receptor associates with intracytoplasmic tyrosine kinases, essentially janus kinase 2 (JAK2), which regulates MPL stability and cell-surface expression, and mediates TPO-induced signal transduction. We demonstrate that JAK2 and MPL mediate TPO-induced proliferation arrest and megakaryocytic differentiation of the human megakaryoblastic leukemia cell line UT7-MPL. A decrease in JAK2 or MPL protein expression, and JAK2 chemical inhibition, suppress this antiproliferative action of TPO. The expression of JAK2 and MPL, which progressively increases along normal human megakaryopoiesis, is decreased in platelets of patients diagnosed with JAK2- or MPL-mutated essential thrombocytemia and primary myelofibrosis, 2 myeloproliferative neoplasms in which megakaryocytes (MKs) proliferate excessively. Finally, low doses of JAK2 chemical inhibitors are shown to induce a paradoxical increase in MK production, both in vitro and in vivo. We propose that JAK2 and MPL expression levels regulate megakaryocytic proliferation vs differentiation in both normal and pathological conditions, and that JAK2 chemical inhibitors could promote a paradoxical thrombocytosis when used at suboptimal doses. © 2014 by The American Society of Hematology.

  7. MicroRNA-200c Modulates the Expression of MUC4 and MUC16 by Directly Targeting Their Coding Sequences in Human Pancreatic Cancer

    PubMed Central

    Radhakrishnan, Prakash; Mohr, Ashley M.; Grandgenett, Paul M.; Steele, Maria M.; Batra, Surinder K.; Hollingsworth, Michael A.

    2013-01-01

    Transmembrane mucins, MUC4 and MUC16 are associated with tumor progression and metastatic potential in human pancreatic adenocarcinoma. We discovered that miR-200c interacts with specific sequences within the coding sequence of MUC4 and MUC16 mRNAs, and evaluated the regulatory nature of this association. Pancreatic cancer cell lines S2.028 and T3M-4 transfected with miR-200c showed a 4.18 and 8.50 fold down regulation of MUC4 mRNA, and 4.68 and 4.82 fold down regulation of MUC16 mRNA compared to mock-transfected cells, respectively. A significant reduction of glycoprotein expression was also observed. These results indicate that miR-200c overexpression regulates MUC4 and MUC16 mucins in pancreatic cancer cells by directly targeting the mRNA coding sequence of each, resulting in reduced levels of MUC4 and MUC16 mRNA and protein. These data suggest that, in addition to regulating proteins that modulate EMT, miR-200c influences expression of cell surface mucins in pancreatic cancer. PMID:24204560

  8. MicroRNA-200c modulates the expression of MUC4 and MUC16 by directly targeting their coding sequences in human pancreatic cancer.

    PubMed

    Radhakrishnan, Prakash; Mohr, Ashley M; Grandgenett, Paul M; Steele, Maria M; Batra, Surinder K; Hollingsworth, Michael A

    2013-01-01

    Transmembrane mucins, MUC4 and MUC16 are associated with tumor progression and metastatic potential in human pancreatic adenocarcinoma. We discovered that miR-200c interacts with specific sequences within the coding sequence of MUC4 and MUC16 mRNAs, and evaluated the regulatory nature of this association. Pancreatic cancer cell lines S2.028 and T3M-4 transfected with miR-200c showed a 4.18 and 8.50 fold down regulation of MUC4 mRNA, and 4.68 and 4.82 fold down regulation of MUC16 mRNA compared to mock-transfected cells, respectively. A significant reduction of glycoprotein expression was also observed. These results indicate that miR-200c overexpression regulates MUC4 and MUC16 mucins in pancreatic cancer cells by directly targeting the mRNA coding sequence of each, resulting in reduced levels of MUC4 and MUC16 mRNA and protein. These data suggest that, in addition to regulating proteins that modulate EMT, miR-200c influences expression of cell surface mucins in pancreatic cancer.

  9. Human cytomegalovirus gH stability and trafficking are regulated by ER-associated degradation and transmembrane architecture.

    PubMed

    Gardner, Thomas J; Hernandez, Rosmel E; Noriega, Vanessa M; Tortorella, Domenico

    2016-03-30

    The prototypic betaherpesvirus human cytomegalovirus (CMV) establishes life-long persistence within its human host. While benign in healthy individuals, CMV poses a significant threat to the immune compromised, including transplant recipients and neonates. The CMV glycoprotein complex gH/gL/gO mediates infection of fibroblasts, and together with the gH/gL/UL128/130/131 a pentameric complex permits infection of epithelial, endothethial, and myeloid cells. Given the central role of the gH/gL complex during infection, we were interested in studying cellular trafficking of the gH/gL complex through generation of human cells that stably express gH and gL. When expressed alone, CMV gH and gL were degraded through the ER-associated degradation (ERAD) pathway. However, co-expression of these proteins stabilized the polypeptides and enhanced their cell-surface expression. To further define regulatory factors involved in gH/gL trafficking, a CMV gH chimera in which the gH transmembrane and cytoplasmic tail were replaced with that of human CD4 protein permitted cell surface gH expression in absence of gL. We thus demonstrate the ability of distinct cellular processes to regulate the trafficking of viral glycoproteins. Collectively, the data provide insight into the processing and trafficking requirements of CMV envelope protein complexes and provide an example of the co-opting of cellular processes by CMV.

  10. WNK4 inhibits NCC protein expression through MAPK ERK1/2 signaling pathway.

    PubMed

    Zhou, Bo; Wang, Dexuan; Feng, Xiuyan; Zhang, Yiqian; Wang, Yanhui; Zhuang, Jieqiu; Zhang, Xuemei; Chen, Guangping; Delpire, Eric; Gu, Dingying; Cai, Hui

    2012-03-01

    WNK [with no lysine (K)] kinase is a subfamily of serine/threonine kinases. Mutations in two members of this family (WNK1 and WNK4) cause pseudohypoaldosteronism type II featuring hypertension, hyperkalemia, and metabolic acidosis. WNK1 and WNK4 were shown to regulate sodium chloride cotransporter (NCC) activity through phosphorylating SPAK and OSR1. Previous studies including ours have also shown that WNK4 inhibits NCC function and its protein expression. A recent study reported that a phorbol ester inhibits NCC function via activation of extracellular signal-regulated kinase (ERK) 1/2 kinase. In the current study, we investigated whether WNK4 affects NCC via the MAPK ERK1/2 signaling pathway. We found that WNK4 increased ERK1/2 phosphorylation in a dose-dependent manner in mouse distal convoluted tubule (mDCT) cells, whereas WNK4 mutants with the PHA II mutations (E562K and R1185C) lost the ability to increase the ERK1/2 phosphorylation. Hypertonicity significantly increased ERK1/2 phosphorylation in mDCT cells. Knock-down of WNK4 expression by siRNA resulted in a decrease of ERK1/2 phosphorylation. We further showed that WNK4 knock-down significantly increases the cell surface and total NCC protein expressions and ERK1/2 knock-down also significantly increases cell surface and total NCC expression. These data suggest that WNK4 inhibits NCC through activating the MAPK ERK1/2 signaling pathway.

  11. Dysregulated expression of cell surface glycoprotein CDCP1 in prostate cancer

    PubMed Central

    Yang, Lifang; Dutta, Sucharita M.; Troyer, Dean A.; Lin, Jefferson B.; Lance, Raymond A.; Nyalwidhe, Julius O.; Drake, Richard R; Semmes, O. John

    2015-01-01

    CUB-domain-containing protein 1 (CDCP1) is a trans-membrane protein regulator of cell adhesion with a potent pro-migratory function in tumors. Given that proteolytic cleavage of the ectodomain correlates with outside-in oncogenic signaling, we characterized glycosylation in the context of cellular processing and expression of CDCP1 in prostate cancer. We detected 135 kDa full-length and proteolytic processed 70 kDa species in a panel of PCa cell models. The relative expression of full-length CDCP1 correlated with the metastatic potential of syngeneic cell models and an increase in surface membrane expression of CDCP1 was observed in tumor compared to adjacent normal prostate tissues. We demonstrated that glycosylation of CDCP1 is a prerequisite for protein stability and plasma membrane localization, and that the expression level and extent of N-glycosylation of CDCP1 correlated with metastatic status. Interestingly, complex N-linked glycans with sialic acid chains were restricted to the N-terminal half of the ectodomain and absent in the truncated species. Characterization of the extracellular expression of CDCP1 identified novel circulating forms and revealed that extracellular vesicles provide additional processing pathways. Employing immunoaffinity mass spectrometry, we detected elevated levels of circulating CDCP1 in patient urine with high-risk disease. Our results establish that differential glycosylation, cell surface presentation and extracellular expression of CDCP1 are hallmarks of PCa progression. PMID:26497208

  12. The expression patterns of pro-apoptotic and anti-apoptotic factors in human fetal and adult ovary.

    PubMed

    Poljicanin, Ana; Vukusic Pusic, Tanja; Vukojevic, Katarina; Caric, Ana; Vilovic, Katarina; Tomic, Snjezana; Soljic, Violeta; Saraga-Babic, Mirna

    2013-07-01

    The influence of pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins on the cell death (caspase-3, TUNEL) of different ovarian cell lineages was immunohistochemically analyzed in six fetal and five adult human ovaries in order to disclose possible mechanisms of cell number control. Mild to moderate expression of Bcl-2 characterized ovarian surface epithelium, follicular cells and oocytes of 15 and 22 week human ovaries, while expression of Bax and caspase-3 gradually increased in all ovarian cell populations, except caspase-3 in the ovarian surface epithelium. Different levels of Bax and Bcl-2 proteins co-expression characterized fetal ovarian cells, while TUNEL and caspase-3 co-expression was found only in some of them. In adult ovaries, Bcl-2 was moderately and Bax strongly expressed in the surface ovarian epithelium and stroma. Bcl-2 and Bax expression in granulosa and theca interna cells varied depending on the stage of follicular atresia. Caspase-3 apoptotic cells characterized granulosa cells of adult atretic follicles. Our results indicate that intracellular levels of Bcl-2 and Bax protein might regulate the final destiny of developing germ cells. Caspase-3 dependent apoptosis seems to be the most important, but not the only cell death pathway in ovaries. In adult ovaries, caspase-dependent cell death characterized granulosa cells, but not the germ cells. Copyright © 2012 Elsevier GmbH. All rights reserved.

  13. A protein crosslinking assay for measuring cell surface expression of glutamate receptor subunits in the rodent brain after in vivo treatments

    PubMed Central

    Boudreau, Amy C.; Milovanovic, Mike; Conrad, Kelly L.; Nelson, Christopher; Ferrario, Carrie R.; Wolf, Marina E.

    2012-01-01

    Trafficking of neurotransmitter receptors between intracellular and cell surface compartments is important for regulating neurotransmission. We developed a method for determining if an in vivo treatment has altered receptor distribution in a particular region of rodent brain. After the treatment, brain slices are rapidly prepared from the region of interest. Then cell surface-expressed receptors are covalently crosslinked to nearby proteins using the membrane-impermeable, bifunctional crosslinker bis(sulfosuccinimidyl)suberate (BS3). This increases the apparent molecular weight of surface receptors, while intracellular receptors are not modified. Thus, surface and intracellular receptor pools can be separated and quantified using SDS-PAGE and immunoblotting. This method is particularly useful for analyzing AMPA receptor subunits, offering advantages in accuracy, efficiency and cost compared to biotinylation. A disadvantage is that some antibodies no longer recognize their target protein after crosslinking. We have used this method to quantify changes in receptor distribution after acute and chronic exposure to psychomotor stimulants. PMID:22470150

  14. Cell Type-Specific Regulation of Immunological Synapse Dynamics by B7 Ligand Recognition

    PubMed Central

    Brzostek, Joanna; Gascoigne, Nicholas R. J.; Rybakin, Vasily

    2016-01-01

    B7 proteins CD80 (B7-1) and CD86 (B7-2) are expressed on most antigen-presenting cells and provide critical co-stimulatory or inhibitory input to T cells via their T-cell-expressed receptors: CD28 and CTLA-4. CD28 is expressed on effector T cells and regulatory T cells (Tregs), and CD28-dependent signals are required for optimum activation of effector T cell functions. CD28 ligation on effector T cells leads to formation of distinct molecular patterns and induction of cytoskeletal rearrangements at the immunological synapse (IS). CD28 plays a critical role in recruitment of protein kinase C (PKC)-θ to the effector T cell IS. CTLA-4 is constitutively expressed on the surface of Tregs, but it is expressed on effector T cells only after activation. As CTLA-4 binds to B7 proteins with significantly higher affinity than CD28, B7 ligand recognition by cells expressing both receptors leads to displacement of CD28 and PKC-θ from the IS. In Tregs, B7 ligand recognition leads to recruitment of CTLA-4 and PKC-η to the IS. CTLA-4 plays a role in regulation of T effector and Treg IS stability and cell motility. Due to their important roles in regulating T-cell-mediated responses, B7 receptors are emerging as important drug targets in oncology. In this review, we present an integrated summary of current knowledge about the role of B7 family receptor–ligand interactions in the regulation of spatial and temporal IS dynamics in effector and Tregs. PMID:26870040

  15. Genome-Wide Transcriptome Analyses of Silicon Metabolism in Phaeodactylum tricornutum Reveal the Multilevel Regulation of Silicic Acid Transporters

    PubMed Central

    Sapriel, Guillaume; Quinet, Michelle; Heijde, Marc; Jourdren, Laurent; Tanty, Véronique; Luo, Guangzuo; Le Crom, Stéphane; Lopez, Pascal Jean

    2009-01-01

    Background Diatoms are largely responsible for production of biogenic silica in the global ocean. However, in surface seawater, Si(OH)4 can be a major limiting factor for diatom productivity. Analyzing at the global scale the genes networks involved in Si transport and metabolism is critical in order to elucidate Si biomineralization, and to understand diatoms contribution to biogeochemical cycles. Methodology/Principal Findings Using whole genome expression analyses we evaluated the transcriptional response to Si availability for the model species Phaeodactylum tricornutum. Among the differentially regulated genes we found genes involved in glutamine-nitrogen pathways, encoding putative extracellular matrix components, or involved in iron regulation. Some of these compounds may be good candidates for intracellular intermediates involved in silicic acid storage and/or intracellular transport, which are very important processes that remain mysterious in diatoms. Expression analyses and localization studies gave the first picture of the spatial distribution of a silicic acid transporter in a diatom model species, and support the existence of transcriptional and post-transcriptional regulations. Conclusions/Significance Our global analyses revealed that about one fourth of the differentially expressed genes are organized in clusters, underlying a possible evolution of P. tricornutum genome, and perhaps other pennate diatoms, toward a better optimization of its response to variable environmental stimuli. High fitness and adaptation of diatoms to various Si levels in marine environments might arise in part by global regulations from gene (expression level) to genomic (organization in clusters, dosage compensation by gene duplication), and by post-transcriptional regulation and spatial distribution of SIT proteins. PMID:19829693

  16. A Phosphoinositide 3-Kinase (PI3K)-serum- and glucocorticoid-inducible Kinase 1 (SGK1) Pathway Promotes Kv7.1 Channel Surface Expression by Inhibiting Nedd4-2 Protein*

    PubMed Central

    Andersen, Martin Nybo; Krzystanek, Katarzyna; Petersen, Frederic; Bomholtz, Sofia Hammami; Olesen, Søren-Peter; Abriel, Hugues; Jespersen, Thomas; Rasmussen, Hanne Borger

    2013-01-01

    Epithelial cell polarization involves several kinase signaling cascades that eventually divide the surface membrane into an apical and a basolateral part. One kinase, which is activated during the polarization process, is phosphoinositide 3-kinase (PI3K). In MDCK cells, the basolateral potassium channel Kv7.1 requires PI3K activity for surface-expression during the polarization process. Here, we demonstrate that Kv7.1 surface expression requires tonic PI3K activity as PI3K inhibition triggers endocytosis of these channels in polarized MDCK. Pharmacological inhibition of SGK1 gave similar results as PI3K inhibition, whereas overexpression of constitutively active SGK1 overruled it, suggesting that SGK1 is the primary downstream target of PI3K in this process. Furthermore, knockdown of the ubiquitin ligase Nedd4-2 overruled PI3K inhibition, whereas a Nedd4-2 interaction-deficient Kv7.1 mutant was resistant to both PI3K and SGK1 inhibition. Altogether, these data suggest that a PI3K-SGK1 pathway stabilizes Kv7.1 surface expression by inhibiting Nedd4-2-dependent endocytosis and thereby demonstrates that Nedd4-2 is a key regulator of Kv7.1 localization and turnover in epithelial cells. PMID:24214981

  17. A phosphoinositide 3-kinase (PI3K)-serum- and glucocorticoid-inducible kinase 1 (SGK1) pathway promotes Kv7.1 channel surface expression by inhibiting Nedd4-2 protein.

    PubMed

    Andersen, Martin Nybo; Krzystanek, Katarzyna; Petersen, Frederic; Bomholtz, Sofia Hammami; Olesen, Søren-Peter; Abriel, Hugues; Jespersen, Thomas; Rasmussen, Hanne Borger

    2013-12-27

    Epithelial cell polarization involves several kinase signaling cascades that eventually divide the surface membrane into an apical and a basolateral part. One kinase, which is activated during the polarization process, is phosphoinositide 3-kinase (PI3K). In MDCK cells, the basolateral potassium channel Kv7.1 requires PI3K activity for surface-expression during the polarization process. Here, we demonstrate that Kv7.1 surface expression requires tonic PI3K activity as PI3K inhibition triggers endocytosis of these channels in polarized MDCK. Pharmacological inhibition of SGK1 gave similar results as PI3K inhibition, whereas overexpression of constitutively active SGK1 overruled it, suggesting that SGK1 is the primary downstream target of PI3K in this process. Furthermore, knockdown of the ubiquitin ligase Nedd4-2 overruled PI3K inhibition, whereas a Nedd4-2 interaction-deficient Kv7.1 mutant was resistant to both PI3K and SGK1 inhibition. Altogether, these data suggest that a PI3K-SGK1 pathway stabilizes Kv7.1 surface expression by inhibiting Nedd4-2-dependent endocytosis and thereby demonstrates that Nedd4-2 is a key regulator of Kv7.1 localization and turnover in epithelial cells.

  18. Engineering of global regulators and cell surface properties toward enhancing stress tolerance in Saccharomyces cerevisiae.

    PubMed

    Kuroda, Kouichi; Ueda, Mitsuyoshi

    2017-12-01

    Microbial cell factories are subject to various stresses, leading to the reductions of metabolic activity and bioproduction efficiency. Therefore, the development of stress-tolerant microorganisms is important for improving bio-production efficiency. Recently, modifications of cell surface properties and master regulators have been shown to be effective approaches for enhancing stress tolerance. The cell surface is an attractive target owing to its interactions with the environment and its role in transmitting environmental information. Cell surface engineering in yeast has enabled the convenient modification of cell surface properties. Displaying random peptide libraries and subsequent screening can successfully improve stress tolerance. Furthermore, master regulators including transcription factors are also promising target to be engineered because stress tolerance is determined by many cooperative factors and modification of master regulators can simultaneously affect the expression of multiple downstream genes. The key single amino acid mutations in transcription factors have been identified by analyzing tolerant yeasts that were isolated by adaptive evolution under stress conditions. This enabled the reconstruction of stress-tolerant yeast without burdening cells by introducing the identified mutations. Therefore, for the construction of stress-tolerant yeast from any strains, these two approaches are promising alternatives to conventional overexpression and deletion of stress-related genes. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  19. The Carboxyl Tail of Connexin32 Regulates Gap Junction Assembly in Human Prostate and Pancreatic Cancer Cells*

    PubMed Central

    Katoch, Parul; Mitra, Shalini; Ray, Anuttoma; Kelsey, Linda; Roberts, Brett J.; Wahl, James K.; Johnson, Keith R.; Mehta, Parmender P.

    2015-01-01

    Connexins, the constituent proteins of gap junctions, are transmembrane proteins. A connexin (Cx) traverses the membrane four times and has one intracellular and two extracellular loops with the amino and carboxyl termini facing the cytoplasm. The transmembrane and the extracellular loop domains are highly conserved among different Cxs, whereas the carboxyl termini, often called the cytoplasmic tails, are highly divergent. We have explored the role of the cytoplasmic tail of Cx32, a Cx expressed in polarized and differentiated cells, in regulating gap junction assembly. Our results demonstrate that compared with the full-length Cx32, the cytoplasmic tail-deleted Cx32 is assembled into small gap junctions in human pancreatic and prostatic cancer cells. Our results further document that the expression of the full-length Cx32 in cells, which express the tail-deleted Cx32, increases the size of gap junctions, whereas the expression of the tail-deleted Cx32 in cells, which express the full-length Cx32, has the opposite effect. Moreover, we show that the tail is required for the clustering of cell-cell channels and that in cells expressing the tail-deleted Cx32, the expression of cell surface-targeted cytoplasmic tail alone is sufficient to enhance the size of gap junctions. Our live-cell imaging data further demonstrate that gap junctions formed of the tail-deleted Cx32 are highly mobile compared with those formed of full-length Cx32. Our results suggest that the cytoplasmic tail of Cx32 is not required to initiate the assembly of gap junctions but for their subsequent growth and stability. Our findings suggest that the cytoplasmic tail of Cx32 may be involved in regulating the permeability of gap junctions by regulating their size. PMID:25548281

  20. MUS81 is associated with cell proliferation and cisplatin sensitivity in serous ovarian cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Suhong; Zheng, Hui; Department of Oncology, Shanghai Medical College, Fudan University, Shanghai

    The dysfunction of DNA damage repair (DDR) pathway contributes to tumorigenesis and drug-resistance in cancer. MUS81 is a member of the conserved xeroderma pigmentosum group F (XPF) family protein of endonucleases, which is important to the DDR pathway. However, the role of MUS81 in the development of ovarian cancer remains uncertain. To explore the expression of MUS81 and its association to serous ovarian cancer (SOC), 43 biopsies of SOC patients were detected by qRT-PCR, and 29 specimens were further performed by immunohistochemistry analysis. Here, we observed that MUS81 was over-expressed in SOC tissues at both transcript and protein levels, andmore » the expression level of MUS81 protein in ovarian cancer cell lines was also higher than that in human normal ovarian surface epithelial cell line (HOSEpiC). We also found that down-regulation of MUS81 expression in ovarian cancer cells inhibited cell proliferation and colony formation ability, and influenced cell cycle progression. Moreover, inhibition of MUS81 expression induced cellular senescence and enhanced the antitumor effect of cisplatin. Down-regulation of MUS81 expression could suppress the growth and development of SOC. These results indicate that MUS81 might play important roles in the progression of SOC and influence the antitumor effect of cisplatin. - Highlights: • MUS81 was overexpression in serous ovarian cancer (SOC). • Meanwhile down-regulation of inhibited cell proliferation and influenced cell cycle progression. • Inhibition of MUS81 induced cell cellular senescence and enhanced the antitumor effect of cisplatin. • Down-regulation of MUS81 expression could suppress the growth and development of SOC.« less

  1. Electroosmotic flow and ionic conductance in a pH-regulated rectangular nanochannel

    NASA Astrophysics Data System (ADS)

    Sadeghi, Morteza; Saidi, Mohammad Hassan; Sadeghi, Arman

    2017-06-01

    Infinite series solutions are obtained for electrical potential, electroosmotic velocity, ionic conductance, and surface physicochemical properties of long pH-regulated rectangular nanochannels of low surface potential utilizing the double finite Fourier transform method. Closed form expressions are also obtained for channels of large height to width ratio for which the depthwise variations vanish. Neglecting the Stern layer impact, the effects of EDL (Electric Double Layer) overlap, multiple ionic species, and association/dissociation reactions on the surface are all taken into account. Moreover, finite-element-based numerical simulations are conducted to account for the end effects as well as to validate the analytical solutions. We show that, with the exception of the migratory ionic conductivity, all the physicochemical parameters are strong functions of the channel aspect ratio. Accordingly, a slit geometry is not a good representative of a rectangular channel when the width is comparable to the height. It is also observed that the distribution of the electrical potential is not uniform over the surface of a charge-regulated channel. In addition, unlike ordinary channels for which an increase in the background salt concentration is always accompanied by higher flow rates, quite the opposite may be true for a pH-regulated duct at higher salt concentrations.

  2. Involvement of Rab9 and Rab11 in the intracellular trafficking of TRPC6.

    PubMed

    Cayouette, Sylvie; Bousquet, Simon M; Francoeur, Nancy; Dupré, Emilie; Monet, Michaël; Gagnon, Hugo; Guedri, Youssef B; Lavoie, Christine; Boulay, Guylain

    2010-07-01

    TRPC proteins become involved in Ca2+ entry following the activation of Gq-protein coupled receptors. TRPC6 is inserted into the plasma membrane upon stimulation and remains in the plasma membrane as long as the stimulus is present. However, the mechanism that regulates the trafficking of TRPC6 is unclear. In the present study, we highlighted the involvement of two Rab GTPases in the trafficking of TRPC6. Rab9 co-localized in vesicular structures with TRPC6 in HeLa cells and co-immunoprecipitated with TRPC6. When co-expressed with TRPC6, Rab9(S21N), a dominant negative mutant, caused an increase in the level of TRPC6 at the plasma membrane and in TRPC6-mediated Ca2+ entry upon activation by a muscarinic receptor agonist. Similarly, the expression of Rab11 also caused an increase in TRPC6 expression at the cell surface and an increase in TRPC6-mediated Ca2+ entry. The co-expression of TRPC6 with the dominant negative mutant Rab11(S25N) abolished CCh-induced TRPC6 activation and reduced the level of TRPC6 at the plasma membrane. This study demonstrates that the trans-Golgi network and recycling endosomes are involved in the intracellular trafficking of TRPC6 by regulating channel density at the cell surface. 2010 Elsevier B.V. All rights reserved.

  3. Cooperative roles for emmprin and LYVE-1 in the regulation of chemoresistance for primary effusion lymphoma

    PubMed Central

    Qin, Z; Dai, L; Bratoeva, M; Slomiany, MG; Toole, BP; Parsons, C

    2013-01-01

    The Kaposi’s sarcoma-associated herpesvirus is the causative agent of primary effusion lymphoma (PEL), for which cytotoxic chemotherapy represents the standard of care. The high mortality associated with PEL may be explained in part by resistance of these tumors to chemotherapy. The membrane-bound glycoprotein emmprin (CD147) enhances chemoresistance in tumors through effects on transporter expression, trafficking and interactions. Interactions between hyaluronan and hyaluronan receptors on the cell surface also facilitate emmprin-mediated chemoresistance. Whether emmprin or hyaluronan-receptor interactions regulate chemotherapeutic resistance for virus-associated malignancies is unknown. Using human PEL tumor cells, we found that PEL sensitivity to chemotherapy is directly proportional to expression of emmprin, the lymphatic vessel endothelial hyaluronan receptor-1 (LYVE-1) and a drug transporter known as the breast cancer resistance protein/ABCG2 (BCRP), and that emmprin, LYVE-1 and BCRP interact with each other and colocalize on the PEL cell surface. In addition, we found that emmprin induces chemoresistance in PEL cells through upregulation of BCRP expression, and RNA interference targeting of emmprin, LYVE-1 or BCRP enhances PEL cell apoptosis induced by chemotherapy. Finally, disruption of hyaluronan-receptor interactions using small hyaluronan oligosaccharides reduces expression of emmprin and BCRP while sensitizing PEL cells to chemotherapy. Collectively, these data support interdependent roles for emmprin, LYVE-1 and BCRP in chemotherapeutic resistance for PEL. PMID:21660043

  4. Polydimethylsiloxane (PDMS) modulates CD38 expression, absorbs retinoic acid and may perturb retinoid signalling.

    PubMed

    Futrega, Kathryn; Yu, Jianshi; Jones, Jace W; Kane, Maureen A; Lott, William B; Atkinson, Kerry; Doran, Michael R

    2016-04-21

    Polydimethylsiloxane (PDMS) is the most commonly used material in the manufacture of customized cell culture devices. While there is concern that uncured PDMS oligomers may leach into culture medium and/or hydrophobic molecules may be absorbed into PDMS structures, there is no consensus on how or if PDMS influences cell behaviour. We observed that human umbilical cord blood (CB)-derived CD34(+) cells expanded in standard culture medium on PDMS exhibit reduced CD38 surface expression, relative to cells cultured on tissue culture polystyrene (TCP). All-trans retinoic acid (ATRA) induces CD38 expression, and we reasoned that this hydrophobic molecule might be absorbed by PDMS. Through a series of experiments we demonstrated that ATRA-mediated CD38 expression was attenuated when cultures were maintained on PDMS. Medium pre-incubated on PDMS for extended durations resulted in a time-dependant reduction of ATRA in the medium and increasingly attenuated CD38 expression. This indicated a time-dependent absorption of ATRA into the PDMS. To better understand how PDMS might generally influence cell behaviour, Ingenuity Pathway Analysis (IPA) was used to identify potential upstream regulators. This analysis was performed for differentially expressed genes in primary cells including CD34(+) haematopoietic progenitor cells, mesenchymal stromal cells (MSC), and keratinocytes, and cell lines including prostate cancer epithelial cells (LNCaP), breast cancer epithelial cells (MCF-7), and myeloid leukaemia cells (KG1a). IPA predicted that the most likely common upstream regulator of perturbed pathways was ATRA. We demonstrate here that ATRA is absorbed by PDMS in a time-dependent manner and results in the concomitant reduced expression of CD38 on the cell surface of CB-derived CD34(+) cells.

  5. The Dentin Sialoprotein (DSP) Domain Regulates Dental Mesenchymal Cell Differentiation through a Novel Surface Receptor

    PubMed Central

    Wan, Chunyan; Yuan, Guohua; Luo, Daoshu; Zhang, Lu; Lin, Heng; Liu, Huan; Chen, Lei; Yang, Guobin; Chen, Shuo; Chen, Zhi

    2016-01-01

    Dentin sialophosphoprotein (DSPP) is a dentin extracellular matrix protein that is processed into dentin sialoprotein (DSP), dentin glycoprotein (DGP) and dentin phosphoprotein (DPP). DSP is mainly expressed in odontoblasts. We hypothesized that DSP interacts with cell surface receptors and subsequently activates intracellular signaling. Using DSP as bait for screening a protein library, we demonstrate that DSP acts as a ligand and binds to integrin β6. The 36 amino acid residues of DSP are sufficient to bind to integrin β6. This peptide promoted cell attachment, migration, differentiation and mineralization of dental mesenchymal cells. In addition, DSP aa183-219 stimulated phosphorylation of ERK1/2 and P38 kinases. This activation was inhibited by an anti-integrin β6 antibody and siRNA. Furthermore, we demonstrate that this DSP fragment induces SMAD1/5/8 phosphorylation and nuclear translocation via ERK1/2 and P38 signaling. SMAD1/5/8 binds to SMAD binding elements (SBEs) in the DSPP gene promoter. SBE mutations result in a decrease in DSPP transcriptional activity. Endogenous DSPP expression was up-regulated by DSP aa183-219 in dental mesenchymal cells. The data in the current study demonstrate for the first time that this DSP domain acts as a ligand in a RGD-independent manner and is involved in intracellular signaling via interacting with integrin β6. The DSP domain regulates DSPP expression and odontoblast homeostasis via a positive feedback loop. PMID:27430624

  6. The Dentin Sialoprotein (DSP) Domain Regulates Dental Mesenchymal Cell Differentiation through a Novel Surface Receptor.

    PubMed

    Wan, Chunyan; Yuan, Guohua; Luo, Daoshu; Zhang, Lu; Lin, Heng; Liu, Huan; Chen, Lei; Yang, Guobin; Chen, Shuo; Chen, Zhi

    2016-07-19

    Dentin sialophosphoprotein (DSPP) is a dentin extracellular matrix protein that is processed into dentin sialoprotein (DSP), dentin glycoprotein (DGP) and dentin phosphoprotein (DPP). DSP is mainly expressed in odontoblasts. We hypothesized that DSP interacts with cell surface receptors and subsequently activates intracellular signaling. Using DSP as bait for screening a protein library, we demonstrate that DSP acts as a ligand and binds to integrin β6. The 36 amino acid residues of DSP are sufficient to bind to integrin β6. This peptide promoted cell attachment, migration, differentiation and mineralization of dental mesenchymal cells. In addition, DSP (aa183-219) stimulated phosphorylation of ERK1/2 and P38 kinases. This activation was inhibited by an anti-integrin β6 antibody and siRNA. Furthermore, we demonstrate that this DSP fragment induces SMAD1/5/8 phosphorylation and nuclear translocation via ERK1/2 and P38 signaling. SMAD1/5/8 binds to SMAD binding elements (SBEs) in the DSPP gene promoter. SBE mutations result in a decrease in DSPP transcriptional activity. Endogenous DSPP expression was up-regulated by DSP (aa183-219) in dental mesenchymal cells. The data in the current study demonstrate for the first time that this DSP domain acts as a ligand in a RGD-independent manner and is involved in intracellular signaling via interacting with integrin β6. The DSP domain regulates DSPP expression and odontoblast homeostasis via a positive feedback loop.

  7. Keratin impact on PKCδ- and ASMase-mediated regulation of hepatocyte lipid raft size – implication for FasR-associated apoptosis

    PubMed Central

    Gilbert, Stéphane; Loranger, Anne; Omary, M. Bishr

    2016-01-01

    ABSTRACT Keratins are epithelial cell intermediate filament (IF) proteins that are expressed as pairs in a cell-differentiation-regulated manner. Hepatocytes express the keratin 8 and 18 pair (denoted K8/K18) of IFs, and a loss of K8 or K18, as in K8-null mice, leads to degradation of the keratin partner. We have previously reported that a K8/K18 loss in hepatocytes leads to altered cell surface lipid raft distribution and more efficient Fas receptor (FasR, also known as TNFRSF6)-mediated apoptosis. We demonstrate here that the absence of K8 or transgenic expression of the K8 G62C mutant in mouse hepatocytes reduces lipid raft size. Mechanistically, we find that the lipid raft size is dependent on acid sphingomyelinase (ASMase, also known as SMPD1) enzyme activity, which is reduced in absence of K8/K18. Notably, the reduction of ASMase activity appears to be caused by a less efficient redistribution of surface membrane PKCδ toward lysosomes. Moreover, we delineate the lipid raft volume range that is required for an optimal FasR-mediated apoptosis. Hence, K8/K18-dependent PKCδ- and ASMase-mediated modulation of lipid raft size can explain the more prominent FasR-mediated signaling resulting from K8/K18 loss. The fine-tuning of ASMase-mediated regulation of lipid rafts might provide a therapeutic target for death-receptor-related liver diseases. PMID:27422101

  8. Notch and PKC are involved in formation of the lateral region of the dorso-ventral axis in Drosophila embryos.

    PubMed

    Tremmel, Daniel M; Resad, Sedat; Little, Christopher J; Wesley, Cedric S

    2013-01-01

    The Notch gene encodes an evolutionarily conserved cell surface receptor that generates regulatory signals based on interactions between neighboring cells. In Drosophila embryos it is normally expressed at a low level due to strong negative regulation. When this negative regulation is abrogated neurogenesis in the ventral region is suppressed, the development of lateral epidermis is severely disrupted, and the dorsal aminoserosa is expanded. Of these phenotypes only the anti-neurogenic phenotype could be linked to excess canonical Notch signaling. The other phenotypes were linked to high levels of Notch protein expression at the surface of cells in the lateral regions indicating that a non-canonical Notch signaling activity normally functions in these regions. Results of our studies reported here provide evidence. They show that Notch activities are inextricably linked to that of Pkc98E, the homolog of mammalian PKCδ. Notch and Pkc98E up-regulate the levels of the phosphorylated form of IκBCactus, a negative regulator of Toll signaling, and Mothers against dpp (MAD), an effector of Dpp signaling. Our data suggest that in the lateral regions of the Drosophila embryos Notch activity, in conjunction with Pkc98E activity, is used to form the slopes of the opposing gradients of Toll and Dpp signaling that specify cell fates along the dorso-ventral axis.

  9. Notch and PKC Are Involved in Formation of the Lateral Region of the Dorso-Ventral Axis in Drosophila Embryos

    PubMed Central

    Tremmel, Daniel M.; Resad, Sedat; Little, Christopher J.; Wesley, Cedric S.

    2013-01-01

    The Notch gene encodes an evolutionarily conserved cell surface receptor that generates regulatory signals based on interactions between neighboring cells. In Drosophila embryos it is normally expressed at a low level due to strong negative regulation. When this negative regulation is abrogated neurogenesis in the ventral region is suppressed, the development of lateral epidermis is severely disrupted, and the dorsal aminoserosa is expanded. Of these phenotypes only the anti-neurogenic phenotype could be linked to excess canonical Notch signaling. The other phenotypes were linked to high levels of Notch protein expression at the surface of cells in the lateral regions indicating that a non-canonical Notch signaling activity normally functions in these regions. Results of our studies reported here provide evidence. They show that Notch activities are inextricably linked to that of Pkc98E, the homolog of mammalian PKCδ. Notch and Pkc98E up-regulate the levels of the phosphorylated form of IκBCactus, a negative regulator of Toll signaling, and Mothers against dpp (MAD), an effector of Dpp signaling. Our data suggest that in the lateral regions of the Drosophila embryos Notch activity, in conjunction with Pkc98E activity, is used to form the slopes of the opposing gradients of Toll and Dpp signaling that specify cell fates along the dorso-ventral axis. PMID:23861806

  10. CD147, CD44, and the epidermal growth factor receptor (EGFR) signaling pathway cooperate to regulate breast epithelial cell invasiveness.

    PubMed

    Grass, G Daniel; Tolliver, Lauren B; Bratoeva, Momka; Toole, Bryan P

    2013-09-06

    The immunoglobulin superfamily glycoprotein CD147 (emmprin; basigin) is associated with an invasive phenotype in various types of cancers, including malignant breast cancer. We showed recently that up-regulation of CD147 in non-transformed, non-invasive breast epithelial cells is sufficient to induce an invasive phenotype characterized by membrane type-1 matrix metalloproteinase (MT1-MMP)-dependent invadopodia activity (Grass, G. D., Bratoeva, M., and Toole, B. P. (2012) Regulation of invadopodia formation and activity by CD147. J. Cell Sci. 125, 777-788). Here we found that CD147 induces breast epithelial cell invasiveness by promoting epidermal growth factor receptor (EGFR)-Ras-ERK signaling in a manner dependent on hyaluronan-CD44 interaction. Furthermore, CD147 promotes assembly of signaling complexes containing CD147, CD44, and EGFR in lipid raftlike domains. We also found that oncogenic Ras regulates CD147 expression, hyaluronan synthesis, and formation of CD147-CD44-EGFR complexes, thus forming a positive feedback loop that may amplify invasiveness. Last, we showed that malignant breast cancer cells are heterogeneous in their expression of surface-associated CD147 and that high levels of membrane CD147 correlate with cell surface EGFR and CD44 levels, activated EGFR and ERK1, and activated invadopodia. Future studies should evaluate CD147 as a potential therapeutic target and disease stratification marker in breast cancer.

  11. SH2 domain-containing adaptor protein B expressed in dendritic cells is involved in T-cell homeostasis by regulating dendritic cell-mediated Th2 immunity.

    PubMed

    Ahmed, Md Selim; Kang, Myeong-Ho; Lee, Ezra; Park, Yujin; Jeong, Yideul; Bae, Yong-Soo

    2017-01-01

    The Src homology 2 domain-containing adaptor protein B (SHB) is widely expressed in immune cells and acts as an important regulator for hematopoietic cell function. SHB silencing induces Th2 immunity in mice. SHB is also involved in T-cell homeostasis in vivo . However, SHB has not yet been studied and addressed in association with dendritic cells (DCs). The effects of SHB expression on the immunogenicity of DCs were assessed by Shb gene silencing in mouse bone marrow-derived DCs (BMDCs). After silencing, surface phenotype, cytokine expression profile, and T-cell stimulation capacity of BMDCs were examined. We investigated the signaling pathways involved in SHB expression during BMDC development. We also examined the immunogenicity of SHB-knockdown (SHB KD ) BMDCs in a mouse atopic dermatitis model. SHB was steadily expressed in mouse splenic DCs and in in vitro -generated BMDCs in both immature and mature stages. SHB expression was contingent on activation of the mitogen- activated protein kinase/Foxa2 signaling pathway during DC development. SHB KD increased the expression of MHC class II and costimulatory molecules without affecting the cytokine expression of BMDCs. When co-cultured with T cells, SHB KD in BMDCs significantly induced CD4 + T-cell proliferation and the expression of Th2 cytokines, while the regulatory T cell (Treg) population was downregulated. In mouse atopic dermatitis model, mice inoculated with SHB KD DCs developed more severe symptoms of atopic dermatitis compared with mice injected with control DCs. SHB expression in DCs plays an important role in T-cell homeostasis in vivo by regulating DC-mediated Th2 polarization.

  12. Antithrombotic Effects of Nur77 and Nor1 Are Mediated Through Upregulating Thrombomodulin Expression in Endothelial Cells.

    PubMed

    Yang, Ping; Wei, Xin; Zhang, Jian; Yi, Bing; Zhang, Guan-Xin; Yin, Litian; Yang, Xiao-Feng; Sun, Jianxin

    2016-02-01

    Thrombomodulin is highly expressed on the lumenal surface of vascular endothelial cells (ECs) and possesses potent anticoagulant, antifibrinolytic, and anti-inflammatory activities in the vessel wall. However, the regulation of thrombomodulin expression in ECs remains largely unknown. In this study, we characterized nuclear receptor 4A family as a novel regulator of thrombomodulin expression in vascular ECs. We demonstrated that both nuclear receptors 4A, Nur77 and Nor1, robustly increase thrombomodulin mRNA and protein levels in human vascular ECs and in mouse liver tissues after adenovirus-mediated transduction of Nur77 and Nor1 cDNAs. Moreover, Nur77 deficiency and knockdown of Nur77 and Nor1 expression markedly attenuated the basal and vascular endothelial growth factor165-stimulated thrombomodulin expression. Mechanistically, we found that Nur77 and Nor1 increase thrombomodulin expression by acting through 2 different mechanisms. We showed that Nur77 barely affects thrombomodulin promoter activity, but significantly increases thrombomodulin mRNA stability, whereas Nor1 enhances thrombomodulin expression mainly through induction of Kruppel-like factors 2 and 4 in vascular ECs. Furthermore, we demonstrated that both Nur77 and Nor1 significantly increase protein C activity and inhibit tumor necrosis factor α-induced prothrombotic effects in human ECs. Deficiency of Nur77 increases susceptibility to arterial thrombosis, whereas enhanced expression of Nur77 and Nor1 protects mice from arterial thrombus formation. Our results identified nuclear receptors 4A as novel regulators of thrombomodulin expression and function in vascular ECs and provided a proof-of-concept demonstration that targeted increasing expression of Nur77 and Nor1 in the vascular endothelium might represent a novel therapeutic approach for the treatment of thrombotic disorders. © 2015 American Heart Association, Inc.

  13. Expression Analysis of the Transmembrane Mucin MUC20 in Human Corneal and Conjunctival Epithelia

    PubMed Central

    Woodward, Ashley M.; Argüeso, Pablo

    2014-01-01

    Purpose. Cell surface mucins are a group of highly O-glycosylated transmembrane glycoproteins responsible for the protection of epithelial cells on mucosal surfaces. The aim of this study was to investigate the localization and regulation of mucin 20 (MUC20) at the ocular surface. Methods. Localization of MUC20 in human corneal and conjunctival epithelia was evaluated by immunofluorescence microscopy. Immortalized corneal (HCLE) and conjunctival (HCjE) cell lines were grown at different stages of differentiation and subjected to quantitative PCR and Western blot analyses. Cell surface proteins on apical cell membranes were biotinylated and isolated by neutravidin chromatography. Results. The MUC20 was detected throughout the entire human ocular surface epithelia, predominantly in cell membranes within intermediate cell layers. In conjunctiva, MUC20 also was observed in the cytoplasm of apical cells within the stratified squamous epithelium, but not in goblet cells. Quantitative PCR and immunoblotting demonstrated expression of MUC20 in HCLE and HCjE cells. Induction of differentiation with serum-containing medium resulted in upregulation of MUC20 mRNA and protein. Biotin labeling of the surface of stratified cultures revealed low levels of MUC20 protein on apical glycocalyces. Further, MUC20 was not detected in the cell culture media or in human tears, suggesting that the extracellular domain of MUC20 is not released from the ocular surface as described previously for other cell surface mucins. Conclusions. Our results indicate that MUC20 is a novel transmembrane mucin expressed by the human corneal and conjunctival epithelia, and suggest that differential expression of MUC20 during differentiation has a role in maintaining ocular surface homeostasis. PMID:25168902

  14. The Androgen-Regulated Protease TMPRSS2 Activates aProteolytic Cascade Involving Components of the Tumor Microenvironment and Promotes Prostate Cancer Metastasis

    PubMed Central

    Lucas, Jared M.; Heinlein, Cynthia; Kim, Tom; Hernandez, Susana A.; Malik, Muzdah S.; True, Lawrence D.; Morrissey, Colm; Corey, Eva; Montgomery, Bruce; Mostaghel, Elahe; Clegg, Nigel; Coleman, Ilsa; Brown, Christopher M.; Schneider, Eric L.; Craik, Charles; Simon, Julian; Bedalov, Tony; Nelson, Peter S.

    2014-01-01

    TMPRSS2 is an androgen-regulated cell surface serine protease expressed predominantly in prostate epithelium. TMPRSS2 is expressed highly in localized high-grade prostate cancers and in the majority of human prostate cancer metastasis. Through the generation of mouse models with a targeted deletion of Tmprss2, we demonstrate that the activity of this protease regulates cancer cell invasion and metastasis to distant organs. By screening combinatorial peptide libraries we identified a spectrum of TMPRSS2 substrates that include pro-hepatocyte growth factor (HGF). HGF activated by TMPRSS2 promoted c-Met receptor tyrosine kinase signaling, and initiated a pro-invasive EMT phenotype. Chemical library screens identified a potent bioavailable TMPRSS2 inhibitor that suppressed prostate cancer metastasis in vivo. Together, these findings provide a mechanistic link between androgen-regulated signaling programs and prostate cancer metastasis that operate via context-dependent interactions with extracellular constituents of the tumor microenvironment. PMID:25122198

  15. Regulation of osteogenesis by micro/nano hierarchical titanium surfaces through a Rock-Wnt5a feedback loop.

    PubMed

    Yu, Yonglin; Shen, Xinkun; Liu, Junjie; Hu, Yan; Ran, Qichun; Mu, Caiyun; Cai, Kaiyong

    2018-05-28

    Titanium substrates with micro/nano hierarchical features could positively mediate the osteogenesis of a titanium implant; nevertheless, the underlying molecular mechanism needs to be further revealed. In this work, we fabricated a micro/nano hierarchically structured Ti (MNT) sample and attempted to evaluate its topography-mediated biological effects and potential molecular mechanisms in vitro. The results proved that MNT could not only affect cell morphology and osteogenic differentiation, but also regulate ROCK activity cell biological functions of osteoblasts involved in ROCK activation, β-catenin accumulation, and high-Wnt5a expression in respect to topographical features. Moreover, blockade of ROCK activation resulted in significant inhibition of cell differentiation and Wnt5a expression. Furthermore, the anti-Wnt5a significantly down-regulated ROCK activity. In short, these results indicate the important role of ROCK-Wnt5a feedback loop in regulating cell differentiation by topographies. Copyright © 2018. Published by Elsevier B.V.

  16. Multiple Signaling Pathways Are Involved in the Interleukine-4 Regulated Expression of DC-SIGN in THP-1 Cell Line

    PubMed Central

    Jin, Changzhong; Wu, Lijuan; Li, Jie; Fang, Meixin; Cheng, Linfang; Wu, Nanping

    2012-01-01

    Dendritic cell-specific intercellular adhesion molecule-3 grabbing nonintegrin (DC-SIGN) is an important pattern recognition receptor on dendritic cells (DCs), and its expression shows significant cytological and histological specificity, being interleukine-4 (IL-4) dependent. The signaling pathways through which IL-4 regulates expression of DC-SIGN are still unclear. We used phorbol 12-myristate 13-acetate- (PMA-) differentiated THP-1 cells as the in vitro model of monocyte/macrophage cells to study the signaling pathways involved in IL-4-regulated expression of DC-SIGN. We found that a high expression of DC-SIGN could be induced by IL-4 at the levels of mRNA and cell surface protein. Upregulated expression of DC-SIGN was almost completely blocked by the specific inhibitor of ERK pathway, and partly reduced by the specific inhibitors of JAK-STAT and NF-κB pathways. The activation of the three signaling pathways was directly confirmed by testing the phosphorylation of protein kinase within the cytoplasm and nucleus over time. The analysis of cis-acting elements of DC-SIGN promoter showed that the activity of DC-SIGN promoter without Ets-1 transcription factors binding site almost completely disappeared. Our results demonstrated that multiple signaling pathways are involved in IL-4 induced high expression of DC-SIGN on THP-1 cells, in which ERK pathway is the main signaling pathway and mediated by the Ets-1 transcription factors binding site. PMID:22675249

  17. Induction and expression of GluA1 (GluR-A)-independent LTP in the hippocampus

    PubMed Central

    Romberg, Carola; Raffel, Joel; Martin, Lucy; Sprengel, Rolf; Seeburg, Peter H; Rawlins, J Nicholas P; Bannerman, David M; Paulsen, Ole

    2009-01-01

    Long-term potentiation (LTP) at hippocampal CA3–CA1 synapses is thought to be mediated, at least in part, by an increase in the postsynaptic surface expression of α-amino-3-hydroxy-5-methyl-4-isoxazole proprionic acid (AMPA) receptors induced by N-methyl-d-aspartate (NMDA) receptor activation. While this process was originally attributed to the regulated synaptic insertion of GluA1 (GluR-A) subunit-containing AMPA receptors, recent evidence suggests that regulated synaptic trafficking of GluA2 subunits might also contribute to one or several phases of potentiation. However, it has so far been difficult to separate these two mechanisms experimentally. Here we used genetically modified mice lacking the GluA1 subunit (Gria1−/− mice) to investigate GluA1-independent mechanisms of LTP at CA3–CA1 synapses in transverse hippocampal slices. An extracellular, paired theta-burst stimulation paradigm induced a robust GluA1-independent form of LTP lacking the early, rapidly decaying component characteristic of LTP in wild-type mice. This GluA1-independent form of LTP was attenuated by inhibitors of neuronal nitric oxide synthase and protein kinase C (PKC), two enzymes known to regulate GluA2 surface expression. Furthermore, the induction of GluA1-independent potentiation required the activation of GluN2B (NR2B) subunit-containing NMDA receptors. Our findings support and extend the evidence that LTP at hippocampal CA3–CA1 synapses comprises a rapidly decaying, GluA1-dependent component and a more sustained, GluA1-independent component, induced and expressed via a separate mechanism involving GluN2B-containing NMDA receptors, neuronal nitric oxide synthase and PKC. PMID:19302150

  18. ARF6 directs axon transport and traffic of integrins and regulates axon growth in adult DRG neurons.

    PubMed

    Eva, Richard; Crisp, Sarah; Marland, Jamie R K; Norman, Jim C; Kanamarlapudi, Venkateswarlu; ffrench-Constant, Charles; Fawcett, James W

    2012-07-25

    Integrins are involved in axon growth and regeneration. Manipulation of integrins is a route to promoting axon regeneration and understanding regeneration failure in the CNS. Expression of α9 integrin promotes axon regeneration, so we have investigated α9β1 trafficking and transport in axons and at the growth cone. We have previously found that α9 and β1 integrins traffic via Rab11-positive recycling endosomes in peripheral axons and growth cones. However, transport via Rab11 is slow, while rapid transport occurs in vesicles lacking Rab11. We have further studied α9 and β1 integrin transport and traffic in adult rat dorsal root ganglion axons and PC12 cells. Integrins are in ARF6 vesicles during rapid axonal transport and during trafficking in the growth cone. We report that rapid axonal transport of these integrins and their trafficking at the cell surface is regulated by ARF6. ARF6 inactivation by expression of ACAP1 leads to increased recycling of β1 integrins to the neuronal surface and to increased anterograde axonal transport. ARF6 activation by expression of the neuronal guanine nucleotide exchange factors, ARNO or EFA6, increases retrograde integrin transport in axons and increases integrin internalization. ARF6 inactivation increases integrin-mediated outgrowth, while activation decreases it. The coordinated changes in integrin transport and recycling resulting from ARF6 activation or inactivation are the probable mechanism behind this regulation of axon growth. Our data suggest a novel mechanism of integrin traffic and transport in peripheral axons, regulated by the activation state of ARF6, and suggest that ARF6 might be targeted to enhance integrin-dependent axon regeneration after injury.

  19. Aberrant neuronal activity-induced signaling and gene expression in a mouse model of RASopathy

    PubMed Central

    Nakhaei-Rad, Saeideh; Montenegro-Venegas, Carolina; Pina-Fernández, Eneko; Marini, Claudia; Santos, Monica; Ahmadian, Mohammad R.; Stork, Oliver; Zenker, Martin

    2017-01-01

    Noonan syndrome (NS) is characterized by reduced growth, craniofacial abnormalities, congenital heart defects, and variable cognitive deficits. NS belongs to the RASopathies, genetic conditions linked to mutations in components and regulators of the Ras signaling pathway. Approximately 50% of NS cases are caused by mutations in PTPN11. However, the molecular mechanisms underlying cognitive impairments in NS patients are still poorly understood. Here, we report the generation and characterization of a new conditional mouse strain that expresses the overactive Ptpn11D61Y allele only in the forebrain. Unlike mice with a global expression of this mutation, this strain is viable and without severe systemic phenotype, but shows lower exploratory activity and reduced memory specificity, which is in line with a causal role of disturbed neuronal Ptpn11 signaling in the development of NS-linked cognitive deficits. To explore the underlying mechanisms we investigated the neuronal activity-regulated Ras signaling in brains and neuronal cultures derived from this model. We observed an altered surface expression and trafficking of synaptic glutamate receptors, which are crucial for hippocampal neuronal plasticity. Furthermore, we show that the neuronal activity-induced ERK signaling, as well as the consecutive regulation of gene expression are strongly perturbed. Microarray-based hippocampal gene expression profiling revealed profound differences in the basal state and upon stimulation of neuronal activity. The neuronal activity-dependent gene regulation was strongly attenuated in Ptpn11D61Y neurons. In silico analysis of functional networks revealed changes in the cellular signaling beyond the dysregulation of Ras/MAPK signaling that is nearly exclusively discussed in the context of NS at present. Importantly, changes in PI3K/AKT/mTOR and JAK/STAT signaling were experimentally confirmed. In summary, this study uncovers aberrant neuronal activity-induced signaling and regulation of gene expression in Ptpn11D61Y mice and suggests that these deficits contribute to the pathophysiology of cognitive impairments in NS. PMID:28346493

  20. Procyanidin dimer B2-mediated IRAK-M induction negatively regulates TLR4 signaling in macrophages

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sung, Nak-Yun; Yang, Mi-So; Song, Du-Sub

    Highlights: •Pro B2 elevated the expression of IRAK-M, a negative regulator of TLR signaling. •LPS-induced expression of cell surface molecules was inhibited by Pro B2. •LPS-induced production of pro-inflammatory cytokines was inhibited by Pro B2. •Pro B2 inhibited LPS-induced activation of MAPKs and NF-κB through IRAK-M. •Pro B2 inactivated naïve T cells by inhibiting LPS-induced cytokines via IRAK-M. -- Abstract: Polyphenolic compounds have been found to possess a wide range of physiological activities that may contribute to their beneficial effects against inflammation-related diseases; however, the molecular mechanisms underlying this anti-inflammatory activity are not completely characterized, and many features remain tomore » be elucidated. In this study, we investigated the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by procyanidin dimer B2 (Pro B2) in macrophages. Pro B2 markedly elevated the expression of the interleukin (IL)-1 receptor-associated kinase (IRAK)-M protein, a negative regulator of TLR signaling. Lipopolysaccharide (LPS)-induced expression of cell surface molecules (CD80, CD86, and MHC class I/II) and production of pro-inflammatory cytokines (tumor necrosis factor-α, IL-1β, IL-6, and IL-12p70) were inhibited by Pro B2, and this action was prevented by IRAK-M silencing. In addition, Pro B2-treated macrophages inhibited LPS-induced activation of mitogen-activated protein kinases such as extracellular signal-regulated kinase 1/2, p38, and c-Jun N-terminal kinase and the translocation of nuclear factor κB and p65 through IRAK-M. We also found that Pro B2-treated macrophages inactivated naïve T cells by inhibiting LPS-induced interferon-γ and IL-2 secretion through IRAK-M. These novel findings provide new insights into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and the immune-pharmacological role of Pro B2 in the immune response against the development and progression of many chronic diseases.« less

  1. Perilipin, a critical regulator of fat storage and breakdown, is a target gene of estrogen receptor-related receptor {alpha}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko

    2008-04-11

    Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less

  2. Selenoprotein W controls epidermal growth factor receptor surface expression, activation and degradation via receptor ubiquitination

    USDA-ARS?s Scientific Manuscript database

    Epidermal growth factor (EGF) receptor (EGFR) is the founding member of the ErbB family of growth factor receptors that modulate a complex network of intracellular signaling pathways controlling growth, proliferation and differentiation. Selenoprotein W (SEPW1) is a diet-regulated, highly conserved...

  3. The membrane trafficking and functionality of the K+-Cl- co-transporter KCC2 is regulated by TGF-β2.

    PubMed

    Roussa, Eleni; Speer, Jan Manuel; Chudotvorova, Ilona; Khakipoor, Shokoufeh; Smirnov, Sergei; Rivera, Claudio; Krieglstein, Kerstin

    2016-09-15

    Functional activation of the neuronal K(+)-Cl(-) co-transporter KCC2 (also known as SLC12A5) is a prerequisite for shifting GABAA responses from depolarizing to hyperpolarizing during development. Here, we introduce transforming growth factor β2 (TGF-β2) as a new regulator of KCC2 membrane trafficking and functional activation. TGF-β2 controls membrane trafficking, surface expression and activity of KCC2 in developing and mature mouse primary hippocampal neurons, as determined by immunoblotting, immunofluorescence, biotinylation of surface proteins and KCC2-mediated Cl(-) extrusion. We also identify the signaling pathway from TGF-β2 to cAMP-response-element-binding protein (CREB) and Ras-associated binding protein 11b (Rab11b) as the underlying mechanism for TGF-β2-mediated KCC2 trafficking and functional activation. TGF-β2 increases colocalization and interaction of KCC2 with Rab11b, as determined by 3D stimulated emission depletion (STED) microscopy and co-immunoprecipitation, respectively, induces CREB phosphorylation, and enhances Rab11b gene expression. Loss of function of either CREB1 or Rab11b suppressed TGF-β2-dependent KCC2 trafficking, surface expression and functionality. Thus, TGF-β2 is a new regulatory factor for KCC2 functional activation and membrane trafficking, and a putative indispensable molecular determinant for the developmental shift of GABAergic transmission. © 2016. Published by The Company of Biologists Ltd.

  4. EMMPRIN Regulates Cytoskeleton Reorganization and Cell Adhesion in Prostate Cancer

    PubMed Central

    Zhu, Haining; Zhao, Jun; Zhu, Beibei; Collazo, Joanne; Gal, Jozsef; Shi, Ping; Liu, Li; Ström, Anna-Lena; Lu, Xiaoning; McCann, Richard O.; Toborek, Michal; Kyprianou, Natasha

    2011-01-01

    Background Proteins on cell surface play important roles during cancer progression and metastasis via their ability to mediate cell-to-cell interactions and navigate the communication between cells and the microenvironment. Methods In this study a targeted proteomic analysis was conducted to identify the differential expression of cell surface proteins in human benign (BPH-1) vs. malignant (LNCaP and PC-3) prostate epithelial cells. We identified EMMPRIN (extracellular matrix metalloproteinase inducer) as a key candidate and shRNA functional approaches were subsequently applied to determine the role of EMMPRIN in prostate cancer cell adhesion, migration, invasion as well as cytoskeleton organization. Results EMMPRIN was found to be highly expressed on the surface of prostate cancer cells compared to BPH-1 cells, consistent with a correlation between elevated EMMPRIN and metastasis found in other tumors. No significant changes in cell proliferation, cell cycle progression or apoptosis were detected in EMMPRIN knockdown cells compared to the scramble controls. Furthermore, EMMPRIN silencing markedly decreased the ability of PC-3 cells to form filopodia, a critical feature of invasive behavior, while it increased expression of cell-cell adhesion and gap junction proteins. Conclusions Our results suggest that EMMPRIN regulates cell adhesion, invasion and cytoskeleton reorganization in prostate cancer cells. This study identifies a new function for EMMPRIN as a contributor to prostate cancer cell-cell communication and cytoskeleton changes towards metastatic spread, and suggests its potential value as a marker of prostate cancer progression to metastasis. PMID:21563192

  5. EMMPRIN regulates cytoskeleton reorganization and cell adhesion in prostate cancer.

    PubMed

    Zhu, Haining; Zhao, Jun; Zhu, Beibei; Collazo, Joanne; Gal, Jozsef; Shi, Ping; Liu, Li; Ström, Anna-Lena; Lu, Xiaoning; McCann, Richard O; Toborek, Michal; Kyprianou, Natasha

    2012-01-01

    Proteins on cell surface play important roles during cancer progression and metastasis via their ability to mediate cell-to-cell interactions and navigate the communication between cells and the microenvironment. In this study a targeted proteomic analysis was conducted to identify the differential expression of cell surface proteins in human benign (BPH-1) versus malignant (LNCaP and PC-3) prostate epithelial cells. We identified EMMPRIN (extracellular matrix metalloproteinase inducer) as a key candidate and shRNA functional approaches were subsequently applied to determine the role of EMMPRIN in prostate cancer cell adhesion, migration, invasion as well as cytoskeleton organization. EMMPRIN was found to be highly expressed on the surface of prostate cancer cells compared to BPH-1 cells, consistent with a correlation between elevated EMMPRIN and metastasis found in other tumors. No significant changes in cell proliferation, cell cycle progression, or apoptosis were detected in EMMPRIN knockdown cells compared to the scramble controls. Furthermore, EMMPRIN silencing markedly decreased the ability of PC-3 cells to form filopodia, a critical feature of invasive behavior, while it increased expression of cell-cell adhesion and gap junction proteins. Our results suggest that EMMPRIN regulates cell adhesion, invasion, and cytoskeleton reorganization in prostate cancer cells. This study identifies a new function for EMMPRIN as a contributor to prostate cancer cell-cell communication and cytoskeleton changes towards metastatic spread, and suggests its potential value as a marker of prostate cancer progression to metastasis. Copyright © 2011 Wiley Periodicals, Inc.

  6. Epithelial heparan sulfate regulates Sonic Hedgehog signaling in lung development.

    PubMed

    He, Hua; Huang, Meina; Sun, Shenfei; Wu, Yihui; Lin, Xinhua

    2017-08-01

    The tree-like structure of the mammalian lung is generated from branching morphogenesis, a reiterative process that is precisely regulated by numerous factors. How the cell surface and extra cellular matrix (ECM) molecules regulate this process is still poorly understood. Herein, we show that epithelial deletion of Heparan Sulfate (HS) synthetase Ext1 resulted in expanded branching tips and reduced branching number, associated with several mesenchymal developmental defects. We further demonstrate an expanded Fgf10 expression and increased FGF signaling activity in Ext1 mutant lungs, suggesting a cell non-autonomous mechanism. Consistent with this, we observed reduced levels of SHH signaling which is responsible for suppressing Fgf10 expression. Moreover, reactivating SHH signaling in mutant lungs rescued the tip dilation phenotype and attenuated FGF signaling. Importantly, the reduced SHH signaling activity did not appear to be caused by decreased Shh expression or protein stability; instead, biologically active form of SHH proteins were reduced in both the Ext1 mutant epithelium and surrounding wild type mesenchymal cells. Together, our study highlights the epithelial HS as a key player for dictating SHH signaling critical for lung morphogenesis.

  7. Temperature Regulation of Shigella Virulence: Identification of Temperature-Regulated Shigella Invasion Genes by the Isolation of inv::lacZ Operon Fusions and the Characterization of the Virulence Gene Regulator virR

    DTIC Science & Technology

    1991-04-10

    Partial nucleotide sequence of viri? clone pAEH122 102 14. Effects of VirR’ activity on Ipa expression 106 15. Sequencing strategy for the 2.3 kb EcoRl...Confluent monolayers of mammalian cells are challenged with virulent organisms and invasion and intercellular spread result in a cytopathic effect ...destruction of the mucosal surface and an inflammatory response ensues which mimics the effects of invasion and intercellular spread in the mucosa of the

  8. OmpR and RcsB abolish temporal and spatial changes in expression of flhD in Escherichia coli biofilm.

    PubMed

    Samanta, Priyankar; Clark, Emily R; Knutson, Katie; Horne, Shelley M; Prüß, Birgit M

    2013-08-02

    Biofilms are communities of bacteria that are characterized by specific phenotypes, including an increased resistance towards anti-microbials and the host immune system. This calls for the development of novel biofilm prevention and treatment options to combat infectious disease. In Escherichia coli, numerous global regulators have been implicated in the control of biofilm associated cell surface organelles. These include the flagellar regulator FlhD/FlhC, the osmoregulator EnvZ/OmpR, and the colanic acid activator RcsCDB. Using flow cell technology and fluorescence microscopy, we determined the temporal expression from flhD::gfp, ompR::gfp, and rcsB::gfp in E. coli biofilm, as well as the impact of the negative regulation of flhD by OmpR and RcsB. Spatial gene expression was investigated from flhD::gfp. The temporal gene expression profile for flhD yielded an early peak at 12 h, a minimum of expression at 35 h, and a second increase in expression towards 51 h of biofilm development. In contrast, the ompR profile showed a peak at 35 h. A mutation in ompR abolished time dependence of flhD expression after the initial growth period of 12 h. Intriguingly, rcsB expression did not correlate inversely with flhD expression, yet a mutation in rcsB abolished time dependence of flhD expression as well. Spatially, expression of flhD was highest in the outermost layer of the biofilm in the parent strain. In ompR and rcsB mutants, flhD was expressed throughout the biofilm. Mutations in both, ompR and rcsB increased flhD expression throughout all temporal and spatial experiments. This increase was paralleled by reductions in biofilm amounts at four tested time points. Our data lead to the conclusion that FlhD/FlhC and its regulation by OmpR and RcsB may be our first target mechanism for the development of novel biofilm prevention and treatment techniques.

  9. OmpR and RcsB abolish temporal and spatial changes in expression of flhD in Escherichia coli Biofilm

    PubMed Central

    2013-01-01

    Background Biofilms are communities of bacteria that are characterized by specific phenotypes, including an increased resistance towards anti-microbials and the host immune system. This calls for the development of novel biofilm prevention and treatment options to combat infectious disease. In Escherichia coli, numerous global regulators have been implicated in the control of biofilm associated cell surface organelles. These include the flagellar regulator FlhD/FlhC, the osmoregulator EnvZ/OmpR, and the colanic acid activator RcsCDB. Using flow cell technology and fluorescence microscopy, we determined the temporal expression from flhD::gfp, ompR::gfp, and rcsB::gfp in E. coli biofilm, as well as the impact of the negative regulation of flhD by OmpR and RcsB. Spatial gene expression was investigated from flhD::gfp. Results The temporal gene expression profile for flhD yielded an early peak at 12 h, a minimum of expression at 35 h, and a second increase in expression towards 51 h of biofilm development. In contrast, the ompR profile showed a peak at 35 h. A mutation in ompR abolished time dependence of flhD expression after the initial growth period of 12 h. Intriguingly, rcsB expression did not correlate inversely with flhD expression, yet a mutation in rcsB abolished time dependence of flhD expression as well. Spatially, expression of flhD was highest in the outermost layer of the biofilm in the parent strain. In ompR and rcsB mutants, flhD was expressed throughout the biofilm. Mutations in both, ompR and rcsB increased flhD expression throughout all temporal and spatial experiments. This increase was paralleled by reductions in biofilm amounts at four tested time points. Conclusion Our data lead to the conclusion that FlhD/FlhC and its regulation by OmpR and RcsB may be our first target mechanism for the development of novel biofilm prevention and treatment techniques. PMID:23914787

  10. Methylglyoxal-bis-guanylhydrazone inhibits osteopontin expression and differentiation in cultured human monocytes.

    PubMed

    Jin, Xia; Xu, Hua; McGrath, Michael S

    2018-01-01

    Monocyte activation and polarization play essential roles in many chronic inflammatory diseases. An imbalance of M1 and M2 macrophage activation (pro-inflammatory and alternatively activated, respectively) is believed to be a key aspect in the etiology of these diseases, thus a therapeutic approach that regulates macrophage activation could be of broad clinical relevance. Methylglyoxal-bis-guanylhydrazone (MGBG), a regulator of polyamine metabolism, has recently been shown to be concentrated in monocytes and macrophages, and interfere with HIV integration into the DNA of these cells in vitro. RNA expression analysis of monocytes from HIV+ and control donors with or without MGBG treatment revealed the only gene to be consistently down regulated by MGBG to be osteopontin (OPN). The elevated expression of this pro-inflammatory cytokine and monocyte chemoattractant is associated with various chronic inflammatory diseases. We demonstrate that MGBG is a potent inhibitor of secreted OPN (sOPN) in cultured monocytes with 50% inhibition achieved at 0.1 μM of the drug. Furthermore, inhibition of OPN RNA transcription in monocyte cultures occurs at similar concentrations of the drug. During differentiation of monocytes into macrophages in vitro, monocytes express cell surface CD16 and the cells undergo limited DNA synthesis as measured by uptake of BrdU. MGBG inhibited both activities at similar doses to those regulating OPN expression. In addition, monocyte treatment with MGBG inhibited differentiation into both M1 and M2 classes of macrophages at non-toxic doses. The inhibition of differentiation and anti-OPN effects of MGBG were specific for monocytes in that differentiated macrophages were nearly resistant to MGBG activities. Thus MGBG may have potential therapeutic utility in reducing or normalizing OPN levels and regulating monocyte activation in diseases that involve chronic inflammation.

  11. The Endogenous GRP78 Interactome in Human Head and Neck Cancers: A Deterministic Role of Cell Surface GRP78 in Cancer Stemness.

    PubMed

    Chen, Hsin-Ying; Chang, Joseph Tung-Chieh; Chien, Kun-Yi; Lee, Yun-Shien; You, Guo-Rung; Cheng, Ann-Joy

    2018-01-11

    Cell surface glucose regulated protein 78 (GRP78), an endoplasmic reticulum (ER) chaperone, was suggested to be a cancer stem cell marker, but the influence of this molecule on cancer stemness is poorly characterized. In this study, we developed a mass spectrometry platform to detect the endogenous interactome of GRP78 and investigated its role in cancer stemness. The interactome results showed that cell surface GRP78 associates with multiple molecules. The influence of cell population heterogeneity of head and neck cancer cell lines (OECM1, FaDu, and BM2) according to the cell surface expression levels of GRP78 and the GRP78 interactome protein, Progranulin, was investigated. The four sorted cell groups exhibited distinct cell cycle distributions, asymmetric/symmetric cell divisions, and different relative expression levels of stemness markers. Our results demonstrate that cell surface GRP78 promotes cancer stemness, whereas drives cells toward a non-stemlike phenotype when it chaperones Progranulin. We conclude that cell surface GRP78 is a chaperone exerting a deterministic influence on cancer stemness.

  12. Cloning and expression of R-Spondin1 in different vertebrates suggests a conserved role in ovarian development.

    PubMed

    Smith, Craig A; Shoemaker, Christina M; Roeszler, Kelly N; Queen, Joanna; Crews, David; Sinclair, Andrew H

    2008-07-24

    R-Spondin1 (Rspo1) is a novel regulator of the Wnt/beta-catenin signalling pathway. Loss-of-function mutations in human RSPO1 cause testicular differentiation in 46, XX females, pointing to a role in ovarian development. Here we report the cloning and comparative expression analysis of R-SPONDIN1 orthologues in the mouse, chicken and red-eared slider turtle, three species with different sex-determining mechanisms. Evidence is presented that this gene is an ancient component of the vertebrate ovary-determining pathway. Gonadal RSPO1 gene expression is female up-regulated in the embryonic gonads in each species at the onset of sexual differentiation. In the mouse gonad, Rspo1 mRNA is expressed in the somatic cell lineage at the time of ovarian differentiation (E12.5-E15.5), with little expression in germ cells. However, the protein is localised in the cytoplasm and at the cell surface of both somatic (pre-follicular) and germ cells. In the chicken embryo, RSPO1 expression becomes elevated in females at the time of ovarian differentiation, coinciding with female-specific activation of the FOXL2 gene and estrogen synthesis. RSPO1 protein in chicken is localised in the outer cortical zone of the developing ovary, the site of primordial follicle formation and germ cell differentiation. Inhibition of estrogen synthesis with a specific aromatase inhibitor results in a decline in chicken RSPO1 expression, indicating that RSPO1 is influenced by estrogen. In the red-eared slider turtle, which exhibits temperature-dependent sex determination, up-regulation of RSPO1 occurs during the temperature-sensitive period, when gonadal development is responsive to temperature. Accordingly, RSPO1 expression is temperature-responsive, and is down-regulated in embryos shifted from female- to male-producing incubation temperatures. These results indicate that RSPO1 is up-regulated in the embryonic gonads of female vertebrates with different sex-determining mechanisms. In all instances, RSPO1 is expressed in the incipient ovary. These findings suggest that R-SPONDIN1 is an ancient, conserved part of the vertebrate ovary-determining pathway.

  13. Cloning and expression of R-Spondin1 in different vertebrates suggests a conserved role in ovarian development

    PubMed Central

    Smith, Craig A; Shoemaker, Christina M; Roeszler, Kelly N; Queen, Joanna; Crews, David; Sinclair, Andrew H

    2008-01-01

    Background R-Spondin1 (Rspo1) is a novel regulator of the Wnt/β-catenin signalling pathway. Loss-of-function mutations in human RSPO1 cause testicular differentiation in 46, XX females, pointing to a role in ovarian development. Here we report the cloning and comparative expression analysis of R-SPONDIN1 orthologues in the mouse, chicken and red-eared slider turtle, three species with different sex-determining mechanisms. Evidence is presented that this gene is an ancient component of the vertebrate ovary-determining pathway. Results Gonadal RSPO1 gene expression is female up-regulated in the embryonic gonads in each species at the onset of sexual differentiation. In the mouse gonad, Rspo1 mRNA is expressed in the somatic cell lineage at the time of ovarian differentiation (E12.5–E15.5), with little expression in germ cells. However, the protein is localised in the cytoplasm and at the cell surface of both somatic (pre-follicular) and germ cells. In the chicken embryo, RSPO1 expression becomes elevated in females at the time of ovarian differentiation, coinciding with female-specific activation of the FOXL2 gene and estrogen synthesis. RSPO1 protein in chicken is localised in the outer cortical zone of the developing ovary, the site of primordial follicle formation and germ cell differentiation. Inhibition of estrogen synthesis with a specific aromatase inhibitor results in a decline in chicken RSPO1 expression, indicating that RSPO1 is influenced by estrogen. In the red-eared slider turtle, which exhibits temperature-dependent sex determination, up-regulation of RSPO1 occurs during the temperature-sensitive period, when gonadal development is responsive to temperature. Accordingly, RSPO1 expression is temperature-responsive, and is down-regulated in embryos shifted from female- to male-producing incubation temperatures. Conclusion These results indicate that RSPO1 is up-regulated in the embryonic gonads of female vertebrates with different sex-determining mechanisms. In all instances, RSPO1 is expressed in the incipient ovary. These findings suggest that R-SPONDIN1 is an ancient, conserved part of the vertebrate ovary-determining pathway. PMID:18651984

  14. Notch Signaling Is Involved in Neurogenic Commitment of Human Periodontal Ligament-Derived Mesenchymal Stem Cells

    PubMed Central

    Osathanon, Thanaphum; Manokawinchoke, Jeeranan; Nowwarote, Nunthawan; Aguilar, Panuroot; Palaga, Tanapat

    2013-01-01

    Notch signaling plays critical roles in stem cells by regulating cell fate determination and differentiation. The aim of this study was to evaluate the participation of Notch signaling in neurogenic commitment of human periodontal ligament-derived mesenchymal stem cells (hPDLSCs) and to examine the ability to control differentiation of these cells using modified surfaces containing affinity immobilized Notch ligands. Neurogenic induction of hPDLSCs was performed via neurosphere formation. Cells were aggregated and form spheres as early 1 day in culture. In addition, the induced cells exhibited increased mRNA and protein expression of neuronal markers that is, β3-tubulin and neurofilament. During neuronal differentiation, a significant increase of Hes1 and Hey1 mRNA expression was noted. Using pharmacological inhibition (γ-secretase inhibitor) or genetic manipulation (overexpression of dominant negative mastermind-like transcription co-activators), neurosphere formation was attenuated and a marked decrease in neurogenic mRNA expression was observed. To confirm the role of Notch signaling in neuronal differentiation of hPDLSCs, the Notch ligand, Jagged-1, is bound to the surface using an affinity immobilization technique. The hPDLSC cultured on a Jagged-1-modified surface had increased expression of Notch signaling target genes, Hes-1 and Hey-1, confirming the activity and potency of surface-bound Jagged-1. Further, hPDLSC on surface-bound Jagged-1 under serum-free conditions showed multiple long and thin neurite-like extensions, and an increase in the expression of neurogenic mRNA markers was observed. Pretreatment of the cells with γ-secretase inhibitor, DAPT, before seeding on the Jagged-1-modified surface blocked development of the neurite-like morphology. Together, the results in this study suggest the involvement of Notch signaling in neurogenic commitment of hPDLSCs. PMID:23379739

  15. Rbt1 protein domains analysis in Candida albicans brings insights into hyphal surface modifications and Rbt1 potential role during adhesion and biofilm formation.

    PubMed

    Monniot, Céline; Boisramé, Anita; Da Costa, Grégory; Chauvel, Muriel; Sautour, Marc; Bougnoux, Marie-Elisabeth; Bellon-Fontaine, Marie-Noëlle; Dalle, Frédéric; d'Enfert, Christophe; Richard, Mathias L

    2013-01-01

    Cell wall proteins are central to the virulence of Candida albicans. Hwp1, Hwp2 and Rbt1 form a family of hypha-associated cell surface proteins. Hwp1 and Hwp2 have been involved in adhesion and other virulence traits but Rbt1 is still poorly characterized. To assess the role of Rbt1 in the interaction of C. albicans with biotic and abiotic surfaces independently of its morphological state, heterologous expression and promoter swap strategies were applied. The N-terminal domain with features typical of the Flo11 superfamily was found to be essential for adhesiveness to polystyrene through an increase in cell surface hydrophobicity. A 42 amino acid-long domain localized in the central part of the protein was shown to enhance the aggregation function. We demonstrated that a VTTGVVVVT motif within the 42 amino acid domain displayed a high β-aggregation potential and was responsible for cell-to-cell interactions by promoting the aggregation of hyphae. Finally, we showed through constitutive expression that while Rbt1 was directly accessible to antibodies in hyphae, it was not so in yeast. Similar results were obtained for another cell wall protein, namely Iff8, and suggested that modification of the cell wall structure between yeast and hyphae can regulate the extracellular accessibility of cell wall proteins independently of gene regulation.

  16. Physical and biological regulation of neuron regenerative growth and network formation on recombinant dragline silks

    DOE PAGES

    An, Bo; Tang-Schomer, Min D.; Huang, Wenwen; ...

    2015-02-11

    In this paper, recombinant spider silks produced in transgenic goat milk were studied as cell culture matrices for neuronal growth. Major ampullate spidroin 1 (MaSp1) supported neuronal growth, axon extension and network connectivity, with cell morphology comparable to the gold standard poly-lysine. In addition, neurons growing on MaSp1 films had increased neural cell adhesion molecule (NCAM) expression at both mRNA and protein levels. The results indicate that MaSp1 films present useful surface charge and substrate stiffness to support the growth of primary rat cortical neurons. Moreover, a putative neuron-specific surface binding sequence GRGGL within MaSp1 may contribute to the biologicalmore » regulation of neuron growth. These findings indicate that MaSp1 could regulate neuron growth through its physical and biological features. Finally, this dual regulation mode of MaSp1 could provide an alternative strategy for generating functional silk materials for neural tissue engineering.« less

  17. Physical and biological regulation of neuron regenerative growth and network formation on recombinant dragline silks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    An, Bo; Tang-Schomer, Min D.; Huang, Wenwen

    In this paper, recombinant spider silks produced in transgenic goat milk were studied as cell culture matrices for neuronal growth. Major ampullate spidroin 1 (MaSp1) supported neuronal growth, axon extension and network connectivity, with cell morphology comparable to the gold standard poly-lysine. In addition, neurons growing on MaSp1 films had increased neural cell adhesion molecule (NCAM) expression at both mRNA and protein levels. The results indicate that MaSp1 films present useful surface charge and substrate stiffness to support the growth of primary rat cortical neurons. Moreover, a putative neuron-specific surface binding sequence GRGGL within MaSp1 may contribute to the biologicalmore » regulation of neuron growth. These findings indicate that MaSp1 could regulate neuron growth through its physical and biological features. Finally, this dual regulation mode of MaSp1 could provide an alternative strategy for generating functional silk materials for neural tissue engineering.« less

  18. Ecto-F1-ATPase: A moonlighting protein complex and an unexpected apoA-I receptor

    PubMed Central

    Vantourout, Pierre; Radojkovic, Claudia; Lichtenstein, Laeticia; Pons, Véronique; Champagne, Eric; Martinez, Laurent O

    2010-01-01

    Mitochondrial ATP synthase has been recently detected at the surface of different cell types, where it is a high affinity receptor for apoA-I, the major protein component in high density lipoproteins (HDL). Cell surface ATP synthase (namely ecto-F1-ATPase) expression is related to different biological effects, such as regulation of HDL uptake by hepatocytes, endothelial cell proliferation or antitumor activity of Vγ9/Vδ2 T lymphocytes. This paper reviews the recently discovered functions and regulations of ecto-F1-ATPase. Particularly, the role of the F1-ATPase pathway(s) in HDL-cholesterol uptake and apoA-I-mediated endothelial protection suggests its potential importance in reverse cholesterol transport and its regulation might represent a potential therapeutic target for HDL-related therapy for cardiovascular diseases. Therefore, it is timely for us to better understand how this ecto-enzyme and downstream pathways are regulated and to develop pharmacologic interventions. PMID:21157968

  19. Physical and biological regulation of neuron regenerative growth and network formation on recombinant dragline silks.

    PubMed

    An, Bo; Tang-Schomer, Min; Huang, Wenwen; He, Jiuyang; Jones, Justin; Lewis, Randolph V; Kaplan, David L

    2015-04-01

    Recombinant spider silks produced in transgenic goat milk were studied as cell culture matrices for neuronal growth. Major ampullate spidroin 1 (MaSp1) supported neuronal growth, axon extension and network connectivity, with cell morphology comparable to the gold standard poly-lysine. In addition, neurons growing on MaSp1 films had increased neural cell adhesion molecule (NCAM) expression at both mRNA and protein levels. The results indicate that MaSp1 films present useful surface charge and substrate stiffness to support the growth of primary rat cortical neurons. Moreover, a putative neuron-specific surface binding sequence GRGGL within MaSp1 may contribute to the biological regulation of neuron growth. These findings indicate that MaSp1 could regulate neuron growth through its physical and biological features. This dual regulation mode of MaSp1 could provide an alternative strategy for generating functional silk materials for neural tissue engineering. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Interplay of the modified nucleotide phosphoadenosine 5'-phosphosulfate (PAPS) with global regulatory proteins in Escherichia coli: modulation of cyclic AMP (cAMP)-dependent gene expression and interaction with the HupA regulatory protein.

    PubMed

    Longo, Francesca; Motta, Sara; Mauri, Pierluigi; Landini, Paolo; Rossi, Elio

    2016-11-25

    In the bacterium Escherichia coli, some intermediates of the sulfate assimilation and cysteine biosynthesis pathway can act as signal molecules and modulate gene expression. In addition to sensing and utilization of sulphur sources, these signaling mechanisms also impact more global cell processes, such as resistance to antimicrobial agents and biofilm formation. In a recent work, we have shown that inactivation of the cysH gene, encoding phosphoadenosine-phosphosulfate (PAPS) reductase, and the consequent increase in intracellular PAPS concentration, strongly affect production of several cell surface-associated structures, enhancing surface adhesion and cell aggregation. In order to identify the molecular mechanism relaying intracellular PAPS concentration to regulation of cell surface-associated structures, we looked for mutations able to suppress the effects of cysH inactivation. We found that mutations in the adenylate cyclase-encoding cyaA gene abolished the effects of PAPS accumulation; consistent with this result, cyclic AMP (cAMP)-dependent gene expression appears to be increased in the cysH mutant. Experiments aimed at the direct identification of proteins interacting with either CysC or CysH, i.e. the PAPS-related proteins APS kinase and PAPS reductase, allowed us to identify several regulators, namely, CspC, CspE, HNS and HupA. Protein-protein interaction between HupA and CysH was confirmed by a bacterial two hybrid system, and inactivation of the hupA gene enhanced the effects of the cysH mutation in terms of production of cell surface-associated factors. Our results indicate that PAPS can modulate different regulatory systems, providing evidence that this molecule acts as a global signal molecule in E. coli. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. The Cystic Fibrosis Transmembrane Conductance Regulator Potentiator Ivacaftor Augments Mucociliary Clearance Abrogating Cystic Fibrosis Transmembrane Conductance Regulator Inhibition by Cigarette Smoke.

    PubMed

    Raju, S Vamsee; Lin, Vivian Y; Liu, Limbo; McNicholas, Carmel M; Karki, Suman; Sloane, Peter A; Tang, Liping; Jackson, Patricia L; Wang, Wei; Wilson, Landon; Macon, Kevin J; Mazur, Marina; Kappes, John C; DeLucas, Lawrence J; Barnes, Stephen; Kirk, Kevin; Tearney, Guillermo J; Rowe, Steven M

    2017-01-01

    Acquired cystic fibrosis transmembrane conductance regulator (CFTR) dysfunction may contribute to chronic obstructive pulmonary disease pathogenesis and is a potential therapeutic target. We sought to determine the acute effects of cigarette smoke on ion transport and the mucociliary transport apparatus, their mechanistic basis, and whether deleterious effects could be reversed with the CFTR potentiator ivacaftor (VX-770). Primary human bronchial epithelial (HBE) cells and human bronchi were exposed to cigarette smoke extract (CSE) and/or ivacaftor. CFTR function and expression were measured in Ussing chambers and by surface biotinylation. CSE-derived acrolein modifications on CFTR were determined by mass spectroscopic analysis of purified protein, and the functional microanatomy of the airway epithelia was measured by 1-μm resolution optical coherence tomography. CSE reduced CFTR-dependent current in HBE cells (P < 0.05) and human bronchi (P < 0.05) within minutes of exposure. The mechanism involved CSE-induced reduction of CFTR gating, decreasing CFTR open-channel probability by approximately 75% immediately after exposure (P < 0.05), whereas surface CFTR expression was partially reduced with chronic exposure, but was stable acutely. CSE treatment of purified CFTR resulted in acrolein modifications on lysine and cysteine residues that likely disrupt CFTR gating. In primary HBE cells, CSE reduced airway surface liquid depth (P < 0.05) and ciliary beat frequency (P < 0.05) within 60 minutes that was restored by coadministration with ivacaftor (P < 0.005). Cigarette smoking transmits acute reductions in CFTR activity, adversely affecting the airway surface. These effects are reversible by a CFTR potentiator in vitro, representing a potential therapeutic strategy in patients with chronic obstructive pulmonary disease with chronic bronchitis.

  2. Small-Molecule Sigma1 Modulator Induces Autophagic Degradation of PD-L1.

    PubMed

    Maher, Christina M; Thomas, Jeffrey D; Haas, Derick A; Longen, Charles G; Oyer, Halley M; Tong, Jane Y; Kim, Felix J

    2018-02-01

    Emerging evidence suggests that Sigma1 ( SIGMAR1 , also known as sigma-1 receptor) is a unique ligand-regulated integral membrane scaffolding protein that contributes to cellular protein and lipid homeostasis. Previously, we demonstrated that some small-molecule modulators of Sigma1 alter endoplasmic reticulum (ER)-associated protein homeostasis pathways in cancer cells, including the unfolded protein response and autophagy. Programmed death-ligand 1 (PD-L1) is a type I integral membrane glycoprotein that is cotranslationally inserted into the ER and is processed and transported through the secretory pathway. Once at the surface of cancer cells, PD-L1 acts as a T-cell inhibitory checkpoint molecule and suppresses antitumor immunity. Here, we demonstrate that in Sigma1-expressing triple-negative breast and androgen-independent prostate cancer cells, PD-L1 protein levels were suppressed by RNAi knockdown of Sigma1 and by small-molecule inhibition of Sigma1. Sigma1-mediated action was confirmed by pharmacologic competition between Sigma1-selective inhibitor and activator ligands. When administered alone, the Sigma1 inhibitor decreased cell surface PD-L1 expression and suppressed functional interaction of PD-1 and PD-L1 in a coculture of T cells and cancer cells. Conversely, the Sigma1 activator increased PD-L1 cell surface expression, demonstrating the ability to positively and negatively modulate Sigma1 associated PD-L1 processing. We discovered that the Sigma1 inhibitor induced degradation of PD-L1 via autophagy, by a mechanism distinct from bulk macroautophagy or general ER stress-associated autophagy. Finally, the Sigma1 inhibitor suppressed IFNγ-induced PD-L1. Our data demonstrate that small-molecule Sigma1 modulators can be used to regulate PD-L1 in cancer cells and trigger its degradation by selective autophagy. Implications: Sigma1 modulators sequester and eliminate PD-L1 by autophagy, thus preventing functional PD-L1 expression at the cell surface. This posits Sigma1 modulators as novel therapeutic agents in PD-L1/PD-1 blockade strategies that regulate the tumor immune microenvironment. Visual Overview: http://mcr.aacrjournals.org/content/molcanres/16/2/243/F1.large.jpg Mol Cancer Res; 16(2); 243-55. ©2017 AACR . ©2017 American Association for Cancer Research.

  3. ZEB1 limits adenoviral infectability by transcriptionally repressing the Coxsackie virus and Adenovirus Receptor

    PubMed Central

    2011-01-01

    Background We have previously reported that RAS-MEK (Cancer Res. 2003 May 1;63(9):2088-95) and TGF-β (Cancer Res. 2006 Feb 1;66(3):1648-57) signaling negatively regulate coxsackie virus and adenovirus receptor (CAR) cell-surface expression and adenovirus uptake. In the case of TGF-β, down-regulation of CAR occurred in context of epithelial-to-mesenchymal transition (EMT), a process associated with transcriptional repression of E-cadherin by, for instance, the E2 box-binding factors Snail, Slug, SIP1 or ZEB1. While EMT is crucial in embryonic development, it has been proposed to contribute to the formation of invasive and metastatic carcinomas by reducing cell-cell contacts and increasing cell migration. Results Here, we show that ZEB1 represses CAR expression in both PANC-1 (pancreatic) and MDA-MB-231 (breast) human cancer cells. We demonstrate that ZEB1 physically associates with at least one of two closely spaced and conserved E2 boxes within the minimal CAR promoter here defined as genomic region -291 to -1 relative to the translational start ATG. In agreement with ZEB1's established role as a negative regulator of the epithelial phenotype, silencing its expression in MDA-MB-231 cells induced a partial Mesenchymal-to-Epithelial Transition (MET) characterized by increased levels of E-cadherin and CAR, and decreased expression of fibronectin. Conversely, knockdown of ZEB1 in PANC-1 cells antagonized both the TGF-β-induced down-regulation of E-cadherin and CAR and the reduction of adenovirus uptake. Interestingly, even though ZEB1 clearly contributes to the TGF-β-induced mesenchymal phenotype of PANC-1 cells, TGF-β did not seem to affect ZEB1's protein levels or subcellular localization. These findings suggest that TGF-β may inhibit CAR expression by regulating factor(s) that cooperate with ZEB1 to repress the CAR promoter, rather than by regulating ZEB1 expression levels. In addition to the negative E2 box-mediated regulation the minimal CAR promoter is positively regulated through conserved ETS and CRE elements. Conclusions This report provides evidence that inhibition of ZEB1 may improve adenovirus uptake of cancer cells that have undergone EMT and for which ZEB1 is necessary to maintain the mesenchymal phenotype. Targeting of ZEB1 may reverse some aspects of EMT including the down-regulation of CAR. PMID:21791114

  4. Up-regulation of Hyperpolarization-activated Cyclic Nucleotide-gated Channel 3 (HCN3) by Specific Interaction with K+ Channel Tetramerization Domain-containing Protein 3 (KCTD3)*

    PubMed Central

    Cao-Ehlker, Xiaochun; Zong, Xiangang; Hammelmann, Verena; Gruner, Christian; Fenske, Stefanie; Michalakis, Stylianos; Wahl-Schott, Christian; Biel, Martin

    2013-01-01

    Most ion channels consist of the principal ion-permeating core subunit(s) and accessory proteins that are assembled with the channel core. The biological functions of the latter proteins are diverse and include the regulation of the biophysical properties of the ion channel, its connection to signaling pathways and the control of its cell surface expression. There is recent evidence that native hyperpolarization-activated cyclic nucleotide-gated channel complexes (HCN1–4) also contain accessory subunits, among which TRIP8b (tetratricopeptide repeat-containing Rab8b-interacting protein) has been most extensively studied. Here, we identify KCTD3, a so far uncharacterized member of the potassium channel tetramerization-domain containing (KCTD) protein family as an HCN3-interacting protein. KCTD3 is widely expressed in brain and some non-neuronal tissues and colocalizes with HCN3 in specific regions of the brain including hypothalamus. Within the HCN channel family, KCTD3 specifically binds to HCN3 and leads to a profound up-regulation of cell surface expression and current density of this channel. HCN3 can also functionally interact with TRIP8b; however, we found no evidence for channel complexes containing both TRIP8b and KCTD3. The C terminus of HCN3 is crucially required for functional interaction with KCTD3. Replacement of the cytosolic C terminus of HCN2 by the corresponding domain of HCN3 renders HCN2 sensitive to regulation by KCTD3. The C-terminal-half of KCTD3 is sufficient for binding to HCN3. However, the complete protein including the N-terminal tetramerization domain is needed for HCN3 current up-regulation. Together, our experiments indicate that KCTD3 is an accessory subunit of native HCN3 complexes. PMID:23382386

  5. IL-27 induces the production of IgG1 by human B cells.

    PubMed

    Boumendjel, Amel; Tawk, Lina; Malefijt, René de Waal; Boulay, Vera; Yssel, Hans; Pène, Jérôme

    2006-12-01

    It has been reported that IL-27 specifically induces the production of IgG2a by mouse B cells and inhibits IL-4-induced IgG1 synthesis. Here, we show that human naïve cord blood expresses a functional IL-27 receptor, consisting of the TCCR and gp130 subunits, although at lower levels as compared to naïve and memory splenic B cells. IL-27 does not induce proliferative responses and does not increase IgG1 production by CD19(+)CD27(+) memory B cells. However, it induces a low, but significant production of IgG1 by naïve CD19(+)CD27(-)IgD(+)IgG(-) spleen and cord blood B cells, activated via CD40, whereas it has no effect on the production of the other IgG subclasses. In addition, IL-27 induces the differentiation of a population of B cells that express high levels of CD38, in association with a down-regulation of surface IgD expression, and that are surface IgG(+/int), CD20(low), CD27(high), indicating that IL-27 promotes isotype switching and plasma cell differentiation of naive B cells. However, as compared to the effects of IL-21 and IL-10, both switch factors for human IgG1 and IgG3, those of IL-27 are modest and regulate exclusively the production of IgG1. Finally, although IL-27 has no effect on IL-4 and anti-CD40-induced Cepsilon germline promoter activity, it up-regulates IL-4-induced IgE production by naive B cells. These results point to a partial redundancy of switch factors regulating the production of IgG1 in humans, and furthermore indicate the existence of a common regulation of the human IgG1and murine IgG2a isotypes by IL-27.

  6. HMGB1 binds to activated platelets via the receptor for advanced glycation end products and is present in platelet rich human coronary artery thrombi.

    PubMed

    Ahrens, Ingo; Chen, Yung-Chih; Topcic, Danijal; Bode, Michael; Haenel, David; Hagemeyer, Christoph E; Seeba, Hannah; Duerschmied, Daniel; Bassler, Nicole; Jandeleit-Dahm, Karin A; Sweet, Matthew J; Agrotis, Alex; Bobik, Alex; Peter, Karlheinz

    2015-11-01

    High mobility group box 1 (HMGB1) acts as both a nuclear protein that regulates gene expression, as well as a pro-inflammatory alarmin that is released from necrotic or activated cells. Recently, HMGB1-expression in human atherosclerotic plaques was identified. Therapeutic blockade of HMGB1 reduced the development of diet-induced atherosclerosis in ApoE knockout mice. Thus, we hypothesised an interaction between HMGB1 and activated platelets. Binding of recombinant HMGB1 to platelets was assessed by flow cytometry. HMGB1 bound to thrombin-activated human platelets (MFI 2.49 vs 25.01, p=0.0079). Blood from wild-type, TLR4 and RAGE knockout mice was used to determine potential HMGB1 receptors on platelets. HMGB1 bound to platelets from wild type C57Bl6 (MFI 2.64 vs 20.3, p< 0.05), and TLR4-/- mice (MFI 2.11 vs 25.65, p< 0.05) but failed to show binding to platelets from RAGE-/- mice (p > 0.05). RAGE expression on human platelets was detected by RT-PCR with mRNA extracted from highly purified platelets and confirmed by Western blot and immunofluorescence microscopy. Platelet activation increased RAGE surface expression (MFI 4.85 vs 6.74, p< 0.05). Expression of HMGB1 in human coronary artery thrombi was demonstrated by immunohistochemistry and revealed high expression levels. Platelets bind HMGB1 upon thrombin-induced activation. Platelet specific expression of RAGE could be detected at the mRNA and protein level and is involved in the binding of HMGB1. Furthermore, platelet activation up-regulates platelet surface expression of RAGE. HMGB1 is highly expressed in platelet-rich human coronary artery thrombi pointing towards a central role for HMGB1 in atherothrombosis, thereby suggesting the possibility of platelet targeted anti-inflammatory therapies for atherothrombosis.

  7. A transgenic reporter under control of an es1 promoter/enhancer marks wound epidermis and apical epithelial cap during tail regeneration in Xenopus laevis tadpole.

    PubMed

    Sato, Kentaro; Umesono, Yoshihiko; Mochii, Makoto

    2018-01-15

    Rapid wound healing and subsequent formation of the apical epithelial cap (AEC) are believed to be required for successful appendage regeneration in amphibians. Despite the significant role of AEC in limb regeneration, its role in tail regeneration and the mechanisms that regulate the wound healing and AEC formation are not well understood. We previously identified Xenopus laevis es1, which is preferentially expressed in wounded regions, including the AEC after tail regeneration. In this study we established and characterized transgenic Xenopus laevis lines harboring the enhanced green fluorescent protein (EGFP) gene under control of an es1 gene regulatory sequence (es1:egfp). The EGFP reporter expression was clearly seen in several regions of the embryo and then declined to an undetectable level in larvae, recapitulating the endogenous es1 expression. After amputation of the tadpole tail, EGFP expression was re-activated at the edge of the stump epidermis and then increased in the wound epidermis (WE) covering the amputation surface. As the stump started to regenerate, the EGFP expression became restricted to the most distal epidermal region, including the AEC. EGFP was preferentially expressed in the basal or deep cells but not in the superficial cells of the WE and AEC. We performed a small-scale pharmacological screening for chemicals that affected the expression of EGFP in the stump epidermis after tail amputation. The EGFP expression was attenuated by treatment with an inhibitor for ERK, TGF-β or reactive oxygen species (ROS) signaling. These treatments also impaired wound closure of the amputation surface, suggesting that the three signaling activities are required for es1 expression in the WE and successful wound healing after tail amputation. These findings showed that es1:egfp Xenopus laevis should be a useful tool to analyze molecular mechanisms regulating wound healing and appendage regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Effects of space flight on surface marker expression

    NASA Astrophysics Data System (ADS)

    Sonnenfeld, G.

    1999-01-01

    Space flight has been shown to affect expression of several cell surface markers. These markers play important roles in regulation of immune responses, including CD4 and CD8. The studies have involved flight of experimental animals and humans followed by analysis of tissue samples (blood in humans, rats and monkeys, spleen, thymus, lymph nodes and bone marrow in rodents). The degree and direction of the changes induced by space flight have been determined by the conditions of the flight. Also, there may be compartmentalization of the response of surface markers to space flight, with differences in the response of cells isolated from blood and local immune tissue. The same type of compartmentalization was also observed with cell adhesion molecules (integrins). In this case, the expression of integrins from lymph node cells differed from that of splenocytes isolated from rats immediately after space flight. Cell culture studies have indicated that there may be an inhibition in conversion of a precursor cell line to cells exhibiting mature macrophage characteristics after space flight, however, these experiments were limited as a result of technical difficulties. In general, it is clear that space flight results in alterations of cell surface markers. The biological significance of these changes remains to be established.

  9. A bio-recognition device developed onto nano-crystals of carbonate apatite for cell-targeted gene delivery.

    PubMed

    Chowdhury, E H; Akaike, Toshihiro

    2005-05-20

    The DNA delivery to mammalian cells is an essential tool for analyzing gene structure, regulation, and function. The approach holds great promise for the further development of gene therapy techniques and DNA vaccination strategies to treat and control diseases. Here, we report on the establishment of a cell-specific gene delivery and expression system by physical adsorption of a cell-recognition molecule on the nano-crystal surface of carbonate apatite. As a model, DNA/nano-particles were successfully coated with asialofetuin to facilitate uptake by hepatocyte-derived cell lines through the asialoglycoprotein receptor (ASGPr) and albumin to prevent non-specific interactions of the particles with cell-surface. The resulting composite particles with dual surface properties could accelerate DNA uptake and enhance expression to a notable extent. Nano-particles coated with transferrin in the same manner dramatically enhanced transgene expression in the corresponding receptor-bearing cells and thus our newly developed strategy represents a universal phenomenon for anchoring a bio-recognition macromolecule on the apatite crystal surface for targeted gene delivery, having immediate applications in basic research laboratories and great promise for gene therapy. (c) 2005 Wiley Periodicals, Inc.

  10. Functional roles of cell surface peptidases in reproductive organs

    PubMed Central

    2004-01-01

    A number of biologically active peptides have been proposed to regulate function and differentiation of reproductive organs in an autocrine and/or paracrine fashion. Regulation of the local concentrations of these peptides is one of the important factors influencing their physiological effects on target cells. Membrane‐bound cell surface peptidases can activate or inactivate biologically active peptides before peptide factors access their receptors on the cell surface. Aminopeptidase A (EC 3.4.11.7), placental leucine aminopeptidase (EC 3.4.11.3), aminopeptidase‐N/CD13 (EC 3.4.11.2), dipeptidyl peptidases IV/CD26 (EC.3.4.14.5), carboxypeptidase‐M (EC 3.4.17.12), neutral endopeptidase/CD10 (EC 3.4.24.11) and endothelin converting enzyme‐1 (EC 3.4.23) are differentially expressed on the ovary, endometrium and placenta. The inhibition of enzyme activity affects steroid hormone production by granulosa and thecal cells, decidualization of endometrium and migration of extravillous trophoblasts. These findings suggest that membrane‐bound cell surface peptidases are local regulators for cellular growth and differentiation in reproductive organs by controlling extracellular concentration of peptide factors. (Reprod Med Biol 2004; 3: 165 –176) PMID:29662383

  11. gp96 expression in neutrophils is critical for the onset of Escherichia coli K1 (RS218) meningitis

    PubMed Central

    Mittal, Rahul; Prasadarao, Nemani V.

    2012-01-01

    Despite the fundamental function of neutrophils (PMNs) in innate immunity, their role in Escherichia coli K1 (EC-K1) induced meningitis is unexplored. Here we show that PMN-depleted mice are resistant to EC-K1 (RS218) meningitis. EC-K1 survives and multiplies in PMNs for which outer membrane protein A (OmpA) expression is essential. EC-K1infection of PMNs increases the cell surface expression of gp96, which acts as a receptor for bacterial entry. Suppression of gp96 expression in newborn mice prevents the onset of EC-K1 meningitis. Infection of PMNs with EC-K1 suppresses oxidative burst by down regulating rac1, rac2 and gp91phox transcription both in vitro and in vivo. The interaction of loop 2 of OmpA with gp96 is essential for EC-K1-mediated inhibition of oxidative burst. These results reveal that EC-K1 exploits surface expressed gp96 in PMNs to prevent oxidative burst for the onset of neonatal meningitis. PMID:22109526

  12. N-cadherin prodomain processing regulates synaptogenesis.

    PubMed

    Reinés, Analía; Bernier, Louis-Philippe; McAdam, Robyn; Belkaid, Wiam; Shan, Weisong; Koch, Alexander W; Séguéla, Philippe; Colman, David R; Dhaunchak, Ajit S

    2012-05-02

    Classical cadherins, which are adhesion molecules functioning at the CNS synapse, are synthesized as adhesively inactive precursor proteins in the endoplasmic reticulum (ER). Signal sequence and prodomain cleavage in the ER and Golgi apparatus, respectively, activates their adhesive properties. Here, we provide the first evidence for sorting of nonadhesive precursor N-cadherin (ProN) to the neuronal surface, where it coexists with adhesively competent mature N-cadherin (N-cad), generating a spectrum of adhesive strengths. In cultured hippocampal neurons, a high ProN/N-cad ratio downregulates synapse formation. Neurons expressing genetically engineered uncleavable ProN make markedly fewer synapses. The synapse number can be rescued to normality by depleting surface ProN levels through prodomain cleavage by an exogenous protease. Finally, prodomain processing is developmentally regulated in the rat hippocampus. We conclude that it is the ProN/N-cad ratio and not mature N-cad alone that is critical for regulation of adhesion during synaptogenesis.

  13. The G-protein coupled estrogen receptor, GPER: The inside and inside-out story.

    PubMed

    Gaudet, H M; Cheng, S B; Christensen, E M; Filardo, E J

    2015-12-15

    GPER possesses structural and functional characteristics shared by members of the G-protein-coupled receptor (GPCR) superfamily, the largest class of plasma membrane receptors. This newly appreciated estrogen receptor is localized predominately within intracellular membranes in most, but not all, cell types and its surface expression is modulated by steroid hormones and during tissue injury. An intracellular staining pattern is not unique among GPCRs, which employ a diverse array of molecular mechanisms that restrict cell surface expression and effectively regulating receptor binding and activation. The finding that GPER displays an intracellular predisposition has created some confusion as the estrogen-inducible transcription factors, ERα and ERβ, also reside intracellularly, and has led to complex suggestions of receptor interaction. GPER undergoes constitutive retrograde trafficking from the plasma membrane to the endoplasmic reticulum and recent studies indicate its interaction with PDZ binding proteins that sort transmembrane receptors to synaptosomes and endosomes. Genetic targeting and selective ligand approaches as well as cell models that express GPER in the absence of ERs clearly supports GPER as a bonafide "stand alone" receptor. Here, the molecular details that regulate GPER action, its cell biological activities and its implicated roles in physiological and pathological processes are reviewed. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Potential involvement of rainbow trout thrombocytes in immune functions: a study using a panel of monoclonal antibodies and RT-PCR

    USGS Publications Warehouse

    Kollner, B.; Fisher, U.; Rombout, J.H.W.M.; Taverne-Thiele, J.J.; Hansen, J.D.

    2004-01-01

    The functional relationship between fish and mammalian thrombocytes is relatively unknown. In this study, a panel of monoclonal antibodies (mAbs) was used to investigate the functional properties of rainbow trout thrombocytes. The mAbs recognize cell-surface molecules on thrombocytes with molecular weights ranging from 17 to 160 kDa. Flow cytometric and immuno-electron microscopic analyses demonstrate that these molecules are expressed at different levels and that surface expression increased upon activation with bovine collagen. Two of these cell-surface molecules (17 and 21 kDa) were directly involved in collagen-induced aggregation of thrombocytes since aggregation was blocked upon pre-treatment with mAbs that recognize the two surface markers. Interestingly, the percentage of thrombocytes in blood increased after stimulation using different antigens. The transcriptional profile of trout thrombocytes was then examined after immuno-magnetic enrichment using the described mAbs to assess potential roles of trout thrombocytes in immune functions. Trout thrombocytes express components of the MHC class Ia pathway, IL1β, TNFα, TGFβ, the interleukin receptor common γ chain as well as CXC and CC chemokines. MHC class IIB and TNFα were expressed at low levels in resting thrombocytes. No evidence was found for the expression of TCRαβ, Ig heavy chain, CD8α or CK1 mRNA. Taken together, these results suggest that rainbow trout thrombocytes express molecules involved in activation, aggregation and genes encoding proteins, that are involved in antigen presentation and immune regulation.

  15. Polycystin-2 Expression and Function in Adult Mouse Lacrimal Acinar Cells

    PubMed Central

    Hilgenberg, Jill D.; Rybalchenko, Volodymyr; Medina-Ortiz, Wanda E.; Gregg, Elaine V.; Koulen, Peter

    2011-01-01

    Purpose. Lacrimal glands regulate the production and secretion of tear fluid. Dysfunction of lacrimal gland acinar cells can ultimately result in ocular surface disorders, such as dry eye disease. Ca2+ homeostasis is tightly regulated in the cellular environment, and secretion from the acinar cells of the lacrimal gland is regulated by both cholinergic and adrenergic stimuli, which both result in changes in the cytosolic Ca2+ concentration. We have previously described the detailed intracellular distribution of inositol-1,4,5-trisphosphate receptors (IP3Rs), and ryanodine receptors (RyRs) in lacrimal acinar cells, however, little is known regarding the expression and distribution of the third major class of intracellular Ca2+ release channels, transient receptor potential polycystin family (TRPP) channels. Methods. Studies were performed in adult lacrimal gland tissue of Swiss-Webster mice. Expression, localization, and intracellular distribution of TRPP Ca2+ channels were investigated using immunocytochemistry, immunohistochemistry, and electron microscopy. The biophysical properties of single polycystin-2 channels were investigated using a planar lipid bilayer electrophysiology system. Results. All channel-forming isoforms of TRPP channels (polycystin-2, polycystin-L, and polycystin-2L2) were expressed in adult mouse lacrimal gland. Subcellular analysis of immunogold labeling revealed strongest polycystin-2 expression on the membranes of the endoplasmic reticulum, Golgi, and nucleus. Biophysical properties of lacrimal gland polycystin-2 channels were similar to those described for other tissues. Conclusions. The expression of TRPP channels in lacrimal acinar cells suggests a functional role of the proteins in the regulation of lacrimal fluid secretion under physiological and disease conditions, and provides the basis for future studies focusing on physiology and pharmacology. PMID:21508103

  16. IL-10-dependent down-regulation of MHC class II expression level on monocytes by peritoneal fluid from endometriosis patients.

    PubMed

    Lee, Kyu-Sup; Baek, Dae-Won; Kim, Ki-Hyung; Shin, Byoung-Sub; Lee, Dong-Hyung; Kim, Ja-Woong; Hong, Young-Seoub; Bae, Yoe-Sik; Kwak, Jong-Young

    2005-11-01

    Endometriosis is a gynecologic disorder characterized by the ectopic growth of misplaced endometrial cells. Moreover, immunological abnormalities of cell-mediated and humoral immunity may be associated with the pathogenesis of endometriosis. The effects of peritoneal fluid (PF) from endometriosis patients on the expression levels of MHC class II and costimulatory molecules on the cell surfaces of monocytes were investigated. Compared to the PF of controls, the addition of 10% PF (n=10) from patients with endometriosis to culture medium significantly reduced the percentage of MHC class II-positive cells in cultures of a THP-1, monocytic cell line at 48 h. The effect of endometriosis patient PF (EPF) was dose-dependent, and similar effect was observed in peripheral blood monocytes. An inverse correlation was found between MHC class II expression level and IL-10 concentration in EPF (r=-0.518; p=0.019) and in the supernatant of peripheral blood monocyte cultured in EPF (r=-0.459; p=0.042) (n=20). The expression levels of costimulatory molecules (CD80 and CD86), but not of CD54 and B7-H1, were down-regulated by EPF. The mRNA level of HLA-DR was unaffected by EPF but protein level was reduced by EPF. Neutralizing IL-10 antibody abrogated MHC class II down-regulation on monocytes, which had been induced by EPF. However, in a functional assay, monocytes treated with EPF failed to stimulate T cell in mixed leukocyte reaction, although T cell proliferation was increased with EPF-treated monocytes and Staphylococcus enterotoxin B. These results suggest that MHC class II expression level on monocytes is down-regulated by EPF, but the cell stimulatory ability of monocytes does not coincide with MHC class II expression level.

  17. C-Type Lectin Receptor MCL Facilitates Mincle Expression and Signaling through Complex Formation.

    PubMed

    Miyake, Yasunobu; Masatsugu, Oh-hora; Yamasaki, Sho

    2015-06-01

    C-type lectin receptors expressed in APCs are recently defined pattern recognition receptors that play a crucial role in immune responses against pathogen-associated molecular patterns. Among pathogen-associated molecular patterns, cord factor (trehalose-6,6'-dimycolate [TDM]) is the most potent immunostimulatory component of the mycobacterial cell wall. Two C-type lectin receptors, macrophage-inducible C-type lectin (Mincle) and macrophage C-type lectin (MCL), are required for immune responses against TDM. Previous studies indicate that MCL is required for TDM-induced Mincle expression. However, the mechanism by which MCL induces Mincle expression has not been fully understood. In this study, we demonstrate that MCL interacts with Mincle to promote its surface expression. After LPS or zymosan stimulation, MCL-deficient bone marrow-derived dendritic cells (BMDCs) had a lower level of Mincle protein expression, although mRNA expression was comparable with wild-type BMDCs. Meanwhile, BMDCs from MCL transgenic mice showed an enhanced level of Mincle expression on the cell surface. MCL was associated with Mincle through the stalk region and this region was necessary and sufficient for the enhancement of Mincle expression. This interaction appeared to be mediated by the hydrophobic repeat of MCL, as substitution of four hydrophobic residues within the stalk region with serine (MCL(4S)) abolished the function to enhance the surface expression of Mincle. MCL(4S) mutant failed to restore the defective TDM responses in MCL-deficient BMDCs. These results suggest that MCL positively regulates Mincle expression through protein-protein interaction via its stalk region, thereby magnifying Mincle-mediated signaling. Copyright © 2015 by The American Association of Immunologists, Inc.

  18. Epidermal growth factor system is a physiological regulator of development of the mouse fetal submandibular gland and regulates expression of the alpha6-integrin subunit.

    PubMed

    Kashimata, M; Gresik, E W

    1997-02-01

    Epidermal growth factor (EGF) and transforming growth factor-alpha (TGF-alpha) regulate branching morphogenesis of fetal mouse submandibular gland (SMG) rudiments in vitro. The EGF system (EGF, TGF-alpha, and their shared receptor, EGFR) also regulates expression of integrins and their ligands in the extracellular matrix. We show here that inhibition of EGFR tyrosine-kinase activity by a tyrphostin retards in vitro development of SMGs. Using total RNA isolated from pooled SMGs taken from intact mouse fetuses, mRNA transcripts for EGF, TGF-alpha, and EGFR were detected by reverse transcription-polymerase chain reaction (RT-PCR), and age-dependent variations in the levels of these mRNA were quantitatively determined by nuclease protection assays. These findings suggest that the EGF system is operative in the in vivo development of this gland. alpha6-Integrin subunit was localized by immunofluorescence at the basal surface of epithelial cells. Branching morphogenesis of cultured SMG rudiments was inhibited by anti-alpha6 antibodies. Synthesis of alpha6-subunit in cultured SMGs, detected by metabolic labeling and immunoprecipitation, was increased by EGF and drastically reduced by tyrphostin. RT-PCR revealed that mRNAs for alpha6- and beta1- and beta4-integrin subunits are expressed at all ages between embryonic day 13 and postnatal day 7. These findings suggest that 1) the EGF system is a physiologic regulator of development of fetal mouse SMG, and 2) one mechanism by which it acts may be by regulating expression of integrins, which in turn control interaction of epithelial cells with the extracellular matrix.

  19. Immunological compatibility status of placenta-derived stem cells is mediated by scaffold 3D structure.

    PubMed

    Azizian, Sara; Khatami, Fatemeh; Modaresifar, Khashayar; Mosaffa, Nariman; Peirovi, Habibollah; Tayebi, Lobat; Bahrami, Soheyl; Redl, Heinz; Niknejad, Hassan

    2018-02-23

    Placenta-derived amniotic epithelial cells (AECs), a great cell source for tissue engineering and stem cell therapy, are immunologically inert in their native state; however, immunological changes in these cells after culture and differentiation have challenged their applications. The aim of this study was to investigate the effect of 2D and 3D scaffolds on human lymphocyte antigens (HLA) expression by AECs. The effect of different preparation parameters including pre-freezing time and temperature was evaluated on 3D chitosan-gelatine scaffolds properties. Evaluation of MHC class I, HLA-DR and HLA-G expression in AECs after 7 d culture on 2D bed and 3D scaffold of chitosan-gelatine showed that culture of AECs on the 2D substrate up-regulated MHC class I and HLA-DR protein markers on AECs surface and down-regulated HLA-G protein. In contrast, 3D scaffold did not increase protein expression of MHC class I and HLA-DR. Moreover, HLA-G protein expression remained unchanged in 3D culture. These results confirm that 3D scaffold can remain AECs in their native immunological state and modification of physical properties of the scaffold is a key regulator of immunological markers at the gene and protein expression levels; a strategy which circumvents rejection challenge of amniotic stem cells to be translated into the clinic.

  20. Structural and functional conservation of CLEC-2 with the species-specific regulation of transcript expression in evolution.

    PubMed

    Wang, Lan; Ren, Shifang; Zhu, Haiyan; Zhang, Dongmei; Hao, Yuqing; Ruan, Yuanyuan; Zhou, Lei; Lee, Chiayu; Qiu, Lin; Yun, Xiaojing; Xie, Jianhui

    2012-08-01

    CLEC-2 was first identified by sequence similarity to C-type lectin-like molecules with immune functions and has been reported as a receptor for the platelet-aggregating snake venom toxin rhodocytin and the endogenous sialoglycoprotein podoplanin. Recent researches indicate that CLEC-2-deficient mice were lethal at the embryonic stage associated with disorganized and blood-filled lymphatic vessels and severe edema. In view of a necessary role of CLEC-2 in the individual development, it is of interest to investigate its phylogenetic homology and highly conserved functional regions. In this work, we reported that CLEC-2 from different species holds with an extraordinary conservation by sequence alignment and phylogenetic tree analysis. The functional structures including N-linked oligosaccharide sites and ligand-binding domain implement a structural and functional conservation in a variety of species. The glycosylation sites (N120 and N134) are necessary for the surface expression CLEC-2. CLEC-2 from different species possesses the binding activity of mouse podoplanin. Nevertheless, the expression of CLEC-2 is regulated with a species-specific manner. The alternative splicing of pre-mRNA, a regulatory mechanism of gene expression, and the binding sites on promoter for several key transcription factors vary between different species. Therefore, CLEC-2 shares high sequence homology and functional identity. However the transcript expression might be tightly regulated by different mechanisms in evolution.

  1. Gene array analysis reveals a common Runx transcriptional program controlling cell adhesion and survival

    PubMed Central

    Wotton, Sandy; Terry, Anne; Kilbey, Anna; Jenkins, Alma; Herzyk, Pawel; Cameron, Ewan; Neil, James C.

    2008-01-01

    The Runx genes play divergent roles in development and cancer, where they can act either as oncogenes or tumour suppressors. We compared the effects of ectopic Runx expression in established fibroblasts, where all three genes produce an indistinguishable phenotype entailing epithelioid morphology and increased cell survival under stress conditions. Gene array analysis revealed a strongly overlapping transcriptional signature, with no examples of opposing regulation of the same target gene. A common set of 50 highly regulated genes was identified after further filtering on regulation by inducible RUNX1-ER. This set revealed a strong bias towards genes with annotated roles in cancer and development, and a preponderance of targets encoding extracellular or surface proteins, reflecting the marked effects of Runx on cell adhesion. Furthermore, in silico prediction of resistance to glucocorticoid growth inhibition was confirmed in fibroblasts and lymphoid cells expressing ectopic Runx. The effects of fibroblast expression of common RUNX1 fusion oncoproteins (RUNX1-ETO, TEL-RUNX1, CBFB-MYH11) were also tested. While two direct Runx activation target genes were repressed (Ncam1, Rgc32), the fusion proteins appeared to disrupt regulation of down-regulated targets (Cebpd, Id2, Rgs2) rather than impose constitutive repression. These results elucidate the oncogenic potential of the Runx family and reveal novel targets for therapeutic inhibition. PMID:18560354

  2. [Effect of Yiguan Decoction on differentiation of bone marrow mesenchymal stem cells into hepatocyte-like cells: an experimental research].

    PubMed

    Ping, Jian; Chen, Hong-Yun; Yang, Zhou; Yang, Cheng; Xu, Lie-Ming

    2014-03-01

    To observe the effect of Yiguan Decoction (YGD) on differentiation of bone marrow mesenchymal stem cells (BMSCs) into hepatocyte-like cells in vitro. Rat BMSCs were isolated using whole bone marrow adherent method. The properties of BMSCs were identified by analyzing the expression of surface cytokines by flow cytometry. The third passage cells were differentiated into fat cells to identify their features. BMSCs were incubated with hepatocyte growth factor (HGF) plus fibroblast growth factor 4 (FGF4) or YGD containing serum YGD for 21 days. The mRNA expression of alpha-fetoprotein (alphaAFP), albumin (Alb), and hepatocyte nuclear factor 4alpha (HNF4alpha) were detected by real time PCR. Expression of AFP and cytokeratin 18 (CK18) protein was detected by cell immunofluorescence. Glycogen synthesis was observed using periodic acid-Schiff stain (PAS). CK18, Wnt 3alpha, and alphacatenin protein expressions were detected by Western blot. High expression of CD90, CD29, and CD44, and low expression of CD34 and CD11b were observed in BMSCs isolated by whole bone mar- row adherent method, and numerous lipid droplets were observed in BMSCs using oil red O staining. Both YGD containing serum and growth factor stimulated the expression levels of Alb, AFP, HNF4alpha mRNA and CK18 protein. The down-regulated expression of Wnt 3alpha and beta-catenin could be detected at 21 days after induction. The synthesized glycogen granule could be seen. Down-regulated Wnt 3alpha and beta-catenin expression could also be observed. YGD could induce the differentiation of rat BMSCs into hepatocyte-like cells, which was related to down-regulating Wnt/beta-catenin signal pathway.

  3. Systemic Sclerosis Patients Present Alterations in the Expression of Molecules Involved in B-Cell Regulation

    PubMed Central

    Soto, Lilian; Ferrier, Ashley; Aravena, Octavio; Fonseca, Elianet; Berendsen, Jorge; Biere, Andrea; Bueno, Daniel; Ramos, Verónica; Aguillón, Juan Carlos; Catalán, Diego

    2015-01-01

    The activation threshold of B cells is tightly regulated by an array of inhibitory and activator receptors in such a way that disturbances in their expression can lead to the appearance of autoimmunity. The aim of this study was to evaluate the expression of activating and inhibitory molecules involved in the modulation of B cell functions in transitional, naive, and memory B-cell subpopulations from systemic sclerosis patients. To achieve this, blood samples were drawn from 31 systemic sclerosis patients and 53 healthy individuals. Surface expression of CD86, MHC II, CD19, CD21, CD40, CD22, Siglec 10, CD35, and FcγRIIB was determined by flow cytometry. IL-10 production was evaluated by intracellular flow cytometry from isolated B cells. Soluble IL-6 and IL-10 levels were measured by ELISA from supernatants of stimulated B cells. Systemic sclerosis patients exhibit an increased frequency of transitional and naive B cells related to memory B cells compared with healthy controls. Transitional and naive B cells from patients express higher levels of CD86 and FcγRIIB than healthy donors. Also, B cells from patients show high expression of CD19 and CD40, whereas memory cells from systemic sclerosis patients show reduced expression of CD35. CD19 and CD35 expression levels associate with different autoantibody profiles. IL-10+ B cells and secreted levels of IL-10 were markedly reduced in patients. In conclusion, systemic sclerosis patients show alterations in the expression of molecules involved in B-cell regulation. These abnormalities may be determinant in the B-cell hyperactivation observed in systemic sclerosis. PMID:26483788

  4. Sequence variations and protein expression levels of the two immune evasion proteins Gpm1 and Pra1 influence virulence of clinical Candida albicans isolates.

    PubMed

    Luo, Shanshan; Hipler, Uta-Christina; Münzberg, Christin; Skerka, Christine; Zipfel, Peter F

    2015-01-01

    Candida albicans, the important human fungal pathogen uses multiple evasion strategies to control, modulate and inhibit host complement and innate immune attack. Clinical C. albicans strains vary in pathogenicity and in serum resistance, in this work we analyzed sequence polymorphisms and variations in the expression levels of two central fungal complement evasion proteins, Gpm1 (phosphoglycerate mutase 1) and Pra1 (pH-regulated antigen 1) in thirteen clinical C. albicans isolates. Four nucleotide (nt) exchanges, all representing synonymous exchanges, were identified within the 747-nt long GPM1 gene. For the 900-nt long PRA1 gene, sixteen nucleotide exchanges were identified, which represented synonymous, as well as non-synonymous exchanges. All thirteen clinical isolates had a homozygous exchange (A to G) at position 73 of the PRA1 gene. Surface levels of Gpm1 varied by 8.2, and Pra1 levels by 3.3 fold in thirteen tested isolates and these differences influenced fungal immune fitness. The high Gpm1/Pra1 expressing candida strains bound the three human immune regulators more efficiently, than the low expression strains. The difference was 44% for Factor H binding, 51% for C4BP binding and 23% for plasminogen binding. This higher Gpm1/Pra1 expressing strains result in enhanced survival upon challenge with complement active, Factor H depleted human serum (difference 40%). In addition adhesion to and infection of human endothelial cells was increased (difference 60%), and C3b surface deposition was less effective (difference 27%). Thus, variable expression levels of central immune evasion protein influences immune fitness of the human fungal pathogen C. albicans and thus contribute to fungal virulence.

  5. Thermo-Regulation of Genes Mediating Motility and Plant Interactions in Pseudomonas syringae

    PubMed Central

    Hockett, Kevin L.; Burch, Adrien Y.; Lindow, Steven E.

    2013-01-01

    Pseudomonas syringae is an important phyllosphere colonist that utilizes flagellum-mediated motility both as a means to explore leaf surfaces, as well as to invade into leaf interiors, where it survives as a pathogen. We found that multiple forms of flagellum-mediated motility are thermo-suppressed, including swarming and swimming motility. Suppression of swarming motility occurs between 28° and 30°C, which coincides with the optimal growth temperature of P. syringae. Both fliC (encoding flagellin) and syfA (encoding a non-ribosomal peptide synthetase involved in syringafactin biosynthesis) were suppressed with increasing temperature. RNA-seq revealed 1440 genes of the P. syringae genome are temperature sensitive in expression. Genes involved in polysaccharide synthesis and regulation, phage and IS elements, type VI secretion, chemosensing and chemotaxis, translation, flagellar synthesis and motility, and phytotoxin synthesis and transport were generally repressed at 30°C, while genes involved in transcriptional regulation, quaternary ammonium compound metabolism and transport, chaperone/heat shock proteins, and hypothetical genes were generally induced at 30°C. Deletion of flgM, a key regulator in the transition from class III to class IV gene expression, led to elevated and constitutive expression of fliC regardless of temperature, but did not affect thermo-regulation of syfA. This work highlights the importance of temperature in the biology of P. syringae, as many genes encoding traits important for plant-microbe interactions were thermo-regulated. PMID:23527276

  6. Identification of Candidate Transcriptional Regulators of Epidermal Transfer Cell Development in Vicia faba Cotyledons

    PubMed Central

    Arun-Chinnappa, Kiruba S.; McCurdy, David W.

    2016-01-01

    Transfer cells (TCs) are anatomically-specialized cells formed at apoplasmic-symplasmic bottlenecks in nutrient transport pathways in plants. TCs form invaginated wall ingrowths which provide a scaffold to amplify plasma membrane surface area and thus increase the density of nutrient transporters required to achieve enhanced nutrient flow across these bottlenecks. Despite their importance to nutrient transport in plants, little is known of the transcriptional regulation of wall ingrowth formation. Here, we used RNA-Seq to identify transcription factors putatively involved in regulating epidermal TC development in cotyledons of Vicia faba. Comparing cotyledons cultured for 0, 3, 9, and 24 h to induce trans-differentiation of epidermal TCs identified 43 transcription factors that showed either epidermal-specific or epidermal–enhanced expression, and 10 that showed epidermal-specific down regulation. Members of the WRKY and ethylene-responsive families were prominent in the cohort of transcription factors showing epidermal-specific or epidermal–enhanced expression, consistent with the initiation of TC development often representing a response to stress. Members of the MYB family were also prominent in these categories, including orthologs of MYB genes involved in localized secondary wall deposition in Arabidopsis thaliana. Among the group of transcription factors showing down regulation were various homeobox genes and members of the MADs-box and zinc-finger families of poorly defined functions. Collectively, this study identified several transcription factors showing expression characteristics and orthologous functions that indicate likely participation in transcriptional regulation of epidermal TC development in V. faba cotyledons. PMID:27252730

  7. System analysis of the regulation of the immune response by CD147 and FOXC1 in cancer cell lines

    PubMed Central

    Kong, Ling-Min; Wei, Ding; Xu, Jing; Wang, Zi-Ling; Bian, Huijie; Chen, Zhi-Nan

    2018-01-01

    CD147, encoded by BSG, is a highly glycosylated transmembrane protein that belongs to the immunological superfamily and expressed on the surface of many types of cancer cells. While CD147 is best known as a potent inducer of extracellular matrix metalloproteinases, it can also function as a key mediator of inflammatory and immune responses. To systematically elucidate the function of CD147 in cancer cells, we performed an analysis of genome-wide profiling across the Cancer Cell Line Encyclopedia (CCLE). We showed that CD147 mRNA expression was much higher than that of most other genes in cancer cell lines. CD147 varied widely across these cell lines, with the highest levels in the ovary (COLO704) and stomach (SNU668), intermediate levels in the lung (RERFLCKJ, NCIH596 and NCIH1651) and lowest levels in hematopoietic and lymphoid tissue (UT7, HEL9217, HEL and MHHCALL3) and the kidney (A704 and SLR20). Genome-wide analyses showed that CD147 expression was significantly negatively correlated with immune-related genes. Our findings implicated CD147 as a novel regulator of immune-related genes and suggest its important role as a master regulator of immune-related responses in cancer cell lines. We also found a high correlation between the expression of CD147 and FOXC1, and proved that CD147 was a direct transcriptional target of FOXC1. Our findings demonstrate that FOXC1 is a novel regulator of CD147 and confirms its role as a master regulator of the immune response. PMID:29560120

  8. An investigation into the effect of surface roughness of stainless steel on human umbilical vein endothelial cell gene expression.

    PubMed

    McLucas, E; Moran, M T; Rochev, Y; Carroll, W M; Smith, T J

    2006-01-01

    The surface properties of vascular devices dictate the initial postimplantation reactions that occur and thus the efficacy of the implantation procedure. Over the last number of years, a number of different stent designs have emerged and stents are generally polished to a mirror finish during the manufacturing procedure. This study sought to investigate the effect of stainless steel surface roughness on endothelial cell gene expression using an appropriate cell culture in vitro assay system. Stainless steel discs were roughened by shot blasting or polished by mechanical polishing. The surface roughness of the treated and untreated discs was determined by atomic force microscopy (AFM). Cells were seeded on collagen type 1 gels and left to attach for 24 h. Stainless steel discs of varying roughness were then placed in contact with the cells and incubated for 24 h. RNA extractions and quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) was then performed to determine the expression levels of candidate genes in the treated cells compared to suitable control cells. E-selectin and vascular cellular adhesion molecule (VCAM-1) were found to be significantly up-regulated in cells incubated with polished and roughened samples, indicating endothelial cell activation and inflammation. This study indicates that the surface roughness of stainless steel is an important surface property in the development of vascular stents.

  9. Surface localization of the nuclear receptor CAR in influenza A virus-infected cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takahashi, Tadanobu; Department of Biochemistry, School of Pharmaceutical Sciences, University of Shizuoka, CREST, JST, and COE Program in the 21st Century, Shizuoka 422-8526; Moriyama, Yusuke

    Constitutive active/androstane receptor CAR is a member of the nuclear receptors which regulate transcription of xenobiotic metabolism enzymes. CAR is usually localized in the cytosol and nucleus. Here, we found that CAR was localized at the cell surface of influenza A virus (IAV)-infected cells. Additionally, we demonstrated that expression of a viral envelope glycoprotein, either hemagglutinin (HA) or neuraminidase (NA), but not viral nucleoprotein (NP), was responsible for this localization. This report is the first demonstration of CAR at the surface of tissue culture cells, and suggests that CAR may exert the IAV infection mechanism.

  10. N-glycans are direct determinants of CFTR folding and stability in secretory and endocytic membrane traffic.

    PubMed

    Glozman, Rina; Okiyoneda, Tsukasa; Mulvihill, Cory M; Rini, James M; Barriere, Herve; Lukacs, Gergely L

    2009-03-23

    N-glycosylation, a common cotranslational modification, is thought to be critical for plasma membrane expression of glycoproteins by enhancing protein folding, trafficking, and stability through targeting them to the ER folding cycles via lectin-like chaperones. In this study, we show that N-glycans, specifically core glycans, enhance the productive folding and conformational stability of a polytopic membrane protein, the cystic fibrosis transmembrane conductance regulator (CFTR), independently of lectin-like chaperones. Defective N-glycosylation reduces cell surface expression by impairing both early secretory and endocytic traffic of CFTR. Conformational destabilization of the glycan-deficient CFTR induces ubiquitination, leading to rapid elimination from the cell surface. Ubiquitinated CFTR is directed to lysosomal degradation instead of endocytic recycling in early endosomes mediated by ubiquitin-binding endosomal sorting complex required for transport (ESCRT) adaptors Hrs (hepatocyte growth factor-regulated tyrosine kinase substrate) and TSG101. These results suggest that cotranslational N-glycosylation can exert a chaperone-independent profolding change in the energetic of CFTR in vivo as well as outline a paradigm for the peripheral trafficking defect of membrane proteins with impaired glycosylation.

  11. Cellular localization of the activated EGFR determines its effect on cell growth in MDA-MB-468 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hyatt, Dustin C.; Ceresa, Brian P.

    2008-11-01

    The epidermal growth factor (EGF) receptor (EGFR) is a ubiquitously expressed receptor tyrosine kinase that regulates diverse cell functions that are dependent upon cell type, the presence of downstream effectors, and receptor density. In addition to activating biochemical pathways, ligand stimulation causes the EGFR to enter the cell via clathrin-coated pits. Endocytic trafficking influences receptor signaling by controlling the duration of EGFR phosphorylation and coordinating the receptor's association with downstream effectors. To better understand the individual contributions of cell surface and cytosolic EGFRs on cell physiology, we used EGF that was conjugated to 900 nm polystyrene beads (EGF-beads). EGF-beads canmore » stimulate the EGFR and retain the activated receptor at the plasma membrane. In MDA-MB-468 cells, a breast cancer cell line that over-expresses the EGFR, only internalized, activated EGFRs stimulate caspase-3 and induce cell death. Conversely, signaling cascades triggered from activated EGFR retained at the cell surface inhibit caspase-3 and promote cell proliferation. Thus, through endocytosis, the activated EGFR can differentially regulate cell growth in MDA-MB-468 cells.« less

  12. In situ cell surface proteomics reveals differentially expressed membrane proteins in retinal pigment epithelial cells during autoimmune uveitis.

    PubMed

    Uhl, P B; Szober, C M; Amann, B; Alge-Priglinger, C; Ueffing, M; Hauck, S M; Deeg, C A

    2014-09-23

    Retinal pigment epithelium (RPE) builds the outer blood-retinal barrier of the eye and plays an important role in pathogenesis of the sight threatening disease equine recurrent uveitis (ERU). ERU is a spontaneous autoimmune mediated inflammatory disease characterised by the breakdown of the outer blood-retinal barrier and an influx of autoaggressive T-cells into the inner eye. Therefore, identification of molecular mechanisms contributing to changed function of blood-retinal barrier in ERU is important for the understanding of pathophysiology. Cell surface proteins of RPE collected from healthy horses and horses with ERU were captured by in situ biotinylation and analysed with high resolution mass spectrometry coupled to liquid chromatography (LC-MS/MS) to identify differentially expressed proteins. With label free differential proteomics, a total of 27 differently expressed cell surface proteins in diseased RPE could be detected. Significant down-regulation of three very interesting proteins, synaptotagmin 1, basigin and collectrin was verified and further characterised. We applied an innovative and successful method to detect changes in the plasma cell surface proteome of RPE cells in a spontaneous inflammatory eye disease, serving as a valuable model for human autoimmune uveitis. We were able to identify 27 differentially expressed plasma cell membrane proteins, including synaptotagmin 1, basigin and collectrin, which play important roles in cell adhesion, transport and cell communication. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Endosomal sorting of GLUT4 and Gap1 is conserved between yeast and insulin-sensitive cells

    PubMed Central

    Shewan, Annette M.; McCann, Rebecca K.; Lamb, Christopher A.; Stirrat, Laura; Kioumourtzoglou, Dimitrios; Adamson, Iain S.; Verma, Suzie; James, David E.; Bryant, Nia J.

    2013-01-01

    Summary The insulin-regulated trafficking of the facilitative glucose transporter GLUT4 in human fat and muscle cells and the nitrogen-regulated trafficking of the general amino acid permease Gap1 in the yeast Saccharomyces cerevisiae share several common features: Both Gap1 and GLUT4 are nutrient transporters that are mobilised to the cell surface from an intracellular store in response to an environmental cue; both are polytopic membrane proteins harbouring amino acid targeting motifs in their C-terminal tails that are required for their regulated trafficking; ubiquitylation of both Gap1 and GLUT4 plays an important role in their regulated trafficking, as do the ubiquitin-binding GGA (Golgi-localised, γ-ear-containing, ARF-binding) adaptor proteins. Here, we find that when expressed heterologously in yeast, human GLUT4 is subject to nitrogen-regulated trafficking in an ubiquitin-dependent manner similar to Gap1. In addition, by expressing a GLUT4/Gap1 chimeric protein in adipocytes we show that the carboxy-tail of Gap1 directs intracellular sequestration and insulin-regulated trafficking in adipocytes. These findings demonstrate that the trafficking signals and their cognate molecular regulatory machinery that mediate regulated exocytosis of membrane proteins are conserved across evolution. PMID:23424197

  14. Keratin impact on PKCδ- and ASMase-mediated regulation of hepatocyte lipid raft size - implication for FasR-associated apoptosis.

    PubMed

    Gilbert, Stéphane; Loranger, Anne; Omary, M Bishr; Marceau, Normand

    2016-09-01

    Keratins are epithelial cell intermediate filament (IF) proteins that are expressed as pairs in a cell-differentiation-regulated manner. Hepatocytes express the keratin 8 and 18 pair (denoted K8/K18) of IFs, and a loss of K8 or K18, as in K8-null mice, leads to degradation of the keratin partner. We have previously reported that a K8/K18 loss in hepatocytes leads to altered cell surface lipid raft distribution and more efficient Fas receptor (FasR, also known as TNFRSF6)-mediated apoptosis. We demonstrate here that the absence of K8 or transgenic expression of the K8 G62C mutant in mouse hepatocytes reduces lipid raft size. Mechanistically, we find that the lipid raft size is dependent on acid sphingomyelinase (ASMase, also known as SMPD1) enzyme activity, which is reduced in absence of K8/K18. Notably, the reduction of ASMase activity appears to be caused by a less efficient redistribution of surface membrane PKCδ toward lysosomes. Moreover, we delineate the lipid raft volume range that is required for an optimal FasR-mediated apoptosis. Hence, K8/K18-dependent PKCδ- and ASMase-mediated modulation of lipid raft size can explain the more prominent FasR-mediated signaling resulting from K8/K18 loss. The fine-tuning of ASMase-mediated regulation of lipid rafts might provide a therapeutic target for death-receptor-related liver diseases. © 2016. Published by The Company of Biologists Ltd.

  15. Membrane Type 1 Matrix Metalloproteinase Regulates Monocyte Migration and Collagen Destruction in Tuberculosis.

    PubMed

    Sathyamoorthy, Tarangini; Tezera, Liku B; Walker, Naomi F; Brilha, Sara; Saraiva, Luisa; Mauri, Francesco A; Wilkinson, Robert J; Friedland, Jon S; Elkington, Paul T

    2015-08-01

    Tuberculosis (TB) remains a global pandemic and drug resistance is rising. Multicellular granuloma formation is the pathological hallmark of Mycobacterium tuberculosis infection. The membrane type 1 matrix metalloproteinase (MT1-MMP or MMP-14) is a collagenase that is key in leukocyte migration and collagen destruction. In patients with TB, induced sputum MT1-MMP mRNA levels were increased 5.1-fold compared with matched controls and correlated positively with extent of lung infiltration on chest radiographs (r = 0.483; p < 0.05). M. tuberculosis infection of primary human monocytes increased MT1-MMP surface expression 31.7-fold and gene expression 24.5-fold. M. tuberculosis-infected monocytes degraded collagen matrix in an MT1-MMP-dependent manner, and MT1-MMP neutralization decreased collagen degradation by 73%. In human TB granulomas, MT1-MMP immunoreactivity was observed in macrophages throughout the granuloma. Monocyte-monocyte networks caused a 17.5-fold increase in MT1-MMP surface expression dependent on p38 MAPK and G protein-coupled receptor-dependent signaling. Monocytes migrating toward agarose beads impregnated with conditioned media from M. tuberculosis-infected monocytes expressed MT1-MMP. Neutralization of MT1-MMP activity decreased this M. tuberculosis network-dependent monocyte migration by 44%. Taken together, we demonstrate that MT1-MMP is central to two key elements of TB pathogenesis, causing collagen degradation and regulating monocyte migration. Copyright © 2015 The Authors.

  16. Cytokine-mediated FOXO3a phosphorylation suppresses FasL expression in hemopoietic cell lines: investigations of the role of Fas in apoptosis due to cytokine starvation.

    PubMed

    Behzad, Hayedeh; Jamil, Sarwat; Denny, Trisha A; Duronio, Vincent

    2007-05-01

    We have investigated phosphatidylinositol 3-kinase (PI3K)-dependent survival signalling pathways using several cytokines in three different hemopoietic cell lines, MC/9, FDC-P1, and TF-1. Cytokines caused PI3K- and PKB-dependent phosphorylation of FOXO3a (previously known as FKHRL1) at three distinct sites. Following cytokine withdrawal or PI3K inhibition, both of which are known to lead to apoptosis, there was a loss of FOXO3a phosphorylation, and a resulting increase in forkhead transcriptional activity, along with increased expression of Fas Ligand (FasL), which could be detected at the cell surface. Concurrently, an increase in cell surface expression of Fas was also detected. Despite the presence of both FasL and Fas, there was no detectable evidence that activation of Fas-mediated apoptotic events was contributing to apoptosis resulting from cytokine starvation or inhibition of PI3K activity. Thus, inhibition of FOXO3a activity is mediated by the PI3K-PKB pathway, but regulation of FasL is not the primary means by which cell survival is regulated in cytokine-dependent hemopoietic cells. We were also able to confirm increased expression of known FOXO3a targets, Bim and p27kip1. Together, these results support the conclusion that mitochondrial-mediated signals play the major role in apoptosis of hemopoietic cells due to loss of cytokine signalling.

  17. CD147, CD44, and the Epidermal Growth Factor Receptor (EGFR) Signaling Pathway Cooperate to Regulate Breast Epithelial Cell Invasiveness*

    PubMed Central

    Grass, G. Daniel; Tolliver, Lauren B.; Bratoeva, Momka; Toole, Bryan P.

    2013-01-01

    The immunoglobulin superfamily glycoprotein CD147 (emmprin; basigin) is associated with an invasive phenotype in various types of cancers, including malignant breast cancer. We showed recently that up-regulation of CD147 in non-transformed, non-invasive breast epithelial cells is sufficient to induce an invasive phenotype characterized by membrane type-1 matrix metalloproteinase (MT1-MMP)-dependent invadopodia activity (Grass, G. D., Bratoeva, M., and Toole, B. P. (2012) Regulation of invadopodia formation and activity by CD147. J. Cell Sci. 125, 777–788). Here we found that CD147 induces breast epithelial cell invasiveness by promoting epidermal growth factor receptor (EGFR)-Ras-ERK signaling in a manner dependent on hyaluronan-CD44 interaction. Furthermore, CD147 promotes assembly of signaling complexes containing CD147, CD44, and EGFR in lipid raftlike domains. We also found that oncogenic Ras regulates CD147 expression, hyaluronan synthesis, and formation of CD147-CD44-EGFR complexes, thus forming a positive feedback loop that may amplify invasiveness. Last, we showed that malignant breast cancer cells are heterogeneous in their expression of surface-associated CD147 and that high levels of membrane CD147 correlate with cell surface EGFR and CD44 levels, activated EGFR and ERK1, and activated invadopodia. Future studies should evaluate CD147 as a potential therapeutic target and disease stratification marker in breast cancer. PMID:23888049

  18. Differential response of bone and kidney to ACEI in db/db mice: A potential effect of captopril on accelerating bone loss.

    PubMed

    Zhang, Yan; Li, Xiao-Li; Sha, Nan-Nan; Shu, Bing; Zhao, Yong-Jian; Wang, Xin-Luan; Xiao, Hui-Hui; Shi, Qi; Wong, Man-Sau; Wang, Yong-Jun

    2017-04-01

    The components of renin-angiotensin system (RAS) are expressed in the kidney and bone. Kidney disease and bone injury are common complications associated with diabetes. This study aimed to investigate the effects of an angiotensin-converting enzyme inhibitor, captopril, on the kidney and bone of db/db mice. The db/db mice were orally administered by gavage with captopril for 8weeks with db/+ mice as the non-diabetic control. Serum and urine biochemistries were determined by standard colorimetric methods or ELISA. Histological measurements were performed on the kidney by periodic acid-schiff staining and on the tibial proximal metaphysis by safranin O and masson-trichrome staining. Trabecular bone mass and bone quality were analyzed by microcomputed tomography. Quantitative polymerase chain reaction and immunoblotting were applied for molecular analysis on mRNA and protein expression. Captopril significantly improved albuminuria and glomerulosclerosis in db/db mice, and these effects might be attributed to the down-regulation of angiotensin II expression and the expression of its down-stream profibrotic factors in the kidney, like connective tissue growth factor and vascular endothelial growth factor. Urinary excretion of calcium and phosphorus markedly increased in db/db mice in response to captopril. Treatment with captopril induced a decrease in bone mineral density and deterioration of trabecular bone at proximal metaphysis of tibia in db/db mice, as shown in the histological and reconstructed 3-dimensional images. Even though captopril effectively reversed the diabetes-induced changes in calcium-binding protein 28-k and vitamin D receptor expression in the kidney as well as the expression of RAS components and bradykinin receptor-2 in bone tissue, treatment with captopril increased the osteoclast-covered bone surface, reduced the osteoblast-covered bone surface, down-regulated the expression of type 1 collagen and transcription factor runt-related transcription factor 2 (markers for osteoblastic functions), and up-regulated the expression of carbonic anhydrase II (marker for bone resorption). Captopril exerted therapeutic effects on renal injuries associated with type 2 diabetes but worsened the deteriorations of trabecular bone in db/db mice; the latter of which was at least in part due to the stimulation of osteoclastogenesis and the suppression of osteogenesis by captopril. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Pseudomonas aeruginosa type IV minor pilins and PilY1 regulate virulence by modulating FimS-AlgR activity.

    PubMed

    Marko, Victoria A; Kilmury, Sara L N; MacNeil, Lesley T; Burrows, Lori L

    2018-05-18

    Type IV pili are expressed by a wide range of prokaryotes, including the opportunistic pathogen Pseudomonas aeruginosa. These flexible fibres mediate twitching motility, biofilm maturation, surface adhesion, and virulence. The pilus is composed mainly of major pilin subunits while the low abundance minor pilins FimU-PilVWXE and the putative adhesin PilY1 prime pilus assembly and are proposed to form the pilus tip. The minor pilins and PilY1 are encoded in an operon that is positively regulated by the FimS-AlgR two-component system. Independent of pilus assembly, PilY1 was proposed to be a mechanosensory component that-in conjunction with minor pilins-triggers up-regulation of acute virulence phenotypes upon surface attachment. Here, we investigated the link between the minor pilins/PilY1 and virulence. pilW, pilX, and pilY1 mutants had reduced virulence towards Caenorhabditis elegans relative to wild type or a major pilin mutant, implying a role in pathogenicity that is independent of pilus assembly. We hypothesized that loss of specific minor pilins relieves feedback inhibition on FimS-AlgR, increasing transcription of the AlgR regulon and delaying C. elegans killing. Reporter assays confirmed that FimS-AlgR were required for increased expression of the minor pilin operon upon loss of select minor pilins. Overexpression of AlgR or its hyperactivation via a phosphomimetic mutation reduced virulence, and the virulence defects of pilW, pilX, and pilY1 mutants required FimS-AlgR expression and activation. We propose that PilY1 and the minor pilins inhibit their own expression, and that loss of these proteins leads to FimS-mediated activation of AlgR that suppresses expression of acute-phase virulence factors and delays killing. This mechanism could contribute to adaptation of P. aeruginosa in chronic lung infections, as mutations in the minor pilin operon result in the loss of piliation and increased expression of AlgR-dependent virulence factors-such as alginate-that are characteristic of such infections.

  20. Thalidomide inhibits lipopolysaccharide-induced tumor necrosis factor-alpha production via down-regulation of MyD88 expression.

    PubMed

    Noman, Abu Shadat M; Koide, Naoki; Hassan, Ferdaus; I-E-Khuda, Imtiaz; Dagvadorj, Jargalsaikhan; Tumurkhuu, Gantsetseg; Islam, Shamima; Naiki, Yoshikazu; Yoshida, Tomoaki; Yokochi, Takashi

    2009-02-01

    The effect of thalidomide on lipopolysaccharide (LPS)-induced tumor necrosis factor (TNF)-alpha production was studied by using RAW 264.7 murine macrophage-like cells. Thalidomide significantly inhibited LPS-induced TNF-alpha production. Thalidomide prevented the activation of nuclear factor (NF)-KB by down-regulating phosphorylation of inhibitory KB factor (IKB), and IKB kinase (IKK)-alpha and IKK-beta Moreover, thalidomide inhibited LPS-induced phosphorylation of AKT, p38 and stress-activated protein kinase (SAPK)/JNK. The expression of myeloid differentiation factor 88 (MyD88) protein and mRNA was markedly reduced in thalidomide-treated RAW 264.7 cells but there was no significant alteration in the expression of interleukin-1 receptor-associated kinase (IRAK) 1 and TNF receptor-associated factor (TRAF) 6 in the cells. Thalidomide did not affect the cell surface expression of Toll-like receptor (TLR) 4 and CD14, suggesting the impairment of intracellular LPS signalling in thalidomide-treated RAW 264.7 cells. Thalidomide significantly inhibited the TNF-alpha production in response to palmitoyl-Cys(RS)-2,3-di(palmitoyloxy) propyl)-Ala-Gly-OH (Pam(3)Cys) as a MyD88-dependent TLR2 ligand. Therefore, it is suggested that thalidomide might impair LPS signalling via down-regulation of MyD88 protein and mRNA and inhibit LPS-induced TNF-alpha production. The putative mechanism of thalidomide-induced MyD88 down-regulation is discussed.

  1. PrP(C) regulates epidermal growth factor receptor function and cell shape dynamics in Neuro2a cells.

    PubMed

    Llorens, Franc; Carulla, Patricia; Villa, Ana; Torres, Juan M; Fortes, Puri; Ferrer, Isidre; del Río, José A

    2013-10-01

    The prion protein (PrP) plays a key role in prion disease pathogenesis. Although the misfolded and pathologic variant of this protein (PrP(SC)) has been studied in depth, the physiological role of PrP(C) remains elusive and controversial. PrP(C) is a cell-surface glycoprotein involved in multiple cellular functions at the plasma membrane, where it interacts with a myriad of partners and regulates several intracellular signal transduction cascades. However, little is known about the gene expression changes modulated by PrP(C) in animals and in cellular models. In this article, we present PrP(C)-dependent gene expression signature in N2a cells and its implication in the most overrepresented functions: cell cycle, cell growth and proliferation, and maintenance of cell shape. PrP(C) over-expression enhances cell proliferation and cell cycle re-entrance after serum stimulation, while PrP(C) silencing slows down cell cycle progression. In addition, MAP kinase and protein kinase B (AKT) pathway activation are under the regulation of PrP(C) in asynchronous cells and following mitogenic stimulation. These effects are due in part to the modulation of epidermal growth factor receptor (EGFR) by PrP(C) in the plasma membrane, where the two proteins interact in a multimeric complex. We also describe how PrP(C) over-expression modulates filopodia formation by Rho GTPase regulation mainly in an AKT-Cdc42-N-WASP-dependent pathway. © 2013 International Society for Neurochemistry.

  2. Megalin/LRP2 Expression Is Induced by Peroxisome Proliferator-Activated Receptor -Alpha and -Gamma: Implications for PPARs' Roles in Renal Function

    PubMed Central

    Cabezas, Felipe; Lagos, Jonathan; Céspedes, Carlos; Vio, Carlos P.; Bronfman, Miguel; Marzolo, María-Paz

    2011-01-01

    Background Megalin is a large endocytic receptor with relevant functions during development and adult life. It is expressed at the apical surface of several epithelial cell types, including proximal tubule cells (PTCs) in the kidney, where it internalizes apolipoproteins, vitamins and hormones with their corresponding carrier proteins and signaling molecules. Despite the important physiological roles of megalin little is known about the regulation of its expression. By analyzing the human megalin promoter, we found three response elements for the peroxisomal proliferator-activated receptor (PPAR). The objective of this study was to test whether megalin expression is regulated by the PPARs. Methodology/Principal Findings Treatment of epithelial cell lines with PPARα or PPARγ ligands increased megalin mRNA and protein expression. The stimulation of megalin mRNA expression was blocked by the addition of specific PPARα or PPARγ antagonists. Furthermore, PPAR bound to three PPAR response elements located in the megalin promoter, as shown by EMSA, and PPARα and its agonist activated a luciferase construct containing a portion of the megalin promoter and the first response element. Accordingly, the activation of PPARα and PPARγ enhanced megalin expression in mouse kidney. As previously observed, high concentrations of bovine serum albumin (BSA) decreased megalin in PTCs in vitro; however, PTCs pretreated with PPARα and PPARγ agonists avoided this BSA-mediated reduction of megalin expression. Finally, we found that megalin expression was significantly inhibited in the PTCs of rats that were injected with BSA to induce tubulointerstitial damage and proteinuria. Treatment of these rats with PPARγ agonists counteracted the reduction in megalin expression and the proteinuria induced by BSA. Conclusions PPARα/γ and their agonists positively control megalin expression. This regulation could have an important impact on several megalin-mediated physiological processes and on pathophysiologies such as chronic kidney disease associated with diabetes and hypertension, in which megalin expression is impaired. PMID:21311715

  3. Phosphatidylserine as an anchor for plasminogen and its plasminogen receptor, Histone H2B, to the macrophage surface

    PubMed Central

    DAS, R.; PLOW, E. F.

    2013-01-01

    Summary Background Plasminogen (Plg) binding to cell surface Plg receptors (Plg-Rs) on the surface of macrophages facilitates Plg activation and migration of these cells. Histone H2B (H2B) acts as a Plg-R and its cell surface expression is upregulated when monocytes are differentiated to macrophages via a pathway dependent on L-type Ca2+ channels and intracellular Ca2+. Objectives We sought to investigate the mechanism by which H2B, a protein without a transmembrane domain, is retained on themacrophage surface. Methods THP-1 monocytoid cells were induced to differentiate with interferon gamma + Vitamin D3 or to undergo apoptosis by treatment with camptothecin. Flow cytometry and cell surface biotinylation followed by Western blotting were used to measure the interrelationship between Plg binding, cell surface expression of H2B and outermembrane exposure of phosphatidylserine (PS). Results H2B interacted directly with PS via an electrostatic interaction. Anti-PS or PS binding proteins, annexin V and protein S, diminished H2B interaction with PS on the surface of differentiated or apoptotic cells and these same reagents inhibited Plg binding to these cells. L-type Ca2+ channels played a significant role in PS exposure, H2B surface expression and Plg binding induced either by differentiation or apoptosis. Conclusions These data suggest that H2B tethers to the surface of cells by interacting with PS on differentiated or apoptotic monocytoid cells. L-type Ca2+ channels regulate PS exposure on the surface of these cells. The exposed PS interacts directly with H2B and hence provides sites for Plg to bind to. PMID:21040449

  4. Immunostimulatory CpG-oligonucleotides induce functional high affinity IL-2 receptors on B-CLL cells: costimulation with IL-2 results in a highly immunogenic phenotype.

    PubMed

    Decker, T; Schneller, F; Kronschnabl, M; Dechow, T; Lipford, G B; Wagner, H; Peschel, C

    2000-05-01

    CpG-oligodeoxynucleotides (CpG-ODN) have been shown to induce proliferation, cytokine production, and surface molecule regulation in normal and malignant human B cells. In the present study, we investigated the potential of CpG-ODN to induce functional high-affinity receptors in leukemic and normal B cells and the effects of costimulation with IL-2 on proliferation, cytokine secretion, and surface molecule regulation. Highly purified B cells from B-CLL patients and normal controls were stimulated with CpG-ODN with or without IL-2. Expression of CD25 was determined using FACS, and the presence of high-affinity IL-2 receptors was determined by scatchard analysis. Costimulatory effects of IL-2 and CpG-ODN were investigated using proliferation assays, ELISA (IL-6, TNF-alpha), and FACS analysis (CD80, CD86 expression). Reactivity of autologous and allogeneic T cells toward activated B-CLL cells was determined in mixed lymphocyte reactions and Interferon-gamma Elispot assays. The CpG-ODN DSP30 caused a significantly stronger induction of the IL-2 receptor alpha chain in malignant as compared with normal B cells (p = 0.03). This resulted in the expression of functional high-affinity IL-2 receptors in B-CLL cells, but fewer numbers of receptors with less affinity were expressed in normal B cells. Although addition of IL-2 to CpG-ODN-stimulated cells augmented proliferation in both normal B cells and B-CLL cells, no costimulatory effect on cytokine production or surface molecule expression could be observed in normal B cells. In contrast, TNF-alpha and IL-6 production was increased in B-CLL cells, and the expression of CD80 and CD86 was further enhanced when IL-2 was used as a costimulus. Autologous and allogeneic immune recognition of B-CLL cells stimulated with CpG-ODN and IL-2 was increased compared with B-CLL cells stimulated with CpG-ODN alone. Stimulation of B-CLL cells with CpG-ODN and IL-2 might be an attractive strategy for potential immunotherapies for B-CLL patients.

  5. Expression of a major surface protein of Trypanosoma brucei insect forms is controlled by the activity of mitochondrial enzymes.

    PubMed

    Vassella, Erik; Probst, Matthias; Schneider, André; Studer, Erwin; Renggli, Christina Kunz; Roditi, Isabel

    2004-09-01

    In cycling between the mammalian host and the tsetse fly vector, trypanosomes undergo major changes in energy metabolism and surface coat composition. Early procyclic (insect) forms in the tsetse fly midgut are coated by glycoproteins known as EP and GPEET procyclins. EP expression continues in late procyclic forms, whereas GPEET is down-regulated. In culture, expression of GPEET is modulated by glycerol or glucose. Here, we demonstrate that a glycerol-responsive element of 25 nucleotides within the 3' untranslated region of GPEET mRNA also controls expression by glucose and during development in the fly. In trypanosomes, mitochondrial ATP is produced mainly by the acetate: succinate-CoA transferase/succinyl-CoA synthetase (ASCT) cycle, the citric acid cycle, and the cytochromes. Silencing of the pyruvate dehydrogenase or succinyl-CoA synthetase from the ASCT cycle by RNA interference induces reexpression of GPEET in late procyclic forms, whereas inhibition of the citric acid cycle or the cytochromes has no effect. In contrast, inhibition of the alternative oxidase, the second branch of the electron transport chain, with salicylhydroxamic acid overrides the effect of glucose or glycerol and causes a reduction in the level of GPEET mRNA. Our results reveal a new mechanism by which expression of a surface glycoprotein is controlled by the activity of mitochondrial enzymes.

  6. Lack of a direct role for macrosialin in oxidized LDL metabolism.

    PubMed

    de Beer, Maria C; Zhao, Zhenze; Webb, Nancy R; van der Westhuyzen, Deneys R; de Villiers, Willem J S

    2003-04-01

    Murine macrosialin (MS), a scavenger receptor family member, is a heavily glycosylated transmembrane protein expressed predominantly in macrophage late endosomes. MS is also found on the cell surface where it is suggested, on the basis of ligand blotting, to bind oxidized LDL (oxLDL). Here we report on the regulation of MS by an atherogenic high-fat diet and oxLDL, and on the inability of MS in transfected cells to bind oxLDL. MS expression was markedly increased in the livers of atherosclerosis-susceptible C57BL/6 and atherosclerosis-resistant C3H/HeJ mice fed an atherogenic high-fat diet. In resident-mouse peritoneal macrophages, treatment with oxLDL upregulated MS mRNA and protein expression 1.5- to 3-fold. MS, overexpressed in COS-7 cells through adenovirus mediated gene transfer, bound oxLDL by ligand blotting. However, no binding of oxLDL to MS was observed in intact transfected COS-7 and Chinese hamster ovary cells, despite significant cell surface expression of MS. Furthermore, inhibition of MS through gene silencing did not affect the binding of oxLDL to macrophages. We conclude that although MS expression in macrophages and Kupffer cells is responsive to a proatherogenic inflammatory diet and to oxLDL, MS does not function as an oxLDL receptor on the cell surface.

  7. The cysteine-rich domain regulates ADAM protease function in vivo.

    PubMed

    Smith, Katherine M; Gaultier, Alban; Cousin, Helene; Alfandari, Dominique; White, Judith M; DeSimone, Douglas W

    2002-12-09

    ADAMs are membrane-anchored proteases that regulate cell behavior by proteolytically modifying the cell surface and ECM. Like other membrane-anchored proteases, ADAMs contain candidate "adhesive" domains downstream of their metalloprotease domains. The mechanism by which membrane-anchored cell surface proteases utilize these putative adhesive domains to regulate protease function in vivo is not well understood. We address this important question by analyzing the relative contributions of downstream extracellular domains (disintegrin, cysteine rich, and EGF-like repeat) of the ADAM13 metalloprotease during Xenopus laevis development. When expressed in embryos, ADAM13 induces hyperplasia of the cement gland, whereas ADAM10 does not. Using chimeric constructs, we find that the metalloprotease domain of ADAM10 can substitute for that of ADAM13, but that specificity for cement gland expansion requires a downstream extracellular domain of ADAM13. Analysis of finer resolution chimeras indicates an essential role for the cysteine-rich domain and a supporting role for the disintegrin domain. These and other results reveal that the cysteine-rich domain of ADAM13 cooperates intramolecularly with the ADAM13 metalloprotease domain to regulate its function in vivo. Our findings thus provide the first evidence that a downstream extracellular adhesive domain plays an active role in regulating ADAM protease function in vivo. These findings are likely relevant to other membrane-anchored cell surface proteases.

  8. Expression and regulation of Sef, a novel signaling inhibitor of receptor tyrosine kinases-mediated signaling in the nervous system.

    PubMed

    Grothe, Claudia; Claus, Peter; Haastert, Kirsten; Lutwak, Ela; Ron, Dina

    2008-01-01

    Fibroblast growth factors (FGFs) signal via four distinct high affinity cell surface tyrosine kinase receptors, termed FGFR1-FGFR4 (FGFR-FGF-receptor). Recently, a new modulator of the FGF signaling pathway, the transmembrane protein 'similar expression to FGF genes' (Sef), has been identified in zebrafish and subsequently in mammals. Sef from mouse and human inhibits FGF mitogenic activity. In the present study, we analyzed the expression of Sef in distinct rat brain areas, in the spinal cord and in peripheral nerves and spinal ganglia using semi-quantitative RT-PCR. Furthermore, we studied the cellular expression pattern of Sef in intact spinal ganglia and sciatic nerves and, in addition, after crush lesion, using in situ hybridization and immunohistochemistry. Sef transcripts were expressed in all brain areas evaluated and in the spinal cord. A neuronal expression was found in both intact and injured spinal ganglia. Intact sciatic nerves, however, showed little or no Sef expression. Seven days after injury, high Sef expression was concentrated to the crush site, and Schwann cells seemed to be the source of Sef. The labeling pattern of up-regulated Sef was complementary to the patterns of FGF-2 and FGFR1-3, which were localized proximal and distal to the crush site. These results suggest an involvement of Sef during the nerve regeneration process, possibly by fine-tuning the effects of FGF signaling.

  9. Whole cigarette smoke increased the expression of TLRs, HBDs, and proinflammory cytokines by human gingival epithelial cells through different signaling pathways.

    PubMed

    Semlali, Abdelhabib; Witoled, Chmielewski; Alanazi, Mohammed; Rouabhia, Mahmoud

    2012-01-01

    The gingival epithelium is becoming known as a regulator of the oral innate immune responses to a variety of insults such as bacteria and chemicals, including those chemicals found in cigarette smoke. We investigated the effects of whole cigarette smoke on cell-surface-expressed Toll-like receptors (TLR)-2, -4 and -6, human β-defensin (HBD) and proinflammatory cytokine expression and production in primary human gingival epithelial cells. Whole cigarette smoke was shown to increase TLR2, TLR4 and TLR6 expression. Cigarette smoke led to ERK1/2, p38 and JNK phosphorylation in conjunction with nuclear factor-κB (NFκB) translocation into the nucleus. TLR expression following cigarette smoke exposure was down regulated by the use of ERK1/2, p38, JNK MAP kinases, and NFκB inhibitors, suggesting the involvement of these signaling pathways in the cellular response against cigarette smoke. Cigarette smoke also promoted HBD2, HBD3, IL-1β, and IL-6 expression through the ERK1/2 and NFκB pathways. Interestingly, the modulation of TLR, HBD, and cytokine expression was maintained long after the gingival epithelial cells were exposed to smoke. By promoting TLR, HBDs, and proinflammatory cytokine expression and production, cigarette smoke may contribute to innate immunity dysregulation, which may have a negative effect on human health.

  10. Whole Cigarette Smoke Increased the Expression of TLRs, HBDs, and Proinflammory Cytokines by Human Gingival Epithelial Cells through Different Signaling Pathways

    PubMed Central

    Semlali, Abdelhabib; Witoled, Chmielewski; Alanazi, Mohammed; Rouabhia, Mahmoud

    2012-01-01

    The gingival epithelium is becoming known as a regulator of the oral innate immune responses to a variety of insults such as bacteria and chemicals, including those chemicals found in cigarette smoke. We investigated the effects of whole cigarette smoke on cell-surface-expressed Toll-like receptors (TLR)-2, −4 and −6, human β-defensin (HBD) and proinflammatory cytokine expression and production in primary human gingival epithelial cells. Whole cigarette smoke was shown to increase TLR2, TLR4 and TLR6 expression. Cigarette smoke led to ERK1/2, p38 and JNK phosphorylation in conjunction with nuclear factor-κB (NFκB) translocation into the nucleus. TLR expression following cigarette smoke exposure was down regulated by the use of ERK1/2, p38, JNK MAP kinases, and NFκB inhibitors, suggesting the involvement of these signaling pathways in the cellular response against cigarette smoke. Cigarette smoke also promoted HBD2, HBD3, IL-1β, and IL-6 expression through the ERK1/2 and NFκB pathways. Interestingly, the modulation of TLR, HBD, and cytokine expression was maintained long after the gingival epithelial cells were exposed to smoke. By promoting TLR, HBDs, and proinflammatory cytokine expression and production, cigarette smoke may contribute to innate immunity dysregulation, which may have a negative effect on human health. PMID:23300722

  11. Macrophage heterogeneity and cholesterol homeostasis: classically-activated macrophages are associated with reduced cholesterol accumulation following treatment with oxidized LDL.

    PubMed

    Chu, Eugene M; Tai, Daven C; Beer, Jennifer L; Hill, John S

    2013-02-01

    Macrophages are centrally involved during atherosclerosis development and are the predominant cell type that accumulates cholesterol in the plaque. Macrophages however, are heterogeneous in nature reflecting a variety of microenvironments and different phenotypes may be more prone to contribute towards atherosclerosis progression. Using primary human monocyte-derived macrophages, we sought to evaluate one aspect of atherogenic potential of different macrophage phenotypes by determining their propensity to associate with and accumulate oxidized low density lipoprotein (oxLDL). Classically-activated macrophages treated simultaneously with interferon γ (IFNγ) and tumor necrosis factor α (TNFα) associated with less oxLDL and accumulated less cholesterol compared to untreated controls. The combined treatment of IFNγ and TNFα reduced the mRNA expression of CD36 and the expression of both cell surface CD36 and macrophage scavenger receptor 1 (MSR1) protein. Under oxLDL loaded conditions, IFNγ and TNFα did not reduce macrophage protein expression of the transcription factor peroxisome proliferator-actived receptor γ (PPARγ) which is known to positively regulate CD36 expression. However, macrophages treated with IFNγ attenuated the ability of the PPARγ-specific agonist rosiglitazone from upregulating cell surface CD36 protein expression. Our results demonstrate that the observed reduction of cholesterol accumulation in macrophages treated with IFNγ and TNFα following oxLDL treatment was due at least in part to reduced cell surface CD36 and MSR1 protein expression. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Laminin and integrin expression in the ventral ectodermal ridge of the mouse embryo: implications for regulation of BMP signalling.

    PubMed

    Lopez-Escobar, Beatriz; De Felipe, Beatriz; Sanchez-Alcazar, Jose Antonio; Sasaki, Takako; Copp, Andrew J; Ybot-Gonzalez, Patricia

    2012-11-01

    The ventral ectodermal ridge (VER) is an important signalling centre in the mouse tail-bud following completion of gastrulation. BMP regulation is essential for VER function, but how these signals are transmitted between adjacent tissues is unclear. We investigated the idea that extracellular matrix components might be involved, using immunohistochemistry and in situ hybridisation to detect all known α, β, and γ laminin chains and their mRNAs in the early tail bud. We identified an apparently novel laminin variant, comprising α5, β3 and γ2 chains, as a major component of the VER basement membrane at E9.5. Strikingly, only the mRNAs for these chains were co-expressed in VER cells, suggesting that lamin532 may be the sole basement membrane laminin at this stage. Since α6 integrin was also expressed in VER cells, this raises the possibility of cell-matrix interactions regulating BMP signalling at this site of caudal morphogenesis. Laminin532 could interact with α6-containing integrin to direct differentiation of the specialised VER cells from surface ectoderm. Copyright © 2012 Wiley Periodicals, Inc.

  13. Laminin and integrin expression in the ventral ectodermal ridge of the mouse embryo: implications for regulation of BMP signalling

    PubMed Central

    Lopez-Escobar, Beatriz; de Felipe, Beatriz; Sanchez-Alcazar, Jose Antonio; Sasaki, Takako; Copp, Andrew J.; Ybot-Gonzalez, Patricia

    2013-01-01

    Background The ventral ectodermal ridge (VER) is an important signalling centre in the mouse tail-bud following completion of gastrulation. BMP regulation is essential for VER function, but how these signals are transmitted between adjacent tissues is unclear. Results We investigated the idea that extracellular matrix components might be involved, using immunohistochemistry and in situ hybridisation to detect all known α, β and γ laminin chains and their mRNAs in the early tail bud. We identified an apparently novel laminin variant, comprising α5, β3 and γ2 chains, as a major component of the VER basement membrane at E9.5. Strikingly, only the mRNAs for these chains were co-expressed in VER cells, suggesting that lamin532 may be the sole basement membrane laminin at this stage. Since α6 integrin was also expressed in VER cells, this raises the possibility of cell-matrix interactions regulating BMP signalling at this site of caudal morphogenesis. Conclusions Laminin532 could interact with α6-containing integrin to direct differentiation of the specialised VER cells from surface ectoderm. PMID:22911573

  14. The carboxyl tail of connexin32 regulates gap junction assembly in human prostate and pancreatic cancer cells.

    PubMed

    Katoch, Parul; Mitra, Shalini; Ray, Anuttoma; Kelsey, Linda; Roberts, Brett J; Wahl, James K; Johnson, Keith R; Mehta, Parmender P

    2015-02-20

    Connexins, the constituent proteins of gap junctions, are transmembrane proteins. A connexin (Cx) traverses the membrane four times and has one intracellular and two extracellular loops with the amino and carboxyl termini facing the cytoplasm. The transmembrane and the extracellular loop domains are highly conserved among different Cxs, whereas the carboxyl termini, often called the cytoplasmic tails, are highly divergent. We have explored the role of the cytoplasmic tail of Cx32, a Cx expressed in polarized and differentiated cells, in regulating gap junction assembly. Our results demonstrate that compared with the full-length Cx32, the cytoplasmic tail-deleted Cx32 is assembled into small gap junctions in human pancreatic and prostatic cancer cells. Our results further document that the expression of the full-length Cx32 in cells, which express the tail-deleted Cx32, increases the size of gap junctions, whereas the expression of the tail-deleted Cx32 in cells, which express the full-length Cx32, has the opposite effect. Moreover, we show that the tail is required for the clustering of cell-cell channels and that in cells expressing the tail-deleted Cx32, the expression of cell surface-targeted cytoplasmic tail alone is sufficient to enhance the size of gap junctions. Our live-cell imaging data further demonstrate that gap junctions formed of the tail-deleted Cx32 are highly mobile compared with those formed of full-length Cx32. Our results suggest that the cytoplasmic tail of Cx32 is not required to initiate the assembly of gap junctions but for their subsequent growth and stability. Our findings suggest that the cytoplasmic tail of Cx32 may be involved in regulating the permeability of gap junctions by regulating their size. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Phenotypic Heterogeneity and the Evolution of Bacterial Life Cycles.

    PubMed

    van Gestel, Jordi; Nowak, Martin A

    2016-02-01

    Most bacteria live in colonies, where they often express different cell types. The ecological significance of these cell types and their evolutionary origin are often unknown. Here, we study the evolution of cell differentiation in the context of surface colonization. We particularly focus on the evolution of a 'sticky' cell type that is required for surface attachment, but is costly to express. The sticky cells not only facilitate their own attachment, but also that of non-sticky cells. Using individual-based simulations, we show that surface colonization rapidly evolves and in most cases leads to phenotypic heterogeneity, in which sticky and non-sticky cells occur side by side on the surface. In the presence of regulation, cell differentiation leads to a remarkable set of bacterial life cycles, in which cells alternate between living in the liquid and living on the surface. The dominant life stage is formed by the surface-attached colony that shows many complex features: colonies reproduce via fission and by producing migratory propagules; cells inside the colony divide labour; and colonies can produce filaments to facilitate expansion. Overall, our model illustrates how the evolution of an adhesive cell type goes hand in hand with the evolution of complex bacterial life cycles.

  16. Oxygen Modulates Human Decidual Natural Killer Cell Surface Receptor Expression and Interactions with Trophoblasts1

    PubMed Central

    Wallace, Alison E.; Goulwara, Sonu S.; Whitley, Guy S.; Cartwright, Judith E.

    2014-01-01

    Decidual natural killer (dNK) cells have been shown to both promote and inhibit trophoblast behavior important for decidual remodeling in pregnancy and have a distinct phenotype compared to peripheral blood NK cells. We investigated whether different levels of oxygen tension, mimicking the physiological conditions of the decidua in early pregnancy, altered cell surface receptor expression and activity of dNK cells and their interactions with trophoblast. dNK cells were isolated from terminated first-trimester pregnancies and cultured in oxygen tensions of 3%, 10%, and 21% for 24 h. Cell surface receptor expression was examined by flow cytometry, and the effects of secreted factors in conditioned medium (CM) on the trophoblast cell line SGHPL-4 were assessed in vitro. SGHPL-4 cells treated with dNK cell CM incubated in oxygen tensions of 10% were significantly more invasive (P < 0.05) and formed endothelial-like networks to a greater extent (P < 0.05) than SGHPL-4 cells treated with dNK cell CM incubated in oxygen tensions of 3% or 21%. After 24 h, a lower percentage of dNK cells expressed CD56 at 21% oxygen (P < 0.05), and an increased percentage of dNK cells expressed NKG2D at 10% oxygen (P < 0.05) compared to other oxygen tensions, with large patient variation. This study demonstrates dNK cell phenotype and secreted factors are modulated by oxygen tension, which induces changes in trophoblast invasion and endovascular-like differentiation. Alterations in dNK cell surface receptor expression and secreted factors at different oxygen tensions may represent regulation of function within the decidua during the first trimester of pregnancy. PMID:25232021

  17. Expression of Arabidopsis SHN1 in Indian Mulberry (Morus indica L.) Increases Leaf Surface Wax Content and Reduces Post-harvest Water Loss

    PubMed Central

    Sajeevan, R. S.; Nataraja, Karaba N.; Shivashankara, K. S.; Pallavi, N.; Gurumurthy, D. S.; Shivanna, M. B.

    2017-01-01

    Mulberry (Morus species) leaf is the sole food for monophagous silkworms, Bombyx mori L. Abiotic stresses such as drought, salinity, and high temperature, significantly decrease mulberry productivity and post-harvest water loss from leaves influence silkworm growth and cocoon yield. Leaf surface properties regulate direct water loss through the cuticular layer. Leaf surface waxes, contribute for cuticular resistance and protect mesophyll cells from desiccation. In this study we attempted to overexpress AtSHN1, a transcription factor associated with epicuticular wax biosynthesis to increase leaf surface wax load in mulberry. Agrobacterium mediated in vitro transformation was carried out using hypocotyl and cotyledonary explants of Indian mulberry (cv. M5). Mulberry transgenic plants expressing AtSHN1 displayed dark green shiny appearance with increased leaf surface wax content. Scanning electron microscopy (SEM) and gas chromatograph–mass spectrometry (GC-MS) analysis showed change in pattern of surface wax deposition and significant change in wax composition in AtSHN1 overexpressors. Increased wax content altered leaf surface properties as there was significant difference in water droplet contact angle and diameter between transgenic and wild type plants. The transgenic plants showed significant improvement in leaf moisture retention capacity even 5 h after harvest and there was slow degradation of total buffer soluble protein in detached leaves compared to wild type. Silkworm bioassay did not indicate any undesirable effects on larval growth and cocoon yield. This study demonstrated that expression of AtSHN1, can increase surface wax load and reduce the post-harvest water loss in mulberry. PMID:28421085

  18. High-Content Surface and Total Expression siRNA Kinase Library Screen with VX-809 Treatment Reveals Kinase Targets that Enhance F508del-CFTR Rescue.

    PubMed

    Perkins, Lydia A; Fisher, Gregory W; Naganbabu, Matharishwan; Schmidt, Brigitte F; Mun, Frederick; Bruchez, Marcel P

    2018-03-05

    The most promising F508del-CFTR corrector, VX-809, has been unsuccessful as an effective, stand-alone treatment for CF patients, but the rescue effect in combination with other drugs may confer an acceptable level of therapeutic benefit. Targeting cellular factors that modify trafficking may act to enhance the cell surface density of F508-CFTR with VX-809 correction. Our goal is to identify druggable kinases that enhance F508del-CFTR rescue and stabilization at the cell surface beyond that achievable with the VX-809 corrector alone. To achieve this goal, we implemented a new high-throughput screening paradigm that quickly and quantitatively measures surface density and total protein in the same cells. This allowed for rapid screening for increased surface targeting and proteostatic regulation. The assay utilizes fluorogen-activating-protein (FAP) technology with cell excluded and cell permeant fluorogenic dyes in a quick, wash-free fluorescent plate reader format on live cells to first measure F508del-CFTR expressed on the surface and then the total amount of F508del-CFTR protein present. To screen for kinase targets, we used Dharmacon's ON-TARGET plus SMARTpool siRNA Kinase library (715 target kinases) with and without 10 μM VX-809 treatment in triplicate at 37 °C. We identified several targets that had a significant interaction with VX-809 treatment in enhancing surface density with siRNA knockdown. Select small-molecule inhibitors of the kinase targets demonstrated augmented surface expression with VX-809 treatment.

  19. Generating Chondromimetic Mesenchymal Stem Cell Spheroids by Regulating Media Composition and Surface Coating.

    PubMed

    Sridharan, BanuPriya; Laflin, Amy D; Detamore, Michael S

    2018-04-01

    Spheroids of mesenchymal stem cells (MSCs) in cartilage tissue engineering have been shown to enhance regenerative potential owing to their 3D structure. In this study, we explored the possibility of priming spheroids under different media to replace the use of inductive surface coatings for chondrogenic differentiation. Rat bone marrow-derived MSCs were organized into cell spheroids by the hanging drop technique and subsequently cultured on hyaluronic acid (HA) coated or non-coated well plates under different cell media conditions. Endpoint analysis included cell viability, DNA and Glycosaminoglycan (GAG) and collagen content, gene expression and immunohistochemistry. For chondrogenic applications, MSC spheroids derived on non-coated surfaces outperformed the spheroids derived from HA-coated surfaces in matrix synthesis and collagen II gene expression. Spheroids on non-coated surfaces gave rise to the highest collagen and GAG when primed with medium containing insulin-like growth factor (IGF) for 1 week during spheroid formation. Spheroids that were grown in chondroinductive raw material-inclusive media such as aggrecan or chondroitin sulfate exhibited the highest Collagen II gene expression in the non-coated surface at 1 week. Media priming by growth factors and raw materials might be a more predictive influencer of chondrogenesis compared to inductive-surfaces. Such tailored bioactivity of the stem cell spheroids in the stage of the spheroid formation may give rise to a platform technology that may eventually produce spheroids capable of chondrogenesis achieved by mere media manipulation, skipping the need for additional culture on a modified surface, that paves the way for cost-effective technologies.

  20. Inhibition of mitogen-activated protein kinase Erk1/2 promotes protein degradation of ATP binding cassette transporters A1 and G1 in CHO and HuH7 cells.

    PubMed

    Mulay, Vishwaroop; Wood, Peta; Manetsch, Melanie; Darabi, Masoud; Cairns, Rose; Hoque, Monira; Chan, Karen Cecilia; Reverter, Meritxell; Alvarez-Guaita, Anna; Rye, Kerry-Anne; Rentero, Carles; Heeren, Joerg; Enrich, Carlos; Grewal, Thomas

    2013-01-01

    Signal transduction modulates expression and activity of cholesterol transporters. We recently demonstrated that the Ras/mitogen-activated protein kinase (MAPK) signaling cascade regulates protein stability of Scavenger Receptor BI (SR-BI) through Proliferator Activator Receptor (PPARα) -dependent degradation pathways. In addition, MAPK (Mek/Erk 1/2) inhibition has been shown to influence liver X receptor (LXR) -inducible ATP Binding Cassette (ABC) transporter ABCA1 expression in macrophages. Here we investigated if Ras/MAPK signaling could alter expression and activity of ABCA1 and ABCG1 in steroidogenic and hepatic cell lines. We demonstrate that in Chinese Hamster Ovary (CHO) cells and human hepatic HuH7 cells, extracellular signal-regulated kinase 1/2 (Erk1/2) inhibition reduces PPARα-inducible ABCA1 protein levels, while ectopic expression of constitutively active H-Ras, K-Ras and MAPK/Erk kinase 1 (Mek1) increases ABCA1 protein expression, respectively. Furthermore, Mek1/2 inhibitors reduce ABCG1 protein levels in ABCG1 overexpressing CHO cells (CHO-ABCG1) and human embryonic kidney 293 (HEK293) cells treated with LXR agonist. This correlates with Mek1/2 inhibition reducing ABCG1 cell surface expression and decreasing cholesterol efflux onto High Density Lipoproteins (HDL). Real Time reverse transcriptase polymerase chain reaction (RT-PCR) and protein turnover studies reveal that Mek1/2 inhibitors do not target transcriptional regulation of ABCA1 and ABCG1, but promote ABCA1 and ABCG1 protein degradation in HuH7 and CHO cells, respectively. In line with published data from mouse macrophages, blocking Mek1/2 activity upregulates ABCA1 and ABCG1 protein levels in human THP1 macrophages, indicating opposite roles for the Ras/MAPK pathway in the regulation of ABC transporter activity in macrophages compared to steroidogenic and hepatic cell types. In summary, this study suggests that Ras/MAPK signaling modulates PPARα- and LXR-dependent protein degradation pathways in a cell-specific manner to regulate the expression levels of ABCA1 and ABCG1 transporters.

  1. Mesenchymal stromal cells express GARP/LRRC32 on their surface: effects on their biology and immunomodulatory capacity.

    PubMed

    Carrillo-Galvez, Ana Belén; Cobo, Marién; Cuevas-Ocaña, Sara; Gutiérrez-Guerrero, Alejandra; Sánchez-Gilabert, Almudena; Bongarzone, Pierpaolo; García-Pérez, Angélica; Muñoz, Pilar; Benabdellah, Karim; Toscano, Miguel G; Martín, Francisco; Anderson, Per

    2015-01-01

    Mesenchymal stromal cells (MSCs) represent a promising tool for therapy in regenerative medicine, transplantation, and autoimmune disease due to their trophic and immunomodulatory activities. However, we are still far from understanding the mechanisms of action of MSCs in these processes. Transforming growth factor (TGF)-β1 is a pleiotropic cytokine involved in MSC migration, differentiation, and immunomodulation. Recently, glycoprotein A repetitions predominant (GARP) was shown to bind latency-associated peptide (LAP)/TGF-β1 to the cell surface of activated Foxp3(+) regulatory T cells (Tregs) and megakaryocytes/platelets. In this manuscript, we show that human and mouse MSCs express GARP which presents LAP/TGF-β1 on their cell surface. Silencing GARP expression in MSCs increased their secretion and activation of TGF-β1 and reduced their proliferative capacity in a TGF-β1-independent manner. Importantly, we showed that GARP expression on MSCs contributed to their ability to inhibit T-cell responses in vitro. In summary, we have found that GARP is an essential molecule for MSC biology, regulating their immunomodulatory and proliferative activities. We envision GARP as a new target for improving the therapeutic efficacy of MSCs and also as a novel MSC marker. © 2014 AlphaMed Press.

  2. Mesenchymal Stromal Cells Express GARP/LRRC32 on Their Surface: Effects on Their Biology and Immunomodulatory Capacity

    PubMed Central

    Carrillo-Galvez, Ana Belén; Cobo, Marién; Cuevas-Ocaña, Sara; Gutiérrez-Guerrero, Alejandra; Sánchez-Gilabert, Almudena; Bongarzone, Pierpaolo; García-Pérez, Angélica; Muñoz, Pilar; Benabdellah, Karim; Toscano, Miguel G; Martín, Francisco; Anderson, Per

    2015-01-01

    Mesenchymal stromal cells (MSCs) represent a promising tool for therapy in regenerative medicine, transplantation, and autoimmune disease due to their trophic and immunomodulatory activities. However, we are still far from understanding the mechanisms of action of MSCs in these processes. Transforming growth factor (TGF)-β1 is a pleiotropic cytokine involved in MSC migration, differentiation, and immunomodulation. Recently, glycoprotein A repetitions predominant (GARP) was shown to bind latency-associated peptide (LAP)/TGF-β1 to the cell surface of activated Foxp3+ regulatory T cells (Tregs) and megakaryocytes/platelets. In this manuscript, we show that human and mouse MSCs express GARP which presents LAP/TGF-β1 on their cell surface. Silencing GARP expression in MSCs increased their secretion and activation of TGF-β1 and reduced their proliferative capacity in a TGF-β1-independent manner. Importantly, we showed that GARP expression on MSCs contributed to their ability to inhibit T-cell responses in vitro. In summary, we have found that GARP is an essential molecule for MSC biology, regulating their immunomodulatory and proliferative activities. We envision GARP as a new target for improving the therapeutic efficacy of MSCs and also as a novel MSC marker. Stem Cells 2015;33:183–195 PMID:25182959

  3. Behavioral abnormalities in prion protein knockout mice and the potential relevance of PrPc for the cytoskeleton

    USDA-ARS?s Scientific Manuscript database

    The cellular prion protein (PrPC) is a highly conserved protein, which is anchored to the outer surface of the plasma membrane. Even though its physiological function has already been investigated in different cell or mouse models where PrPC expression is either up-regulated or depleted, its exact p...

  4. A Novel Member of the Insulin-Like Growth Factor Binding Protein Superfamily in Prostate Cancer

    DTIC Science & Technology

    2004-02-01

    1269, 2002. The effect of sodium butyrate (NaB), a potent inhibitor of cancer cell growth, on the regulation of IGFBP-rP2 expression was correlated...4072-4080, 2000 3. Tsubaki J, Choi W-K, Ingermann AR, Twigg SM, Kim H-S, Rosenfeld RG, Oh Y: Effects of sodium butyrate on expression of members of...injected over the activated surface in a 10-mM sodium reproducibility. acetate solution. A solution of I m ethanolamine was then passed over the

  5. Tetraspanin Tspan9 regulates platelet collagen receptor GPVI lateral diffusion and activation

    PubMed Central

    Haining, Elizabeth J.; Matthews, Alexandra L.; Noy, Peter J.; Romanska, Hanna M.; Harris, Helen J.; Pike, Jeremy; Morowski, Martina; Gavin, Rebecca L.; Yang, Jing; Milhiet, Pierre-Emmanuel; Berditchevski, Fedor; Nieswandt, Bernhard; Poulter, Natalie S.; Watson, Steve P.; Tomlinson, Michael G.

    2017-01-01

    Abstract The tetraspanins are a superfamily of four-transmembrane proteins, which regulate the trafficking, lateral diffusion and clustering of the transmembrane proteins with which they interact. We have previously shown that tetraspanin Tspan9 is expressed on platelets. Here we have characterised gene-trap mice lacking Tspan9. The mice were viable with normal platelet numbers and size. Tspan9-deficient platelets were specifically defective in aggregation and secretion induced by the platelet collagen receptor GPVI, despite normal surface GPVI expression levels. A GPVI activation defect was suggested by partially impaired GPVI-induced protein tyrosine phosphorylation. In mechanistic experiments, Tspan9 and GPVI co-immunoprecipitated and co-localised, but super-resolution imaging revealed no defects in collagen-induced GPVI clustering on Tspan9-deficient platelets. However, single particle tracking using total internal reflection fluorescence microscopy showed that GPVI lateral diffusion was reduced by approximately 50% in the absence of Tspan9. Therefore, Tspan9 plays a fine-tuning role in platelet activation by regulating GPVI membrane dynamics. PMID:28032533

  6. The hypertonic environment differentially regulates wild-type CFTR and TNR-CFTR chloride channels.

    PubMed

    Lassance-Soares, Roberta M; Cheng, Jie; Krasnov, Kristina; Cebotaru, Liudmila; Cutting, Garry R; Souza-Menezes, Jackson; Morales, Marcelo M; Guggino, William B

    2010-01-01

    This study tested the hypotheses that the hypertonic environment of the renal medulla regulates the expression of cystic fibrosis transmembrane conductance regulator protein (CFTR) and its natural splice variant, TNR-CFTR. To accomplish this, Madin-Darby canine kidney (MDCK) stable cell lines expressing TNR-CFTR or CFTR were used. The cells were treated with hypertonic medium made with either NaCl or urea or sucrose (480 mOsm/kg or 560 mOsm/kg) to mimic the tonicity of the renal medulla environment. Western blot data showed that CFTR and TNR-CFTR total cell protein is increased by hypertonic medium, but using the surface biotinylation technique, only CFTR was found to be increased in cell plasma membrane. Confocal microscopy showed TNR-CFTR localization primarily at the endoplasmic reticulum and plasma membrane. In conclusion, CFTR and TNR-CFTR have different patterns of distribution in MDCK cells and they are modulated by a hypertonic environment, suggesting their physiological importance in renal medulla. Copyright © 2010 S. Karger AG, Basel.

  7. GSK3 and Polo-like kinase regulate ADAM13 function during cranial neural crest cell migration

    PubMed Central

    Abbruzzese, Genevieve; Cousin, Hélène; Salicioni, Ana Maria; Alfandari, Dominique

    2014-01-01

    ADAMs are cell surface metalloproteases that control multiple biological processes by cleaving signaling and adhesion molecules. ADAM13 controls cranial neural crest (CNC) cell migration both by cleaving cadherin-11 to release a promigratory extracellular fragment and by controlling expression of multiple genes via its cytoplasmic domain. The latter activity is regulated by γ-secretase cleavage and the translocation of the cytoplasmic domain into the nucleus. One of the genes regulated by ADAM13, the protease calpain8, is essential for CNC migration. Although the nuclear function of ADAM13 is evolutionarily conserved, it is unclear whether the transcriptional regulation is also performed by other ADAMs and how this process may be regulated. We show that ADAM13 function to promote CNC migration is regulated by two phosphorylation events involving GSK3 and Polo-like kinase (Plk). We further show that inhibition of either kinase blocks CNC migration and that the respective phosphomimetic forms of ADAM13 can rescue these inhibitions. However, these phosphorylations are not required for ADAM13 proteolysis of its substrates, γ-secretase cleavage, or nuclear translocation of its cytoplasmic domain. Of significance, migration of the CNC can be restored in the absence of Plk phosphorylation by expression of calpain-8a, pointing to impaired nuclear activity of ADAM13. PMID:25298404

  8. A Bioinformatics Approach Identifies Signal Transducer and Activator of Transcription-3 and Checkpoint Kinase 1 as Upstream Regulators of Kidney Injury Molecule-1 after Kidney Injury

    PubMed Central

    Ajay, Amrendra Kumar; Kim, Tae-Min; Ramirez-Gonzalez, Victoria; Park, Peter J.; Frank, David A.

    2014-01-01

    Kidney injury molecule-1 (KIM-1)/T cell Ig and mucin domain-containing protein-1 (TIM-1) is upregulated more than other proteins after AKI, and it is highly expressed in renal damage of various etiologies. In this capacity, KIM-1/TIM-1 acts as a phosphatidylserine receptor on the surface of injured proximal tubular epithelial cells, mediating phagocytosis of apoptotic cells, and it may also act as a costimulatory molecule for immune cells. Despite recognition of KIM-1 as an important therapeutic target for kidney disease, the regulators of KIM-1 transcription in the kidney remain unknown. Using a bioinformatics approach, we identified upstream regulators of KIM-1 after AKI. In response to tubular injury in rat and human kidneys or oxidant stress in human proximal tubular epithelial cells (HPTECs), KIM-1 expression increased significantly in a manner that corresponded temporally and regionally with increased phosphorylation of checkpoint kinase 1 (Chk1) and STAT3. Both ischemic and oxidant stress resulted in a dramatic increase in reactive oxygen species that phosphorylated and activated Chk1, which subsequently bound to STAT3, phosphorylating it at S727. Furthermore, STAT3 bound to the KIM-1 promoter after ischemic and oxidant stress, and pharmacological or genetic induction of STAT3 in HPTECs increased KIM-1 mRNA and protein levels. Conversely, inhibition of STAT3 using siRNAs or dominant negative mutants reduced KIM-1 expression in a kidney cancer cell line (769-P) that expresses high basal levels of KIM-1. These observations highlight Chk1 and STAT3 as critical upstream regulators of KIM-1 expression after AKI and may suggest novel approaches for therapeutic intervention. PMID:24158981

  9. Naringin, a flavanone glycoside, promotes angiogenesis and inhibits endothelial apoptosis through modulation of inflammatory and growth factor expression in diabetic foot ulcer in rats.

    PubMed

    Kandhare, Amit D; Ghosh, Pinaki; Bodhankar, Subhash L

    2014-08-05

    Chronic, unhealed diabetic foot ulcer (DFU) is one of the most severe complications of diabetes mellitus (DM). Naringin, a flavanone glycoside antioxidant, was reported to have antidiabetic and anti-apoptotic properties. In the present study DM was induced experimentally by streptozotocin (STZ, 55 mg/kg, i.p.). In surgically introduced wounds on the dorsal surface of the hind paw of rats, the healing potential of naringin was investigated. Rats were treated with naringin (20, 40 and 80 mg/kg, p.o.), insulin (10 IU/kg, s.c.) and tetrachlorodecaoxide (TCDO) (1 drop, twice a day, topically) for 16 days. The wound area was measured every second day, and on day 17 various biochemical parameters were determined in serum, wound tissue, and histopathological examination of the wound was performed. Naringin (40 and 80 mg/kg) significantly (P<0.05) improved wound area, serum glucose level, glycated Hb and serum insulin. Naringin treatment at 40 and 80 mg/kg resulted in significant (P<0.05) up-regulation of mRNA expression of growth factor (IFG-1, TGF-β and VEGF-c), Ang-1 and collagen-1 whereas mRNA expression of inflammatory mediators (TNF-α, IL-1β and IL-6) was down-regulated. Furthermore, naringin significantly (P<0.05) attenuated STZ-induced apoptosis and stimulated angiogenesis in the wound tissue. Further results suggest that angiogenesis was improved via naringin-mediated inhibition of hyperglycemia, oxidative stress, down-regulation of inflammatory mediator expression and up-regulation of growth factor expression, leading to improved wound healing of DFU. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. Neutral endopeptidase inhibits prostate cancer cell migration by blocking focal adhesion kinase signaling.

    PubMed

    Sumitomo, M; Shen, R; Walburg, M; Dai, J; Geng, Y; Navarro, D; Boileau, G; Papandreou, C N; Giancotti, F G; Knudsen, B; Nanus, D M

    2000-12-01

    Neutral endopeptidase 24.11 (NEP, CD10) is a cell-surface enzyme expressed by prostatic epithelial cells that cleaves and inactivates neuropeptides implicated in the growth of androgen-independent prostate cancer (PC). NEP substrates such as bombesin and endothelin-1 induce cell migration. We investigated the mechanisms of NEP regulation of cell migration in PC cells, including regulation of phosphorylation on tyrosine of focal adhesion kinase (FAK). Western analyses and cell migration assays revealed an inverse correlation between NEP expression and the levels of FAK phosphorylation and cell migration in PC cell lines. Constitutively expressed NEP, recombinant NEP, and induced NEP expression using a tetracycline-repressive expression system inhibited bombesin- and endothelin-1-stimulated FAK phosphorylation and cell migration. This results from NEP-induced inhibition of neuropeptide-stimulated association of FAK with cSrc protein. Expression of a mutated catalytically inactive NEP protein also resulted in partial inhibition of FAK phosphorylation and cell migration. Coimmunoprecipitation experiments show that NEP associates with tyrosine-phosphorylated Lyn kinase, which then binds the p85 subunit of phosphatidylinositol 3-kinase (PI3-K) resulting in an NEP-Lyn-PI3-K protein complex. This complex competitively blocks FAK-PI3-K interaction, suggesting that NEP protein inhibits cell migration via a protein-protein interaction independent of its catalytic function. These experiments demonstrate that NEP can inhibit FAK phosphorylation on tyrosine and PC cell migration through multiple pathways and suggest that cell migration which contributes to invasion and metastases in PC cells can be regulated by NEP.

  11. Neutral endopeptidase inhibits prostate cancer cell migration by blocking focal adhesion kinase signaling

    PubMed Central

    Sumitomo, Makoto; Shen, Ruoqian; Walburg, Marc; Dai, Jie; Geng, Yiping; Navarro, Daniel; Boileau, Guy; Papandreou, Christos N.; Giancotti, Filippo G.; Knudsen, Beatrice; Nanus, David M.

    2000-01-01

    Neutral endopeptidase 24.11 (NEP, CD10) is a cell-surface enzyme expressed by prostatic epithelial cells that cleaves and inactivates neuropeptides implicated in the growth of androgen-independent prostate cancer (PC). NEP substrates such as bombesin and endothelin-1 induce cell migration. We investigated the mechanisms of NEP regulation of cell migration in PC cells, including regulation of phosphorylation on tyrosine of focal adhesion kinase (FAK). Western analyses and cell migration assays revealed an inverse correlation between NEP expression and the levels of FAK phosphorylation and cell migration in PC cell lines. Constitutively expressed NEP, recombinant NEP, and induced NEP expression using a tetracycline-repressive expression system inhibited bombesin- and endothelin-1–stimulated FAK phosphorylation and cell migration. This results from NEP-induced inhibition of neuropeptide-stimulated association of FAK with cSrc protein. Expression of a mutated catalytically inactive NEP protein also resulted in partial inhibition of FAK phosphorylation and cell migration. Coimmunoprecipitation experiments show that NEP associates with tyrosine-phosphorylated Lyn kinase, which then binds the p85 subunit of phosphatidylinositol 3-kinase (PI3-K) resulting in an NEP-Lyn-PI3-K protein complex. This complex competitively blocks FAK-PI3-K interaction, suggesting that NEP protein inhibits cell migration via a protein-protein interaction independent of its catalytic function. These experiments demonstrate that NEP can inhibit FAK phosphorylation on tyrosine and PC cell migration through multiple pathways and suggest that cell migration which contributes to invasion and metastases in PC cells can be regulated by NEP. PMID:11104793

  12. Investigating Evolutionary Conservation of Dendritic Cell Subset Identity and Functions

    PubMed Central

    Vu Manh, Thien-Phong; Bertho, Nicolas; Hosmalin, Anne; Schwartz-Cornil, Isabelle; Dalod, Marc

    2015-01-01

    Dendritic cells (DCs) were initially defined as mononuclear phagocytes with a dendritic morphology and an exquisite efficiency for naïve T-cell activation. DC encompass several subsets initially identified by their expression of specific cell surface molecules and later shown to excel in distinct functions and to develop under the instruction of different transcription factors or cytokines. Very few cell surface molecules are expressed in a specific manner on any immune cell type. Hence, to identify cell types, the sole use of a small number of cell surface markers in classical flow cytometry can be deceiving. Moreover, the markers currently used to define mononuclear phagocyte subsets vary depending on the tissue and animal species studied and even between laboratories. This has led to confusion in the definition of DC subset identity and in their attribution of specific functions. There is a strong need to identify a rigorous and consensus way to define mononuclear phagocyte subsets, with precise guidelines potentially applicable throughout tissues and species. We will discuss the advantages, drawbacks, and complementarities of different methodologies: cell surface phenotyping, ontogeny, functional characterization, and molecular profiling. We will advocate that gene expression profiling is a very rigorous, largely unbiased and accessible method to define the identity of mononuclear phagocyte subsets, which strengthens and refines surface phenotyping. It is uniquely powerful to yield new, experimentally testable, hypotheses on the ontogeny or functions of mononuclear phagocyte subsets, their molecular regulation, and their evolutionary conservation. We propose defining cell populations based on a combination of cell surface phenotyping, expression analysis of hallmark genes, and robust functional assays, in order to reach a consensus and integrate faster the huge but scattered knowledge accumulated by different laboratories on different cell types, organs, and species. PMID:26082777

  13. Glucocorticoids Suppress Renal Cell Carcinoma Progression by Enhancing Na,K-ATPase Beta-1 Subunit Expression

    PubMed Central

    Huynh, Thu P.; Barwe, Sonali P.; Lee, Seung J.; McSpadden, Ryan; Franco, Omar E.; Hayward, Simon W.; Damoiseaux, Robert; Grubbs, Stephen S.; Petrelli, Nicholas J.; Rajasekaran, Ayyappan K.

    2015-01-01

    Glucocorticoids are commonly used as palliative or chemotherapeutic clinical agents for treatment of a variety of cancers. Although steroid treatment is beneficial, the mechanisms by which steroids improve outcome in cancer patients are not well understood. Na,K-ATPase beta-subunit isoform 1 (NaK-β1) is a cell-cell adhesion molecule, and its expression is down-regulated in cancer cells undergoing epithelial-to mesenchymal-transition (EMT), a key event associated with cancer progression to metastatic disease. In this study, we performed high-throughput screening to identify small molecules that could up-regulate NaK-β1 expression in cancer cells. Compounds related to the glucocorticoids were identified as drug candidates enhancing NaK-β1 expression. Of these compounds, triamcinolone, dexamethasone, and fluorometholone were validated to increase NaK-β1 expression at the cell surface, enhance cell-cell adhesion, attenuate motility and invasiveness and induce mesenchymal to epithelial like transition of renal cell carcinoma (RCC) cells in vitro. Treatment of NaK-β1 knockdown cells with these drug candidates confirmed that these compounds mediate their effects through up-regulating NaK-β1. Furthermore, we demonstrated that these compounds attenuate tumor growth in subcutaneous RCC xenografts and reduce local invasiveness in orthotopically-implanted tumors. Our results strongly indicate that the addition of glucocorticoids in the treatment of RCC may improve outcome for RCC patients by augmenting NaK-β1 cell-cell adhesion function. PMID:25836370

  14. Keratinocytes negatively regulate the N-cadherin levels of melanoma cells via contact-mediated calcium regulation.

    PubMed

    Chung, Heesung; Jung, Hyejung; Jho, Eek-Hoon; Multhaupt, Hinke A B; Couchman, John R; Oh, Eok-Soo

    2018-06-14

    In human skin, melanocytes and their neighboring keratinocytes have a close functional interrelationship. Keratinocytes, which represent the prevalent cell type of human skin, regulate melanocytes through various mechanisms. Here, we use a keratinocyte and melanoma co-culture system to show for the first time that keratinocytes regulate the cell surface expression of N-cadherin through cell-cell contact. Compared to mono-cultured human melanoma A375 cells, which expressed high levels of N-cadherin, those co-cultured with the HaCaT human keratinocyte cell line showed reduced levels of N-cadherin. This reduction was most evident in areas of A375 cells that underwent cell-cell contact with the HaCaT cells, whereas HaCaT cell-derived extracellular matrix and conditioned medium both failed to reduce N-cadherin levels. The intracellular level of calcium in co-cultured A375 cells was lower than that in mono-cultured A375 cells, and treatment with a cell-permeant calcium chelator (BAPTA) reduced the N-cadherin level of mono-cultured A375 cells. Furthermore, co-culture with HaCaT cells reduced the expression levels of transient receptor potential cation channel (TRPC) 1, -3 and -6 in A375 cells, and siRNA-mediated multi-depletion of TRPC1, -3 and -6 reduced the N-cadherin level in these cells. Taken together, these data suggest that keratinocytes negatively regulate the N-cadherin levels of melanoma cells via cell-to-cell contact-mediated calcium regulation. Copyright © 2018. Published by Elsevier Inc.

  15. Time-Resolved Analysis of Cytosolic and Surface-Associated Proteins of Staphylococcus aureus HG001 under Planktonic and Biofilm Conditions.

    PubMed

    Moche, Martin; Schlüter, Rabea; Bernhardt, Jörg; Plate, Kristina; Riedel, Katharina; Hecker, Michael; Becher, Dörte

    2015-09-04

    Staphylococcal biofilms are associated with persistent infections due to their capacity to protect bacteria against the host's immune system and antibiotics. Cell-surface-associated proteins are of great importance during biofilm formation. In the present study, an optimized biotinylation approach for quantitative GeLC-MS-based analysis of the staphylococcal cell-surface proteome was applied and the cytoplasmic protein fraction was analyzed to elucidate proteomic differences between colony biofilms and planktonic cells. The experimental setup enabled a time-resolved monitoring of the proteome under both culture conditions and the comparison of biofilm cells to planktonic cells at several time points. This allowed discrimination of differences attributed to delayed growth phases from responses provoked by biofilm conditions. Biofilm cells expressed CcpA-dependent catabolic proteins earlier than planktonic cells and strongly accumulated proteins that belong to the SigB stress regulon. The amount of the cell-surface protein and virulence gene regulator Rot decreased within biofilms and MgrA-dependent regulations appeared more pronounced. Biofilm cells simultaneously up-regulated activators (e.g., SarZ) as well as repressors (e.g., SarX) of RNAIII. A decreased amount of high-affinity iron uptake systems and an increased amount of the iron-storage protein FtnA possibly indicated a lower demand of iron in biofilms.

  16. In Vitro Studies on the Antimicrobial Peptide Human Beta-Defensin 9 (HBD9): Signalling Pathways and Pathogen-Related Response (An American Ophthalmological Society Thesis)

    PubMed Central

    Dua, Harminder S.; Otri, Ahmad Muneer; Hopkinson, Andrew; Mohammed, Imran

    2014-01-01

    Purpose: Human β-defensins (HBDs) are an important part of the innate immune host defense at the ocular surface. Unlike other defensins, expression of HBD9 at the ocular surface is reduced during microbial infection, but activation of toll-like receptor 2 (TLR2) in corneal epithelial cells has been shown to up-regulate HBD9. Our purpose was to test the hypothesis that TLR2 has a key role in the signalling pathway(s) involved in the overexpression or underexpression of HBD9, and accordingly, different pathogens would induce a different expression pattern of HBD9. Methods: The in vitro RNAi silencing method and response to dexamethasone were used to determine key molecules involved in signalling pathways of HBD9 in immortalized human corneal epithelial cells. The techniques included cell culture with exposure to specific transcription factor inhibitors and bacteria, RNA extraction and cDNA synthesis, quantitative real-time polymerase chain reaction, and immunohistology. Results: This study demonstrates that TLR2 induces HBD9 mRNA and protein expression in a time- and dose-dependent manner. Transforming growth factor-β–activated kinase 1 (TAK1) plays a central role in HBD9 induction by TLR2, and transcription factors c-JUN and activating transcription factor 2 are also involved. Dexamethasone reduces TLR2-mediated up-regulation of HBD9 mRNA and protein levels in mitogen-activated protein kinase phosphatase 1 (MKP1)-dependent and c-JUN-independent manner. HBD9 expression differs with gram-negative and gram-positive bacteria. Conclusions: TLR2-mediated MKPs and nuclear factor-κB signalling pathways are involved in HBD9 expression. TAK-1 is a key molecule. These molecules can be potentially targeted to modulate HBD9 expression. Differential expression of HBD9 with different bacteria could be related to differences in pathogen-associated molecular patterns of these organisms. PMID:25646028

  17. Long term storage in liquid nitrogen leads to only minor phenotypic and gene expression changes in the mammary carcinoma model cell line BT474.

    PubMed

    Fazekas, Judit; Grunt, Thomas W; Jensen-Jarolim, Erika; Singer, Josef

    2017-05-23

    Cancer cell lines are indispensible surrogate models in cancer research, as they can be used off-the-shelf, expanded to the desired extent, easily modified and exchanged between research groups for affirmation, reproduction or follow-up experiments.As malignant cells are prone to genomic instability, phenotypical changes may occur after certain passages in culture. Thus, cell lines have to be regularly authenticated to ensure data quality. In between experiments these cell lines are often stored in liquid nitrogen for extended time periods.Although freezing of cells is a necessary evil, little research is performed on how long-term storage affects cancer cell lines. Therefore, this study investigated the effects of a 28-year long liquid nitrogen storage period on BT474 cells with regard to phenotypical changes, differences in cell-surface receptor expression as well as cytokine and gene expressional variations. Two batches of BT474 cells, one frozen in 1986, the other directly purchased from ATCC were investigated by light microscopy, cell growth analysis, flow cytometry and cytokine as well as whole-transcriptome expression profiling. The cell lines were morphologically indifferent and showed similar growth rates and similar cell-surface receptor expression. Transcriptome analysis revealed significant differences in only 26 of 40,716 investigated RefSeq transcripts with 4 of them being up-regulated and 22 down-regulated. This study demonstrates that even after very long periods of storage in liquid nitrogen, cancer cell lines display only minimal changes in their gene expression profiles. However, also such minor changes should be carefully assessed before continuation of experiments, especially if phenotypic alterations can be additionally observed.

  18. Nedd4-2 Modulates Renal Na+-Cl− Cotransporter via the Aldosterone-SGK1-Nedd4-2 Pathway

    PubMed Central

    Arroyo, Juan Pablo; Lagnaz, Dagmara; Ronzaud, Caroline; Vázquez, Norma; Ko, Benjamin S.; Moddes, Lauren; Ruffieux-Daidié, Dorothée; Hausel, Pierrette; Koesters, Robert; Yang, Baoli; Stokes, John B.; Hoover, Robert S.

    2011-01-01

    Regulation of renal Na+ transport is essential for controlling blood pressure, as well as Na+ and K+ homeostasis. Aldosterone stimulates Na+ reabsorption by the Na+-Cl− cotransporter (NCC) in the distal convoluted tubule (DCT) and by the epithelial Na+ channel (ENaC) in the late DCT, connecting tubule, and collecting duct. Aldosterone increases ENaC expression by inhibiting the channel's ubiquitylation and degradation; aldosterone promotes serum-glucocorticoid-regulated kinase SGK1-mediated phosphorylation of the ubiquitin-protein ligase Nedd4-2 on serine 328, which prevents the Nedd4-2/ENaC interaction. It is important to note that aldosterone increases NCC protein expression by an unknown post-translational mechanism. Here, we present evidence that Nedd4-2 coimmunoprecipitated with NCC and stimulated NCC ubiquitylation at the surface of transfected HEK293 cells. In Xenopus laevis oocytes, coexpression of NCC with wild-type Nedd4-2, but not its catalytically inactive mutant, strongly decreased NCC activity and surface expression. SGK1 prevented this inhibition in a kinase-dependent manner. Furthermore, deficiency of Nedd4-2 in the renal tubules of mice and in cultured mDCT15 cells upregulated NCC. In contrast to ENaC, Nedd4-2-mediated inhibition of NCC did not require the PY-like motif of NCC. Moreover, the mutation of Nedd4-2 at either serine 328 or 222 did not affect SGK1 action, and mutation at both sites enhanced Nedd4-2 activity and abolished SGK1-dependent inhibition. Taken together, these results suggest that aldosterone modulates NCC protein expression via a pathway involving SGK1 and Nedd4-2 and provides an explanation for the well-known aldosterone-induced increase in NCC protein expression. PMID:21852580

  19. Endocytosis as a mechanism of regulating natural killer cell function: unique endocytic and trafficking pathway for CD94/NKG2A.

    PubMed

    Peruzzi, Giovanna; Masilamani, Madhan; Borrego, Francisco; Coligan, John E

    2009-01-01

    Natural killer (NK) cells are lymphocytes generally recognized as sentinels of the innate immune system due to their inherent capacity to deal with diseased (stressed) cells, including malignant and infected. This ability to recognize many potentially pathogenic situations is due to the expression of a diverse panel of activation receptors. Because NK cell activation triggers an aggressive inflammatory response, it is important to have a means of throttling this response. Hence, NK cells also express a panel of inhibitory receptors that recognize ligands expressed by "normal" cells. Little or nothing is known about the endocytosis and trafficking of NK cell receptors, which are of great relevance to understanding how NK cells maintain the appropriate balance of activating and inhibitory receptors on their cell surface. In this review, we focus on the ITIM-containing inhibitory receptor CD94/NKG2A showing that it is endocytosed by a previously undescribed macropinocytic-like process that may be related to the maintenance of its surface expression.

  20. The gene for fibroblast activation protein {alpha} (FAP), a putative cell surface-bound serine protease expressed in cancer stroma and wound healing, maps to chromosome band 2q23

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mathew, S.; Murty, V.V.V.S.; Chaganti, R.S.K.

    The human fibroblast activation protein {alpha} (FAP{alpha}) is an inducible cell surface glycoprotein of M{sub r} 95,000 recognized by a number of monoclonal antibodies (mAbs), including the prototype mAb F19. Immunohistochemical studies have shown that FAP{alpha} expression in vivo is tightly regulated, with transient expression in some fetal mesenchymal tissues but absence of expression in most normal adult tissues. Reexpression of FAP{alpha} is observed in the reactive stromal fibroblasts of several common types of epithelial cancers, including >90% of breast, colorectal, and lung carcinomas and healing wounds. Cloning and sequence analysis of an FAP{alpha}-specific cDNA has revealed that the moleculemore » is encoded by a novel gene, FAP, which shows sequence similarity to members of the serine protease family of integral membrane proteins, namely dipeptidyl peptidase IV (DPPIV, also known as lymphocyte activation antigen, CD26, or adenosine dearoinase binding protein) and DPPX, a DPPIV-related molecule of unknown function. 15 refs., 1 fig.« less

  1. Adhesion, proliferation and differentiation of osteoblasts on zirconia films prepared by cathodic arc deposition.

    PubMed

    Zhang, Shailin; Sun, Junying; Xu, Ying; Qian, Shi; Wang, Bing; Liu, Fei; Liu, Xuanyong

    2013-01-01

    Zirconia films were prepared on titanium by cathodic arc deposition technique. The surface topography and element composition of the films were characterized by scanning electron microscopy and X-ray photoelectron spectroscopy, respectively. Osteoblast-like MG63 cells were cultured on the surface of the zirconia films in vitro, and cell behaviour was investigated, with titanium as control. The results obtained from scanning electron microscopy and immunofluorescence studies showed that the MG63 cells on ZrO2 films spread better than those on Ti. The CCK8 assay indicated that the zirconia films promoted the proliferation of MG63 cells. The results of alkaline phosphatase (ALP) activity test and the expression of osteogenic marker genes, such as ALP, collagen I and osteocalcin, demonstrated that the differentiation of MG63 cells might be enhanced by zirconia films. In addition, the zirconia films possibly regulated osteoclastogenic gene expression by stimulating the expression of osteoprotegerin and reducing the expression of receptor activator of nuclear factor-kappaB ligand. The present work suggests that the ZrO2 film is worth further consideration for orthopedic implant applications.

  2. Involvement of up-regulated Necl-5/Tage4/PVR/CD155 in the loss of contact inhibition in transformed NIH3T3 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Minami, Yukiko; Department of Surgery and Clinical Oncology, Osaka University Graduate School of Medicine/Faculty of Medicine, Suita 565-0871, Osaka; Ikeda, Wataru

    2007-01-26

    Normal cells show contact inhibition of cell movement and proliferation, but this is lost following transformation. We found that Necl-5, originally identified as a poliovirus receptor and up-regulated in many cancer cells, enhances growth factor-induced cell movement and proliferation. We showed that when cells contact other cells, Necl-5 interacts in trans with nectin-3 and is removed by endocytosis from the cell surface, resulting in a reduction of cell movement and proliferation. We show here that up-regulation of the gene encoding Necl-5 by the oncogene V12-Ki-Ras causes enhanced cell movement and proliferation. Upon cell-cell contact, de novo synthesis of Necl-5 exceedsmore » the rate of Necl-5 endocytosis, eventually resulting in a net increase in the amount of Necl-5 at the cell surface. In addition, expression of the gene encoding nectin-3 is markedly reduced in transformed cells. Thus, up-regulation of Necl-5 following transformation contributes to the loss of contact inhibition in transformed cells.« less

  3. Expression, immunogenicity and variation of iron-regulated surface protein A from bovine isolates of Staphylococcus aureus.

    PubMed

    Misra, Neha; Wines, Tyler F; Knopp, Colton L; McGuire, Mark A; Tinker, Juliette K

    2017-05-01

    Staphylococcus aureus iron-regulated surface protein A (IsdA) is a fibrinogen and fibronectin adhesin that also contributes to iron sequestration and resistance to innate immunity. IsdA is conserved in human isolates and has been investigated as a human vaccine candidate. Here we report the expression of isdA, the efficacy of anti-IsdA responses and the existence of IsdA sequence variants from bovine Staphylococcus. Clinical staphylococci were obtained from US dairy farms and assayed by PCR for the presence and expression of isdA. isdA-positive species from bovines included S. aureus, S. haemolyticus and S. chromogenes. Immunoassays on bovine milk and serum confirmed the induction and opsonophagocytic activity of anti-IsdA humoral responses. The variable region of isdA was sequenced and protein alignments predicted the presence of two main variants consistent with those from human S. aureus. Mouse antibodies against one IsdA variant reduced staphylococcal binding to fibronectin in vitro in an isotype-dependent manner. Purified IsdA variants bound distinctly to fibronectin and fibrinogen. Our findings demonstrate that variability within the C-terminus of this adhesin affects immune reactivity and binding specificity, but are consistent with the significance of IsdA in bovine disease and relevant for vaccine development. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Expression patterns of ERVWE1/Syncytin-1 and other placentally expressed human endogenous retroviruses along the malignant transformation process of hydatidiform moles.

    PubMed

    Bolze, Pierre-Adrien; Patrier, Sophie; Cheynet, Valérie; Oriol, Guy; Massardier, Jérôme; Hajri, Touria; Guillotte, Michèle; Bossus, Marc; Sanlaville, Damien; Golfier, François; Mallet, François

    2016-03-01

    Up to 20% of hydatidiform moles are followed by malignant transformation in gestational trophoblastic neoplasia and require chemotherapy. Syncytin-1 is involved in human placental morphogenesis and is also expressed in various cancers. We assessed the predictive value of the expression of Syncytin-1 and its interactants in the malignant transformation process of hydatidiform moles. Syncytin-1 glycoprotein was localized by immunohistochemistry in hydatidiform moles, gestational trophoblastic neoplasia and control placentas. The transcription levels of its locus ERVWE1, its interaction partners (hASCT1, hASCT2, TLR4 and DC-SIGN) and two loci (ERVFRDE1 and ERV3) involved the expression of other placental envelopes were assessed by real-time PCR. Syncytin-1 glycoprotein was expressed in syncytiotrophoblast of hydatidiform moles with an apical enhancement when compared with normal placentas. Moles with further malignant transformation had a higher staining intensity of Syncytin-1 surface unit C-terminus but the transcription level of its locus ERVWE1 was not different from that of moles with further remission and normal placentas. hASCT1 and TLR4, showed lower transcription levels in complete moles when compared to normal placentas. ERVWE1, ERVFRDE1 and ERV3 transcription was down-regulated in hydatidiform moles and gestational trophoblastic neoplasia. Variations of Syncytin-1 protein localization and down-regulation of hASCT1 and TLR4 transcription are likely to reflect altered functions of Syncytin-1 in the premalignant context of complete moles. The reduced transcription in gestational trophoblastic diseases of ERVWE1, ERVFRDE1 and ERV3, which expression during normal pregnancy is differentially regulated by promoter region methylation, suggest a joint dysregulation mechanism in malignant context. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. An RNA-binding protein, Qki5, regulates embryonic neural stem cells through pre-mRNA processing in cell adhesion signaling.

    PubMed

    Hayakawa-Yano, Yoshika; Suyama, Satoshi; Nogami, Masahiro; Yugami, Masato; Koya, Ikuko; Furukawa, Takako; Zhou, Li; Abe, Manabu; Sakimura, Kenji; Takebayashi, Hirohide; Nakanishi, Atsushi; Okano, Hideyuki; Yano, Masato

    2017-09-15

    Cell type-specific transcriptomes are enabled by the action of multiple regulators, which are frequently expressed within restricted tissue regions. In the present study, we identify one such regulator, Quaking 5 (Qki5), as an RNA-binding protein (RNABP) that is expressed in early embryonic neural stem cells and subsequently down-regulated during neurogenesis. mRNA sequencing analysis in neural stem cell culture indicates that Qki proteins play supporting roles in the neural stem cell transcriptome and various forms of mRNA processing that may result from regionally restricted expression and subcellular localization. Also, our in utero electroporation gain-of-function study suggests that the nuclear-type Qki isoform Qki5 supports the neural stem cell state. We next performed in vivo transcriptome-wide protein-RNA interaction mapping to search for direct targets of Qki5 and elucidate how Qki5 regulates neural stem cell function. Combined with our transcriptome analysis, this mapping analysis yielded a bona fide map of Qki5-RNA interaction at single-nucleotide resolution, the identification of 892 Qki5 direct target genes, and an accurate Qki5-dependent alternative splicing rule in the developing brain. Last, our target gene list provides the first compelling evidence that Qki5 is associated with specific biological events; namely, cell-cell adhesion. This prediction was confirmed by histological analysis of mice in which Qki proteins were genetically ablated, which revealed disruption of the apical surface of the lateral wall in the developing brain. These data collectively indicate that Qki5 regulates communication between neural stem cells by mediating numerous RNA processing events and suggest new links between splicing regulation and neural stem cell states. © 2017 Hayakawa-Yano et al.; Published by Cold Spring Harbor Laboratory Press.

  6. Immunohistochemical quantification of the cobalamin transport protein, cell surface receptor and Ki-67 in naturally occurring canine and feline malignant tumors and in adjacent normal tissues

    PubMed Central

    Sysel, Annette M.; Valli, Victor E.; Bauer, Joseph A.

    2015-01-01

    Cancer cells have an obligate need for cobalamin (vitamin B12) to enable DNA synthesis necessary for cellular replication. This study quantified the immunohistochemical expression of the cobalamin transport protein (transcobalamin II; TCII), cell surface receptor (transcobalamin II-R; TCII-R) and proliferation protein (Ki-67) in naturally occurring canine and feline malignant tumors, and compared these results to expression in corresponding adjacent normal tissues. All malignant tumor tissues stained positively for TCII, TCII-R and Ki-67 proteins; expression varied both within and between tumor types. Expression of TCII, TCII-R and Ki-67 was significantly higher in malignant tumor tissues than in corresponding adjacent normal tissues in both species. There was a strong correlation between TCII and TCII-R expression, and a modest correlation between TCII-R and Ki-67 expression in both species; a modest association between TCII and Ki-67 expression was present in canine tissues only. These results demonstrate a quantifiable, synchronous up-regulation of TCII and TCII-R expression by proliferating canine and feline malignant tumors. The potential to utilize these proteins as biomarkers to identify neoplastic tissues, streamline therapeutic options, evaluate response to anti-tumor therapy and monitor for recurrent disease has important implications in the advancement of cancer management for both human and companion animal patients. PMID:25633912

  7. Tumor Necrosis Factor-α– and Interleukin-1β–Dependent Matrix Metalloproteinase-3 Expression in Nucleus Pulposus Cells Requires Cooperative Signaling via Syndecan 4 and Mitogen-Activated Protein Kinase–NF-κB Axis

    PubMed Central

    Wang, Xin; Wang, Hua; Yang, Hao; Li, Jun; Cai, Qiqing; Shapiro, Irving M.; Risbud, Makarand V.

    2015-01-01

    Matrix metalloproteinase-3 (MMP-3) plays an important role in intervertebral disc degeneration, a ubiquitous condition closely linked to low back pain and disability. Elevated expression of syndecan 4, a cell surface heparan sulfate proteoglycan, actively controls disc matrix catabolism. However, the relationship between MMP-3 expression and syndecan 4 in the context of inflammatory disc disease has not been clearly defined. We investigated the mechanisms by which cytokines control MMP-3 expression in rat and human nucleus pulposus cells. Cytokine treatment increased MMP-3 expression and promoter activity. Stable silencing of syndecan 4 blocked cytokine-mediated MMP-3 expression; more important, syndecan 4 did not mediate its effects through NF-κB or mitogen-activated protein kinase (MAPK) pathways. However, treatment with MAPK and NF-κB inhibitors resulted in partial blocking of the inductive effect of cytokines on MMP-3 expression. Loss-of-function studies confirmed that NF-κB, p38α/β2/γ/δ, and extracellular signal–regulated kinase (ERK) 2, but not ERK1, contributed to cytokine-dependent induction of MMP3 promoter activity. Similarly, inhibitor treatments, lentiviral short hairpin-p65, and short hairpin-IκB kinase β significantly decreased cytokine-dependent up-regulation in MMP-3 expression. Finally, we show that transforming growth factor-β can block the up-regulation of MMP-3 induced by tumor necrosis factor (TNF)-α by counteracting the NF-κB pathway and syndecan 4 expression. Taken together, our results suggest that cooperative signaling through syndecan 4 and the TNF receptor 1–MAPK–NF-κB axis is required for TNF-α–dependent expression of MMP-3 in nucleus pulposus cells. Controlling these pathways may slow the progression of intervertebral disc degeneration and matrix catabolism. PMID:25063530

  8. H9N2 avian influenza virus enhances the immune responses of BMDCs by down-regulating miR29c.

    PubMed

    Lin, Jian; Xia, Jing; Chen, Ya T; Zhang, Ke Y; Zeng, Yan; Yang, Qian

    2017-02-01

    Avian influenza virus (AIV) of the subtypes H9 and N2 is well recognised and caused outbreaks-due to its high genetic variability and high rate of recombination with other influenza virus subtypes. The pathogenicity of H9N2 AIV depends on the host immune response. Dendritic cells (DCs) are major antigen presenting cells that can significantly inhibit H9N2 AIV replication. MicroRNAs (miRNAs) influence the ability of DCs to present antigens, as well as the ability of AIVs to infect host cells and replicate. Here, we studied the molecular mechanism underlying the miRNA-mediated regulation of immune function of mouse DCs. We first screened for and verified the induction of miRNAs in DCs after H9N2 AIVstimulation. We also constructed miR29c, miR339 and miR222 over-expression vector and showed that only the induction of miR29c lead to a hugely increased expression of surface marker MHCII and CD40. Whilst the inhibition of miR29c, miR339 and miR222 in mouse DCs would repressed the expression of DCs surface markers. Moreover, we found that miR29c stimulation not only up-regulate MHCII and CD40, but also enhance the ability of DCs to activate lymphocytes and secrete cytokines IL-6 or TNF-a. Furthermore, we found that Tarbp1 and Rfx7 were targeted and repressed by miR29c. Finally, we revealed that the inhibition of miR29c marvelously accelerated virus replication. Together, our data shed new light on the roles and mechanisms of miR29c in regulating DC function and suggest new strategies for combating AIVs. Copyright © 2016. Published by Elsevier Ltd.

  9. Chemoresistance induces enhanced adhesion and transendothelial penetration of neuroblastoma cells by down-regulating NCAM surface expression

    PubMed Central

    Blaheta, Roman A; Daher, Frederick H; Michaelis, Martin; Hasenberg, Christoph; Weich, Eva M; Jonas, Dietger; Kotchetkov, Rouslan; Doerr, Hans Willhelm; Cinatl, Jindrich

    2006-01-01

    Background Drug resistance to chemotherapy is often associated with increased malignancy in neuroblastoma (NB). One explanation for the link between resistance and malignancy might be that resistance facilitates cancer progression and invasion. To investigate this hypothesis, adhesion, transendothelial penetration and NCAM (CD56) adhesion receptor expression of drug-resistant versus drug-sensitive NB tumor cells were evaluated. Methods Acquired drug resistance was mimicked by exposing parental UKF-NB-2, UKF-NB-3 or IMR-32 tumor cells to increasing concentrations of vincristine- (VCR) or doxorubicin (DOX) to establish the resistant tumor cell sublines UKF-NB-2VCR, UKF-NB-2DOX, UKF-NB-3VCR, UKF-NB-3DOX, IMR-32VCR and IMR-32DOX. Additionally, the malignant behaviour of UKF-NB-4, which already possessed the intrinsic multidrug resistance (MDR) phenotype, was analyzed. UKF-NB-4 exposed to VCR or DOX were designated UKF-NB-4VCR or UKF-NB-4DOX. Combined phase contrast – reflection interference contrast microscopy was used to separately evaluate NB cell adhesion and penetration. NCAM was analyzed by flow cytometry, western blot and RT-PCR. Results VCR and DOX resistant tumor sublines showed enhanced adhesion and penetration capacity, compared to their drug naïve controls. Strongest effects were seen with UKF-NB-2VCR, UKF-NB-3VCR and IMR-32DOX. DOX or VCR treatment also evoked increased invasive behaviour of UKF-NB-4. The process of accelerated tumor invasion was accompanied by decreased NCAM surface and protein expression, and down-regulation of NCAM coding mRNA. Transfection of UKF-NB-4VCR cells with NCAM cDNA led to a significant receptor up-regulation, paralleled by diminished adhesion to an endothelial cell monolayer. Conclusion It is concluded that NB cells resistant to anticancer drugs acquire increased invasive capacity relative to non-resistant parental cells, and that enhanced invasion is caused by strong down-regulation of NCAM adhesion receptors. PMID:17181871

  10. CFTR, Mucins, and Mucus Obstruction in Cystic Fibrosis

    PubMed Central

    Kreda, Silvia M.; Davis, C. William; Rose, Mary Callaghan

    2012-01-01

    Mucus pathology in cystic fibrosis (CF) has been known for as long as the disease has been recognized and is sometimes called mucoviscidosis. The disease is marked by mucus hyperproduction and plugging in many organs, which are usually most fatal in the airways of CF patients, once the problem of meconium ileus at birth is resolved. After the CF gene, CFTR, was cloned and its protein product identified as a cAMP-regulated Cl− channel, causal mechanisms underlying the strong mucus phenotype of the disease became obscure. Here we focus on mucin genes and polymeric mucin glycoproteins, examining their regulation and potential relationships to a dysfunctional cystic fibrosis transmembrane conductance regulator (CFTR). Detailed examination of CFTR expression in organs and different cell types indicates that changes in CFTR expression do not always correlate with the severity of CF disease or mucus accumulation. Thus, the mucus hyperproduction that typifies CF does not appear to be a direct cause of a defective CFTR but, rather, to be a downstream consequence. In organs like the lung, up-regulation of mucin gene expression by inflammation results from chronic infection; however, in other instances and organs, the inflammation may have a non-infectious origin. The mucus plugging phenotype of the β-subunit of the epithelial Na+ channel (βENaC)-overexpressing mouse is proving to be an archetypal example of this kind of inflammation, with a dehydrated airway surface/concentrated mucus gel apparently providing the inflammatory stimulus. Data indicate that the luminal HCO3 − deficiency recently described for CF epithelia may also provide such a stimulus, perhaps by causing a mal-maturation of mucins as they are released onto luminal surfaces. In any event, the path between CFTR dysfunction and mucus hyperproduction has proven tortuous, and its unraveling continues to offer its own twists and turns, along with fascinating glimpses into biology. PMID:22951447

  11. Complement factor H: spatial and temporal expression and localization in the eye.

    PubMed

    Mandal, Md Nawajes A; Ayyagari, Radha

    2006-09-01

    Complement factor H (CFH) is a component of the mammalian complement system, which regulates the alternative pathway of complement activation and protects the host cell from inappropriate complement activation. CFH is a key regulator of innate immunity, and CFH deficiency leads to membranoproliferative glomerulonephritis type II. A variation in human CFH, Y402H, has been shown to be associated with an increased risk for age-related macular degeneration. The authors describe studies on the spatial and temporal expression of the CFH gene and localization of this protein in ocular tissues to gain insight into its role in the eye. CFH expression in human and mouse tissues was studied by quantitative RT-PCR and Western blot analysis, and localization of CFH was studied by immunohistochemical analysis followed by fluorescence microscopy. In human and mouse, CFH expression was found to be similar to the highest level of expression in the liver. In ocular tissue, CFH was detected in the distalmost optic nerve (3 mm) cut from the scleral surface of the eyeball, sclera, RPE-choroid, retina, lens, and ciliary body. In mouse, Cfh expression was observed from early embryonic stages, and in the eye its expression increased with age. A significant level of CFH expression is maintained in different ocular tissues during development and aging. Sustained high levels of CFH expression in eye tissues suggest that this protein may play a role in protecting these tissues from indiscriminate complement activation and inflammatory insult.

  12. Differential expression of E-cadherin at the surface of rat beta-cells as a marker of functional heterogeneity.

    PubMed

    Bosco, Domenico; Rouiller, Dominique G; Halban, Philippe A

    2007-07-01

    The aim of this study was to assess whether the expression of E-cadherin at the surface of rat beta-cells is regulated by insulin secretagogues and correlates with insulin secretion. When cultured under standard conditions, virtually all beta-cells expressed E-cadherin observed by immunofluorescence, but heterogeneous staining was observed. Using fluorescence-activated cell sorting (FACS), two beta-cell sub-populations were sorted: one that was poorly labeled ('ECad-low') and another that was highly labeled ('ECad-high'). After 1-h stimulation with 16.7 mM glucose, insulin secretion (reverse hemolytic plaque assay) from individual ECad-high beta-cells was higher than that from ECad-low beta-cells. Ca2+-dependent beta-cell aggregation was increased at 16.7 mM glucose when compared with 2.8 mM glucose. E-cadherin at the surface of beta-cells was increased after 18 h at 11.1 and 22.2 mM glucose when compared with 2.8 mM glucose, with the greatest increase at 22.2 mM glucose + 0.5 mM isobutylmethylxanthine (IBMX). While no labeling was detected on freshly trypsinized cells, the proportion of stained cells increased in a time-dependent manner during culture for 1, 3, and 24 h. This recovery was faster when cells were incubated at 16.7 vs 2.8 mM glucose. Cycloheximide inhibited expression of E-cadherin at 2.8 mM glucose, but not at 16.7 mM, while depolymerization of actin by either cytochalasin B or latrunculin B increased surface E-cadherin at low glucose. In conclusion, these results show that expression of E-cadherin at the surface of islet beta-cells is controlled by secretagogues including glucose, correlates with insulin secretion, and can serve as a surface marker of beta-cell function.

  13. Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System.

    PubMed

    Liao, Ting-Yu Angela; Lau, Alice; Joseph, Sunil; Hytönen, Vesa; Hmama, Zakaria

    2015-01-01

    Current strategies to improve the current BCG vaccine attempt to over-express genes encoding specific M. tuberculosis (Mtb) antigens and/or regulators of antigen presentation function, which indeed have the potential to reshape BCG in many ways. However, these approaches often face serious difficulties, in particular the efficiency and stability of gene expression via nucleic acid complementation and safety concerns associated with the introduction of exogenous DNA. As an alternative, we developed a novel non-genetic approach for rapid and efficient display of exogenous proteins on bacterial cell surface. The technology involves expression of proteins of interest in fusion with a mutant version of monomeric avidin that has the feature of reversible binding to biotin. Fusion proteins are then used to decorate the surface of biotinylated BCG. Surface coating of BCG with recombinant proteins was highly reproducible and stable. It also resisted to the freeze-drying shock routinely used in manufacturing conventional BCG. Modifications of BCG surface did not affect its growth in culture media neither its survival within the host cell. Macrophages phagocytized coated BCG bacteria, which efficiently delivered their surface cargo of avidin fusion proteins to MHC class I and class II antigen presentation compartments. Thereafter, chimeric proteins corresponding to a surrogate antigen derived from ovalbumin and the Mtb specific ESAT6 antigen were generated and tested for immunogenicity in vaccinated mice. We found that BCG displaying ovalbumin antigen induces an immune response with a magnitude similar to that induced by BCG genetically expressing the same surrogate antigen. We also found that BCG decorated with Mtb specific antigen ESAT6 successfully induces the expansion of specific T cell responses. This novel technology, therefore, represents a practical and effective alternative to DNA-based gene expression for upgrading the current BCG vaccine.

  14. Differential regulation of ROMK (Kir1.1) in distal nephron segments by dietary potassium.

    PubMed

    Wade, James B; Fang, Liang; Coleman, Richard A; Liu, Jie; Grimm, P Richard; Wang, Tong; Welling, Paul A

    2011-06-01

    ROMK channels are well-known to play a central role in renal K secretion, but the absence of highly specific and avid-ROMK antibodies has presented significant roadblocks toward mapping the extent of expression along the entire distal nephron and determining whether surface density of these channels is regulated in response to physiological stimuli. Here, we prepared new ROMK antibodies verified to be highly specific, using ROMK knockout mice as a control. Characterization with segmental markers revealed a more extensive pattern of ROMK expression along the entire distal nephron than previously thought, localizing to distal convoluted tubule regions, DCT1 and DCT2; the connecting tubule (CNT); and cortical collecting duct (CD). ROMK was diffusely distributed in intracellular compartments and at the apical membrane of each tubular region. Apical labeling was significantly increased by high-K diet in DCT2, CNT1, CNT2, and CD (P < 0.05) but not in DCT1. Consistent with the large increase in apical ROMK, dramatically increased mature glycosylation was observed following dietary potassium augmentation. We conclude 1) our new antibody provides a unique tool to characterize ROMK channel localization and expression and 2) high-K diet causes a large increase in apical expression of ROMK in DCT2, CNT, and CD but not in DCT1, indicating that different regulatory mechanisms are involved in K diet-regulated ROMK channel functions in the distal nephron.

  15. Regulation of bacterial virulence by Csr (Rsm) systems.

    PubMed

    Vakulskas, Christopher A; Potts, Anastasia H; Babitzke, Paul; Ahmer, Brian M M; Romeo, Tony

    2015-06-01

    Most bacterial pathogens have the remarkable ability to flourish in the external environment and in specialized host niches. This ability requires their metabolism, physiology, and virulence factors to be responsive to changes in their surroundings. It is no surprise that the underlying genetic circuitry that supports this adaptability is multilayered and exceedingly complex. Studies over the past 2 decades have established that the CsrA/RsmA proteins, global regulators of posttranscriptional gene expression, play important roles in the expression of virulence factors of numerous proteobacterial pathogens. To accomplish these tasks, CsrA binds to the 5' untranslated and/or early coding regions of mRNAs and alters translation, mRNA turnover, and/or transcript elongation. CsrA activity is regulated by noncoding small RNAs (sRNAs) that contain multiple CsrA binding sites, which permit them to sequester multiple CsrA homodimers away from mRNA targets. Environmental cues sensed by two-component signal transduction systems and other regulatory factors govern the expression of the CsrA-binding sRNAs and, ultimately, the effects of CsrA on secretion systems, surface molecules and biofilm formation, quorum sensing, motility, pigmentation, siderophore production, and phagocytic avoidance. This review presents the workings of the Csr system, the paradigm shift that it generated for understanding posttranscriptional regulation, and its roles in virulence networks of animal and plant pathogens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Regulation of Bacterial Virulence by Csr (Rsm) Systems

    PubMed Central

    Vakulskas, Christopher A.; Potts, Anastasia H.; Babitzke, Paul; Ahmer, Brian M. M.

    2015-01-01

    SUMMARY Most bacterial pathogens have the remarkable ability to flourish in the external environment and in specialized host niches. This ability requires their metabolism, physiology, and virulence factors to be responsive to changes in their surroundings. It is no surprise that the underlying genetic circuitry that supports this adaptability is multilayered and exceedingly complex. Studies over the past 2 decades have established that the CsrA/RsmA proteins, global regulators of posttranscriptional gene expression, play important roles in the expression of virulence factors of numerous proteobacterial pathogens. To accomplish these tasks, CsrA binds to the 5′ untranslated and/or early coding regions of mRNAs and alters translation, mRNA turnover, and/or transcript elongation. CsrA activity is regulated by noncoding small RNAs (sRNAs) that contain multiple CsrA binding sites, which permit them to sequester multiple CsrA homodimers away from mRNA targets. Environmental cues sensed by two-component signal transduction systems and other regulatory factors govern the expression of the CsrA-binding sRNAs and, ultimately, the effects of CsrA on secretion systems, surface molecules and biofilm formation, quorum sensing, motility, pigmentation, siderophore production, and phagocytic avoidance. This review presents the workings of the Csr system, the paradigm shift that it generated for understanding posttranscriptional regulation, and its roles in virulence networks of animal and plant pathogens. PMID:25833324

  17. Detailed expression profile of the six Glypicans and their modifying enzyme, Notum during chick limb and feather development.

    PubMed

    Saad, Kawakeb; Theis, Susanne; Otto, Anthony; Luke, Graham; Patel, Ketan

    2017-04-30

    The development of vertebrate appendages, especially the limb and feather buds are orchestrated by numerous secreted signalling molecules including Sonic Hedgehog, Bone Morphogenetic Proteins, Fibroblast Growth Factors and Wnts. These proteins coordinate the growth and patterning of ectodermal and mesenchymal cells. The influence of signalling molecules is affected over large distances by their concentration (morphogen activity) but also at local levels by the presence of proteins that either attenuate or promote their activity. Glypicans are cell surface molecules that regulate the activity of the major secreted signalling molecules expressed in the limb and feather bud. Here we investigated the expression of all Glypicans during chick limb and feather development. In addition we profiled the expression of Notum, an enzyme that regulates Glypican activity. We show that five of the six Glypicans and Notum are expressed in a dynamic manner during the development of limbs and feathers. We also investigated the expression of key Glypicans and show that they are controlled by signalling molecules highlighting the presence of feedback loops. Lastly we show that Glypicans and Notum are expressed in a tissue specific manner in adult chicken tissues. Our results strongly suggest that the Glypicans and Notum have many as yet undiscovered roles to play during the development of vertebrate appendages. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Wnt ligands from the embryonic surface ectoderm regulate ‘bimetallic strip’ optic cup morphogenesis in mouse

    PubMed Central

    Carpenter, April C.; Smith, April N.; Wagner, Heidi; Cohen-Tayar, Yamit; Rao, Sujata; Wallace, Valerie; Ashery-Padan, Ruth; Lang, Richard A.

    2015-01-01

    The Wnt/β-catenin response pathway is central to many developmental processes. Here, we assessed the role of Wnt signaling in early eye development using the mouse as a model system. We showed that the surface ectoderm region that includes the lens placode expressed 12 out of 19 possible Wnt ligands. When these activities were suppressed by conditional deletion of wntless (Le-cre; Wlsfl/fl) there were dramatic consequences that included a saucer-shaped optic cup, ventral coloboma, and a deficiency of periocular mesenchyme. This phenotype shared features with that produced when the Wnt/β-catenin pathway co-receptor Lrp6 is mutated or when retinoic acid (RA) signaling in the eye is compromised. Consistent with this, microarray and cell fate marker analysis identified a series of expression changes in genes known to be regulated by RA or by the Wnt/β-catenin pathway. Using pathway reporters, we showed that Wnt ligands from the surface ectoderm directly or indirectly elicit a Wnt/β-catenin response in retinal pigment epithelium (RPE) progenitors near the optic cup rim. In Le-cre; Wlsfl/fl mice, the numbers of RPE cells are reduced and this can explain, using the principle of the bimetallic strip, the curvature of the optic cup. These data thus establish a novel hypothesis to explain how differential cell numbers in a bilayered epithelium can lead to shape change. PMID:25715397

  19. A role for AT1 receptor-associated proteins in blood pressure regulation.

    PubMed

    Castrop, Hayo

    2015-04-01

    The renin angiotensin-system is one of the most important humoral regulators of blood pressure. The recently discovered angiotensin receptor-associated proteins serve as local modulators of the renin angiotensin-system. These proteins interact with the AT1 receptor in a tissue-specific manner and regulate the sensitivity of the target cell for angiotensin II. The predominant effect of the AT1 receptor-associated proteins on angiotensin II-induced signaling is the modulation of the surface expression of the AT1 receptor. This review provides an overview of our current knowledge with respect to the relevance of AT1 receptor-associated proteins for blood pressure regulation. Two aspects of blood pressure regulation will be discussed in detail: angiotensin II-dependent volume homoeostasis and vascular resistance. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. A2A adenosine receptor ligand binding and signalling is allosterically modulated by adenosine deaminase.

    PubMed

    Gracia, Eduard; Pérez-Capote, Kamil; Moreno, Estefanía; Barkešová, Jana; Mallol, Josefa; Lluís, Carme; Franco, Rafael; Cortés, Antoni; Casadó, Vicent; Canela, Enric I

    2011-05-01

    A2ARs (adenosine A2A receptors) are highly enriched in the striatum, which is the main motor control CNS (central nervous system) area. BRET (bioluminescence resonance energy transfer) assays showed that A2AR homomers may act as cell-surface ADA (adenosine deaminase; EC 3.5.4.4)-binding proteins. ADA binding affected the quaternary structure of A2ARs present on the cell surface. ADA binding to adenosine A2ARs increased both agonist and antagonist affinity on ligand binding to striatal membranes where these proteins are co-expressed. ADA also increased receptor-mediated ERK1/2 (extracellular-signal-regulated kinase 1/2) phosphorylation. Collectively, the results of the present study show that ADA, apart from regulating the concentration of extracellular adenosine, may behave as an allosteric modulator that markedly enhances ligand affinity and receptor function. This powerful regulation may have implications for the physiology and pharmacology of neuronal A2ARs.

  1. Cell Surface Expression of Human Ether-a-go-go-related Gene (hERG) Channels Is Regulated by Caveolin-3 Protein via the Ubiquitin Ligase Nedd4-2*

    PubMed Central

    Guo, Jun; Wang, Tingzhong; Li, Xian; Shallow, Heidi; Yang, Tonghua; Li, Wentao; Xu, Jianmin; Fridman, Michael D.; Yang, Xiaolong; Zhang, Shetuan

    2012-01-01

    The human ether-a-go-go-related gene (hERG) encodes the rapidly activating delayed rectifier potassium channel (IKr) which plays an important role in cardiac repolarization. A reduction or increase in hERG current can cause long or short QT syndrome, respectively, leading to fatal cardiac arrhythmias. The channel density in the plasma membrane is a key determinant of the whole cell current amplitude. To gain insight into the molecular mechanisms for the regulation of hERG density at the plasma membrane, we used whole cell voltage clamp, Western blotting, and immunocytochemical methods to investigate the effects of an integral membrane protein, caveolin-3 (Cav3) on hERG expression levels. Our data demonstrate that Cav3, hERG, and ubiquitin-ligase Nedd4-2 interact with each other and form a complex. Expression of Cav3 thus enhances the hERG-Nedd4-2 interaction, leading to an increased ubiquitination and degradation of mature, plasma-membrane localized hERG channels. Disrupting Nedd4-2 interaction with hERG by mutations eliminates the effects of Cav3 on hERG channels. Knockdown of endogenous Cav3 or Nedd4-2 in cultured neonatal rat ventricular myocytes using siRNA led to an increase in native IKr. Our data demonstrate that hERG expression in the plasma membrane is regulated by Cav3 via Nedd4-2. These findings extend our understanding of the regulation of hERG channels and cardiac electrophysiology. PMID:22879586

  2. Regulation of B cell functions by the sialic acid-binding receptors siglec-G and CD22.

    PubMed

    Jellusova, Julia; Nitschke, Lars

    2011-01-01

    B cell antigen receptor (BCR) engagement can lead to many different physiologic outcomes. To achieve an appropriate response, the BCR signal is interpreted in the context of other stimuli and several additional receptors on the B cell surface participate in the modulation of the signal. Two members of the Siglec (sialic acid-binding immunoglobulin-like lectin) family, CD22 and Siglec-G have been shown to inhibit the BCR signal. Recent findings indicate that the ability of these two receptors to bind sialic acids might be important to induce tolerance to self-antigens. Sialylated glycans are usually absent on microbes but abundant in higher vertebrates and might therefore provide an important tolerogenic signal. Since the expression of the specific ligands for Siglec-G and CD22 is tightly regulated and since Siglecs are not only able to bind their ligands in trans but also on the same cell surface this might provide additional mechanisms to control the BCR signal. Although both Siglec-G and CD22 are expressed on B cells and are able to inhibit BCR mediated signaling, they also show unique biological functions. While CD22 is the dominant regulator of calcium signaling on conventional B2 cells and also seems to play a role on marginal zone B cells, Siglec-G exerts its function mainly on B1 cells and influences their lifespan and antibody production. Both Siglec-G and CD22 have also recently been linked to toll-like receptor signaling and may provide a link in the regulation of the adaptive and innate immune response of B cells.

  3. Leucine Stimulates Insulin Secretion via Down-regulation of Surface Expression of Adrenergic α2A Receptor through the mTOR (Mammalian Target of Rapamycin) Pathway

    PubMed Central

    Yang, Jun; Dolinger, Michael; Ritaccio, Gabrielle; Mazurkiewicz, Joseph; Conti, David; Zhu, Xinjun; Huang, Yunfei

    2012-01-01

    The amino acid leucine is a potent secretagogue, capable of inducing insulin secretion. It also plays an important role in the regulation of mTOR activity, therefore, providing impetus to investigate if a leucine-sensing mechanism in the mTOR pathway is involved in insulin secretion. We found that leucine-induced insulin secretion was inhibited by both the mTOR inhibitor rapamycin as well as the adrenergic α2 receptor agonist clonidine. We also demonstrated that leucine down-regulated the surface expression of adrenergic α2A receptor via activation of the mTOR pathway. The leucine stimulatory effect on insulin secretion was attenuated in diabetic Goto-Kakizaki rats that overexpress adrenergic α2A receptors, confirming the role of leucine in insulin secretion. Thus, our data demonstrate that leucine regulates insulin secretion by modulating adrenergic α2 receptors through the mTOR pathway. The role of the mTOR pathway in metabolic homeostasis led us to a second important finding in this study; retrospective analysis of clinical data showed that co-administration of rapamycin and clonidine was associated with an increased incidence of new-onset diabetes in renal transplantation patients over those receiving rapamycin alone. We believe that inhibition of mTOR by rapamycin along with activation of adrenergic α2 receptors by clonidine represents a double-hit to pancreatic islets that synergistically disturbs glucose homeostasis. This new insight may have important implications for the clinical management of renal transplant patients. PMID:22645144

  4. Organization and PprB-dependent control of the Pseudomonas aeruginosa tad Locus, involved in Flp pilus biology.

    PubMed

    Bernard, Christophe S; Bordi, Christophe; Termine, Elise; Filloux, Alain; de Bentzmann, Sophie

    2009-03-01

    Bacterial attachment to the substratum involves several cell surface organelles, including various types of pili. The Pseudomonas aeruginosa Tad machine assembles type IVb pili, which are required for adhesion to abiotic surfaces and to eukaryotic cells. Type IVb pili consist of a major subunit, the Flp pilin, processed by the FppA prepilin peptidase. In this study, we investigated the regulatory mechanism of the tad locus. We showed that the flp gene is expressed late in the stationary growth phase in aerobic conditions. We also showed that the tad locus was composed of five independent transcriptional units. We used transcriptional fusions to show that tad gene expression was positively controlled by the PprB response regulator. We subsequently showed that PprB bound to the promoter regions, directly controlling the expression of these genes. We then evaluated the contribution of two genes, tadF and rcpC, to type IVb pilus assembly. The deletion of these two genes had no effect on Flp production, pilus assembly, or Flp-mediated adhesion to abiotic surfaces in our conditions. However, our results suggest that the putative RcpC protein modifies the Flp pilin, thereby promoting Flp-dependent adhesion to eukaryotic cells.

  5. Development of the Astyanax mexicanus circadian clock and non-visual light responses.

    PubMed

    Frøland Steindal, Inga A; Beale, Andrew D; Yamamoto, Yoshiyuki; Whitmore, David

    2018-06-23

    Most animals and plants live on the planet exposed to periods of rhythmic light and dark. As such, they have evolved endogenous circadian clocks to regulate their physiology rhythmically, and non-visual light detection mechanisms to set the clock to the environmental light-dark cycle. In the case of fish, circadian pacemakers are not only present in the majority of tissues and cells, but these tissues are themselves directly light-sensitive, expressing a wide range of opsin photopigments. This broad non-visual light sensitivity exists to set the clock, but also impacts a wide range of fundamental cell biological processes, such as DNA repair regulation. In this context, Astyanax mexicanus is a very intriguing model system with which to explore non-visual light detection and circadian clock function. Previous work has shown that surface fish possess the same directly light entrainable circadian clocks, described above. The same is true for cave strains of Astyanax in the laboratory, though no daily rhythms have been observed under natural dark conditions in Mexico. There are, however, clear alterations in the cave strain light response and changes to the circadian clock, with a difference in phase of peak gene expression and a reduction in amplitude. In this study, we expand these early observations by exploring the development of non-visual light sensitivity and clock function between surface and cave populations. When does the circadian pacemaker begin to oscillate during development, and are there differences between the various strains? Is the difference in acute light sensitivity, seen in adults, apparent from the earliest stages of development? Our results show that both cave and surface populations must experience daily light exposure to establish a larval gene expression rhythm. These oscillations begin early, around the third day of development in all strains, but gene expression rhythms show a significantly higher amplitude in surface fish larvae. In addition, the light induction of clock genes is developmentally delayed in cave populations. Zebrafish embryonic light sensitivity has been shown to be critical not only for clock entrainment, but also for transcriptional activation of DNA repair processes. Similar downstream transcriptional responses to light also occur in Astyanax. Interestingly, the establishment of the adult timing profile of clock gene expression takes several days to become apparent. This fact may provide mechanistic insight into the key differences between the cave and surface fish clock mechanisms. Copyright © 2018. Published by Elsevier Inc.

  6. PPE57 induces activation of macrophages and drives Th1-type immune responses through TLR2.

    PubMed

    Xu, Ying; Yang, Enzhuo; Huang, Qi; Ni, Wenwen; Kong, Cong; Liu, Guoyuan; Li, Guanghua; Su, Haibo; Wang, Honghai

    2015-06-01

    Proline-glutamic acid (PE) and proline-proline-glutamic acid (PPE) are related proteins exclusive to Mycobacteria that play diverse roles in modulating critical innate immune pathways. In this study, we observed that the PPE57 protein is associated with the cell wall and is exposed on the cell surface. PPE57 enhances Mycobacterium spp. entering into macrophages and plays a role in macrophage phagocytosis. To explore the underlying mechanism, we demonstrated that PPE57 is able to recognise Toll-like receptor 2 (TLR2) and further induce macrophage activation by augmenting the expression of several cell surface molecules (CD40, CD80, CD86 and MHC class II) and pro-inflammatory cytokines (TNF-α, IL-6 and IL-12p40) within macrophages. These molecules are involved in the mitogen-activated protein kinase (MAPK) and nuclear factor κB (NF-κB) signalling pathways. We demonstrated that PPE57 effectively polarises T cells to secrete interferon (IFN)-γ and IL-2 and to up-regulate CXCR3 expression in vivo and in vitro, suggesting that this protein may contribute to Th1 polarisation during the immune response. Moreover, recombinant Bacillus Calmette-Guérin (BCG) over-expressing PPE57 could provide better protective efficacy against Mycobacterium tuberculosis challenge compared with BCG. Taken together, our data provides several pieces of evidence that PPE57 may regulate innate and adaptive immunity by interacting with TLR2. These findings indicate that PPE57 protein is a potential antigen for the rational design of an efficient vaccine against M. tuberculosis. PPE57 is located on the cell surface and enhances mycobacterium entry into macrophage. PPE57 interacts directly with TLR2 on macrophages. PPE57 plays a key role in the activation of macrophages in a TLR2-dependent manner. PPE57 induces a Th1 immune response via TLR2-mediated macrophage functions. Recombinant BCG over-expressing PPE57 could improve protective efficacy against M. tuberculosis.

  7. Neural precursor cell-expressed developmentally down-regulated protein 4-2 (Nedd4-2) regulation by 14-3-3 protein binding at canonical serum and glucocorticoid kinase 1 (SGK1) phosphorylation sites.

    PubMed

    Chandran, Sindhu; Li, Hui; Dong, Wuxing; Krasinska, Karolina; Adams, Chris; Alexandrova, Ludmila; Chien, Allis; Hallows, Kenneth R; Bhalla, Vivek

    2011-10-28

    Regulation of epithelial Na(+) channel (ENaC)-mediated transport in the distal nephron is a critical determinant of blood pressure in humans. Aldosterone via serum and glucocorticoid kinase 1 (SGK1) stimulates ENaC by phosphorylation of the E3 ubiquitin ligase Nedd4-2, which induces interaction with 14-3-3 proteins. However, the mechanisms of SGK1- and 14-3-3-mediated regulation of Nedd4-2 are unclear. There are three canonical SGK1 target sites on Nedd4-2 that overlap phosphorylation-dependent 14-3-3 interaction motifs. Two of these are termed "minor," and one is termed "major," based on weak or strong binding to 14-3-3 proteins, respectively. By mass spectrometry, we found that aldosterone significantly stimulates phosphorylation of a minor, relative to the major, 14-3-3 binding site on Nedd4-2. Phosphorylation-deficient minor site Nedd4-2 mutants bound less 14-3-3 than did wild-type (WT) Nedd4-2, and minor site Nedd4-2 mutations were sufficient to inhibit SGK1 stimulation of ENaC cell surface expression. As measured by pulse-chase and cycloheximide chase assays, a major binding site Nedd4-2 mutant had a shorter cellular half-life than WT Nedd4-2, but this property was not dependent on binding to 14-3-3. Additionally, a dimerization-deficient 14-3-3ε mutant failed to bind Nedd4-2. We conclude that whereas phosphorylation at the Nedd4-2 major site is important for interaction with 14-3-3 dimers, minor site phosphorylation by SGK1 may be the relevant molecular switch that stabilizes Nedd4-2 interaction with 14-3-3 and thus promotes ENaC cell surface expression. We also propose that major site phosphorylation promotes cellular Nedd4-2 protein stability, which potentially represents a novel form of regulation for turnover of E3 ubiquitin ligases.

  8. Expression of Inflammation-related Intercellular Adhesion Molecules in Cardiomyocytes In Vitro and Modulation by Pro-inflammatory Agents.

    PubMed

    El-Battrawy, Ibrahim; Tülümen, Erol; Lang, Siegfried; Akin, Ibrahim; Behnes, Michael; Zhou, Xiabo; Mavany, Martin; Bugert, Peter; Bieback, Karen; Borggrefe, Martin; Elmas, Elif

    2016-01-01

    Cell-surface adhesion molecules regulate multiple intercellular and intracellular processes and play important roles in inflammation by facilitating leukocyte endothelial transmigration. Whether cardiomyocytes express surface-adhesion molecules related to inflammation and the effect of pro-inflammatory mediators remain unknown. In the present study, the expression of different cell-adhesion molecules (CD11a, CD11b, CD31, CD62P, CD162, F11 receptor and mucosal vascular addressin cell adhesion molecule 1 (MADCAM1)) and the effect of pro-inflammatory mediators were investigated in an in vitro model of human cardiomyocytes. Cells were supplied as a primary culture of cardiac alpha actin-positive cells from human heart tissue. The cells were incubated for 24 h with 1 U/ml thrombin or 700 ng/ml lipopolysaccharide (LPS) or with a combination of both. The expression of the cell adhesion molecules was measured by flow cytometry. In cultured human cardiomyocytes, 22.8% of cells expressed CD31, 7.1% MADCAM1 and 2.6% F11R. CD11a, CD11b, CD62P and CD162 were expressed by fewer than 2% of the cells at baseline. CD31 expression increased on incubation of cardiomyocytes with thrombin by 26% (p<0.05) and with LPS by 26% (p=0.06). The combination of thrombin and LPS did not result in increased levels of CD31 (p>0.10). The pro-inflammatory agents LPS and thrombin had no effect on the expression of MADCAM1 and F11R. Inflammation-related cell-adhesion molecules CD31, MADCAM1 and F11R were shown to be expressed on the surface of human cardiomyocytes in an in vitro model. Incubation with LPS or thrombin resulted in increased expression of CD31, however, it did not modify the expression of the cell adhesion molecules MADCAM1 and F11R. Copyright © 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  9. The Pseudomonas aeruginosa ribbon-helix-helix DNA-binding protein AlgZ (AmrZ) controls twitching motility and biogenesis of type IV pili.

    PubMed

    Baynham, Patricia J; Ramsey, Deborah M; Gvozdyev, Borys V; Cordonnier, Ellen M; Wozniak, Daniel J

    2006-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that is commonly found in water and soil. In order to colonize surfaces with low water content, P. aeruginosa utilizes a flagellum-independent form of locomotion called twitching motility, which is dependent upon the extension and retraction of type IV pili. This study demonstrates that AlgZ, previously identified as a DNA-binding protein absolutely required for transcription of the alginate biosynthetic operon, is required for twitching motility. AlgZ may be required for the biogenesis or function of type IV pili in twitching motility. Transmission electron microscopy analysis of an algZ deletion in nonmucoid PAO1 failed to detect surface pili. To examine expression and localization of PilA (the major pilin subunit), whole-cell extracts and cell surface pilin preparations were analyzed by Western blotting. While the PilA levels present in whole-cell extracts were similar for wild-type P. aeruginosa and P. aeruginosa with the algZ deletion, the amount of PilA on the surface of the cells was drastically reduced in the algZ mutant. Analysis of algZ and algD mutants indicates that the DNA-binding activity of AlgZ is essential for the regulation of twitching motility and that this is independent of the role of AlgZ in alginate expression. These data show that AlgZ DNA-binding activity is required for twitching motility independently of its role in alginate production and that this involves the surface localization of type IV pili. Given this new role in twitching motility, we propose that algZ (PA3385) be designated amrZ (alginate and motility regulator Z).

  10. Incorporation of cerium oxide into hydroxyapatite coating regulates osteogenic activity of mesenchymal stem cell and macrophage polarization.

    PubMed

    Li, Kai; Shen, Qingyi; Xie, Youtao; You, Mingyu; Huang, Liping; Zheng, Xuebin

    2017-02-01

    Biomedical coatings for orthopedic implants should facilitate osseointegration and mitigate implant-induced inflammatory reactions. Cerium oxide (CeO 2 ) ceramics possess anti-oxidative properties and can be used to decrease mediators of inflammation, which makes them attractive for biomedical applications. In our work, two kinds of CeO 2 incorporated hydroxyapatite coatings (HA-10Ce and HA-30Ce) were prepared via plasma spraying technique and the effects of CeO 2 addition on the responses of bone mesenchymal stem cells (BMSCs) and RAW264.7 macrophages were investigated. An increase in CeO 2 content in the HA coatings resulted in better osteogenic behaviors of BMSCs in terms of cell proliferation, alkaline phosphatase (ALP) activity and mineralized nodule formation. RT-PCR and western blot analysis suggested that the incorporation of CeO 2 may promote the osteogenic differentiation of BMSCs through the Smad-dependent BMP signaling pathway, which activated Runx2 expression and subsequently enhanced the expression of ALP and OCN. The expression profiles of macrophages cultured on the CeO 2 modified coating revealed a tendency toward a M2 phenotype, because of an upregulation of M2 surface markers (CD163 and CD206), anti-inflammatory cytokines (TNF-α and IL-6) and osteoblastogenesis-related genes (BMP2 and TGF-β1) as well as a downregulation of M1 surface markers (CCR7 and CD11c), proinflammatory cytokines (IL-10 and IL-1ra) and reactive oxygen species production. The results suggested the regulation of BMSCs behaviors and macrophage-mediated responses at the coating's surface were associated with CeO 2 incorporation. The incorporation of CeO 2 in HA coatings can be a valuable strategy to promote osteogenic responses and reduce inflammatory reactions.

  11. Identification of a novel loss-of-function PHEX mutation, Ala720Ser, in a sporadic case of adult-onset hypophosphatemic osteomalacia.

    PubMed

    Goljanek-Whysall, Katarzyna; Tridimas, Andreas; McCormick, Rachel; Russell, Nicki-Jayne; Sloman, Melissa; Sorani, Alan; Fraser, William D; Hannan, Fadil M

    2018-01-01

    Adults presenting with sporadic hypophosphatemia and elevations in circulating fibroblast growth factor-23 (FGF23) concentrations are usually investigated for an acquired disorder of FGF23 excess such as tumor induced osteomalacia (TIO). However, in some cases the underlying tumor is not detected, and such patients may harbor other causes of FGF23 excess. Indeed, coding-region and 3'UTR mutations of phosphate-regulating neutral endopeptidase (PHEX), which encodes a cell-surface protein that regulates circulating FGF23 concentrations, can lead to alterations in phosphate homeostasis, which are not detected until adulthood. Here, we report an adult female who presented with hypophosphatemic osteomalacia and raised serum FGF23 concentrations. The patient and her parents, who were her only first-degree relatives, had no history of rickets. The patient was thus suspected of having TIO. However, no tumor had been identified following extensive localization studies. Mutational analysis of the PHEX coding-region and 3'UTR was undertaken, and this revealed the patient to be heterozygous for a novel germline PHEX mutation (c.2158G>T; p.Ala720Ser). In vitro studies involving the expression of WT and mutant PHEX proteins in HEK293 cells demonstrated the Ala720Ser mutation to impair trafficking of PHEX, with ~20% of the mutant protein being expressed at the cell surface, compared to ~80% cell surface expression for WT PHEX (p<0.05). Thus, our studies have identified a pathogenic PHEX mutation in a sporadic case of adult-onset hypophosphatemic osteomalacia, and these findings highlight a role for PHEX gene analysis in some cases of suspected TIO, particularly when no tumor has been identified. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. The cytoplasmic domain of the gamete membrane fusion protein HAP2 targets the protein to the fusion site in Chlamydomonas and regulates the fusion reaction.

    PubMed

    Liu, Yanjie; Pei, Jimin; Grishin, Nick; Snell, William J

    2015-03-01

    Cell-cell fusion between gametes is a defining step during development of eukaryotes, yet we know little about the cellular and molecular mechanisms of the gamete membrane fusion reaction. HAP2 is the sole gamete-specific protein in any system that is broadly conserved and shown by gene disruption to be essential for gamete fusion. The wide evolutionary distribution of HAP2 (also known as GCS1) indicates it was present in the last eukaryotic common ancestor and, therefore, dissecting its molecular properties should provide new insights into fundamental features of fertilization. HAP2 acts at a step after membrane adhesion, presumably directly in the merger of the lipid bilayers. Here, we use the unicellular alga Chlamydomonas to characterize contributions of key regions of HAP2 to protein location and function. We report that mutation of three strongly conserved residues in the ectodomain has no effect on targeting or fusion, although short deletions that include those residues block surface expression and fusion. Furthermore, HAP2 lacking a 237-residue segment of the cytoplasmic region is expressed at the cell surface, but fails to localize at the apical membrane patch specialized for fusion and fails to rescue fusion. Finally, we provide evidence that the ancient HAP2 contained a juxta-membrane, multi-cysteine motif in its cytoplasmic region, and that mutation of a cysteine dyad in this motif preserves protein localization, but substantially impairs HAP2 fusion activity. Thus, the ectodomain of HAP2 is essential for its surface expression, and the cytoplasmic region targets HAP2 to the site of fusion and regulates the fusion reaction. © 2015. Published by The Company of Biologists Ltd.

  13. Reduced caveolin-1 promotes hyper-inflammation due to abnormal heme oxygenase-1 localizationin LPS challenged macrophages with dysfunctional CFTR

    PubMed Central

    Zhang, Ping-Xia; Murray, Thomas S.; Villella, Valeria Rachela; Ferrari, Eleonora; Esposito, Speranza; D'Souza, Anthony; Raia, Valeria; Maiuri, Luigi; Krause, Diane S.; Egan, Marie E.; Bruscia, Emanuela M.

    2013-01-01

    We have previously reported that TLR4 signaling is increased in lipopolysaccharide (LPS) -stimulated Cystic Fibrosis (CF) macrophages (MΦs), contributing to the robust production of pro-inflammatory cytokines. The heme oxygenase (HO-1)/carbon monoxide (CO) pathway modulates cellular redox status, inflammatory responses, and cell survival. The HO-1 enzyme, together with the scaffold protein caveolin 1 (CAV-1), also acts as a negative regulator of TLR4 signaling in MΦs. Here, we demonstrate that in LPS-challenged CF MΦs, HO-1 does not compartmentalize normally to the cell surface and instead accumulates intracellularly. The abnormal HO-1 localization in CF MΦs in response to LPS is due to decreased CAV-1 expression, which is controlled by the cellular oxidative state, and is required for HO-1 delivery to the cell surface. Overexpression of HO-1 or stimulating the pathway with CO-releasing molecules (CORM2)enhancesCAV-1 expression in CF MΦs, suggesting a positive-feed forward loop between HO-1/CO induction and CAV-1 expression. These manipulations reestablished HO-1 and CAV-1 cell surface localization in CF MΦ's. Consistent with restoration of HO-1/CAV-1 negative regulation of TLR4 signaling, genetic or pharmacological (CORM2)-induced enhancement of this pathway decreased the inflammatory response of CF MΦs and CF mice treated with LPS. In conclusion, our results demonstrate that the counter-regulatory HO-1/CO pathway, which is critical in balancing and limiting the inflammatory response, is defective in CF MΦs through a CAV-1-dependent mechanism, exacerbating the CF MΦ's response to LPS. This pathway could be a potential target for therapeutic intervention for CF lung disease. PMID:23606537

  14. Deletion of Rab GAP AS160 modifies glucose uptake and GLUT4 translocation in primary skeletal muscles and adipocytes and impairs glucose homeostasis.

    PubMed

    Lansey, Melissa N; Walker, Natalie N; Hargett, Stefan R; Stevens, Joseph R; Keller, Susanna R

    2012-11-15

    Tight control of glucose uptake in skeletal muscles and adipocytes is crucial to glucose homeostasis and is mediated by regulating glucose transporter GLUT4 subcellular distribution. In cultured cells, Rab GAP AS160 controls GLUT4 intracellular retention and release to the cell surface and consequently regulates glucose uptake into cells. To determine AS160 function in GLUT4 trafficking in primary skeletal muscles and adipocytes and investigate its role in glucose homeostasis, we characterized AS160 knockout (AS160(-/-)) mice. We observed increased and normal basal glucose uptake in isolated AS160(-/-) adipocytes and soleus, respectively, while insulin-stimulated glucose uptake was impaired and GLUT4 expression decreased in both. No such abnormalities were found in isolated AS160(-/-) extensor digitorum longus muscles. In plasma membranes isolated from AS160(-/-) adipose tissue and gastrocnemius/quadriceps, relative GLUT4 levels were increased under basal conditions and remained the same after insulin treatment. Concomitantly, relative levels of cell surface-exposed GLUT4, determined with a glucose transporter photoaffinity label, were increased in AS160(-/-) adipocytes and normal in AS160(-/-) soleus under basal conditions. Insulin augmented cell surface-exposed GLUT4 in both. These observations suggest that AS160 is essential for GLUT4 intracellular retention and regulation of glucose uptake in adipocytes and skeletal muscles in which it is normally expressed. In vivo studies revealed impaired insulin tolerance in the presence of normal (male) and impaired (female) glucose tolerance. Concurrently, insulin-elicited increases in glucose disposal were abolished in all AS160(-/-) skeletal muscles and liver but not in AS160(-/-) adipose tissues. This suggests AS160 as a target for differential manipulation of glucose homeostasis.

  15. Cellular and Molecular Biology of Airway Mucins

    PubMed Central

    Lillehoj, Erik P.; Kato, Kosuke; Lu, Wenju; Kim, Kwang C.

    2017-01-01

    Airway mucus constitutes a thin layer of airway surface liquid with component macromolecules that covers the luminal surface of the respiratory tract. The major function of mucus is to protect the lungs through mucociliary clearance of inhaled foreign particles and noxious chemicals. Mucus is comprised of water, ions, mucin glycoproteins, and a variety of other macromolecules, some of which possess anti-microbial, anti-protease, and anti-oxidant activities. Mucins comprise the major protein component of mucus and exist as secreted and cell-associated glycoproteins. Secreted, gel-forming mucins are mainly responsible for the viscoelastic property of mucus, which is crucial for effective mucociliary clearance. Cell-associated mucins shield the epithelial surface from pathogens through their extracellular domains and regulate intracellular signaling through their cytoplasmic regions. However, neither the exact structures of mucin glycoproteins, nor the manner through which their expression is regulated, are completely understood. This chapter reviews what is currently known about the cellular and molecular properties of airway mucins. PMID:23445810

  16. Cranial neural crest recycle surface integrins in a substratum-dependent manner to promote rapid motility.

    PubMed

    Strachan, Lauren R; Condic, Maureen L

    2004-11-08

    Cell migration is essential for proper development of numerous structures derived from embryonic neural crest cells (NCCs). Although the migratory pathways of NCCs have been determined, the molecular mechanisms regulating NCC motility remain unclear. NCC migration is integrin dependent, and recent work has shown that surface expression levels of particular integrin alpha subunits are important determinants of NCC motility in vitro. Here, we provide evidence that rapid cranial NCC motility on laminin requires integrin recycling. NCCs showed both ligand- and receptor-specific integrin regulation in vitro. On laminin, NCCs accumulated internalized laminin but not fibronectin receptors over 20 min, whereas on fibronectin neither type of receptor accumulated internally beyond 2 min. Internalized laminin receptors colocalized with receptor recycling vesicles and were subsequently recycled back to the cell surface. Blocking receptor recycling with bafilomycin A inhibited NCC motility on laminin, indicating that substratum-dependent integrin recycling is essential for rapid cranial neural crest migration.

  17. Differential effect of rebamipide on transmembrane mucin biosynthesis in stratified ocular surface epithelial cells.

    PubMed

    Uchino, Yuichi; Woodward, Ashley M; Argüeso, Pablo

    2016-12-01

    Mucins are a group of highly glycosylated glycoproteins responsible for the protection of wet-surfaced epithelia. Recent data indicate that transmembrane mucins differ in their contribution to the protective function of the ocular surface, with MUC16 being the most effective barrier on the apical surface glycocalyx. Here, we investigated the role of the mucoprotective drug rebamipide in the regulation of transmembrane mucin biosynthesis using stratified cultures of human corneal and conjunctival epithelial cells. We find that the addition of rebamipide to corneal, but not conjunctival, epithelial cells increased MUC16 protein biosynthesis. Rebamipide did not affect the levels of MUC1, 4 and 20 compared to control. In these experiments, rebamipide had no effect on the expression levels of Notch intracellular domains, suggesting that the rebamipide-induced increase in MUC16 biosynthesis in differentiated corneal cultures is not regulated by Notch signaling. Overall these findings indicate that rebamipide induces the differential upregulation of MUC16 in stratified cultures of human corneal epithelial cells, which may have implications to the proper restoration of barrier function in ocular surface disease. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Synergistic responses of superficial chemistry and micro topography of titanium created by wire-type electric discharge machining.

    PubMed

    Kataoka, Yu; Tamaki, Yukimichi; Miyazaki, Takashi

    2011-01-01

    Wire-type electric discharge machining has been applied to the manufacture of endosseous titanium implants as this computer associated technique allows extremely accurate complex sample shaping with an optimal micro textured surface during the processing. Since the titanium oxide layer is sensitively altered by each processing, the authors hypothesized that this technique also up-regulates biological responses through the synergistic effects of the superficial chemistry and micro topography. To evaluate the respective in vitro cellular responses on the superficial chemistry and micro topography of titanium surface processed by wire-type electric discharge, we used titanium-coated epoxy resin replica of the surface. An oxide layer on the titanium surface processed by wire-type electric discharge activated the initial responses of osteoblastic cells through an integrin-mediated mechanism. Since the mRNA expression of ALP on those replicas was up-regulated compared to smooth titanium samples, the micro topography of a titanium surface processed by wire-type electric discharge promotes the osteogenic potential of cells. The synergistic response of the superficial chemistry and micro topography of titanium processed by wire-type electric discharge was demonstrated in this study.

  19. Epigenetic suppression of neprilysin regulates breast cancer invasion

    PubMed Central

    Stephen, H M; Khoury, R J; Majmudar, P R; Blaylock, T; Hawkins, K; Salama, M S; Scott, M D; Cosminsky, B; Utreja, N K; Britt, J; Conway, R E

    2016-01-01

    In women, invasive breast cancer is the second most common cancer and the second cause of cancer-related death. Therefore, identifying novel regulators of breast cancer invasion could lead to additional biomarkers and therapeutic targets. Neprilysin, a cell-surface enzyme that cleaves and inactivates a number of substrates including endothelin-1 (ET1), has been implicated in breast cancer, but whether neprilysin promotes or inhibits breast cancer cell progression and metastasis is unclear. Here, we asked whether neprilysin expression predicts and functionally regulates breast cancer cell invasion. RT–PCR and flow cytometry analysis of MDA-MB-231 and MCF-7 breast cancer cell lines revealed decreased neprilysin expression compared with normal epithelial cells. Expression was also suppressed in invasive ductal carcinoma (IDC) compared with normal tissue. In addition, in vtro invasion assays demonstrated that neprilysin overexpression decreased breast cancer cell invasion, whereas neprilysin suppression augmented invasion. Furthermore, inhibiting neprilysin in MCF-7 breast cancer cells increased ET1 levels significantly, whereas overexpressing neprilysin decreased extracellular-signal related kinase (ERK) activation, indicating that neprilysin negatively regulates ET1-induced activation of mitogen-activated protein kinase (MAPK) signaling. To determine whether neprilysin was epigenetically suppressed in breast cancer, we performed bisulfite conversion analysis of breast cancer cells and clinical tumor samples. We found that the neprilysin promoter was hypermethylated in breast cancer; chemical reversal of methylation in MDA-MB-231 cells reactivated neprilysin expression and inhibited cancer cell invasion. Analysis of cancer databases revealed that neprilysin methylation significantly associates with survival in stage I IDC and estrogen receptor-negative breast cancer subtypes. These results demonstrate that neprilysin negatively regulates the ET axis in breast cancer, and epigenetic suppression of neprilysin in invasive breast cancer cells enables invasion. Together, this implicates neprilysin as an important regulator of breast cancer invasion and clarifies its utility as a potential biomarker for invasive breast cancer. PMID:26950599

  20. Epigenetic suppression of neprilysin regulates breast cancer invasion.

    PubMed

    Stephen, H M; Khoury, R J; Majmudar, P R; Blaylock, T; Hawkins, K; Salama, M S; Scott, M D; Cosminsky, B; Utreja, N K; Britt, J; Conway, R E

    2016-03-07

    In women, invasive breast cancer is the second most common cancer and the second cause of cancer-related death. Therefore, identifying novel regulators of breast cancer invasion could lead to additional biomarkers and therapeutic targets. Neprilysin, a cell-surface enzyme that cleaves and inactivates a number of substrates including endothelin-1 (ET1), has been implicated in breast cancer, but whether neprilysin promotes or inhibits breast cancer cell progression and metastasis is unclear. Here, we asked whether neprilysin expression predicts and functionally regulates breast cancer cell invasion. RT-PCR and flow cytometry analysis of MDA-MB-231 and MCF-7 breast cancer cell lines revealed decreased neprilysin expression compared with normal epithelial cells. Expression was also suppressed in invasive ductal carcinoma (IDC) compared with normal tissue. In addition, in vtro invasion assays demonstrated that neprilysin overexpression decreased breast cancer cell invasion, whereas neprilysin suppression augmented invasion. Furthermore, inhibiting neprilysin in MCF-7 breast cancer cells increased ET1 levels significantly, whereas overexpressing neprilysin decreased extracellular-signal related kinase (ERK) activation, indicating that neprilysin negatively regulates ET1-induced activation of mitogen-activated protein kinase (MAPK) signaling. To determine whether neprilysin was epigenetically suppressed in breast cancer, we performed bisulfite conversion analysis of breast cancer cells and clinical tumor samples. We found that the neprilysin promoter was hypermethylated in breast cancer; chemical reversal of methylation in MDA-MB-231 cells reactivated neprilysin expression and inhibited cancer cell invasion. Analysis of cancer databases revealed that neprilysin methylation significantly associates with survival in stage I IDC and estrogen receptor-negative breast cancer subtypes. These results demonstrate that neprilysin negatively regulates the ET axis in breast cancer, and epigenetic suppression of neprilysin in invasive breast cancer cells enables invasion. Together, this implicates neprilysin as an important regulator of breast cancer invasion and clarifies its utility as a potential biomarker for invasive breast cancer.

  1. Potentiation of angiogenic switch in capillary endothelial cells by cAMP: A cross-talk between up-regulated LLO biosynthesis and the HSP-70 expression.

    PubMed

    Martínez, Juan A; Tavárez, José J; Oliveira, Caroline M; Banerjee, Dipak K

    2006-05-01

    During tumor growth and invasion, the endothelial cells from a relatively quiescent endothelium start proliferating. The exact mechanism of switching to a new angiogenic phenotype is currently unknown. We have examined the role of intracellular cAMP in this process. When a non-transformed capillary endothelial cell line was treated with 2 mM 8Br-cAMP, cell proliferation was enhanced by approximately 70%. Cellular morphology indicated enhanced mitosis after 32-40 h with almost one-half of the cell population in the S phase. Bcl-2 expression and caspase-3, -8, and -9 activity remained unaffected. A significant increase in the Glc(3)Man(9)GlcNAc(2)-PP-Dol biosynthesis and turnover, Factor VIIIC N-glycosylation, and cell surface expression of N-glycans was observed in cells treated with 8Br-cAMP. Dol-P-Man synthase activity in the endoplasmic reticulum membranes also increased. A 1.4-1.6-fold increase in HSP-70 and HSP-90 expression was also observed in 8Br-cAMP treated cells. On the other hand, the expression of GRP-78/Bip was 2.3-fold higher compared to that of GRP-94 in control cells, but after 8Br-cAMP treatment for 32 h, it was reduced by 3-fold. GRP-78/Bip expression in untreated cells was 1.2-1.5-fold higher when compared with HSP-70 and HSP-90, whereas that of the GRP-94 was 1.5-1.8-fold lower. After 8Br-cAMP treatment, GRP-78/Bip expression was reduced 4.5-4.8-fold, but the GRP-94 was reduced by 1.5-1.6-fold only. Upon comparison, a 2.9-fold down-regulation of GRP-78/Bip was observed compared to GRP-94. We, therefore, conclude that a high level of Glc(3)Man(9)GlcNAc(2)-PP-Dol, resulting from 8Br-cAMP stimulation up-regulated HSP-70 expression and down-regulated that of the GRP-78/Bip, maintained adequate protein folding, and reduced endoplasmic reticulum stress. As a result capillary endothelial cell proliferation was induced.

  2. Induction of chemokine receptor CXCR4 expression by transforming growth factor-β1 in human basal cell carcinoma cells.

    PubMed

    Chu, Chia-Yu; Sheen, Yi-Shuan; Cha, Shih-Ting; Hu, Yeh-Fang; Tan, Ching-Ting; Chiu, Hsien-Ching; Chang, Cheng-Chi; Chen, Min-Wei; Kuo, Min-Liang; Jee, Shiou-Hwa

    2013-11-01

    Higher CXCR4 expression enhances basal cell carcinoma (BCC) invasion and angiogenesis. The underlying mechanism of increased CXCR4 expression in invasive BCC is still not well understood. To investigate the mechanisms involved in the regulation of CXCR4 expression in invasive BCC. We used qRT-PCR, RT-PCR, Western blot, and flow cytometric analyses to examine different CXCR4 levels among the clinical samples, co-cultured BCC cells and BCC cells treated with recombinant transforming growth factor-β1 (TGF-β1) and connective tissue growth factor (CTGF). Immunohistochemical studies were used to demonstrate the correlation between TGF-β1 and CXCR4 expressions. The signal transduction pathway and transcriptional regulation were confirmed by treatments with chemical inhibitors, neutralizing antibodies, or short interfering RNAs, as well as luciferase reporter activity. Invasive BCC has higher TGF-β1 and CTGF levels compared to non-invasive BCC. Non-contact dermal fibroblasts co-culture with human BCC cells also increases the expression of CXCR4 in BCC cells. Treatment with recombinant human TGF-β1, but not CTGF, enhanced the CXCR4 levels in time- and dose-dependent manners. The protein level and surface expression of CXCR4 in human BCC cells was increased by TGF-β1 treatment. TGF-β1 was intensely expressed in the surrounding fibroblasts of invasive BCC and was positively correlated with the CXCR4 expression of BCC cells. The transcriptional regulation of CXCR4 by TGF-β1 is mediated by its binding to the TGF-β receptor II and phosphorylation of the extracellular signal-related kinase 1/2 (ERK1/2)-ETS-1 pathway. TGF-β1 induces upregulation of CXCR4 in human BCC cells by phosphorylation of ERK1/2-ETS-1 pathway. Copyright © 2013 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  3. Replenishment of RANTES mRNA expression in activated eosinophils fromatopic asthmatics

    PubMed Central

    Velazquez, J R; Lacy, P; Moqbel, R

    2000-01-01

    Eosinophils have been shown to express the gene encoding regulated upon activation, normal T‐cell expressed and secreted (RANTES), a potent eosinophilotactic chemokine. RANTES protein expression in eosinophils has previously been shown to be up‐regulated by a number of agonists, including complement‐dependent factors (C3b/iC3b) and interferon‐γ (IFN‐γ). We hypothesized that gene expression of RANTES is regulated in these cells by eosinophil‐specific agonists. We analysed RANTES mRNA expression by reverse‐transcription polymerase chain reaction (RT‐PCR) in human peripheral blood eosinophils obtained from mild atopic asthmatics following stimulation over time. In resting eosinophils, a low level of RANTES mRNA was found to be constitutively expressed in all the atopic donors tested in this study (n = 6). Following stimulation with C3b/iC3b (serum‐coated surfaces), eosinophils released measurable levels of RANTES, while sustained transcript expression was detected for up to 24 hr of stimulation. In contrast, IFN‐γ (5 ng/ml) transiently and significantly (P < 0·05, n = 3) depleted relative amounts of RANTES PCR product (compared with β2‐microglobulin) after 1–4 hr of stimulation. RANTES transcript was again detectable after 24 hr of IFN‐γ incubation, suggesting that the pool of RANTES mRNA had been replenished. Other eosinophil‐active cytokines, interleukin‐3 (IL‐3), IL‐4, IL‐5 and granulocyte–macrophage colony‐stimulating factor, did not appear to modulate RANTES mRNA expression after 1 hr of incubation. The effect of IFN‐γ on RANTES mRNA was reversed by cycloheximide, suggesting that IFN‐γ may act by increasing the rate of translation of RANTES mRNA. These findings indicate that IFN‐γ may induce a rapid and transient effect on the translation and replenishment of RANTES mRNA in eosinophils. This novel observation supports the notion that eosinophils have the potential to replenish their stored and released bioactive proteins. PMID:10792507

  4. Pim-1L Protects Cell Surface-Resident ABCA1 From Lysosomal Degradation in Hepatocytes and Thereby Regulates Plasma High-Density Lipoprotein Level.

    PubMed

    Katsube, Akira; Hayashi, Hisamitsu; Kusuhara, Hiroyuki

    2016-12-01

    ATP-binding cassette transporter A1 (ABCA1) exerts an atheroprotective action through the biogenesis of high-density lipoprotein in hepatocytes and prevents the formation of foam cells from macrophages. Controlling ABCA1 is a rational approach to improving atherosclerotic cardiovascular disease. Although much is known about the regulatory mechanism of ABCA1 synthesis, the molecular mechanism underpinning its degradation remains to be clearly described. ABCA1 possesses potential sites of phosphorylation by serine/threonine-protein kinase Pim-1 (Pim-1). Pim-1 depletion decreased the expression of cell surface-resident ABCA1 (csABCA1) and apolipoprotein A-I-mediated [ 3 H]cholesterol efflux in the human hepatoma cell line HepG2, but not in peritoneal macrophages from mice. In vitro kinase assay, immunoprecipitation, and immunocytochemistry suggested phosphorylation of csABCA1 by the long form of Pim-1 (Pim-1L). Cell surface biotinylation indicated that Pim-1L inhibited lysosomal degradation of csABCA1 involving the liver X receptor β, which interacts with csABCA1 and thereby protects it from ubiquitination and subsequent lysosomal degradation. Cell surface coimmunoprecipitation with COS-1 cells expressing extracellularly hemagglutinin-tagged ABCA1 showed that Pim-1L-mediated phosphorylation of csABCA1 facilitated the interaction between csABCA1 and liver X receptor β and thereby stabilized the csABCA1-Pim-1L complex. Mice deficient in Pim-1 kinase activity showed lower expression of ABCA1 in liver plasma membranes and lower plasma high-density lipoprotein levels than control mice. Pim-1L protects hepatic csABCA1 from lysosomal degradation by facilitating the physical interaction between csABCA1 and liver X receptor β and subsequent stabilization of the csABCA1-Pim-1L complex and thereby regulates the circulating level of high-density lipoprotein. Our findings may aid the development of high-density lipoprotein-targeted therapy. © 2016 American Heart Association, Inc.

  5. CMTM3 (CKLF-Like Marvel Transmembrane Domain 3) Mediates Angiogenesis by Regulating Cell Surface Availability of VE-Cadherin in Endothelial Adherens Junctions.

    PubMed

    Chrifi, Ihsan; Louzao-Martinez, Laura; Brandt, Maarten; van Dijk, Christian G M; Burgisser, Petra; Zhu, Changbin; Kros, Johan M; Duncker, Dirk J; Cheng, Caroline

    2017-06-01

    Decrease in VE-cadherin adherens junctions reduces vascular stability, whereas disruption of adherens junctions is a requirement for neovessel sprouting during angiogenesis. Endocytosis plays a key role in regulating junctional strength by altering bioavailability of cell surface proteins, including VE-cadherin. Identification of new mediators of endothelial endocytosis could enhance our understanding of angiogenesis. Here, we assessed the function of CMTM3 (CKLF-like MARVEL transmembrane domain 3), which we have previously identified as highly expressed in Flk1 + endothelial progenitor cells during embryonic development. Using a 3-dimensional coculture of human umbilical vein endothelial cells-GFP (green fluorescent protein) and pericytes-RFP (red fluorescent protein), we demonstrated that siRNA-mediated CMTM3 silencing in human umbilical vein endothelial cells impairs angiogenesis. In vivo CMTM3 inhibition by morpholino injection in developing zebrafish larvae confirmed that CMTM3 expression is required for vascular sprouting. CMTM3 knockdown in human umbilical vein endothelial cells does not affect proliferation or migration. Intracellular staining demonstrated that CMTM3 colocalizes with early endosome markers EEA1 (early endosome marker 1) and Clathrin + vesicles and with cytosolic VE-cadherin in human umbilical vein endothelial cells. Adenovirus-mediated CMTM3 overexpression enhances endothelial endocytosis, shown by an increase in Clathrin + , EEA1 + , Rab11 + , Rab5 + , and Rab7 + vesicles. CMTM3 overexpression enhances, whereas CMTM3 knockdown decreases internalization of cell surface VE-cadherin in vitro. CMTM3 promotes loss of endothelial barrier function in thrombin-induced responses, shown by transendothelial electric resistance measurements in vitro. In this study, we have identified a new regulatory function for CMTM3 in angiogenesis. CMTM3 is involved in VE-cadherin turnover and is a regulator of the cell surface pool of VE-cadherin. Therefore, CMTM3 mediates cell-cell adhesion at adherens junctions and contributes to the control of vascular sprouting. © 2017 American Heart Association, Inc.

  6. Gene therapy for human ovarian cancer cells using efficient expression of Fas gene combined with γδT cells.

    PubMed

    Lin, Jiajing; Zeng, Dingyuan; He, Hongying; Tan, Guangping; Lan, Ying; Jiang, Fuyan; Sheng, Shuting

    2017-10-01

    Low tissue specificity and efficiency of exogenous gene expression are the two major obstacles in tumor‑targeted gene therapy. The Fas cell surface death receptor (Fas)/Fas ligand pathway is one of the primary pathways responsible for the regulation of cell apoptosis. The aim of the present study was to explore whether the regulation of tumor specific promoters and a two‑step transcriptional amplification system (TSTA) assured efficient, targeted expression of their downstream Fas gene in human ovarian cancer cells, and to assess the killing effect of γδT cells on these cells with high Fas expression. Three shuttle plasmids containing different control elements of the human telomerase reverse transcriptase (hTERT) promoter and/or TSTA were constructed and packaged into adenovirus 5 (Ad5) vectors for the expression of exogenous Fas gene. The human ovarian cancer cell line SKOV3 and a control human embryonic lung fibroblast cell line were transfected with Ad5‑hTERT‑Fas or Ad5‑hTERT‑TSTA‑Fas. Fas mRNA and protein expression were examined by reverse transcription‑quantitative polymerase chain reaction and western blot analysis. γδT lymphocytes were isolated, cultured and mixed at different ratios with SKOV3 cells with Fas expression in order to assess the killing effect of γδT cells. hTERT promoter induced the specific expression of FAS gene in SKOV3 cells, and the TSTA strategy increased FAS expression by 14.2‑fold. The killing effect of γδT cells increased with the expression level of Fas and the effector‑target cell ratio. The killing rate for SKOV3 cells with high FAS expression was 72.5% at an effector‑target cell ratio of 40:1. The regulators of hTERT promoter and TSTA assure the efficient and targeted expression of their downstream Fas gene in SKOV3 cells. The killing effect of γδT cells for ovarian cancer cells with relatively high Fas expression was improved.

  7. Potential role of lycopene in targeting proprotein convertase subtilisin/kexin type-9 to combat hypercholesterolemia.

    PubMed

    Sultan Alvi, Sahir; Ansari, Irfan A; Khan, Imran; Iqbal, Johar; Khan, M Salman

    2017-07-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK-9) is a serine protease of the proprotien convertase (PC) family that has profound effects on plasma low density lipoprotein cholesterol (LDL-C) levels, the major risk factor for coronary heart disease (CHD), through its ability to mediate LDL receptor (LDL-R) protein degradation and reduced recycling to the surface of hepatocytes. Thus, the current study was premeditated not only to evaluate the role of lycopene in targeting the inhibition of PCSK-9 via modulation of genes involved in cholesterol homeostasis in HFD rats but also to examine a correlation between HFD induced inflammatory cascades and subsequent regulation of PCSK-9 expression. Besides the effect of lycopene on hepatic PCSK-9 gene expression, PPI studies for PCSK-9-Lycopene complex and EGF-A of LDL-R were also performed via molecular informatics approach to assess the dual mode of action of lycopene in LDL-R recycling and increased removal of circulatory LDL-C. We for the first time deciphered that lycopene treatment significantly down-regulates the expression of hepatic PCSK-9 and HMGR, whereas, hepatic LDL-R expression was significantly up-regulated. Furthermore, lycopene ameliorated inflammation stimulated expression of PCSK-9 via suppressing the expression of inflammatory markers. The results from our molecular informatics studies confirmed that lycopene, while occupying the active site of PCSK-9 crystal structure, reduces the affinity of PCSK-9 to complex with EGF-A of LDL-R, whereas, atorvastatin makes PCSK-9-EGF-A complex formation more feasible than both of PCSK-9-EGF-A alone and Lycopene-PCSK-9-EGF-A complex. Based on above results, it can be concluded that lycopene exhibits potent hypolipidemic activities via molecular mechanisms that are either identical (HMGR inhibition) or distinct from that of statins (down-regulation of PCSK-9 mRNA synthesis). To the best of our knowledge, this is the first report that lycopene has this specific biological property. Being a natural, safer and alternative therapeutic agent, lycopene could be used as a complete regulator of cholesterol homeostasis and ASCVD. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Effect of PGE2 on the cell surface molecule expression in PMA treated thymocytes.

    PubMed

    Daculsi, R; Vaillier, D; Carron, J C; Gualde, N

    1998-02-01

    PGE2 is produced by cells of the thymic microenvironment. The effects of PGE2 are mediated by cAMP through binding to its intracellular receptor protein kinase A (PKA). Phorbol 12-myristate 13-acetate (PMA) is known to modulate CD molecule expression on thymocytes, probably through activation of protein kinase C (PKC). We have hypothesized that cross-talk between these two signalling pathways may affect modulation of the CD molecules on the cell surface of thymocytes. For this purpose, we compare the effects of PMA alone or combined with PGE2 on CD3, CD4 and CD8 expression on mouse thymocytes by flow-cytometric analysis. PMA treatment almost completely abolished CD4 expression and slightly decreased CD3 and CD8 expression. PGE2 alone did not change the CD3, CD4 and CD8 molecule expression. Combined with PMA, PGE2 can overcome the decrease induced by PMA of the CD3 expression and partially reduced the disappearance of the CD4 molecule. On the other hand PGE2 accelerated the loss of CD8 molecule expression. These events occurred only in CD4+ CD8+ immature thymocytes. An analogue of cAMP (dibutyryl cAMP) mimics the effect of PGE2, but not Br-cGMP. This differential regulation by PGE2 of the CD molecule expression on immature thymocytes may provide additional evidence on the role of PGE2 during the process of thymic differentiation.

  9. Structural determinants of APOBEC3B non-catalytic domain for molecular assembly and catalytic regulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao, Xiao; Yang, Hanjing; Arutiunian, Vagan

    The catalytic activity of human cytidine deaminase APOBEC3B (A3B) has been correlated with kataegic mutational patterns within multiple cancer types. The molecular basis of how the N-terminal non-catalytic CD1 regulates the catalytic activity and consequently, biological function of A3B remains relatively unknown. Here, we report the crystal structure of a soluble human A3B-CD1 variant and delineate several structural elements of CD1 involved in molecular assembly, nucleic acid interactions and catalytic regulation of A3B. We show that (i) A3B expressed in human cells exists in hypoactive high-molecular-weight (HMW) complexes, which can be activated without apparent dissociation into low-molecular-weight (LMW) species aftermore » RNase A treatment. (ii) Multiple surface hydrophobic residues of CD1 mediate the HMW complex assembly and affect the catalytic activity, including one tryptophan residue W127 that likely acts through regulating nucleic acid binding. (iii) One of the highly positively charged surfaces on CD1 is involved in RNA-dependent attenuation of A3B catalysis. (iv) Surface hydrophobic residues of CD1 are involved in heterogeneous nuclear ribonucleoproteins (hnRNPs) binding to A3B. The structural and biochemical insights described here suggest that unique structural features on CD1 regulate the molecular assembly and catalytic activity of A3B through distinct mechanisms.« less

  10. Postnatal Expression of V2 Vasopressin Receptor Splice Variants in the Rat Cerebellum

    PubMed Central

    Vargas, Karina J.; Sarmiento, José M.; Ehrenfeld, Pamela; Añazco, Carolina C.; Villanueva, Carolina I.; Carmona, Pamela L.; Brenet, Marianne; Navarro, Javier; Müller-Esterl, Werner; Figueroa, Carlos D.; González, Carlos B.

    2010-01-01

    The V2 vasopressin receptor gene contains an alternative splice site in exon-3, which leads to the generation of two splice variants (V2a and V2b) first identified in the kidney. The open reading frame of the alternatively spliced V2b transcripten codes a truncated receptor, showing the same amino acid sequence as the canonical V2a receptor up to the 6th transmembrane segment, but displaying a distinct sequence to the corresponding 7th transmembrane segment and C-terminal domain relative to the V2a receptor. Here, we demonstrate the postnatal expression of V2a and V2b variants in the rat cerebellum. Most importantly, we showed by in situ hybridization and immunocytochemistry that both V2 splice variants were preferentially expressed in Purkinje cells, from early to late postnatal development. In addition, both variants were transiently expressed in the neuroblastic external granule cells and Bergmann fibers. These results indicate that the cellular distributions of both splice variants are developmentally regulated, and suggest that the transient expression of the V2 receptor is involved in the mechanisms of cerebellar cytodifferentiation by AVP. Finally, transfected CHO-K1 .expressing similar amounts of both V2 splice variants, as that found in the cerebellum, showed a significant reduction in the surface expression of V2a receptors, suggesting that the differential expression of the V2 splice variants regulate the vasopressin signaling in the cerebellum. PMID:19281786

  11. Cell Density Control of Staphylococcal Virulence Mediated by an Octapeptide Pheromone

    NASA Astrophysics Data System (ADS)

    Ji, Guangyong; Beavis, Ronald C.; Novick, Richard P.

    1995-12-01

    Some bacterial pathogens elaborate and secrete virulence factors in response to environmental signals, others in response to a specific host product, and still others in response to no discernible cue. In this study, we have demonstrated that the synthesis of Staphylococcus aureus virulence factors is controlled by a density-sensing system that utilizes an octapeptide produced by the organism itself. The octapeptide activates expression of the agr locus, a global regulator of the virulence response. This response involves the reciprocal regulation of genes encoding surface proteins and those encoding secreted virulence factors. As cells enter the postexponential phase, surface protein genes are repressed by agr and secretory protein genes are subsequently activated. The intracellular agr effector is a regulatory RNA, RNAIII, whose transcription is activated by an agr-encoded signal transduction system for which the octapeptide is the ligand.

  12. Cell surface marker profiling of human tracheal basal cells reveals distinct subpopulations, identifies MST1/MSP as a mitogenic signal, and identifies new biomarkers for lung squamous cell carcinomas.

    PubMed

    Van de Laar, Emily; Clifford, Monica; Hasenoeder, Stefan; Kim, Bo Ram; Wang, Dennis; Lee, Sharon; Paterson, Josh; Vu, Nancy M; Waddell, Thomas K; Keshavjee, Shaf; Tsao, Ming-Sound; Ailles, Laurie; Moghal, Nadeem

    2014-12-31

    The large airways of the lungs (trachea and bronchi) are lined with a pseudostratified mucociliary epithelium, which is maintained by stem cells/progenitors within the basal cell compartment. Alterations in basal cell behavior can contribute to large airway diseases including squamous cell carcinomas (SQCCs). Basal cells have traditionally been thought of as a uniform population defined by basolateral position, cuboidal cell shape, and expression of pan-basal cell lineage markers like KRT5 and TP63. While some evidence suggests that basal cells are not all functionally equivalent, few heterogeneously expressed markers have been identified to purify and study subpopulations. In addition, few signaling pathways have been identified that regulate their cell behavior. The goals of this work were to investigate tracheal basal cell diversity and to identify new signaling pathways that regulate basal cell behavior. We used flow cytometry (FACS) to profile cell surface marker expression at a single cell level in primary human tracheal basal cell cultures that maintain stem cell/progenitor activity. FACS results were validated with tissue staining, in silico comparisons with normal basal cell and lung cancer datasets, and an in vitro proliferation assay. We identified 105 surface markers, with 47 markers identifying potential subpopulations. These subpopulations generally fell into more (~ > 13%) or less abundant (~ < 6%) groups. Microarray gene expression profiling supported the heterogeneous expression of these markers in the total population, and immunostaining of large airway tissue suggested that some of these markers are relevant in vivo. 24 markers were enriched in lung SQCCs relative to adenocarcinomas, with four markers having prognostic significance in SQCCs. We also identified 33 signaling receptors, including the MST1R/RON growth factor receptor, whose ligand MST1/MSP was mitogenic for basal cells. This work provides the largest description to date of molecular diversity among human large airway basal cells. Furthermore, these markers can be used to further study basal cell function in repair and disease, and may aid in the classification and study of SQCCs.

  13. TRAIL-death receptor endocytosis and apoptosis are selectively regulated by dynamin-1 activation.

    PubMed

    Reis, Carlos R; Chen, Ping-Hung; Bendris, Nawal; Schmid, Sandra L

    2017-01-17

    Clathrin-mediated endocytosis (CME) constitutes the major pathway for uptake of signaling receptors into eukaryotic cells. As such, CME regulates signaling from cell-surface receptors, but whether and how specific signaling receptors reciprocally regulate the CME machinery remains an open question. Although best studied for its role in membrane fission, the GTPase dynamin also regulates early stages of CME. We recently reported that dynamin-1 (Dyn1), previously assumed to be neuron-specific, can be selectively activated in cancer cells to alter endocytic trafficking. Here we report that dynamin isoforms differentially regulate the endocytosis and apoptotic signaling downstream of TNF-related apoptosis-inducing ligand-death receptor (TRAIL-DR) complexes in several cancer cells. Whereas the CME of constitutively internalized transferrin receptors is mainly dependent on the ubiquitously expressed Dyn2, TRAIL-induced DR endocytosis is selectively regulated by activation of Dyn1. We show that TRAIL stimulation activates ryanodine receptor-mediated calcium release from endoplasmic reticulum stores, leading to calcineurin-mediated dephosphorylation and activation of Dyn1, TRAIL-DR endocytosis, and increased resistance to TRAIL-induced apoptosis. TRAIL-DR-mediated ryanodine receptor activation and endocytosis is dependent on early caspase-8 activation. These findings delineate specific mechanisms for the reciprocal crosstalk between signaling and the regulation of CME, leading to autoregulation of endocytosis and signaling downstream of surface receptors.

  14. TRAIL-death receptor endocytosis and apoptosis are selectively regulated by dynamin-1 activation

    PubMed Central

    Reis, Carlos R.; Chen, Ping-Hung; Bendris, Nawal; Schmid, Sandra L.

    2017-01-01

    Clathrin-mediated endocytosis (CME) constitutes the major pathway for uptake of signaling receptors into eukaryotic cells. As such, CME regulates signaling from cell-surface receptors, but whether and how specific signaling receptors reciprocally regulate the CME machinery remains an open question. Although best studied for its role in membrane fission, the GTPase dynamin also regulates early stages of CME. We recently reported that dynamin-1 (Dyn1), previously assumed to be neuron-specific, can be selectively activated in cancer cells to alter endocytic trafficking. Here we report that dynamin isoforms differentially regulate the endocytosis and apoptotic signaling downstream of TNF-related apoptosis-inducing ligand–death receptor (TRAIL–DR) complexes in several cancer cells. Whereas the CME of constitutively internalized transferrin receptors is mainly dependent on the ubiquitously expressed Dyn2, TRAIL-induced DR endocytosis is selectively regulated by activation of Dyn1. We show that TRAIL stimulation activates ryanodine receptor-mediated calcium release from endoplasmic reticulum stores, leading to calcineurin-mediated dephosphorylation and activation of Dyn1, TRAIL–DR endocytosis, and increased resistance to TRAIL-induced apoptosis. TRAIL–DR-mediated ryanodine receptor activation and endocytosis is dependent on early caspase-8 activation. These findings delineate specific mechanisms for the reciprocal crosstalk between signaling and the regulation of CME, leading to autoregulation of endocytosis and signaling downstream of surface receptors. PMID:28049841

  15. Autophagy mediates cell cycle response by regulating nucleocytoplasmic transport of PAX6 in limbal stem cells under ultraviolet-A stress

    PubMed Central

    Laggner, Maria; Pollreisz, Andreas; Schmidinger, Gerald; Schmidt-Erfurth, Ursula; Chen, Ying-Ting

    2017-01-01

    Limbal stem cells (LSC) account for homeostasis and regeneration of corneal epithelium. Solar ultraviolet A (UVA) is the major source causing oxidative damage in the ocular surface. Autophagy, a lysosomal degradation mechanism, is essential for physiologic function and stress defense of stem cells. PAX6, a master transcription factor governing corneal homeostasis by regulating cell cycle and cell fate of LSC, responds to oxidative stress by nucleocytoplasmic shuttling. Impaired autophagy and deregulated PAX6 have been reported in oxidative stress-related ocular surface disorders. We hypothesize a functional role for autophagy and PAX6 in LSC’s stress response to UVA. Therefore, human LSC colonies were irradiated with a sub-lethal dose of UVA and autophagic activity and intracellular reactive oxygen species (ROS) were measured by CYTO-ID assay and CM-H2DCFDA live staining, respectively. Following UVA irradiation, the percentage of autophagic cells significantly increased in LSC colonies while intracellular ROS levels remained unaffected. siRNA-mediated knockdown (KD) of ATG7 abolished UVA-induced autophagy and led to an excessive accumulation of ROS. Upon UVA exposure, LSCs displayed nuclear-to-cytoplasmic translocation of PAX6, while ATG7KD or antioxidant pretreatment largely attenuated the intracellular trafficking event. Immunofluorescence showing downregulation of proliferative marker PCNA and induction of cell cycle regulator p21 indicates cell cycle arrest in UVA-irradiated LSC. Abolishing autophagy, adenoviral-assisted restoration of nuclear PAX6 or antioxidant pretreatment abrogated the UVA-induced cell cycle arrest. Adenoviral expression of an ectopic PAX gene, PAX7, did not affect UVA cell cycle response. Furthermore, knocking down PAX6 attenuated the cell cycle progression of irradiated ATG7KD LSC by de-repressing p21 expression. Collectively, our data suggest a crosstalk between autophagy and PAX6 in regulating cell cycle response of ocular progenitors under UVA stress. Autophagy deficiency leads to impaired intracellular trafficking of PAX6, perturbed redox balance and uncurbed cell cycle progression in UVA-stressed LSCs. The coupling of autophagic machinery and PAX6 in cell cycle regulation represents an attractive therapeutic target for hyperproliferative ocular surface disorders associated with solar radiation. PMID:28700649

  16. Forskolin-induced apical membrane insertion of virally expressed, epitope-tagged CFTR in polarized MDCK cells.

    PubMed

    Howard, M; Jiang, X; Stolz, D B; Hill, W G; Johnson, J A; Watkins, S C; Frizzell, R A; Bruton, C M; Robbins, P D; Weisz, O A

    2000-08-01

    Channel gating of the cystic fibrosis transmembrane conductance regulator (CFTR) is activated in response to cAMP stimulation. In addition, CFTR activation may also involve rapid insertion of a subapical pool of CFTR into the plasma membrane (PM). However, this issue has been controversial, in part because of the difficulty in distinguishing cell surface vs. intracellular CFTR. Recently, a fully functional, epitope-tagged form of CFTR (M2-901/CFTR) that can be detected immunologically in nonpermeabilized cells was characterized (Howard M, Duvall MD, Devor DC, Dong J-Y, Henze K, and Frizzell RA. Am J Physiol Cell Physiol 269: C1565-C1576, 1995; and Schultz BD, Takahashi A, Liu C, Frizzell RA, and Howard M. Am J Physiol Cell Physiol 273: C2080-C2089, 1997). We have developed replication-defective recombinant adenoviruses that express M2-901/CFTR and used them to probe cell surface CFTR in forskolin (FSK)-stimulated polarized Madin-Darby canine kidney (MDCK) cells. Virally expressed M2-901/CFTR was functional and was readily detected on the apical surface of FSK-stimulated polarized MDCK cells. Interestingly, at low multiplicity of infection, we observed FSK-stimulated insertion of M2901/CFTR into the apical PM, whereas at higher M2-901/CFTR expression levels, no increase in surface expression was detected using indirect immunofluorescence. Immunoelectron microscopy of unstimulated and FSK-stimulated cells confirmed the M2-901/CFTR redistribution to the PM upon FSK stimulation and demonstrates that the apically inserted M2-901/CFTR originates from a population of subapical vesicles. Our observations may reconcile previous conflicting reports regarding the effect of cAMP stimulation on CFTR trafficking.

  17. Regulation of ICAM-1 in cells of the monocyte/macrophage system in microgravity.

    PubMed

    Paulsen, Katrin; Tauber, Svantje; Dumrese, Claudia; Bradacs, Gesine; Simmet, Dana M; Gölz, Nadine; Hauschild, Swantje; Raig, Christiane; Engeli, Stephanie; Gutewort, Annett; Hürlimann, Eva; Biskup, Josefine; Unverdorben, Felix; Rieder, Gabriela; Hofmänner, Daniel; Mutschler, Lisa; Krammer, Sonja; Buttron, Isabell; Philpot, Claudia; Huge, Andreas; Lier, Hartwin; Barz, Ines; Engelmann, Frank; Layer, Liliana E; Thiel, Cora S; Ullrich, Oliver

    2015-01-01

    Cells of the immune system are highly sensitive to altered gravity, and the monocyte as well as the macrophage function is proven to be impaired under microgravity conditions. In our study, we investigated the surface expression of ICAM-1 protein and expression of ICAM-1 mRNA in cells of the monocyte/macrophage system in microgravity during clinostat, parabolic flight, sounding rocket, and orbital experiments. In murine BV-2 microglial cells, we detected a downregulation of ICAM-1 expression in clinorotation experiments and a rapid and reversible downregulation in the microgravity phase of parabolic flight experiments. In contrast, ICAM-1 expression increased in macrophage-like differentiated human U937 cells during the microgravity phase of parabolic flights and in long-term microgravity provided by a 2D clinostat or during the orbital SIMBOX/Shenzhou-8 mission. In nondifferentiated U937 cells, no effect of microgravity on ICAM-1 expression could be observed during parabolic flight experiments. We conclude that disturbed immune function in microgravity could be a consequence of ICAM-1 modulation in the monocyte/macrophage system, which in turn could have a strong impact on the interaction with T lymphocytes and cell migration. Thus, ICAM-1 can be considered as a rapid-reacting and sustained gravity-regulated molecule in mammalian cells.

  18. Regulation of ICAM-1 in Cells of the Monocyte/Macrophage System in Microgravity

    PubMed Central

    Paulsen, Katrin; Tauber, Svantje; Dumrese, Claudia; Bradacs, Gesine; Simmet, Dana M.; Gölz, Nadine; Hauschild, Swantje; Raig, Christiane; Engeli, Stephanie; Gutewort, Annett; Hürlimann, Eva; Biskup, Josefine; Rieder, Gabriela; Hofmänner, Daniel; Mutschler, Lisa; Krammer, Sonja; Philpot, Claudia; Huge, Andreas; Lier, Hartwin; Barz, Ines; Engelmann, Frank; Layer, Liliana E.; Thiel, Cora S.

    2015-01-01

    Cells of the immune system are highly sensitive to altered gravity, and the monocyte as well as the macrophage function is proven to be impaired under microgravity conditions. In our study, we investigated the surface expression of ICAM-1 protein and expression of ICAM-1 mRNA in cells of the monocyte/macrophage system in microgravity during clinostat, parabolic flight, sounding rocket, and orbital experiments. In murine BV-2 microglial cells, we detected a downregulation of ICAM-1 expression in clinorotation experiments and a rapid and reversible downregulation in the microgravity phase of parabolic flight experiments. In contrast, ICAM-1 expression increased in macrophage-like differentiated human U937 cells during the microgravity phase of parabolic flights and in long-term microgravity provided by a 2D clinostat or during the orbital SIMBOX/Shenzhou-8 mission. In nondifferentiated U937 cells, no effect of microgravity on ICAM-1 expression could be observed during parabolic flight experiments. We conclude that disturbed immune function in microgravity could be a consequence of ICAM-1 modulation in the monocyte/macrophage system, which in turn could have a strong impact on the interaction with T lymphocytes and cell migration. Thus, ICAM-1 can be considered as a rapid-reacting and sustained gravity-regulated molecule in mammalian cells. PMID:25654110

  19. Granulocyte-macrophage and macrophage colony-stimulating factors differentially regulate alpha v integrin expression on cultured human macrophages.

    PubMed

    De Nichilo, M O; Burns, G F

    1993-03-15

    The colony-stimulating factors (CSFs) greatly influence mature macrophage function in vitro: macrophage (M)-CSF induces maturation of monocytes and enhances differentiated cell function; granulocyte-macrophage (GM)-CSF stimulates a variety of antimicrobial functions. In vivo M-CSF is thought to promote differentiation, and GM-CSF is thought to potentiate the inflammatory response. One mechanism by which these differential effects may be achieved is through the receptor-mediated interaction of macrophages with their extracellular matrix. Here we show that M-CSF induces specifically the expression of the alpha v beta 5 integrin receptor, whereas GM-CSF rapidly induces mRNA and surface expression of the alpha v beta 3 integrin. The M-CSF-treated cells acquire a flattened epitheloid phenotype, and on vitronectin the alpha v beta 5 is located in adhesion plaques. These cells do not bind collagen or laminin. In contrast, cells treated with GM-CSF adopt an elongated phenotype on a number of substrates, including collagen and laminin, and express alpha v beta 3 at the leading edge of cells on vitronectin. These results suggest that a primary means by which the CSFs exert their individual effects on mature cells may be through regulating integrin expression.

  20. Long-lasting spatial learning and memory impairments caused by chronic cerebral hypoperfusion associate with a dynamic change of HCN1/HCN2 expression in hippocampal CA1 region.

    PubMed

    Luo, Pan; Lu, Yun; Li, Changjun; Zhou, Mei; Chen, Cheng; Lu, Qing; Xu, Xulin; He, Zhi; Guo, Lianjun

    2015-09-01

    Chronic cerebral hypoperfusion (CCH) causes learning and memory impairments and increases the risk of Alzheimer disease (AD) and vascular dementia (VD) through several biologically plausible pathways, yet the mechanisms underlying the disease process remained unclear particularly in a temporal manner. We performed permanent bilateral occlusion of the common carotid arteries (two-vessel occlusion, 2VO) to induce CCH. To determine whether hyperpolarization-activated cyclic nucleotide-gated (HCN) channels are altered at different stages of cognitive impairment caused by CCH, adult male SD rats were randomly distributed into sham-operated 4, 8 and 12weeks group, 2VO 4, 8 and 12weeks group. Learning and memory performance were evaluated with Morris water maze (MWM) and long-term potentiation (LTP) was used to address the underlying synaptic mechanisms. Expression of NeuN, HCN1 and HCN2 in hippocampal CA1, DG and CA3 areas was quantified by immunohistochemistry and western blotting. Our data showed that CCH induced a remarkable spatial learning and memory deficits in rats of 2VO 4, 8, and 12weeks group although neuronal loss only occurred after 4weeks of 2VO surgery in CA1. In addition, a significant reduction of HCN1 surface expression in CA1 was observed in the group that suffered 4weeks ischemia but neither 8 nor 12weeks. However, HCN2 surface expression in CA1 increased throughout the ischemia time-scales (4, 8 and 12w). Our findings indicate spatial learning and memory deficits in the CCH model are associated with disturbed HCN1 and HCN2 surface expression in hippocampal CA1. The altered patterns of both HCN1 and HCN2 surface expression may be implicated in the early stage (4w) of spatial learning and memory impairments; and the stable and long-lasting impairments of spatial learning and memory may partially attribute to the up-regulated HCN2 surface expression. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Naringin suppress chondrosarcoma migration through inhibition vascular adhesion molecule-1 expression by modulating miR-126.

    PubMed

    Tan, Tzu-Wei; Chou, Ying-Erh; Yang, Wei-Hung; Hsu, Chin-Jung; Fong, Yi-Chin; Tang, Chih-Hsin

    2014-09-01

    Chondrosarcoma, a primary malignant bone cancer, has a potent capacity to invade locally and cause distant metastasis, especially to the lungs. Patients diagnosed with it have poor prognosis. Naringin, polymethoxylated flavonoid commonly found in citrus fruits, has anti-oxidant, anti-inflammatory and anti-tumor activity; whether naringin regulates migration of chondrosarcoma is largely unknown. Here we report that naringin does not expedite apoptosis in human chondrosarcoma. By contrast, at noncytotoxic concentrations, naringin suppressed migration and invasion of chondrosarcoma cells. Vascular cell adhesion molecule-1 (VCAM-1) of the immunoglobulin superfamily is linked with metastasis; we found incubation of chondrosarcoma cells with naringin reducing mRNA transcription for, and cell surface expression of, VCAM-1. We also observed that naringin enhancing miR-126 expression, and miR-126 inhibitor reversed the naringin-inhibited cell motility and VCAM-1 expression. Therefore, naringin inhibits migration and invasion of human chondrosarcoma via down-regulation of VCAM-1 by increasing miR-126. Thus, naringin may be a novel anti-migration agent for the treatment of migration in chondrosarcoma. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Regulation of Expressive Behavior as Reflecting Affect Socialization.

    ERIC Educational Resources Information Center

    Saarni, Carolyn

    Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…

  3. Regulation of Hsp27 and Hsp70 expression in human and mouse skin construct models by caveolae following exposure to the model sulfur mustard vesicant, 2-chloroethyl ethyl sulfide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Black, Adrienne T.; Hayden, Patrick J.; Casillas, Robert P.

    Dermal exposure to the vesicant sulfur mustard causes marked inflammation and tissue damage. Basal keratinocytes appear to be a major target of sulfur mustard. In the present studies, mechanisms mediating skin toxicity were examined using a mouse skin construct model and a full-thickness human skin equivalent (EpiDerm-FT{sup TM}). In both systems, administration of the model sulfur mustard vesicant, 2-chloroethyl ethyl sulfide (CEES, 100-1000 {mu}M) at the air surface induced mRNA and protein expression of heat shock proteins 27 and 70 (Hsp27 and Hsp70). CEES treatment also resulted in increased expression of caveolin-1, the major structural component of caveolae. Immunohistochemistry revealedmore » that Hsp27, Hsp70 and caveolin-1 were localized in basal and suprabasal layers of the epidermis. Caveolin-1 was also detected in fibroblasts in the dermal component of the full thickness human skin equivalent. Western blot analysis of caveolar membrane fractions isolated by sucrose density centrifugation demonstrated that Hsp27 and Hsp70 were localized in caveolae. Treatment of mouse keratinocytes with filipin III or methyl-{beta}-cyclodextrin, which disrupt caveolar structure, markedly suppressed CEES-induced Hsp27 and Hsp70 mRNA and protein expression. CEES treatment is known to activate JNK and p38 MAP kinases; in mouse keratinocytes, inhibition of these enzymes suppressed CEES-induced expression of Hsp27 and Hsp70. These data suggest that MAP kinases regulate Hsp 27 and Hsp70; moreover, caveolae-mediated regulation of heat shock protein expression may be important in the pathophysiology of vesicant-induced skin toxicity.« less

  4. Newly generated heparanase knock-out mice unravel co-regulation of heparanase and matrix metalloproteinases.

    PubMed

    Zcharia, Eyal; Jia, Juan; Zhang, Xiao; Baraz, Lea; Lindahl, Ulf; Peretz, Tamar; Vlodavsky, Israel; Li, Jin-Ping

    2009-01-01

    Heparanase, a mammalian endo-beta-D-glucuronidase, specifically degrades heparan sulfate proteoglycans ubiquitously associated with the cell surface and extracellular matrix. This single gene encoded enzyme is over-expressed in most human cancers, promoting tumor metastasis and angiogenesis. We report that targeted disruption of the murine heparanase gene eliminated heparanase enzymatic activity, resulting in accumulation of long heparan sulfate chains. Unexpectedly, the heparanase knockout (Hpse-KO) mice were fertile, exhibited a normal life span and did not show prominent pathological alterations. The lack of major abnormalities is attributed to a marked elevation in the expression of matrix metalloproteinases, for example, MMP2 and MMP14 in the Hpse-KO liver and kidney. Co-regulation of heparanase and MMPs was also noted by a marked decrease in MMP (primarily MMP-2,-9 and 14) expression following transfection and over-expression of the heparanase gene in cultured human mammary carcinoma (MDA-MB-231) cells. Immunostaining (kidney tissue) and chromatin immunoprecipitation (ChIP) analysis (Hpse-KO mouse embryonic fibroblasts) suggest that the newly discovered co-regulation of heparanase and MMPs is mediated by stabilization and transcriptional activity of beta-catenin. The lack of heparanase expression and activity was accompanied by alterations in the expression level of MMP family members, primarily MMP-2 and MMP-14. It is conceivable that MMP-2 and MMP-14, which exert some of the effects elicited by heparanase (i.e., over branching of mammary glands, enhanced angiogenic response) can compensate for its absence, in spite of their different enzymatic substrate. Generation of viable Hpse-KO mice lacking significant abnormalities may provide a promising indication for the use of heparanase as a target for drug development.

  5. Logical Analysis of Regulation of Interleukin-12 Expression Pathway Regulation During HCV Infection.

    PubMed

    Farooqi, Zia-Ur-Rehman; Tareen, Samar H K; Ahmed, Jamil; Zaidi, Najam-Us-Sahar S

    2016-01-01

    Hepatitis C virus (HCV) triggers coordinated innate and adaptive response in host cell. HCV genome and proteins of the replicating virus are recognized as non-self-antigens by host cell to activate Toll Like Receptors (TLRs). Activated TLRs ultimately express cytokines, which can clear virus either by activating interferon (IFN), protein kinase C (PKC) and RNA Lase system or through activation of cytotoxic T-lymphocytes. Interleukin-12 (IL-12) is a potent antiviral cytokine, capable of clearing HCV by bridging both innate and adaptive antiviral immune response. Activation of TLR-4 on macrophages surface induces expression of IL-12 via NF-κB and AP-1 transcriptional pathway. After expression, IL- 12 releases IFN-γ, which activates anti-HCV cytotoxic lymphocytes. Conversely, in chronic HCV infection downregulation of IL-12 has been reported instead of by number of studies. Keeping in view of the above mentioned facts, this study was designed to evaluate HCV-core mediated down-regulation of IL-12 transcriptional pathway by employing a logical modeling approach based on the Ren´e Thomas formalism. The logical parameters of entities were estimated by using SMBioNet. The Logical model represents all possible dynamics of protein expression involved during course of HCV pathology. Results demonstrated that at chronic stage of infection, though TLR-4 was constantly active but yet it failed to express the NF-κB, AP-1, IL-12 and IFN-γ. This mechanism was indicative of incorporation of core mediated changes in IL-12 regulatory pathway. Moreover, results also indicate that HCV adopts different trajectories to accomplish the persistence of chronic phase of infection. It also implicated that human immune system tries to clear HCV but core is capable of inducing system oscillations to evade the immunity.

  6. Regulation of Hsp27 and Hsp70 expression in human and mouse skin construct models by caveolae following exposure to the model sulfur mustard vesicant, 2-chloroethyl ethyl sulfide

    PubMed Central

    Black, Adrienne T.; Hayden, Patrick J.; Casillas, Robert P.; Heck, Diane E.; Gerecke, Donald R.; Sinko, Patrick J.; Laskin, Debra L.; Laskin, Jeffrey D.

    2012-01-01

    Dermal exposure to the vesicant sulfur mustard causes marked inflammation and tissue damage. Basal keratinocytes appear to be a major target of sulfur mustard. In the present studies, mechanisms mediating skin toxicity were examined using a mouse skin construct model and a full-thickness human skin equivalent (EpiDerm-FTTM). In both systems, administration of the model sulfur mustard vesicant, 2-chloroethyl ethyl sulfide (CEES, 100–1000 µM) at the air surface induced mRNA and protein expression of heat shock proteins 27 and 70 (Hsp27 and Hsp70). CEES treatment also resulted in increased expression of caveolin-1, the major structural component of caveolae. Immunohistochemistry revealed that Hsp27, Hsp70 and caveolin-1 were localized in basal and suprabasal layers of the epidermis. Caveolin-1 was also detected in fibroblasts in the dermal component of the full thickness human skin equivalent. Western blot analysis of caveolar membrane fractions isolated by sucrose density centrifugation demonstrated that Hsp27 and Hsp70 were localized in caveolae. Treatment of mouse keratinocytes with filipin III or methyl-β-cyclodextrin, which disrupt caveolar structure, markedly suppressed CEES-induced Hsp27 and Hsp70 mRNA and protein expression. CEES treatment is known to activate JNK and p38 MAP kinases; in mouse keratinocytes, inhibition of these enzymes suppressed CEES-induced expression of Hsp27 and Hsp70. These data suggest that MAP kinases regulate Hsp 27 and Hsp70; moreover, caveolae-mediated regulation of heat shock protein expression may be important in the pathophysiology of vesicant-induced skin toxicity. PMID:21457723

  7. Regulation of Hsp27 and Hsp70 expression in human and mouse skin construct models by caveolae following exposure to the model sulfur mustard vesicant, 2-chloroethyl ethyl sulfide.

    PubMed

    Black, Adrienne T; Hayden, Patrick J; Casillas, Robert P; Heck, Diane E; Gerecke, Donald R; Sinko, Patrick J; Laskin, Debra L; Laskin, Jeffrey D

    2011-06-01

    Dermal exposure to the vesicant sulfur mustard causes marked inflammation and tissue damage. Basal keratinocytes appear to be a major target of sulfur mustard. In the present studies, mechanisms mediating skin toxicity were examined using a mouse skin construct model and a full-thickness human skin equivalent (EpiDerm-FT™). In both systems, administration of the model sulfur mustard vesicant, 2-chloroethyl ethyl sulfide (CEES, 100-1000μM) at the air surface induced mRNA and protein expression of heat shock proteins 27 and 70 (Hsp27 and Hsp70). CEES treatment also resulted in increased expression of caveolin-1, the major structural component of caveolae. Immunohistochemistry revealed that Hsp27, Hsp70 and caveolin-1 were localized in basal and suprabasal layers of the epidermis. Caveolin-1 was also detected in fibroblasts in the dermal component of the full thickness human skin equivalent. Western blot analysis of caveolar membrane fractions isolated by sucrose density centrifugation demonstrated that Hsp27 and Hsp70 were localized in caveolae. Treatment of mouse keratinocytes with filipin III or methyl-β-cyclodextrin, which disrupt caveolar structure, markedly suppressed CEES-induced Hsp27 and Hsp70 mRNA and protein expression. CEES treatment is known to activate JNK and p38 MAP kinases; in mouse keratinocytes, inhibition of these enzymes suppressed CEES-induced expression of Hsp27 and Hsp70. These data suggest that MAP kinases regulate Hsp 27 and Hsp70; moreover, caveolae-mediated regulation of heat shock protein expression may be important in the pathophysiology of vesicant-induced skin toxicity. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Expression of Pleiotrophin in the Prostate is Androgen Regulated and it Functions as an Autocrine Regulator of Mesenchyme and Cancer Associated Fibroblasts and as a Paracrine Regulator of Epithelia

    PubMed Central

    Orr, Brigid; Vanpoucke, Griet; Grace, O Cathal; Smith, Lee; Anderson, Richard A; Riddick, Antony CP; Franco, Omar E; Hayward, Simon W; Thomson, Axel A

    2011-01-01

    BACKGROUND Androgens and paracrine signaling from mesenchyme/stroma regulate development and disease of the prostate, and gene profiling studies of inductive prostate mesenchyme have identified candidate molecules such as pleiotrophin (Ptn). METHODS Ptn transcripts and protein were localized by in situ and immunohistochemistry and Ptn mRNA was quantitated by Northern blot and qRT-PCR. Ptn function was examined by addition of hPTN protein to rat ventral prostate organ cultures, primary human fetal prostate fibroblasts, prostate cancer associated fibroblasts, and BPH1 epithelia. RESULTS During development, Ptn transcripts and protein were expressed in ventral mesenchymal pad (VMP) and prostatic mesenchyme. Ptn was localized to mesenchyme surrounding ductal epithelial tips undergoing branching morphogenesis, and was located on the surface of epithelia. hPTN protein stimulated branching morphogenesis and stromal and epithelial proliferation, when added to rat VP cultures, and also stimulated growth of fetal human prostate fibroblasts, prostate cancer associated fibroblasts, and BPH1 epithelia. PTN mRNA was enriched in patient-matched normal prostate fibroblasts versus prostate cancer associated fibroblasts. PTN also showed male enriched expression in fetal human male urethra versus female, and between wt male and ARKO male mice. Transcripts for PTN were upregulated by testosterone in fetal human prostate fibroblasts and organ cultures of female rat VMP. Ptn protein was increased by testosterone in organ cultures of female rat VMP and in rat male urethra compared to female. CONCLUSIONS Our data suggest that in the prostate Ptn functions as a regulator of both mesenchymal and epithelial proliferation, and that androgens regulate Ptn levels. Prostate 71:305–317, 2011. © 2010 Wiley-Liss, Inc. PMID:20812209

  9. Heterodimerization with beta2-adrenergic receptors promotes surface expression and functional activity of alpha1D-adrenergic receptors.

    PubMed

    Uberti, Michelle A; Hague, Chris; Oller, Heide; Minneman, Kenneth P; Hall, Randy A

    2005-04-01

    The alpha1D-adrenergic receptor (alpha1D-AR) is a G protein-coupled receptor (GPCR) that is poorly trafficked to the cell surface and largely nonfunctional when heterologously expressed by itself in a variety of cell types. We screened a library of approximately 30 other group I GPCRs in a quantitative luminometer assay for the ability to promote alpha1D-AR cell surface expression. Strikingly, these screens revealed only two receptors capable of inducing robust increases in the amount of alpha1D-AR at the cell surface: alpha1B-AR and beta2-AR. Confocal imaging confirmed that coexpression with beta2-AR resulted in translocation of alpha1D-AR from intracellular sites to the plasma membrane. Additionally, coimmunoprecipitation studies demonstrated that alpha1D-AR and beta2-AR specifically interact to form heterodimers when coexpressed in HEK-293 cells. Ligand binding studies revealed an increase in total alpha1D-AR binding sites upon coexpression with beta2-AR, but no apparent effect on the pharmacological properties of the receptors. In functional studies, coexpression with beta2-AR significantly enhanced the coupling of alpha1D-AR to norepinephrine-stimulated Ca2+ mobilization. Heterodimerization of beta2-AR with alpha1D-AR also conferred the ability of alpha1D-AR to cointernalize upon beta2-AR agonist stimulation, revealing a novel mechanism by which these different adrenergic receptor subtypes may regulate each other's activity. These findings demonstrate that the selective association of alpha1D-AR with other receptors is crucial for receptor surface expression and function and also shed light on a novel mechanism of cross talk between alpha1- and beta2-ARs that is mediated through heterodimerization and cross-internalization.

  10. Hydroxy decenoic acid down regulates gtfB and gtfC expression and prevents Streptococcus mutans adherence to the cell surfaces

    PubMed Central

    2012-01-01

    Background 10-Hydroxy-2-decenoic acid, an unsaturated fatty acid is the most active and unique component to the royal jelly that has antimicrobial properties. Streptococcus mutans is associated with pathogenesis of oral cavity, gingivoperiodontal diseases and bacteremia following dental manipulations. In the oral cavity, S. mutans colonize the soft tissues including tongue, palate, and buccal mucosa. When considering the role of supragingival dental plaque in caries, the proportion of acid producing bacteria (particularly S. mutans), has direct relevance to the pathogenicity of the plaque. The genes that encode glucosyltransferases (gtfs) especially gtfB and gtfC are important in S. mutans colonization and pathogenesis. This study investigated the hydroxy-decenoic acid (HDA) effects on gtfB and gtfC expression and S. mutans adherence to cells surfaces. Methods Streptococcus mutans was treated by different concentrations of HPLC purified HDA supplied by Iran Beekeeping and Veterinary Association. Real time RT-PCR and western blot assays were conducted to evaluate gtfB and gtfC genes transcription and translation before and after HDA treatment. The bacterial attachment to the cell surfaces was evaluated microscopically. Results 500 μg ml-1 of HDA inhibited gtfB and gtfC mRNA transcription and its expression. The same concentration of HDA decreased 60% the adherence of S. mutans to the surface of P19 cells. Conclusion Hydroxy-decenoic acid prevents gtfB and gtfC expression efficiently in the bactericide sub-concentrations and it could effectively reduce S. mutans adherence to the cell surfaces. In the future, therapeutic approaches to affecting S. mutans could be selective and it’s not necessary to put down the oral flora completely. PMID:22839724

  11. Hydroxy decenoic acid down regulates gtfB and gtfC expression and prevents Streptococcus mutans adherence to the cell surfaces.

    PubMed

    Yousefi, Behnam; Ghaderi, Shahrooz; Rezapoor-Lactooyi, Alireza; Amiri, Niusha; Verdi, Javad; Shoae-Hassani, Alireza

    2012-07-28

    10-Hydroxy-2-decenoic acid, an unsaturated fatty acid is the most active and unique component to the royal jelly that has antimicrobial properties. Streptococcus mutans is associated with pathogenesis of oral cavity, gingivoperiodontal diseases and bacteremia following dental manipulations. In the oral cavity, S. mutans colonize the soft tissues including tongue, palate, and buccal mucosa. When considering the role of supragingival dental plaque in caries, the proportion of acid producing bacteria (particularly S. mutans), has direct relevance to the pathogenicity of the plaque. The genes that encode glucosyltransferases (gtfs) especially gtfB and gtfC are important in S. mutans colonization and pathogenesis. This study investigated the hydroxy-decenoic acid (HDA) effects on gtfB and gtfC expression and S. mutans adherence to cells surfaces. Streptococcus mutans was treated by different concentrations of HPLC purified HDA supplied by Iran Beekeeping and Veterinary Association. Real time RT-PCR and western blot assays were conducted to evaluate gtfB and gtfC genes transcription and translation before and after HDA treatment. The bacterial attachment to the cell surfaces was evaluated microscopically. 500 μg ml-1 of HDA inhibited gtfB and gtfC mRNA transcription and its expression. The same concentration of HDA decreased 60% the adherence of S. mutans to the surface of P19 cells. Hydroxy-decenoic acid prevents gtfB and gtfC expression efficiently in the bactericide sub-concentrations and it could effectively reduce S. mutans adherence to the cell surfaces. In the future, therapeutic approaches to affecting S. mutans could be selective and it's not necessary to put down the oral flora completely.

  12. Phenotypic Heterogeneity and the Evolution of Bacterial Life Cycles

    PubMed Central

    van Gestel, Jordi; Nowak, Martin A.

    2016-01-01

    Most bacteria live in colonies, where they often express different cell types. The ecological significance of these cell types and their evolutionary origin are often unknown. Here, we study the evolution of cell differentiation in the context of surface colonization. We particularly focus on the evolution of a ‘sticky’ cell type that is required for surface attachment, but is costly to express. The sticky cells not only facilitate their own attachment, but also that of non-sticky cells. Using individual-based simulations, we show that surface colonization rapidly evolves and in most cases leads to phenotypic heterogeneity, in which sticky and non-sticky cells occur side by side on the surface. In the presence of regulation, cell differentiation leads to a remarkable set of bacterial life cycles, in which cells alternate between living in the liquid and living on the surface. The dominant life stage is formed by the surface-attached colony that shows many complex features: colonies reproduce via fission and by producing migratory propagules; cells inside the colony divide labour; and colonies can produce filaments to facilitate expansion. Overall, our model illustrates how the evolution of an adhesive cell type goes hand in hand with the evolution of complex bacterial life cycles. PMID:26894881

  13. SFTA3 - a novel surfactant protein of the ocular surface and its role in corneal wound healing and tear film surface tension.

    PubMed

    Schicht, Martin; Garreis, Fabian; Hartjen, Nadine; Beileke, Stephanie; Jacobi, Christina; Sahin, Afsun; Holland, Detlef; Schröder, Henrik; Hammer, Christian M; Paulsen, Friedrich; Bräuer, Lars

    2018-06-28

    The study aimed to characterize the expression and function of SFTA3 at the ocular surface and in tears. Ocular tissues, conjunctival (HCjE) and human corneal (HCE) epithelial cell lines as well as tearfilm of patients suffering from different forms of dry eye disease (DED) were analyzed by means of RT-PCR, western blot, immunohistochemistry, and ELISA. A possible role of recombinant SFTA3 in corneal wound healing was investigated performing in vitro scratch assays. Tear film regulatory properties were analyzed with the spinning drop method and the regulation of SFTA3 transcripts was studied in HCE and HCjE after incubation with proinflammatory cytokines as well as typical ocular pathogens by real-time RT-PCR and ELISA. The results reveal that human ocular tissue as well as tears of healthy volunteers express SFTA3 whereas tears from patients with DED showed significantly increased SFTA3 levels. In vitro wounding of HCE cell cultures that had been treated with recombinant SFTA3 demonstrated a significantly increased wound closure rate and rSFTA3 reduced the surface tension of tear fluid. The results indicate that SFTA3 at the ocular surface seemed to be involved in wound healing and the reduction of surface tension.

  14. Propofol inhibits invasion and proliferation of C6 glioma cells by regulating the Ca2+ permeable AMPA receptor-system xc- pathway.

    PubMed

    Wang, Xin-Yue; Li, Yan-Li; Wang, Hai-Yun; Zhu, Min; Guo, Di; Wang, Guo-Lin; Gao, Ying-Tang; Yang, Zhuo; Li, Tang; Yang, Chen-Yi; Chen, Yi-Meng

    2017-10-01

    Anesthetics are documented to affect tumors; therefore, we studied the antiglioma effect of propofol on proliferation and invasiveness of glioma cells and explored the underlying mechanism. C6 glioma cells were cultured and treated with propofol, and cell viability, invasiveness, and migration were measured. Glutamate release was measured using an enzyme-catalyzed kinetic reaction. xCT protein and α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor GluR2 subunit protein expression was assessed with Western blot analysis and immunofluorescent staining. We observed that propofol significantly inhibited C6 glioma cell viability, invasiveness, and migration and decreased glutamate release. An agonist of the cystine/glutamate antiporter system (system x c - ), N-acetylcysteine (NAC), reversed propofol's effects, and propofol could inhibit C6 glioma cell proliferation by adding excess exogenous glutamate (100μM). Finally, propofol increased the surface expression of GluR2, but decreased surface expression of xCT. The effects of propofol on surface expression of GluR2 and xCT could be rescued by (R, S)-AMPA, an agonist of Ca 2+ permeable AMPA receptor (CPAR). Thus, propofol can inhibit cell viability, invasiveness, and migration of C6 glioma cells, and the CPAR-system x c - pathway contributes to these events. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. IL-1β-induced matrix metalloproteinase-13 is activated by a disintegrin and metalloprotease-28-regulated proliferation of human osteoblast-like cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ozeki, Nobuaki; Kawai, Rie; Yamaguchi, Hideyuki

    2014-04-15

    We reported previously that matrix metalloproteinase (MMP)-13 accelerates bone remodeling in oral periradicular lesions, and indicated a potentially unique role for MMP-13 in wound healing and regeneration of alveolar bone. The ADAM (a disintegrin and metalloprotease) family is a set of multifunctional cell surface and secreted glycoproteins, of which ADAM-28 has been localized in bone and bone-like tissues. In this study, we show that interleukin (IL)-1β induces the expression of MMP-13 and ADAM-28 in homogeneous α7 integrin-positive human skeletal muscle stem cell (α7{sup +}hSMSC)-derived osteoblast-like (α7{sup +}hSMSC-OB) cells, and promotes proliferation while inhibiting apoptosis in these cells. At higher concentrations,more » however, IL-1β failed to induce the expression of these genes and caused an increase in apoptosis. We further employed ADAM-28 small interfering RNA (siRNA) to investigate whether IL-1β-induced MMP-13 expression is linked to this IL-1β-mediated changes in cell proliferation and apoptosis. Silencing ADAM-28 expression potently suppressed IL-1β-induced MMP-13 expression and activity, decreased cell proliferation and increased apoptosis in α7{sup +}hSMSC-OB cells. In contrast, MMP-13 siRNA had no effect on ADAM-28 expression, suggesting ADAM-28 regulates MMP-13. Exogenous MMP-13 induced α7{sup +}hSMSC-OB cell proliferation and could rescue ADAM-28 siRNA-induced apoptosis, and we found that proMMP-13 is partially cleaved into its active form by ADAM-28 in vitro. Overall, our results suggest that IL-1β-induced MMP-13 expression and changes in cell proliferation and apoptosis in α7{sup +}hSMSC-OB cells are regulated by ADAM-28. - Highlights: • IL-1β induces the MMP-13 and ADAM-28 expression in human osteoblast-like cells. • IL-1β-induced MMP-13 expression increases proliferation and decreased apoptosis. • MMP-13 expression induced by IL-1β is regulated by ADAM-28. • proMMP-13 appears to be cleaved into its active form via ADAM-28.« less

  16. The role of heparins and nano-heparins as therapeutic tool in breast cancer.

    PubMed

    Afratis, Nikos A; Karamanou, Konstantina; Piperigkou, Zoi; Vynios, Demitrios H; Theocharis, Achilleas D

    2017-06-01

    Glycosaminoglycans are integral part of the dynamic extracellular matrix (ECM) network that control crucial biochemical and biomechanical signals required for tissue morphogenesis, differentiation, homeostasis and cancer development. Breast cancer cells communicate with stromal ones to modulate ECM mainly through release of soluble effectors during cancer progression. The intracellular cross-talk between cell surface receptors and estrogen receptors is important for the regulation of breast cancer cell properties and production of ECM molecules. In turn, reorganized ECM-cell surface interface modulates signaling cascades, which regulate almost all aspects of breast cell behavior. Heparan sulfate chains present on cell surface and matrix proteoglycans are involved in regulation of breast cancer functions since they are capable of binding numerous matrix molecules, growth factors and inflammatory mediators thus modulating their signaling. In addition to its anticoagulant activity, there is accumulating evidence highlighting various anticancer activities of heparin and nano-heparin derivatives in numerous types of cancer. Importantly, heparin derivatives significantly reduce breast cancer cell proliferation and metastasis in vitro and in vivo models as well as regulates the expression profile of major ECM macromolecules, providing strong evidence for therapeutic targeting. Nano-formulations of the glycosaminoglycan heparin are possibly novel tools for targeting tumor microenvironment. In this review, the role of heparan sulfate/heparin and its nano-formulations in breast cancer biology are presented and discussed in terms of future pharmacological targeting.

  17. Identification of Human P2X1 Receptor-interacting Proteins Reveals a Role of the Cytoskeleton in Receptor Regulation*

    PubMed Central

    Lalo, Ulyana; Roberts, Jonathan A.; Evans, Richard J.

    2011-01-01

    P2X1 receptors are ATP-gated ion channels expressed by smooth muscle and blood cells. Carboxyl-terminally His-FLAG-tagged human P2X1 receptors were stably expressed in HEK293 cells and co-purified with cytoskeletal proteins including actin. Disruption of the actin cytoskeleton with cytochalasin D inhibited P2X1 receptor currents with no effect on the time course of the response or surface expression of the receptor. Stabilization of the cytoskeleton with jasplakinolide had no effect on P2X1 receptor currents but decreased receptor mobility. P2X2 receptor currents were unaffected by cytochalasin, and P2X1/2 receptor chimeras were used to identify the molecular basis of actin sensitivity. These studies showed that the intracellular amino terminus accounts for the inhibitory effects of cytoskeletal disruption similar to that shown for lipid raft/cholesterol sensitivity. Stabilization of the cytoskeleton with jasplakinolide abolished the inhibitory effects of cholesterol depletion on P2X1 receptor currents, suggesting that lipid rafts may regulate the receptor through stabilization of the cytoskeleton. These studies show that the cytoskeleton plays an important role in P2X1 receptor regulation. PMID:21757694

  18. Regulated proteolysis of Trop2 drives epithelial hyperplasia and stem cell self-renewal via β-catenin signaling.

    PubMed

    Stoyanova, Tanya; Goldstein, Andrew S; Cai, Houjian; Drake, Justin M; Huang, Jiaoti; Witte, Owen N

    2012-10-15

    The cell surface protein Trop2 is expressed on immature stem/progenitor-like cells and is overexpressed in many epithelial cancers. However the biological function of Trop2 in tissue maintenance and tumorigenesis remains unclear. In this study, we demonstrate that Trop2 is a regulator of self-renewal, proliferation, and transformation. Trop2 controls these processes through a mechanism of regulated intramembrane proteolysis that leads to cleavage of Trop2, creating two products: the extracellular domain and the intracellular domain. The intracellular domain of Trop2 is released from the membrane and accumulates in the nucleus. Heightened expression of the Trop2 intracellular domain promotes stem/progenitor self-renewal through signaling via β-catenin and is sufficient to initiate precursor lesions to prostate cancer in vivo. Importantly, we demonstrate that loss of β-catenin or Trop2 loss-of-function cleavage mutants abrogates Trop2-driven self-renewal and hyperplasia in the prostate. These findings suggest that heightened expression of Trop2 is selected for in epithelial cancers to enhance the stem-like properties of self-renewal and proliferation. Defining the mechanism of Trop2 function in self-renewal and transformation is essential to identify new therapeutic strategies to block Trop2 activation in cancer.

  19. Regulated proteolysis of Trop2 drives epithelial hyperplasia and stem cell self-renewal via β-catenin signaling

    PubMed Central

    Stoyanova, Tanya; Goldstein, Andrew S.; Cai, Houjian; Drake, Justin M.; Huang, Jiaoti; Witte, Owen N.

    2012-01-01

    The cell surface protein Trop2 is expressed on immature stem/progenitor-like cells and is overexpressed in many epithelial cancers. However the biological function of Trop2 in tissue maintenance and tumorigenesis remains unclear. In this study, we demonstrate that Trop2 is a regulator of self-renewal, proliferation, and transformation. Trop2 controls these processes through a mechanism of regulated intramembrane proteolysis that leads to cleavage of Trop2, creating two products: the extracellular domain and the intracellular domain. The intracellular domain of Trop2 is released from the membrane and accumulates in the nucleus. Heightened expression of the Trop2 intracellular domain promotes stem/progenitor self-renewal through signaling via β-catenin and is sufficient to initiate precursor lesions to prostate cancer in vivo. Importantly, we demonstrate that loss of β-catenin or Trop2 loss-of-function cleavage mutants abrogates Trop2-driven self-renewal and hyperplasia in the prostate. These findings suggest that heightened expression of Trop2 is selected for in epithelial cancers to enhance the stem-like properties of self-renewal and proliferation. Defining the mechanism of Trop2 function in self-renewal and transformation is essential to identify new therapeutic strategies to block Trop2 activation in cancer. PMID:23070813

  20. The histone methyltransferase Smyd2 is a negative regulator of macrophage activation by suppressing interleukin 6 (IL-6) and tumor necrosis factor α (TNF-α) production.

    PubMed

    Xu, Guiliang; Liu, Guilin; Xiong, Sidong; Liu, Haiyan; Chen, Xi; Zheng, Biao

    2015-02-27

    SET and MYND domain-containing 2 (Smyd2), a histone 3 lysine 4- and histone 3 lysine 36 (H3K36)-specific methyltransferase, plays critical roles in cardiac development and tumorigenesis. However, the role of Smyd2 in immunity and inflammation remains poorly understood. In this study, we report that Smyd2 is a novel negative regulator for macrophage activation and M1 polarization. Elevated Smyd2 expression suppresses the production of proinflammatory cytokines, including IL-6 and TNF, and inhibits the expression of important cell surface molecules, including major MHC-II and costimulatory molecules. Furthermore, macrophages with high Smyd2 expression inhibit Th-17 cell differentiation but promote regulatory T cell differentiation as a result of increased TGF-β production and decreased IL-6 secretion. In macrophages, Smyd2 specifically facilitates H3K36 dimethylation at Tnf and Il6 promoters to suppress their transcription and inhibits NF-κB and ERK signaling. Therefore, our data demonstrate that epigenetic modification by Smyd2-mediated H3K36 dimethylation at Tnf and Il6 promoters plays an important role in the regulation of macrophage activation during inflammation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Top